Parametric amplifications in the nonlinear transmission line
Energy Technology Data Exchange (ETDEWEB)
Kawata, T; Sakai, J; Inoue, H [Toyama Univ., Takaoka (Japan). Faculty of Engineering
1980-03-01
The parametric amplification in a transmission line with nonlinear capacitors is analysed theoretically using the equations of three wave interactions. Since this line has two modes, high frequency and low frequency modes, there may occur some mode coupling phenomena through the resonant interactions. We consider three waves with wave number k sub(j) and frequency ..omega..sub(j) in resonance with each other, that is, ..omega../sub 1/ + ..omega../sub 2/ = ..omega../sub 3/ and k/sub 1/ + k/sub 2/ = k/sub 3/, where 0 <= ..omega../sub 1/ <= ..omega../sub 2/ <= ..omega../sub 3/ and k/sub 3/ >= 0. Such conditions are realized in our network and there exist two states: ''forward state'' (each group velocity is positive) and ''backward state'' (one of the group velocities is negative). The coupled equations of three waves has two constant pumps: high frequency (HF) pump and low frequency (LF) pump. Using linear approximations, we examine the possible types of parametric amplification and obtain the power gains depending on the frequency deviation. For only the case of HF pump we get the gain between signals with seme frequency and also get the gain from the low frequency signal to the high frequency signal (''up-conversion'') for the LF pump. The nonlinear analysis gives the exact relation between input and output signals. For the forward state the gain is absolutely suppressed by the ratio of pumping power to input power, while the gain of backward state has no finite maximum and there may appear an ''oscillating state'' if the pumping power is comparatively small.
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
van Roy, N.; Forus, A.; Myklebost, O.; Cheng, N. C.; Versteeg, R.; Speleman, F.
1995-01-01
The neuroblastoma cell line NGP contains two homogeneously staining regions (hsr). One of these hsrs contains MYCN sequences. Reverse painting experiments demonstrated that the second HSR consisted of two chromosome 12-derived amplification units, located at 12q14-15 and 12q24. Southern blot and
Mode group specific amplification length in an asymmetric LPG assisted few-mode EDFA
Rastogi, Vipul; Gaur, Ankita; Aschieri, Pierre; Dussardier, Bernard
2017-01-01
This article presents a scheme for few-mode EDFA, which allows to choose independent amplification lengths for different mode groups. The EDF is a dual concentric core fiber, where the central core is connected to the line FMF and the ring core is doped with erbium to provide amplification. The modes of FMF are launched into the central core of the EDF, are converted into ring modes using LPG for amplification and then converted back into central core modes using another LPG. The distance between the LPGs determines the amplification length. The amplification length, can thus, be chosen for a given mode group. We demonstrate the working of this concept by choosing LP11 and LP21 mode groups of the FMF and show that a suitable choice of amplification lengths for the two mode groups can tailor the differential modal gain (DMG) to any desired value. We demonstrate achieving zero DMG among all the mode of LP11 and LP21 mode groups using this concept while having gain in excess of 20 dB. The study should be useful for optical fiber communication system employing space-division multiplexing (SDM).
Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E
2014-01-01
Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.
Directory of Open Access Journals (Sweden)
Mark J Hoser
Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
International Nuclear Information System (INIS)
Schlehofer, J.R.; Ehrbar, M.; zur Hausen, H.
1986-01-01
The SV40-transformed human kidney cell line, NB-E, amplifies integrated as well as episomal SV40 DNA upon treatment with chemical (DMBA) or physical (uv irradiation) carcinogens (initiators) as well as after infection with herpes simplex virus (HSV) type 1 or with vaccinia virus. In addition it is shown that vaccinia virus induces SV40 DNA amplification also in the SV40-transformed Chinese hamster embryo cell line, CO631. These findings demonstrate that human cells similar to Chinese hamster cells amplify integrated DNA sequences after treatment with carcinogens or infection with specific viruses. Furthermore, a poxvirus--vaccinia virus--similar to herpes group viruses induces DNA amplification. As reported for other systems, the vaccinia virus-induced DNA amplification in NB-E cells is inhibited by coinfection with adeno-associated virus (AAV) type 5. This is in line with previous studies on inhibition of carcinogen- or HSV-induced DNA amplification in CO631 cells. The experiments also demonstrate that vaccinia virus, in addition to herpes and adenoviruses acts as a helper virus for replication and structural antigen synthesis of AAV-5 in NB-E cells
Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD
Directory of Open Access Journals (Sweden)
Silva L.M.
2001-01-01
Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Anthony W.l. Lo
2002-01-01
Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.
Huang, Mengqi; Zhou, Xiaoming; Wang, Huiying; Xing, Da
2018-02-06
A novel CRISPR/Cas9 triggered isothermal exponential amplification reaction (CAS-EXPAR) strategy based on CRISPR/Cas9 cleavage and nicking endonuclease (NEase) mediated nucleic acids amplification was developed for rapid and site-specific nucleic acid detection. CAS-EXPAR was primed by the target DNA fragment produced by cleavage of CRISPR/Cas9, and the amplification reaction performed cyclically to generate a large number of DNA replicates which were detected using a real-time fluorescence monitoring method. This strategy that combines the advantages of CRISPR/Cas9 and exponential amplification showed high specificity as well as rapid amplification kinetics. Unlike conventional nucleic acids amplification reactions, CAS-EXPAR does not require exogenous primers, which often cause target-independent amplification. Instead, primers are first generated by Cas9/sgRNA directed site-specific cleavage of target and accumulated during the reaction. It was demonstrated this strategy gave a detection limit of 0.82 amol and showed excellent specificity in discriminating single-base mismatch. Moreover, the applicability of this method to detect DNA methylation and L. monocytogenes total RNA was also verified. Therefore, CAS-EXPAR may provide a new paradigm for efficient nucleic acid amplification and hold the potential for molecular diagnostic applications.
Energy Technology Data Exchange (ETDEWEB)
Sun, S
1992-07-01
The work of this thesis must be associated with the realization of EUROGAM detector. This device will be composed in a first time of 45 Germanium gamma radiation detectors (each being surrounded with 10 BGO detectors). The purpose of this thesis was the design and the miniaturization of the amplification line which must be associated with each Germanium detector (are also included the circuit of ballistic shortage correction). The design and study of amplifier has been effected with the help of computer-aided design in using SPICE software. The details are explained widely but in another part, the author studies the theoretical interpretation of disturbing phenomena.
International Nuclear Information System (INIS)
Wang Shunbao; Guo Lei; Niu Wenzhe
1997-01-01
Ten clones were picked from cultured colonies of CaEs-17 cell line and developed to a subcell line. The values of SF 2 were measured for each subcell line. Two radioresistant subcell lines, clone 7 and clone 10 were established. According to survival curve assay, for wild type, the value of D 0 was 1.57 Gy, D Q was 1.07 Gy, N was 1.96, SF 2 was 0.41. For clone 7, the value of D 0 was 1.64 Gy, D Q was 1.85 Gy, N was 3.07, SF 2 was 0.53. For clone 10, the value of D 0 was 1.58 Gy, D Q was 2.04 Gy, N was 3.63, SF 2 was 0.61. Clone 7 and clone 10 have much higher values of D Q and N than those of wild type. There was amplification of H-ras gene in clone 10 after 2 Gy irradiation. The amplification of H-ras gene in clone 10 after 2 Gy irradiation might be involved in hetero geneity of CaEs-17 cell line
Region-specific protein misfolding cyclic amplification reproduces brain tropism of prion strains.
Privat, Nicolas; Levavasseur, Etienne; Yildirim, Serfildan; Hannaoui, Samia; Brandel, Jean-Philippe; Laplanche, Jean-Louis; Béringue, Vincent; Seilhean, Danielle; Haïk, Stéphane
2017-10-06
Human prion diseases such as Creutzfeldt-Jakob disease are transmissible brain proteinopathies, characterized by the accumulation of a misfolded isoform of the host cellular prion protein (PrP) in the brain. According to the prion model, prions are defined as proteinaceous infectious particles composed solely of this abnormal isoform of PrP (PrP Sc ). Even in the absence of genetic material, various prion strains can be propagated in experimental models. They can be distinguished by the pattern of disease they produce and especially by the localization of PrP Sc deposits within the brain and the spongiform lesions they induce. The mechanisms involved in this strain-specific targeting of distinct brain regions still are a fundamental, unresolved question in prion research. To address this question, we exploited a prion conversion in vitro assay, protein misfolding cyclic amplification (PMCA), by using experimental scrapie and human prion strains as seeds and specific brain regions from mice and humans as substrates. We show here that region-specific PMCA in part reproduces the specific brain targeting observed in experimental, acquired, and sporadic Creutzfeldt-Jakob diseases. Furthermore, we provide evidence that, in addition to cellular prion protein, other region- and species-specific molecular factors influence the strain-dependent prion conversion process. This important step toward understanding prion strain propagation in the human brain may impact research on the molecular factors involved in protein misfolding and the development of ultrasensitive methods for diagnosing prion disease. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification
Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.
2016-01-01
The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544
Specific single-cell isolation and genomic amplification of uncultured microorganisms
DEFF Research Database (Denmark)
Kvist, Thomas; Ahring, Birgitte Kiær; Lasken, R.S.
2007-01-01
We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group-specific pri......We in this study describe a new method for genomic studies of individual uncultured prokaryotic organisms, which was used for the isolation and partial genome sequencing of a soil archaeon. The diversity of Archaea in a soil sample was mapped by generating a clone library using group......-specific primers in combination with a terminal restriction fragment length polymorphism profile. Intact cells were extracted from the environmental sample, and fluorescent in situ hybridization probing with Cy3-labeled probes designed from the clone library was subsequently used to detect the organisms...... of interest. Single cells with a bright fluorescent signal were isolated using a micromanipulator and the genome of the single isolated cells served as a template for multiple displacement amplification (MDA) using the Phi29 DNA polymerase. The generated MDA product was afterwards used for 16S rRNA gene...
Specific detection of Pectobacterium carotovorum by loop-mediated isothermal amplification.
Yasuhara-Bell, Jarred; Marrero, Glorimar; De Silva, Asoka; Alvarez, Anne M
2016-12-01
Potatoes are an important agroeconomic crop worldwide and maceration diseases caused by pectolytic bacterial pathogens result in significant pre- and post-harvest losses. Pectobacterium carotovorum shares a common host range with other Pectobacterium spp. and other members of the Enterobacteriaceae, such as Dickeya spp. As these pathogens cannot be clearly differentiated on the basis of the symptoms they cause, improved methods of identification are critical for the determination of sources of contamination. Current standardized methods for the differentiation of pectolytic species are time consuming and require trained personnel, as they rely on traditional bacteriological practices that do not always produce conclusive results. In this growing world market, there is a need for rapid diagnostic tests that can differentiate between pectolytic pathogens, as well as separate them from non-pectolytic enteric bacteria associated with soft rots of potato. An assay has been designed previously to detect the temperate pathogen Pectobacterium atrosepticum, but there is currently no recognized rapid assay for the detection of the tropical/subtropical counterpart, Pectobacterium carotovorum. This report describes the development of a loop-mediated isothermal amplification (LAMP) assay that detects P. carotovorum with high specificity. The assay was evaluated using all known species of Pectobacterium and only showed positive reactions for P. carotovorum. This assay was also tested against 15 non-target genera of plant-associated bacteria and did not produce any false positives. The LAMP assay described here can be used as a rapid test for the differentiation of P. carotovorum from other pectolytic pathogens, and its gene target can be the basis for the development of other molecular-based detection assays. © 2016 BSPP and John Wiley & Sons Ltd.
Evaluation of bias associated with high-multiplex, target-specific pre-amplification
Directory of Open Access Journals (Sweden)
Steven T. Okino
2016-01-01
Full Text Available We developed a novel PCR-based pre-amplification (PreAmp technology that can increase the abundance of over 350 target genes one million-fold. To assess potential bias introduced by PreAmp we utilized ERCC RNA reference standards, a model system that quantifies measurement error in RNA analysis. We assessed three types of bias: amplification bias, dynamic range bias and fold-change bias. We show that our PreAmp workflow introduces only minimal amplification and fold-change bias under stringent conditions. We do detect dynamic range bias if a target gene is highly abundant and PreAmp occurred for 16 or more PCR cycles; however, this type of bias is easily correctable. To assess PreAmp bias in a gene expression profiling experiment, we analyzed a panel of genes that are regulated during differentiation using the NTera2 stem cell model system. We find that results generated using PreAmp are similar to results obtained using standard qPCR (without the pre-amplification step. Importantly, PreAmp maintains patterns of gene expression changes across samples; the same biological insights would be derived from a PreAmp experiment as with a standard gene expression profiling experiment. We conclude that our PreAmp technology can facilitate analysis of extremely limited samples in gene expression quantification experiments.
Egfr Amplification Specific Gene Expression in Phyllodes Tumours of the Breast
Directory of Open Access Journals (Sweden)
Konstantin Agelopoulos
2007-01-01
Full Text Available Background: Recently, we were able to show that amplifications of the epidermal growth factor receptor (egfr gene and the overexpression of EGFR were associated with the initiation and progression of phyllodes tumours. Methods: In order to gain further insights into regulation mechanisms associated with egfr amplifications and EGFR expression in phyllodes tumours, we performed global gene expression analysis (Affymetrix A133.2 on a series of 10 phyllodes tumours, of these three with and seven without amplifications of an important regulatory repeat in intron 1 of egfr (CA-SSR I. The results were verified and extended by means of immunohistochemistry using the tissue microarray method on an extensively characterized series of 58 phyllodes tumours with antibodies against caveolin-1, eps15, EGF, TGF-α, pErk, pAkt and mdm2. Results: We were able to show that the presence of egfr CA-SSR I amplifications in phyllodes tumours was associated with 230 differentially expressed genes. Caveolin-1 and eps15, involved in EGFR turnover and signalling, were regulated differentially on the RNA and protein level proportionally to egfr gene dosage. Further immunohistochemical analysis revealed that the expression of caveolin-1 and eps15 were also significantly correlated with the expression of pAkt (p < 0.05, pERK (p < 0.05, mdm2 (p < 0.01 and EGF (p < 0.001 for caveolin-1. Eps15 and pERK were further associated with tumour grade (p < 0.01 and p < 0.001, respectively. Conclusion: Our results show that amplifications within regulatory sequences of egfr are associated with the expression of eps15 and caveolin-1, indicating an increased turnover of EGFR. The interplay between EGFR and caveolin-1, eps15, pAkt, mdm2 and pERK therefore seems to present a major molecular pathway in carcinogenesis and progression of breast phyllodes tumours.
Site Specific Ground Response Analysis for Quantifying Site Amplification at A Regolith Site
Directory of Open Access Journals (Sweden)
Bambang Setiawan
2017-08-01
Full Text Available DOI: 10.17014/ijog.4.3.159-167A numerical model has demonstrated that it can simulate reasonably well earthquake motions at the ground level during a seismic event. The most widely used model is an equivalent linear approach. The equivalent linear model was used to compute the free-field response of Adelaide regolith during the 1997 Burra earthquake. The aim of this study is to quantify the amplification at the investigated site. The model computed the ground response of horizontally layered soil deposits subjected to transient and vertically propagating shear waves through a one-dimensional-soil column. Each soil layer was assumed to be homogeneous, visco-elastic, and infinite in the horizontal extent. The results of this study were compared to other studies and forward computation of the geotechnical dynamic parameters of the investigated site. The amplification triggered by the 1997 Burra seismic event was deduced. This study reveals the amplification factor up to 3.6 at the studied site.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1989-01-01
DP gene typing using in vitro DNA amplification combined with sequence-specific oligonucleotide probes has recently been reported. The resulting DNA amplification was specific for the HLA-DPB locus. Typing for the individual DPB alleles was exclusively dependent on the hybridizations of the probe...
Directory of Open Access Journals (Sweden)
Shota Teramoto
2014-06-01
Full Text Available Miniature inverted-repeat transposable elements (MITEs are numerically predominant transposable elements in the rice genome, and their activities have influenced the evolution of genes. Very little is known about how MITEs can rapidly amplify to thousands in the genome. The rice MITE mPing is quiescent in most cultivars under natural growth conditions, although it is activated by various stresses, such as tissue culture, gamma-ray irradiation, and high hydrostatic pressure. Exceptionally in the temperate japonica rice strain EG4 (cultivar Gimbozu, mPing has reached over 1000 copies in the genome, and is amplifying owing to its active transposition even under natural growth conditions. Being the only active MITE, mPing in EG4 is an appropriate material to study how MITEs amplify in the genome. Here, we provide important findings regarding the transposition and amplification of mPing in EG4. Transposon display of mPing using various tissues of a single EG4 plant revealed that most de novo mPing insertions arise in embryogenesis during the period from 3 to 5 days after pollination (DAP, and a large majority of these insertions are transmissible to the next generation. Locus-specific PCR showed that mPing excisions and insertions arose at the same time (3 to 5 DAP. Moreover, expression analysis and in situ hybridization analysis revealed that Ping, an autonomous partner for mPing, was markedly up-regulated in the 3 DAP embryo of EG4, whereas such up-regulation of Ping was not observed in the mPing-inactive cultivar Nipponbare. These results demonstrate that the early embryogenesis-specific expression of Ping is responsible for the successful amplification of mPing in EG4. This study helps not only to elucidate the whole mechanism of mPing amplification but also to further understand the contribution of MITEs to genome evolution.
Ghindilis, Andrey L; Smith, Maria W; Simon, Holly M; Seoudi, Ihab A; Yazvenko, Nina S; Murray, Iain A; Fu, Xiaoqing; Smith, Kenneth; Jen-Jacobson, Linda; Xu, Shuang-Yong
2015-01-13
An alternative to qPCR was developed for nucleic acid assays, involving signal rather than target amplification. The new technology, Restriction Cascade Exponential Amplification (RCEA), relies on specific cleavage of probe-target hybrids by restriction endonucleases (REase). Two mutant REases for amplification (Ramp), S17C BamHI and K249C EcoRI, were conjugated to oligonucleotides, and immobilized on a solid surface. The signal generation was based on: (i) hybridization of a target DNA to a Ramp-oligonucleotide probe conjugate, followed by (ii) specific cleavage of the probe-target hybrid using a non-immobilized recognition REase. The amount of Ramp released into solution upon cleavage was proportionate to the DNA target amount. Signal amplification was achieved through catalysis, by the free Ramp, of a restriction cascade containing additional oligonucleotide-conjugated Ramp and horseradish peroxidase (HRP). Colorimetric quantification of free HRP indicated that the RCEA achieved a detection limit of 10 aM (10(-17) M) target concentration, or approximately 200 molecules, comparable to the sensitivity of qPCR-based assays. The RCEA assay had high specificity, it was insensitive to non-specific binding, and detected target sequences in the presence of foreign DNA. RCEA is an inexpensive isothermal assay that allows coupling of the restriction cascade signal amplification with any DNA target of interest.
Kang, Sung-Il; Her, Moon; Kim, Ji-Yeon; Lee, Jin Ju; Lee, Kichan; Sung, So-Ra; Jung, Suk Chan
2015-06-01
A rapid and accurate diagnosis of brucellosis is required to reduce and prevent the spread of disease among animals and the risk of transfer to humans. In this study, a Brucella abortus-specific (Ba) LAMP assay was developed, that had six primers designed from the BruAb2_0168 region of chromosome I. The specificity of this LAMP assay was confirmed with Brucella reference strains, B. abortus vaccine strains, B. abortus isolates and phylogenetically or serologically related strains. The detection limit of target DNA was up to 20 fg/μl within 60 min. The sensitivity of the new LAMP assay was equal to or slightly higher than other PCR based assays. Moreover, this Ba-LAMP assay could specifically amplify all B. abortus biovars compared to previous PCR assays. To our knowledge, this is the first report of specific detection of B. abortus using a LAMP assay. The Ba-LAMP assay can offer a rapid, sensitive and accurate diagnosis of bovine brucellosis in the field. Copyright © 2015 Elsevier Ltd. All rights reserved.
Karthik, K; Rathore, Rajesh; Thomas, Prasad; Arun, T R; Viswas, K N; Agarwal, R K; Manjunathachar, H V; Dhama, Kuldeep
2014-01-01
Brucella abortus, the major causative agent of abortion in cattle and a zoonotic pathogen, needs to be diagnosed at an early stage. Loop-mediated isothermal amplification (LAMP) test is easy to perform and also promising to be adapted at field level. To develop a LAMP assay for specific and rapid detection of B. abortus from clinical samples of cattle. LAMP primers were designed targeting BruAb2_0168 region using specific software tool and LAMP was optimized. The developed LAMP was tested for its specificity with 3 Brucella spp. and 11 other non-Brucella spp. Sensitivity of the developed LAMP was also carried out with known quantity of DNA. Cattle whole blood samples and aborted fetal stomach contents were collected and used for testing with developed LAMP assay and results were compared with polymerase chain reaction (PCR). The developed LAMP assay works at 61 °C for 60 min and the detection limit was observed to be 100-fold more than the conventional PCR that is commonly used for diagnosis of B. abortus. Clinical sensitivity and specificity of the developed LAMP assay was 100% when compared with Rose Bengal plate test and standard tube agglutination test. SYB® green dye I was used to visualize the result with naked eye. The novelty of the developed LAMP assay for specifically detecting B. abortus infection in cattle along with its inherent rapidness and high sensitivity can be employed for detecting this economically important pathogen of cattle at field level as well be exploited for screening of human infections.
Barkway, Christopher P; Pocock, Rebecca L; Vrba, Vladimir; Blake, Damer P
2015-02-20
Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm's anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.
Hume, Benjamin C.C.; Ziegler, Maren; Poulain, Julie; Pochon, Xavier; Romac, Sarah; Boissin, Emilie; de Vargas, Colomban; Planes, Serge; Wincker, Patrick; Voolstra, Christian R.
2018-01-01
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Liu, Chun-Yan; Song, Hui-Qun; Zhang, Ren-Li; Chen, Mu-Xin; Xu, Min-Jun; Ai, Lin; Chen, Xiao-Guang; Zhan, Xi-Mei; Liang, Shao-Hui; Yuan, Zi-Guo; Lin, Rui-Qing; Zhu, Xing-Quan
2011-08-01
Angiostrongylus cantonensis, a rat lungworm, can cause eosinophilic meningitis and angiostrongyliasis in humans following ingestion of contaminated foods or intermediate/paratenic hosts with infective larvae. The snail Achatina fulica is one of the important intermediate hosts of A. cantonensis and is commonly eaten by humans in some countries. In the present study, we developed a loop-mediated isothermal amplification (LAMP) method for the specific detection of A. cantonensis in Ac. fulica. Primers for LAMP were designed based on the first internal transcribed spacer (ITS-1) of nuclear ribosomal DNA (rDNA) of A. cantonensis. Specificity tests showed that only the products of A. cantonensis were detected when DNA samples of A. cantonensis and the heterologous control samples Anisakis simplex s.s, Trichuris trichiura, Toxocara canis, Trichinella spiralis and Ascaris lumbricoides were amplified by LAMP. Sensitivity evaluation indicated that the LAMP assay is 10 times more sensitive than the conventional polymerase chain reaction (PCR) assay. The established LAMP assay is rapid, inexpensive and easy to be performed. It can be used in clinical applications for rapid and sensitive detection of A. cantonensis in snails, which has implications for the effective control of angiostrongyliasis. Copyright © 2011 Elsevier Ltd. All rights reserved.
Hume, Benjamin C.C.
2018-05-23
The Internal Transcribed Spacer 2 (ITS2) rRNA gene is a commonly targeted genetic marker to assess diversity of Symbiodinium, a dinoflagellate genus of algal endosymbionts that is pervasively associated with marine invertebrates, and notably reef-building corals. Here we tested three commonly used ITS2 primer pairs (SYM_VAR_5.8S2/SYM_VAR_REV, ITSintfor2/ITSReverse, and ITS-DINO/ITS2Rev2) with regard to amplification specificity and sensitivity towards Symbiodinium, as well as sub-genera taxonomic bias. We tested these primers over a range of sample types including three coral species, coral surrounding water, reef surface water, and open ocean water to assess their suitability for use in large-scale next generation sequencing projects and to develop a standardised PCR protocol. We found the SYM_VAR_5.8S2/SYM_VAR_REV primers to perform superior to the other tested ITS2 primers. We therefore used this primer pair to develop a standardised PCR protocol. To do this, we tested the effect of PCR-to-PCR variation, annealing temperature, cycle number, and different polymerase systems on the PCR efficacy. The Symbiodinium ITS2 PCR protocol developed here delivers improved specificity and sensitivity towards Symbiodinium with apparent minimal sub-genera taxonomic bias across all sample types. In particular, the protocol’s ability to amplify Symbiodinium from a range of environmental sources will facilitate the study of Symbiodinium populations across biomes.
Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy
Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying
2013-01-01
We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578
Kim, Kyung Seok; Szendrei, Zsofia; Rodriguez-Saona, Cesar; Mulder, Phillip G; Sappington, Thomas W
2009-04-01
The boll weevil, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), is a serious pest of cultivated cotton, Gossypium hirsutum L., in the Americas, and reinfestation of zones from which they have been eradicated is of perpetual concern. Extensive arrays of pheromone traps monitor for reintroductions, but occasionally the traps collect nontarget weevils that can be misidentified by scouts. For example, the congeneric pepper weevil, Anthonomus eugenii Cano, and other superficially similar weevils are attracted to components of the boll weevil lure or trap color. Although morphologically distinguishable by trained personnel, the potential for misidentification is compounded when captured weevils are dismembered or partially consumed by ants or ground beetles that sometimes feed on them in the traps. Because misidentification can have expensive consequences, a molecular diagnostic tool would be of great value to eradication managers. We demonstrate that a cocktail of three primer pairs in a single polymerase chain reaction (PCR) amplify species-specific microsatellites that unambiguously distinguish the boll weevil from three other weevil species tested, including pepper weevil; cranberry weevil, Anthonomus eugenii musculus Say; and pecan weevil, Curculio caryae Horn. However, it does not distinguish the boll weevil from the subspecific "thurberia" weevil. A universal internal transcribed spacer primer pair included in the cocktail cross-amplifies DNA from all species, serving as a positive control. Furthermore, the diagnostic primers amplified the target microsatellites from various boll weevil adult body parts, indicating that the PCR technology using the primer cocktail is sensitive enough to positively identify a boll weevil even when the body is partly degraded.
DEFF Research Database (Denmark)
Chen, I Y; Gheysens, O; Ray, S
2010-01-01
in a cardiac cell line and the myocardium, while minimizing expression in non-cardiac cell lines and the liver. In vitro, the TSTA system significantly enhanced cTnT-mediated reporter gene expression with moderate preservation of cardiac specificity. After intramyocardial and hydrodynamic tail vein delivery...... genes, firefly luciferase (fluc) and Renilla luciferase (hrluc), driven by the cardiac troponin T (cTnT) promoter. The vector was characterized in vitro and in living mice using luminometry and bioluminescence imaging to assess its ability to mediate strong, correlated reporter gene expression...
Concept for Specific Lines of Business, Energy Saving Tourism
International Nuclear Information System (INIS)
Jilek, W.
1998-01-01
In the spirit of the objectives of the Energy Plan 1995 in order to make more efficient use of energy and thus to reduce energy requirements, to promote the use of renewable energies, and to attach maximum importance to the ecological compatibility of the energy systems, among other project the provincial government of Styria is pursuing the option of consulting small and medium-sized enterprises in a target manner. Three years after being launched, this Ecological Company Consulting scheme for various lines of business is now producing successful results, demonstrating that energy saving, business profit and ecology can go hand in hand by example of numerous pilot projects. Trade-specific concepts have been elaborated for foodstuffs, carpenters and car repair and sales firms, bakeries and hairdressers and, most recently, for tourist industry business /hotels, bars, restaurants, etc.). The province of Styria, represented by the Energy Commissioner and the department of waste management, is co-operating closely in the Ecological Company Consulting scheme with the Styrian Chamber of Commerce and the Economy Promotion Institute (Wirtschaftsfoerderungsinstitut). In several cases, other provinces, the Federal Ministry of Environmental, Youth and Family Affairs, and the Federal Chamber of Commerce have adopted the results of this co-operation, while in some cases subsidy schemes are linked to these trade-specific concepts. In the course of the scheme, the aim is to investigate energy requirements, saving potentials and questions of waste management. (author)
Balbekin, Nikolay; Petrov, Nikolay; Pul'kin, Sergey; Shoev, Vladislav; Sevryugin, Alexander; Tursunov, Ibrohim; Venediktov, Dmitrii; Venediktov, Vladimir
2017-10-01
The method of amplification of hologram was applied to the so-called Rozhdestvenskiy hooks, that were obtained in the Rozhdestvenskiy interferometer (Michelson interferometer, combined with a grating spectrograph). In such a device the absorption lines reveal themselves as specific "hooks", whose curvature provides the information about the atomic oscillator force. The holographic amplification "smoothes" the hooks and thus makes their analysis much simpler.
International Nuclear Information System (INIS)
Clemens, Farrah; Verma, Rini; Ramnath, Jamuna; Landolph, Joseph R.
2005-01-01
Occupational exposure of humans to mixtures of insoluble and soluble nickel (Ni) compounds correlates with increased incidences of lung, sinus, and pharyngeal tumors. Specific insoluble Ni compounds are carcinogenic to animals by inhalation and induce morphological and neoplastic transformation of cultured rodent cells. Our objectives were to (1) understand mechanisms of nickel ion-induced cell transformation, hence carcinogenesis and (2) develop biomarkers of nickel ion exposure and nickel ion-induced cell transformation. We isolated mRNAs from green nickel oxide (NiO), crystalline nickel monosulfide (NiS), and 3-methylcholanthrene (MCA) transformed C3H/10T1/2 Cl 8 cell lines, and determined by mRNA differential display that nine mRNA fragments were differentially expressed between Ni transformed and non-transformed 10T1/2 cell lines. Fragment R2-5 was expressed at higher steady-state levels in the transformed cell lines. R2-5 had 100% sequence identity to part of the coding region of Ect2, a mouse proto-oncogene encoding a GDP-GTP exchange factor. The 3.9-kb Ect2 transcript was expressed at 1.6- to 3.6-fold higher steady-state levels in four Ni transformed, and in two MCA-transformed, cell lines. Ect2 protein was expressed at 3.0- to 4.5-fold higher steady-state levels in Ni-transformed and in MCA-transformed cell lines. The Ect2 gene was amplified by 3.5- to 10-fold in Ni transformed, and by 2.5- to 3-fold in MCA transformed cell lines. Binding of nickel ions to enzymes of DNA synthesis likely caused amplification of the Ect2 gene. Ect2 gene amplification and over-expression of Ect2 mRNA and protein can cause microtubule disassembly and cytokinesis, contributing to induction and maintenance of morphological, anchorage-independent, and neoplastic transformation of these cell lines. Over-expression of Ect2 protein is a useful biomarker to detect exposure to nickel compounds and nickel ion-induced morphological and neoplastic cell transformation
Directory of Open Access Journals (Sweden)
Nao Nishida
Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.
Directory of Open Access Journals (Sweden)
Figueiredo B.C.
2000-01-01
Full Text Available Adrenocortical tumors (ACT in children under 15 years of age exhibit some clinical and biological features distinct from ACT in adults. Cell proliferation, hypertrophy and cell death in adrenal cortex during the last months of gestation and the immediate postnatal period seem to be critical for the origin of ACT in children. Studies with large numbers of patients with childhood ACT have indicated a median age at diagnosis of about 4 years. In our institution, the median age was 3 years and 5 months, while the median age for first signs and symptoms was 2 years and 5 months (N = 72. Using the comparative genomic hybridization technique, we have reported a high frequency of 9q34 amplification in adenomas and carcinomas. This finding has been confirmed more recently by investigators in England. The lower socioeconomic status, the distinctive ethnic groups and all the regional differences in Southern Brazil in relation to patients in England indicate that these differences are not important to determine 9q34 amplification. Candidate amplified genes mapped to this locus are currently being investigated and Southern blot results obtained so far have discarded amplification of the abl oncogene. Amplification of 9q34 has not been found to be related to tumor size, staging, or malignant histopathological features, nor does it seem to be responsible for the higher incidence of ACT observed in Southern Brazil, but could be related to an ACT from embryonic origin.
Jin, Yuesheng; Zhang, Hao; Tsao, Sai Wah; Jin, Charlotte; Lv, Mei; Strömbeck, Bodil; Wiegant, Joop; Wan, Thomas Shek Kong; Yuen, Po Wing; Kwong, Yok-Lam
2004-01-01
This study aimed at identifying the genetic events involved in immortalization of ovarian epithelial cells, which might be important steps in ovarian carcinogenesis. The genetic profiles of five human ovarian surface epithelial (HOSE) cell lines immortalized by retroviral transfection of the human papillomavirus (HPV) E6/E7 genes were thoroughly characterized by chromosome banding and fluorescence in situ hybridization (FISH), at various passages pre- and post-crisis. In pre-crisis, most cells had simple, non-clonal karyotypic changes. Telomere association was the commonest aberration, suggesting that tolermase dysfunction might be an important genetic event leading to cellular crisis. After immortalization post-crisis, however, the karyotypic patterns were non-random. Loss of genetic materials was a characteristic feature. The commonest numerical aberrations were -13, -14, -16, -17, -18, and +5. Among them, loss of chromosome 13 was common change observed in all lines. The only recurrent structural aberration was homogeneously staining regions (hsr) observed in three lines. FISH and combined binary ratio labeling (COBRA)-FISH showed in two cases that the hsrs were derived from chromosome 20. Clonal evolution was observed in four of the lines. In one line, hsr was the only change shared by all subclones, suggesting that it might be a primary event in cell immortalization. The results of the present study suggested that loss of chromosome 13 and the amplification of chromosome 20 might be early genetic events involved in ovarian cell immortalization, and might be useful targets for the study of genomic aberrations in ovarian carcinogenesis.
Directory of Open Access Journals (Sweden)
Koji Hashimoto
2016-05-01
Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1990-01-01
The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...... be carefully titrated for each primer pair in the PCR. The influence of mismatches between the primer and the DNA template were studied and we found that, by using primers differing only from each other at the 3' end, cross-amplification of closely homologous alleles could be avoided. Thus, single base...
International Nuclear Information System (INIS)
Tang, Jin-Bao; Tang, Ying; Yang, Hong-Ming
2015-01-01
Highlights: • An efficient signal amplification strategy for label-free EIA is proposed. • Divalent biotinylated AP and monovalent biotinylated ZZ were prepared via Avitag–BirA system. • The above site-specific biotinylated fusion proteins form complex via SA–biotin interaction. • The mechanism relies on the ZZ–Avi-B/SA/AP–(Avi-B) 2 complex. • The analytical signals are enhanced (32-fold) by the proposed strategy. - Abstract: Constructing a recombinant protein between a reporter enzyme and a detector protein to produce a homogeneous immunological reagent is advantageous over random chemical conjugation. However, the approach hardly recombines multiple enzymes in a difunctional fusion protein, which results in insufficient amplification of the enzymatic signal, thereby limiting its application in further enhancement of analytical signal. In this study, two site-specific biotinylated recombinant proteins, namely, divalent biotinylated alkaline phosphatase (AP) and monovalent biotinylated ZZ domain, were produced by employing the Avitag–BirA system. Through the high streptavidin (SA)–biotin interaction, the divalent biotinylated APs were clustered in the SA–biotin complex and then incorporated with the biotinylated ZZ. This incorporation results in the formation of a functional macromolecule that involves numerous APs, thereby enhancing the enzymatic signal, and in the production of several ZZ molecules for the interaction with immunoglobulin G (IgG) antibody. The advantage of this signal amplification strategy is demonstrated through ELISA, in which the analytical signal was substantially enhanced, with a 32-fold increase in the detection sensitivity compared with the ZZ–AP fusion protein approach. The proposed immunoassay without chemical modification can be an alternative strategy to enhance the analytical signals in various applications involving immunosensors and diagnostic chips, given that the label-free IgG antibody is suitable for
Energy Technology Data Exchange (ETDEWEB)
Tang, Jin-Bao [School of Pharmacy, Weifang Medical University, Weifang 261053 (China); Tang, Ying [Affiliated Hospital of Weifang Medical University, Weifang 261041 (China); Yang, Hong-Ming, E-mail: yanghongming2006@sohu.com [School of Pharmacy, Weifang Medical University, Weifang 261053 (China)
2015-02-15
Highlights: • An efficient signal amplification strategy for label-free EIA is proposed. • Divalent biotinylated AP and monovalent biotinylated ZZ were prepared via Avitag–BirA system. • The above site-specific biotinylated fusion proteins form complex via SA–biotin interaction. • The mechanism relies on the ZZ–Avi-B/SA/AP–(Avi-B){sub 2} complex. • The analytical signals are enhanced (32-fold) by the proposed strategy. - Abstract: Constructing a recombinant protein between a reporter enzyme and a detector protein to produce a homogeneous immunological reagent is advantageous over random chemical conjugation. However, the approach hardly recombines multiple enzymes in a difunctional fusion protein, which results in insufficient amplification of the enzymatic signal, thereby limiting its application in further enhancement of analytical signal. In this study, two site-specific biotinylated recombinant proteins, namely, divalent biotinylated alkaline phosphatase (AP) and monovalent biotinylated ZZ domain, were produced by employing the Avitag–BirA system. Through the high streptavidin (SA)–biotin interaction, the divalent biotinylated APs were clustered in the SA–biotin complex and then incorporated with the biotinylated ZZ. This incorporation results in the formation of a functional macromolecule that involves numerous APs, thereby enhancing the enzymatic signal, and in the production of several ZZ molecules for the interaction with immunoglobulin G (IgG) antibody. The advantage of this signal amplification strategy is demonstrated through ELISA, in which the analytical signal was substantially enhanced, with a 32-fold increase in the detection sensitivity compared with the ZZ–AP fusion protein approach. The proposed immunoassay without chemical modification can be an alternative strategy to enhance the analytical signals in various applications involving immunosensors and diagnostic chips, given that the label-free IgG antibody is suitable
Future plans for the MP line (Both general and specific)
International Nuclear Information System (INIS)
Underwood, D.G.
1988-01-01
This talk consists of three sections. Topics range from suggestions of possible physics, which are presented to provoke thought and discussion about the distant future, to specific goals of E-704 for the next running period. The sections are on physics issues, possible upgrades of the beam and experimental apparatus, and goals for the next running period. 4 refs., 5 figs
Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu
2015-03-01
Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.
Directory of Open Access Journals (Sweden)
Erica L Cain
2011-04-01
Full Text Available Analysis of chromosomal rearrangements within primary tumors has been influential in the identification of novel oncogenes. Identification of the "driver" gene(s within cancer-derived amplicons is, however, hampered by the fact that most amplicons contain many gene products. Amplification of 1q21-1q23 is strongly associated with liposarcomas and microarray-based comparative genomic hybridization narrowed down the likely candidate oncogenes to two: the activating transcription factor 6 (atf6 and the dual specificity phosphatase 12 (dusp12. While atf6 is an established transcriptional regulator of the unfolded protein response, the potential role of dusp12 in cancer remains uncharacterized.To evaluate the oncogenic potential of dusp12, we established stable cell lines that ectopically over-express dusp12 in isolation and determined whether this cell line acquired properties frequently associated with transformed cells. Here, we demonstrate that cells over-expressing dusp12 display increased cell motility and resistance to apoptosis. Additionally, over-expression of dusp12 promoted increased expression of the c-met proto-oncogene and the collagen and laminin receptor intergrin alpha 1 (itga1 which is implicated in metastasis.Collectively, these results suggest that dusp12 is oncologically relevant and exposes a potential association between dusp12 and established oncogenes that could be therapeutically targeted.
Barani, S.; Mascandola, C.; Massa, M.; Spallarossa, D.
2017-12-01
The recent Emilia seismic sequence (Northern Italy) occurred at the end of the first half of 2012 with main shock of Mw6.1 highlighted the importance of studying site effects in the Po Plain, the larger and deeper sedimentary basin in Italy. As has long been known, long-period amplification related to deep sedimentary basins can significantly affect the characteristics of the ground-motion induced by strong earthquakes. It follows that the effects of deep sedimentary deposits on ground shaking require special attention during the definition of the design seismic action. The work presented here analyzes the impact of deep-soil discontinuities on ground-motion amplification, with particular focus on long-period probabilistic seismic-hazard assessment. The study focuses on the site of Castelleone, where a seismic station of the Italian National Seismic Network has been recording since 2009. Our study includes both experimental and numerical site response analyses. Specifically, extensive active and passive geophysical measurements were carried out in order to define a detailed shear-wave velocity (VS) model to be used in the numerical analyses. These latter are needed to assess the site-specific ground-motion hazard. Besides classical seismic refraction profiles and multichannel analysis of surface waves, we analyzed ambient vibration measurements in both single and array configurations. The VS profile was determined via joint inversion of the experimental phase-velocity dispersion curve with the ellipticity curve derived from horizontal-to-vertical spectral ratios. The profile shows two main discontinuities at depths of around 160 and 1350 m, respectively. The probabilistic site-specific hazard was assessed in terms of both spectral acceleration and displacement. A partially non-ergodic approach was adopted. We have found that the spectral acceleration hazard is barely sensitive to long-period (up to 10 s) amplification related to the deeper discontinuity whereas the
Directory of Open Access Journals (Sweden)
Deguo Wang
2015-05-01
Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Wang, Deguo; Liu, Yanhong
2015-05-26
Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Yin, Hao; Du, Jianchang; Li, Leiting; Jin, Cong; Fan, Lian; Li, Meng; Wu, Jun; Zhang, Shaoling
2014-06-04
Cassandra transposable elements belong to a specific group of terminal-repeat retrotransposons in miniature (TRIM). Although Cassandra TRIM elements have been found in almost all vascular plants, detailed investigations on the nature, abundance, amplification timeframe, and evolution have not been performed in an individual genome. We therefore conducted a comprehensive analysis of Cassandra retrotransposons using the newly sequenced pear genome along with four other Rosaceae species, including apple, peach, mei, and woodland strawberry. Our data reveal several interesting findings for this particular retrotransposon family: 1) A large number of the intact copies contain three, four, or five long terminal repeats (LTRs) (∼20% in pear); 2) intact copies and solo LTRs with or without target site duplications are both common (∼80% vs. 20%) in each genome; 3) the elements exhibit an overall unbiased distribution among the chromosomes; 4) the elements are most successfully amplified in pear (5,032 copies); and 5) the evolutionary relationships of these elements vary among different lineages, species, and evolutionary time. These results indicate that Cassandra retrotransposons contain more complex structures (elements with multiple LTRs) than what we have known previously, and that frequent interelement unequal recombination followed by transposition may play a critical role in shaping and reshaping host genomes. Thus this study provides insights into the property, propensity, and molecular mechanisms governing the formation and amplification of Cassandra retrotransposons, and enhances our understanding of the structural variation, evolutionary history, and transposition process of LTR retrotransposons in plants. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Narender S Maan
Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and
Directory of Open Access Journals (Sweden)
Mohammad Rubayet Hasan
2014-01-01
Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.
Directory of Open Access Journals (Sweden)
Hadi Ravan
2017-09-01
Discussion and conclusion: As a result of a high sensitivity and specificity of the method as well as its low cost per assay, it could be concluded that the present LAMP assay is a powerful, accurate, and efficient method for detecting pathogenic serovar Salmonella typhimurium in food-processing industries and diagnostic laboratories.
Pathway-specific differences between tumor cell lines and normal and tumor tissue cells
Directory of Open Access Journals (Sweden)
Tozeren Aydin
2006-11-01
Full Text Available Abstract Background Cell lines are used in experimental investigation of cancer but their capacity to represent tumor cells has yet to be quantified. The aim of the study was to identify significant alterations in pathway usage in cell lines in comparison with normal and tumor tissue. Methods This study utilized a pathway-specific enrichment analysis of publicly accessible microarray data and quantified the gene expression differences between cell lines, tumor, and normal tissue cells for six different tissue types. KEGG pathways that are significantly different between cell lines and tumors, cell lines and normal tissues and tumor and normal tissue were identified through enrichment tests on gene lists obtained using Significance Analysis of Microarrays (SAM. Results Cellular pathways that were significantly upregulated in cell lines compared to tumor cells and normal cells of the same tissue type included ATP synthesis, cell communication, cell cycle, oxidative phosphorylation, purine, pyrimidine and pyruvate metabolism, and proteasome. Results on metabolic pathways suggested an increase in the velocity nucleotide metabolism and RNA production. Pathways that were downregulated in cell lines compared to tumor and normal tissue included cell communication, cell adhesion molecules (CAMs, and ECM-receptor interaction. Only a fraction of the significantly altered genes in tumor-to-normal comparison had similar expressions in cancer cell lines and tumor cells. These genes were tissue-specific and were distributed sparsely among multiple pathways. Conclusion Significantly altered genes in tumors compared to normal tissue were largely tissue specific. Among these genes downregulation was a major trend. In contrast, cell lines contained large sets of significantly upregulated genes that were common to multiple tissue types. Pathway upregulation in cell lines was most pronounced over metabolic pathways including cell nucleotide metabolism and oxidative
Van Der Pol, Barbara; Warren, Terri; Taylor, Stephanie N; Martens, Mark; Jerome, Keith R; Mena, Leandro; Lebed, Joel; Ginde, Savita; Fine, Paul; Hook, Edward W
2012-11-01
Herpes infections are among the most common sexually transmitted infections (STI), but diagnostic methods for genital herpes have not kept pace with the movement toward molecular testing. Here, we describe an FDA-approved molecular assay that identifies and types herpes simplex virus (HSV) infections for use in routine clinical settings. Paired samples from anogenital lesions were tested using the BD ProbeTec HSV Q(x) (HSVQ(x)) system, HSV culture and, a laboratory-developed PCR assay. Family planning, obstetrics/gynecology (OB/GYN), or sexually transmitted disease (STD) clinics in the United States served as recruitment sites. Sensitivity and specificity estimates, head-to-head comparisons, measures of agreement, and latent-class analyses were performed to provide robust estimates of performance. A total of 508 participants (174 men and 334 women) with anogenital lesions were included; 260 HSV-2 and 73 HSV-1 infections were identified. No differences in test performance based on gender, clinic type, location of the lesion, or type of lesion were observed. The sensitivity of HSV-2 detection ranged from 98.4 to 100% depending on the analytical approach, while the specificity ranged from 80.6%, compared to the less sensitive culture method, to 97.0%, compared to PCR. For HSV-1, the sensitivity and specificity ranges were 96.7 to 100% and 95.1 to 99.4%, respectively. This assay may improve our ability to accurately diagnose anogenital lesions due to herpes infection.
Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao
2017-07-01
We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11 M to 9.0 × 10 -10 M, and as low as 1.0 × 10 -11 M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8 M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.
Kunzelmann, K; Lei, D C; Eng, K; Escobar, L C; Koslowsky, T; Gruenert, D C
1995-09-01
Analysis of vectorial ion transport and protein trafficking in transformed cystic fibrosis (CF) epithelial cells has been limited because the cells tend to lose their tight junctions with multiple subcultures. To elucidate ion transport and protein trafficking in CF epithelial cells, a polar cell line with apical and basolateral compartments will facilitate analysis of the efficacy of different gene therapy strategies in a "tight epithelium" in vitro. This study investigates the genotypic and phenotypic properties of a CF nasal polyp epithelial, delta F508 homozygote, cell line that has tight junctions pre-crisis. The cells (sigma CFNPE14o-) were transformed with an origin-of-replication defective SV40 plasmid. They develop transepithelial resistance in Ussing chambers and are defective in cAMP-dependent Cl- transport as measured by efflux of radioactive Cl-, short circuit current (Isc), or whole-cell patch clamp. Stimulation of the cells by bradykinin, histamine, or ATP seems to activate both K(+)- and Ca(+2)-dependent Cl- transport. Measurement of 36Cl- efflux following stimulation with A23187 and ionomycin indicate a Ca(+2)-dependent Cl- transport. Volume regulatory capacity of the cells is indicated by cell swelling conductance. Expression of the CF transmembrane conductance regulator mRNA was indicated by RT-PCR amplification. When cells are grown at 26 degrees C for 48 h there is no indication of cAMP-dependent Cl- as has been previously indicated in heterologous expression systems. Antibodies specific for secretory cell antigens indicate the presence of antigens found in goblet, serous, and mucous cells; in goblet and serous cells; or in goblet and mucous cells; but not antigens found exclusively in mucous or serous cells.(ABSTRACT TRUNCATED AT 250 WORDS)
Production of prostate-specific antigen by a breast cancer cell line, Sk-Br-3
International Nuclear Information System (INIS)
Kamali Sarvestani, E.; Ghaderi, A.
2002-01-01
Prostate-specific antigen is a 33-KDa serine protease that is produced predominantly by prostate epithelium. However, it has been shown that about 30-40% of female breast tumors produce prostate-specific antigen and its production is associated with the presence of estrogen and progesterone receptors. We have now developed a new tissue culture system to study prostate-specific antigen production in breast cancer and its association with prognostic factors such as progesterone receptor and c-erbB-2. For this purpose we investigated the ability of prostate-specific antigen production in five different cell lines, including two breast cancer cell lines, Sk-Br-3 and MDA-MB-453. The prostate-specific antigen in tissue culture supernatant and cytoplasm of the Sk-Br-3 cell line was detected by western blotting and immunoperoxidase, respectively. Furthermore, we found lower expression of c-erbB-2 in Sk-Br-3 than non-prostate-specific antigen producer breast cancer cell line, MDA-MB-453. Progesterone receptor was expressed by both prostate-specific antigen-positive and -negative cell lines and only the intensity of staining and the number of positive cells in Sk-Br-3 population was higher than MDA-MB-453. According to our findings prostate-specific antigen can be considered as a good prognostic factor in breast cancer and we suggest that these two cell lines are a good in vitro model to study the relationship of different breast cancer prognostic factors and their regulations
Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan
2016-02-01
Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Miniaturized isothermal nucleic acid amplification, a review.
Asiello, Peter J; Baeumner, Antje J
2011-04-21
Micro-Total Analysis Systems (µTAS) for use in on-site rapid detection of DNA or RNA are increasingly being developed. Here, amplification of the target sequence is key to increasing sensitivity, enabling single-cell and few-copy nucleic acid detection. The several advantages to miniaturizing amplification reactions and coupling them with sample preparation and detection on the same chip are well known and include fewer manual steps, preventing contamination, and significantly reducing the volume of expensive reagents. To-date, the majority of miniaturized systems for nucleic acid analysis have used the polymerase chain reaction (PCR) for amplification and those systems are covered in previous reviews. This review provides a thorough overview of miniaturized analysis systems using alternatives to PCR, specifically isothermal amplification reactions. With no need for thermal cycling, isothermal microsystems can be designed to be simple and low-energy consuming and therefore may outperform PCR in portable, battery-operated detection systems in the future. The main isothermal methods as miniaturized systems reviewed here include nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA). Also, important design criteria for the miniaturized devices are discussed. Finally, the potential of miniaturization of some new isothermal methods such as the exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others is presented.
[The characters and specific features of new human embryonic stem cells lines].
Krylova, T A; Kol'tsova, A M; Zenin, V V; Gordeeva, O F; Musorina, A S; Goriachaia, T S; Shlykova, S A; Kamenetskaia, Iu K; Pinaev, G P; Polianskaia, G G
2009-01-01
Four continuous human embryonic stem cell lines (SC1, SC2, SC3 and SC4), derived from the blastocysts has been described. The cell lines were cultivated on mitotically inactivated human feeder cells. The cell lines SC1 and SC2 have passed through 150 population doublings and the cell lines SC3 and SC4 -- near 120 populations doublings, which exceeds Hayflick limit sufficiently. These cell lines maintain high activity of alkaline phosphatase, expression of transcription factor OCT-4 and cell surface antigens (SSEA-4, TRA-1-60 and TRA-1-81), confirming their ESC status and human specificity. Immunofluorescent detection of antigens, characteristic of ectoderm, endoderm and mesoderm confirms the ability of these cells to retain their pluripotency under in vitro condition. PCR analysis revealed expression of six genes specific for pluripotent cells (OCT-4, NANOG, DPPA3/STELLA, TDGF/CRIPTO and LEFTYA). Correlation between the level of proliferative activity and the character of DNA-bound fluorescent staining was found. Fluorescent dyes, Hoechst 33342 and PI, produced diffuse staining of the nuclei in slowly proliferating cells of the SC1 and SC2 lines. In contrast, in actively proliferating cells of the SC3 and SC4 lines, the clear staining of the nuclei was observed. Upon changing the cultivation condition, proliferative activity of SC3 and SC4 lines decreased and became similar to that of SC1 and SC2 lines. The character of the fluorescent staining of all these lines was also shown to be similar. These results show that quality of the fluorescent staining with Hoechst 33342 and PI reflects the level of proliferation. Possible causes and mechanisms of this feature of human ESC are discussed.
International Nuclear Information System (INIS)
Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong
2013-01-01
We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)
RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity
2013-01-01
A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183
Amplification factor variable amplifier
Akitsugu, Oshita; Nauta, Bram
2007-01-01
PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and
Amplification factor variable amplifier
Akitsugu, Oshita; Nauta, Bram
2010-01-01
PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can
Identification of genome-specific transcripts in wheat–rye translocation lines
Directory of Open Access Journals (Sweden)
Tong Geon Lee
2015-09-01
Full Text Available Studying gene expression in wheat–rye translocation lines is complicated due to the presence of homeologs in hexaploid wheat and high levels of synteny between wheat and rye genomes (Naranjo and Fernandez-Rueda, 1991 [1]; Devos et al., 1995 [2]; Lee et al., 2010 [3]; Lee et al., 2013 [4]. To overcome limitations of current gene expression studies on wheat–rye translocation lines and identify genome-specific transcripts, we developed a custom Roche NimbleGen Gene Expression microarray that contains probes derived from the sequence of hexaploid wheat, diploid rye and diploid progenitors of hexaploid wheat genome (Lee et al., 2014. Using the array developed, we identified genome-specific transcripts in a wheat–rye translocation line (Lee et al., 2014. Expression data are deposited in the NCBI Gene Expression Omnibus (GEO under accession number GSE58678. Here we report the details of the methods used in the array workflow and data analysis.
Yang, Yukun; Cao, Yaoyu; Wang, Xiaomin; Fang, Guozhen; Wang, Shuo
2015-02-15
In this work, we presented a three-dimensional (3D) molecularly imprinted electrochemical sensor (MIECS) with novel strategy for ultrasensitive and specific quantification of metolcarb based on prussian blue (PB) mediated amplification combined with signal enhancement of ordered mesoporous carbon. The molecularly imprinted polymers were synthesized by electrochemically induced redox polymerization of para aminobenzoic acid (p-ABA) in the presence of template metolcarb. Ordered mesoporous carbon material (CMK-3) was introduced to enhance the electrochemical response by improving the structure of the modified electrodes and facilitating charge transfer processes of PB which was used as an inherent electrochemical active probe. The modification process for the working electrodes of the MIECS was characterized by scanning electron microscope (SEM) and cyclic voltammetry (CV), and several important parameters controlling the performance of the MIECS were investigated and optimized in detail. The MIECS with 3D structure had the advantages of ease of preparation, high porous surface structure, speedy response, ultrasensitivity, selectivity, reliable stability, good reproducibility and repeatability. Under the optimal conditions, the MIECS offered an excellent current response for metolcarb in the linear response range of 5.0 × 10(-10)-1.0 × 10(-4) mol L(-1) and the limit of detection (LOD) was calculated to be 9.3 × 10 (-11)mol L(-1) (S/N = 3). The proposed MIECS has been successfully applied for the determination of metolcarb in real samples with satisfactory recoveries. Furthermore, the construction route of this ultrasensitive 3D MIECS may provide a guideline for the determination of non-electroactive analytes in environmental control and food safety. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Dyukov, L.V.; Fedorov, A.F.; Terekhov, V.F.
1977-01-01
The circuit and design of a modulator at pulse power of 15 MW and average power of 300 kW, intended for supplying a klystron generator, are described. The modulator is designed for operating in a lengthy mode. The capacitance storage-former is made in the form of three parallel sections of artificial shaping lines in order to lower the specific loads on the elements of the shaping line and thyristors. The thyristor spark gaps are made in the form of a unified water-cooled assembly composed of 12 series TD-320 thyristors. An assessment of the modulator reliability has shown that the average time-to-fault is 800 hr. Modulator tests confirm that the choice of the circuit solution is correct. The modulator total efficiency equals to approximately 0.9
Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens
2011-01-01
Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301
Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C
2013-06-01
Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.
Modes in Component Behavior Specification via EBP and their Application in Product Lines
Czech Academy of Sciences Publication Activity Database
Kofroň, Jan; Plášil, František; Šerý, O.
2009-01-01
Roč. 51, č. 1 (2009), s. 31-41 ISSN 0950-5849 R&D Projects: GA AV ČR 1ET400300504 Grant - others:GA ČR(CZ) GA201/08/0266 Institutional research plan: CEZ:AV0Z10300504 Keywords : behavior specification * component modes * software product lines Subject RIV: JC - Computer Hardware ; Software Impact factor: 1.821, year: 2009
Scaradavou, A; Carrier, C; Mollen, N; Stevens, C; Rubinstein, P
1996-08-15
A critical issue regarding the broader utilization of placental/ umbilical cord blood (PCB) in unrelated bone marrow restoration is the possibility of contamination with maternal lymphocytes capable of immunological reactivity against the eventual recipient. On transplantation, such maternal cells might lead to graft-versus-host disease (GVHD) even if the intended donor's neonatal lymphocytes were unresponsive. We measured the proportion of PCB samples that were contaminated with maternal cells. Placental-maternal sample pairs were selected so that the mother was heterozygous for the DR53 haplotype, whereas the placental sample was DR53-negative. The PCB samples were investigated for the presence of the noninherited maternal gene DRB4, exclusive to the DR53 haplotypes. Locus-specific polymerase chain reaction amplification with DRB4 sequence-specific primers was followed by either gel electrophoresis or blotting and hybridization to an internal sequence DRB4 probe. Polymerase chain reaction products from DNA mixtures containing as low as 0.5 ng of a DRB4-positive DNA control in 1.0 microgram of a DRB4-negative DNA sample (1:2 x 10(3) dilution) showed a visible DRB4 band in agarose gels stained with ethidium bromide. Locus-specific hybridization increased the detection sensitivity to 1:10(5) (0.01 ng of the DRB4-positive DNA control). Control mixtures of known amounts of DRB4-positive and -negative DNA were included in all experiments. Comparison of the thickness of DRB4 bands after electrophoresis and the intensity of the DRB4-specific hybridization signals to the concentration controls allowed a rough estimation of the amount of maternal DNA in the placental blood specimens. A total of 213 PCB samples were tested. By gel electrophoresis, DRB4-specific bands were observed to be as strong or stronger in 23 (10.8%) samples as those in the 1:2 x 10(3) control, and 153 (17.8%) samples were negative in this test. The remaining 37 (17.3%) samples disclosed weaker DRB4
Establishment of monoclonal HCC cell lines with organ site-specific tropisms
International Nuclear Information System (INIS)
Wan, Jinliang; Wen, Duo; Dong, Lili; Tang, Jun; Liu, Dongli; Liu, Yang; Tao, Zhonghua; Gao, Dongmei; Sun, Huichuan; Cao, Ya; Fan, Jia; Wu, Weizhong
2015-01-01
Organ site-specific metastasis is an ominous feature for most poor-prognostic hepatocellular carcinoma (HCC) patients. Cancer cell lines and animal models are indispensable for investigating the molecular mechanisms of organ specific tropism. However, till now, little is known about the drivers in HCC metastatic tropism, and also no effective way has been developed to block the process of tropistic metastasis. In this study, we established several monoclonal HCC cell lines from HCCLM3-RFP together with their xenograft models, and then analyzed their metastatic potentials and tropisms using in-vitro and in-vivo assays, and finally elucidated the driving forces of HCC tropistic metastases. Six monoclonal cell lines with different organ site-specific tropism were established successfully. SPARC, VCAM1 and ANGPTL4 were found positively correlated with the potentials of lung metastasis, while ITGA1 had a positive relation to lymph node metastasis of enterocoelia. By our powerful platforms, HCC metastatic tropisms in clinic could be easily mimicked and recapitulated for exploring the bilateral interactions between tumor and its microenvironment, elucidating the drivers of HCC metastatic tropisms, and testing anti-cancer effects of newly developed agent in pre-clinical stage. The online version of this article (doi:10.1186/s12885-015-1692-0) contains supplementary material, which is available to authorized users
Adriaansen-Tennekes, R.; Vries Reilingh, de G.; Nieuwland, M.G.B.; Parmentier, H.K.; Savelkoul, H.F.J.
2009-01-01
Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based
Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D)
International Nuclear Information System (INIS)
Judge, S.M.; Chatterton, R.T. Jr.
1983-01-01
The purpose of this study was to examine the lactogenic response of human mammary cancer cell lines to hormones in vitro. Progesterone was found to stimulate the incorporation of 14C from [14C]acetate into triglycerides (TG) and to promote accumulation of TG with a fatty acid composition similar to that of human milk fat in T-47D cells. Lipid droplets were observed in larger numbers without concomitant accumulation of casein granules in cells incubated with progesterone, but secretion of lipid into the medium did not occur. An effect of progesterone on TG accumulation was detectable after 12 hr and was maximal at 72 hr. Increasing doses of progesterone (10(-9) to 10(-5) M) caused a progressive increase in TG accumulation. The presence of cortisol and/or prolactin did not alter TG formation nor the dose response of the cells to progesterone. The growth rate of T-47D cells was not altered by the presence of progesterone in the medium. Neither of the human mammary cancer cell lines, MCF-7 and HBL-100, nor the human fibroblast cell lines, 28 and 857, responded to progesterone. The data indicate that, while the normally lactogenic hormones do not stimulate milk product biosynthesis in the cell lines tested, progesterone specifically stimulated synthesis and accumulation of TG in the T-47D cells
Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression
Directory of Open Access Journals (Sweden)
Juni eSarkar
2014-07-01
Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.
International Nuclear Information System (INIS)
Lee, Yen-Min; Li, Jia-Han; Cheng, Hsin-Hung; Wang, Fu-Min; Shen, Yu-Tian; Tsai, Kuen-Yu; Shieh, Jason J; Chen, Alek C
2014-01-01
The Fourier scatterometry model was used to measure the ZEP 520A electron beam resist lines with specific line edge roughness (LER). By obtaining the pupils via an objective lens, the angle-resolved diffraction spectrum was collected efficiently without additional mechanical scanning. The concavity of the pupil was considered as the weight function in specimen recognition. A series of white noises was examined in the model, and the tolerant white noise levels for different system numerical apertures (NAs) were reported. Our numerical results show that the scatterometry model of a higher NA can identify a target with a higher white noise level. Moreover, the fabricated ZEP 520A electron beam resist gratings with LER were measured by using our model, and the fitting results were matched with scanning electron microscope measurements. (paper)
Adriaansen-Tennekes, R; de Vries Reilingh, G; Nieuwland, M G B; Parmentier, H K; Savelkoul, H F J
2009-09-01
Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based differential immune competence. The parental line of these hens was randomly bred as the control line and was used as well. Recently, we showed that these selection lines differ in their stress reactivity; the low line birds show a higher hypothalamic-pituitary-adrenal (HPA) axis reactivity. To examine maternal effects and neonatal nutritional exposure on nutrient sensitivity, we studied 2 subsequent generations. This also created the opportunity to examine egg production in these birds. The 3 lines were fed 2 different nutritionally complete layer feeds for a period of 22 wk in the first generation. The second generation was fed from hatch with the experimental diets. At several time intervals, parameters reflecting humoral immunity were determined such as specific antibody to Newcastle disease and infectious bursal disease vaccines; levels of natural antibodies binding lipopolysaccharide, lipoteichoic acid, and keyhole limpet hemocyanin; and classical and alternative complement activity. The most pronounced dietary-induced effects were found in the low line birds of the first generation: specific antibody titers to Newcastle disease vaccine were significantly elevated by 1 of the 2 diets. In the second generation, significant differences were found in lipoteichoic acid natural antibodies of the control and low line hens. At the end of the observation period of egg parameters, a significant difference in egg weight was found in birds of the high line. Our results suggest that nutritional differences have immunomodulatory effects on innate and adaptive humoral immune parameters in birds with high HPA axis reactivity and affect egg production in birds with low HPA axis reactivity.
Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.
Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan
2013-11-19
The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.
Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis
International Nuclear Information System (INIS)
Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus
2005-01-01
TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor
Using Regularization to Infer Cell Line Specificity in Logical Network Models of Signaling Pathways
Directory of Open Access Journals (Sweden)
Sébastien De Landtsheer
2018-05-01
Full Text Available Understanding the functional properties of cells of different origins is a long-standing challenge of personalized medicine. Especially in cancer, the high heterogeneity observed in patients slows down the development of effective cures. The molecular differences between cell types or between healthy and diseased cellular states are usually determined by the wiring of regulatory networks. Understanding these molecular and cellular differences at the systems level would improve patient stratification and facilitate the design of rational intervention strategies. Models of cellular regulatory networks frequently make weak assumptions about the distribution of model parameters across cell types or patients. These assumptions are usually expressed in the form of regularization of the objective function of the optimization problem. We propose a new method of regularization for network models of signaling pathways based on the local density of the inferred parameter values within the parameter space. Our method reduces the complexity of models by creating groups of cell line-specific parameters which can then be optimized together. We demonstrate the use of our method by recovering the correct topology and inferring accurate values of the parameters of a small synthetic model. To show the value of our method in a realistic setting, we re-analyze a recently published phosphoproteomic dataset from a panel of 14 colon cancer cell lines. We conclude that our method efficiently reduces model complexity and helps recovering context-specific regulatory information.
Directory of Open Access Journals (Sweden)
Minas Bakalchev
2015-10-01
Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.
Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.
Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke
2013-12-15
The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.
ISP-50 Specifications for a Direct Vessel Injection Line Break Test with the ATLAS
International Nuclear Information System (INIS)
Choi, Ki Yong; Baek, Won Pil; Kim, Yeon Sik; Park, Hyun Sik; Cho, Seok; Kang, Kyoung Ho; Choi, Nam Hyun; Min, Kyoung Ho
2009-06-01
An OECD/NEA International Standard Problem Exercise (ISP) focussing on a DVI line break simulation result with the ATLAS was approved by the NEA Committee on the Safety of Nuclear Installation (CSNI) meeting in December 2008 and was numbered by ISP-50. The ISP-50 program will be operated by an operating agency, KAERI for three years starting from the physical year 2009. Fourteen international organizations confirmed their participation in the ISP-50, including NRC (USA), JAEA, JNES (Japan), GRS (Germany), KFKI-AEKI (Hungary), EDO Gidropress (Russia), VTT, Fortum (Finland), NRI (Czech Republic), Univ. of Pisa (Italy), KINS, KNF, KOPEC, and KAERI (Korea). In addition, KTH in Sweden and HSE in UK are considering late participation. Recently, NPIC and CIAE in China hope to join the ISP-50. As for the safety analysis codes, nine codes are expected to be used for the ISP-50: MARS-3D, RELAP5- 3D, RELAP5, TRACE, CATHARE, APROS, ATHELET, TRAP, and KORSAR. It is the first ISP exercise in Korea in which a domestic test facility is utilized by international nuclear society and this exercise will contribute to extending our physical understanding on thermal hydraulic phenomena during the DVI line break accidents and to verifying the best-estimate thermal-hydraulic safety analysis codes. This report was prepared to define technical specifications of the ISP-50 exercise according the guideline provided by OECD/CSNI. It includes general objectives, phases, deliverables to participants, parameters required for comparison and the time table
International Nuclear Information System (INIS)
Davis, E.; Rasmussen, B.
2004-01-01
This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system
Xiong, L Z; Xu, C G; Saghai Maroof, M A; Zhang, Q
1999-04-01
DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. In this study, we assessed the extent and pattern of cytosine methylation in the rice genome, using the technique of methylation-sensitive amplified polymorphism (MSAP), which is a modification of the amplified fragment length polymorphism (AFLP) method that makes use of the differential sensitivity of a pair of isoschizomers to cytosine methylation. The tissues assayed included seedlings and flag leaves of an elite rice hybrid, Shanyou 63, and the parental lines Zhenshan 97 and Minghui 63. In all, 1076 fragments, each representing a recognition site cleaved by either or both of the isoschizomers, were amplified using 16 pairs of selective primers. A total of 195 sites were found to be methylated at cytosines in one or both parents, and the two parents showed approximately the same overall degree of methylation (16.3%), as revealed by the incidence of differential digestion by the isoschizomers. Four classes of patterns were identified in a comparative assay of cytosine methylation in the parents and hybrid; increased methylation was detected in the hybrid compared to the parents at some of the recognition sites, while decreased methylation in the hybrid was detected at other sites. A small proportion of the sites was found to be differentially methylated in seedlings and flag leaves; DNA from young seedlings was methylated to a greater extent than that from flag leaves. Almost all of the methylation patterns detected by MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrate that the MSAP technique is highly efficient for large-scale detection of cytosine methylation in the rice genome. We believe that the technique can be adapted for use in other plant species.
Zahradnik, Celine; Kolm, Claudia; Martzy, Roland; Mach, Robert L; Krska, Rudolf; Farnleitner, Andreas H; Brunner, Kurt
2014-11-01
In 2003 the European Commission introduced a 0.9% threshold for food and feed products containing genetically modified organism (GMO)-derived components. For commodities containing GMO contents higher than this threshold, labelling is mandatory. To provide a DNA-based rapid and simple detection method suitable for high-throughput screening of GMOs, several isothermal amplification approaches for the 35S promoter were tested: strand displacement amplification, nicking-enzyme amplification reaction, rolling circle amplification, loop-mediated isothermal amplification (LAMP) and helicase-dependent amplification (HDA). The assays developed were tested for specificity in order to distinguish between samples containing genetically modified (GM) maize and non-GM maize. For those assays capable of this discrimination, tests were performed to determine the lower limit of detection. A false-negative rate was determined to rule out whether GMO-positive samples were incorrectly classified as GMO-negative. A robustness test was performed to show reliable detection independent from the instrument used for amplification. The analysis of three GM maize lines showed that only LAMP and HDA were able to differentiate between the GMOs MON810, NK603, and Bt11 and non-GM maize. Furthermore, with the HDA assay it was possible to realize a detection limit as low as 0.5%. A false-negative rate of only 5% for 1% GM maize for all three maize lines shows that HDA has the potential to be used as an alternative strategy for the detection of transgenic maize. All results obtained with the LAMP and HDA assays were compared with the results obtained with a previously reported real-time PCR assay for the 35S promoter in transgenic maize. This study presents two new screening assays for detection of the 35S promoter in transgenic maize by applying the isothermal amplification approaches HDA and LAMP.
Energy Technology Data Exchange (ETDEWEB)
E Davis, B Rasmussen
2004-12-31
This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system.
Czech Academy of Sciences Publication Activity Database
Selicharová, Irena; Šanda, Miloslav; Mládková, Jana; Ohri, S. S.; Vashishta, A.; Fusek, M.; Jiráček, Jiří; Vetvicka, V.
2008-01-01
Roč. 19, č. 5 (2008), s. 1237-1244 ISSN 1021-335X R&D Projects: GA MZd NR8323 Grant - others:NIH(US) ROI CAA082159-03 Institutional research plan: CEZ:AV0Z40550506 Keywords : breast cancer * cell line * 2-DE * organ-specific metastases Subject RIV: CE - Biochemistry Impact factor: 1.524, year: 2008
Li, Jianping; Yang, Bin; Pan, Hongcheng; Xu, Guobao
2018-06-30
The selective and sensitive detection of rare earth elements is thought to be difficult because the concentration of those elements in the sample is commonly at a low level and they normally have severe mutual interference which is caused by homologous chemical properties. In this study, a novel molecularly imprinted polymer (MIP) sensor was fabricated for highly sensitive and selective determination of ultra-trace Tb 3+ . The Tb 3+ -ethylenediaminetetraacetic acid complex (Tb-EDTA) as the template molecule was incorporated into mono-6-mercapto-β-cyclodextrin (mono-6-SH-β-CD) to form a Russian Matryoshka (RM)-structured molecule (CD/Tb-EDTA). Titanium isopropoxide was utilized in vapor sol-gel polymerization to construct MIP membrane. Moreover, the selectivity of the RM MIP sensor was remarkably enhanced by the "triple-selectivity" recognition of EDTA-to-Tb 3+ , β-CD-to-(Tb-EDTA), and 3D cavity-to-(CD/Tb-EDTA), while the sensitivity of the MIP sensor was significantly improved by ECL signal enhancement based on double amplification, in other words, the electrochemiluminescence resonance energy transfer (ECL-RET) between the ECL donor of CD/Tb-EDTA and the ECL acceptor of Ru(bpy) 3 2+ , and the ECL enhancement by the co-reactant of CD/Tb-EDTA on Ru(bpy) 3 Cl 2 . When the imprinted cavities were occupied by Tb-EDTA during rebinding, the host-guest inclusion structured complex was formed and the ECL intensities produced by the Ru(bpy) 3 Cl 2 ECL system increased with increasing concentration of Tb-EDTA. The proposed sensor was used for quantitative analysis of Tb 3+ with concentrations ranging from 8.00 × 10 -13 mol/L to 4.00 × 10 -9 mol/L and successfully applied to detect Tb 3+ in seawater samples. The detection limit of the sensor was found to be 3.90 × 10 -13 mol/L (DL = 3δ b /K), which is lower than previously reported values. Thus, the fabricated sensor is feasible for practical applications. Copyright © 2018 Elsevier B.V. All rights
NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.
Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina
2008-10-01
We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.
Flux line lattice melting transition in YBa2Cu3O6.94 observed in specific heat experiments
International Nuclear Information System (INIS)
Roulin, M.; Junod, A.; Walker, E.
1996-01-01
When a magnetic field penetrates a type II superconductor, it forms a lattice of thin quantized filaments called magnetic vortices. Resistance, magnetization, and neutron diffraction experiments have shown that the vortex lattice of high-temperature superconductors can melt along a line in the field-temperature plane. The calorimetric signature of melting on this line was observed in a high-accuracy adiabatic specific heat experiment performed on YBa 2 Cu 3 O 6.94 . The specific heat of the vortex liquid was greater than that of the vortex solid. 17 refs., 3 figs
Amplification of PVT1 contributes to the pathophysiology ofovarian and breast cancer
Energy Technology Data Exchange (ETDEWEB)
Guan, Yinghui; Kuo, Wen-Lin; Stilwell, Jackie; Takano, Hirokuni; Lapuk, Anna; Fridlyand, Jane; Mao, Jian-Hua; Yu, Mami; Ginzinger, David; Gray, Joe W.
2007-10-09
Purpose. This study was designed to elucidate the role of amplification at 8q24 in the pathophysiology of ovarian and breast cancer since increased copy number at this locus is one of the most frequent genomic abnormalities in these cancers. Experimental Design. To accomplish this, we assessed the association of amplification at 8q24 with outcome in ovarian cancers using FISH to tissue microarrays and measured responses of ovarian and breast cancer cell lines to specific small interfering RNAs (siRNA) against the oncogene, MYC, and a putative noncoding RNA, PVT1, both of which map to 8q24. Results. Amplification of 8q24 was associated with significantly reduced survival duration. In addition, siRNA-mediated reduction in either PVT1 or MYC expression inhibited proliferation in breast and ovarian cancer cell lines in which they were both amplified and over expressed but not in lines in which they were not amplified/over expressed. Inhibition of PVT1 expression also induced a strong apoptotic response in cell lines in which it was over expressed but not in lines in which it was not amplified/over expressed. Inhibition of MYC, on the other hand, did not induce an apoptotic response in cell lines in which MYC was amplified and over expressed. Conclusions. These results suggest that MYC and PVT1 contribute independently to ovarian and breast pathogenesis when over expressed because of genomic abnormalities. They also suggest that PVT1 mediated inhibition of apoptosis may explain why amplification of 8q24 is associated with reduced survival duration in patients treated with agents that act through apoptotic mechanisms.
Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco
2016-06-01
To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the
Gene amplification in carcinogenesis
Directory of Open Access Journals (Sweden)
Lucimari Bizari
2006-01-01
Full Text Available Gene amplification increases the number of genes in a genome and can give rise to karyotype abnormalities called double minutes (DM and homogeneously staining regions (HSR, both of which have been widely observed in human tumors but are also known to play a major role during embryonic development due to the fact that they are responsible for the programmed increase of gene expression. The etiology of gene amplification during carcinogenesis is not yet completely understood but can be considered a result of genetic instability. Gene amplification leads to an increase in protein expression and provides a selective advantage during cell growth. Oncogenes such as CCND1, c-MET, c-MYC, ERBB2, EGFR and MDM2 are amplified in human tumors and can be associated with increased expression of their respective proteins or not. In general, gene amplification is associated with more aggressive tumors, metastases, resistance to chemotherapy and a decrease in the period during which the patient stays free of the disease. This review discusses the major role of gene amplification in the progression of carcinomas, formation of genetic markers and as possible therapeutic targets for the development of drugs for the treatment of some types of tumors.
A. C. Odeón; M. R. Leunda; C. Faverín; N. Boynak; M. M. Vena; O. Zabal
2009-01-01
The aim of this work was to study the in vitro amplification of BVDV (Pestivirus, Flaviridae) field isolates from Argentina in MDBK, BoTur and BHK-21 continuous cell lines. Field isolates 99/134 (mucosal disease), 00/693 (mucosal disease), 04P7016 (respiratory disease) and 04/89 (mucosal disease), genotype 1b, were used and compared with the Singer and NADL reference strains, genotype 1a. Additionally, cell lines derived from explants of bovine testis (RD- 420), bovine uterus (NCL-1) and porc...
Brown, Allan C.D.; Schmidt, Nancy M.
1984-01-01
The development of a micro-computer application for the on-line prediction of surgeon-specific operating room time using an IBM - PCXT is described. The reasons leading to the project, together with an assessment of the Condor 20 relational database management system as the basis for the application are discussed.
International Nuclear Information System (INIS)
Kasperson, R.E.; Renn, O.; Slovic, P.; Kasperson, J.X.; Emani, S.
1989-01-01
The risks associated with radioactive and other hazardous waste disposal may be expected to interact with societal processes to enlarge or attenuate the consequences of risks and risk events. This article summarizes a conceptual framework that depicts the social amplification of risk. Using a data base of 128 hazard events that have occurred largely over the past ten years, the authors examine the role of physical consequences, media coverage, and public perceptions of risk in generating social and economic impacts. The analysis concludes that social amplification processes substantially shape the nature and magnitude of those impacts but also that such social amplification appears to be systematically related to characteristics of the risks and risk events
Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W
2009-05-01
Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.
7 CFR 1755.397 - RUS performance specification for line concentrators.
2010-01-01
... part 51. Copies of these standards are available for inspection during normal business hours at RUS.... (ii) There should be provisions for such types of lines as ground start, loop start, regular... surface of the protectors. Means for easy identification of pairs shall be provided. (v) Protectors shall...
Zhao, Zhixun; Fan, Bin; Wu, Guohua; Yan, Xinmin; Li, Yingguo; Zhou, Xiaoli; Yue, Hua; Dai, Xueling; Zhu, Haixia; Tian, Bo; Li, Jian; Zhang, Qiang
2014-01-17
Capripox viruses are economically important pathogens in goat and sheep producing areas of the world, with specific focus on goat pox virus (GTPV), sheep pox virus (SPPV) and the Lumpy Skin Disease virus (LSDV). Clinically, sheep pox and goat pox have the same symptoms and cannot be distinguished serologically. This presents a real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Capripox outbreaks. A LAMP method was developed for the specific differential detection of GTPV and SPPV using three sets of LAMP primers designed on the basis of ITR sequences. Reactions were performed at 62°C for either 45 or 60 min, and specificity confirmed by successful differential detection of several GTPV and SPPV isolates. No cross reactivity with Orf virus, foot-and-mouth disease virus (FMDV), A. marginale Lushi isolate, Mycoplasma mycoides subsp. capri, Chlamydophila psittaci, Theileria ovis, T. luwenshuni, T. uilenbergi or Babesia sp was noted. RFLP-PCR analysis of 135 preserved epidemic materials revealed 48 samples infected with goat pox and 87 infected with sheep pox, with LAMP test results showing a positive detection for all samples. When utilizing GTPV and SPPV genomic DNA, the universal LAMP primers (GSPV) and GTPV LAMP primers displayed a 100% detection rate; while the SPPV LAMP detection rate was 98.8%, consistent with the laboratory tested results. In summary, the three sets of LAMP primers when combined provide an analytically robust method able to fully distinguish between GTPV and SPPV. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of GTPV and SPPV infections, with the potential to be standardized as a detection method for Capripox viruses in endemic areas.
Directory of Open Access Journals (Sweden)
Suslov V.M.
2005-12-01
Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.
Directory of Open Access Journals (Sweden)
Yamin Zhang
2017-12-01
Full Text Available Skin fibroblasts and tumor fibroblasts were extracted from a 64-year old male patient clinically diagnosed with laryngeal carcinoma. Control and tumor specific induced pluripotent stem cells were reprogrammed with 5 reprogramming factors, Klf-4, c-Myc, Oct-4, Sox-2, and Lin-28, using the messenger RNA reprogramming system. The transgene-free iPSC lines showed pluripotency, confirmed by immunofluorescence staining. The iPSC lines also showed normal karyotype, and could form embryoid bodies in vitro and differentiate into the 3 germ layers in vivo. This in vitro cellular model can be used to study the oncogenesis and pathogenesis of laryngeal carcinoma.
Cho, Min Seok; Park, Duck Hwan; Ahn, Tae-Young; Park, Dong Suk
2015-09-01
The aim of this study was to develop a SYBR Green-based real-time PCR assay for the rapid, specific, and sensitive detection of Acidovorax avenae subsp. citrulli, which causes bacterial fruit blotch (BFB), a serious disease of cucurbit plants. The molecular and serological methods currently available for the detection of this pathogen are insufficiently sensitive and specific. Thus, a novel SYBR Green-based real-time PCR assay targeting the YD-repeat protein gene of A. avenae subsp. citrulli was developed. The specificity of the primer set was evaluated using DNA purified from 6 isolates of A. avenae subsp. citrulli, 7 other Acidovorax species, and 22 of non-targeted strains, including pathogens and non-pathogens. The AC158F/R primer set amplified a single band of the expected size from genomic DNA obtained from the A. avenae subsp. citrulli strains but not from the genomic DNA of other Acidovorax species, including that of other bacterial genera. Using this assay, it was possible to detect at least one genomeequivalents of the cloned amplified target DNA using 5 × 10(0) fg/μl of purified genomic DNA per reaction or using a calibrated cell suspension, with 6.5 colony-forming units per reaction being employed. In addition, this assay is a highly sensitive and reliable method for identifying and quantifying the target pathogen in infected samples that does not require DNA extraction. Therefore, we suggest that this approach is suitable for the rapid and efficient diagnosis of A. avenae subsp. citrulli contaminations of seed lots and plants.
Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw
2015-08-01
Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Biomaterials in light amplification
Mysliwiec, Jaroslaw; Cyprych, Konrad; Sznitko, Lech; Miniewicz, Andrzej
2017-03-01
Biologically produced or inspired materials can serve as optical gain media, i.e. they can exhibit the phenomenon of light amplification. Some of these materials, under suitable dye-doping and optical pumping conditions, show lasing phenomena. The emerging branch of research focused on obtaining lasing action in highly disordered and highly light scattering materials, i.e. research on random lasing, is perfectly suited for biological materials. The use of biomaterials in light amplification has been extensively reported in the literature. In this review we attempt to report on progress in the development of biologically derived systems able to show the phenomena of light amplification and random lasing together with the contribution of our group to this field. The rich world of biopolymers modified with molecular aggregates and nanocrystals, and self-organized at the nanoscale, offers a multitude of possibilities for tailoring luminescent and light scattering properties that are not easily replicated in conventional organic or inorganic materials. Of particular importance and interest are light amplification and lasing, or random lasing studies in biological cells and tissues. In this review we will describe nucleic acids and their complexes employed as gain media due to their favorable optical properties and ease of manipulation. We will report on research conducted on various biomaterials showing structural analogy to nucleic acids such as fluorescent proteins, gelatins in which the first distributed feedback laser was realized, and also amyloids or silks, which, due to their dye-doped fiber-like structure, allow for light amplification. Other materials that were investigated in that respect include polysaccharides, like starch exhibiting favorable photostability in comparison to other biomaterials, and chitosan, which forms photonic crystals or cellulose. Light amplification and random lasing was not only observed in processed biomaterials but also in living
Directory of Open Access Journals (Sweden)
Badolo Athanase
2012-07-01
Full Text Available Abstract Background Malaria control relies heavily on treated bed nets and indoor residual spraying with pyrethroid insecticides. Unfortunately, the resistance to pyrethroid insecticides, mainly due to the kdr mutation, is spreading in the main malaria vector Anopheles gambiae s.l., decreasing the insecticides’ efficacy. To manage the insecticide resistance rapidly and flexibly, simple and effective tools for the early detection of resistant mosquitoes are needed. This study aimed to develop an allele-specific, loop-mediated, isothermal amplification (AS-LAMP method to detect the West African-type kdr mutation (kdr-w; L1014F in field-collected mosquitoes. Methods DNA fragments of the wild-type and the mutated kdr gene were used to select the primers and develop the method. The primers were designed with the mutation at the 5’ end of the backward inner primer (BIP. The AS-LAMP method was compared to the AS-PCR method using the genomic DNA of 120 field-collected mosquitoes. Results The AS-LAMP method could discriminate between the wild-type homozygote, the heterozygote, and the kdr-w homozygote within 75 min. The AS-LAMP method has the advantage of being faster and at least as sensitive and specific as the AS-PCR method. Conclusions The AS-LAMP method can be used to detect the kdr mutation for quick decision-making, even in less well-equipped laboratories.
Screening and Establishment of Human Lung Cancer Cell Lines with Organ-specific Metastasis Potential
Directory of Open Access Journals (Sweden)
Qinghua ZHOU
2014-03-01
Full Text Available Background and objective Cancer metastasis is not only the malignant marker and characteristics, but also the main cause of failure to cure and lose their life in the patients with lung cancer. Lung cancer metastasis has organ-specific characteristics. The most common sites of lung cancer metastasis are mediastinal lymph node, brain, bone, liver and adrenal gland. The aim of this study is to screen and establish lung cancer cell model with organ-specific metastasis potential with human high-metastatic large cell lung cancer cell line L9981 established by our laboratory previously, and to provide cell models for studying the mechanisms and signal regulation of organ-specific metastasis of lung cancer. Materials and methods The parent lung cancer cell line, L9981-Luc, was inoculated in the armpit of nude mice. The live animal imaging system, IVIS-200, was used to detect the lung cancer organ-specific metastasis every week. When the organ-specific metastasis were established, the nude mices bearing the lung cancer were sacrificed when they became moribund. Under sterile conditions, the organs (mediastinal lymph nodes, lung, spinal column and brain with lung cancer organ-specific metastasis were removed and the metastasized nodules were dissected free of connective tissue and blood clots, and rinsed twice with medium. The metastasized nodules were finely minced using sterile scalpel blades in medium, and the cells were seeded in tissue culture dishes. Then, the cells with organ-specific metastasis potential were reinoculated into the armpit of nude mice, respectively. This processes were repeated to establish the organ-specific metastatic sublines of L9981-Luc cell line more than 10 times. Finally, the organ-specific metastasis sublines of L9981-Luc were screened and established, which the four cell lines have the characteristics only metastasized to brian, lung, bone and mediastinal lymph node. Results A group of organ-specific metastasis cell
work specification for the construction of 33kv overhead lines across
African Journals Online (AJOL)
HOD
obtained using the standard mathematical equations and the specifications for Aluminium Conductor Steel Reinforce ... systems. The choice of conductor depends on the cost and efficiency. ... Support structure requirements, limitations.
Directory of Open Access Journals (Sweden)
Alessandra M. Welker
2016-02-01
Full Text Available Glioblastoma (GBM is a deadly brain cancer, for which few effective drug treatments are available. Several studies have used zebrafish models to study GBM, but a standardized approach to modeling GBM in zebrafish was lacking to date, preventing comparison of data across studies. Here, we describe a new, standardized orthotopic xenotransplant model of GBM in zebrafish. Dose-response survival assays were used to define the optimal number of cells for tumor formation. Techniques to measure tumor burden and cell spread within the brain over real time were optimized using mouse neural stem cells as control transplants. Applying this standardized approach, we transplanted two patient-derived GBM cell lines, serum-grown adherent cells and neurospheres, into the midbrain region of embryonic zebrafish and analyzed transplanted larvae over time. Progressive brain tumor growth and premature larval death were observed using both cell lines; however, fewer transplanted neurosphere cells were needed for tumor growth and lethality. Tumors were heterogeneous, containing both cells expressing stem cell markers and cells expressing markers of differentiation. A small proportion of transplanted neurosphere cells expressed glial fibrillary acidic protein (GFAP or vimentin, markers of more differentiated cells, but this number increased significantly during tumor growth, indicating that these cells undergo differentiation in vivo. By contrast, most serum-grown adherent cells expressed GFAP and vimentin at the earliest times examined post-transplant. Both cell types produced brain tumors that contained Sox2+ cells, indicative of tumor stem cells. Transplanted larvae were treated with currently used GBM therapeutics, temozolomide or bortezomib, and this resulted in a reduction in tumor volume in vivo and an increase in survival. The standardized model reported here facilitates robust and reproducible analysis of glioblastoma tumor cells in real time and provides a
Telomerase Repeated Amplification Protocol (TRAP).
Mender, Ilgen; Shay, Jerry W
2015-11-20
Telomeres are found at the end of eukaryotic linear chromosomes, and proteins that bind to telomeres protect DNA from being recognized as double-strand breaks thus preventing end-to-end fusions (Griffith et al. , 1999). However, due to the end replication problem and other factors such as oxidative damage, the limited life span of cultured cells (Hayflick limit) results in progressive shortening of these protective structures (Hayflick and Moorhead, 1961; Olovnikov, 1973). The ribonucleoprotein enzyme complex telomerase-consisting of a protein catalytic component hTERT and a functional RNA component hTR or hTERC - counteracts telomere shortening by adding telomeric repeats to the end of chromosomes in ~90% of primary human tumors and in some transiently proliferating stem-like cells (Shay and Wright, 1996; Shay and Wright, 2001). This results in continuous proliferation of cells which is a hallmark of cancer. Therefore, telomere biology has a central role in aging, cancer progression/metastasis as well as targeted cancer therapies. There are commonly used methods in telomere biology such as Telomere Restriction Fragment (TRF) (Mender and Shay, 2015b), Telomere Repeat Amplification Protocol (TRAP) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this detailed protocol we describe Telomere Repeat Amplification Protocol (TRAP). The TRAP assay is a popular method to determine telomerase activity in mammalian cells and tissue samples (Kim et al. , 1994). The TRAP assay includes three steps: extension, amplification, and detection of telomerase products. In the extension step, telomeric repeats are added to the telomerase substrate (which is actually a non telomeric oligonucleotide, TS) by telomerase. In the amplification step, the extension products are amplified by the polymerase chain reaction (PCR) using specific primers (TS upstream primer and ACX downstream primer) and in the detection step, the presence or absence of telomerase is
Multiscale image contrast amplification (MUSICA)
Vuylsteke, Pieter; Schoeters, Emile P.
1994-05-01
This article presents a novel approach to the problem of detail contrast enhancement, based on multiresolution representation of the original image. The image is decomposed into a weighted sum of smooth, localized, 2D basis functions at multiple scales. Each transform coefficient represents the amount of local detail at some specific scale and at a specific position in the image. Detail contrast is enhanced by non-linear amplification of the transform coefficients. An inverse transform is then applied to the modified coefficients. This yields a uniformly contrast- enhanced image without artefacts. The MUSICA-algorithm is being applied routinely to computed radiography images of chest, skull, spine, shoulder, pelvis, extremities, and abdomen examinations, with excellent acceptance. It is useful for a wide range of applications in the medical, graphical, and industrial area.
Previsani, N; Fontana, S; Hirt, B; Beard, P
1997-10-01
Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of MVMi and MVMp3 input virion DNA appeared in the nuclear fractions of EL4 cells 1 h after infection. However, double-stranded replicative-form (RF) DNA of the two viruses appeared at different times, at 10 h postinfection with MVMi and at 24 h postinfection with MVMp3. The amount of MVMp3 RF DNA detected at 24 h was very small because it was produced only in a tiny subset of the population of EL4 cells that proved to be permissive for MVMp3. Replication of double-stranded viral DNA in EL4 cells was measured after transfection of purified RF DNA, cloned viral DNA, and cloned viral DNA with a mutation preventing synthesis of the capsid proteins. In each of these cases, DNA replication was comparable for MVMi and MVMp3. Production of virus particles also appeared to be similar after transfection of the two types of RF DNA into EL4 cells. Conversion of incoming 32P-labeled single-stranded MVM DNA to 32P-labeled double-stranded RF DNA was detected only after RF DNA amplification, indicating that few molecules serve as templates for viral DNA amplification. We showed that extracts of EL4 cells contain a factor which can destabilize MVMi virions but not MVMp3 by testing the sensitivity of viral DNA to DNase and by CsCl gradient analyses of viral particles. We therefore conclude that the MVMp3 life cycle is arrested after the transport of virions to the nucleus and prior to the replication of RF DNA, most likely at the stage of viral decapsidation.
DNA amplification is rare in normal human cells
International Nuclear Information System (INIS)
Wright, J.A.; Watt, F.M.; Hudson, D.L.; Stark, G.R.; Smith, H.S.; Hancock, M.C.
1990-01-01
Three types of normal human cells were selected in tissue culture with three drugs without observing a single amplification event from a total of 5 x 10 8 cells. No drug-resistant colonies were observed when normal foreskin keratinocytes were selected with N-(phosphonacetyl)-L-aspartate or with hydroxyurea or when normal mammary epithelial cells were selected with methotrexate. Some slightly resistant colonies with limited potential for growth were obtained when normal diploid fibroblast cells derived from fetal lung were selected with methotrexate or hydroxyurea but careful copy-number analysis of the dihydrofolate reductase and ribonucleotide reductase genes revealed no evidence of amplification. The rarity of DNA amplification in normal human cells contrasts strongly with the situation in tumors and in established cell lines, where amplification of onogenes and of genes mediating drug resistance is frequent. The results suggest that tumors and cell lines have acquired the abnormal ability to amplify DNA with high frequency
Classification of human cancers based on DNA copy number amplification modeling
Directory of Open Access Journals (Sweden)
Knuutila Sakari
2008-05-01
Full Text Available Abstract Background DNA amplifications alter gene dosage in cancer genomes by multiplying the gene copy number. Amplifications are quintessential in a considerable number of advanced cancers of various anatomical locations. The aims of this study were to classify human cancers based on their amplification patterns, explore the biological and clinical fundamentals behind their amplification-pattern based classification, and understand the characteristics in human genomic architecture that associate with amplification mechanisms. Methods We applied a machine learning approach to model DNA copy number amplifications using a data set of binary amplification records at chromosome sub-band resolution from 4400 cases that represent 82 cancer types. Amplification data was fused with background data: clinical, histological and biological classifications, and cytogenetic annotations. Statistical hypothesis testing was used to mine associations between the data sets. Results Probabilistic clustering of each chromosome identified 111 amplification models and divided the cancer cases into clusters. The distribution of classification terms in the amplification-model based clustering of cancer cases revealed cancer classes that were associated with specific DNA copy number amplification models. Amplification patterns – finite or bounded descriptions of the ranges of the amplifications in the chromosome – were extracted from the clustered data and expressed according to the original cytogenetic nomenclature. This was achieved by maximal frequent itemset mining using the cluster-specific data sets. The boundaries of amplification patterns were shown to be enriched with fragile sites, telomeres, centromeres, and light chromosome bands. Conclusions Our results demonstrate that amplifications are non-random chromosomal changes and specifically selected in tumor tissue microenvironment. Furthermore, statistical evidence showed that specific chromosomal features
Specific sensitivity of small cell lung cancer cell lines to the snake venom toxin taipoxin
DEFF Research Database (Denmark)
Poulsen, Thomas T; Pedersen, Nina; Perin, Mark S
2005-01-01
and relatively specifically expressed in SCLC, consistent with the neuroendocrine features of this cancer. Normally, NPR is exclusively expressed in neurons, where it associates with the homologous proteins neuronal pentraxins 1 and 2 (NP1 and NP2) in complexes capable of binding the snake venom neurotoxin...
Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research
Tetteh, Paul W.; Kretzschmar, Kai; Begthel, Harry; Van Den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; Van Es, Johan H.; Offerhaus, G. Johan A; Clevers, Hans
2016-01-01
Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic
Directory of Open Access Journals (Sweden)
Víctor A. Solarte
2015-01-01
Full Text Available Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20–254, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90% in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.
Solarte, Víctor A; Rosas, Jaiver E; Rivera, Zuly J; Arango-Rodríguez, Martha L; García, Javier E; Vernot, Jean-Paul
2015-01-01
Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC) cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20-25)4, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90%) in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.
International Nuclear Information System (INIS)
Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.
2007-01-01
Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron
Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A
1987-01-01
Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula. PMID:3498590
Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A
1987-08-01
Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula.
Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research.
Tetteh, Paul W; Kretzschmar, Kai; Begthel, Harry; van den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; van Es, Johan H; Offerhaus, G Johan A; Clevers, Hans
2016-10-18
Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic anhydrase I (Car1) is a gene expressed uniquely in colonic epithelial cells. We generated a colon-specific inducible Car1 CreER knock-in (KI) mouse with broad Cre activity in epithelial cells of the proximal colon and cecum. Deletion of the tumor suppressor gene Apc using the Car1 CreER KI caused tumor formation in the cecum but did not yield adenomas in the proximal colon. Mutation of both Apc and Kras yielded microadenomas in both the cecum and the proximal colon, which progressed to macroadenomas with significant morbidity. Aggressive carcinomas with some invasion into lymph nodes developed upon combined induction of oncogenic mutations of Apc, Kras, p53, and Smad4 Importantly, no adenomas were observed in the small intestine. Additionally, we observed tumors from differentiated Car1-expressing cells with Apc/Kras mutations, suggesting that a top-down model of intestinal tumorigenesis can occur with multiple mutations. Our results establish the Car1 CreER KI as a valuable mouse model to study colon-specific tumorigenesis and metastasis as well as cancer-cell-of-origin questions.
Position-specific isotope analysis by on-line pyrolysis coupled to IRMS
Gilbert, A.; Suda, K.; Yamada, K.; Ueno, Y.; Yoshida, N.
2016-12-01
Position-specific isotopic analyses (PSIA) provide unique information regarding the sources, sinks and processes related to natural molecules. For instance, PSIA of short-chain hydrocarbons could lead to temperature of formation and maturity of natural gas reservoirs [1][2]. In the last decade, quantitative Nuclear Magnetic Resonance (NMR) specrometry has been used for PSIA of organic molecules such as glucose or n-alkanes [3][4]. However, due to its low sensitivity, application to low amount geochemical samples remains challenging. In 1997, Corso & Brenna proposed to adapt a pyrolysis furnace to an isotope ratio mass spectrometer, making it possible the thermal degradation of the target molecule and the subsequent analysis of the d13C values of the fragments formed [5]. Starting from fatty acid methyl esters they demonstrated the absence of rearrangement during pyrolytic degradation and could determine the d13C value of carboxyl C-atom position. We adapted the system for the full characterization of position-specific isotope composition of small molecules (ethanol, acetic acid, alanine, propane). Nanomole amount of sample can be analyzed with a precision on intramolecular d13C values of 1‰ or lower [2]. We recently analyzed abiotic and thermogenic propane samples both from the field and from lab simulations. PSIA of propane shows systematic differences of position-specific isotope composition between thermogenic and abiotic samples. While the former show 13C-depletion on the terminal C-atom position - consistent with thermal cracking kinetic models [6] - abiotic samples show little or no preference for terminal or central 13C-isotopomer. These results emphasize the potential of PSIA to trace the the processes associated with organic molecules production. [1] Piasecki et al. 2016 GCA 188, 58 [2] Gilbert et al. 2016 GCA 177, 205 [3] Gilbert et al. 2012 PNAS, 109, 18204 [4] Gilbert et al. 2013 Org. Geochem, 62, 56 [5] Corso & Brenna 1997 PNAS, 94, 1049 [6] Tang et
International Nuclear Information System (INIS)
Tucker, M.A.
1988-01-01
Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome
International Nuclear Information System (INIS)
Droms, K.; Sueoka, N.
1987-01-01
This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP
International Nuclear Information System (INIS)
Hou Shasha; Wang Hui; Feng Fang; Lin Ning; Fu Hongliang; Du Xueliang; Wu Jingchuan
2011-01-01
Objective: To investigate the changes of iodide uptake and the expression of thyroid-specific genes in poorly differentiated follicular thyroid carcinoma (FTC) cells after transfection of human TSH receptor (hTSHR) gene in vitro. Methods: The recombinant eukaryotic expression plasmid PcDNA3.1/hTSHR-cDNA was transformed into DH 5a bacterial for amplification and then the recombinant plasmid was extracted. The recombinant was identified with PCR amplifying, restriction enzyme digestion analysis and DNA sequencing. The recombinant plasmid pcDNA3.1/hTSHR was transfected into FTC-133 cell line by lipofectin method in vitro. Immunofluorescence, iodide uptake studies and real time-PCR were applied to detect target protein expression. Statistical analysis was performed with t-test using SPSS 13.0 software. Results: Kpn I and Xba I restriction enzyme digestion, PCR amplifying and DNA sequencing confirmed that pcDNA3.1/hTSHR was successfully constructed. After transfection of the recombinant plasmid pcDNA3.1/hTSHR-cDNA and the stimulation of hTSH, the tumor cells displayed the expression of hTSHR protein at cell surface and cytoplasm. The iodine uptake in pcDNA3.1/hTSHR transfected cells was 2.9 times higher than that of control(pcDNA3.1(+) transfected cells) group(t = 28.63, P<0.01). The expression of TSHR, NIS, TPO and Tg (mRNA levels) in pcDNA3.1/hTSHR transfected cells were also significantly elevated by 1.74 (t =5.959, P<0.01), 7.2 (t =3.807, P<0.05), 2.88 (t=4.769, P<0.01) and 2.67 times (t=6.388, P<0.01) respectively compared to those of the control group. Conclusion: The study demonstrates that iodide uptake may be reactivated by hTSHR receptor gene transfection in poorly differentiated FTC cell. (authors)
Chang Y.K.; Martinez-Bustos F.; Park T.S.; Kokini J.L.
1999-01-01
The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...
Directory of Open Access Journals (Sweden)
Pravas Ranjan Sahoo
2016-05-01
Full Text Available India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.
Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis
2016-05-01
India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.
Clinical application of somatosensory amplification in psychosomatic medicine
Directory of Open Access Journals (Sweden)
Nakao Mutsuhiro
2007-10-01
Full Text Available Abstract Many patients with somatoform disorders are frequently encountered in psychosomatic clinics as well as in primary care clinics. To assess such patients objectively, the concept of somatosensory amplification may be useful. Somatosensory amplification refers to the tendency to experience a somatic sensation as intense, noxious, and disturbing. It may have a role in a variety of medical conditions characterized by somatic symptoms that are disproportionate to demonstrable organ pathology. It may also explain some of the variability in somatic symptomatology found among different patients with the same serious medical disorder. It has been assessed with a self-report questionnaire, the Somatosensory Amplification Scale. This instrument was developed in a clinical setting in the U.S., and the reliability and validity of the Japanese and Turkish versions have been confirmed as well. Many studies have attempted to clarify the specific role of somatosensory amplification as a pathogenic mechanism in somatization. It has been reported that somatosensory amplification does not correlate with heightened sensitivity to bodily sensations and that emotional reactivity exerts its influence on somatization via a negatively biased reporting style. According to our recent electroencephalographic study, somatosensory amplification appears to reflect some aspects of long-latency cognitive processing rather than short-latency interoceptive sensitivity. The concept of somatosensory amplification can be useful as an indicator of somatization in the therapy of a broad range of disorders, from impaired self-awareness to various psychiatric disorders. It also provides useful information for choosing appropriate pharmacological or psychological therapy. While somatosensory amplification has a role in the presentation of somatic symptoms, it is closely associated with other factors, namely, anxiety, depression, and alexithymia that may also influence the same
Evidence of high-elevation amplification versus Arctic amplification.
Wang, Qixiang; Fan, Xiaohui; Wang, Mengben
2016-01-12
Elevation-dependent warming in high-elevation regions and Arctic amplification are of tremendous interest to many scientists who are engaged in studies in climate change. Here, using annual mean temperatures from 2781 global stations for the 1961-2010 period, we find that the warming for the world's high-elevation stations (>500 m above sea level) is clearly stronger than their low-elevation counterparts; and the high-elevation amplification consists of not only an altitudinal amplification but also a latitudinal amplification. The warming for the high-elevation stations is linearly proportional to the temperature lapse rates along altitudinal and latitudinal gradients, as a result of the functional shape of Stefan-Boltzmann law in both vertical and latitudinal directions. In contrast, neither altitudinal amplification nor latitudinal amplification is found within the Arctic region despite its greater warming than lower latitudes. Further analysis shows that the Arctic amplification is an integrated part of the latitudinal amplification trend for the low-elevation stations (≤500 m above sea level) across the entire low- to high-latitude Northern Hemisphere, also a result of the mathematical shape of Stefan-Boltzmann law but only in latitudinal direction.
Efficient Audio Power Amplification - Challenges
DEFF Research Database (Denmark)
Andersen, Michael Andreas E.
2005-01-01
For more than a decade efficient audio power amplification has evolved and today switch-mode audio power amplification in various forms are the state-of-the-art. The technical steps that lead to this evolution are described and in addition many of the challenges still to be faced and where...
Efficient audio power amplification - challenges
Energy Technology Data Exchange (ETDEWEB)
Andersen, Michael A.E.
2005-07-01
For more than a decade efficient audio power amplification has evolved and today switch-mode audio power amplification in various forms are the state-of-the-art. The technical steps that lead to this evolution are described and in addition many of the challenges still to be faced and where extensive research and development are needed is covered. (au)
Zhang, Hongwei; Feng, Shaolong; Zhao, Yulong; Wang, Shuo; Lu, Xiaonan
2015-12-02
Yersinia enterocolitica (Y. enterocolitica) is frequently isolated from a wide variety of foods and can cause human yersiniosis. Biochemical and culture-based assays are common detection methods, but require a long incubation time and easily misidentify Y. enterocolitica as other non-pathogenic Yersinia species. Alternatively, cross-priming amplification (CPA) under isothermal conditions combined with immunoblotting analysis enables a more sensitive detection in a relatively short time period. A set of specific displacement primers, cross primers and testing primers was designed on the basis of six specific sequences in Y. enterocolitica 16S-23S rDNA internal transcribed spacer. Under isothermal condition, amplification and hybridization were conducted simultaneously at 63°C for 60 min. The specificity of CPA was tested for 96 different bacterial strains and 165 commercial milk powder samples. Two red lines were developed on BioHelix Express strip for all of the Y. enterocolitica strains, and one red line was shown for non-Y. enterocolitica strains. The limit of detection of CPA was 10(0)fg for genomic DNA (1000 times more sensitive than PCR assay), 10(1) CFU/ml for pure bacterial culture, and 10(0) CFU per 100 g milk powder with pre-enrichment at 37°C for 24 h. CPA combined with immunoblotting analysis can achieve highly specific and sensitive detection of Y. enterocolitica in milk powder in 90 min after pre-enrichment. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kalejs, Martins; Ivanov, Andrey; Plakhins, Gregory; Cragg, Mark S; Emzinsh, Dzintars; Illidge, Timothy M; Erenpreisa, Jekaterina
2006-01-01
We have previously reported that p53 mutated radioresistant lymphoma cell lines undergo mitotic catastrophe after irradiation, resulting in metaphase arrest and the generation of endopolyploid cells. A proportion of these endopolyploid cells then undergo a process of de-polyploidisation, stages of which are partially reminiscent of meiotic prophase. Furthermore, expression of meiosis-specific proteins of the cancer/testis antigens group of genes has previously been reported in tumours. We therefore investigated whether expression of meiosis-specific genes was associated with the polyploidy response in our tumour model. Three lymphoma cell lines, Namalwa, WI-L2-NS and TK6, of varying p53 status were exposed to a single 10 Gy dose of gamma radiation and their responses assessed over an extended time course. DNA flow cytometry and mitotic counts were used to assess the kinetics and extent of polyploidisation and mitotic progression. Expression of meiotic genes was analysed using RT-PCR and western blotting. In addition, localisation of the meiotic cohesin REC8 and its relation to centromeres was analysed by immunofluorescence. The principal meiotic regulator MOS was found to be significantly post-transcriptionally up-regulated after irradiation in p53 mutated but not p53 wild-type lymphoma cells. The maximum expression of MOS coincided with the maximal fraction of metaphase arrested cells and was directly proportional to both the extent of the arrest and the number of endopolyploid cells that subsequently emerged. The meiotic cohesin REC8 was also found to be up-regulated after irradiation, linking sister chromatid centromeres in the metaphase-arrested and subsequent giant cells. Finally, RT-PCR revealed expression of the meiosis-prophase genes, DMC1, STAG3, SYCP3 and SYCP1. We conclude that multiple meiotic genes are aberrantly activated during mitotic catastrophe in p53 mutated lymphoma cells after irradiation. Furthermore, we suggest that the coordinated expression
DEFF Research Database (Denmark)
Haase, Rikke N; Megnekou, Rosette; Lundquist, Maja
2006-01-01
Placenta-sequestering Plasmodium falciparum parasites causing pregnancy-associated malaria express pregnancy-specific variant surface antigens (VSA(PAM)). We report here that VSA(PAM)-expressing patient isolates adhere strongly to the choriocarcinoma cell line BeWo and that the BeWo line can...... be used to efficiently select for VSA(PAM) expression in vitro....
International Nuclear Information System (INIS)
Sadikovic, Bekim; Haines, Thomas R; Butcher, Darci T; Rodenhiser, David I
2004-01-01
Compromised patterns of gene expression result in genomic instability, altered patterns of gene expression and tumour formation. Specifically, aberrant DNA hypermethylation in gene promoter regions leads to gene silencing, whereas global hypomethylation events can result in chromosomal instability and oncogene activation. Potential links exist between environmental agents and DNA methylation, but the destabilizing effects of environmental exposures on the DNA methylation machinery are not understood within the context of breast cancer aetiology. We assessed genome-wide changes in methylation patterns using a unique methylation profiling technique called amplification of intermethylated sites (AIMS). This method generates easily readable fingerprints that represent the investigated cell line's methylation profile, based on the differential cleavage of DNA with methylation-specific isoschisomeric restriction endonucleases. We validated this approach by demonstrating both unique and reoccurring sites of genomic hypomethylation in four breast carcinoma cell lines treated with the cytosine analogue 5-azacytidine. Comparison of treated with control samples revealed individual bands that exhibited methylation changes, and these bands were excized and cloned, and the precise genomic location individually identified. In most cases, these regions of hypomethylation coincided with susceptible target regions previously associated with chromosome breakage, rearrangement and gene amplification. Similarly, we observed that acute benzopyrene exposure is associated with altered methylation patterns in these cell lines. These results reinforce the link between environmental exposures, DNA methylation and breast cancer, and support a role for AIMS as a rapid, affordable screening method to identify environmentally induced DNA methylation changes that occur in tumourigenesis
Reid, Michael S; Le, X Chris; Zhang, Hongquan
2018-04-27
Isothermal exponential amplification techniques, such as strand-displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), helicase-dependent amplification (HDA), and recombinase polymerase amplification (RPA), have great potential for on-site, point-of-care, and in-situ assay applications. These amplification techniques eliminate the need for temperature cycling required for polymerase chain reaction (PCR) while achieving comparable amplification yield. We highlight here recent advances in exponential amplification reaction (EXPAR) for the detection of nucleic acids, proteins, enzyme activities, cells, and metal ions. We discuss design strategies, enzyme reactions, detection techniques, and key features. Incorporation of fluorescence, colorimetric, chemiluminescence, Raman, and electrochemical approaches enables highly sensitive detection of a variety of targets. Remaining issues, such as undesirable background amplification resulting from non-specific template interactions, must be addressed to further improve isothermal and exponential amplification techniques. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.
2007-01-01
The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168
On-line analysis of biosignals for the automation of total and specific sleep deprivation in the rat
Directory of Open Access Journals (Sweden)
ENNIO A VIVALDI
2008-12-01
Full Text Available A computer-based system that automates sleep studies, including sleep deprivation paradigms, is described. The system allows for total or REM-specific sleep deprivation and is based on a reliable, fast-responding, on-line state detection algorithm linked to a dependable intervention device. Behavioral state detection is achieved by dimensión reduction of short-term EEG power spectrum. Interventions are made by serial outputs to servomotors that move a cage with different patterns and variable intensity. The system can adapt itself to individual characteristics and to changes in recording conditions. Customized protocols can be designed by defining the states or stages to be deprived, including scheduling temporal patterns. A detailed analysis of the relevant signáis during and after deprivation is readily available. Data is presented from two experimental designs in rats. One consisted of specific REM-sleep short-term deprivation and the other of 10-hour total sleep deprivation. An outline of conceptual and practical considerations involved in the automation of laboratory set-ups oriented to biosignal analysis is provided. Careful monitoring of sleep EEG variables during sleep deprivation suggests peculiarities of brain functioning in that condition. A corollary is that sleep deprivation should not be considered to be merely a forced prolonged wakefulness.
Energy Technology Data Exchange (ETDEWEB)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))
1988-09-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.
International Nuclear Information System (INIS)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.
1988-01-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression
Melting of the flux line lattice observed by specific heat experiments in YBa2Cu3O7-δ
International Nuclear Information System (INIS)
Roulin, M.; Junod, A.; Erb, A.; Walker, E.
1996-01-01
High resolution adiabatic specific heat experiments on YBa 2 Cu 3 O 7-δ (0≤δ≤0.05) are performed in magnetic fields from 0 to 14 T (B parallel c and B perpendicular c). In a 0.3 gram, twinned crystal with strong pinning, a step is consistently observed at the melting temperature T m of the vortex solid up to a critical point that depends on δ. The field B m and step temperature T m obey the relation B m =B m0 (δ)(1-T m /T c ) ∼4/3 . The anisotropy of B m and that of the upper critical field B c2 are found to be equal. Alternatively, in a 18 mg, twinned crystal of high purity with low pinning, first-order-like specific heat peaks are observed on the melting line from 8 to 14 T. The entropy under these peaks is ∼0.5 k B /vortex/bilayer. These characteristic features are attributed to the melting of a vortex glass in the former case and that of a vortex lattice in the latter case
Sambhara, S R; Upadhya, A G; Miller, R G
1990-06-12
We describe a microculture system for the generation of CTL and T helper cells against peptides. Tryptic digest and cyanogen bromide fragments of chicken ovalbumin and synthetic peptides of ovalbumin (323-339) and influenza virus (NP 365-380) were used to generate CTL and T helper lines from unprimed T cells. These lines were both peptide-specific and MHC-restricted. The relative ease of generating peptide-specific, MHC-restricted CTL and helper T cell lines with as few as 10(6) unprimed lymphocytes can be an efficient method of detecting potential immunogenic determinants of an antigen.
RNA amplification for successful gene profiling analysis
Directory of Open Access Journals (Sweden)
Wang Ena
2005-07-01
Full Text Available Abstract The study of clinical samples is often limited by the amount of material available to study. While proteins cannot be multiplied in their natural form, DNA and RNA can be amplified from small specimens and used for high-throughput analyses. Therefore, genetic studies offer the best opportunity to screen for novel insights of human pathology when little material is available. Precise estimates of DNA copy numbers in a given specimen are necessary. However, most studies investigate static variables such as the genetic background of patients or mutations within pathological specimens without a need to assess proportionality of expression among different genes throughout the genome. Comparative genomic hybridization of DNA samples represents a crude exception to this rule since genomic amplification or deletion is compared among different specimens directly. For gene expression analysis, however, it is critical to accurately estimate the proportional expression of distinct RNA transcripts since such proportions directly govern cell function by modulating protein expression. Furthermore, comparative estimates of relative RNA expression at different time points portray the response of cells to environmental stimuli, indirectly informing about broader biological events affecting a particular tissue in physiological or pathological conditions. This cognitive reaction of cells is similar to the detection of electroencephalographic patterns which inform about the status of the brain in response to external stimuli. As our need to understand human pathophysiology at the global level increases, the development and refinement of technologies for high fidelity messenger RNA amplification have become the focus of increasing interest during the past decade. The need to increase the abundance of RNA has been met not only for gene specific amplification, but, most importantly for global transcriptome wide, unbiased amplification. Now gene-specific
Realization of the conceptual ideal for x-ray amplification
Energy Technology Data Exchange (ETDEWEB)
Borisov, Alex B; Racz, Ervin; Zhang Ping; McCorkindale, John C; Khan, Shahab F; Poopalasingam, Sankar; Zhao Ji; Rhodes, Charles K [Laboratory for X-Ray Microimaging and Bioinformatics, Department of Physics, University of Illinois at Chicago, Chicago, IL 60607-7059 (United States)
2008-05-28
The Xe(L) system is an amplifier with fundamentally different dynamic characteristics from all previously developed laser amplifiers; it represents the conceptual ideal through full utilization of the Kramers-Kronig relations that fundamentally couple the dispersive and absorptive components. The dispersive response of the system, through optimal governance of the power compression, rules the amplification and establishes a minimum gain for the amplifier. Accordingly, the amplification requires a minimum value of the dispersion to be surpassed; the corresponding gain follows automatically. As a leading consequence, since this minimum gain is sufficiently high, the key experimental observation is the uniform presence of saturated amplification signaled by strong spectral hole burning on all transitions exhibiting amplification, including double-vacancy lines. This cardinal signature demonstrates that the amplification is legislated by the saturated gain g{sub s}, not the corresponding small signal value g{sub 0}. The chief outcome is that explosive dispersion yields perforce explosive amplification and the efficient generation of maximally bright coherent power.
Targeting MET Amplification as a New Oncogenic Driver
Energy Technology Data Exchange (ETDEWEB)
Kawakami, Hisato [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan); Okamoto, Isamu, E-mail: okamotoi@kokyu.med.kyushu-u.ac.jp [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan); Center for Clinical and Translational Research, Kyushu University Hospital, 3-1-1 Maidashi, Higashiku, Fukuoka 812-8582 (Japan); Okamoto, Wataru [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan); Division of Transrlational Research, Exploratory Oncology Research & Clinical Trial Center, National Cancer Center, 6-5-1 Kashiwanoha, Kashiwa, Chiba 277-8577 (Japan); Tanizaki, Junko [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan); Lowe Center for Thoracic Oncology, Dana-Farber Cancer Institute, HIM223, 450 Brookline Avenue, Boston, MA 02215 (United States); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan); Nishio, Kazuto [Department of Genome Biology, Kinki University Faculty of Medicine, 377-2 Ohno-higashi, Osaka-Sayama, Osaka 589-8511 (Japan)
2014-07-22
Certain genetically defined cancers are dependent on a single overactive oncogene for their proliferation and survival, a phenomenon known as “oncogene addiction”. A new generation of drugs that selectively target such “driver oncogenes” manifests a clinical efficacy greater than that of conventional chemotherapy in appropriate genetically defined patients. MET is a proto-oncogene that encodes a receptor tyrosine kinase, and aberrant activation of MET signaling occurs in a subset of advanced cancers as result of various genetic alterations including gene amplification, polysomy, and gene mutation. Our preclinical studies have shown that inhibition of MET signaling either with the small-molecule MET inhibitor crizotinib or by RNA interference targeted to MET mRNA resulted in marked antitumor effects in cancer cell lines with MET amplification both in vitro and in vivo. Furthermore, patients with non-small cell lung cancer or gastric cancer positive for MET amplification have shown a pronounced clinical response to crizotinib. Accumulating preclinical and clinical evidence thus suggests that MET amplification is an “oncogenic driver” and therefore a valid target for treatment. However, the prevalence of MET amplification has not been fully determined, possibly in part because of the difficulty in evaluating gene amplification. In this review, we provide a rationale for targeting this genetic alteration in cancer therapy.
Targeting MET Amplification as a New Oncogenic Driver
International Nuclear Information System (INIS)
Kawakami, Hisato; Okamoto, Isamu; Okamoto, Wataru; Tanizaki, Junko; Nakagawa, Kazuhiko; Nishio, Kazuto
2014-01-01
Certain genetically defined cancers are dependent on a single overactive oncogene for their proliferation and survival, a phenomenon known as “oncogene addiction”. A new generation of drugs that selectively target such “driver oncogenes” manifests a clinical efficacy greater than that of conventional chemotherapy in appropriate genetically defined patients. MET is a proto-oncogene that encodes a receptor tyrosine kinase, and aberrant activation of MET signaling occurs in a subset of advanced cancers as result of various genetic alterations including gene amplification, polysomy, and gene mutation. Our preclinical studies have shown that inhibition of MET signaling either with the small-molecule MET inhibitor crizotinib or by RNA interference targeted to MET mRNA resulted in marked antitumor effects in cancer cell lines with MET amplification both in vitro and in vivo. Furthermore, patients with non-small cell lung cancer or gastric cancer positive for MET amplification have shown a pronounced clinical response to crizotinib. Accumulating preclinical and clinical evidence thus suggests that MET amplification is an “oncogenic driver” and therefore a valid target for treatment. However, the prevalence of MET amplification has not been fully determined, possibly in part because of the difficulty in evaluating gene amplification. In this review, we provide a rationale for targeting this genetic alteration in cancer therapy
International Nuclear Information System (INIS)
Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.
1984-01-01
Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)
Directory of Open Access Journals (Sweden)
Fatemeh Moradipour
2017-10-01
Full Text Available Introduction: Cucumber (Cucumis sativus L. is one of the most widely cultivated vegetables. Plant length is a quantitative trait is controlled by many genes. These traits are difficult to study due to the complex nature of their inheritance. The combining ability estimation is useful in determining the breeding value of cucumber lines by suggesting the appropriate use in a breeding program. In studying combining ability, the most commonly utilized experimental approach is the diallel design. General combining ability is a measure of additive genetic action; and specific combining ability (SCA is deviation from additivity. General combining ability is a main effect and SCA is an interaction. The aim is to determine the breeding value of the cross. Heterosis has been utilized to exploit dominance variance through production of hybrids. There are reports on positive and negative heterosis in cucumber however, there are differences between reports. This research was conducted to estimate general and specific combining ability and heterosis in cucumber inbred lines and hybrids to produce hybrids with high yield and quality. Material and Methods: In the spring of 2014, the seven parental lines and their 21 F1 hybrid were planted at the University of Guilan, in loamy sand field. Three replications were arranged in a randomized complete block design. The sandy loam soil was prepared by plowing and disking and formed into raised beds by plowed and harrow prior to plant establishment. Rows were on 1 m centers and plants were about 25 cm apart in the row. Prior to planting 150 kg·ha-1 of nitrogen from urea and 100 kg·ha-1 of phosphorous from triple superphosphate and 80 kg·ha-1 of potassium sulfate was applied. Side dressing with the same amount of nitrogen and phosphorus occurred at 50% flowering stage. Irrigation with 250 m3·ha-1, three times weekly, was begun at plant first flowering. In each replication, 12 individuals of each line or hybrid were
Xu, Jingguo; Guo, Jia; Maina, Sarah Wanjiku; Yang, Yumeng; Hu, Yimin; Li, Xuanxuan; Qiu, Jiarong; Xin, Zhihong
2018-05-15
An ultra-sensitive aptamer-based biosensor for the detection of staphylococcus aureus was established by adopting the nicking enzyme amplification reaction (NEAR) and the rolling circle amplification (RCA) technologies. Aptamer-probe (AP), containing an aptamer and a probe sequence, was developed to act as the recognition unit of the biosensor, which was specifically bound to S. aureus. The probe was released from AP and initiated into the subsequent DNA amplification reactions where S. aureus was present, converting the detection of S. aureus to the investigation of probe oligonucleotide. The RCA amplification products contained a G-quadruplex motif and formed a three dimensional structure in presence of hemin. The G4/hemin complex showed horseradish peroxidase (HRP)-mimic activity and catalyzed the chemiluminescence reaction of luminol mediated by H 2 O 2 . The results showed that the established biosensor could detect S. aureus specifically with a good linear correlation at 5-10 4 CFU/mL. The signal values based on NEAR-RCA two-step cycle were boosted acutely, much higher than that relied on one-cycle magnification. The limit of detection (LoD) was determined to be as low as 5 CFU/mL. The established aptasensor exhibited a good discrimination of living against dead S. aureus, and can be applied to detect S. aureus in the food industry. Copyright © 2018 Elsevier Inc. All rights reserved.
Digital Microfluidics for Nucleic Acid Amplification
Directory of Open Access Journals (Sweden)
Beatriz Coelho
2017-06-01
Full Text Available Digital Microfluidics (DMF has emerged as a disruptive methodology for the control and manipulation of low volume droplets. In DMF, each droplet acts as a single reactor, which allows for extensive multiparallelization of biological and chemical reactions at a much smaller scale. DMF devices open entirely new and promising pathways for multiplex analysis and reaction occurring in a miniaturized format, thus allowing for healthcare decentralization from major laboratories to point-of-care with accurate, robust and inexpensive molecular diagnostics. Here, we shall focus on DMF platforms specifically designed for nucleic acid amplification, which is key for molecular diagnostics of several diseases and conditions, from pathogen identification to cancer mutations detection. Particular attention will be given to the device architecture, materials and nucleic acid amplification applications in validated settings.
DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification.
Liu, Meng; Yin, Qingxin; McConnell, Erin M; Chang, Yangyang; Brennan, John D; Li, Yingfu
2018-03-26
Technologies capable of linking DNA amplification to molecular recognition are very desirable for ultrasensitive biosensing applications. We have developed a simple but powerful isothermal DNA amplification method, termed DNAzyme feedback amplification (DFA), that is capable of relaying molecular recognition to exponential DNA amplification. The method incorporates both an RNA-cleaving DNAzyme (RCD) and rolling circle amplification (RCA) carried out by a special DNA polymerase using a circular DNA template. DFA begins with a stimulus-dependent RCA reaction, producing tandemly linked RCDs in long-chain DNA products. These RCDs cleave an RNA-containing DNA sequence to form additional primers that hybridize to the circular DNA molecule, giving rise to DNA assemblies that act as the new inputs for RCA. The RCA reaction and the cleavage event keep on feeding each other autonomously, resulting in exponential growth of repetitive DNA sequences that can be easily detected. This method can be used for the detection of both nucleic acid based targets and non-nucleic acid analytes. In this article, we discuss the conceptual framework of the feedback amplification approach, the essential features of this method as well as remaining challenges and possible solutions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Next generation Chirped Pulse Amplification
Energy Technology Data Exchange (ETDEWEB)
Nees, J; Biswal, S; Mourou, G [Univ. Michigan, Center for Ultrafast Optical Science, Ann Arbor, MI (United States); Nishimura, Akihiko; Takuma, Hiroshi
1998-03-01
The limiting factors of Chirped Pulse Amplification (CPA) are discussed and experimental results of CPA in Yb:glass regenerative amplifier are given. Scaling of Yb:glass to the petawatt level is briefly discussed. (author)
Migliarini, Sara; Pacini, Giulia; Pasqualetti, Massimo
2015-01-01
Serotonin has been gaining increasing attention during the last two decades due to the dual function of this monoamine as key regulator during critical developmental events and as neurotransmitter. Importantly, unbalanced serotonergic levels during critical temporal phases might contribute to the onset of neuropsychiatric disorders, such as schizophrenia and autism. Despite increasing evidences from both animal models and human genetic studies have underpinned the importance of serotonin homeostasis maintenance during central nervous system development and adulthood, the precise role of this molecule in time-specific activities is only beginning to be elucidated. Serotonin synthesis is a 2-step process, the first step of which is mediated by the rate-limiting activity of Tph enzymes, belonging to the family of aromatic amino acid hydroxylases and existing in two isoforms, Tph1 and Tph2, responsible for the production of peripheral and brain serotonin, respectively. In the present study, we generated and validated a conditional knockout mouse line, Tph2 flox/flox, in which brain serotonin can be effectively ablated with time specificity. We demonstrated that the Cre-mediated excision of the third exon of Tph2 gene results in the production of a Tph2 null allele in which we observed the near-complete loss of brain serotonin, as well as the growth defects and perinatal lethality observed in serotonin conventional knockouts. We also revealed that in mice harbouring the Tph2 null allele, but not in wild-types, two distinct Tph2 mRNA isoforms are present, namely Tph2Δ3 and Tph2Δ3Δ4, with the latter showing an in-frame deletion of amino acids 84–178 and coding a protein that could potentially retain non-negligible enzymatic activity. As we could not detect Tph1 expression in the raphe, we made the hypothesis that the Tph2Δ3Δ4 isoform can be at the origin of the residual, sub-threshold amount of serotonin detected in the brain of Tph2 null/null mice. Finally, we set
Matsuyama, Rima; Tsutsui, Tomomi; Lee, Kyoung Ho; Onitsuka, Masayoshi; Omasa, Takeshi
2015-12-01
The dihydrofolate reductase gene amplification system is widely used in Chinese hamster ovary (CHO) cells for the industrial production of therapeutic proteins. To enhance the efficiency of conventional gene amplification systems, we previously presented a novel method using cell-cycle checkpoint engineering. Here, we constructed high-producing and stable cells by the conditional expression of mutant cell division cycle 25 homolog B (CDC25B) using the Cre-loxP system. A bispecific antibody-producing CHO DG44-derived cell line was transfected with floxed mutant CDC25B. After inducing gene amplification in the presence of 250 nM methotrexate, mutant CDC25B sequence was removed by Cre recombinase protein expression. Overexpression of the floxed mutant CDC25B significantly enhanced the efficiency of transgene amplification and productivity. Moreover, the specific production rate of the isolated clone CHO Cre-1 and Cre-2 were approximately 11-fold and 15-fold higher than that of mock-transfected clone CHO Mock-S. Chromosomal aneuploidy was increased by mutant CDC25B overexpression, but Cre-1 and Cre-2 did not show any changes in chromosome number during long-term cultivation, as is the case with CHO Mock-S. Our results suggest that high-producing and stable cells can be constructed by conditionally controlling a cell-cycle checkpoint integrated in conventional gene amplification systems. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Galton, J.E.; Xue, B.; Hochwald, G.M.; Thorbecke, G.J.
1982-01-01
Transplantable 7,12-dimethylbenz[a]anthracene-induced SC chicken fibrosarcoma (CHCT-NYU) lines were studied for their ability to grow in internal organs after iv injection (artificial metastases) into 1- to 3-week-old chickens. Some tumor lines were recently derived, whereas others were studied after many serial subcutaneous transplantations. Artificial metastases were seen in the stomach, pancreas, lungs, heart, and muscle, and occasionally in the kidneys and liver. Agammaglobulinemic recipients showed more extensive organ involvement than normal recipients of the same age. Whole-body ν-irradiation enhanced the incidence of artificial metastases, particularly in lungs. Antibody from the serum of a primary tumor-bearing host reduced the growth of the corresponding tumor in many organs. The metastatic pattern of line CHCT-NYU4 was a relatively stable property. However, intravenous transplantation of tumor cells from line CHCT-NYU4 taken from the liver, lungs, and pancreas of a single recipient established sublines with changes in organ specificity. After a few such serial transplants of liver-derived tumor, a line was derived that grew virtually in the liver alone. A subline with preference for growth in lungs was also obtained, but its ability to grow in the pancreas persisted. A pancreas-derived tumor line also grew in the liver and lungs. Subcutaneous transplants of tissue fragments of the lung-derived tumor line caused the appearance of spontaneous metastases in lungs. The incidence of spontaneous metastases with the lung-derived line was much greater than that with the liver-derived line or with the original CHCT-NYU4 line
Parametric Amplification of Gravitational Fluctuations during Reheating
International Nuclear Information System (INIS)
Finelli, F.; Brandenberger, R.; Finelli, F.
1999-01-01
Cosmological perturbations can undergo amplification by parametric resonance during preheating even on scales larger than the Hubble radius, without violating causality. A unified description of gravitational and matter fluctuations is crucial to determine the strength of the instability. To extract specific signatures of the oscillating inflaton field during reheating, it is essential to focus on a variable describing metric fluctuations which is constant in the standard analyses of inflation. For a massive inflaton without self-coupling, we find no additional growth of superhorizon modes during reheating beyond the usual predictions. For a massless self-coupled inflaton, there is a sub-Hubble scale resonance. copyright 1999 The American Physical Society
A large ungated TPC with GEM amplification
Berger, M.; Ball, M.; Fabbietti, L.; Ketzer, B.; Arora, R.; Beck, R.; Böhmer, F. V.; Chen, J.-C.; Cusanno, F.; Dørheim, S.; García, F.; Hehner, J.; Herrmann, N.; Höppner, C.; Kaiser, D.; Kis̆, M.; Kleipa, V.; Konorov, I.; Kunkel, J.; Kurz, N.; Leifels, Y.; Müllner, P.; Münzer, R.; Neubert, S.; Rauch, J.; Schmidt, C. J.; Schmitz, R.; Soyk, D.; Vandenbroucke, M.; Voss, B.; Walther, D.; Zmeskal, J.
2017-10-01
A Time Projection Chamber (TPC) is an ideal device for the detection of charged particle tracks in a large volume covering a solid angle of almost 4 π. The high density of hits on a given particle track facilitates the task of pattern recognition in a high-occupancy environment and in addition provides particle identification by measuring the specific energy loss for each track. For these reasons, TPCs with Multiwire Proportional Chamber (MWPC) amplification have been and are widely used in experiments recording heavy-ion collisions. A significant drawback, however, is the large dead time of the order of 1 ms per event generated by the use of a gating grid, which is mandatory to prevent ions created in the amplification region from drifting back into the drift volume, where they would severely distort the drift path of subsequent tracks. For experiments with higher event rates this concept of a conventional TPC operating with a triggered gating grid can therefore not be applied without a significant loss of data. A continuous readout of the signals is the more appropriate way of operation. This, however, constitutes a change of paradigm with considerable challenges to be met concerning the amplification region, the design and bandwidth of the readout electronics, and the data handling. A mandatory prerequisite for such an operation is a sufficiently good suppression of the ion backflow from the avalanche region, which otherwise limits the tracking and particle identification capabilities of such a detector. Gas Electron Multipliers (GEM) are a promising candidate to combine excellent spatial resolution with an intrinsic suppression of ions. In this paper we describe the design, construction and the commissioning of a large TPC with GEM amplification and without gating grid (GEM-TPC). The design requirements have driven innovations in the construction of a light-weight field-cage, a supporting media flange, the GEM amplification and the readout system, which are
Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei
2018-07-01
Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.
International Nuclear Information System (INIS)
Gouget, B.; Sergeant, C.; Benard, J.; Llabador, Y.; Simonoff, M.
2000-01-01
N-myc oncogene amplification is a powerful predictor of aggressive behavior of neuroblastoma (NB), the most common solid tumor of the early childhood. Since N-myc overexpression - subsequent to amplification - determines a phenotype of invasiveness and metastatic spreading, it is assumed that N-myc amplified neuroblasts synthesize zinc metalloenzymes leading to tumor invasion and formation of metastases. In order to test a possible relation between N-myc oncogene amplification and trace metal contents in human NB cells, Fe, Cu and Zn concentrations have been measured by nuclear microprobe analysis in three human neuroblastoma cell lines with various degrees of N-myc amplification. Elemental determinations show uniform distribution of trace metals within the cells, but variations of intracellular trace metal concentrations with respect to the degree of N-myc amplification are highly dependent on the nature of the element. Zinc concentration is higher in both N-myc amplified cell lines (IMR-32 and IGR-N-91) than in the non-amplified cells (SK-N-SH). In contrast, intracellular iron content is particularly low in N-myc amplified cell lines. Moreover, copper concentrations showed an increase with the degree of N-myc amplification. These results indicate that a relationship exists between intracellular trace metals and N-myc oncogene amplification. They further suggest that trace metals very probably play a determinant role in mechanisms of the neuroblastoma invasiveness
Genome position and gene amplification
Czech Academy of Sciences Publication Activity Database
Jirsová, Pavla; Snijders, A.M.; Kwek, S.; Roydasgupta, R.; Fridlyand, J.; Tokuyasu, T.; Pinkel, D.; Albertson, D. G.
2007-01-01
Roč. 8, č. 6 (2007), r120 ISSN 1474-760X Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : gene amplification * array comparative genomic hybridization * oncogene Subject RIV: BO - Biophysics Impact factor: 6.589, year: 2007
DEFF Research Database (Denmark)
Odum, Niels; Ledbetter, J A; Martin, P
1991-01-01
Major histocompatibility complex (MHC) class II molecules have been implicated in cell adhesion in two ways. In addition to the well-established role of class II antigens in low-affinity adhesion provided by interactions between class II and CD4, recent data indicated that class II may also induce...... adhesion between T and B cells by activating the CD18/CD11a (LFA-1) adhesion pathway. Here we report that monoclonal antibodies (mAb) against HLA-DR (L243, p4.1, HB10a, VI15) and certain broad class II reacting mAb (TU35, TU39), but not anti-DQ (TU22, Leu-10) mAb, induced homotypic aggregation of human...... class II-positive monocytic (I937) and T leukemic (HUT78) tumor cell lines and Epstein-Barr virus (EBV) transformed B-lymphoid cell lines (EBV-LCL). Class II-negative cell lines (U-937 and the EBV-LCL mutant line 616) were not induced to aggregate. An HLA-G-transfected EBV-LCL, 221-AGN...
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the installation of the SN-635 transfer line for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-635 transfer line and the tie in of SN-633 to the AY-02A pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
Mumma, M. J.; Buhl, D.; Chin, G.; Deming, D.; Espenak, F.; Kostiuk, T.; Zipoy, D.
1981-01-01
Fully resolved intensity profiles of various lines in the carbon dioxide band at 10.4 micrometers have been measured on Mars with an infrared heterodyne spectrometer. Analysis of the line shapes shows that the Mars atmosphere exhibits positive gain in these lines. The detection of natural optical gain amplification enables identification of these lines as a definite natural laser.
Soft x-ray amplification in an ablative capillary discharge
International Nuclear Information System (INIS)
Kwek, K.H.; Low, K.S.; Tan, C.A.; Lim, C.S.
1999-01-01
Soft x-ray amplification in CVI 18.2 nm line is observed in an ablative UHMW-PE capillary discharge. The gain coefficient is measured to be 1.9 cm -1 . The electron density is about 2 x 10 19 cm -3 . This indicates that capillary discharge pumping device can be a source for a compact soft x-ray laser. (author)
Meyer, P; Heidmann, I
1994-05-25
We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.
Amplification-free liquid biopsy by fluorescence approach
DEFF Research Database (Denmark)
Uhd, Jesper; Okholm, Anders; Kjems, Jargen
2017-01-01
Liquid biopsy is an attractive new paradigm of modern cancer research and clinical oncology. Synergy of fluorescence microscopy with mutation specific molecular probes is a method that we developed for the detection of tumor related circulating DNA, ctDNA. The present detection methods of ctDNA...... samples include amplification-based techniques that have multiple challenges, are often time consuming and rather expensive. In this work, we successfully applied the hybridization assay and advanced microscopy for the reliable amplification-free detection and quantification of cancer associated mutations...... in ctDNA....
Empirical Site Amplification Factors Incorporating Soil Nonlinearity in Taiwan
Kuo, C. H.; Chung, C. H.; Che-Min, L.; Huang, J. Y.; Wen, K. L.
2017-12-01
Characteristics of site amplifications caused by both crustal and subduction earthquakes are important in Taiwan. For example, seismic waves were amplified and led to significant building damages in the Taipei Basin by the 1986 Hualien offshore (subduction interface) and the 1999 Chi-Chi earthquakes (crustal), for which the epicentral distances were about 100 km. To understand local site amplifications in Taiwan, empirical site amplification factors for horizontal ground motions are studied using recently constructed strong motion and site databases for the free-field TSMIP stations in Taiwan. Records of large magnitude earthquakes of ML larger than six from 1994 to 2014 were selected for this study. Site amplification factors at site conditions with Vs30 of 120 m/s to 1500 m/s and base accelerations up to 0.7g were inferred from intensity ratios of station pairs within specific distances. The reference site condition is assumed as Vs30 of 760 m/s (B/C boundary). Preliminary results indicate: 1. Soil nonlinearity is more obviously at short periods (PGA, Sa0.3) than long periods (PGV, Sa1.0). 2. Soil nonlinearity is significant for stations belong to site classes of B, C, D, and E in Taiwan. 3. Effect of station-pair distance is seen at short periods (PGA and Sa0.3). 4. No significant different is found in site amplifications of crustal and subduction earthquakes. The result could be a reference for the Fa and Fv in Taiwan's building code.
Generation of recombinant pestiviruses using a full genome amplification strategy
DEFF Research Database (Denmark)
Rasmussen, Thomas Bruun; Reimann, Ilona; Uttenthal, Åse
Aim Complete genome amplification of viral RNA provides a new tool for generation of modified pestiviruses. We have recently reported a full genome amplification strategy for direct recovery of infectious pestivirus (Rasmussen et al., 2008). This comprised rescue of BDV strain “Gifhorn” from a full......-length RT-PCR amplicon demonstrating that long RT-PCR can be used for direct generation of an infectious pestivirus. The strategy is not limited to amplification of BDV “Gifhorn”, but can be further utilized for amplification of a diverse selection of pestivirus strains and for the generation of modified...... was reverse transcribed to cDNA at 50C for 90 minutes using SuperScript III reverse transcriptase (Invitrogen). Full-length PCR amplification was performed using primers specific for the extreme 5’- and 3’-ends of the viral genomes. A T7 promoter was incorporated in the 5’-primers for direct in vitro...
Laser amplification in excited dielectrics
Winkler, Thomas; Haahr-Lillevang, Lasse; Sarpe, Cristian; Zielinski, Bastian; Götte, Nadine; Senftleben, Arne; Balling, Peter; Baumert, Thomas
2018-01-01
Wide-bandgap dielectrics such as glasses or water are transparent at visible and infrared wavelengths. This changes when they are exposed to ultrashort and highly intense laser pulses. Different interaction mechanisms lead to the appearance of various transient nonlinear optical phenomena. Using these, the optical properties of dielectrics can be controlled from the transparent to the metal-like state. Here we expand this range by a yet unexplored mechanism in excited dielectrics: amplification. In a two-colour pump-probe experiment, we show that a 400 nm femtosecond laser pulse is coherently amplified inside an excited sapphire sample on a scale of a few micrometres. Simulations strongly support the proposed two-photon stimulated emission process, which is temporally and spatially controllable. Consequently, we expect applications in all fields that demand strongly localized amplification.
Directory of Open Access Journals (Sweden)
V.Vasco
2017-06-01
Full Text Available Background: Bone hardness and strength depends on mineralization, which involves a complex process in which calcium phosphate, produced by bone-forming cells, was shed around the fibrous matrix. This process is strictly regulated, and a number of signal transduction systems were interested in calcium metabolism, such as the phosphoinositide (PI pathway and related phospholipase C (PLC enzymes. Objectives: Our aim was to search for common patterns of expression in osteoblasts, as well as in ES and SS. Methods: We analysed the PLC enzymes in human osteoblasts and osteosarcoma cell lines MG-63 and SaOS-2. We compared the obtained results to the expression of PLCs in samples of patients affected with Ewing sarcoma (ES and synovial sarcoma (SS. Results: In osteoblasts, MG-63 cells and SaOS-2 significant differences were identified in the expression of PLC δ4 and PLC η subfamily isoforms. Differences were also identified regarding the expression of PLCs in ES and SS. Most ES and SS did not express PLCB1, which was expressed in most osteoblasts, MG-63 and SaOS-2 cells. Conversely, PLCB2, unexpressed in the cell lines, was expressed in some ES and SS. However, PLCH1 was expressed in SaOS-2 and inconstantly expressed in osteoblasts, while it was expressed in ES and unexpressed in SS. The most relevant difference observed in ES compared to SS regarded PLC ε and PLC η isoforms. Conclusion: MG-63 and SaOS-2 osteosarcoma cell lines might represent an inappropriate experimental model for studies about the analysis of signal transduction in osteoblasts
Measuring the amplification of attention
Blaser, Erik; Sperling, George; Lu, Zhong-Lin
1999-01-01
An ambiguous motion paradigm, in which the direction of apparent motion is determined by salience (i.e., the extent to which an area is perceived as figure versus ground), is used to assay the amplification of color by attention to color. In the red–green colored gratings used in these experiments, without attention instructions, salience depends on the chromaticity difference between colored stripes embedded in the motion sequence and the yellow background. Selective attention to red (or to ...
Spheromak Impedance and Current Amplification
International Nuclear Information System (INIS)
Fowler, T K; Hua, D D; Stallard, B W
2002-01-01
It is shown that high current amplification can be achieved only by injecting helicity on the timescale for reconnection, τ REC , which determines the effective impedance of the spheromak. An approximate equation for current amplification is: dI TOR 2 /dt ∼ I 2 /τ REC - I TOR 2 /τ closed where I is the gun current, I TOR is the spheromak toroidal current and τ CLOSED is the ohmic decay time of the spheromak. Achieving high current amplification, I TOR >> I, requires τ REC CLOSED . For resistive reconnection, this requires reconnection in a cold zone feeding helicity into a hot zone. Here we propose an impedance model based on these ideas in a form that can be implemented in the Corsica-based helicity transport code. The most important feature of the model is the possibility that τ REC actually increases as the spheromak temperature increases, perhaps accounting for the ''voltage sag'' observed in some experiments, and a tendency toward a constant ratio of field to current, B ∝ I, or I TOR ∼ I. Program implications are discussed
DEFF Research Database (Denmark)
Monks, A.; Hose, C.D.; Pezzoli, P.
2009-01-01
gene modulation were significantly correlated. A belinostat-gene profile was specific for HDACi in three cell lines when compared with equipotent concentrations of four mechanistically different chemotherapeutic agents: 5-fluorouracil, cisplatin, paclitaxel, and thiotepa. Belinostat- and trichostatin...... in a drug-sensitive tumor than a more resistant model. We have demonstrated a gene signature that is selectively regulated by HDACi when compared with other clinical agents allowing us to distinguish HDACi responses from those related to other mechanisms Udgivelsesdato: 2009/9...
TGF-b and a specific TGF-b inhibitor regulate pericentrin B and MYH9 in glioma cell lines
Directory of Open Access Journals (Sweden)
Óscar Álzate
2006-01-01
Full Text Available Malignant gliomas are heterogeneous, highly invasive vascular tumours. The multifunctional cytokine, transforming growth factor-beta (TGF-P, is expressed by grade III/IV gliomas and promotes tumour angiogenesis, invasión and immune escape. It has been shown previously that a small TGF-P receptor type I (TGF-(3-RI molecule inhibitor (SB-431542 blocks TGF-(3-mediated signal transduction, induction of angiogenic factor expression and cellular motility. As glioma cell lines display differential sensitivity to TGF-P, it was expected that they would also be differentially impacted by disruption of TGF-P signalling. Differential in gel expression (DIGE analysis and mass spectrometry was used in this work for determining protein regulation effects of both TGF-P and SB-431542 on human glioma cell lines. It was found that pericentrin B and non muscle myosin were differentially expressed in fragments which likely resulted from protease activation by the tumour growth mechanism. These results suggest that both pericentrin B and non-muscle myosin might be potential glioma biomarkers. Key words: DIGE, proteomics, glioma, TGF-P, mass spectrometry, non muscle myosin, pericentrin B.
Energy Technology Data Exchange (ETDEWEB)
Bevanger, Kjetil
2011-02-15
To achieve European-level policy goals on climate change challenges, as well securing the electricity supply within Norway, it will be necessary to increase power line construction efforts significantly, as well as to upgrade the existing grid. Statnett have estimated an approximately 40 billion NOK investment over the next 10 years will be required for the central grid. Although this is a huge investment, the length of the new transmission lines constructed will only comprise a small part of the Norwegian grid. Of approximately 193 000 km of overhead power lines in Norway the distribution grid (i.e. up to 24 kV) comprises 85%. In this report we discuss the ornithological challenges connected to the different elements of the Norwegian grid. All overhead wires pose a potential risk to flying birds; however, the risk increases with the number of lines and wire length per unit of land area. The central and regional grid, in general, represents no electrocution threat, as the distances between the phase conductors and/or the distance between a phase conductor and an earthed device is rather wide. Thus the electrocution problem is a distribution grid specific problem. Both the collision and the electrocution risk are highly species specific problems. Over the last years several research projects have collected data enabling an identification of the bird species and bird species groups facing a particular risk. However, there is still a lack of know-ledge in several respects, for example why the number of collisions is not evenly distributed along a power line section, but is frequently concentrated at a few spots. This type of knowledge is crucial to contribute to the selection of as environmentally friendly power line routing as possible when new power lines are constructed. This is also stressed in the new Energy Act of 2009. With respect to both upgrading, and to new power line constructions, underground cabling should be used to a much greater extent. This will
Project W-314 specific test and evaluation plan for SN-633 transfer line (241-AX-B to 241-AY-02A)
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation
Development of an electronic system for signals amplification
International Nuclear Information System (INIS)
Santos, Italo S.; Tobias, Carmen C.B.
2009-01-01
This paper presents the obtained results with a spectrometer for electromagnetic radiation whose detector, a Si PIN type diode, was directly coupled to a signal amplification system developed in this project for scientific initiation. The linearity conditions and the gain operational limits, constituted of two stages of amplification based on the employment of devices from AMTEK A225 and A206, were determined using a precision pulse generator. The obtained results shown that the developed system is stable and linear in the gain range of 50-150. The spectrometric response of the electronic system coupled to the Siemens SFH-00206 type diode, were studied in view of the register of the 59.5 keV gamma ray spectra proceeding from 241 Am as function of the reversal polarization voltage. The influence pf the voltage and the electronic contribution in the energy resolution of the registered spectra under room temperature (22 degree Celsius) had also investigated considering the more adequate value of the coupling capacitance of the amplification system diode. Up to the present. the best energy resolution (FWHM = 4.85 keV) of the 59.5 keV line was obtained for the condition of the detector polarization at 16 V. This result proves that the signal amplification system developed coupled to the SFH00206 diode, besides the low cost, excellent operational condition for the detection and spectrometry or low energy electromagnetic radiation
Directory of Open Access Journals (Sweden)
Gupta N
2013-12-01
Full Text Available Neha Gupta, Hassan Hatoum, Grace K DyDepartment of Medicine, Roswell Park Cancer Institute, Buffalo, NY, USAAbstract: Lung cancer is the leading cause of cancer mortality worldwide in both men and women. Non-small-cell lung cancer (NSCLC is the most common type of lung cancer, accounting for more than 80% of cases. Paclitaxel has a broad spectrum of activity against various malignancies, including NSCLC. Paclitaxel is poorly soluble in water and thus, until recently, its commercially available preparations contained a non-ionic solvent Cremophor EL®. Cremophor EL® improves the solubility of paclitaxel and allows its intravenous administration. However, certain side-effects associated with paclitaxel, such as hypersensitivity reactions, myelosuppression, and peripheral neuropathy, are known to be worsened by Cremophor®. Nanoparticle albumin-bound paclitaxel ([nab-paclitaxel] ABRAXANE® ABI-007 is a new generation formulation of paclitaxel that obviates the need for Cremophor®, resulting in a safer and faster infusion without requiring the use of premedications to avoid hypersensitivity. Albumin-binding receptor-mediated delivery and lack of sequestering Cremophor® micelles allow higher intratumoral concentration of pharmacologically active paclitaxel. Multiple clinical trials have demonstrated a superior tolerability profile of nab-paclitaxel in comparison to solvent-bound paclitaxel (sb-paclitaxel. A recent Phase III trial compared the effects of weekly nab-paclitaxel in combination with carboplatin versus sb-paclitaxel in combination with carboplatin given every 3 weeks for first line treatment of NSCLC. This trial highlights the weekly nab-paclitaxel combination as an alternate treatment option for NSCLC, with higher response rate in squamous cell NSCLC and longer survival in elderly patients. This review will focus on the properties of nab-paclitaxel and its use in the first line treatment of NSCLC.Keywords: ABI-007, Abraxane, nab
Reveles, Kelly R; Backo, Jennifer L; Corvino, Frank A; Zivkovic, Marko; Broderick, Kelly C
2017-12-01
The reduction in recurrent Clostridium difficile-associated diarrhea (CDAD) with fidaxomicin therapy may reduce hospital readmissions and lead to lower overall CDAD costs. However, studies assessing the cost-effectiveness of fidaxomicin as first-line therapy from the U.S. hospital perspective are lacking. This study evaluated the costs associated with utilizing fidaxomicin or vancomycin as a first-line therapy for CDAD in specific patient populations from a U.S. hospital perspective. A decision-analytic model was developed to estimate total costs (hospitalization and drug costs) associated with using fidaxomicin or vancomycin as first-line therapy for a first episode and up to two recurrences of CDAD in five patient populations: general population, elderly, patients receiving concomitant antibiotics, and patients with renal impairment or cancer. The total cost of CDAD treatment using fidaxomicin first line in the general population was $14,442 per patient versus $14,179 per patient with vancomycin first line. In subgroup analyses, fidaxomicin use resulted in total hospital cost savings of $616 per patient in patients with cancer and $312 in patients with concomitant antibiotic use; vancomycin use was associated with total hospital cost savings of $243 per patient in the elderly and $371 in patients with renal impairment. Fidaxomicin as first-line CDAD therapy is associated with similar total costs as compounded vancomycin oral solution in the general population. In elderly and renally impaired patients, slight increases in hospital cost were observed with fidaxomicin therapy, and in patients with cancer or concomitant antibiotic use, hospital cost savings were observed. © 2017 Pharmacotherapy Publications, Inc.
Yang, Huan-Lan; Wei, Shuang; Gooneratne, Ravi; Mutukumira, Anthony N; Ma, Xue-Jun; Tang, Shu-Ze; Wu, Xi-Yang
2018-04-01
A novel RPA-IAC assay using recombinase polymerase and an internal amplification control (IAC) for Vibrio parahaemolyticus detection was developed. Specific primers were designed based on the coding sequence for the toxR gene in V. parahaemolyticus. The recombinase polymerase amplification (RPA) reaction was conducted at a constant low temperature of 37 °C for 20 min. Assay specificity was validated by using 63 Vibrio strains and 10 non-Vibrio bacterial species. In addition, a competitive IAC was employed to avoid false-negative results, which co-amplified simultaneously with the target sequence. The sensitivity of the assay was determined as 3 × 10 3 CFU/mL, which is decidedly more sensitive than the established PCR method. This method was then used to test seafood samples that were collected from local markets. Seven out of 53 different raw seafoods were detected as V. parahaemolyticus-positive, which were consistent with those obtained using traditional culturing method and biochemical assay. This novel RPA-IAC assay provides a rapid, specific, sensitive, and more convenient detection method for V. parahaemolyticus.
Hultberg, Björn
2004-04-01
Despite the growing evidence that plasma homocysteine is a cardiovascular risk factor, the mechanism behind the vascular injuries is still unknown. Studies of the cellular uptake systems for homocysteine are scarce, but membrane transporters of cyst(e)ine seem to be involved. In the present study the cellular uptake of extracellular homocysteine in HeLa and hepatoma cell lines is investigated by using several different transport inhibitors for cellular uptake of cyst(e)ine. It is shown that systems A and Xc- are the main transport systems for homocysteine uptake in HeLa cells. It is also confirmed that the magnitude of homocysteine uptake in hepatoma cells is lower than in HeLa cells. However, in the presence of high amounts of extracellular homocysteine both cell types exhibited a high elimination of homocysteine, which was inhibited by the presence of inhibitors of systems A or Xc-. It is possible that there is normally a high turnover of homocysteine in cell cultures, which is not detected by occasional determinations of homocysteine concentrations. The complex pattern of homocysteine production, release, uptake and distribution between different cells in the body is important to examine further in order to possibly be able to modulate the elimination of homocysteine from circulation and thereby lower the risk of cardiovascular disease.
Directory of Open Access Journals (Sweden)
Pilar eAlberdi
2016-02-01
Full Text Available Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum
Pain Amplification Syndrome: A Biopsychosocial Approach.
Namerow, Lisa B; Kutner, Emily C; Wakefield, Emily C; Rzepski, Barbara R; Sahl, Robert A
2016-08-01
Pediatric neurologists frequently encounter patients who present with significant musculoskeletal pain that cannot be attributed to a specific injury or illness, which can often be defined as pain amplification syndrome (PAS). PAS in children and adolescents is the result of a heightened pain sensitivity pathway, which is intensified by significant biological, psychological, and social contributors. Appropriate assessment and multimodal intervention of PAS are crucial to treatment success, including neurology and behavioral health collaborative treatment plans to restore patient function and reduce pain perception. Pediatric neurologists are imperative in the identification of patients with PAS, providing the family assurance in diagnosis and validation of pain, and directing patients to the appropriate multidisciplinary treatment pathway. Copyright © 2016 Elsevier Inc. All rights reserved.
Whole genome amplification in preimplantation genetic diagnosis*
Zheng, Ying-ming; Wang, Ning; Li, Lei; Jin, Fan
2011-01-01
Preimplantation genetic diagnosis (PGD) refers to a procedure for genetically analyzing embryos prior to implantation, improving the chance of conception for patients at high risk of transmitting specific inherited disorders. This method has been widely used for a large number of genetic disorders since the first successful application in the early 1990s. Polymerase chain reaction (PCR) and fluorescent in situ hybridization (FISH) are the two main methods in PGD, but there are some inevitable shortcomings limiting the scope of genetic diagnosis. Fortunately, different whole genome amplification (WGA) techniques have been developed to overcome these problems. Sufficient DNA can be amplified and multiple tasks which need abundant DNA can be performed. Moreover, WGA products can be analyzed as a template for multi-loci and multi-gene during the subsequent DNA analysis. In this review, we will focus on the currently available WGA techniques and their applications, as well as the new technical trends from WGA products. PMID:21194180
Controlled Microwave Heating Accelerates Rolling Circle Amplification.
Yoshimura, Takeo; Suzuki, Takamasa; Mineki, Shigeru; Ohuchi, Shokichi
2015-01-01
Rolling circle amplification (RCA) generates single-stranded DNAs or RNA, and the diverse applications of this isothermal technique range from the sensitive detection of nucleic acids to analysis of single nucleotide polymorphisms. Microwave chemistry is widely applied to increase reaction rate as well as product yield and purity. The objectives of the present research were to apply microwave heating to RCA and indicate factors that contribute to the microwave selective heating effect. The microwave reaction temperature was strictly controlled using a microwave applicator optimized for enzymatic-scale reactions. Here, we showed that microwave-assisted RCA reactions catalyzed by either of the four thermostable DNA polymerases were accelerated over 4-folds compared with conventional RCA. Furthermore, the temperatures of the individual buffer components were specifically influenced by microwave heating. We concluded that microwave heating accelerated isothermal RCA of DNA because of the differential heating mechanisms of microwaves on the temperatures of reaction components, although the overall reaction temperatures were the same.
Zhou, Dinggang; Wang, Chunfeng; Li, Zhu; Chen, Yun; Gao, Shiwu; Guo, Jinlong; Lu, Wenying; Su, Yachun; Xu, Liping; Que, Youxiong
2016-01-01
Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP) assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg(2+), 6:1 ratio of inner vs. outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was 10-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100%) by LAMP and 97/100 cases (97%) by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable, and cost-effective for detection of the bar specific transgenic sugarcane.
Directory of Open Access Journals (Sweden)
Dinggang eZhou
2016-03-01
Full Text Available Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg2+, 6:1 ratio of inner vs outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was ten-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100% by LAMP and 97/100 cases (97% by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable and cost-effective for detection of the bar specific transgenic sugarcane.
Directory of Open Access Journals (Sweden)
Anne Guimier
Full Text Available Somatically acquired genomic alterations with MYCN amplification (MNA are key features of neuroblastoma (NB, the most common extra-cranial malignant tumour of childhood. Little is known about the frequency, clinical characteristics and outcome of NBs harbouring genomic amplification(s distinct from MYCN.Genomic profiles of 1100 NBs from French centres studied by array-CGH were re-examined specifically to identify regional amplifications. Patients were included if amplifications distinct from the MYCN locus were seen. A subset of NBs treated at Institut Curie and harbouring MNA as determined by array-CGH without other amplification was also studied. Clinical and histology data were retrospectively collected.In total, 56 patients were included and categorised into 3 groups. Group 1 (n = 8 presented regional amplification(s without MNA. Locus 12q13-14 was a recurrent amplified region (4/8 cases. This group was heterogeneous in terms of INSS stages, primary localisations and histology, with atypical clinical features. Group 2 (n = 26 had MNA as well as other regional amplifications. These patients shared clinical features of those of a group of NBs MYCN amplified (Group 3, n = 22. Overall survival for group 1 was better than that of groups 2 and 3 (5 year OS: 87.5%±11% vs 34.9%±7%, log-rank p<0.05.NBs harbouring regional amplification(s without MNA are rare and seem to show atypical features in clinical presentation and genomic profile. Further high resolution genetic explorations are justified in this heterogeneous group, especially when considering these alterations as predictive markers for targeted therapy.
Guimier, Anne; Ferrand, Sandrine; Pierron, Gaëlle; Couturier, Jérôme; Janoueix-Lerosey, Isabelle; Combaret, Valérie; Mosseri, Véronique; Thebaud, Estelle; Gambart, Marion; Plantaz, Dominique; Marabelle, Aurélien; Coze, Carole; Rialland, Xavier; Fasola, Sylvie; Lapouble, Eve; Fréneaux, Paul; Peuchmaur, Michel; Michon, Jean; Delattre, Olivier; Schleiermacher, Gudrun
2014-01-01
Background Somatically acquired genomic alterations with MYCN amplification (MNA) are key features of neuroblastoma (NB), the most common extra-cranial malignant tumour of childhood. Little is known about the frequency, clinical characteristics and outcome of NBs harbouring genomic amplification(s) distinct from MYCN. Methods Genomic profiles of 1100 NBs from French centres studied by array-CGH were re-examined specifically to identify regional amplifications. Patients were included if amplifications distinct from the MYCN locus were seen. A subset of NBs treated at Institut Curie and harbouring MNA as determined by array-CGH without other amplification was also studied. Clinical and histology data were retrospectively collected. Results In total, 56 patients were included and categorised into 3 groups. Group 1 (n = 8) presented regional amplification(s) without MNA. Locus 12q13-14 was a recurrent amplified region (4/8 cases). This group was heterogeneous in terms of INSS stages, primary localisations and histology, with atypical clinical features. Group 2 (n = 26) had MNA as well as other regional amplifications. These patients shared clinical features of those of a group of NBs MYCN amplified (Group 3, n = 22). Overall survival for group 1 was better than that of groups 2 and 3 (5 year OS: 87.5%±11% vs 34.9%±7%, log-rank p<0.05). Conclusion NBs harbouring regional amplification(s) without MNA are rare and seem to show atypical features in clinical presentation and genomic profile. Further high resolution genetic explorations are justified in this heterogeneous group, especially when considering these alterations as predictive markers for targeted therapy. PMID:25013904
Laser amplification in excited dielectrics
DEFF Research Database (Denmark)
Winkler, Thomas; Haahr-Lillevang, Lasse; Sarpe, Cristian
2018-01-01
Wide-bandgap dielectrics such as glasses or water are transparent at visible and infrared wavelengths. This changes when they are exposed to ultrashort and highly intense laser pulses. Different interaction mechanisms lead to the appearance of various transient nonlinear optical phenomena. Using...... these, the optical properties of dielectrics can be controlled from the transparent to the metal-like state. Here we expand this range by a yet unexplored mechanism in excited dielectrics: amplification. In a two-colour pump-probe experiment, we show that a 400nm femtosecond laser pulse is coherently...
Resonant primordial gravitational waves amplification
Directory of Open Access Journals (Sweden)
Chunshan Lin
2016-01-01
Full Text Available We propose a mechanism to evade the Lyth bound in models of inflation. We minimally extend the conventional single-field inflation model in general relativity (GR to a theory with non-vanishing graviton mass in the very early universe. The modification primarily affects the tensor perturbation, while the scalar and vector perturbations are the same as the ones in GR with a single scalar field at least at the level of linear perturbation theory. During the reheating stage, the graviton mass oscillates coherently and leads to resonant amplification of the primordial tensor perturbation. After reheating the graviton mass vanishes and we recover GR.
Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng
2018-06-29
The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Isothermal amplification detection of nucleic acids by a double-nicked beacon.
Shi, Chao; Zhou, Meiling; Pan, Mei; Zhong, Guilin; Ma, Cuiping
2016-03-01
Isothermal and rapid amplification detection of nucleic acids is an important technology in environmental monitoring, foodborne pathogen detection, and point-of-care clinical diagnostics. Here we have developed a novel method of isothermal signal amplification for single-stranded DNA (ssDNA) detection. The ssDNA target could be used as an initiator, coupled with a double-nicked molecular beacon, to originate amplification cycles, achieving cascade signal amplification. In addition, the method showed good specificity and strong anti-jamming capability. Overall, it is a one-pot and isothermal strand displacement amplification method without the requirement of a stepwise procedure, which greatly simplifies the experimental procedure and decreases the probability of contamination of samples. With its advantages, the method would be very useful to detect nucleic acids in point-of-care or field use. Copyright © 2015 Elsevier Inc. All rights reserved.
Kuijpers, Chantal C. H. J.; Moelans, Cathy B.; van Slooten, Henk-Jan; Horstman, Anja; Hinrichs, John W. J.; Al-Janabi, Shaimaa; van Diest, Paul J.; Jiwa, Mehdi
2013-01-01
Background HER-2 is a prognostic and predictive marker, but as yet no technique is perfectly able to identify patients likely to benefit from HER-2 targeted therapies. We aimed to prospectively assess the added value of first-line co-testing by IHC, and multiplex ligation-dependent probe amplification (MLPA) and chromogenic in situ hybridization (CISH). Methods As local validation, HER-2 MLPA and CISH were compared in 99 breast cancers. Next, we reviewed 937 invasive breast cancers, from 4 Dutch pathology laboratories, that were prospectively assessed for HER-2 by IHC and MLPA (and CISH in selected cases). Results The validation study demonstrated 100% concordance between CISH and MLPA, if both methods were assessable and conclusive (81.8% of cases). Significant variation regarding percentages IHC 0/1+ and 2+ cases was observed between the laboratories (pCISH was 98.1% (575/586) (Kappa = 0.94). Of the IHC 3+ cases, 6.7% failed to reveal gene amplification, whereas 0.8% of the IHC 0/1+ cases demonstrated gene amplification. Results remained discordant after retrospective review in 3/11 discordant cases. In the remaining 8 cases the original IHC score was incorrect or adapted after repeated IHC staining. Conclusions MLPA is a low-cost and quantitative high-throughput technique with near perfect concordance with CISH. The use of MLPA in routinely co-testing all breast cancers may reduce HER-2 testing variation between laboratories, may serve as quality control for IHC, will reveal IHC 0/1+ patients with gene amplification, likely responsive to trastuzumab, and identify IHC 3+ cases without gene amplification that may respond less well. PMID:24324739
Directory of Open Access Journals (Sweden)
Chantal C H J Kuijpers
Full Text Available BACKGROUND: HER-2 is a prognostic and predictive marker, but as yet no technique is perfectly able to identify patients likely to benefit from HER-2 targeted therapies. We aimed to prospectively assess the added value of first-line co-testing by IHC, and multiplex ligation-dependent probe amplification (MLPA and chromogenic in situ hybridization (CISH. METHODS: As local validation, HER-2 MLPA and CISH were compared in 99 breast cancers. Next, we reviewed 937 invasive breast cancers, from 4 Dutch pathology laboratories, that were prospectively assessed for HER-2 by IHC and MLPA (and CISH in selected cases. RESULTS: The validation study demonstrated 100% concordance between CISH and MLPA, if both methods were assessable and conclusive (81.8% of cases. Significant variation regarding percentages IHC 0/1+ and 2+ cases was observed between the laboratories (p<0.0001. Overall concordance between IHC and MLPA/CISH was 98.1% (575/586 (Kappa = 0.94. Of the IHC 3+ cases, 6.7% failed to reveal gene amplification, whereas 0.8% of the IHC 0/1+ cases demonstrated gene amplification. Results remained discordant after retrospective review in 3/11 discordant cases. In the remaining 8 cases the original IHC score was incorrect or adapted after repeated IHC staining. CONCLUSIONS: MLPA is a low-cost and quantitative high-throughput technique with near perfect concordance with CISH. The use of MLPA in routinely co-testing all breast cancers may reduce HER-2 testing variation between laboratories, may serve as quality control for IHC, will reveal IHC 0/1+ patients with gene amplification, likely responsive to trastuzumab, and identify IHC 3+ cases without gene amplification that may respond less well.
Signal amplification of microRNAs with modified strand displacement-based cycling probe technology.
Jia, Huning; Bu, Ying; Zou, Bingjie; Wang, Jianping; Kumar, Shalen; Pitman, Janet L; Zhou, Guohua; Song, Qinxin
2016-10-24
Micro ribose nucleic acids (miRNAs) play an important role in biological processes such as cell differentiation, proliferation and apoptosis. Therefore, miRNAs are potentially a powerful marker for monitoring cancer and diagnosis. Here, we present sensitive signal amplification for miRNAs based on modified cycling probe technology with strand displacement amplification. miRNA was captured by the template coupled with beads, and then the first cycle based on SDA was repeatedly extended to the nicking end, which was produced by the extension reaction of miRNA. The products generated by SDA are captured by a molecular beacon (MB), which is designed to initiate the second amplification cycle, with a similar principle to the cycling probe technology (CPT), which is based on repeated digestion of the DNA-RNA hybrid by the RNase H. After one sample enrichment and two steps of signal amplification, 0.1 pM of let-7a can be detected. The miRNA assay exhibits a great dynamic range of over 100 orders of magnitude and high specificity to clearly discriminate a single base difference in miRNA sequences. This isothermal amplification does not require any special temperature control instrument. The assay is also about signal amplification rather than template amplification, therefore minimising contamination issues. In addition, there is no need for the reverse transcription (RT) process. Thus the amplification is suitable for miRNA detection.
Risk Perception and Social Amplification
International Nuclear Information System (INIS)
Smith, R.E.
2001-01-01
This paper seeks to consider social amplification as it applies to risk perception. Perceptions of the magnitude of a risk are conditioned by issues such as the degree of uncertainty in probability and consequences, the nature of the consequences and the relative weightings placed on probability and consequences. Risk perceptions are also influenced by factors such as confidence in the operator of an industrial process, trust in the regulator and the perceived fairness of regulatory decision-making. Different people may hold different views about these issues and there may also be difficulties in communication. The paper identifies and discusses self-reinforcing mechanisms, which will be labelled 'lock-in' here. They appear to apply in many situations where social amplification is observed. Historically, the term 'lock-in' has been applied mainly in the technological context but, in this paper, four types of lock-in are identified, namely scientific/technological, economic, social and institutional lock-in. One type of lock-in tends to lead to the next and all are buttressed by people's general acceptance of the familiar, fear of the unknown and resistance to change. The regulator seeks to make decisions which achieve the common good rather than supporting or perpetuating any set of vested interests. In this regard the locked-in positions of stakeholders, whether organisations, interest groups, or individual members of the public, are obstacles and challenges. Existing methods of consultation are unsatisfactory in terms of achieving a proper and productive level of dialogue with stakeholders
Directory of Open Access Journals (Sweden)
Minsoung Rhee
Full Text Available Multiple displacement amplification (MDA is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet, ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.
CHANG, Y. K.; MARTINEZ-BUSTOS, F.; PARK, T. S.; KOKINI, J .L.
1999-01-01
The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...
Singbrant, Sofie; van Galen, Peter; Lucas, Daniel; Challen, Grant; Rossi, Derrick J; Daley, George Q
2015-09-01
Transplantation of hematopoietic stem cells (HSCs) to treat hematologic disorders is routinely used in the clinic. However, HSC therapy is hindered by the requirements of finding human leukocyte antigen (HLA)-matched donors and attaining sufficient numbers of long-term HSCs in the graft. Therefore, ex vivo expansion of transplantable HSCs remains one of the "holy grails" of hematology. Without the ability to maintain and expand human HSCs in vitro, two complementary approaches involving cellular reprogramming to generate transplantable HSCs have emerged. Reprogrammed HSCs represent a potentially inexhaustible supply of autologous tissue. On March 18th, 2015, Dr. George Q. Daley and Dr. Derrick J. Rossi, two pioneers in the field, presented and discussed their most recent research on these topics in a webinar organized by the International Society for Experimental Hematology (ISEH). Here, we summarize these seminars and discuss the possibilities and challenges in the field of hematopoietic specification. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.
Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna
2018-02-09
Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.
Aveskamp, M.M.; Woudenberg, J.H.C.; Gruyter, de J.; Turco, E.; Groenewald, J.Z.; Crous, P.W.
2009-01-01
Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to
Aveskamp, M.M.; Woudenberg, J.H.C.; de Gruyter, J.; Turco, E.; Groenewald, J.Z.; Crous, P.W.
2009-01-01
Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to
International Nuclear Information System (INIS)
Boucher, T.J.; Owca, W.A.
1985-05-01
This document is the Semiscale MOD-2C feedwater and steam line break experiment series Experiment Operating Specification Appendix for tests S-FS-6 and S-FS-7. Test S-FS-6 is the third test in the series and simulates a 100% break in a steam generator bottom feedwater line downstream of the check valve accompanied by compounding factors (such as check valve failure, loss-of-offsite power at SIS and SIS delayed until low steam generator pressure signal). The test is terminated after plant stabilization and recovery procedures including unaffected loop steam and feed, pressurizer heater operation, pressurizer auxiliary spray operation, and normal charging/letdown operation. Test S-FS-7 is the fourth test in the series and simulates a 14.3% break in a steam generator bottom feedwater line downstream of the check valve, accompanied by compounding factors. The test is terminated after plant stabilization procedures including unaffected loop steam and feed, pressurizer heater operation, and normal charging/letdown operation. The test was followed by an affected loop secondary refill after isolating the break. The Appendix contains information on the major fluid systems, initial experiment conditions, experiment boundary conditions, and sequence of experiment events. Also included is a discussion of the scaling criteria and philosophy used to develop the experiment initial and boundary conditions and system configuration
Hedberg, Annica; Knutsen, Erik; Løvhaugen, Anne Silje; Jørgensen, Tor Erik; Perander, Maria; Johansen, Steinar D
2018-04-19
Low-level mitochondrial heteroplasmy is a common phenomenon in both normal and cancer cells. Here, we investigate the link between low-level heteroplasmy and mitogenome mutations in a human breast cancer matched cell line by high-throughput sequencing. We identified 23 heteroplasmic sites, of which 15 were common between normal cells (Hs578Bst) and cancer cells (Hs578T). Most sites were clustered within the highly conserved Complex IV and ribosomal RNA genes. Two heteroplasmic variants in normal cells were found as fixed mutations in cancer cells. This indicates a positive selection of these variants in cancer cells. RNA-Seq analysis identified upregulated L-strand specific transcripts in cancer cells, which include three mitochondrial long non-coding RNA molecules. We hypothesize that this is due to two cancer cell-specific mutations in the control region.
Directory of Open Access Journals (Sweden)
Alves Leonardo
2010-03-01
Full Text Available Abstract Background microRNAs (miRNAs are endogenous small non-coding RNAs that post-transcriptionally regulate gene expression. In plants, they typically show high complementarity to a single sequence motif within their target mRNAs and act by catalyzing specific mRNA cleavage and degradation. miRNAs are processed from much longer primary transcripts via precursor miRNAs containing fold-back structures. Leaving these secondary structures intact, miRNAs can be re-designed experimentally to target mRNAs of choice. Results We designed primary synthetic miRNAs (pri-smiRNAs on the basis of the primary transcript of the Arabidopsis MIR159A gene by replacing the original miR159a and the corresponding miR159a* with novel sequences, keeping the overall secondary structure as predicted by the program RNAfold. We used the program RNAhybrid to optimize smiRNA design and to screen the complete Arabidopsis transcriptome for potential off-targets. To improve the molecular cloning of the pri-smiRNA we inserted restriction sites in the original MIR159A primary transcript to easily accommodate the smiRNA/smiRNA* DNA fragment. As a proof-of-concept, we targeted the single gene encoding chalcone synthase (CHS in Arabidopsis. We demonstrate smiRNA(CHS expression and CHS mRNA cleavage in different transgenic lines. Phenotypic changes in these lines were observed for seed color and flavonol derivatives, and quantified with respect to anthocyanin content. We also tested the effect of mismatches and excess G:U base pairs on knockdown efficiency. Conclusions RNAhybrid-assisted design of smiRNAs and generation of pri-smiRNAs using a novel vector containing restriction sites greatly improves specificity and speed of the generation of stable knockdown lines for functional analyses in plants.
Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura
2015-01-01
The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered
Measuring the amplification of attention.
Blaser, E; Sperling, G; Lu, Z L
1999-09-28
An ambiguous motion paradigm, in which the direction of apparent motion is determined by salience (i.e., the extent to which an area is perceived as figure versus ground), is used to assay the amplification of color by attention to color. In the red-green colored gratings used in these experiments, without attention instructions, salience depends on the chromaticity difference between colored stripes embedded in the motion sequence and the yellow background. Selective attention to red (or to green) alters the perceived direction of motion and is found to be equivalent to increasing the physical redness (or greenness) by 25-117%, depending on the observer and color. Whereas attention to a color drastically alters the salience of that color, it leaves color appearance unchanged. A computational model, which embodies separate, parallel pathways for object perception and for salience, accounts for 99% of the variance of the experimental data.
Risk Perception and Social Amplification
Energy Technology Data Exchange (ETDEWEB)
Smith, R.E. [Environment Agency (United Kingdom)
2001-07-01
This paper seeks to consider social amplification as it applies to risk perception. Perceptions of the magnitude of a risk are conditioned by issues such as the degree of uncertainty in probability and consequences, the nature of the consequences and the relative weightings placed on probability and consequences. Risk perceptions are also influenced by factors such as confidence in the operator of an industrial process, trust in the regulator and the perceived fairness of regulatory decision-making. Different people may hold different views about these issues and there may also be difficulties in communication. The paper identifies and discusses self-reinforcing mechanisms, which will be labelled 'lock-in' here. They appear to apply in many situations where social amplification is observed. Historically, the term 'lock-in' has been applied mainly in the technological context but, in this paper, four types of lock-in are identified, namely scientific/technological, economic, social and institutional lock-in. One type of lock-in tends to lead to the next and all are buttressed by people's general acceptance of the familiar, fear of the unknown and resistance to change. The regulator seeks to make decisions which achieve the common good rather than supporting or perpetuating any set of vested interests. In this regard the locked-in positions of stakeholders, whether organisations, interest groups, or individual members of the public, are obstacles and challenges. Existing methods of consultation are unsatisfactory in terms of achieving a proper and productive level of dialogue with stakeholders.
Previsani, N; Fontana, S; Hirt, B; Beard, P
1997-01-01
Two murine parvoviruses with genomic sequences differing only in 33 nucleotides (8 amino acids) in the region coding for the capsid proteins show different host cell specificities: MVMi grows in EL4 T lymphocytes and MVMp3 grows in A9 fibroblasts. In this study we compared the courses of infections with these two viruses in EL4 cells in order to investigate at which step(s) the infection process of MVMp3 is interrupted. The two viruses bound equally well to EL4 cells, and similar amounts of M...
Naito, Mariko; Ogura, Yoshitoshi; Itoh, Takehiko; Shoji, Mikio; Okamoto, Masaaki; Hayashi, Tetsuya; Nakayama, Koji
2016-02-01
Prevotella intermedia is a pathogenic bacterium involved in periodontal diseases. Here, we present the complete genome sequence of a clinical strain, OMA14, of this bacterium along with the results of comparative genome analysis with strain 17 of the same species whose genome has also been sequenced, but not fully analysed yet. The genomes of both strains consist of two circular chromosomes: the larger chromosomes are similar in size and exhibit a high overall linearity of gene organizations, whereas the smaller chromosomes show a significant size variation and have undergone remarkable genome rearrangements. Unique features of the Pre. intermedia genomes are the presence of a remarkable number of essential genes on the second chromosomes and the abundance of conjugative and mobilizable transposons (CTns and MTns). The CTns/MTns are particularly abundant in the second chromosomes, involved in its extensive genome rearrangement, and have introduced a number of strain-specific genes into each strain. We also found a novel 188-bp repeat sequence that has been highly amplified in Pre. intermedia and are specifically distributed among the Pre. intermedia-related species. These findings expand our understanding of the genetic features of Pre. intermedia and the roles of CTns and MTns in the evolution of bacteria. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Paul, Shanty; Wildhagen, Henning; Janz, Dennis; Teichmann, Thomas; Hänsch, Robert; Polle, Andrea
2016-01-01
Cytokinins play an important role in vascular development. But knowledge on the cellular localization of this growth hormone in the stem and other organs of woody plants is lacking. The main focus of this study was to investigate the occurrence and cellular localization of active cytokinins in leaves, roots, and along the stem of Populus × canescens and to find out how the pattern is changed between summer and winter. An ARR5::GUS reporter construct was used to monitor distribution of active cytokinins in different tissues of transgenic poplar lines. Three transgenic lines tested under outdoor conditions showed no influence of ARR5::GUS reporter construct on the growth performance compared with the wild-type, but one line lost the reporter activity. ARR5::GUS activity indicated changes in the tissue- and cell type-specific pattern of cytokinin activity during dormancy compared with the growth phase. ARR5::GUS activity, which was present in the root tips in the growing season, disappeared in winter. In the stem apex ground tissue, ARR5::GUS activity was higher in winter than in summer. Immature leaves from tissue-culture grown plants showed inducible ARR5::GUS activity. Leaf primordia in summer showed ARR5::GUS activity, but not the expanded leaves of outdoor plants or leaf primordia in winter. In stem cross sections, the most prominent ARR5::GUS activity was detected in the cortex region and in the rays of bark in summer and in winter. In the cambial zone the ARR5::GUS activity was more pronounced in the dormant than in growth phase. The pith and the ray cells adjacent to the vessels also displayed ARR5::GUS activity. In silico analyses of the tissue-specific expression patterns of the whole PtRR type-A family of poplar showed that PtRR10, the closest ortholog to the Arabidopsis ARR5 gene, was usually the most highly expressed gene in all tissues. In conclusion, gene expression and tissue-localization indicate high activity of cytokinins not only in summer, but
International Nuclear Information System (INIS)
Fernanda Amary, M; Ye, Hongtao; Berisha, Fitim; Khatri, Bhavisha; Forbes, Georgina; Lehovsky, Katie; Frezza, Anna M; Behjati, Sam; Tarpey, Patrick; Pillay, Nischalan; Campbell, Peter J; Tirabosco, Roberto; Presneau, Nadège; Strauss, Sandra J; Flanagan, Adrienne M
2014-01-01
Osteosarcoma, the most common primary bone sarcoma, is a genetically complex disease with no widely accepted biomarker to allow stratification of patients for treatment. After a recent report of one osteosarcoma cell line and one tumor exhibiting fibroblastic growth factor receptor 1 (FGFR1) gene amplification, the aim of this work was to assess the frequency of FGFR1 amplification in a larger cohort of osteosarcoma and to determine if this biomarker could be used for stratification of patients for treatment. About 352 osteosarcoma samples from 288 patients were analyzed for FGFR1 amplification by interphase fluorescence in situ hybridization. FGFR1 amplification was detected in 18.5% of patients whose tumors revealed a poor response to chemotherapy, and no patients whose tumors responded well to therapy harbored this genetic alteration. FGFR1 amplification is present disproportionately in the rarer histological variants of osteosarcoma. This study provides a rationale for inclusion of patients with osteosarcoma in clinical trials using FGFR kinase inhibitors
A PCA3 gene-based transcriptional amplification system targeting primary prostate cancer
Neveu, Bertrand; Jain, Pallavi; T?tu, Bernard; Wu, Lily; Fradet, Yves; Pouliot, Fr?d?ric
2015-01-01
Targeting specifically primary prostate cancer (PCa) cells for immune therapy, gene therapy or molecular imaging is of high importance. The PCA3 long non-coding RNA is a unique PCa biomarker and oncogene that has been widely studied. This gene has been mainly exploited as an accurate diagnostic urine biomarker for PCa detection. In this study, the PCA3 promoter was introduced into a new transcriptional amplification system named the 3-Step Transcriptional Amplification System (PCA3-3STA) and ...
Gao, Zhenzhen; Chen, Wei; Zhang, Xiaohua; Cai, Peifen; Fang, Xianying; Xu, Qiang; Sun, Yang; Gu, Yanhong
2013-06-01
Icotinib is a potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. In this study, we reported that icotinib had the antitumor activity on human squamous cell carcinoma cell line A431 in vitro. Meanwhile, adhesion to fibronectin and expression of integrin α3 and β1 were significantly reduced in a dose-dependent manner after the treatment of icotinib. Moreover, icotinib induced cell cycle arrested and affected expression of various cell cycle related proteins in squamous cancer cell line A431, whereas it did not cause apoptosis. Furthermore, icotinib remarkably down-regulated phosphorylation of protein kinase B (AKT) though blocking the interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and AKT in A431 cells. Taken together, it is shown that the small molecular compound, icotinib, has an anti-squamous cell carcinoma activity in vitro and its antitumor mechanism is associated with the blockage of the interaction between PDK1 and AKT. These results provide a novel strategy for anti-squamous cell carcinoma therapy. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Atossa Shaltouki
2015-05-01
Full Text Available In this study, we used patient-specific and isogenic PARK2-induced pluripotent stem cells (iPSCs to show that mutations in PARK2 alter neuronal proliferation. The percentage of TH+ neurons was decreased in Parkinson’s disease (PD patient-derived neurons carrying various mutations in PARK2 compared with an age-matched control subject. This reduction was accompanied by alterations in mitochondrial:cell volume fraction (mitochondrial volume fraction. The same phenotype was confirmed in isogenic PARK2 null lines. The mitochondrial phenotype was also seen in non-midbrain neurons differentiated from the PARK2 null line, as was the functional phenotype of reduced proliferation in culture. Whole genome expression profiling at various stages of differentiation confirmed the mitochondrial phenotype and identified pathways altered by PARK2 dysfunction that include PD-related genes. Our results are consistent with current model of PARK2 function where damaged mitochondria are targeted for degradation via a PARK2/PINK1-mediated mechanism.
Wai, T; Grumet, R
1995-09-01
The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.
Directory of Open Access Journals (Sweden)
Qazi H. A. A.
2017-12-01
Full Text Available Verification and validation of welding procedure specifications for X-70 grade line pipe welding was performed as per clause 8.2, Annexure B and D of API 5L, 45th Edition to check weld integrity in its future application conditions. Hot rolled coils were imported from China, de-coiling, strip edge milling, three roller bending to from pipe, inside and outside submerged arc welding of pipe, online ultrasonic testing of weld, HAZ and pipe body, cutting at fixed random length of pipe, visual inspection of pipe, Fluoroscopic inspection of pipe, welding procedure qualification test pieces marking at weld portion of the pipe, tensile testing, guided bend testing, CVN Impact testing were performed. Detailed study was conducted to explore possible explanations and variation in mechanical properties, WPS is examined and qualified as per API 5L 45th Edition.
Cernanská, Dana; Paoletti, Barbara; Králová-Hromadová, Ivica; Iorio, Raffaella; Cudeková, Patrícia; Milillo, Piermarino; Traversa, Donato
2009-03-09
Five horse farms located in eastern Slovakia were investigated for the presence of benzimidazole-resistant strongyles by faecal egg count reduction test and egg hatch assay. Coprocultures were prepared for each farm from faecal samples taken pre- and post-treatment and harvested larvae were molecularly examined with a Reverse Line Blot assay. Faecal egg count reduction values ranged from 0 to 52.5% and all farms were positive for benzimidazole-resistant cyathostomins. Seven benzimidazole-resistant cyathostomin species were molecularly identified on farms before and also after treatment. These data demonstrate that resistance to benzimidazoles is well established in cyathostomin populations from horse farms in the Slovak Republic and that the molecular assay was able to determine the species-specific distribution of resistant cyathostomins under field conditions.
Directory of Open Access Journals (Sweden)
A. C. Odeón
2009-06-01
Full Text Available The aim of this work was to study the in vitro amplification of BVDV (Pestivirus, Flaviridae field isolates from Argentina in MDBK, BoTur and BHK-21 continuous cell lines. Field isolates 99/134 (mucosal disease, 00/693 (mucosal disease, 04P7016 (respiratory disease and 04/89 (mucosal disease, genotype 1b, were used and compared with the Singer and NADL reference strains, genotype 1a. Additionally, cell lines derived from explants of bovine testis (RD- 420, bovine uterus (NCL-1 and porcine kidney (PKZ were tested as alternative substrates for BVDV propagation in vitro. The effect of cell line, harvest time and infection protocol was evaluated. The viral titers observed depended on the virus and harvest time but not on the infection protocol. We found that MDBK and BoTur cell lines were susceptible to the infection whereas BHK-21 and PKZ were not. NADL viral titers, 00/693 and 04/89, increased from 24 to 48 h p.i. in BoTur cells and then reached a plateau, whereas those of 99/134 and 04P7016 remained constant between 24 and 72 h p.i. BVDV Singer, on the other hand, presented a maximum titer at 24 h p.i. and then decreased. BVDV-NADL titers increased in MDBK and NCL-1 but not in RD-420 between 24 and 48 h p.i., and then decreased at 72 h p.i. These facts lead us to conclude that neither the subgenotypes (1a, 1b nor the clinical symptoms of the animal from the virus had been isolated seem to affect the virus cell line kinetics of viral replication in vitro. On the other hand, the most homogenous behavior, the most similar replication curves, and highest titers observed in MDBK and NCL-1 seem to indicate that these lines are generally more susceptible to BVDV replication.Se estudió la interacción de aislamientos de campo de Argentina del VDVB (Pestivirus, Flaviridae en las líneas celulares continuas MDBK, BoTur y BHK-21. Se utilizaron los virus de campo genotipo 1b, 99/134, 00/693 (casos compatibles con enfermedad de las mucosas y 04P7016 (cuadro
Diagnostic Devices for Isothermal Nucleic Acid Amplification
Directory of Open Access Journals (Sweden)
Chia-Chen Chang
2012-06-01
Full Text Available Since the development of the polymerase chain reaction (PCR technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.
Diagnostic devices for isothermal nucleic acid amplification.
Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann
2012-01-01
Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.
Diagnosis of brugian filariasis by loop-mediated isothermal amplification.
Directory of Open Access Journals (Sweden)
Catherine B Poole
Full Text Available In this study we developed and evaluated a Brugia Hha I repeat loop-mediated isothermal amplification (LAMP assay for the rapid detection of Brugia genomic DNA. Amplification was detected using turbidity or fluorescence as readouts. Reactions generated a turbidity threshold value or a clear visual positive within 30 minutes using purified genomic DNA equivalent to one microfilaria. Similar results were obtained using DNA isolated from blood samples containing B. malayi microfilariae. Amplification was specific to B. malayi and B. timori, as no turbidity was observed using DNA from the related filarial parasites Wuchereria bancrofti, Onchocerca volvulus or Dirofilaria immitis, or from human or mosquito. Furthermore, the assay was most robust using a new strand-displacing DNA polymerase termed Bst 2.0 compared to wild-type Bst DNA polymerase, large fragment. The results indicate that the Brugia Hha I repeat LAMP assay is rapid, sensitive and Brugia-specific with the potential to be developed further as a field tool for diagnosis and mapping of brugian filariasis.
NSGIC Local Govt | GIS Inventory — Park Facilities dataset current as of 2010. Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained...
Near-noiseless amplification of light by a phase-sensitive fibre ...
Indian Academy of Sciences (India)
PRAMANA c Indian Academy of Sciences. Vol. 56, Nos 2 & 3. — journal of. Feb. & Mar. 2001 physics pp. 281–285. Near-noiseless amplification of light by a phase- ... optic lines, is a type of linear phase-insensitive amplifier (PIA) [1,2]. .... isation controllers at each port are adjusted to equally excite both axes of the PM fibre.
Privacy amplification for quantum key distribution
International Nuclear Information System (INIS)
Watanabe, Yodai
2007-01-01
This paper examines classical privacy amplification using a universal family of hash functions. In quantum key distribution, the adversary's measurement can wait until the choice of hash functions is announced, and so the adversary's information may depend on the choice. Therefore the existing result on classical privacy amplification, which assumes the independence of the choice from the other random variables, is not applicable to this case. This paper provides a security proof of privacy amplification which is valid even when the adversary's information may depend on the choice of hash functions. The compression rate of the proposed privacy amplification can be taken to be the same as that of the existing one with an exponentially small loss in secrecy of a final key. (fast track communication)
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
Somjen, D; Katzburg, S; Sharon, O; Grafi-Cohen, M; Knoll, E; Stern, N
2011-02-01
In cultured human osteoblasts estradiol-17β (E2) modulated DNA synthesis, the specific activity of creatine kinase BB (CK), 12 and 15 lipoxygenase (LO) mRNA expression and formation of 12- and 15-hydroxyeicosatetraenoic acid (HETE). We now investigate the response of human bone cell line (SaOS2) to phytoestrogens and estrogen receptors (ER)-specific agonists and antagonists. Treatment of SaSO2 with E2, 2,3-bis (4-hydroxyphenyl)-propionitrile (DPN; ERβ-specific agonist), 4,4',4″-[4-propyl-(1H)-pyrazol-1,3,5-triyl] tris-phenol (PPT; ERα-specific agonist), biochainin A (BA), daidzein (D), genistein (G) and raloxifene (Ral) showed increased DNA synthesis and CK. Ral inhibited completely all stimulations except DPN and to some extent D. The ERα-specific antagonist methyl-piperidino-pyrazole (MPP) and the ERβ-specific antagonist 4-[2-phenyl-5,7-bis (tri-fluoro-methyl) pyrazolo [1,5-a]pyrimidin-3-yl] phenol (PTHPP) inhibited DNA synthesis, CK and reactive oxygen species (ROS) formation induced by estrogens according to their receptors affinity. The LO inhibitor baicaleine inhibited only E2, DPN and G's effects. E2 and Ral unlike all other compounds had no effect on ERα mRNA expression, while ERβ mRNA expression was stimulated by all compounds. All compounds modulated the expression of 12LO and 15LO mRNA, except E2, PPT and Ral for 12LO, and 12- and 15-HETE productions and stimulated ROS formation which was inhibited by NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and N-acetyl cysteine and the estrogen inhibitor ICI. DPI did not affect hormonal-induced DNA and CK. In conclusion, we provide evidence for the separation of mediation via ERα and ERβ pathways in the effects of estrogenic compounds on osteoblasts, but the role of LO/HETE/ROS is unclear. Copyright © 2010 Wiley-Liss, Inc.
Controlled Microwave Heating Accelerates Rolling Circle Amplification.
Directory of Open Access Journals (Sweden)
Takeo Yoshimura
Full Text Available Rolling circle amplification (RCA generates single-stranded DNAs or RNA, and the diverse applications of this isothermal technique range from the sensitive detection of nucleic acids to analysis of single nucleotide polymorphisms. Microwave chemistry is widely applied to increase reaction rate as well as product yield and purity. The objectives of the present research were to apply microwave heating to RCA and indicate factors that contribute to the microwave selective heating effect. The microwave reaction temperature was strictly controlled using a microwave applicator optimized for enzymatic-scale reactions. Here, we showed that microwave-assisted RCA reactions catalyzed by either of the four thermostable DNA polymerases were accelerated over 4-folds compared with conventional RCA. Furthermore, the temperatures of the individual buffer components were specifically influenced by microwave heating. We concluded that microwave heating accelerated isothermal RCA of DNA because of the differential heating mechanisms of microwaves on the temperatures of reaction components, although the overall reaction temperatures were the same.
Rolling circle amplification of metazoan mitochondrialgenomes
Energy Technology Data Exchange (ETDEWEB)
Simison, W. Brian; Lindberg, D.R.; Boore, J.L.
2005-07-31
Here we report the successful use of rolling circle amplification (RCA) for the amplification of complete metazoan mt genomes to make a product that is amenable to high-throughput genome sequencing techniques. The benefits of RCA over PCR are many and with further development and refinement of RCA, the sequencing of organellar genomics will require far less time and effort than current long PCR approaches.
Improved multiple displacement amplification (iMDA) and ultraclean reagents.
Motley, S Timothy; Picuri, John M; Crowder, Chris D; Minich, Jeremiah J; Hofstadler, Steven A; Eshoo, Mark W
2014-06-06
Next-generation sequencing sample preparation requires nanogram to microgram quantities of DNA; however, many relevant samples are comprised of only a few cells. Genomic analysis of these samples requires a whole genome amplification method that is unbiased and free of exogenous DNA contamination. To address these challenges we have developed protocols for the production of DNA-free consumables including reagents and have improved upon multiple displacement amplification (iMDA). A specialized ethylene oxide treatment was developed that renders free DNA and DNA present within Gram positive bacterial cells undetectable by qPCR. To reduce DNA contamination in amplification reagents, a combination of ion exchange chromatography, filtration, and lot testing protocols were developed. Our multiple displacement amplification protocol employs a second strand-displacing DNA polymerase, improved buffers, improved reaction conditions and DNA free reagents. The iMDA protocol, when used in combination with DNA-free laboratory consumables and reagents, significantly improved efficiency and accuracy of amplification and sequencing of specimens with moderate to low levels of DNA. The sensitivity and specificity of sequencing of amplified DNA prepared using iMDA was compared to that of DNA obtained with two commercial whole genome amplification kits using 10 fg (~1-2 bacterial cells worth) of bacterial genomic DNA as a template. Analysis showed >99% of the iMDA reads mapped to the template organism whereas only 0.02% of the reads from the commercial kits mapped to the template. To assess the ability of iMDA to achieve balanced genomic coverage, a non-stochastic amount of bacterial genomic DNA (1 pg) was amplified and sequenced, and data obtained were compared to sequencing data obtained directly from genomic DNA. The iMDA DNA and genomic DNA sequencing had comparable coverage 99.98% of the reference genome at ≥1X coverage and 99.9% at ≥5X coverage while maintaining both balance
By-product formation in repetitive PCR amplification of DNA libraries during SELEX.
Tolle, Fabian; Wilke, Julian; Wengel, Jesper; Mayer, Günter
2014-01-01
The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments. Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation and improving the success rate of aptamer selection.
PCR amplification of repetitive sequences as a possible approach in relative species quantification
DEFF Research Database (Denmark)
Ballin, Nicolai Zederkopff; Vogensen, Finn Kvist; Karlsson, Anders H
2012-01-01
Abstract Both relative and absolute quantifications are possible in species quantification when single copy genomic DNA is used. However, amplification of single copy genomic DNA does not allow a limit of detection as low as one obtained from amplification of repetitive sequences. Amplification...... of repetitive sequences is therefore frequently used in absolute quantification but problems occur in relative quantification as the number of repetitive sequences is unknown. A promising approach was developed where data from amplification of repetitive sequences were used in relative quantification of species...... to relatively quantify the amount of chicken DNA in a binary mixture of chicken DNA and pig DNA. However, the designed PCR primers lack the specificity required for regulatory species control....
Human small-cell lung cancers show amplification and expression of the N-myc gene
International Nuclear Information System (INIS)
Nau, M.M.; Brooks, B.J. Jr.; Carney, D.N.; Gazdar, A.F.; Battey, J.F.; Sausville, E.A.; Minna, J.D.
1986-01-01
The authors have found that 6 of 31 independently derived human small-cell lung cancer (SCLC) cell lines have 5- to 170-fold amplified N-myc gene sequences. The amplification is seen with probes from two separate exons of N-myc, which are homologous to either the second or the third exon of the c-myc gene. Amplified N-myc sequences were found in a tumor cell line started prior to chemotherapy, in SCLC tumor samples harvested directly from tumor metastases at autopsy, and from a resected primary lung cancer. Several N-myc-amplified tumor cell lines also exhibited N-myc hybridizing fragments not in the germ-line position. In one patient's tumor, an additional amplitifed N-myc DNA fragment was observed and this fragment was heterogeneously distributed in liver metastases. In contrast to SCLC with neuroendocrine properties, no non-small-cell lung cancer lines examined were found to have N-myc amplification. Fragments encoding two N-myc exons also detect increased amounts of a 3.1-kilobase N-myc mRNA in N-myc-amplified SCLC lines and in one cell line that does not show N-myc gene amplification. Both DNA and RNA hybridization experiments, using a 32 P-labelled restriction probe, show that in any one SCLC cell line, only one myc-related gene is amplified and expressed. They conclude that N-myc amplification is both common and potentially significant in the tumorigenesis or tumor progression of SCLC
Kivlehan, Francine; Mavré, François; Talini, Luc; Limoges, Benoît; Marchal, Damien
2011-09-21
We described an electrochemical method to monitor in real-time the isothermal helicase-dependent amplification of nucleic acids. The principle of detection is simple and well-adapted to the development of portable, easy-to-use and inexpensive nucleic acids detection technologies. It consists of monitoring a decrease in the electrochemical current response of a reporter DNA intercalating redox probe during the isothermal DNA amplification. The method offers the possibility to quantitatively analyze target nucleic acids in less than one hour at a single constant temperature, and to perform at the end of the isothermal amplification a DNA melt curve analysis for differentiating between specific and non-specific amplifications. To illustrate the potentialities of this approach for the development of a simple, robust and low-cost instrument with high throughput capability, the method was validated with an electrochemical system capable of monitoring up to 48 real-time isothermal HDA reactions simultaneously in a disposable microplate consisting of 48-electrochemical microwells. Results obtained with this approach are comparable to that obtained with a well-established but more sophisticated and expensive fluorescence-based method. This makes for a promising alternative detection method not only for real-time isothermal helicase-dependent amplification of nucleic acid, but also for other isothermal DNA amplification strategies.
Methylation specific Multiplex Ligation-dependent Probe Amplification
DEFF Research Database (Denmark)
Joergensen, M W; Rasmussen, A A; Niemann, I
2013-01-01
moles. Triploid pregnancies can have either the chromosomal constitution of two maternal and one paternal set, or two paternal and one maternal set, but only the conceptuses with two paternal sets have the potential to cause maternal complications. Therefore, it would be beneficial to introduce a method...... that gives the gynaecologist the parental origin of the genome of the triploid conceptus as early as possible, without delaying the process by first collecting parental samples....
Sequence-specific inhibition of microRNA-130a gene by CRISPR/Cas9 system in breast cancer cell line
Ainina Abdollah, Nur; Das Kumitaa, Theva; Yusof Narazah, Mohd; Razak, Siti Razila Abdul
2017-05-01
MicroRNAs (miRNAs) are short stranded noncoding RNA that play important roles in apoptosis, cell survival, development and cell proliferation. However, gene expression control via small regulatory RNA, particularly miRNA in breast cancer is still less explored. Therefore, this project aims to develop an approach to target microRNA-130a using the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system in MCF7, breast cancer cell line. The 20 bp sequences target at stem loop, 3ʹ and 5ʹ end of miR130a were cloned into pSpCas9(BB)-2A-GFP (PX458) plasmid, and the positive clones were confirmed by sequencing. A total of 5 μg of PX458-miR130a was transfected to MCF7 using Lipofectamine® 3000 according to manufacturer’s protocol. The transfected cells were maintained in the incubator at 37 °C under humidified 5% CO2. After 48 hours, cells were harvested and total RNA was extracted using miRNeasy Mini Kit (Qiagen). cDNAs were synthesised specific to miR-130a using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Then, qRT-PCR was carried out using TaqMan Universal Master Mix (Applied Biosystems) to quantify the knockdown level of mature miRNAs in the cells. Result showed that miR-130a-5p was significantly downregulated in MCF7 cell line. However, no significant changes were observed for sequences targeting miR-130a-3p and stem loop. Thus, this study showed that the expression of miR-130a-5p was successfully down-regulated using CRISPR silencing system. This technique may be useful to manipulate the level of miRNA in various cell types to answer clinical questions at the molecular level.
Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C
2016-01-01
The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.
Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne
2009-02-02
The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.
Chen, Xiaoyun; Wang, Xiaofu; Jin, Nuo; Zhou, Yu; Huang, Sainan; Miao, Qingmei; Zhu, Qing; Xu, Junfeng
2012-11-07
Genetically modified (GM) rice KMD1, TT51-1, and KF6 are three of the most well known transgenic Bt rice lines in China. A rapid and sensitive molecular assay for risk assessment of GM rice is needed. Polymerase chain reaction (PCR), currently the most common method for detecting genetically modified organisms, requires temperature cycling and relatively complex procedures. Here we developed a visual and rapid loop-mediated isothermal amplification (LAMP) method to amplify three GM rice event-specific junction sequences. Target DNA was amplified and visualized by two indicators (SYBR green or hydroxy naphthol blue [HNB]) within 60 min at an isothermal temperature of 63 °C. Different kinds of plants were selected to ensure the specificity of detection and the results of the non-target samples were negative, indicating that the primer sets for the three GM rice varieties had good levels of specificity. The sensitivity of LAMP, with detection limits at low concentration levels (0.01%−0.005% GM), was 10- to 100-fold greater than that of conventional PCR. Additionally, the LAMP assay coupled with an indicator (SYBR green or HNB) facilitated analysis. These findings revealed that the rapid detection method was suitable as a simple field-based test to determine the status of GM crops.
Directory of Open Access Journals (Sweden)
Qing Zhu
2012-11-01
Full Text Available Genetically modified (GM rice KMD1, TT51-1, and KF6 are three of the most well known transgenic Bt rice lines in China. A rapid and sensitive molecular assay for risk assessment of GM rice is needed. Polymerase chain reaction (PCR, currently the most common method for detecting genetically modified organisms, requires temperature cycling and relatively complex procedures. Here we developed a visual and rapid loop-mediated isothermal amplification (LAMP method to amplify three GM rice event-specific junction sequences. Target DNA was amplified and visualized by two indicators (SYBR green or hydroxy naphthol blue [HNB] within 60 min at an isothermal temperature of 63 °C. Different kinds of plants were selected to ensure the specificity of detection and the results of the non-target samples were negative, indicating that the primer sets for the three GM rice varieties had good levels of specificity. The sensitivity of LAMP, with detection limits at low concentration levels (0.01%–0.005% GM, was 10- to 100-fold greater than that of conventional PCR. Additionally, the LAMP assay coupled with an indicator (SYBR green or HNB facilitated analysis. These findings revealed that the rapid detection method was suitable as a simple field-based test to determine the status of GM crops.
Liu, Pengpeng; Zhang, Rui; Yu, Wenwen; Ye, Yingnan; Cheng, Yanan; Han, Lei; Dong, Li; Chen, Yongzi; Wei, Xiyin; Yu, Jinpu
2017-12-01
Lung cancer stem cells (LCSCs) are considered as the cellular origins of metastasis and relapse of lung cancer. However, routine two-dimensional culture system (2D-culture) hardly mimics the growth and functions of LCSCs in vivo and therefore significantly decreases the stemness activity of LCSCs. In this study, we constructed a special BME-based three-dimensional culture system (3D-culture) to amplify LCSCs in human lung adenocarcinoma cell line A549 cells and found 3D-culture promoted the enrichment and amplification of LCSCs in A549 cells displaying higher proliferation potential and invasion activity, but lower apoptosis. The expression and secretion levels of FGF1 and IGF1 were dramatically elevated in 3D-culture compared to 2D-culture. After growing in FGF1 and IGF1-conditioned 3D-culture, the proportion of LCSCs with specific stemness phenotypes in A549 cells significantly increased compared to that in conventional 3D suspension culture system. Further results indicated that FGF1 and IGF1 promoted the amplification and cancer stemness of LCSCs dependent on MAPK signaling pathway. Our data firstly established a growth factors-conditioned 3D-culture for LCSCs and demonstrated the effects of FGF1 and IGF1 in promoting the enrichment and amplification of LCSCs which might provide a feasible cell model in vitro for both mechanism study and translational research on lung cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.
Precision charge amplification and digitization system for a scintillating and lead glass array
International Nuclear Information System (INIS)
Delchamps, S.W.; Rameika, R.; Arenton, M.
1989-01-01
A 544-channel low-noise, high-rate, precision charge amplification and ADC system was constructed for the Fermilab Experiment 705 electromagnetic calorimeter, which employs SCG1-C scintillating glass and SF5 lead glass instrumented with photo-multiplier tubes. A general discussion of the system is given, and the charge amplification, fast trigger pulse generation, and analog to digital conversion aspects of the system are presented in more detail. Performance is evaluated using data from Experiment 705 and from off-line tests. Short and long term pedestal stability, baseline recovery and rate capability, linearity of response, and crosstalk between channels are discussed. 8 refs., 2 tabs
Precision charge amplification and digitization system for a scintillating and lead glass array
Energy Technology Data Exchange (ETDEWEB)
Delchamps, S.W.; Rameika, R.; Arenton, M.; Chen, T.Y.; Conetti, S.; Cox, B.; Etemadi, B.; Fortney, L.; Guffey, K.; Haire, M.
1989-01-01
A 544-channel low-noise, high-rate, precision charge amplification and ADC system was constructed for the Fermilab Experiment 705 electromagnetic calorimeter, which employs SCG1-C scintillating glass and SF5 lead glass instrumented with photo-multiplier tubes. A general discussion of the system is given, and the charge amplification, fast trigger pulse generation, and analog to digital conversion aspects of the system are presented in more detail. Performance is evaluated using data from Experiment 705 and from off-line tests. Short and long term pedestal stability, baseline recovery and rate capability, linearity of response, and crosstalk between channels are discussed. 8 refs., 2 tabs.
Relative Role of Horizontal and Vertical Processes in Arctic Amplification
Kim, K. Y.
2017-12-01
The physical mechanism of Arctic amplification is still controversial. Specifically, relative role of vertical processes resulting from the reduction of sea ice in the Barents-Kara Seas is not clearly understood in comparison with the horizontal advection of heat and moisture. Using daily data, heat and moisture budgets are analyzed during winter (Dec. 1-Feb. 28) over the region of sea ice reduction in order to delineate the relative roles of horizontal and vertical processes. Detailed heat and moisture budgets in the atmospheric column indicate that the vertical processes, release of turbulent heat fluxes and evaporation, are a major contributor to the increased temperature and specific humidity over the Barents-Kara Seas. In addition, greenhouse effect caused by the increased specific humidity, also plays an important role in Arctic amplification. Horizontal processes such as advection of heat and moisture are the primary source of variability (fluctuations) in temperature and specific humidity in the atmospheric column. Advection of heat and moisture, on the other hand, is little responsible for the net increase in temperature and specific humidity over the Barents-Kara Seas.
Directory of Open Access Journals (Sweden)
Y. K. CHANG
1999-09-01
Full Text Available The influence of specific mechanical energy (SME on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity of cornmeal at the exit die was influenced by screw speed, rate of total mass flow, mass temperature inside the extruder and SME. An increase in screw speed resulted in an increase in SME and a decrease in viscosity. A reduction in slit die height and an increase in screw speed and mass temperature led to a remarkable macromolecular degradation of the starch, as evidenced by the decrease in viscosity.
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
Liaqat, Iram; Bachmann, Robert Thomas; Sabri, Anjum Nasim; Edyvean, Robert G J
2010-08-01
Dental unit water line (DUWL) contamination by opportunistic pathogens has its significance in nosocomial infection of patients, health care workers, and life-threatening infections to immunocompromized persons. Recently, the quorum sensing (QS) system of DUWL isolates has been found to affect their biofilm-forming ability, making it an attractive target for antimicrobial therapy. In this study, the effect of two quorum-sensing inhibitory compounds (patulin; PAT, penicillic acid; PA) and EDTA on planktonic growth, AI-2 signalling and in vitro biofilm formation of Pseudomonas aeruginosa, Achromobacter xylosoxidans and Achromobacter sp. was monitored. Vibrio harveyi BB170 bioassay and crystal violet staining methods were used to detect the AI-2 monitoring and biofilm formation in DUWL isolates, respectively. The V. harveyi BB170 bioassay failed to induce bioluminescence in A. xylosoxidans and Achromobacter sp., while P. aeruginosa showed AI-2 like activity suggesting the need of some pretreatments prior to bioassay. All strains were found to form biofilms within 72 h of incubation. The QSIs/EDTA combination have isolate-specific effects on biofilm formation and in some cases it stimulated biofilm formation as often as it was inhibited. However, detailed information about the anti-biofilm effect of these compounds is still lacking.
Bohling, Sandra D.; King, Thomas C.; Wittwer, Carl T.; Elenitoba-Johnson, Kojo S. J.
1999-01-01
Polymerase chain reaction (PCR) amplification and product analysis for the detection of chromosomal translocations, such as the t(14;18), has traditionally been a two-step process. PCR product detection has generally entailed gel electrophoresis and/or hybridization or sequencing for confirmation of assay specificity. Using a microvolume fluorimeter integrated with a thermal cycler and a PCR-compatible double-stranded DNA (dsDNA) binding fluorescent dye (SYBR Green I), we investigated the feasibility of simultaneous thermal amplification and detection of MBR/JH translocation products by fluorescence melting curve analysis. We analyzed DNA from 30 cases of lymphoproliferative disorders comprising 19 cases of previously documented MBR/JH-positive follicle center lymphoma and 11 reactive lymphadenopathies. The samples were coded and analyzed blindly for the presence of MBR/JH translocations by fluorescence melting curve analysis. We also performed dilutional assays using the MBR/JH-positive cell line SUDHL-6. Multiplex PCR for MBR/JH and β-globin was used to simultaneously assess sample adequacy. All (100%) of the 19 cases previously determined to be MBR/JH positive by conventional PCR analysis showed a characteristic sharp decrease in fluorescence at ∼90°C by melting curve analysis after amplification. Fluorescence melting peaks obtained by plotting the negative derivative of fluorescence over temperature (−dF/dT) versus temperature (T) showed melting temperatures (Tm) at 88.85 ± 1.15°C. In addition, multiplex assays using both MBR/JH and β-globin primers yielded easily distinguishable fluorescence melting peaks at ∼90°C and 81.2°C, respectively. Dilutional assays revealed that fluorescence melting curve analysis was more sensitive than conventional PCR and agarose gel electrophoresis with ultraviolet transillumination by as much as 100-fold. Simultaneous amplification and fluorescence melting curve analysis is a simple, reliable, and sensitive method
[Investigation of RNA viral genome amplification by multiple displacement amplification technique].
Pang, Zheng; Li, Jian-Dong; Li, Chuan; Liang, Mi-Fang; Li, De-Xin
2013-06-01
In order to facilitate the detection of newly emerging or rare viral infectious diseases, a negative-strand RNA virus-severe fever with thrombocytopenia syndrome bunyavirus, and a positive-strand RNA virus-dengue virus, were used to investigate RNA viral genome unspecific amplification by multiple displacement amplification technique from clinical samples. Series of 10-fold diluted purified viral RNA were utilized as analog samples with different pathogen loads, after a series of reactions were sequentially processed, single-strand cDNA, double-strand cDNA, double-strand cDNA treated with ligation without or with supplemental RNA were generated, then a Phi29 DNA polymerase depended isothermal amplification was employed, and finally the target gene copies were detected by real time PCR assays to evaluate the amplification efficiencies of various methods. The results showed that multiple displacement amplification effects of single-strand or double-strand cDNA templates were limited, while the fold increases of double-strand cDNA templates treated with ligation could be up to 6 X 10(3), even 2 X 10(5) when supplemental RNA existed, and better results were obtained when viral RNA loads were lower. A RNA viral genome amplification system using multiple displacement amplification technique was established in this study and effective amplification of RNA viral genome with low load was achieved, which could provide a tool to synthesize adequate viral genome for multiplex pathogens detection.
Directory of Open Access Journals (Sweden)
Silvia La Monica
Full Text Available Despite the initial response, all patients with epidermal growth factor receptor (EGFR-mutant non-small cell lung cancer (NSCLC eventually develop acquired resistance to EGFR tyrosine kinase inhibitors (TKIs. The EGFR-T790M secondary mutation is responsible for half of acquired resistance cases, while MET amplification has been associated with acquired resistance in about 5-15% of NSCLCs. Clinical findings indicate the retained addiction of resistant tumors on EGFR signaling. Therefore, we evaluated the molecular mechanisms supporting the therapeutic potential of gefitinib maintenance in the HCC827 GR5 NSCLC cell line harbouring MET amplification as acquired resistance mechanism. We demonstrated that resistant cells can proliferate and survive regardless of the presence of gefitinib, whereas the absence of the drug significantly enhanced cell migration and invasion. Moreover, the continuous exposure to gefitinib prevented the epithelial-mesenchymal transition (EMT with increased E-cadherin expression and down-regulation of vimentin and N-cadherin. Importantly, the inhibition of cellular migration was correlated with the suppression of EGFR-dependent Src, STAT5 and p38 signaling as assessed by a specific kinase array, western blot analysis and silencing functional studies. On the contrary, the lack of effect of gefitinib on EGFR phosphorylation in the H1975 cells (EGFR-T790M correlated with the absence of effects on cell migration and invasion. In conclusion, our findings suggest that certain EGFR-mutated patients may still benefit from a second-line therapy including gefitinib based on the specific mechanism underlying tumor cell resistance.
Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance
Directory of Open Access Journals (Sweden)
Haque Kashif A
2005-09-01
Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of
International Nuclear Information System (INIS)
Huang Guoliang; Yang Xiaoyong; Ma Li; Yang Xu
2011-01-01
In this paper, we developed a metal micro-fluidic chip with advanced surface processing for ultra-small volume molecular isothermal amplification. This method takes advantages of the nucleic acid amplification with good stability and consistency, high sensitivity about 31 genomic DNA copies and bacteria specific gene identification. Based on the advanced surface processing, the bioreaction assays of nucleic acid amplification was dropped about 392nl in volume. A high numerical aperture confocal optical detection system was advanced to sensitively monitor the DNA amplification with low noise and high power collecting fluorescence near to the optical diffraction limit. A speedy nucleic acid isothermal amplification was performed in the ultra-small volume microfluidic chip, where the time at the inflexions of second derivative to DNA exponential amplified curves was brought forward and the sensitivity was improved about 65 folds to that of in current 25μl Ep-tube amplified reaction, which indicates a promising clinic molecular diagnostics in the droplet amplification.
HER2 gene amplification in patients with prostate cancer: Evaluating a CISH-based method.
Sharifi, Nazanin; Salmaninejad, Arash; Ferdosi, Samira; Bajestani, Abolfazl Nesaei; Khaleghiyan, Malihe; Estiar, Mehrdad Asghari; Jamali, Mansour; Nowroozi, Mohammad Reza; Shakoori, Abbas
2016-12-01
Prostate cancer (PCa) is one of the most widespread malignancies in the world. The role of the human epidermal growth factor receptor 2 (HER2) in the pathogenesis and progression of human PCa remains poorly understood. In contradiction with breast cancer, studies on HER2 overexpression and gene amplification in PCa have produced varying results, although the HER2 oncogene has been implicated in the biology of numerous tumor types, and serves as a prognostic marker and therapeutic target in breast cancer. Technical challenges are considered the main reasons for data discrepancies. Amplification of the HER2 gene has previously been reported in PCa, in which it was associated with tumor progression. The present study aimed to evaluate the prevalence and clinical significance of HER2 amplification in PCa. A total of 32 biopsy samples obtained from human prostate adenocarcinomas were evaluated by chromogenic in situ hybridization (CISH) to determine the frequency of patients with HER2 gene amplifications. High copy numbers of HER2 were detected in 19 of the prostate tumors analyzed. The results of the present study suggested that, in patients without amplification of HER2, high levels of prostate-specific antigen or a high Gleason score were not significantly correlated with a high pathologic stage. Furthermore, amplification levels of the HER2 gene were directly associated with pathologic stage in patients with PCa. Therefore, the potential use of HER2 as a prognostic factor or therapeutic target for PCa warrants further study.
Helicase-dependent amplification of nucleic acids.
Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand
2013-10-11
Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.
Energy Technology Data Exchange (ETDEWEB)
Akabani, Gamal [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Carlin, Sean [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Welsh, Phil [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States)]. E-mail: zalut001@mc.duke.edu
2006-04-15
Introduction: Radioimmunotherapy with anti-HER2 monoclonal antibodies (mAbs) such as trastuzumab is a promising strategy for treating HER2-positive breast and ovarian carcinoma patients. The objective of this study was to determine the cytotoxic effectiveness of trastuzumab labeled with the 7.2-h half-life {alpha}-particle emitter {sup 211}At. Methods: Experiments were performed on SKBr-3, BT-474 and the transfected MCF7/HER2-18 human breast carcinoma cell lines. Intrinsic radiosensitivity was determined after exposure to external beam irradiation. The cytotoxicity of {sup 211}At-labeled trastuzumab was measured by clonogenic assays. The distribution of HER2 receptor expression on the cell lines was measured using fluorescence-activated cell sorting. A pharmacokinetic (PK)/microdosimetric model was established to assess the effects of specific activity (SA), HER2 receptor expression and absorbed dose on survival fraction (SF). Results: With external beam irradiation, the 2-Gy SF for BT-474, SKBr-3 and MCF7/HER2-18 cells was 0.78, 0.53 and 0.64 Gy, respectively. Heterogeneous HER2 expression was observed, with a subpopulation of cells lacking measurable receptor (14.5%, SKBr-3; 0.34%, MCF-7/HER2; 1.73%, BT-474). When plotted as a function of activity concentration, SF curves were biphasic and inversely proportional to SA; however, when the model was applied and absorbed doses calculated, the SF curve was monoexponential independent of SA. Thus, the PK model was able to demonstrate the effects of competition between cold and labeled mAb. These studies showed that the relative biological effectiveness of {sup 211}At-labeled trastuzaumab was about 10 times higher than that of external beam therapy. Conclusion: These in vitro studies showed that {sup 211}At-labeled trastuzumab mAb is an effective cytotoxic agent for the treatment of HER2-positive tumor cells. The SA of the labeled mAb and the homogeneity of HER2 receptor expression are important variables influencing
Labbé, I.; Oesch, P. A.; Bouwens, R. J.; Illingworth, G. D.; Magee, D.; González, V.; Carollo, C. M.; Franx, M.; Trenti, M.; van Dokkum, P. G.; Stiavelli, M.
2013-11-01
Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ~ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ~120h over the HUDF reaching depths of ~28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct >=3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at >=5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ~ 8 are markedly redder than those at z ~ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ~ 7 and z ~ 8 we estimate a rest-frame equivalent width of {W}_{[O\\,\\scriptsize{III}]\\ \\lambda \\lambda 4959,5007+H\\beta }=670^{+260}_{-170} Å contributing 0.56^{+0.16}_{-0.11} mag to the [4.5] filter at z ~ 8. The corresponding {W}_{H\\alpha }=430^{+160}_{-110} Å implies an average specific star formation rate of sSFR=11_{-5}^{+11} Gyr-1 and a stellar population age of 100_{-50}^{+100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ~3 ×, decreasing the integrated stellar mass density to \\rho ^*(z=8,M_{\\rm{UV}}Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with programs #11563, 9797. Based on observations with the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of
Energy Technology Data Exchange (ETDEWEB)
Labbé, I.; Bouwens, R. J.; Franx, M. [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Oesch, P. A.; Illingworth, G. D.; Magee, D.; González, V. [UCO/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Carollo, C. M. [Institute for Astronomy, ETH Zurich, 8092 Zurich (Switzerland); Trenti, M. [Kavli Institute for Cosmology and Institute of Astronomy, University of Cambridge, Cambridge (United Kingdom); Van Dokkum, P. G. [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Stiavelli, M. [Space Telescope Science Institute, Baltimore, MD 21218 (United States)
2013-11-10
Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ∼ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ∼120h over the HUDF reaching depths of ∼28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct ≥3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at ≥5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ∼ 8 are markedly redder than those at z ∼ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ∼ 7 and z ∼ 8 we estimate a rest-frame equivalent width of contributing 0.56{sup +0.16}{sub -0.11} mag to the [4.5] filter at z ∼ 8. The corresponding W{sub Hα}=430{sup +160}{sub -110} Å implies an average specific star formation rate of sSFR=11{sub -5}{sup +11} Gyr{sup –1} and a stellar population age of 100{sub -50}{sup +100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ∼3 ×, decreasing the integrated stellar mass density to ρ{sup *}(z=8,M{sub UV}<-18)=0.6{sup +0.4}{sub -0.3}×10{sup 6} M{sub sun} Mpc{sup –3}.
D Wang; X Wang; Y Geng; C An
2014-01-01
Purpose : The objective of this study was to develop a sensitive, specific and rapid approach to diagnose hand foot and mouth disease (HFMD) for an early treatment by using loop-mediated isothermal amplification (LAMP) technique. Materials and Methods : A reverse-transcription loop-mediated isothermal amplification (RT-LAMP) for detecting EV71 virus was developed, the specificity and sensitivity of RT-LAMP was tested, and the clinical specimens was assayed by the RT-LAMP comparing with conven...
Internal amplification control of PCR for the Glu1-Dx5 allele in wheat.
Heim, H N; Vieira, E S N; Polo, L R T; Lima, N K; Silva, G J; Linde, G A; Colauto, N B; Schuster, I
2017-08-17
One of the limiting factors in using dominant markers is the unique amplification of the target fragment. Therefore, failures in polymerase chain reaction (PCR) or non-amplifications can be interpreted as an absence of the allele. The possibility of false negatives implies in reduced efficiency in the selection process in genetic breeding programs besides the loss of valuable genetic material. Thus, this study aimed to evaluate the viability of a microsatellite marker as an internal amplification control with a dominant marker for the wheat Glu1-Dx5 gene. A population of 77 wheat cultivars/breeding lines was analyzed. Fourteen microsatellite markers were analyzed in silico regarding the formation of dimers and clamps. The biplex reaction conditions were optimized, and the Xbarc117 marker was selected as the internal amplification control with a Glu1-Dx5 marker in wheat. It was concluded that the Xbarc117 microsatellite marker was effective in the simultaneous amplification with a dominant Glu1-Dx5 marker, making biplex PCR viable in wheat for the studied markers.
ESTIMATION OF AMPLIFICATION FACTOR IN EARTHQUAKE ENGINEERING
Directory of Open Access Journals (Sweden)
Nazarov Yuriy Pavlovich
2015-03-01
Full Text Available The authors are the developers of Odyssey Software (Eurosoft Co. for the analysis of seismological data and computing of seismic loads and their parameters. While communicating with the users of the software, the authors have revealed some uncertainty about both understanding of the term "amplification factor (AF" and calculation of the amplification factor using various methods. In this article, a simple example shows that the determination of the amplification factor as the ratio of the acceleration’s spectrum to the maximal acceleration is derived from the classical definition of AF in the form of the ratio of maximal dynamic displacement to the displacement by the action of static load. Deterministic and probabilistic ap-proaches for the calculating of the AF were discussed. There was an example of AFs calculation and their envelopes for translational and rotational components of seismic impact by using Odyssey Software.
Amplification of hofmeister effect by alcohols.
Xu, Yun; Liu, Guangming
2014-07-03
We have demonstrated that Hofmeister effect can be amplified by adding alcohols to aqueous solutions. The lower critical solution temperature behavior of poly(N-isopropylacrylamide) has been employed as the model system to study the amplification of Hofmeister effect. The alcohols can more effectively amplify the Hofmeister effect following the series methanol alcohols and following the series d-sorbitol ≈ xylitol ≈ meso-erythritol alcohols. Our study reveals that the relative extent of amplification of Hofmeister effect is determined by the stability of the water/alcohol complex, which is strongly dependent on the chemical structure of alcohols. The more stable solvent complex formed via stronger hydrogen bonds can more effectively differentiate the anions through the anion-solvent complex interactions, resulting in a stronger amplification of Hofmeister effect. This study provides an alternative method to tune the relative strength of Hofmeister effect besides salt concentration.
Lidar using the backscatter amplification effect
Razenkov, Igor A.; Banakh, Victor A.
2018-04-01
Experimental data proving the possibility of lidar measurement of the refractive turbulence strength based on the effect of backscatter amplification (BSA) are reported. It is shown that the values of the amplification factor correlate with the variance of random jitter of optical image of an incoherent light source depending on the value of the structure constant of the air refractive index turbulent fluctuations averaged over the probing path. This paper presents the results of measurements of the BSA factor in comparison with the simultaneous measurements of the BSA peak, which is very narrow and only occurs on the laser beam axis. It is constructed the range-time images of the derivative of the amplification factor gives a comprehensive picture of the location of turbulent zones and their temporal dynamics.
Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.
Directory of Open Access Journals (Sweden)
David S Boyle
Full Text Available Improved access to effective tests for diagnosing tuberculosis (TB has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110 and 20 fg (IS1081were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9 and 86.1% (95%CI: 78.1, 94.1 respectively (n = 71. Specificities were 100% and 88.6% (95% CI: 80.8, 96.1 respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2 and 70.8% (95%CI: 62.9, 78.7 were obtained (n = 90. Specificities were 95.4 (95% CI: 92.3,98.1 and 88% (95% CI: 83.6, 92.4 respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB
Lizio, Marina; Ishizu, Yuri; Itoh, Masayoshi; Lassmann, Timo; Hasegawa, Akira; Kubosaki, Atsutaka; Severin, Jessica; Kawaji, Hideya; Nakamura, Yukio; Suzuki, Harukazu; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.
2015-01-01
Mammals are composed of hundreds of different cell types with specialized functions. Each of these cellular phenotypes are controlled by different combinations of transcription factors. Using a human non islet cell insulinoma cell line (TC-YIK) which expresses insulin and the majority of known pancreatic beta cell specific genes as an example, we describe a general approach to identify key cell-type-specific transcription factors (TFs) and their direct and indirect targets. By ranking all human TFs by their level of enriched expression in TC-YIK relative to a broad collection of samples (FANTOM5), we confirmed known key regulators of pancreatic function and development. Systematic siRNA mediated perturbation of these TFs followed by qRT-PCR revealed their interconnections with NEUROD1 at the top of the regulation hierarchy and its depletion drastically reducing insulin levels. For 15 of the TF knock-downs (KD), we then used Cap Analysis of Gene Expression (CAGE) to identify thousands of their targets genome-wide (KD-CAGE). The data confirm NEUROD1 as a key positive regulator in the transcriptional regulatory network (TRN), and ISL1, and PROX1 as antagonists. As a complimentary approach we used ChIP-seq on four of these factors to identify NEUROD1, LMX1A, PAX6, and RFX6 binding sites in the human genome. Examining the overlap between genes perturbed in the KD-CAGE experiments and genes with a ChIP-seq peak within 50 kb of their promoter, we identified direct transcriptional targets of these TFs. Integration of KD-CAGE and ChIP-seq data shows that both NEUROD1 and LMX1A work as the main transcriptional activators. In the core TRN (i.e., TF-TF only), NEUROD1 directly transcriptionally activates the pancreatic TFs HSF4, INSM1, MLXIPL, MYT1, NKX6-3, ONECUT2, PAX4, PROX1, RFX6, ST18, DACH1, and SHOX2, while LMX1A directly transcriptionally activates DACH1, SHOX2, PAX6, and PDX1. Analysis of these complementary datasets suggests the need for caution in interpreting Ch
Electrochemical DNA biosensor based on MNAzyme-mediated signal amplification
International Nuclear Information System (INIS)
Diao, Wei; Tang, Min; Ding, Xiaojuan; Zhang, Ye; Yang, Jianru; Cheng, Wenbin; Mo, Fei; Wen, Bo; Xu, Lulu; Yan, Yurong
2016-01-01
The authors describe an electrochemical sensing strategy for highly sensitive and specific detection of target (analyte) DNA based on an amplification scheme mediated by a multicomponent nucleic acid enzyme (MNAzyme). MNAzymes were formed by multicomponent complexes which produce amplified “output” signals in response to specific “input” signal. In the presence of target nucleic acid, multiple partial enzymes (partzymes) oligonucleotides are assembled to form active MNAzymes. These can cleave H0 substrate into two pieces, thereby releasing the activated MNAzyme to undergo an additional cycle of amplification. Here, the two pieces contain a biotin-tagged sequence and a byproduct. The biotin-tagged sequences are specifically captured by the detection probes immobilized on the gold electrode. By employing streptavidinylated alkaline phosphatase as an enzyme label, an electrochemical signal is obtained. The electrode, if operated at a working potential of 0.25 V (vs. Ag/AgCl) in solution of pH 7.5, covers the 100 pM to 0.25 μM DNA concentration range, with a 79 pM detection limit. In our perception, the strategy introduced here has a wider potential in that it may be applied to molecular diagnostics and pathogen detection. (author)
Ultrashort pulse shaping by optical parametric chirped amplification
International Nuclear Information System (INIS)
Nelet, Ambre
2007-01-01
The aim of this work is to propose new laser architectures based on optical parametric chirped pulse amplification (OPCPA). Common goals of OPCPA pre-amplifiers are to reach high energy level while maintaining the spectrum width and to adapt geometry of the amplified beam to the high power laser chain optics. We consider OPCPA as a way to control and to sculpt ultrashort pulses. Our first set-up aims at thwarting possible time recovery default between pump and signal pulses, which lower the energy extraction. A regenerative OPCPA, idler resonant, is a way to produce a high-intensity and high-repetition rate train of amplified signal replicas. Our second laser system pre-compensates the spectral gain narrowing by sculpting pulses directly within the OPCPA section, where a temporal shaping of the pump beam permits a spectro-spectral shaping of the amplified signal. Finally, we propose an OPCPA based on spatial coding and uniform amplification of spectral signal components by using a fan-out periodically poled crystal and a zero dispersion line. (author) [fr
Zhu, Yazhen; Lu, Dan; Lira, Maruja E; Xu, Qing; Du, Yunzhi; Xiong, Jianghong; Mao, Mao; Chung, Hyun Cheol; Zheng, Guangjuan
2016-04-01
Human epidermal growth factor receptor 2 (HER2) is a key driver of tumorigenesis, and over-expression as a result of HER2 gene amplification has been observed in a number of solid tumors. Recently HER2 has become an important biomarker for the monoclonal antibody treatment of HER2-positive metastatic breast and advanced gastric cancer. The HER2 targeting antibody trastuzumab treatment requires accurate measurement of HER2 levels for proper diagnosis. Droplet digital PCR (ddPCR) with highly direct, precise and absolute nucleic acid quantification could be used to detect HER2 amplification levels. Our objective was to evaluate a robust, accurate and less subjective application of ddPCR for HER2 amplification levels and test the assay performance in clinical formalin-fixed paraffin-embedded (FFPE) breast and gastric carcinoma samples. Genomic DNA from HER2 amplified cell line SK-BR-3 was used to set up the ddPCR assays. The copy number of HER2 was compared to the chromosome 17 centromere reference gene (CEP17), expressed as HER2:CEP17 ratio. Genomic DNAs of FFPE specimens from 145 Asian patients with breast and gastric carcinomas were assayed using both standard methods, immunohistochemistry (IHC) and/or fluorescence in situ hybridization (FISH), and ddPCR. Based on 145 clinical breast and gastric carcinoma cases, our study demonstrated a high concordance of ddPCR results to FISH and IHC. In breast cancer specimens, the ddPCR results had high concordance with FISH and IHC defined HER2 status with a sensitivity of 90.9% (30/33) and a specificity of 100% (77/77). In gastric cancer specimens that were concordant in both FISH and IHC, our assay was 95.5% concordant with FISH and IHC (21/22). ddPCR has the advantage of automation and also allows levels of HER2 amplification to be easily evaluated in large numbers of samples, and presents a potential option to define HER2 status. Copyright © 2015 Elsevier Inc. All rights reserved.
By-Product Formation in Repetitive PCR Amplification of DNA Libraries during SELEX
DEFF Research Database (Denmark)
Tolle, Fabian; Wilke, Julian; Wengel, Jesper
2014-01-01
The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target-recogniz......The selection of nucleic acid aptamers is an increasingly important approach to generate specific ligands binding to virtually any molecule of choice. However, selection-inherent amplification procedures are prone to artificial by-product formation that prohibits the enrichment of target......-recognizing aptamers. Little is known about the formation of such by-products when employing nucleic acid libraries as templates. We report on the formation of two different forms of by-products, named ladder- and non-ladder-type observed during repetitive amplification in the course of in vitro selection experiments....... Based on sequence information and the amplification behaviour of defined enriched nucleic acid molecules we suppose a molecular mechanism through which these amplification by-products are built. Better understanding of these mechanisms might help to find solutions minimizing by-product formation...
Trangoni, Marcos D; Gioffré, Andrea K; Cravero, Silvio L
2017-01-01
LAMP (loop-mediated isothermal amplification) is an isothermal nucleic acid amplification technique that is characterized by its efficiency, rapidity, high yield of final product, robustness, sensitivity, and specificity, with the blueprint that it can be implemented in laboratories of low technological complexity. Despite the conceptual complexity underlying the mechanistic basis for the nucleic acid amplification, the technique is simple to use and the amplification and detection can be carried out in just one step. In this chapter, we present a protocol based on LAMP for the rapid identification of isolates of Brucella spp. and Mycobacterium avium subsp. paratuberculosis, two major bacterial pathogens in veterinary medicine.
Amplification in Technical Manuals: Theory and Practice.
Killingsworth, M. Jimmie; And Others
1989-01-01
Examines how amplification (rhetorical techniques by which discourse is extended to enhance its appeal and information value) tends to increase and improve the coverage, rationale, warnings, behavioral alternatives, examples, previews, and general emphasis of technical manuals. Shows how classical and modern rhetorical theories can be applied to…
Intelligence amplification framework for enhancing scheduling processes
Dobrkovic, Andrej; Liu, Luyao; Iacob, Maria Eugenia; van Hillegersberg, Jos
2016-01-01
The scheduling process in a typical business environment consists of predominantly repetitive tasks that have to be completed in limited time and often containing some form of uncertainty. The intelligence amplification is a symbiotic relationship between a human and an intelligent agent. This
Social amplification of risk: a conceptual framework
International Nuclear Information System (INIS)
Kasperson, R.E.; Renn, O.; Slovic, P.; Brown, H.S.; Emel, J.; Goble, R.; Kasperson, J.X.; Ratick, S.
1988-01-01
One of the most perplexing problems in risk analysis is why some relatively minor risks or risk events, as assessed by technical experts, often elicit strong public concerns and result in substantial impacts upon society and economy. This article sets forth a conceptual framework that seeks to link systematically the technical assessment of risk with psychological, sociological, and cultural perspectives of risk perception and risk-related behavior. The main thesis is that hazards interact with psychological, social, institutional, and cultural processes in ways that may amplify or attenuate public responses to the risk or risk event. A structural description of the social amplification of risk is now possible. Amplification occurs at two stages: in the transfer of information about the risk, and in the response mechanisms of society. Signals about risk are processed by individual and social amplification stations, including the scientist who communicates the risk assessment, the news media, cultural groups, interpersonal networks, and others. Key steps of amplifications can be identified at each stage. The amplified risk leads to behavioral responses, which, in turn, result in secondary impacts. Models are presented that portray the elements and linkages in the proposed conceptual framework
Directory of Open Access Journals (Sweden)
Xiaoyan Zhang
Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry
Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan
2014-01-01
Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid
Johnson, Chad J.; Aiken, Judd M.; McKenzie, Debbie; Samuel, Michael D.; Pedersen, Joel A.
2012-01-01
Protein misfolding cyclic amplification (PMCA) has emerged as an important technique for detecting low levels of pathogenic prion protein in biological samples. The method exploits the ability of the pathogenic prion protein to convert the normal prion protein to a proteinase K-resistant conformation. Inclusion of Teflon® beads in the PMCA reaction (PMCAb) has been previously shown to increase the sensitivity and robustness of detection for the 263 K and SSLOW strains of hamster-adapted prions. Here, we demonstrate that PMCAb with saponin dramatically increases the sensitivity of detection for chronic wasting disease (CWD) agent without compromising the specificity of the assay (i.e., no false positive results). Addition of Teflon® beads increased the robustness of the PMCA reaction, resulting in a decrease in the variability of PMCA results. Three rounds of serial PMCAb allowed detection of CWD agent from a 6.7×10−13 dilution of 10% brain homogenate (1.3 fg of source brain). Titration of the same brain homogenate in transgenic mice expressing cervid prion protein (Tg(CerPrP)1536+/−mice) allowed detection of CWD agent from the 10−6 dilution of 10% brain homogenate. PMCAb is, thus, more sensitive than bioassay in transgenic mice by a factor exceeding 105. Additionally, we are able to amplify CWD agent from brain tissue and lymph nodes of CWD-positive white-tailed deer having Prnp alleles associated with reduced disease susceptibility.
Directory of Open Access Journals (Sweden)
Chad J Johnson
Full Text Available Protein misfolding cyclic amplification (PMCA has emerged as an important technique for detecting low levels of pathogenic prion protein in biological samples. The method exploits the ability of the pathogenic prion protein to convert the normal prion protein to a proteinase K-resistant conformation. Inclusion of Teflon® beads in the PMCA reaction (PMCAb has been previously shown to increase the sensitivity and robustness of detection for the 263 K and SSLOW strains of hamster-adapted prions. Here, we demonstrate that PMCAb with saponin dramatically increases the sensitivity of detection for chronic wasting disease (CWD agent without compromising the specificity of the assay (i.e., no false positive results. Addition of Teflon® beads increased the robustness of the PMCA reaction, resulting in a decrease in the variability of PMCA results. Three rounds of serial PMCAb allowed detection of CWD agent from a 6.7 × 10(-13 dilution of 10% brain homogenate (1.3 fg of source brain. Titration of the same brain homogenate in transgenic mice expressing cervid prion protein (Tg(CerPrP1536(+/- mice allowed detection of CWD agent from the 10(-6 dilution of 10% brain homogenate. PMCAb is, thus, more sensitive than bioassay in transgenic mice by a factor exceeding 10(5. Additionally, we are able to amplify CWD agent from brain tissue and lymph nodes of CWD-positive white-tailed deer having Prnp alleles associated with reduced disease susceptibility.
Li, Xia; Song, Juan; Xue, Qing-Wang; You, Fu-Heng; Lu, Xia; Kong, Yan-Cong; Ma, Shu-Yi; Jiang, Wei; Li, Chen-Zhong
2016-10-21
Bisphenol A (BPA) detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA)/Exonuclease III (Exo III)-combined cascade amplification strategy. First, the duplex DNA probe (RP) with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of "G-quadruplex" in lantern-like structures. Finally, the continuously enriched "G-quadruplex lanterns" were lightened by zinc(II)-protoporphyrin IX (ZnPPIX) generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10 -17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX) provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Directory of Open Access Journals (Sweden)
Xia Li
2016-10-01
Full Text Available Bisphenol A (BPA detection in drinking water and food packaging materials has attracted much attention since the discovery that BPA can interfere with normal physiological processes and cause adverse health effects. Here, we constructed a label-free aptamer fluorescent assay for selective and sensitive detection of BPA based on the rolling circle amplification (RCA/Exonuclease III (Exo III-combined cascade amplification strategy. First, the duplex DNA probe (RP with anti-BPA aptamer and trigger sequence was designed for BPA recognition and signal amplification. Next, under the action of BPA, the trigger probe was liberated from RP to initiate RCA reaction as primary amplification. Subsequently, the RCA products were used to trigger Exo III assisted secondary amplification with the help of hairpin probes, producing plenty of “G-quadruplex” in lantern-like structures. Finally, the continuously enriched “G-quadruplex lanterns” were lightened by zinc(II-protoporphyrin IX (ZnPPIX generating enhanced fluorescence signals. By integrating the primary RCA and secondary Exo III mediated cascade amplification strategy, this method displayed an excellent sensitivity with the detection limits of 5.4 × 10−17 M. In addition, the anti-BPA aptamer exhibits high recognition ability with BPA, guaranteeing the specificity of detection. The reporter signal probe (G-quadruplex with ZnPPIX provides a label-free fluorescence signals readout without complicated labeling procedures, making the method simple in design and cost-effective in operation. Moreover, environmental samples analysis was also performed, suggesting that our strategy was reliable and had a great potential application in environmental monitoring.
Lalam, N.; Jacob, C.
2007-01-01
The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of
Ahmadi, S.; Almasi, A.M.; Fatehi, F.; Struik, P.C.; Moradi, A.
2013-01-01
Loop-mediated isothermal amplification (LAMP) assay is a novel technique for amplifying DNA under constant temperature, with high specificity, sensitivity, rapidity and efficiency. We applied reverse transcription loop-mediated isothermal amplification (RT-LAMP) to visually detect Potato leafroll
Metcalfe, Hannah J; Biffar, Lucia; Steinbach, Sabine; Guzman, Efrain; Connelley, Tim; Morrison, Ivan; Vordermeier, H Martin; Villarreal-Ramos, Bernardo
2018-05-11
There is a need to improve the efficacy of the BCG vaccine against human and bovine tuberculosis. Previous data showed that boosting bacilli Calmette-Guerin (BCG)-vaccinated cattle with a recombinant attenuated human type 5 adenovirally vectored subunit vaccine (Ad5-85A) increased BCG protection and was associated with increased frequency of Ag85A-specific CD4 + T cells post-boosting. Here, the capacity of Ag85A-specific CD4 + T cell lines - derived before and after viral boosting - to interact with BCG-infected macrophages was evaluated. No difference before and after boosting was found in the capacity of these Ag85A-specific CD4 + T cell lines to restrict mycobacterial growth, but the secretion of IL-10 in vitro post-boost increased significantly. Furthermore, cell lines derived post-boost had no statistically significant difference in the secretion of pro-inflammatory cytokines (IL-1β, IL-12, IFNγ or TNFα) compared to pre-boost lines. In conclusion, the protection associated with the increased number of Ag85A-specific CD4 + T cells restricting mycobacterial growth may be associated with anti-inflammatory properties to limit immune-pathology. Copyright © 2018 Department for Environment Food and Rural Affairs. Published by Elsevier Ltd.. All rights reserved.
Mart?nez-Valladares, Mar?a; Rojo-V?zquez, Francisco Antonio
2016-01-01
Background Loop-mediated isothermal amplification (LAMP) is a very specific, efficient, and rapid gene amplification procedure in which the reaction can run at a constant temperature. In the current study we have developed a LAMP assay to improve the diagnosis of Fasciola spp. in the faeces of sheep. Findings After the optimisation of the LAMP assay we have shown similar results between this technique and the standard PCR using the outer primers of the LAMP reaction. In both cases the limit o...
Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry
2013-06-01
Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.
Directory of Open Access Journals (Sweden)
Rothuizen Jan
2006-09-01
Full Text Available Abstract Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE, mammary carcinoma (P114, and osteosarcoma (D17. These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors.
DEFF Research Database (Denmark)
Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina
2002-01-01
background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....
Directory of Open Access Journals (Sweden)
Yu Zhang
2016-07-01
Full Text Available Frontotemporal dementia (FTD is an early onset neurodegenerative disease. Mutations in several genes cause familial FTD and one of them is charged multivesicular body protein 2B (CHMP2B on chromosome 3 (FTD3, a component of the endosomal sorting complex required for transport III (ESCRT-III. We have generated an induced pluripotent stem cell (iPSC line of a healthy individual and inserted the CHMP2B IVS5AS G-C gene mutation into both alleles, resulting in aberrant splicing. This human iPSC line provides an ideal model to study CHMP2B-dependent phenotypes of FTD3.
Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido
2018-02-08
Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays
Tuncel, Aykut; Cevdet Özdag, Özkan; Pamuk, Eren; Akgün, Mustafa
2017-12-01
Single Station Microtremor method, which is widely used nowadays, is an effective and easy applicable method. In this study, dynamic amplification factor distributions of the study area were obtained using scenario earthquake parameters with single station microtremor data gathered at 112 points. In addition, a surface wave active method, which is known as MASW (Multichannel Analysis of Surface Waves), was applied at 43 profiles to calculate the soil amplification values. Dynamic amplification factor (DAF), soil amplification, the predominant soil period (PSP), geology and topography data of the study area were analysed together. Dynamic amplification factor and soil amplification values were obtained 2 or higher at about sea level parts of the study area which are generally composed of alluvial units. Additionally, in high altitude regions that are composed of volcanic rocks, relatively lower dynamic amplification factor and soil amplification values were obtained. The minimum amplification value in the study area was 1.15, while the maximum amplification value was 3.05 according to the dynamic amplification results and the soil amplification values were between 1.16 and 3.85 in harmony. It is seen that the obtained DAF values and the soil amplification values calculated from the seismic velocities are very similar to each other numerically and regionally. Because of this, it is concluded that the values of the soil amplification obtained by the MASW method and the calculated DAF values in this study are in harmony with each other. Although the depths of research in these two calculation methods are different from each other, the similarity of the results allows us to arrive at the result of how effective the ground layer is on the amplification. It has a great importance to calculate the amplification values and other dynamic parameters by in situ measurements for a planned plot because geological units can vary even at very short distances in heterogeneously
Radiosensitivity and TP 53, EGFR amplification and LOH10 analysis of primary glioma cell cultures
International Nuclear Information System (INIS)
Gerlach, B.; Harder, A.H.; Slotman, B.J.; Sminia, P.; Hulsebos, T.J.M.; Leenstra, S.; Peter Vandertop, W.; Hartmann, K.A.
2002-01-01
Aim: Determination of in-vitro radiosensitivity and genetic alterations of cell cultures derived from human glioma biopsy tissue and established glioma cell lines. Material and Methods: Fresh brain tumor specimens of six patients were processed to early passage cell cultures. In addition the cell lines D 384 and Gli 6 were used. Cell cultures were irradiated with doses from 2 to 10 Gy. Following irradiation, cell survival was determined by clonogenic assay and survival curves were generated. The surviving fractions after 2 Gy (SF2) and 4 Gy (SF4) were used as radiosensitivity parameters. Genetic analysis included determination of the mutational and loss of heterozygosity (LOH) status of TP 53 (exons 5-8), the LOH 10- and epidermal growth factor receptor gene (EGFR) amplification status. Results: The SF2 and SF4 values ranged from 0.54 to 0.88 (mean: 0.70) and from 0.13 to 0.52 (mean: 0.32), respectively. Genetic alterations were found in the Gli 6 cell line and in two primary cell cultures. The genetic profile of Gli 6 showed LOH but no TP 53 mutation, complete LOH 10 and no EGFR amplification. The VU 15 cell culture showed TP 53 mutation but no LOH 10 or EGFR amplification, while VU 24 showed incomplete LOH 10, EGFR amplification and no TP 53 mutation. In the other four cell cultures and D 384 cell line no genetic alterations were diagnosed. Histopathological classification of glioblastoma multiforme and/or genetic alterations resulted in lower radiosensitivity. Conclusion: In this small series of early passage glioma cell cultures low radiosensitivity and alterations in cell regulatory genes were seen. Further testing of biological behavior in larger series of patient-derived material is ongoing. (orig.)
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this
Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.
2010-05-04
A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.
Zhou, Hong; Liu, Jing; Xu, Jing-Juan; Zhang, Shu-Sheng; Chen, Hong-Yuan
2018-03-21
Modern optical detection technology plays a critical role in current clinical detection due to its high sensitivity and accuracy. However, higher requirements such as extremely high detection sensitivity have been put forward due to the clinical needs for the early finding and diagnosing of malignant tumors which are significant for tumor therapy. The technology of isothermal amplification with nucleic acids opens up avenues for meeting this requirement. Recent reports have shown that a nucleic acid amplification-assisted modern optical sensing interface has achieved satisfactory sensitivity and accuracy, high speed and specificity. Compared with isothermal amplification technology designed to work completely in a solution system, solid biosensing interfaces demonstrated better performances in stability and sensitivity due to their ease of separation from the reaction mixture and the better signal transduction on these optical nano-biosensing interfaces. Also the flexibility and designability during the construction of these nano-biosensing interfaces provided a promising research topic for the ultrasensitive detection of cancer diseases. In this review, we describe the construction of the burgeoning number of optical nano-biosensing interfaces assisted by a nucleic acid amplification strategy, and provide insightful views on: (1) approaches to the smart fabrication of an optical nano-biosensing interface, (2) biosensing mechanisms via the nucleic acid amplification method, (3) the newest strategies and future perspectives.
Minozzi, G.; Parmentier, H.K.; Mignon-Grasteau, S.; Nieuwland, M.G.B.; Bed'hom, B.; Gourichon, D.; Minvielle, F.; Pinard-van der Laan, M.H.
2008-01-01
Background - The effect of selection for three general immune response traits on primary antibody responses (Ab) to Mycobacterium butyricum or keyhole limpet hemocyanin (KLH) was studied in four experimental lines of White Leghorn chicken. Birds underwent 12 generations of selection for one of three
Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping
2014-08-07
A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.
Catechol-chitosan redox capacitor for added amplification in electrochemical immunoanalysis.
Yan, Kun; Liu, Yi; Guan, Yongguang; Bhokisham, Narendranath; Tsao, Chen-Yu; Kim, Eunkyoung; Shi, Xiao-Wen; Wang, Qin; Bentley, William E; Payne, Gregory F
2018-05-22
Antibodies are common recognition elements for molecular detection but often the signals generated by their stoichiometric binding must be amplified to enhance sensitivity. Here, we report that an electrode coated with a catechol-chitosan redox capacitor can amplify the electrochemical signal generated from an alkaline phosphatase (AP) linked immunoassay. Specifically, the AP product p-aminophenol (PAP) undergoes redox-cycling in the redox capacitor to generate amplified oxidation currents. We estimate an 8-fold amplification associated with this redox-cycling in the capacitor (compared to detection by a bare electrode). Importantly, this capacitor-based amplification is generic and can be coupled to existing amplification approaches based on enzyme-linked catalysis or magnetic nanoparticle-based collection/concentration. Thus, the capacitor should enhance sensitivities in conventional immunoassays and also provide chemical to electrical signal transduction for emerging applications in molecular communication. Copyright © 2018 Elsevier B.V. All rights reserved.
Use of RAPD and PCR double amplification in the study of ancient DNA
Directory of Open Access Journals (Sweden)
F. Balzano
2011-01-01
Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.
Light amplification by seeded Kerr instability
Vampa, G.; Hammond, T. J.; Nesrallah, M.; Naumov, A. Yu.; Corkum, P. B.; Brabec, T.
2018-02-01
Amplification of femtosecond laser pulses typically requires a lasing medium or a nonlinear crystal. In either case, the chemical properties of the lasing medium or the momentum conservation in the nonlinear crystal constrain the frequency and the bandwidth of the amplified pulses. We demonstrate high gain amplification (greater than 1000) of widely tunable (0.5 to 2.2 micrometers) and short (less than 60 femtosecond) laser pulses, up to intensities of 1 terawatt per square centimeter, by seeding the modulation instability in an Y3Al5O12 crystal pumped by femtosecond near-infrared pulses. Our method avoids constraints related to doping and phase matching and therefore can occur in a wider pool of glasses and crystals even at far-infrared frequencies and for single-cycle pulses. Such amplified pulses are ideal to study strong-field processes in solids and highly excited states in gases.
Parametric nanomechanical amplification at very high frequency.
Karabalin, R B; Feng, X L; Roukes, M L
2009-09-01
Parametric resonance and amplification are important in both fundamental physics and technological applications. Here we report very high frequency (VHF) parametric resonators and mechanical-domain amplifiers based on nanoelectromechanical systems (NEMS). Compound mechanical nanostructures patterned by multilayer, top-down nanofabrication are read out by a novel scheme that parametrically modulates longitudinal stress in doubly clamped beam NEMS resonators. Parametric pumping and signal amplification are demonstrated for VHF resonators up to approximately 130 MHz and provide useful enhancement of both resonance signal amplitude and quality factor. We find that Joule heating and reduced thermal conductance in these nanostructures ultimately impose an upper limit to device performance. We develop a theoretical model to account for both the parametric response and nonequilibrium thermal transport in these composite nanostructures. The results closely conform to our experimental observations, elucidate the frequency and threshold-voltage scaling in parametric VHF NEMS resonators and sensors, and establish the ultimate sensitivity limits of this approach.
DEFF Research Database (Denmark)
Sørensen, Jesper Givskov; Loeschcke, Volker; Kristensen, Torsten Nygård
2009-01-01
. 2. We have tested the importance of inducible heat shock proteins (Hsps) under different thermal conditions using two heat shock factor (Hsf) mutant lines (either able (Hsf+) or unable (Hsf0) to mount a heat stress response) and an outbred laboratory adapted wild-type line of Drosophila......1. Laboratory studies on genetically modified strains may reveal important information on mechanisms involved in coping with thermal stress. However, to address the evolutionary significance of specific genes or physiological mechanisms, ecologically relevant field tests should also be performed...
Hormonal Involvement in Breast Cancer Gene Amplification
2010-10-01
been shown to induce DN A amplification in yeast (Gopalakrishnan et al., 2001; Nguy en et al., 2001; Green et al., 2006) an d increased Cdt1 results in...re-replication in human cells (Dorn et al., 2008). The N- terminus of Cdt1 is important for re-replication, perhaps through interactions with PCNA...evolution of a cancer genome. Genome Res. (Epub. Dec. 3, 2008). Harris TD, Buzby PR, Babcock H, Beer E, Bowers J, Bras lavsky I, Causey M
Fast amplification system for gamma spectroscopy
International Nuclear Information System (INIS)
Jesus, E.F.O.; Lopes, R.T.
1992-01-01
An amplification system for gamma spectroscopy with high counting rates was developed. The system was constructed with operational amplifiers, and tested and compared with ORTEC conventional system, using Iridium-192 as source of 9,25 x 10 1 0 Bq of activity and NaI (Tl) detector. The constructed system showed a better performance in relation to efficiency and resolution parameters, tested before. (C.G.C.)
Optimized thermal amplification in a radiative transistor
Energy Technology Data Exchange (ETDEWEB)
Prod' homme, Hugo; Ordonez-Miranda, Jose; Ezzahri, Younes, E-mail: younes.ezzahri@univ-poitiers.fr; Drevillon, Jeremie; Joulain, Karl [Institut Pprime, CNRS, Université de Poitiers, ISAE-ENSMA, F-86962 Futuroscope Chasseneuil (France)
2016-05-21
The thermal performance of a far-field radiative transistor made up of a VO{sub 2} base in between a blackbody collector and a blackbody emitter is theoretically studied and optimized. This is done by using the grey approximation on the emissivity of VO{sub 2} and deriving analytical expressions for the involved heat fluxes and transistor amplification factor. It is shown that this amplification factor can be maximized by tuning the base temperature close to its critical one, which is determined by the temperature derivative of the VO{sub 2} emissivity and the equilibrium temperatures of the collector and emitter. This maximization is the result of the presence of two bi-stable temperatures appearing during the heating and cooling processes of the VO{sub 2} base and enables a thermal switching (temperature jump) characterized by a sizeable variation of the collector-to-base and base-to-emitter heat fluxes associated with a slight change of the applied power to the base. This switching effect leads to the optimization of the amplification factor and therefore it could be used for thermal modulation purposes.
HER-2 amplification in tubular carcinoma of the breast.
Oakley, Gerard J; Tubbs, Raymond R; Crowe, Joseph; Sebek, Bruce; Budd, G Thomas; Patrick, Rebecca J; Procop, Gary W
2006-07-01
The prognostic and therapeutic implications of HER-2 gene amplification and estrogen and progesterone receptor status in breast cancer are well described. To address the relative paucity of information concerning HER-2 amplification for tubular carcinomas, we assessed the frequency of gene amplification in 55 tubular carcinomas of the breast from 54 patients, 5 of which had axillary node metastases. The HER-2 gene copy number was assessed by fluorescence in situ hybridization for the majority of tumors analyzed, whereas estrogen and progesterone receptor status was achieved by immunohistochemical analysis. HER-2 gene amplification was not observed in any of the tumors examined, and most were estrogen receptor-positive. This HER-2 gene amplification frequency was significantly lower than the frequency of gene amplification previously reported for all invasive ductal carcinoma of no special type (P < .01). HER-2 gene amplification likely occurs infrequently, or not at all, in tubular carcinomas of the breast, whereas most express estrogen receptors.
Energy Technology Data Exchange (ETDEWEB)
Hagan, Bethany S.; Bruckner-Lea, Cynthia J.
2002-12-01
This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.
Directory of Open Access Journals (Sweden)
Jason D. Gillman
2013-03-01
Full Text Available Seed phytate is a repository of P and minerals in soybean [ (L. Merr.] seeds that limits P and mineral bioavailability for monogastric animals (e.g., humans, swine [], and poultry [especially chicken, ] due to insufficient digestive tract phytase activity. We previously identified epistatic recessive mutations affecting two paralogous adenosine triphosphate-binding cassette phytic acid transporter genes (one a nonsense mutation in and the other a missense mutation in as the molecular genetic basis in the ethyl methanesulfonate (EMS-induced mutant low phytate soybean line M153. An additional mutant low phytate line, M766, contained one single nucleotide polymorphism within the ninth intron of the locus as well as a nonsense mutation in . The objectives of this research were to clarify the genetics underlying the low phytate phenotype in line M766 and to determine P partitioning in new combinations of mutant alleles from M766 and M153. Inheritance of nonsense alleles affecting both ( genes (one from M153 and one from M766 led to the production of viable seeds that contained transgressive reductions in total seed phytate and significantly higher levels of inorganic phosphate than has been reported for nontransgenic soybean material and will allow efficient molecular selection of soybeans with even greater reductions of phytate for improved quality soybean meal.
Efficient Wave Energy Amplification with Wave Reflectors
DEFF Research Database (Denmark)
Kramer, Morten Mejlhede; Frigaard, Peter Bak
2002-01-01
Wave Energy Converters (WEC's) extract wave energy from a limited area, often a single point or line even though the wave energy is generally spread out along the wave crest. By the use of wave reflectors (reflecting walls) the wave energy is effectively focused and increased to approximately 130......-140%. In the paper a procedure for calculating the efficiency and optimizing the geometry of wave reflectors are described, this by use of a 3D boundary element method. The calculations are verified by laboratory experiments and a very good agreement is found. The paper gives estimates of possible power benifit...... for different geometries of the wave reflectors and optimal geometrical design parameters are specified. On this basis inventors of WEC's can evaluate whether a specific WEC possible could benefit from wave reflectors....
DEFF Research Database (Denmark)
Harboe, Morten; Garred, Peter; Karlstrøm, Ellen
2009-01-01
Complement activation plays an important role in human pathophysiology. The effect of classical pathway activation is largely dependent on alternative pathway (AP) amplification, whereas the role of AP for the down-stream effect of mannan-induced lectin pathway (LP) activation is poorly understood...... that AP amplification is quantitatively responsible for the final effect of initial specific LP activation. TCC generation on the solid phase was distinctly but less inhibited by anti-fD. C2 bypass of the LP pathway could be demonstrated, and AP amplification was also essential during C2 bypass in LP...... as shown by complete inhibition of TCC generation in C2-deficient serum by anti-fD and anti-properdin antibodies. In conclusion, the down-stream effect of LP activation depends strongly on AP amplification in normal human serum and in the C2 bypass pathway....
Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection.
Directory of Open Access Journals (Sweden)
Ahmed Abd El Wahed
Full Text Available Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF. Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR are the standard method for molecular detection of the dengue virus (DENV. Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA assays were developed to detect DENV1-4.Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4 to 241 (DENV1-3 RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal and in Bangkok (Thailand. In Kedougou, the RT-RPA was operated at an ambient temperature of 38 °C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31 and 100% (n=23, respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90 and 100%(n=41, respectively.During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations.
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Directory of Open Access Journals (Sweden)
Bonita J Brewer
2015-12-01
Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K
2015-12-01
DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial
Directory of Open Access Journals (Sweden)
Luciane Cristina Bertholo
2006-08-01
possible interactions, based on the allele-specific genic amplification (PCR-AE with the use in parallel two primers that differ at their 3’ extremities and are complementary to the normal or mutated sequences. RESULTS AND DISCUSSION: The results make evident the validation of this methodology in the characterization of these mutations, once this procedure is easy to execute,to reproduce, as well as it is possible to be applied to a significative number of samples.
Amplification and focusing of a picosecond chirped pulse to 20TW and 5x1017W/cm2
International Nuclear Information System (INIS)
Sauteret, C.; Husson, D.; Rouyer, C.; Seznec, S.; Gary, S.
1991-01-01
Pulses of 20 TW power have been generated at 1064 nm using the Chirped Pulse Amplification technique coupled to a 90 mm output aperture powerful Nd:silicate glass amplification line. This system delivers 60 J in a chirped pulse of 600 ps duration with a capacity of maintaining 3.5 nm output bandwidth. These chirped pulses have been compressed to 1.2 ps with an energy of 24J using large holographic diffraction gratings. After presenting the results we discuss the expected applications in atomic and plasma physics
Multiplex amplification of large sets of human exons.
Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay
2007-11-01
A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.
Social amplification of risk: An empirical study
International Nuclear Information System (INIS)
Burns, W.; Slovic, P.; Kasperson, R.; Kasperson, J.; Renn, O.; Emani, S.
1990-09-01
The social amplification of risk is a theoretical framework that addresses an important deficiency of formal risk assessment methods and procedures. Typically assessments of risk from technological mishaps have been based upon the expected number of people who could be killed or injured or the amount of property that might be damaged. The diverse and consequential impacts that followed in the aftermath of the Three Mile Island accident make it clear that risk assessments that exclude the role of public perceptions of risk will greatly underestimate the potential costs of certain types of hazards. The accident at Three Mile Island produced no direct fatalities and few, if any, expected deaths due to cancer, yet few other accidents in history have had such costly societal impacts. The experience of amplified impacts argues for the development of a broadened theoretical and methodological perspective capable of integrating technical assessment of risk with public perceptions. This report presents the results to date in an ongoing research effort to better understand the complex processes by which adverse events produce impacts. In particular this research attempts to construct a framework that can account for those events that have produced, or are capable of producing, greater societal impacts than would be forecast by traditional risk assessment methods. This study demonstrates that the social amplification of risk involves interactions between sophisticated technological hazards, public and private institutions, and subtle individual and public perceptions and behaviors. These factors, and the variables underlying the intricate processes of social amplification that occur in modern society, are not fully defined and clarified in this report. 19 refs., 9 figs., 10 tabs
Gas amplification properties of GEM foils
International Nuclear Information System (INIS)
Beck, Jeannine
2009-01-01
In the framework of the detector concept International Linear Detector for the future accelerator project International Linear Collider, in which electrons and positrons at c. m. energies of 500 GeV are brought to collision, a time projection chamber shall be applied as central track detector. By the application of such a chamber as track detector a three-dimensional reconstruction of the track points is possible. If a particle passes the gas volume within the chamber it ionizises single gas atoms and the arising electrons move after the amplification in the GEM arrangement to the anode, so that a two-dimensional projection of the particle track is possible. The third dimension is calculated from the drift time of the electrons. The advances of this readout system consist therein that a better position resolution than by a multiwire proportional chamber is reached and the back-drifting ions can be strongly suppressed. Aim of this thesis are studies for a GEM module, which shall be used in a large TPC prototype. Concerning different requirements it is valid to compare different GEMs in order to can meet an optimal choice. In a small prototype present at DESY measurements for the acquisition of GEM-describing parameters were performed. The taking into operation of the test TPC was part of this thesis. Tracks were generated by a radioactive source, by means of which the gas amplification was determined. With the measurement arrangement gas-amplifier foils of different kind were compared in view of their amplification properties and their energy resolution power and systematically studied. Five different GEM performances were studied in the test TPC. These foils differ in their geometrical classification parameters, the fabrication process, or the materials. The GEMs produced at CERN possess in comparison with GEMs of the Japanese firm SciEnergy and a GEM of the US-American firm Tech-Etch the best amplification and resolution properties. Furthermore a new GEM framing
Amplification Effects and Unconventional Monetary Policies
Directory of Open Access Journals (Sweden)
Cécile BASTIDON GILLES
2012-02-01
Full Text Available Global financial crises trigger off amplification effects, which allow relatively small shocks to propagate through the whole financial system. For this reason, the range of Central banks policies is now widening beyond conventional monetary policies and lending of last resort. The aim of this paper is to establish a rule for this practice. The model is based on the formalization of funding conditions in various types of markets. We conduct a comprehensive analysis of the “unconventional monetary policies”, and especially quantify government bonds purchases by the Central bank.
Amplification of curvature perturbations in cyclic cosmology
International Nuclear Information System (INIS)
Zhang Jun; Liu Zhiguo; Piao Yunsong
2010-01-01
We analytically and numerically show that through the cycles with nonsingular bounce, the amplitude of curvature perturbation on a large scale will be amplified and the power spectrum will redden. In some sense, this amplification will eventually destroy the homogeneity of the background, which will lead to the ultimate end of cycles of the global universe. We argue that for the model with increasing cycles, it might be possible that a fissiparous multiverse will emerge after one or several cycles, in which the cycles will continue only at corresponding local regions.
Directory of Open Access Journals (Sweden)
Schallig Henk DFH
2009-01-01
Full Text Available Abstract Background Malaria is one of the most important infectious diseases in the world. Although most cases are found distributed in the tropical regions of Africa, Asia, Central and South Americas, there is in Europe a significant increase in the number of imported cases in non-endemic countries, in particular due to the higher mobility in today's society. Methods The prevalence of a possible asymptomatic infection with Plasmodium species was assessed using Nucleic Acid Sequence Based Amplification (NASBA assays on clinical samples collected from 195 study cases with no clinical signs related to malaria and coming from sub-Saharan African regions to Southern Italy. In addition, base-line demographic, clinical and socio-economic information was collected from study participants who also underwent a full clinical examination. Results Sixty-two study subjects (31.8% were found positive for Plasmodium using a pan Plasmodium specific NASBA which can detect all four Plasmodium species causing human disease, based on the small subunit 18S rRNA gene (18S NASBA. Twenty-four samples (38% of the 62 18S NASBA positive study cases were found positive with a Pfs25 mRNA NASBA, which is specific for the detection of gametocytes of Plasmodium falciparum. A statistically significant association was observed between 18S NASBA positivity and splenomegaly, hepatomegaly and leukopaenia and country of origin. Conclusion This study showed that a substantial proportion of people originating from malaria endemic countries harbor malaria parasites in their blood. If transmission conditions are available, they could potentially be a reservoir. Thefore, health authorities should pay special attention to the health of this potential risk group and aim to improve their health conditions.
FGFR-1 amplification in metastatic lymph-nodal and haematogenous lobular breast carcinoma
Directory of Open Access Journals (Sweden)
Brunello Eleonora
2012-12-01
Full Text Available Abstract Background Lobular breast carcinoma usually shows poor responsiveness to chemotherapies and often lacks targeted therapies. Since FGFR1 expression has been shown to play pivotal roles in primary breast cancer tumorigenesis, we sought to analyze the status of FGFR1 gene in a metastatic setting of lobular breast carcinoma, since promising FGFR1 inhibitors has been recently developed. Methods Fifteen tissue metastases from lobular breast carcinomas with matched primary infiltrative lobular breast carcinoma were recruited. Eleven cases showed loco-regional lymph-nodal and four haematogenous metastases. FGFR-1 gene (8p12 amplification was evaluated by chromogenic in situ hybridization (CISH analysis. Her-2/neu and topoisomerase-IIα gene status was assessed. E-cadherin and Hercept Test were also performed. We distinguished amplification (>6 or cluster of signals versus gains (3–6 signals of the locus specific FGFR-1 gene. Results Three (20% primary lobular breast carcinomas showed >6 or cluster of FGFR1 signals (amplification, six cases (40% had a mean of three (range 3–6 chromogenic signals (gains whereas in 6 (40% was not observed any abnormality. Three of 15 metastasis (20% were amplified, 2/15 (13,4% did not. The ten remaining cases (66,6% showed three chromogenic signals. The three cases with FGFR-1 amplification matched with those primary breast carcinomas showing FGFR-1 amplification. The six cases showing FGFR-1 gains in the primary tumour again showed FGFR-1 gains in the metastases. Four cases showed gains of FGFR-1 gene signals in the metastases and not in the primary tumours. Her-2/neu gene amplification was not observed in all cases but one (6% case. Topoisomerase-IIα was not amplified in all cases. Conclusions 1 a subset of metastatic lobular breast carcinoma harbors FGFR-1 gene amplification or gains of chromogenic signals; 2 a minor heterogeneity has been observed after matching primary and metastatic carcinomas; 3 in the
Aartse, Aafke; Scholtens-Toma, Ingrid; A, van der Hans J.G.; Boersma-Greve, Monique M.; Prins, Theo W.; Ginkel, van Leen A.; Kok, Esther J.; Bovee, Toine F.H.
2017-01-01
Detection of horse DNA by loop-mediated isothermal amplification (LAMP) seems one of the most promising methods to meet the criteria of fast, robust, cost efficient, specific, and sensitive on-site detection. In the present study an assessment of the specificity and sensitivity of the LAMP horse
Giant amplification in degenerate band edge slow-wave structures interacting with an electron beam
Energy Technology Data Exchange (ETDEWEB)
Othman, Mohamed A. K.; Veysi, Mehdi; Capolino, Filippo [Department of Electrical Engineering and Computer Science, University of California, Irvine, California 92697 (United States); Figotin, Alexander [Department of Mathematics, University of California, Irvine, California 92697 (United States)
2016-03-15
We propose a new amplification regime based on a synchronous operation of four degenerate electromagnetic (EM) modes in a slow-wave structure and the electron beam, referred to as super synchronization. These four EM modes arise in a Fabry-Pérot cavity when degenerate band edge (DBE) condition is satisfied. The modes interact constructively with the electron beam resulting in superior amplification. In particular, much larger gains are achieved for smaller beam currents compared to conventional structures based on synchronization with only a single EM mode. We demonstrate giant gain scaling with respect to the length of the slow-wave structure compared to conventional Pierce type single mode traveling wave tube amplifiers. We construct a coupled transmission line model for a loaded waveguide slow-wave structure exhibiting a DBE, and investigate the phenomenon of giant gain via super synchronization using the Pierce model generalized to multimode interaction.
Enzymatic amplification of a flow-injected thermometric enzyme-linked immunoassay for human insulin.
Mecklenburg, M; Lindbladh, C; Li, H; Mosbach, K; Danielsson, B
1993-08-01
A flow-injected thermometric enzyme linked immunoassay for human insulin which employs the lactate dehydrogenase/lactate oxidase (LDH/LOD) substrate recycling system for signal amplification is described. The system is composed of two columns, an immunosorbent column containing immobilized anti-insulin antibodies for sensing and a recycling column containing immobilized LDH/LOD/Catalase for detection. The effect of flow rates, conjugate concentrations, and chromatographic support material upon the sensitivity of the assay are investigated. The assay has a detection limit of 0.025 microgram/ml and a linear range from 0.05 to 2 micrograms/ml. This corresponds to a 10-fold increase in sensitivity over the unamplified system. A recombinant human insulin-proinsulin conjugate was also tested. The results show that enzymatic amplification can be employed to increase the sensitivity and reproducibility of flow injection assay-based biosensors. The implications of these results upon on-line analysis are discussed.
Araújo, T M; Seabra, A D; Lima, E M; Assumpção, P P; Montenegro, R C; Demachki, S; Burbano, R M; Khayat, A S
2016-01-01
Despite progression in treatment of gastric cancer, prognosis of patients remains poor, in part due to the low rate of diagnosis during its early stages. This paradigm implies the necessity to identify molecular biomarkers for early gastric cancer diagnosis, as well as for disease monitoring, thus contributing to the development of new therapeutic approaches. In a previous study, performed by array-Comparative Genomic Hybridization, we described for the first time in literature recurrent amplification of RTEL1 and ABCA13 genes in gastric cancer. Thus, the aim of the present study was to validate recurrent amplification of RTEL1 and ABCA13 genes and associate CNV status with clinicopathological data. Results showed RTEL1 and ABCA13 amplification in 38 % of samples. Statistical analysis demonstrated that RTEL amplification is more common in older patients and more associated with intestinal type and ABCA13 amplification increases the risk of lymph node metastasis and is more common in men. Co-amplification of these genes showed a significant association with advanced staging. aCGH is a very useful tool for investigating novel genes associated with carcinogenesis and RTEL1 amplification may be important for the development of gastric cancer in older patients, besides being a probable event contributing for chromosomal instability in intestinal gastric carcinogenesis. ABCA13 amplification may have age-specific function and could be considered a useful marker for predicting lymph node metastasis in resected gastric cancer patients in early stage. Lastly, RTEL1 and ABCA13 synergistic effect may be considered as a putative marker for advanced staging in gastric cancer patients.
Gao, Min-Jie; Zheng, Zhi-Yong; Wu, Jian-Rong; Dong, Shi-Juan; Li, Zhen; Jin, Hu; Zhan, Xiao-Bei; Lin, Chi-Chung
2012-02-01
Effective expression of porcine interferon-α (pIFN-α) with recombinant Pichia pastoris was conducted in a bench-scale fermentor. The influence of the glycerol feeding strategy on the specific growth rate and protein production was investigated. The traditional DO-stat feeding strategy led to very low cell growth rate resulting in low dry cell weight (DCW) of about 90 g/L during the subsequent induction phase. The previously reported Artificial Neural Network Pattern Recognition (ANNPR) model-based glycerol feeding strategy improved the cell density to 120 g DCW/L, while the specific growth rate decreased from 0.15 to 0.18 to 0.03-0.08 h(-1) during the last 10 h of the glycerol feeding stage leading to a variation of the porcine interferon-α production, as the glycerol feeding scheme had a significant effect on the induction phase. This problem was resolved by an improved ANNPR model-based feeding strategy to maintain the specific growth rate above 0.11 h(-1). With this feeding strategy, the pIFN-α concentration reached a level of 1.43 g/L, more than 1.5-fold higher than that obtained with the previously adopted feeding strategy. Our results showed that increasing the specific growth rate favored the target protein production and the glycerol feeding methods directly influenced the induction stage. Consequently, higher cell density and specific growth rate as well as effective porcine interferon-α production have been achieved by our novel glycerol feeding strategy.
International Nuclear Information System (INIS)
Lentini, Laura; Amato, Angela; Schillaci, Tiziana; Di Leonardo, Aldo
2007-01-01
Genetic instability is a hallmark of tumours and preneoplastic lesions. The predominant form of genome instability in human cancer is chromosome instability (CIN). CIN is characterized by chromosomal aberrations, gains or losses of whole chromosomes (aneuploidy), and it is often associated with centrosome amplification. Centrosomes control cell division by forming a bipolar mitotic spindle and play an essential role in the maintenance of chromosomal stability. However, whether centrosome amplification could directly cause aneuploidy is not fully established. Also, alterations in genes required for mitotic progression could be involved in CIN. A major candidate is represented by Aurora-A/STK15 that associates with centrosomes and is overexpressed in several types of human tumour. Centrosome amplification were induced by hydroxyurea treatment and visualized by immunofluorescence microscopy. Aurora-A/STK15 ectopic expression was achieved by retroviral infection and puromycin selection in HCT116 tumour cells. Effects of Aurora-A/STK15 depletion on centrosome status and ploidy were determined by Aurora-A/STK15 transcriptional silencing by RNA interference. Changes in the expression levels of some mitotic genes were determined by Real time RT-PCR. We investigated whether amplification of centrosomes and overexpression of Aurora-A/STK15 induce CIN using as a model system a colon carcinoma cell line (HCT116). We found that in HCT116 cells, chromosomally stable and near diploid cells harbouring a MIN phenotype, centrosome amplification induced by hydroxyurea treatment is neither maintained nor induces aneuploidy. On the contrary, ectopic overexpression of Aurora-A/STK15 induced supernumerary centrosomes and aneuploidy. Aurora-A/STK15 transcriptional silencing by RNA interference in cells ectopically overexpressing this kinase promptly decreased cell numbers with supernumerary centrosomes and aneuploidy. Our results show that centrosome amplification alone is not sufficient
C-MET overexpression and amplification in gliomas.
Kwak, Yoonjin; Kim, Seong-Ik; Park, Chul-Kee; Paek, Sun Ha; Lee, Soon-Tae; Park, Sung-Hye
2015-01-01
We investigated c-Met overexpression and MET gene amplification in gliomas to determine their incidence and prognostic significance. c-Met immunohistochemistry and MET gene fluorescence in situ hybridization were carried out on tissue microarrays from 250 patients with gliomas (137 grade IV GBMs and 113 grade II and III diffuse gliomas). Clinicopathological features of these cases were reviewed. c-Met overexpression and MET gene amplification were detected in 13.1% and 5.1% of the GBMs, respectively. All the MET-amplified cases showed c-Met overexpression, but MET amplification was not always concordant with c-Met overexpression. None of grade II and III gliomas demonstrated c-Met overexpression or MET gene amplification. Mean survival of the GBM patients with MET amplification was not significantly different from patients without MET amplification (P=0.155). However, GBM patients with c-Met overexpression survived longer than patients without c-Met overexpression (P=0.035). Although MET amplification was not related to poor GBM prognosis, it is partially associated with the aggressiveness of gliomas, as MET amplification was found only in grade IV, not in grade II and III gliomas. We suggest that MET inhibitor therapy may be beneficial in about 5% GBMs, which was the incidence of MET gene amplification found in the patients included in this study.
Earthquake acceleration amplification based on single microtremor test
Jaya Syahbana, Arifan; Kurniawan, Rahmat; Soebowo, Eko
2018-02-01
Understanding soil dynamics is needed to understand soil behaviour, including the parameters of earthquake acceleration amplification. Many researchers now conduct single microtremor tests to obtain amplification of velocity and natural periods of soil at test sites. However, these amplification parameters are rarely used, so a method is needed to convert the velocity amplification to acceleration amplification. This paper will discuss the proposed process of changing the value of amplification. The proposed method is to integrate the time histories of the synthetic earthquake acceleration of the soil surface under the deaggregation at that location so the time histories of the velocity earthquake will be obtained. Next is to conduct a “fitting curve” between amplification by a single microtremor test with amplification of the synthetic earthquake velocity time histories. After obtaining the fitting curve time histories of velocity, differentiation will be conducted to obtain fitting curve acceleration time histories. The final step after obtaining the fitting curve is to compare the acceleration of the “fitting curve” against the histories time of the acceleration of synthetic earthquake at bedrocks to obtain single microtremor acceleration amplification factor.
Quantum tomography enhanced through parametric amplification
Knyazev, E.; Spasibko, K. Yu; Chekhova, M. V.; Khalili, F. Ya
2018-01-01
Quantum tomography is the standard method of reconstructing the Wigner function of quantum states of light by means of balanced homodyne detection. The reconstruction quality strongly depends on the photodetectors quantum efficiency and other losses in the measurement setup. In this article we analyze in detail a protocol of enhanced quantum tomography, proposed by Leonhardt and Paul [1] which allows one to reduce the degrading effect of detection losses. It is based on phase-sensitive parametric amplification, with the phase of the amplified quadrature being scanned synchronously with the local oscillator phase. Although with sufficiently strong amplification the protocol enables overcoming any detection inefficiency, it was so far not implemented in the experiment, probably due to the losses in the amplifier. Here we discuss a possible proof-of-principle experiment with a traveling-wave parametric amplifier. We show that with the state-of-the-art optical elements, the protocol enables high fidelity tomographic reconstruction of bright non-classical states of light. We consider two examples: bright squeezed vacuum and squeezed single-photon state, with the latter being a non-Gaussian state and both strongly affected by the losses.
Electronic cyclotron radiation amplification in thermonuclear plasmas
International Nuclear Information System (INIS)
Ziebell, L.F.
1983-01-01
The amplified emission of electron cyclotron radiation near the fundamental frequency from an inhomogeneous, anisotropic plasma slab is investigated in a linear theory. Plasma polarization effects are consistently included. Expressions are developed in the WKB approximation for emission in the ordinary and the extraordinary modes, for propagation perpendicular to the magnetic field. Numerical results are given for the extraordinary mode, for which effects are strongest. For the case of a loss-cone-type electron momentum distribution, it is shown that the amplification is sensitively dependent on the ratio of parallel-to-perpendicular temperature and on inhomogeneities in the magnetic field. The dependence of the amplification on the distribution is further investigated by considering superpositions of loss-cone and Maxwellian components. It is show that the presence of a Maxwellian component in general reduces the emission relative to the pure loss-cone case, and situations occur in which a layer in the slab very effectively absorbs all the radiation amplified elsewhere. A peculiar behaviour of the refractive index, which occurs in the transition from the pure loss-cone to the pure Maxwellian case, is discussed. (author)
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Quantitative analysis of night skyglow amplification under cloudy conditions
Kocifaj, Miroslav; Solano Lamphar, Héctor Antonio
2014-10-01
The radiance produced by artificial light is a major source of nighttime over-illumination. It can, however, be treated experimentally using ground-based and satellite data. These two types of data complement each other and together have a high information content. For instance, the satellite data enable upward light emissions to be normalized, and this in turn allows skyglow levels at the ground to be modelled under cloudy or overcast conditions. Excessive night lighting imposes an unacceptable burden on nature, humans and professional astronomy. For this reason, there is a pressing need to determine the total amount of downwelling diffuse radiation. Undoubtedly, cloudy periods can cause a significant increase in skyglow as a result of amplification owing to diffuse reflection from clouds. While it is recognized that the amplification factor (AF) varies with cloud cover, the effects of different types of clouds, of atmospheric turbidity and of the geometrical relationships between the positions of an individual observer, the cloud layer, and the light source are in general poorly known. In this paper the AF is quantitatively analysed considering different aerosol optical depths (AODs), urban layout sizes and cloud types with specific albedos and altitudes. The computational results show that the AF peaks near the edges of a city rather than at its centre. In addition, the AF appears to be a decreasing function of AOD, which is particularly important when modelling the skyglow in regions with apparent temporal or seasonal variability of atmospheric turbidity. The findings in this paper will be useful to those designing engineering applications or modelling light pollution, as well as to astronomers and environmental scientists who aim to predict the amplification of skyglow caused by clouds. In addition, the semi-analytical formulae can be used to estimate the AF levels, especially in densely populated metropolitan regions for which detailed computations may be CPU
de Silva, Thushan I; Gould, Victoria; Mohammed, Nuredin I; Cope, Alethea; Meijer, Adam; Zutt, Ilse; Reimerink, Johan; Kampmann, Beate; Hoschler, Katja; Zambon, Maria; Tregoning, John S
2017-10-01
We need greater understanding of the mechanisms underlying protection against influenza virus to develop more effective vaccines. To do this, we need better, more reproducible methods of sampling the nasal mucosa. The aim of the current study was to compare levels of influenza virus A subtype-specific IgA collected using three different methods of nasal sampling. Samples were collected from healthy adult volunteers before and after LAIV immunization by nasal wash, flocked swabs and Synthetic Absorptive Matrix (SAM) strips. Influenza A virus subtype-specific IgA levels were measured by haemagglutinin binding ELISA or haemagglutinin binding microarray and the functional response was assessed by microneutralization. Nasosorption using SAM strips lead to the recovery of a more concentrated sample of material, with a significantly higher level of total and influenza H1-specific IgA. However, an equivalent percentage of specific IgA was observed with all sampling methods when normalized to the total IgA. Responses measured using a recently developed antibody microarray platform, which allows evaluation of binding to multiple influenza strains simultaneously with small sample volumes, were compared to ELISA. There was a good correlation between ELISA and microarray values. Material recovered from SAM strips was weakly neutralizing when used in an in vitro assay, with a modest correlation between the level of IgA measured by ELISA and neutralization, but a greater correlation between microarray-measured IgA and neutralizing activity. In conclusion we have tested three different methods of nasal sampling and show that flocked swabs and novel SAM strips are appropriate alternatives to traditional nasal washes for assessment of mucosal influenza humoral immunity. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yvonne Chekaluk
Full Text Available We performed a genome wide analysis of 164 urothelial carcinoma samples and 27 bladder cancer cell lines to identify copy number changes associated with disease characteristics, and examined the association of amplification events with stage and grade of disease. Multiplex inversion probe (MIP analysis, a recently developed genomic technique, was used to study 80 urothelial carcinomas to identify mutations and copy number changes. Selected amplification events were then analyzed in a validation cohort of 84 bladder cancers by multiplex ligation-dependent probe assay (MLPA. In the MIP analysis, 44 regions of significant copy number change were identified using GISTIC. Nine gene-containing regions of amplification were selected for validation in the second cohort by MLPA. Amplification events at these 9 genomic regions were found to correlate strongly with stage, being seen in only 2 of 23 (9% Ta grade 1 or 1-2 cancers, in contrast to 31 of 61 (51% Ta grade 3 and T2 grade 2 cancers, p<0.001. These observations suggest that analysis of genomic amplification of these 9 regions might help distinguish non-invasive from invasive urothelial carcinoma, although further study is required. Both MIP and MLPA methods perform well on formalin-fixed paraffin-embedded DNA, enhancing their potential clinical use. Furthermore several of the amplified genes identified here (ERBB2, MDM2, CCND1 are potential therapeutic targets.
International Nuclear Information System (INIS)
Pascale, E.; Valle, E.; Furano, A.V.
1990-01-01
Each mammalian genus examined so far contains 50,000-100,000 members of an L1 (LINE 1) family of long interspersed repeated DNA elements. Current knowledge on the evolution of L1 families presents a paradox because, although L1 families have been in mammalian genomes since before the mammalian radiation ∼80 million years ago, most members of the L1 families are only a few million years old. Accordingly it has been suggested either that the extensive amplification that characterizes present-day L1 families did not occur in the past or that old members were removed as new one were generated. However, the authors show here that an ancestral rodent L1 family was extensively amplified ∼10 million years ago and that the relics of this amplification have persisted in modern murine genomes. This amplification occurred just before the divergence of modern murine genera from their common ancestor and identifies the murine node in the lineage of modern muroid rodents The results suggest that repeated amplification of L1 elements is a feature of the evaluation of mammalian genomes and that ancestral amplification events could provide a useful tool for determining mammalian lineages
Identification and removal of low-complexity sites in allele-specific analysis of ChIP-seq data.
Waszak, Sebastian M; Kilpinen, Helena; Gschwind, Andreas R; Orioli, Andrea; Raghav, Sunil K; Witwicki, Robert M; Migliavacca, Eugenia; Yurovsky, Alisa; Lappalainen, Tuuli; Hernandez, Nouria; Reymond, Alexandre; Dermitzakis, Emmanouil T; Deplancke, Bart
2014-01-15
High-throughput sequencing technologies enable the genome-wide analysis of the impact of genetic variation on molecular phenotypes at unprecedented resolution. However, although powerful, these technologies can also introduce unexpected artifacts. We investigated the impact of library amplification bias on the identification of allele-specific (AS) molecular events from high-throughput sequencing data derived from chromatin immunoprecipitation assays (ChIP-seq). Putative AS DNA binding activity for RNA polymerase II was determined using ChIP-seq data derived from lymphoblastoid cell lines of two parent-daughter trios. We found that, at high-sequencing depth, many significant AS binding sites suffered from an amplification bias, as evidenced by a larger number of clonal reads representing one of the two alleles. To alleviate this bias, we devised an amplification bias detection strategy, which filters out sites with low read complexity and sites featuring a significant excess of clonal reads. This method will be useful for AS analyses involving ChIP-seq and other functional sequencing assays. The R package abs filter for library clonality simulations and detection of amplification-biased sites is available from http://updepla1srv1.epfl.ch/waszaks/absfilter
Glais, Laurent; Jacquot, Emmanuel
2015-01-01
Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.
Rosser, A; Rollinson, D; Forrest, M; Webster, B L
2015-09-04
Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.
[Colorimetric detection of HPV6 and HPV16 by loop mediated isothermal amplification].
Lu, Chun-bin; Luo, Le; Yang, Meng-jie; Nie, Kai; Wang, Miao; Ma, Xue-Jun
2011-01-01
A simple, rapid and sensitive colorimetric loop mediated isothermal amplification (LAMP) method was established to detect HPV6 and HPV 16 respectively. The method employed a set of four specially designed primers that recognized six distinct sequences of HPV6-E6 or HPV16-E7 for amplification of nucleic acid under isothermal conditions at 63 degrees C for one hour. The amplification process of LAMP was monitored by the addition of HNB (hydroxy naphthol blue) dye prior to amplification. A positive reaction was indicated by a color change from violet to sky blue and confirmed by real-time turbidimeter and agarose electrophoresis. Thirteen cervical swab samples having single infection with 13 different HPV genotypes were examined to evaluate the specificity. A serial dilution of a cloned plasmid containing HPV-E6 or HPV-E7 gene was examined to evaluate the sensitivity. The results showed that no cross-reaction with other HPV genotypes was observed. The colorimetric LAMP assay could achieve a sensitivity of 1000 copies, 10-20 times lower than that of real-time PCR. The assay was further evaluated with 62 clinical specimens and consistent results were obtained compared with the detection using Kai Pu HPV Genotyping Kit. We concluded that this colorimetric LAMP assay had potential usefulness for the rapid screening of the HPV6 or HPV16 infection in the laboratories and hospitals of provincial and municipal region in China.
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
Single Cell Analysis of Dystrophin and SRY Gene by Using Whole Genome Amplification
Institute of Scientific and Technical Information of China (English)
徐晨明; 金帆; 黄荷凤; 陶冶; 叶英辉
2001-01-01
Objective To develop a reliable and sensitive method for detection of sex and multiloci of Duchenne muscular dystrophy (DMD) gene in single cell Materials & methods Whole genome of single cell were amplified by using 15-base random primers (primer extension preamplification, PEP), then a small aliquot of PEP product were analyzed by using locus-specific nest PCR amplification. The procedure was evaluated by detection dystrophin exons 8, 17, 19, 44, 45, 48 and human testis-determining gene (SRY)in single lymphocytes from known sources and single blastomeres from the couples with no family history of DMD.Results The amplification efficiency rate of six dystrophin exons from single lymphocytes and single blastomeres were 97. 2% (175/180) and 100% (60/60) respectively.Results of SRY showed that 100% (15/15) amplification in single male-derived lymphocytes and 0% (0/15) amplification in single female-derived lymphocytes. Conclusion The technique of single cell PEP-nest PCR for dystrophin exons 8, 17,19, 44, 45, 48 and SRY is highly specifc. PEP-nest PCR is suitable for Preimplantation genetic diagnosis (PGD) of DMD at single cell level.
Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun
2015-07-08
We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.
Directory of Open Access Journals (Sweden)
Daniele Calistri
2004-09-01
Full Text Available DNA amplification of exfoliated cells in stool repre sents an inexpensive and rapid test, but has only 50% to 60% sensitivity. A new quantitative method, calle( fluorescence long DNA, was developed and validate( in our laboratory on stool obtained from 86 patient., with primary colorectal cancer and from 62 health individuals. It consists of the amplification of stoo DNA with fluorescence primers and the quantification of the amplification using a standard curve. Results are arbitrarily expressed in nanograms. The potential of thi new method compared to the conventional approact was analyzed in a subgroup of 94 individuals (51 patients and 38 healthy volunteers. In the presen series, DNA amplification analysis showed a specific ity of 97% and a sensitivity of only 50%. Conversely fluorescence DNA evaluation, using the best cutoff o 25 ng, showed a sensitivity of about 76% and a spec ificity of 93%. Similar sensitivity was observed regard less of Dukes stage, tumor location, and size, thu., also permitting the detection of early-stage tumors The present study seems to indicate that quantitative fluorescence DNA determination in stool successfully identifies colorectal cancer patients with a sensitivity comparable, if not superior, to that of multiple gene analysis but at a lower cost and in a shorter time.
Feng, Jian Q; Xing, Lianping; Zhang, Jiang-Hong; Zhao, Ming; Horn, Diane; Chan, Jeannie; Boyce, Brendan F; Harris, Stephen E; Mundy, Gregory R; Chen, Di
2003-08-01
Bone morphogenetic protein-2 (BMP-2) regulates growth plate chondrogenesis during development and postnatal bone growth, but the control mechanisms of BMP-2 expression in growth plate chondrocytes are unknown. Here we have used both in vitro and in vivo approaches to demonstrate that transcription factor, NF-kappaB, regulates BMP-2 gene expression in chondrocytes. Two putative NF-kappaB response elements were found in the -2712/+165 region of the BMP-2 gene. Cotransfection of mutant I-kappaBalpha expression plasmids with BMP-2 promoter-luciferase reporters into TMC-23 chondrocyte cell line suppressed BMP-2 transcription. Mutations in NF-kappaB response elements in the BMP-2 gene lead to decreases in BMP-2 promoter activity. Electrophoretic mobility shift assay using nuclear extracts from TMC-23 chondrocytic cells revealed that the NF-kappaB subunits p50 and p65 bound to the NF-kappaB response elements of the BMP-2 gene. Thus, NF-kappaB may positively regulate BMP-2 gene transcription. Consistent with these findings, expression of BMP-2 mRNA was significantly reduced in growth plate chondrocytes in NF-kappaB p50/p52 dKO mice, which associated with decreased numbers of 5-bromo-2'-deoxyuridine (BrdUrd)-positive cells in the proliferating zone of growth plate in these mice. Therefore, in postnatal growth plate chondrocytes, expression of BMP-2 is regulated by NF-kappaB, which may play an important role in chondrogenesis.
Directory of Open Access Journals (Sweden)
Michael G. Mauk
2015-10-01
Full Text Available Microfluidic components and systems for rapid (<60 min, low-cost, convenient, field-deployable sequence-specific nucleic acid-based amplification tests (NAATs are described. A microfluidic point-of-care (POC diagnostics test to quantify HIV viral load from blood samples serves as a representative and instructive example to discuss the technical issues and capabilities of “lab on a chip” NAAT devices. A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1 nucleic acids (NAs are extracted from relatively large (~mL volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase (“membrane” to capture sample NAs in a flow-through, filtration mode; (2 NAs captured on the membrane are isothermally (~65 °C amplified; (3 amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4 paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD better than 103 virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed.
Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer
Directory of Open Access Journals (Sweden)
Helen Hencida Thangamony
2018-01-01
Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.
Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC)
International Nuclear Information System (INIS)
Ji, Meiju; Guan, Haixia; Gao, Cuixia; Shi, Bingyin; Hou, Peng
2011-01-01
Lung cancer is the leading cause of cancer-related death worldwide. Genetic and epigenetic alterations have been identified frequently in lung cancer, such as promoter methylation, gene mutations and genomic amplification. However, the interaction between genetic and epigenetic events and their significance in lung tumorigenesis remains poorly understood. We determined the promoter methylation of 6 genes and PIK3CA amplification using quantitative methylation-specific PCR (Q-MSP) and real-time quantitative PCR, respectively, and explore the association of promoter methylation with PIK3CA amplification in a large cohort of clinically well-characterized non-small cell lung cancer (NSCLC). Highly frequent promoter methylation was observed in NSCLC. With 100% diagnostic specificity, excellent sensitivity, ranging from 45.8 to 84.1%, was found for each of the 6 genes. The promoter methylation was associated with histologic type. Methylation of CALCA, CDH1, DAPK1, and EVX2 was more common in squamous cell carcinomas (SCC) compared to adenocarcinomas (ADC). Conversely, there was a trend toward a higher frequency of RASSF1A methylation in ADC than SCC. In addition, PIK3CA amplification was frequently found in NSCLC, and was associated with certain clinicopathologic features, such as smoking history, histologic type and pleural indentation. Importantly, aberrant promoter methylation of certain genes was significantly associated with PIK3CA amplification. Our data showed highly frequent promoter methylation and PIK3CA amplification in Chinese NSCLC population, and first demonstrated the associations of gene methylation with PIK3CA amplification, suggesting that these epigenetic events may be a consequence of overactivation of PI3K/Akt pathway
Directory of Open Access Journals (Sweden)
La Mura Maurizio
2009-02-01
Full Text Available Abstract Background The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR. Here we have applied the loop-mediated isothermal amplification (LAMP method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene junctions. Results We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. Conclusion This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.
Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K
2013-10-15
Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. © 2013 Elsevier B.V. All rights reserved.
The rolling circle amplification and next generation sequencing ...
African Journals Online (AJOL)
Rolling circle amplification is a simple approach of enriching populations of single-stranded DNA plant begomovirus genomes (genus, Begomovirus; family, Geminiviridae). This is an innovative approach that utilizes the robustness of the bacteriophage phi29 DNA polymerase used in circle amplification, together with deep ...
Amplification of Chirality in Hydrogen-Bonded Tetrarosette Helices
Mateos timoneda, Miguel; Crego Calama, Mercedes; Reinhoudt, David
2006-01-01
The amplification of chirality in hydrogen-bonded tetrarosette assemblies under thermodynamic equilibrium is described. The extent of the chiral amplification obtained by means of “sergeants-and-soldiers” experiments depends only on the structure of the assembly and it is independent of the
Centrosome Amplification Is Sufficient to Promote Spontaneous Tumorigenesis in Mammals
Levine, Michelle S.; Bakker, Bjorn; Boeckx, Bram; Moyett, Julia; Lu, James; Vitre, Benjamin; Spierings, Diana C.; Lansdorp, Peter M.; Cleveland, Don W.; Lambrechts, Diether; Foijer, Floris; Holland, Andrew J.
2017-01-01
Centrosome amplification is a common feature of human tumors, but whether this is a cause or a consequence of cancer remains unclear. Here, we test the consequence of centrosome amplification by creating mice in which centrosome number can be chronically increased in the absence of additional
Explanatory Model for Sound Amplification in a Stethoscope
Eshach, H.; Volfson, A.
2015-01-01
In the present paper we suggest an original physical explanatory model that explains the mechanism of the sound amplification process in a stethoscope. We discuss the amplification of a single pulse, a continuous wave of certain frequency, and finally we address the resonant frequencies. It is our belief that this model may provide students with…
An enzymatic signal amplification system for calorimetric studies of cellobiohydrolases
DEFF Research Database (Denmark)
Murphy, Leigh; Baumann, Martin Johannes; Borch, Kim
2010-01-01
amplification method has been developed to measure even slow hydrolytically active enzymes such as cellobiohydrolases. This method is explained in detail for the amplification of the heat signal by more than 130 times by using glucose oxidase and catalase. The kinetics of this complex coupled reaction system...
Rapid screening for human-pathogenic Mucorales using rolling circle amplification.
Dolatabadi, S; Najafzadeh, M J; de Hoog, G S
2014-12-01
Mucormycosis has emerged as a relatively common severe mycosis in patients with haematological and allogeneic stem cell transplantation. Source of transmission is from unidentified sources in the environment. Early diagnosis of infection and its source of contamination are paramount for rapid and appropriate therapy. In this study, rolling circle amplification (RCA) is introduced as a sensitive, specific and reproducible isothermal DNA amplification technique for rapid molecular identification of six of the most virulent species (Rhizopus microsporus, R. arrhizus var. arrhizus, R. arrhizus var. delemar, Mucor irregularis, Mucor circinelloides, Lichtheimia ramosa, Lichtheimia corymbifera). DNAs of target species were successfully amplified, with no cross reactivity between species. RCA can be considered as a rapid detection method with high specificity and sensitivity, suitable for large screening. © 2014 Blackwell Verlag GmbH.
Chirped pulse amplification: Present and future
International Nuclear Information System (INIS)
Maine, P.; Strickland, D.; Pessot, M.; Squier, J.; Bado, P.; Mourou, G.; Harter, D.
1988-01-01
Short pulses with ultrahigh peak powers have been generated in Nd: glass and Alexandrite using the Chirped Pulse Amplification (CPA) technique. This technique has been successful in producing picosecond terawatt pulses with a table-top laser system. In the near future, CPA will be applied to large laser systems such as NOVA to produce petawatt pulses (1 kJ in a 1 ps pulse) with focused intensities exceeding 10/sup /plus/21/ W/cm 2 . These pulses will be associated with electric fields in excess of 100 e/a/sub o/ 2 and blackbody energy densities equivalent to 3 /times/ 10 10 J/cm 3 . This petawatt source will have important applications in x-ray laser research and will lead to fundamentally new experiments in atomic, nuclear, solid-state, plasma, and high-energy density physics. A review of present and future designs are discussed. 17 refs., 5 figs
Raman amplification in optical communication systems
DEFF Research Database (Denmark)
Kjær, Rasmus
2008-01-01
Fiber Raman amplifiers are investigated with the purpose of identifying new applications and limitations for their use in optical communication systems. Three main topics are investigated, namely: New applications of dispersion compensating Raman amplifiers, the use Raman amplification to increase...... fiberbaserede Raman-forstærkere med henblik på at identificere både deres begrænsninger og nye anvendelsesmuligheder i optiske kommunikationssystemer. En numerisk forstærkermodel er blevet udviklet for bedre at forstå forstærkerens dynamik, dens gain- og støjbegrænsninger. Modellen bruges til at forudsige...... forstærkerens statiske og dynamiske egenskaber, og det eftervises at dens resultater er i god overensstemmelse med eksperimentelle forstærkermålinger. Dispersions-kompenserende fiber er på grund af sin store udbredelse og fiberens høje Raman gain effektivitet et meget velegnet Raman gain-medium. Tre nye...
Social and political amplification of technological hazards
International Nuclear Information System (INIS)
Ibitayo, Olurominiyi O.; Mushkatel, Alvin; Pijawka, K. David
2004-01-01
Using an industrial explosion in Henderson, Nevada, as a case study, this paper examines three main issues: the efficacy of a technological hazard event in amplifying otherwise latent issues, the extent to which the hazard event can serve as a focusing event for substantive local and state policy initiatives, and the effect of fragmentation of political authority in managing technological hazards. The findings indicate that the explosion amplified several public safety issues and galvanized the public into pressing for major policy initiatives. However, notwithstanding the amplification of several otherwise latent issues, and the flurry of activities by the state and local governments, the hazard event did not seem to be an effective focusing event or trigger mechanism for substantive state and local policy initiatives. In addition, the study provides evidence of the need for a stronger nexus between political authority, land-use planning and technological hazard management
Resistive wall modes and error field amplification
International Nuclear Information System (INIS)
Boozer, Allen H.
2003-01-01
Resistive wall modes and the rapid damping of plasma rotation by the amplification of magnetic field errors are related physical phenomena that affect the performance of the advanced tokamak and spherical torus plasma confinement devices. Elements of our understanding of these phenomena and the code that is used to design the major experimental facilities are based on the electrical circuit representation of the response of the plasma to perturbations. Although the circuit representation of the plasma may seem heuristic, this representation can be rigorously obtained using Maxwell's equations and linearity for plasmas that evolve on a disparate time scale from that of external currents. These and related results are derived. In addition methods are given for finding the plasma information that the circuit representation requires using post-processors for codes that calculate perturbed plasma equilibria
Scintillation light detectors with Neganov Luke amplification
Isaila, C.; Boslau, O.; Coppi, C.; Feilitzsch, F. v.; Goldstraß, P.; Jagemann, T.; Jochum, J.; Kemmer, J.; Lachenmaier, T.; Lanfranchi, J.-C.; Pahlke, A.; Potzel, W.; Rau, W.; Stark, M.; Wernicke, D.; Westphal, W.
2006-04-01
For an active suppression of the gamma and electron background in the Cryogenic Rare Event Search with Superconducting Thermometers (CRESST) dark matter experiment both phonons and scintillation light generated in a CaWO 4 crystal are detected simultaneously. The phonon signal is read out by a transition edge sensor (TES) on the CaWO 4 crystal. For light detection a silicon absorber equipped with a TES is employed. An efficient background discrimination requires very sensitive light detectors. The threshold can be improved by applying an electric field to the silicon crystal leading to an amplification of the thermal signal due to the Neganov-Luke effect. Measurements showing the improved sensitivity of the light detectors as well as future steps for reducing the observed extra noise will be presented.
Raman Amplification with a Flying Focus
Turnbull, D.; Bucht, S.; Davies, A.; Haberberger, D.; Kessler, T.; Shaw, J. L.; Froula, D. H.
2018-01-01
We propose a new laser amplifier scheme utilizing stimulated Raman scattering in plasma in conjunction with a "flying focus"—a chromatic focusing system combined with a chirped pump beam that provides spatiotemporal control over the pump's focal spot. Pump intensity isosurfaces are made to propagate at v =-c so as to be in sync with the injected counterpropagating seed pulse. By setting the pump intensity in the interaction region to be just above the ionization threshold of the background gas, an ionization wave is produced that travels at a fixed distance ahead of the seed. Simulations show that this will make it possible to optimize the plasma temperature and mitigate many of the issues that are known to have impacted previous Raman amplification experiments, in particular, the growth of precursors.
Protein Misfolding Cyclic Amplification of Infectious Prions.
Moda, Fabio
2017-01-01
Transmissible spongiform encephalopathies, or prion diseases, are a group of incurable disorders caused by the accumulation of an abnormally folded prion protein (PrP Sc ) in the brain. According to the "protein-only" hypothesis, PrP Sc is the infectious agent able to propagate the disease by acting as a template for the conversion of the correctly folded prion protein (PrP C ) into the pathological isoform. Recently, the mechanism of PrP C conversion has been mimicked in vitro using an innovative technique named protein misfolding cyclic amplification (PMCA). This technology represents a great tool for studying diverse aspects of prion biology in the field of basic research and diagnosis. Moreover, PMCA can be expanded for the study of the misfolding process associated to other neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, and frontotemporal lobar degeneration. © 2017 Elsevier Inc. All rights reserved.
Markovian Dynamics of Josephson Parametric Amplification
Directory of Open Access Journals (Sweden)
W. Kaiser
2017-09-01
Full Text Available In this work, we derive the dynamics of the lossy DC pumped non-degenerate Josephson parametric amplifier (DCPJPA. The main element in a DCPJPA is the superconducting Josephson junction. The DC bias generates the AC Josephson current varying the nonlinear inductance of the junction. By this way the Josephson junction acts as the pump oscillator as well as the time varying reactance of the parametric amplifier. In quantum-limited amplification, losses and noise have an increased impact on the characteristics of an amplifier. We outline the classical model of the lossy DCPJPA and derive the available noise power spectral densities. A classical treatment is not capable of including properties like spontaneous emission which is mandatory in case of amplification at the quantum limit. Thus, we derive a quantum mechanical model of the lossy DCPJPA. Thermal losses are modeled by the quantum Langevin approach, by coupling the quantized system to a photon heat bath in thermodynamic equilibrium. The mode occupation in the bath follows the Bose-Einstein statistics. Based on the second quantization formalism, we derive the Heisenberg equations of motion of both resonator modes. We assume the dynamics of the system to follow the Markovian approximation, i.e. the system only depends on its actual state and is memory-free. We explicitly compute the time evolution of the contributions to the signal mode energy and give numeric examples based on different damping and coupling constants. Our analytic results show, that this model is capable of including thermal noise into the description of the DC pumped non-degenerate Josephson parametric amplifier.
Markovian Dynamics of Josephson Parametric Amplification
Kaiser, Waldemar; Haider, Michael; Russer, Johannes A.; Russer, Peter; Jirauschek, Christian
2017-09-01
In this work, we derive the dynamics of the lossy DC pumped non-degenerate Josephson parametric amplifier (DCPJPA). The main element in a DCPJPA is the superconducting Josephson junction. The DC bias generates the AC Josephson current varying the nonlinear inductance of the junction. By this way the Josephson junction acts as the pump oscillator as well as the time varying reactance of the parametric amplifier. In quantum-limited amplification, losses and noise have an increased impact on the characteristics of an amplifier. We outline the classical model of the lossy DCPJPA and derive the available noise power spectral densities. A classical treatment is not capable of including properties like spontaneous emission which is mandatory in case of amplification at the quantum limit. Thus, we derive a quantum mechanical model of the lossy DCPJPA. Thermal losses are modeled by the quantum Langevin approach, by coupling the quantized system to a photon heat bath in thermodynamic equilibrium. The mode occupation in the bath follows the Bose-Einstein statistics. Based on the second quantization formalism, we derive the Heisenberg equations of motion of both resonator modes. We assume the dynamics of the system to follow the Markovian approximation, i.e. the system only depends on its actual state and is memory-free. We explicitly compute the time evolution of the contributions to the signal mode energy and give numeric examples based on different damping and coupling constants. Our analytic results show, that this model is capable of including thermal noise into the description of the DC pumped non-degenerate Josephson parametric amplifier.
Ground amplification determined from borehole accelerograms
International Nuclear Information System (INIS)
Archuleta, R.J.; Seale, S.H.
1991-01-01
The Garner Valley downhole array (GVDA) consists of one surface accelerometer and four downhole accelerometers at depths of 6 m, 15 m, 22m, and 220 m. The five, three-component vertical array of dual-gain accelerometers are capable of measuring accelerations from 3 x 10 -6 g to 2.0 g over a frequency range from 0.0 Hz (0.025, high-gain) Hz to 100 Hz. The site (33 degree 41.60' N, 116 degree 40.20 degree W) is only seven kilometers off the trace of the San Jacinto fault, the most active strand of the San Andreas fault system in southern California and only about 35 km from the San Andreas fault itself. Analysis of individual spectra and spectral ratios for the various depths shows that the zone of weathered granite has a pronounced effect on the spectral amplitudes for frequencies greater than 40 Hz. The soil layer impedance may amplify the high frequencies more than it attenuates. This result must be checked more thoroughly with special consideration of the spectra of the P-wave coda on the horizontal components. Analysis of the P-wave spectra and the spectral ratios shows an increased amplification in the same frequency range (60-90 Hz) where the S-wave spectral ratios imply a change in the attenuation. Comparison of acceleration spectra from two earthquakes, M L 4.2 and M L 2.5 that have nearly the same hypocenter, shows that the near surface amplification and attenuation is nearly the same for both earthquakes. However, the earthquakes themselves are different if we can assume that the recording at 220 m reflects the source spectra with a slight attenuation. The M L 2.5 earthquake has significantly greater high frequency content if the spectra are normalized at the low frequency, i.e., normalization by seismic moment
Cascade DNA nanomachine and exponential amplification biosensing.
Xu, Jianguo; Wu, Zai-Sheng; Shen, Weiyu; Xu, Huo; Li, Hongling; Jia, Lee
2015-11-15
DNA is a versatile scaffold for the assembly of multifunctional nanostructures, and potential applications of various DNA nanodevices have been recently demonstrated for disease diagnosis and treatment. In the current study, a powerful cascade DNA nanomachine was developed that can execute the exponential amplification of p53 tumor suppressor gene. During the operation of the newly-proposed DNA nanomachine, dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) was ingeniously introduced, where the target trigger is repeatedly used as the fuel molecule and the nicked fragments are dramatically accumulated. Moreover, each displaced nicked fragment is able to activate the another type of cyclical strand-displacement amplification, increasing exponentially the value of fluorescence intensity. Essentially, one target binding event can induce considerable number of subsequent reactions, and the nanodevice was called cascade DNA nanomachine. It can implement several functions, including recognition element, signaling probe, polymerization primer and template. Using the developed autonomous operation of DNA nanomachine, the p53 gene can be quantified in the wide concentration range from 0.05 to 150 nM with the detection limit of 50 pM. If taking into account the final volume of mixture, the detection limit is calculated as lower as 6.2 pM, achieving an desirable assay ability. More strikingly, the mutant gene can be easily distinguished from the wild-type one. The proof-of-concept demonstrations reported herein is expected to promote the development and application of DNA nanomachine, showing great potential value in basic biology and medical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.
Bowen, G. J.; Abels, H.
2015-12-01
Abrupt changes in the isotope composition of exogenic carbon pools accompany many major episodes of global change in the geologic record. The global expression of this change in substrates that reflect multiple carbon pools provides important evidence that many events reflect persistent, global redistribution of carbon between reduced and oxidized stocks. As the diversity of records documenting any event grows, however, discrepancies in the expression of carbon isotope change among substrates are almost always revealed. These differences in magnitude, pace, and pattern of change can complicate interpretations of global carbon redistribution, but under ideal circumstances can also provide additional information on changes in specific environmental and biogeochemical systems that accompanied the global events. Here we evaluate possible environmental influences on new terrestrial records of the negative carbon isotope excursions (CIEs) associated with multiple hyperthermals of the Early Eocene, which show a common pattern of amplified carbon isotope change in terrestrial paleosol carbonate records relative to that recorded in marine substrates. Scaling relationships between climate and carbon-cycle proxies suggest that that the climatic (temperature) impact of each event scaled proportionally with the magnitude of its marine CIE, likely implying that all events involved release of reduced carbon with a similar isotopic composition. Amplification of the terrestrial CIEs, however, does not scale with event magnitude, being proportionally less for the first, largest event (the PETM). We conduct a sensitivity test of a coupled plant-soil carbon isotope model to identify conditions that could account for the observed CIE scaling. At least two possibilities consistent with independent lines of evidence emerge: first, varying effects of pCO2 change on photosynthetic carbon isotope discrimination under changing background pCO2, and second, contrasting changes in regional
Creytens, David; van Gorp, Joost; Ferdinande, Liesbeth; Speel, Ernst-Jan; Libbrecht, Louis
2015-02-01
In this study, the detection of MDM2 and CDK4 amplification was evaluated in lipomatous soft tissue tumors using multiplex ligation-dependent probe amplification (MLPA), a PCR-based technique, in comparison with fluorescence in situ hybridization (FISH). These 2 techniques were evaluated in a series of 77 formalin-fixed, paraffin-embedded lipomatous tumors (27 benign adipose tumors, 28 atypical lipomatous tumors/well-differentiated liposarcomas, 18 dedifferentiated liposarcomas, and 4 pleomorphic liposarcomas). Using MLPA, with a cut-off ratio of >2, 36/71 samples (22 atypical lipomatous tumors/well-differentiated liposarcomas, and 14 dedifferentiated liposarcomas) showed MDM2 and CDK4 amplification. Using FISH as gold standard, MLPA showed a sensitivity of 90% (36/40) and a specificity of 100% (31/31) in detecting amplification of MDM2 and CDK4 in lipomatous soft tissue tumors. In case of high-level amplification (MDM2-CDK4/CEP12 ratio >5), concordance was 100%. Four cases of atypical lipomatous tumor/well-differentiated liposarcoma (4/26, 15%) with a low MDM2 and CDK4 amplification level (MDM2-CDK4/CEP12 ratio ranging between 2 and 2.5) detected by FISH showed no amplification by MLPA, although gain of MDM2 and CDK4 (ratios ranging between 1.6 and 1.9) was seen with MLPA. No amplification was detected in benign lipomatous tumors and pleomorphic liposarcomas. Furthermore, there was a very high concordance between the ratios obtained by FISH and MLPA. In conclusion, MLPA proves to be an appropriate and straightforward technique for screening MDM2/CDK4 amplification in lipomatous tumors, especially when a correct cut-off value and reference samples are chosen, and could be considered a good alternative to FISH to determine MDM2 and CDK4 amplification in liposarcomas. Moreover, because MLPA, as a multiplex technique, allows simultaneous detection of multiple chromosomal changes of interest, it could be in the future a very reliable and fast molecular analysis on
Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I
2017-07-15
This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kasten-Pisula, Ulla; Saker, Jarob; Eicheler, Wolfgang; Krause, Mechthild; Yaromina, Ala; Meyer-Staeckling, Soenke; Scherkl, Benjamin; Kriegs, Malte; Brandt, Burkhard; Grenman, Reidar; Petersen, Cordula; Baumann, Michael; Dikomey, Ekkehard
2011-01-01
Purpose: There is conflicting evidence for whether the expression of epidermal growth factor receptor in human tumors can be used as a marker of radioresponse. Therefore, this association was studied in a systematic manner using squamous cell carcinoma (SCC) cell lines grown as cell cultures and xenografts. Methods and Materials: The study was performed with 24 tumor cell lines of different tumor types, including 10 SCC lines, which were also investigated as xenografts on nude mice. Egfr gene dose and the length of CA-repeats in intron 1 were determined by polymerase chain reaction, protein expression in vitro by Western blot and in vivo by enzyme-linked immunosorbent assay, and radiosensitivity in vitro by colony formation. Data were correlated with previously published tumor control dose 50% data after fractionated irradiation of xenografts of the 10 SCC. Results: EGFR protein expression varies considerably, with most tumor cell lines showing moderate and only few showing pronounced upregulation. EGFR upregulation could only be attributed to massive gene amplification in the latter. In the case of little or no amplification, in vitro EGFR expression correlated with both cellular and tumor radioresponse. In vivo EGFR expression did not show this correlation. Conclusions: Local tumor control after the fractionated irradiation of tumors with little or no gene amplification seems to be dependent on in vitro EGFR via its effect on cellular radiosensitivity.
Study on high gain broadband optical parametric chirped pulse amplification
International Nuclear Information System (INIS)
Zhang, S.K.; Fujita, M.; Yamanaka, C.; Yoshida, H.; Kodama, R.; Fujita, H.; Nakatsuka, M.; Izawa, Y.
2000-01-01
Optical parametric chirped pulse amplification has apparent advantages over the current schemes for high energy ultrashort pulse amplification. High gain in a single pass amplification, small B-integral, low heat deposition, high contrast ratio and, especially the extremely broad gain bandwidth with large-size crystals available bring people new hope for over multi-PW level at which the existing Nd:glass systems suffered difficulties. In this paper we present simulation and experimental studies for a high gain optical parametric chirped pulse amplification system which may be used as a preamplifier to replace the current complicated regenerative system or multi-pass Ti:sapphire amplifiers. Investigations on the amplification bandwidth and gain with BBO are performed. Analysis and discussions are also given. (author)
Evaluating whole transcriptome amplification for gene profiling experiments using RNA-Seq.
Faherty, Sheena L; Campbell, C Ryan; Larsen, Peter A; Yoder, Anne D
2015-07-30
RNA-Seq has enabled high-throughput gene expression profiling to provide insight into the functional link between genotype and phenotype. Low quantities of starting RNA can be a severe hindrance for studies that aim to utilize RNA-Seq. To mitigate this bottleneck, whole transcriptome amplification (WTA) technologies have been developed to generate sufficient sequencing targets from minute amounts of RNA. Successful WTA requires accurate replication of transcript abundance without the loss or distortion of specific mRNAs. Here, we test the efficacy of NuGEN's Ovation RNA-Seq V2 system, which uses linear isothermal amplification with a unique chimeric primer for amplification, using white adipose tissue from standard laboratory rats (Rattus norvegicus). Our goal was to investigate potential biological artifacts introduced through WTA approaches by establishing comparisons between matched raw and amplified RNA libraries derived from biological replicates. We found that 93% of expressed genes were identical between all unamplified versus matched amplified comparisons, also finding that gene density is similar across all comparisons. Our sequencing experiment and downstream bioinformatic analyses using the Tuxedo analysis pipeline resulted in the assembly of 25,543 high-quality transcripts. Libraries constructed from raw RNA and WTA samples averaged 15,298 and 15,253 expressed genes, respectively. Although significant differentially expressed genes (P < 0.05) were identified in all matched samples, each of these represents less than 0.15% of all shared genes for each comparison. Transcriptome amplification is efficient at maintaining relative transcript frequencies with no significant bias when using this NuGEN linear isothermal amplification kit under ideal laboratory conditions as presented in this study. This methodology has broad applications, from clinical and diagnostic, to field-based studies when sample acquisition, or sample preservation, methods prove
Wong, Lilian I L; Labrecque, Mark P; Ibuki, Naokazu; Cox, Michael E; Elliott, John E; Beischlag, Timothy V
2015-03-25
Despite stringent restrictions on their use by many countries since the 1970s, the endocrine disrupting chemicals, DDT and DDE are still ubiquitous in the environment. However, little attention has been directed to p,p'-DDT and the anti-androgen, p,p'-DDE on androgen receptor (AR) target gene transcription in human cells. Inhibitors of androgenic activity may have a deleterious clinical outcome in prostate cancer screens and progression, therefore we determined whether environmentally relevant concentrations of p,p'-DDT and p,p'-DDE negatively impact AR-regulated expression of prostate-specific antigen (PSA), and other AR target genes in human LNCaP and VCaP prostate cancer cells. Quantitative real-time PCR and immuno-blotting techniques were used to measure intracellular PSA, PSMA and AR mRNA and protein levels. We have shown for the first time that p,p'-DDT and p,p'-DDE repressed R1881-inducible PSA mRNA and protein levels in a dose-dependent manner. Additionally, we used the fully automated COBAS PSA detection system to determine that extracellular PSA levels were also significantly repressed. These chemicals achieve this by blocking the recruitment of AR to the PSA promoter region at 10 μM, as demonstrated by the chromatin immunoprecipitation (ChIP) in LNCaP cells. Both p,p'-DDT and p,p'-DDE repressed R1881-inducible AR protein accumulation at 10 μM. Thus, we conclude that men who have been exposed to either DDT or DDE may produce a false-negative PSA test when screening for prostate cancer, resulting in an inaccurate clinical diagnosis. More importantly, prolonged exposure to these anti-androgens may mimic androgen ablation therapy in individuals with prostate cancer, thus exacerbating the condition by inadvertently forcing adaptation to this stress early in the disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Maggie R Williams
Full Text Available Loop-mediated isothermal amplification (LAMP of aquatic invasive species environmental DNA (AIS eDNA was used for rapid, sensitive, and specific detection of Dreissena sp. relevant to the Great Lakes (USA basin. The method was validated for two uses including i direct amplification of eDNA using a hand filtration system and ii confirmation of the results after DNA extraction using a conventional thermal cycler run at isothermal temperatures. Direct amplification eliminated the need for DNA extraction and purification and allowed detection of target invasive species in grab or concentrated surface water samples, containing both free DNA as well as larger cells and particulates, such as veligers, eggs, or seeds. The direct amplification method validation was conducted using Dreissena polymorpha and Dreissena bugensis and uses up to 1 L grab water samples for high target abundance (e.g., greater than 10 veligers (larval mussels per L for Dreissena sp. or 20 L samples concentrated through 35 μm nylon screens for low target abundance, at less than 10 veligers per liter water. Surface water concentrate samples were collected over a period of three years, mostly from inland lakes in Michigan with the help of a network of volunteers. Field samples collected from 318 surface water locations included i filtered concentrate for direct amplification validation and ii 1 L grab water sample for eDNA extraction and confirmation. Though the extraction-based protocol was more sensitive (resulting in more positive detections than direct amplification, direct amplification could be used for rapid screening, allowing for quicker action times. For samples collected between May and August, results of eDNA direct amplification were consistent with known presence/absence of selected invasive species. A cross-platform smartphone application was also developed to disseminate the analyzed results to volunteers. Field tests of the direct amplification protocol using a
Genomic Amplification of an Endogenous Retrovirus in Zebrafish T-Cell Malignancies
Directory of Open Access Journals (Sweden)
J. Kimble Frazer
2012-01-01
Full Text Available Genomic instability plays a crucial role in oncogenesis. Somatically acquired mutations can disable some genes and inappropriately activate others. In addition, chromosomal rearrangements can amplify, delete, or even fuse genes, altering their functions and contributing to malignant phenotypes. Using array comparative genomic hybridization (aCGH, a technique to detect numeric variations between different DNA samples, we examined genomes from zebrafish (Danio rerio T-cell leukemias of three cancer-prone lines. In all malignancies tested, we identified recurring amplifications of a zebrafish endogenous retrovirus. This retrovirus, ZFERV, was first identified due to high expression of proviral transcripts in thymic tissue from larval and adult fish. We confirmed ZFERV amplifications by quantitative PCR analyses of DNA from wild-type fish tissue and normal and malignant D. rerio T cells. We also quantified ZFERV RNA expression and found that normal and neoplastic T cells both produce retrovirally encoded transcripts, but most cancers show dramatically increased transcription. In aggregate, these data imply that ZFERV amplification and transcription may be related to T-cell leukemogenesis. Based on these data and ZFERV’s phylogenetic relation to viruses of the murine-leukemia-related virus class of gammaretroviridae, we posit that ZFERV may be oncogenic via an insertional mutagenesis mechanism.
Microsatellite loci in Japanese quail and cross-species amplification in chicken and guinea fowl
Directory of Open Access Journals (Sweden)
Mizutani Makoto
2002-03-01
Full Text Available Abstract In line with the Gifu University's initiative to map the Japanese quail genome, a total of 100 Japanese quail microsatellite markers isolated in our laboratory were evaluated in a population of 20 unrelated quails randomly sampled from a colony of wild quail origin. Ninety-eight markers were polymorphic with an average of 3.7 alleles per locus and a mean heterozygosity of 0.423. To determine the utility of these markers for comparative genome mapping in Phasianidae, cross-species amplification of all the markers was tested with chicken and guinea fowl DNA. Amplification products similar in size to the orthologous loci in quail were observed in 42 loci in chicken and 20 loci in guinea fowl. Of the cross-reactive markers, 57.1% in chicken and 55.0% in guinea fowl were polymorphic when tested in 20 birds from their respective populations. Five of 15 markers that could cross-amplify Japanese quail, chicken, and guinea fowl DNA were polymorphic in all three species. Amplification of orthologous loci was confirmed by sequencing 10 loci each from chicken and guinea fowl and comparing with them the corresponding quail sequence. The microsatellite markers reported would serve as a useful resource base for genetic mapping in quail and comparative mapping in Phasianidae.
Homozygous Deletions and Recurrent Amplifications Implicate New Genes Involved in Prostate Cancer
Directory of Open Access Journals (Sweden)
Wennuan Liu
2008-08-01
Full Text Available Prostate cancer cell lines provide ideal in vitro systems for the identification and analysis of prostate tumor suppressors and oncogenes. A detailed characterization of the architecture of prostate cancer cell line genomes would facilitate the study of precise roles of various genes in prostate tumorigenesis in general. To contribute to such a characterization, we used the GeneChip 500K single nucleotide polymorphic (SNP array for analysis of genotypes and relative DNA copy number changes across the genome of 11 cell lines derived from both normal and cancerous prostate tissues. For comparison purposes, we also examined the alterations observed in the cell lines in tumor/normal pairs of clinical samples from 72 patients. Along with genome-wide maps of DNA copy number changes and loss of heterozygosity for these cell lines, we report previously unreported homozygous deletions and recurrent amplifications in prostate cancers in this study. The homozygous deletions affected a number of biologically important genes, including PPP2R2A and BNIP3L identified in this study and CDKN2A/CDKN2B reported previously. Although most amplified genomic regions tended to be large, amplifications at 8q24.21 were of particular interest because the affected regions are relatively small, are found in multiple cell lines, are located near MYC, an oncogene strongly implicated in prostate tumorigenesis, and are known to harbor SNPs that are associated with inherited susceptibility for prostate cancer. The genomic alterations revealed in this study provide an important catalog of positional information relevant to efforts aimed at deciphering the molecular genetic basis of prostate cancer.
Gray, Kerryn; Crowle, Damian; Scott, Pam
2014-09-01
A significant number of evidence items submitted to Forensic Science Service Tasmania (FSST) are blood swabs or bloodstained items. Samples from these items routinely undergo phenol:chloroform:isoamyl alcohol organic extraction and quantitative Polymerase Chain Reaction (qPCR) testing prior to PowerPlex(®) 21 amplification. This multi-step process has significant cost and timeframe implications in a fiscal climate of tightening government budgets, pressure towards improved operating efficiencies, and an increasing emphasis on rapid techniques better supporting intelligence-led policing. Direct amplification of blood and buccal cells on cloth and Whatman FTA™ card with PowerPlex(®) 21 has already been successfully implemented for reference samples, eliminating the requirement for sample pre-treatment. Scope for expanding this method to include less pristine casework blood swabs and samples from bloodstained items was explored in an endeavour to eliminate lengthy DNA extraction, purification and qPCR steps for a wider subset of samples. Blood was deposited onto a range of substrates including those historically found to inhibit STR amplification. Samples were collected with micro-punch, micro-swab, or both. The potential for further fiscal savings via reduced volume amplifications was assessed by amplifying all samples at full and reduced volume (25 and 13μL). Overall success rate data showed 80% of samples yielded a complete profile at reduced volume, compared to 78% at full volume. Particularly high success rates were observed for the blood on fabric/textile category with 100% of micro-punch samples yielding complete profiles at reduced volume and 85% at full volume. Following the success of this trial, direct amplification of suitable casework blood samples has been implemented at reduced volume. Significant benefits have been experienced, most noticeably where results from crucial items have been provided to police investigators prior to interview of
Chromosomal imbalances in four new uterine cervix carcinoma derived cell lines
International Nuclear Information System (INIS)
Hidalgo, Alfredo; Monroy, Alberto; Arana, Rosa Ma; Taja, Lucía; Vázquez, Guelaguetza; Salcedo, Mauricio
2003-01-01
Uterine cervix carcinoma is the second most common female malignancy worldwide and a major health problem in Mexico, representing the primary cause of death among the Mexican female population. High risk human papillomavirus (HPV) infection is considered to be the most important risk factor for the development of this tumor and cervical carcinoma derived cell lines are very useful models for the study of viral carcinogenesis. Comparative Genomic Hybridization (CGH) experiments have detected a specific pattern of chromosomal imbalances during cervical cancer progression, indicating chromosomal regions that might contain genes that are important for cervical transformation. We performed HPV detection and CGH analysis in order to initiate the genomic characterization of four recently established cervical carcinoma derived cell lines from Mexican patients. All the cell lines were HPV18 positive. The most prevalent imbalances in the cell lines were gains in chromosomes 1q23-q32, 3q11.2-q13.1, 3q22-q26.1, 5p15.1-p11.2, this alteration present as a high copy number amplification in three of the cell lines, 7p15-p13, 7q21, 7q31, 11q21, and 12q12, and losses in 2q35-qter, 4p16, 6q26-qter, 9q34 and 19q13.2-qter. Analysis of our present findings and previously reported data suggest that gains at 1q31-q32 and 7p13-p14, as well as losses at 6q26-q27 are alterations that might be unique for HPV18 positive cases. These chromosomal regions, as well as regions with high copy number amplifications, coincide with known fragile sites and known HPV integration sites. The general pattern of chromosomal imbalances detected in the cells resembled that found in invasive cervical tumors, suggesting that the cells represent good models for the study of cervical carcinoma
International Nuclear Information System (INIS)
Geard, Charles R.; Jenkins, Gloria
1995-01-01
Purpose: To quantitatively assess all gamma-ray induced chromosomal changes confined to one human chromosome using fluorescence microscopy and in situ hybridization with a fluorescently labeled human chromosome specific nucleic acid probe. Methods and Materials: Synchronized human-hamster hybrid cells containing human chromosome 11 were obtained by a modified mitotic shake-off procedure. G1 phase cells (> 95%) were irradiated with 137 Cs gamma rays (0, 0.5, 1.0, 1.5, 2.0, 4.0, 6.0, 8.0, and 10.0 Gy) at a dose rate of 1.1 Gy/min and mitotic cells collected 16-20 h later; chromosomal spreads were prepared, denatured, and hybridized with a fluorescein-tagged nucleic acid probe against total human DNA. Chromosomes were examined by fluorescence microscopy and all categories of change involving the human chromosome 11 as target, recorded. Results: Overall, of the 3104 human-hamster hybrid cells examined, 82.1% were euploid, of which 88.6% contained one copy of human chromosome 11, 6.2% contained two copies, and 5.2% contained 0 copies. This is compatible with mitotic nondisjunction in a small fraction of cells. Of the remaining 17.9% of cells, 85.2% were tetraploid cells with two copies of human chromosome 11. For all aberrations involving human chromosome 11 there was a linear relationship between yield and absorbed dose of 0.1 aberrations per chromosome per Gy. The yield of dicentrics, translocations, and terminal deletions that involve one lesion on the human chromosome was linear, while the yield of interstitial deletions that arise from two interacting lesions on the human chromosome was curvilinear. The frequencies of dicentrics and translocations were about equal, while there was a high (40-60%) incidence of incomplete exchanges between human and hamster chromosomes. Conclusions: Fluorescent in situ hybridization (FISH) procedures allow for the efficient detection of a broad range of induced changes in target chromosomes. Symmetrical exchanges induced in G1
Wang, Qinqin; Zhou, Yanbin; Li, Shaoli; Zhuo, Chao; Xu, Siqi; Huang, Lixia; Yang, Ling; Liao, Kang
2013-01-01
Background Detection of Acinetobacter baumannii has been relying primarily on bacterial culture that often fails to return useful results in time. Although DNA-based assays are more sensitive than bacterial culture in detecting the pathogen, the molecular results are often inconsistent and challenged by doubts on false positives, such as those due to system- and environment-derived contaminations. In addition, these molecular tools require expensive laboratory instruments. Therefore, establishing molecular tools for field use require simpler molecular platforms. The loop-mediated isothermal amplification method is relatively simple and can be improved for better use in a routine clinical bacteriology laboratory. A simple and portable device capable of performing both the amplification and detection (by fluorescence) of LAMP in the same platform has been developed in recent years. This method is referred to as real-time loop-mediated isothermal amplification. In this study, we attempted to utilize this method for rapid detection of A. baumannii. Methodology and Significant Findings Species-specific primers were designed to test the utility of this method. Clinical samples of A. baumannii were used to determine the sensitivity and specificity of this system compared to bacterial culture and a polymerase chain reaction method. All positive samples isolated from sputum were confirmed to be the species of Acinetobacter by 16S rRNA gene sequencing. The RealAmp method was found to be simpler and allowed real-time detection of DNA amplification, and could distinguish A. baumannii from Acinetobacter calcoaceticus and Acinetobacter genomic species 3. DNA was extracted by simple boiling method. Compared to bacterial culture, the sensitivity and specificity of RealAmp in detecting A. baumannii was 98.9% and 75.0%, respectively. Conclusion The RealAmp assay only requires a single unit, and the assay positivity can be verified by visual inspection. Therefore, this assay has
A Novel Line Coding Pair for Fully Passive Long Reach {WDM-PON}s
DEFF Research Database (Denmark)
Presi, Marco; Proietti, Roberto; Prince, Kamau
2008-01-01
A novel line coding pair allows to use unsaturated flective-SOAs as upstream remodulator in long-reach WDM-PONs. Full-duplex and symmetric 80 km reach is demonstrated without in-line amplification at 1.25 Gb/s......A novel line coding pair allows to use unsaturated flective-SOAs as upstream remodulator in long-reach WDM-PONs. Full-duplex and symmetric 80 km reach is demonstrated without in-line amplification at 1.25 Gb/s...
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
HER2 amplification, overexpression and score criteria in esophageal adenocarcinoma
Hu, Yingchuan; Bandla, Santhoshi; Godfrey, Tony E.; Tan, Dongfeng; Luketich, James D.; Pennathur, Arjun; Qiu, Xing; Hicks, David G.; Peters, Jeffrey; Zhou, Zhongren
2011-01-01
The HER2 oncogene was recently reported to be amplified and overexpressed in esophageal adenocarcinoma. However, the relationship of HER2 amplification in esophageal adenocarcinoma with prognosis has not been well defined. The scoring systems for clinically evaluating HER2 in esophageal adenocarcinoma are not established. The aims of the study were to establish a HER2 scoring system and comprehensively investigate HER2 amplification and overexpression in esophageal adenocarcinoma and its precursor lesion. Using a tissue microarray, containing 116 cases of esophageal adenocarcinoma, 34 cases of BE, 18 cases of low grade dysplasia and 15 cases of high grade dysplasia, HER2 amplification and overexpression were analyzed by HercepTest and CISH methods. The amplification frequency in an independent series of 116 esophageal adenocarcinoma samples was also analyzed using Affymetrix SNP 6.0 microarrays. In our studies, we have found that HER2 amplification does not associate with poor prognosis in total 232 esophageal adenocarcinoma patients by CISH and high density microarrays. We further confirm the similar frequency of HER2 amplification by CISH (18.10%; 21/116) and SNP 6.0 microarrays (16.4%, 19/116) in esophageal adenocarcinoma. HER2 protein overexpression was observed in 12.1 % (14/116) of esophageal adenocarcinoma and 6.67% (1/15) of HGD. No HER2 amplification or overexpression was identified in BE or LGD. All HER2 protein overexpression cases showed HER2 gene amplification. Gene amplification was found to be more frequent by CISH than protein overexpression in esophageal adenocarcinoma (18.10% vs 12.9%). A modified two-step model for esophageal adenocarcinoma HER-2 testing is recommend for clinical esophageal adenocarcinoma HER-2 trial. PMID:21460800
Erkens, R.H.J.; Cross, H.; Maas, J.W.; Hoenselaar, K.; Chatrou, L.W.
2008-01-01
Age and the greenness of leaves have been frequently used as indicators for selecting herbarium specimens for molecular studies. Although plant DNA extraction and amplification have been common lab procedures for the past 20 years, no studies specifically investigated the success of these
The aim of this study was to develop a simple and rapid technique for detecting human norovirus (NoV). The loop-mediated isothermal amplification (LAMP) technique was evaluated and found to be sensitive, highly specific, and useful for routine oyster testing. Reverse transcription-LAMP (RT-LAMP) pri...
Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines
International Nuclear Information System (INIS)
Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran
2006-01-01
Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)
Khaleghian, Malihea; Jahanzad, Issa; Shakoori, Abbas; Ardalan, Farid Azmoudeh; Azimi, Cyrus
2015-01-01
Gastric cancer is the fourth most frequent malignancy and the second cause of cancer-related mortality worldwide. It has been suggested that in gastric carcinogenesis, the C-MYC gene has an important function. The objective of this study is to establish the preference of Chromogenic in situ hybridization (CISH) and Immunohistochemistry (IHC) in the diagnosis and prognosis of gastric cancer. Samples comprised of 50 randomly selected patients of whom 40 were male and 10 female. To evaluate the MYC copy number and its protein expression, CISH and IHC analyses were performed for 50 gastric adenocarcinomas, in Iran. The location of the tumor in 64% of the patients was the fundus, and in 72% of patients, the tumors were of a diffuse type; 22 samples showed no amplification, and 28 samples were with amplification. MYC immunoreactivity was observed in 13 samples. Twelve samples showed both MYC amplification and MYC immunoreactivity. In addition, among the 28 CISH+ samples, 12 samples had positive signals for IHC and 16 samples had negative signals for IHC. A majority of the IHC-negative patients had no amplification, but only one patient with IHC positive had no amplification. Our conclusion was that for the management and treatment of gastric cancer, and for special attention of clinicians, for prognosis and tumor progression, the CISH was a better and more feasible test than IHC, in regard to the sensitivity and specificity.
Directory of Open Access Journals (Sweden)
Malihea Khaleghian
2015-01-01
Full Text Available Background: Gastric cancer is the fourth most frequent malignancy and the second cause of cancer-related mortality worldwide. It has been suggested that in gastric carcinogenesis, the C-MYC gene has an important function. The objective of this study is to establish the preference of Chromogenic in situ hybridization (CISH and Immunohistochemistry (IHC in the diagnosis and prognosis of gastric cancer. Materials and Methods: Samples comprised of 50 randomly selected patients of whom 40 were male and 10 female. To evaluate the MYC copy number and its protein expression, CISH and IHC analyses were performed for 50 gastric adenocarcinomas, in Iran. Results: The location of the tumor in 64% of the patients was the fundus, and in 72% of patients, the tumors were of a diffuse type; 22 samples showed no amplification, and 28 samples were with amplification. MYC immunoreactivity was observed in 13 samples. Twelve samples showed both MYC amplification and MYC immunoreactivity. In addition, among the 28 CISH+ samples, 12 samples had positive signals for IHC and 16 samples had negative signals for IHC. A majority of the IHC-negative patients had no amplification, but only one patient with IHC positive had no amplification. Conclusion: Our conclusion was that for the management and treatment of gastric cancer, and for special attention of clinicians, for prognosis and tumor progression, the CISH was a better and more feasible test than IHC, in regard to the sensitivity and specificity.
Amplification and chromosomal dispersion of human endogenous retroviral sequences
International Nuclear Information System (INIS)
Steele, P.E.; Martin, M.A.; Rabson, A.B.; Bryan, T.; O'Brien, S.J.
1986-01-01
Endogenous retroviral sequences have undergone amplification events involving both viral and flanking cellular sequences. The authors cloned members of an amplified family of full-length endogenous retroviral sequences. Genomic blotting, employing a flanking cellular DNA probe derived from a member of this family, revealed a similar array of reactive bands in both humans and chimpanzees, indicating that an amplification event involving retroviral and associated cellular DNA sequences occurred before the evolutionary separation of these two primates. Southern analyses of restricted somatic cell hybrid DNA preparations suggested that endogenous retroviral segments are widely dispersed in the human genome and that amplification and dispersion events may be linked
PCR amplification on microarrays of gel immobilized oligonucleotides
Strizhkov, Boris; Tillib, Sergei; Mikhailovich, Vladimir; Mirzabekov, Andrei
2003-11-04
The invention relates two general methods for performing PCR amplification, combined with the detection and analysis of the PCR products on a microchip. In the first method, the amplification occurs both outside and within a plurality of gel pads on a microchip, with at least one oligonucleotide primer immobilized in a gel pad. In the second method, PCR amplification also takes place within gel pads on a microchip, but the pads are surrounded by a hydrophobic liquid such as that which separates the individual gel pads into environments which resemble micro-miniaturized test tubes.
Du, Yan; Hughes, Randall A.; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.; Li, Bingling
2015-06-01
Strand exchange nucleic acid circuitry can be used to transduce isothermal nucleic acid amplification products into signals that can be readable on an off-the-shelf glucometer. Loop-mediated isothermal amplification (LAMP) is limited by the accumulation of non-specific products, but nucleic acid circuitry can be used to probe and distinguish specific amplicons. By combining this high temperature isothermal amplification method with a thermostable invertase, we can directly transduce Middle-East respiratory syndrome coronavirus and Zaire Ebolavirus templates into glucose signals, with a sensitivity as low as 20-100 copies/μl, equating to atto-molar (or low zepto-mole). Virus from cell lysates and synthetic templates could be readily amplified and detected even in sputum or saliva. An OR gate that coordinately triggered on viral amplicons further guaranteed fail-safe virus detection. The method describes has potential for accelerating point-of-care applications, in that biological samples could be applied to a transducer that would then directly interface with an off-the-shelf, approved medical device.
Rapid detection of Brucella spp. using loop-mediated isothermal amplification (LAMP).
Chen, Shouyi; Li, Xunde; Li, Juntao; Atwill, Edward R
2013-01-01
Brucella spp. are facultative intracellular bacteria that cause zoonotic disease of brucellosis worldwide. Livestock that are most vulnerable to brucellosis include cattle, goats, and pigs. Brucella spp. cause serious health problems to humans and animals and economic losses to the livestock industry. Traditional methods for detection of Brucella spp. take 48-72 h (Kumar et al., J Commun Dis 29:131-137, 1997; Barrouin-Melo et al., Res Vet Sci 83:340-346, 2007) that do not meet the food industry's need of rapid detection. Therefore, there is an urgent need of fast, specific, sensitive, and inexpensive method for diagnosing of Brucella spp. Loop-mediated isothermal amplification (LAMP) is a method to amplify nucleic acid at constant temperatures. Amplification can be detected by visual detection, fluorescent stain, turbidity, and electrophoresis. We targeted at the Brucella-specific gene omp25 and designed LAMP primers for detection of Brucella spp. Amplification of DNA with Bst DNA polymerase can be completed at 65 °C in 60 min. Amplified products can be detected by SYBR Green I stain and 2.0% agarose gel electrophoresis. The LAMP method is feasible for detection of Brucella spp. from blood and milk samples.
Hosokawa, Masahito; Nishikawa, Yohei; Kogawa, Masato; Takeyama, Haruko
2017-07-12
Massively parallel single-cell genome sequencing is required to further understand genetic diversities in complex biological systems. Whole genome amplification (WGA) is the first step for single-cell sequencing, but its throughput and accuracy are insufficient in conventional reaction platforms. Here, we introduce single droplet multiple displacement amplification (sd-MDA), a method that enables massively parallel amplification of single cell genomes while maintaining sequence accuracy and specificity. Tens of thousands of single cells are compartmentalized in millions of picoliter droplets and then subjected to lysis and WGA by passive droplet fusion in microfluidic channels. Because single cells are isolated in compartments, their genomes are amplified to saturation without contamination. This enables the high-throughput acquisition of contamination-free and cell specific sequence reads from single cells (21,000 single-cells/h), resulting in enhancement of the sequence data quality compared to conventional methods. This method allowed WGA of both single bacterial cells and human cancer cells. The obtained sequencing coverage rivals those of conventional techniques with superior sequence quality. In addition, we also demonstrate de novo assembly of uncultured soil bacteria and obtain draft genomes from single cell sequencing. This sd-MDA is promising for flexible and scalable use in single-cell sequencing.
Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J
2018-04-01
Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.
Small sample whole-genome amplification
Hara, Christine; Nguyen, Christine; Wheeler, Elizabeth; Sorensen, Karen; Arroyo, Erin; Vrankovich, Greg; Christian, Allen
2005-11-01
Many challenges arise when trying to amplify and analyze human samples collected in the field due to limitations in sample quantity, and contamination of the starting material. Tests such as DNA fingerprinting and mitochondrial typing require a certain sample size and are carried out in large volume reactions; in cases where insufficient sample is present whole genome amplification (WGA) can be used. WGA allows very small quantities of DNA to be amplified in a way that enables subsequent DNA-based tests to be performed. A limiting step to WGA is sample preparation. To minimize the necessary sample size, we have developed two modifications of WGA: the first allows for an increase in amplified product from small, nanoscale, purified samples with the use of carrier DNA while the second is a single-step method for cleaning and amplifying samples all in one column. Conventional DNA cleanup involves binding the DNA to silica, washing away impurities, and then releasing the DNA for subsequent testing. We have eliminated losses associated with incomplete sample release, thereby decreasing the required amount of starting template for DNA testing. Both techniques address the limitations of sample size by providing ample copies of genomic samples. Carrier DNA, included in our WGA reactions, can be used when amplifying samples with the standard purification method, or can be used in conjunction with our single-step DNA purification technique to potentially further decrease the amount of starting sample necessary for future forensic DNA-based assays.
Optofluidic analysis system for amplification-free, direct detection of Ebola infection
Cai, H.; Parks, J. W.; Wall, T. A.; Stott, M. A.; Stambaugh, A.; Alfson, K.; Griffiths, A.; Mathies, R. A.; Carrion, R.; Patterson, J. L.; Hawkins, A. R.; Schmidt, H.
2015-09-01
The massive outbreak of highly lethal Ebola hemorrhagic fever in West Africa illustrates the urgent need for diagnostic instruments that can identify and quantify infections rapidly, accurately, and with low complexity. Here, we report on-chip sample preparation, amplification-free detection and quantification of Ebola virus on clinical samples using hybrid optofluidic integration. Sample preparation and target preconcentration are implemented on a PDMS-based microfluidic chip (automaton), followed by single nucleic acid fluorescence detection in liquid-core optical waveguides on a silicon chip in under ten minutes. We demonstrate excellent specificity, a limit of detection of 0.2 pfu/mL and a dynamic range of thirteen orders of magnitude, far outperforming other amplification-free methods. This chip-scale approach and reduced complexity compared to gold standard RT-PCR methods is ideal for portable instruments that can provide immediate diagnosis and continued monitoring of infectious diseases at the point-of-care.
James, Ameh; Macdonald, Joanne
2015-01-01
Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.
DEFF Research Database (Denmark)
Kiib, Hans
2015-01-01
At just over 10 meters above street level, the High Line extends three kilometers through three districts of Southwestern Manhattan in New York. It consists of simple steel construction, and previously served as an elevated rail line connection between Penn Station on 34th Street and the many....... The High Line project has been carried out as part of an open conversion strategy. The result is a remarkable urban architectural project, which works as a catalyst for the urban development of Western Manhattan. The greater project includes the restoration and reuse of many old industrial buildings...
La Rosa, Stefano; Bernasconi, Barbara; Vanoli, Alessandro; Sciarra, Amedeo; Notohara, Kenji; Albarello, Luca; Casnedi, Selenia; Billo, Paola; Zhang, Lizhi; Tibiletti, Maria Grazia; Sessa, Fausto
2018-05-02
The molecular alterations of pancreatic acinar cell carcinomas (ACCs) and mixed acinar-neuroendocrine carcinomas (MANECs) are not completely understood, and the possible role of c-MYC amplification in tumor development, progression, and prognosis is not known. We have investigated c-MYC gene amplification in a series of 35 ACCs and 4 MANECs to evaluate its frequency and a possible prognostic role. Gene amplification was investigated using interphasic fluorescence in situ hybridization analysis simultaneously hybridizing c-MYC and the centromere of chromosome 8 probes. Protein expression was immunohistochemically investigated using a specific monoclonal anti-c-myc antibody. Twenty cases had clones with different polysomies of chromosome 8 in absence of c-MYC amplification, and 5 cases had one amplified clone and other clones with chromosome 8 polysomy, while the remaining 14 cases were diploid for chromosome 8 and lacked c-MYC amplification. All MANECs showed c-MYC amplification and/or polysomy which were observed in 54% pure ACCs. Six cases (15.3%) showed nuclear immunoreactivity for c-myc, but only 4/39 cases showed simultaneous c-MYC amplification/polysomy and nuclear protein expression. c-myc immunoreactivity as well as c-MYC amplification and/or chromosome 8 polysomy was not statistically associated with prognosis. Our study demonstrates that a subset of ACCs shows c-MYC alterations including gene amplification and chromosome 8 polysomy. Although they are not associated with a different prognostic signature, the fact that these alterations are present in all MANECs suggests a role in the acinar-neuroendocrine differentiation possibly involved in the pathogenesis of MANECs.
An Asian poverty line? Issues and options
Klasen, Stephan
2016-01-01
Given Asia's record of rapid economic growth and the conceptual and empirical problems of the current international income poverty line ('dollar-a-day'), this paper discusses whether there is merit to develop an Asia-specific poverty line that addresses some of the shortcomings of the dollar-a-day line and additionally considers Asia's particular economic situation. We consider various ways of creating an Asia-specific poverty line, including an Asia-specific international income poverty line...
Detection of HIV-1 p24 Gag in plasma by a nanoparticle-based bio-barcode-amplification method.
Kim, Eun-Young; Stanton, Jennifer; Korber, Bette T M; Krebs, Kendall; Bogdan, Derek; Kunstman, Kevin; Wu, Samuel; Phair, John P; Mirkin, Chad A; Wolinsky, Steven M
2008-06-01
Detection of HIV-1 in patients is limited by the sensitivity and selectivity of available tests. The nanotechnology-based bio-barcode-amplification method offers an innovative approach to detect specific HIV-1 antigens from diverse HIV-1 subtypes. We evaluated the efficacy of this protein-detection method in detecting HIV-1 in men enrolled in the Chicago component of the Multicenter AIDS Cohort Study (MACS). The method relies on magnetic microparticles with antibodies that specifically bind the HIV-1 p24 Gag protein and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the microparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes (hundreds per target) were identified by a nanoparticle-based detection method that does not rely on PCR. Of 112 plasma samples from HIV-1-infected subjects, 111 were positive for HIV-1 p24 Gag protein (range: 0.11-71.5 ng/ml of plasma) by the bio-barcode-amplification method. HIV-1 p24 Gag protein was detected in only 23 out of 112 men by the conventional ELISA. A total of 34 uninfected subjects were negative by both tests. Thus, the specificity of the bio-barcode-amplification method was 100% and the sensitivity 99%. The bio-barcode-amplification method detected HIV-1 p24 Gag protein in plasma from all study subjects with less than 200 CD4(+) T cells/microl of plasma (100%) and 19 out of 20 (95%) HIV-1-infected men who had less than 50 copies/ml of plasma of HIV-1 RNA. In a separate group of 60 diverse international isolates, representative of clades A, B, C and D and circulating recombinant forms CRF01_AE and CRF02_AG, the bio-barcode-amplification method identified the presence of virus correctly. The bio-barcode-amplification method was superior to the conventional ELISA assay for the detection of HIV-1 p24 Gag protein in plasma with a breadth of coverage for diverse
Directory of Open Access Journals (Sweden)
Yanagihara Kazuyoshi
2009-06-01
Full Text Available Abstract Background Gastric cancer is the third most common malignancy affecting the general population worldwide. Aberrant activation of KRAS is a key factor in the development of many types of tumor, however, oncogenic mutations of KRAS are infrequent in gastric cancer. We have developed a novel quantitative method of analysis of DNA copy number, termed digital genome scanning (DGS, which is based on the enumeration of short restriction fragments, and does not involve PCR or hybridization. In the current study, we used DGS to survey copy-number alterations in gastric cancer cells. Methods DGS of gastric cancer cell lines was performed using the sequences of 5000 to 15000 restriction fragments. We screened 20 gastric cancer cell lines and 86 primary gastric tumors for KRAS amplification by quantitative PCR, and investigated KRAS amplification at the DNA, mRNA and protein levels by mutational analysis, real-time PCR, immunoblot analysis, GTP-RAS pull-down assay and immunohistochemical analysis. The effect of KRAS knock-down on the activation of p44/42 MAP kinase and AKT and on cell growth were examined by immunoblot and colorimetric assay, respectively. Results DGS analysis of the HSC45 gastric cancer cell line revealed the amplification of a 500-kb region on chromosome 12p12.1, which contains the KRAS gene locus. Amplification of the KRAS locus was detected in 15% (3/20 of gastric cancer cell lines (8–18-fold amplification and 4.7% (4/86 of primary gastric tumors (8–50-fold amplification. KRAS mutations were identified in two of the three cell lines in which KRAS was amplified, but were not detected in any of the primary tumors. Overexpression of KRAS protein correlated directly with increased KRAS copy number. The level of GTP-bound KRAS was elevated following serum stimulation in cells with amplified wild-type KRAS, but not in cells with amplified mutant KRAS. Knock-down of KRAS in gastric cancer cells that carried amplified wild
International Nuclear Information System (INIS)
Mita, Hiroaki; Yanagihara, Kazuyoshi; Fujita, Masahiro; Hosokawa, Masao; Kusano, Masanobu; Sabau, Sorin Vasile; Tatsumi, Haruyuki; Imai, Kohzoh; Shinomura, Yasuhisa; Tokino, Takashi; Toyota, Minoru; Aoki, Fumio; Akashi, Hirofumi; Maruyama, Reo; Sasaki, Yasushi; Suzuki, Hiromu; Idogawa, Masashi; Kashima, Lisa
2009-01-01
Gastric cancer is the third most common malignancy affecting the general population worldwide. Aberrant activation of KRAS is a key factor in the development of many types of tumor, however, oncogenic mutations of KRAS are infrequent in gastric cancer. We have developed a novel quantitative method of analysis of DNA copy number, termed digital genome scanning (DGS), which is based on the enumeration of short restriction fragments, and does not involve PCR or hybridization. In the current study, we used DGS to survey copy-number alterations in gastric cancer cells. DGS of gastric cancer cell lines was performed using the sequences of 5000 to 15000 restriction fragments. We screened 20 gastric cancer cell lines and 86 primary gastric tumors for KRAS amplification by quantitative PCR, and investigated KRAS amplification at the DNA, mRNA and protein levels by mutational analysis, real-time PCR, immunoblot analysis, GTP-RAS pull-down assay and immunohistochemical analysis. The effect of KRAS knock-down on the activation of p44/42 MAP kinase and AKT and on cell growth were examined by immunoblot and colorimetric assay, respectively. DGS analysis of the HSC45 gastric cancer cell line revealed the amplification of a 500-kb region on chromosome 12p12.1, which contains the KRAS gene locus. Amplification of the KRAS locus was detected in 15% (3/20) of gastric cancer cell lines (8–18-fold amplification) and 4.7% (4/86) of primary gastric tumors (8–50-fold amplification). KRAS mutations were identified in two of the three cell lines in which KRAS was amplified, but were not detected in any of the primary tumors. Overexpression of KRAS protein correlated directly with increased KRAS copy number. The level of GTP-bound KRAS was elevated following serum stimulation in cells with amplified wild-type KRAS, but not in cells with amplified mutant KRAS. Knock-down of KRAS in gastric cancer cells that carried amplified wild-type KRAS resulted in the inhibition of cell growth and
Static and Dynamic Amplification Using Strong Mechanical Coupling
Ilyas, Saad; Jaber, Nizar; Younis, Mohammad I.
2016-01-01
Amplifying the signal-to-noise ratio of resonant sensors is vital toward the effort to miniaturize devices into the sub-micro and nano regimes. In this paper, we demonstrate theoretically and experimentally, amplification through mechanically
Three-dimensional Simulation of Backward Raman Amplification
International Nuclear Information System (INIS)
Balakin, A.A.; Fraiman, G.M.; Fisch, N.J.
2005-01-01
Three-dimensional (3-D) simulations for the Backward Raman Amplification (BRA) are presented. The images illustrate the effects of pump depletion, pulse diffraction, non-homogeneous plasma density, and plasma ionization
Period doubling induced by thermal noise amplification in genetic circuits
Ruocco, G.; Fratalocchi, Andrea
2014-01-01
. In the proposed system, nonlinearity naturally arises from the mechanism of cooperative stability, which regulates the concentration of a protein produced during a transcription process. In this elemental model, bistability results from the coherent amplification
Cross-genus amplification and characterisation of microsatellite loci ...
African Journals Online (AJOL)
Cross-genus amplification and characterisation of microsatellite loci in the little free tailed bat, Chaerephon pumilus s. l. (Molossidae) from South Eastern Africa. Theshnie Naidoo, Angus Macdonald, Jennifer M Lamb ...
Radiation-induced gene amplification in rodent and human cells
International Nuclear Information System (INIS)
Luecke-Huhle, C.; Gloss, B.; Herrlich, P.
1990-01-01
Ionizing and UV radiations induce amplification of SV40 DNA sequences integrated in the genome of Chinese hamster cells and increase amplification of the dihydrofolate reductase (DHFR) gene during methotrexate selection in human skin fibroblasts of a patient with ataxia telangiectasia. Various types of external (60-Co-γ-rays, 241-Am-α-particles, UV) or internal radiation (caused by the decay of 125 I incorporated into DNA in form of I-UdR) were applied. By cell fusion experiments it could be shown that SV40 gene amplification is mediated by one or several diffusible trans-acting factors induced or activated in a dose dependent manner by all types of radiation. One of these factors binds to a 10 bp sequence within the minimal origin of replication of SV40. In vivo competition with an excess of a synthetic oligonucleotide comprising this sequence blocks radiation-induced amplification. (author) 25 refs.; 8 figs
Waser Jürgen; Fuchs Raphael; Ribicic Hrvoje; Schindler Benjamin; Blöschl Günther; Gröller Eduard
2010-01-01
In this paper we present World Lines as a novel interactive visualization that provides complete control over multiple heterogeneous simulation runs. In many application areas decisions can only be made by exploring alternative scenarios. The goal of the suggested approach is to support users in this decision making process. In this setting the data domain is extended to a set of alternative worlds where only one outcome will actually happen. World Lines integrate simulation visualization and...
Current Developments in Prokaryotic Single Cell Whole Genome Amplification
Energy Technology Data Exchange (ETDEWEB)
Goudeau, Danielle; Nath, Nandita; Ciobanu, Doina; Cheng, Jan-Fang; Malmstrom, Rex
2014-03-14
Our approach to prokaryotic single-cell Whole Genome Amplification at the JGI continues to evolve. To increase both the quality and number of single-cell genomes produced, we explore all aspects of the process from cell sorting to sequencing. For example, we now utilize specialized reagents, acoustic liquid handling, and reduced reaction volumes eliminate non-target DNA contamination in WGA reactions. More specifically, we use a cleaner commercial WGA kit from Qiagen that employs a UV decontamination procedure initially developed at the JGI, and we use the Labcyte Echo for tip-less liquid transfer to set up 2uL reactions. Acoustic liquid handling also dramatically reduces reagent costs. In addition, we are exploring new cell lysis methods including treatment with Proteinase K, lysozyme, and other detergents, in order to complement standard alkaline lysis and allow for more efficient disruption of a wider range of cells. Incomplete lysis represents a major hurdle for WGA on some environmental samples, especially rhizosphere, peatland, and other soils. Finding effective lysis strategies that are also compatible with WGA is challenging, and we are currently assessing the impact of various strategies on genome recovery.
Review:Whole genome amplification in preimplantation genetic diagnosis
Institute of Scientific and Technical Information of China (English)
Ying-ming ZHENG; Ning WANG; Lei LI; Fan JIN
2011-01-01
Preimplantation genetic diagnosis(PGD)refers to a procedure for genetically analyzing embryos prior to implantation,improving the chance of conception for patients at high risk of transmitting specific inherited disorders.This method has been widely used for a large number of genetic disorders since the first successful application in the early 1990s.Polymerase chain reaction(PCR)and fluorescent in situ hybridization(FISH)are the two main methods in PGD,but there are some inevitable shortcomings limiting the scope of genetic diagnosis.Fortunately,different whole genome amplification(WGA)techniques have been developed to overcome these problems.Sufficient DNA can be amplified and multiple tasks which need abundant DNA can be performed.Moreover,WGA products can be analyzed as a template for multi-loci and multi-gene during the subsequent DNA analysis.In this review,we will focus on the currently available WGA techniques and their applications,as well as the new technical trends from WGA products.
Risks, media and the social amplification of soil contamination
Energy Technology Data Exchange (ETDEWEB)
Ouboter, S. [NOK, Networkorganisation for Environmental Quality, Gouda (Netherlands)
2003-07-01
Soil experts think of the risks of contaminated sites in terms of adverse effects of toxic substances on human health or environmental quality. In other words, the risk is attributed to the contamination. Social scientists define risk as a situation or event in which something of human value (including humans themselves) has been put at stake and where the outcome is uncertain. Since situations or events are constructions of the human mind, risks are also constructed. A relevant question for a psychologist is to learn how these constructions evolve in the mind of an individual and how this perceived risk influences the individuals' behaviour and well-being. A relevant question for a sociologist is how individuals with their own perceptions, feelings and behaviour interact. Many soil contamination experts experienced that one a site is seen as contaminated by a loathsome source, a chain of adverse reactions can easily put a stigma on that specific location and groups of people associated with that contaminated site. The case of Love Canal is worldwide known as an example of this phenomenon, but many countries have their own national symbol, like Lekkerkerk in the Netherlands. Modern media play an important role in this process. This process is often believed to be irrational and therefore uncontrollable. The question of this workshop is to what level technical soil experts can influence the psychological and social effects of soil contamination, using the social amplification metaphor. (orig.)
Detection of biological molecules using chemical amplification and optical sensors
Van Antwerp, William Peter; Mastrototaro, John Joseph
2000-01-01
Methods are provided for the determination of the concentration of biological levels of polyhydroxylated compounds, particularly glucose. The methods utilize an amplification system that is an analyte transducer immobilized in a polymeric matrix, where the system is implantable and biocompatible. Upon interrogation by an optical system, the amplification system produces a signal capable of detection external to the skin of the patient. Quantitation of the analyte of interest is achieved by measurement of the emitted signal.
Pulse Distortion in Saturated Fiber Optical Parametric Chirped Pulse Amplification
DEFF Research Database (Denmark)
Lali-Dastjerdi, Zohreh; Da Ros, Francesco; Rottwitt, Karsten
2012-01-01
Fiber optical parametric chirped pulse amplification is experimentally compared for different chirped pulses in the picosecond regime. The amplified chirped pulses show distortion appearing as pedestals after recompression when the amplifier is operated in saturation.......Fiber optical parametric chirped pulse amplification is experimentally compared for different chirped pulses in the picosecond regime. The amplified chirped pulses show distortion appearing as pedestals after recompression when the amplifier is operated in saturation....
Current amplification models of sensorineurall and conductive hearing loss
Ostojić, Sanja; Mikić, Branka; Mirić, Danica
2012-01-01
The main function of a hearing aid is to improve auditory and language abilities of hearing impaired users. The amplification model has to be adapted according to age, degree and type of hearing loss. The goal of this paper is to analyze the current amplification models of sensorineural and conductive hearing loss which can provide a high quality of speech perception and sounds at any degree of hearing loss. The BAHA is a surgically implantable system for treatment of conductive hearing loss ...
Amplification caused by gravitational bending of light
International Nuclear Information System (INIS)
Schneider, P.
1985-01-01
Gravitational bending of light may not only lead to multiple imaging (gravitational lens effect), but also affects the apparent luminosity of a source. It is shown here that a mass distribution near the line-of-sight to any source always increases the observable flux relative to the case in which the deflector is absent
Miles, Timothy D; Martin, Frank N; Coffey, Michael D
2015-02-01
Several isothermal amplification techniques recently have been developed that are tolerant of inhibitors present in many plant extracts, which can reduce the need for obtaining purified DNA for running diagnostic assays. One such commercially available technique that has similarities with real-time polymerase chain reaction (PCR) for designing primers and a labeled probe is recombinase polymerase amplification (RPA). This technology was used to develop two simple and rapid approaches for detection of Phytophthora spp.: one genus-specific assay multiplexed with a plant internal control and the other species-specific assays for Phytophthora ramorum and P. kernoviae. All assays were tested for sensitivity (ranging from 3 ng to 1 fg of DNA) and specificity using DNA extracted from more than 136 Phytophthora taxa, 21 Pythium spp., 1 Phytopythium sp., and a wide range of plant species. The lower limit of linear detection using purified DNA was 200 to 300 fg of DNA in all pathogen RPA assays. Six different extraction buffers were tested for use during plant tissue maceration and the assays were validated in the field by collecting 222 symptomatic plant samples from over 50 different hosts. Only 56 samples were culture positive for Phytophthora spp. whereas 91 were positive using the Phytophthora genus-specific RPA test and a TaqMan real-time PCR assay. A technique for the generation of sequencing templates from positive RPA amplifications to confirm species identification was also developed. These RPA assays have added benefits over traditional technologies because they are rapid (results can be obtained in as little as 15 min), do not require DNA extraction or extensive training to complete, use less expensive portable equipment than PCR-based assays, and are significantly more specific than current immunologically based methods. This should provide a rapid, field-deployable capability for pathogen detection that will facilitate point-of-sample collection processing
NSGIC Regional | GIS Inventory — Break Lines dataset current as of 2012. This data was produced for the USGS according to specific project requirements. The Lidar derived breaklines cover Somerset...
Srivastava, Pooja; Ajayakumar, P V; Shanker, Karuna
2014-01-01
The genus Pluchea comprises about 80 species distributed worldwide, out of them, only Pluchea lanceolata (DC.) Oliv. & Hiern, is used extensively in the traditional system of India. No chromatographic method is available for its quality. To perform the energy audit for the extraction of biogenetic pentacyclic triterpene, its acetate and sterol from P. lanceolata utilising organic and four alternative solvents. Additionally to resolve the uncertainty of TLC determination, on-line/off-line coupling with a diode-array detector (DAD), and near-infrared (NIR) and electrospray ionisation (ESI) MS was introduced. The extraction of taraxasterol (Tx), taraxasterol acetate (TxAc) and stigmasterol (St) from P. lanceolata was performed using three energy modes. The effects of different operating parameters were studied for optimum extraction yield using the design of experiments, that is, the central composite design and Box-Behnken design. In addition to the retention factor (Rf ) and visible spectral matching, two additional optical spectroscopic techniques, that is, NIR and ESI-MS, were applied for extended specificity. The method was developed for Tx, TxAc and St determination using HPTLC at 645 nm. The optimum extraction yield of targeted compounds was found to be higher with organic solvents than eco-friendly surfactants. The pulse ultrasonic assisted extraction (PUAE) has resulted in optimum extraction of compounds comparable to hot extraction. Both NIR and ESI-MS provided extended specificity in determination. The 5/1-PUAE was determined to be effective, reproducible, simple and energy efficient for the determination of Tx, TxAc and St in P. lanceolata. The offline coupling of NIR and ESI-MS with HPTLC led to considerable improvement in specificity. Copyright © 2014 John Wiley & Sons, Ltd.
Huang, Xin; Zhai, Congcong; You, Qimin; Chen, Hongjun
2014-07-01
The requirement to monitor the presence of genetically modified organisms (GMO) in a variety of marked products has generated an increasing demand for reliable, rapid, and time and cost-effective analytical methods. Here we report an on-site method for rapid detection of cauliflower mosaic virus promoter (CaMV 35S), a common element present in most GMO, using cross-priming amplification (CPA) technology. Detection was achieved using a DNA-based contamination-proof strip biosensor. The limit of detection was 30 copies for the pBI121 plasmid containing the CaMV 35S gene. The certified reference sample of GM maize line MON810 was detectable even at the low relative mass concentration of 0.05%. The developed CPA method had high specificity for the CaMV 35S gene, as compared with other GM lines not containing this gene and non-GM products. The method was further validated using nine real-world samples, and the results were confirmed by real-time PCR analysis. Because of its simplicity, rapidity, and high sensitivity, this method of detecting the CaMV 35S gene has great commercial prospects for rapid GMO screening of high-consumption food and agriculture products.
Three different signal amplification strategies for the impedimetric sandwich detection of thrombin
Energy Technology Data Exchange (ETDEWEB)
Ocaña, Cristina; Valle, Manel del, E-mail: manel.delvalle@uab.cat
2016-03-17
In this work, we report a comparative study on three highly specific amplification strategies for the ultrasensitive detection of thrombin with the use of aptamer sandwich protocol. The protocol consisted on the use of a first thrombin aptamer immobilized on the electrode surface, the recognition of thrombin protein, and the reaction with a second biotinylated thrombin aptamer forming the sandwich. Through the exposed biotin end, three variants have been tested to amplify the electrochemical impedance signal. The strategies included (a) silver enhancement treatment, (b) gold enhancement treatment and (c) insoluble product produced by the combination of the enzyme horseradish peroxidase (HRP) and 3-amino-9-ethylcarbazole (AEC). The properties of the sensing surface were probed by electrochemical impedance measurements in the presence of the ferrocyanide/ferricyanide redox marker. Insoluble product strategy and silver enhancement treatment resulted in the lowest detection limit (0.3 pM), while gold enhancement method resulted in the highest reproducibility, 8.8% RSD at the pM thrombin concentration levels. Results of silver and gold enhancement treatment also permitted direct inspection by scanning electron microscopy (SEM). - Highlights: • Aptasensor to detect thrombin reaching the femtomolar level. • Biosensing protocol employs two thrombin aptamers in a sandwich capture scheme. • Use of second biotinylated aptamer allows many amplification and detection variants. • Precipitation reaction provides the highest signal amplification of ca. 3 times. • Double recognition event improves remarkably selectivity for thrombin detection.
Gene amplification in Chinese hamster embryo cells by the decay of incorporated iodine-125
International Nuclear Information System (INIS)
Luecke-Huhle, Christine; Ehrfeld, Angelika; Rau, Waltraud
1988-01-01
Simian Virus 40-transformed Chinese hamster embryo cells (Co631) contain 5 viral copies integrated per cell genome. These SV40 sequences were used as an endogenous indicator gene to study response of mammalian cells to radiation at gene level. Cells were internally irradiated by Auger electrons emitted by Iodine-125 which was incorporated in cell DNA in form of 5-[ 125 I] iododeoxyuridine ( 125 IdU). An increase in gene copy number was measured using dispersed cell blotting and Southern analysis in combination with highly sensitive DNA hybridization. A 13-fold amplification of the SV40 sequences and a 2-fold amplification of two cellular oncogenes of the ras family were found. Other cellular genes, like the α-actin gene, are not amplified and no variation in gene copy number was observed after incubation of cells with cold IdU. Thus, specific gene amplification seems to be the consequence of radiation-induced DNA damage and the resulting cell cycle arrest. (author)
Wang, Cong; Li, Rong; Quan, Sheng; Shen, Ping; Zhang, Dabing; Shi, Jianxin; Yang, Litao
2015-06-01
Isothermal DNA/RNA amplification techniques are the primary methodology for developing on-spot rapid nucleic acid amplification assays, and the loop-mediated isothermal amplification (LAMP) technique has been developed and applied in the detection of foodborne pathogens, plant/animal viruses, and genetically modified (GM) food/feed contents. In this study, one set of LAMP assays targeting on eight frequently used universal elements, marker genes, and exogenous target genes, such as CaMV35S promoter, FMV35S promoter, NOS, bar, cry1Ac, CP4 epsps, pat, and NptII, were developed for visual screening of GM contents in plant-derived food samples with high efficiency and accuracy. For these eight LAMP assays, their specificity was evaluated by testing commercial GM plant events and their limits of detection were also determined, which are 10 haploid genome equivalents (HGE) for FMV35S promoter, cry1Ac, and pat assays, as well as five HGE for CaMV35S promoter, bar, NOS terminator, CP4 epsps, and NptII assays. The screening applicability of these LAMP assays was further validated successfully using practical canola, soybean, and maize samples. The results suggested that the established visual LAMP assays are applicable and cost-effective for GM screening in plant-derived food samples.
International Nuclear Information System (INIS)
Shen, Bo; Yan, Yurong; Tang, Renkuan; Li, Yongguo; Li, Jianbo; Cheng, Wei; Ju, Huangxian; Ding, Shijia
2015-01-01
We report on a novel strategy for the electrochemical detection of cocaine. It is based on the use of a supramolecular aptamer, rolling circle amplification (RCA), and multiplex binding of a biotin-strepavidin system. The aptamer fragments were assembled to a supramolecular aptamer which, in the presence of cocaine, conjugates to streptavidin for anchoring of biotinylated circular DNA. This initiates RCA and enables sensitive electrochemical-enzymatic readout. A significant signal amplification was obtained by using streptavidin linked to alkaline phosphatase that binds to the remaining biotinylated detection probes and catalyzes the hydrolysis of the synthetic enzyme substrate α-naphthylphosphate. This dual amplification strategy tremendously increases the detection limit of the aptasensor. Under optimal conditions and using differential pulse voltammetry, cocaine can be detected in the concentration range between 2 and 500 nM with a detection limit as low as 1.3 nM (at S/N = 3). The method is specific and acceptably reproducible. It was successfully applied to the detection of cocaine in (spiked) urine samples. The data were in good agreement with those obtained by the GC-MS reference method. (author)
Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan
2012-04-20
In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.
Three different signal amplification strategies for the impedimetric sandwich detection of thrombin
International Nuclear Information System (INIS)
Ocaña, Cristina; Valle, Manel del
2016-01-01
In this work, we report a comparative study on three highly specific amplification strategies for the ultrasensitive detection of thrombin with the use of aptamer sandwich protocol. The protocol consisted on the use of a first thrombin aptamer immobilized on the electrode surface, the recognition of thrombin protein, and the reaction with a second biotinylated thrombin aptamer forming the sandwich. Through the exposed biotin end, three variants have been tested to amplify the electrochemical impedance signal. The strategies included (a) silver enhancement treatment, (b) gold enhancement treatment and (c) insoluble product produced by the combination of the enzyme horseradish peroxidase (HRP) and 3-amino-9-ethylcarbazole (AEC). The properties of the sensing surface were probed by electrochemical impedance measurements in the presence of the ferrocyanide/ferricyanide redox marker. Insoluble product strategy and silver enhancement treatment resulted in the lowest detection limit (0.3 pM), while gold enhancement method resulted in the highest reproducibility, 8.8% RSD at the pM thrombin concentration levels. Results of silver and gold enhancement treatment also permitted direct inspection by scanning electron microscopy (SEM). - Highlights: • Aptasensor to detect thrombin reaching the femtomolar level. • Biosensing protocol employs two thrombin aptamers in a sandwich capture scheme. • Use of second biotinylated aptamer allows many amplification and detection variants. • Precipitation reaction provides the highest signal amplification of ca. 3 times. • Double recognition event improves remarkably selectivity for thrombin detection.
Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care.
Lillis, Lorraine; Siverson, Joshua; Lee, Arthur; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Lehman, Dara A; Boyle, David S
2016-04-01
Recombinase Polymerase Amplification (RPA) can be used to detect pathogen-specific DNA or RNA in under 20 min without the need for complex instrumentation. These properties enable its potential use in resource limited settings. However, there are concerns that deviations from the manufacturer's protocol and/or storage conditions could influence its performance in low resource settings. RPA amplification relies upon viscous crowding agents for optimal nucleic acid amplification, and thus an interval mixing step after 3-6 min of incubation is recommended to distribute amplicons and improve performance. In this study we used a HIV-1 RPA assay to evaluate the effects of this mixing step on assay performance. A lack of mixing led to a longer time to amplification and inferior detection signal, compromising the sensitivity of the assay. However lowering the assay volume from 50 μL to 5 μL showed similar sensitivity with or without mixing. We present the first peer-reviewed study that assesses long term stability of RPA reagents without a cold chain. Reagents stored at -20 °C, and 25 °C for up to 12 weeks were able to detect 10 HIV-1 DNA copies. Reagents stored at 45 °C for up to 3 weeks were able to detect 10 HIV-1 DNA copies, with reduced sensitivity only after >3 weeks at 45 °C. Together our results show that reducing reaction volumes bypassed the need for the mixing step and that RPA reagents were stable even when stored for 3 weeks at very high temperatures. Copyright © 2016 Elsevier Ltd. All rights reserved.
Direct PCR amplification of the HVSI region in mitochondrial DNA from buccal cell swabs
Directory of Open Access Journals (Sweden)
Kovačević-Grujičić Nataša
2012-01-01
Full Text Available Amplification of human mitochondrial DNA (mtDNA has been widely used in population genetics, human evolutionary and molecular anthropology studies. mtDNA hypervariable segments I and II (HVSI and HVSII were shown to be a suitable tool in genetic analyses due to the unique properties of mtDNA, such as the lack of recombination, maternal mode of inheritance, rapid evolutionary rate and high population-specific polymorphisms. Here we present a rapid and low-cost method for direct PCR amplification of a 330 bp fragment of HVSI from buccal cell samples. Avoiding the DNA isolation step makes this method appropriate for the analysis of a large number of samples in a short period of time. Since the transportation of samples and fieldwork conditions can affect the quality of samples and subsequent DNA analysis, we tested the effects of long-term storage of buccal cell swabs on the suitability of such samples for direct PCR amplification. We efficiently amplified a 330 bp fragment of HVSI even after the long-term storage of buccal cells at room temperature, +4°C or at -20°C, for up to eight months. All examined PCR products were successfully sequenced, regardless of sample storage time and conditions. Our results suggest that the direct PCR amplification of the HVSI region from buccal cells is a method well suited for large-scale mtDNA population studies.[Acknowledgments. This work was supported by the Ministry of Education and Science of the Republic of Serbia (Grant no. III 47025.
Ebai, Tonge; Souza de Oliveira, Felipe Marques; Löf, Liza; Wik, Lotta; Schweiger, Caroline; Larsson, Anders; Keilholtz, Ulrich; Haybaeck, Johannes; Landegren, Ulf; Kamali-Moghaddam, Masood
2017-09-01
Detecting proteins at low concentrations in plasma is crucial for early diagnosis. Current techniques in clinical routine, such as sandwich ELISA, provide sensitive protein detection because of a dependence on target recognition by pairs of antibodies, but detection of still lower protein concentrations is often called for. Proximity ligation assay with rolling circle amplification (PLARCA) is a modified proximity ligation assay (PLA) for analytically specific and sensitive protein detection via binding of target proteins by 3 antibodies, and signal amplification via rolling circle amplification (RCA) in microtiter wells, easily adapted to instrumentation in use in hospitals. Proteins captured by immobilized antibodies were detected using a pair of oligonucleotide-conjugated antibodies. Upon target recognition these PLA probes guided oligonucleotide ligation, followed by amplification via RCA of circular DNA strands that formed in the reaction. The RCA products were detected by horseradish peroxidase-labeled oligonucleotides to generate colorimetric reaction products with readout in an absorbance microplate reader. We compared detection of interleukin (IL)-4, IL-6, IL-8, p53, and growth differentiation factor 15 (GDF-15) by PLARCA and conventional sandwich ELISA or immuno-RCA. PLARCA detected lower concentrations of proteins and exhibited a broader dynamic range compared to ELISA and iRCA using the same antibodies. IL-4 and IL-6 were detected in clinical samples at femtomolar concentrations, considerably lower than for ELISA. PLARCA offers detection of lower protein levels and increased dynamic ranges compared to ELISA. The PLARCA procedure may be adapted to routine instrumentation available in hospitals and research laboratories. © 2017 American Association for Clinical Chemistry.
Bultas, Margaret W; Pohlman, Shawn
2014-01-01
The purpose of this interpretive phenomenological study was to gain a better understanding of the experiences of 11 mothers of preschool children with autism spectrum disorder (ASD). Mothers were interviewed three times over a 6 week period. Interviews were analyzed using interpretive methods. This manuscript highlights one particular theme-a positive perspective mothers described as the "silver lining." This "silver lining" represents optimism despite the adversities associated with parenting a child with ASD. A deeper understanding of this side of mothering children with ASD may help health care providers improve rapport, communication, and result in more authentic family centered care. Copyright © 2014 Elsevier Inc. All rights reserved.
ASAP: Amplification, sequencing & annotation of plastomes
Directory of Open Access Journals (Sweden)
Folta Kevin M
2005-12-01
Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and
Alternative Chemical Amplification Methods for Peroxy Radical Detection
Wood, E. C. D.
2014-12-01
Peroxy radicals (HO2, CH3O2, etc.) are commonly detected by the chemical amplification technique, in which ambient air is mixed with high concentrations of CO and NO, initiating a chain reaction that produces 30 - 200 NO2 molecules per sampled peroxy radical. The NO2 is then measured by one of several techniques. With the exception of CIMS-based techniques, the chemical amplification method has undergone only incremental improvements since it was first introduced in 1982. The disadvantages of the technique include the need to use high concentrations of CO and the greatly reduced sensitivity of the amplification chain length in the presence of water vapor. We present a new chemical amplification scheme in which either ethane or acetaldehyde is used in place of CO, with the NO2 product detected using Cavity Attenuated Phase Shift spectroscopy (CAPS). Under dry conditions, the amplification factor of the alternative amplifiers are approximately six times lower than the CO-based amplifier. The relative humidity "penalty" is not as severe, however, such that at typical ambient relative humidity (RH) values the amplification factor is within a factor of three of the CO-based amplifier. Combined with the NO2 sensitivity of CAPS and a dual-channel design, the detection limit of the ethane amplifier is less than 2 ppt (1 minute average, signal-to-noise ratio 2). The advantages of these alternative chemical amplification schemes are improved safety, a reduced RH correction, and increased sensitivity to organic peroxy radicals relative to HO2.
Hubbert, Beth
2011-01-01
Architecture is a versatile, multifaceted area to study in the artroom with multiple age levels. It can easily stimulate a study of basic line, shape, and various other art elements and principles. It can then be extended into a more extensive study of architectural elements, styles, specific architects, architecture of different cultures, and…
Directory of Open Access Journals (Sweden)
Schillaci Tiziana
2007-11-01
Full Text Available Abstract Background Genetic instability is a hallmark of tumours and preneoplastic lesions. The predominant form of genome instability in human cancer is chromosome instability (CIN. CIN is characterized by chromosomal aberrations, gains or losses of whole chromosomes (aneuploidy, and it is often associated with centrosome amplification. Centrosomes control cell division by forming a bipolar mitotic spindle and play an essential role in the maintenance of chromosomal stability. However, whether centrosome amplification could directly cause aneuploidy is not fully established. Also, alterations in genes required for mitotic progression could be involved in CIN. A major candidate is represented by Aurora-A/STK15 that associates with centrosomes and is overexpressed in several types of human tumour. Methods Centrosome amplification were induced by hydroxyurea treatment and visualized by immunofluorescence microscopy. Aurora-A/STK15 ectopic expression was achieved by retroviral infection and puromycin selection in HCT116 tumour cells. Effects of Aurora-A/STK15 depletion on centrosome status and ploidy were determined by Aurora-A/STK15 transcriptional silencing by RNA interference. Changes in the expression levels of some mitotic genes were determined by Real time RT-PCR. Results We investigated whether amplification of centrosomes and overexpression of Aurora-A/STK15 induce CIN using as a model system a colon carcinoma cell line (HCT116. We found that in HCT116 cells, chromosomally stable and near diploid cells harbouring a MIN phenotype, centrosome amplification induced by hydroxyurea treatment is neither maintained nor induces aneuploidy. On the contrary, ectopic overexpression of Aurora-A/STK15 induced supernumerary centrosomes and aneuploidy. Aurora-A/STK15 transcriptional silencing by RNA interference in cells ectopically overexpressing this kinase promptly decreased cell numbers with supernumerary centrosomes and aneuploidy. Conclusion Our
Stec, Wojciech J; Rosiak, Kamila; Siejka, Paulina; Peciak, Joanna; Popeda, Marta; Banaszczyk, Mateusz; Pawlowska, Roza; Treda, Cezary; Hulas-Bigoszewska, Krystyna; Piaskowski, Sylwester; Stoczynska-Fidelus, Ewelina; Rieske, Piotr
2016-05-31
Glioblastoma is the most common and malignant brain tumor, characterized by high cellular heterogeneity. About 50% of glioblastomas are positive for EGFR amplification, half of which express accompanying EGFR mutation, encoding truncated and constitutively active receptor termed EGFRvIII. Currently, no cell models suitable for development of EGFRvIII-targeting drugs exist, while the available ones lack the intratumoral heterogeneity or extrachromosomal nature of EGFRvIII.The reports regarding the biology of EGFRvIII expressed in the stable cell lines are often contradictory in observations and conclusions. In the present study, we use DK-MG cell line carrying endogenous non-modified EGFRvIII amplicons and derive a sub-line that is near depleted of amplicons, whilst remaining identical on the chromosomal level. By direct comparison of the two lines, we demonstrate positive effects of EGFRvIII on cell invasiveness and populational growth as a result of elevated cell survival but not proliferation rate. Investigation of the PI3K/Akt indicated no differences between the lines, whilst NFκB pathway was over-active in the line strongly expressing EGFRvIII, finding further supported by the effects of NFκB pathway specific inhibitors. Taken together, these results confirm the important role of EGFRvIII in intrinsic and extrinsic regulation of tumor behavior. Moreover, the proposed models are stable, making them suitable for research purposes as well as drug development process utilizing high throughput approach.
DEFF Research Database (Denmark)
Sun, Yi; Than Linh, Quyen; Hung, Tran Quang
2015-01-01
was capable to detect Salmonella at concentration of 50 cells per test within 40 min. The simple design, together with high level of integration, isothermal amplification, and quantitative analysis of multiple samples in short time will greatly enhance the practical applicability of the LOC system for rapid...... amplification (LAMP) for rapid and quantitative detection of Salmonella spp. in food samples. The whole diagnostic procedures including DNA isolation, isothermal amplification, and real-time detection were accomplished in a single chamber. Up to eight samples could be handled simultaneously and the system...... and usually take a few hours to days to complete. In response to the demand for rapid on line or at site detection of pathogens, in this study, we describe for the first time an eight-chamber lab-on-a-chip (LOC) system with integrated magnetic beads-based sample preparation and loop-mediated isothermal...
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Magnetic field amplification in interstellar collisionless shock waves
International Nuclear Information System (INIS)
Chevalier, R.A.
1977-01-01
It is stated that it is commonly assumed that a simple compression of the magnetic field occurs in interstellar shock waves. Recent space observations of the Earth's bow shock have shown that turbulent amplification of the magnetic field can occur in a collisionless shock. It is shown here that radio observations of Tycho's supernova remnant indicate the presence of a shock wave with such magnetic field amplification. There is at present no theory for the microinstabilities that give rise to turbulent amplification of the magnetic field. Despite the lack of theoretical understanding the possibility of field amplification in interstellar shock waves is here considered. In Tycho's supernova remnant there is evidence for the presence of a collisionless shock, and this is discussed. On the basis of observations of the Earth's bow shock, it is expected that turbulent magnetic field amplification occurs in the shock wave of this remnant, and this is supported by radio observations of the remnant. Consideration is given as to what extent the magnetic field is amplified in the shock wave on the basis of the non-thermal radio flux. (U.K.)
Modeling the amplification dynamics of human Alu retrotransposons.
Directory of Open Access Journals (Sweden)
Dale J Hedges
2005-09-01
Full Text Available Retrotransposons have had a considerable impact on the overall architecture of the human genome. Currently, there are three lineages of retrotransposons (Alu, L1, and SVA that are believed to be actively replicating in humans. While estimates of their copy number, sequence diversity, and levels of insertion polymorphism can readily be obtained from existing genomic sequence data and population sampling, a detailed understanding of the temporal pattern of retrotransposon amplification remains elusive. Here we pose the question of whether, using genomic sequence and population frequency data from extant taxa, one can adequately reconstruct historical amplification patterns. To this end, we developed a computer simulation that incorporates several known aspects of primate Alu retrotransposon biology and accommodates sampling effects resulting from the methods by which mobile elements are typically discovered and characterized. By modeling a number of amplification scenarios and comparing simulation-generated expectations to empirical data gathered from existing Alu subfamilies, we were able to statistically reject a number of amplification scenarios for individual subfamilies, including that of a rapid expansion or explosion of Alu amplification at the time of human-chimpanzee divergence.
Modeling the amplification dynamics of human alu retrotransposons.
Directory of Open Access Journals (Sweden)
2005-09-01
Full Text Available Retrotransposons have had a considerable impact on the overall architecture of the human genome. Currently, there are three lineages of retrotransposons (Alu, L1, and SVA that are believed to be actively replicating in humans. While estimates of their copy number, sequence diversity, and levels of insertion polymorphism can readily be obtained from existing genomic sequence data and population sampling, a detailed understanding of the temporal pattern of retrotransposon amplification remains elusive. Here we pose the question of whether, using genomic sequence and population frequency data from extant taxa, one can adequately reconstruct historical amplification patterns. To this end, we developed a computer simulation that incorporates several known aspects of primate Alu retrotransposon biology and accommodates sampling effects resulting from the methods by which mobile elements are typically discovered and characterized. By modeling a number of amplification scenarios and comparing simulation-generated expectations to empirical data gathered from existing Alu subfamilies, we were able to statistically reject a number of amplification scenarios for individual subfamilies, including that of a rapid expansion or explosion of Alu amplification at the time of human-chimpanzee divergence.
A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...
Frequent amplification of CENPF, GMNN and CDK13 genes in hepatocellular carcinomas.
Directory of Open Access Journals (Sweden)
Hye-Eun Kim
Full Text Available Genomic changes frequently occur in cancer cells during tumorigenesis from normal cells. Using the Illumina Human NS-12 single-nucleotide polymorphism (SNP chip to screen for gene copy number changes in primary hepatocellular carcinomas (HCCs, we initially detected amplification of 35 genes from four genomic regions (1q21-41, 6p21.2-24.1, 7p13 and 8q13-23. By integrated screening of these genes for both DNA copy number and gene expression in HCC and colorectal cancer, we selected CENPF (centromere protein F/mitosin, GMNN (geminin, DNA replication inhibitor, CDK13 (cyclin-dependent kinase 13, and FAM82B (family with sequence similarity 82, member B as common cancer genes. Each gene exhibited an amplification frequency of ~30% (range, 20-50% in primary HCC (n = 57 and colorectal cancer (n = 12, as well as in a panel of human cancer cell lines (n = 70. Clonogenic and invasion assays of NIH3T3 cells transfected with each of the four amplified genes showed that CENPF, GMNN, and CDK13 were highly oncogenic whereas FAM82B was not. Interestingly, the oncogenic activity of these genes (excluding FAM82B was highly correlated with gene-copy numbers in tumor samples (correlation coefficient, r>0.423, indicating that amplifications of CENPF, GMNN, and CDK13 genes are tightly linked and coincident in tumors. Furthermore, we confirmed that CDK13 gene copy number was significantly associated with clinical onset age in patients with HCC (P = 0.0037. Taken together, our results suggest that coincidently amplified CDK13, GMNN, and CENPF genes can play a role as common cancer-driver genes in human cancers.
Optical amplification in photonic integrated circuits
Pollnau, Markus
The recent results in the field of fabrication, characterization, and applications of optical waveguides in doped hard crystalline materials, specifically in Ti-doped sapphire and Yb-doped $KY(WO_4)_2$, are reviewed.
[Individual Identification of Cartilage by Direct Amplification in Mass Disasters].
Wang, C H; Xu, C; Li, X Q; Wu, Y; Du, Z
2017-06-01
To explore the effectiveness of direct amplification for the STR analysis of cartilage, and to accelerate the effectiveness of disaster victim identification. Eighty-eight cartilage samples were directly amplified by PowerPle® 21 kit, and the results of genotyping were compared with that obtained by the magnetic beads method. In 88 cartilage samples, the STR genotypes were successfully detected from 84 samples by direct amplification and magnetic beads method, and both the results of genotyping by two method were consistent. Direct amplification with PowerPlex® 21 kit can be used for STR genotyping of cartilages. This method is operated easily and promptly, which has a potential application in the individual identification of mass disasters. Copyright© by the Editorial Department of Journal of Forensic Medicine
Multi-chamber nucleic acid amplification and detection device
Dugan, Lawrence
2017-10-25
A nucleic acid amplification and detection device includes an amplification cartridge with a plurality of reaction chambers for containing an amplification reagent and a visual detection reagent, and a plurality of optically transparent view ports for viewing inside the reaction chambers. The cartridge also includes a sample receiving port which is adapted to receive a fluid sample and fluidically connected to distribute the fluid sample to the reaction chamber, and in one embodiment, a plunger is carried by the cartridge for occluding fluidic communication to the reaction chambers. The device also includes a heating apparatus having a heating element which is activated by controller to generate heat when a trigger event is detected. The heating apparatus includes a cartridge-mounting section which positioned a cartridge in thermal communication with the heating element so that visual changes to the contents of the reaction chambers are viewable through the view ports.
Radioactive wastes and the social amplification of risk
International Nuclear Information System (INIS)
Kasperson, R.E.; Emel, J.; Goble, R.; Hohenemser, C.; Kasperson, J.X.; Renn, O.
1987-01-01
A significant problem in radioactive waste facility siting is that apparent small risks or minor risks events produce substantial public concern and social impacts. The reasons for this difference in public health and societal impacts is not well understood. This paper explores the issues involved in the social amplification of risk, using the risk associated with site characterization as the example. Noteworthy as sources of amplification are the information flow associated with risks and risk events including the large volume of information, the extent of dispute, and misinformation and rumor. Such information passes through the mass media and interpersonal networks. The major mechanisms involved in risk amplifications are discussed and their likely impacts on society described
Wernstedt, Annekatrin; Valtorta, Emanuele; Armelao, Franco; Togni, Roberto; Girlando, Salvatore; Baudis, Michael; Heinimann, Karl; Messiaen, Ludwine; Staehli, Noemie; Zschocke, Johannes; Marra, Giancarlo; Wimmer, Katharina
2012-09-01
Heterozygous PMS2 germline mutations are associated with Lynch syndrome. Up to one third of these mutations are genomic deletions. Their detection is complicated by a pseudogene (PMS2CL), which--owing to extensive interparalog sequence exchange--closely resembles PMS2 downstream of exon 12. A recently redesigned multiplex ligation-dependent probe amplification (MLPA) assay identifies PMS2 copy number alterations with improved reliability when used with reference DNAs containing equal numbers of PMS2- and PMS2CL-specific sequences. We selected eight such reference samples--all publicly available--and used them with this assay to study 13 patients with PMS2-defective colorectal tumors. Three presented deleterious alterations: an Alu-mediated exon deletion; a 125-kb deletion encompassing PMS2 and four additional genes (two with tumor-suppressing functions); and a novel deleterious hybrid PMS2 allele produced by recombination with crossover between PMS2 and PMS2CL, with the breakpoint in intron 10 (the most 5' breakpoint of its kind reported thus far). We discuss mechanisms that might generate this allele in different chromosomal configurations (and their diagnostic implications) and describe an allele-specific PCR assay that facilitates its detection. Our data indicate that the redesigned PMS2 MLPA assay is a valid first-line option. In our series, it identified roughly a quarter of all PMS2 mutations. Copyright © 2012 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Siwon Lee
2015-12-01
Full Text Available We developed a loop-mediated isothermal amplification (LAMP method to rapidly diagnose Wheat streak mosaic virus (WSMV during quarantine inspections of imported wheat, corn, oats, and millet. The LAMP method was developed as a plant quarantine inspection method for the first time, and its simplicity, quickness, specificity and sensitivity were verified compared to current reverse transcription-polymerase chain reaction (RT-PCR and nested PCR quarantine methods. We were able to quickly screen for WSMV at quarantine sites with many test samples; thus, this method is expected to contribute to plant quarantine inspections.
Directory of Open Access Journals (Sweden)
Harish Bokkasam
Full Text Available Molecular communication systems encounter similar constraints as telecommunications. In either case, channel crosstalk at the receiver end will result in information loss that statistical analysis cannot compensate. This is because in any communication channel there is a physical limit to the amount of information that can be transmitted. We present a novel and simple modified end amplification (MEA technique to generate reduced and defined amounts of specific information in form of short fragments from an oligonucleotide source that also contains unrelated and redundant information. Our method can be a valuable tool to investigate information overflow and channel capacity in biomolecular recognition systems.
Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.
Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe
2016-04-01
A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.
Parametric amplification of metric fluctuations during reheating in two field models
International Nuclear Information System (INIS)
Finelli, F.; Brandenberger, R.
2000-01-01
We study the parametric amplification of super-Hubble-scale scalar metric fluctuations at the end of inflation in some specific two-field models of inflation, a class of which is motivated by hybrid inflation. We demonstrate that there can indeed be a large growth of fluctuations due to parametric resonance and that this effect is not taken into account by the conventional theory of isocurvature perturbations. Scalar field interactions play a crucial role in this analysis. We discuss the conditions under which there can be nontrivial parametric resonance effects on large scales
Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M
2003-01-01
Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.
Amplification of the E2F1 transcription factor gene in the HEL erythroleukemia cell line
DEFF Research Database (Denmark)
Saito, M; Helin, K; Valentine, M B
1995-01-01
, we isolated genomic clones encompassing the human E2F1 gene. We then used fluorescence in situ hybridization to localize E2F1 to human chromosome 20q11, telomeric to the p107 locus, a gene whose product is related to the retinoblastoma gene product (pRb). This finding contrasts with the 1p36 and 6q22...
Transmission line capital costs
International Nuclear Information System (INIS)
Hughes, K.R.; Brown, D.R.
1995-05-01
The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs
Directory of Open Access Journals (Sweden)
Cleber M. Guimarães
2010-02-01
Full Text Available Propôs-se avaliar, no presente estudo, a técnica da termometria ao infravermelho na caracterização de linhagens interespecíficas (Oryza glaberrima x Oryza sativa cv Caiapó e intraespecíficas de arroz para tolerância a seca. O experimento, conduzido em Porangatu, GO, foi submetido a condições adequadas de umidade no solo até 30 dias após a emergência, quando então foi implantado um tratamento com deficiência hídrica moderada (aproximadamente 50% da irrigação aplicada em uma parcela testemunha, com condições adequadas de umidade no solo. Verificou-se que as linhagens mais produtivas em condições de deficiência hídrica apresentaram plantas mais altas, com panículas mais densas e com grãos mais bem formados, com menor esterilidade de espiguetas. Observou-se, também, que a temperatura das folhas se correlacionou positivamente com a esterilidade de espiguetas e negativamente com a massa de 100 grãos, altura das plantas, fertilidade de perfilhos e produtividade. Exceto a fertilidade de perfilhos, os demais componentes se correlacionaram com a produtividade de grãos, sendo que com a esterilidade de espiguetas a correlação foi negativa. Concluiu-se que a O. glaberrima confere, às suas progênies, maior rusticidade à deficiência hídrica e que a termometria ao infravermelho é uma técnica auxiliar importante na fenotipagem para tolerância a seca.The purpose of the present study was to evaluate the use of infrared thermometry in the characterization of inter specific (Oryza glaberrima x Oryza sativa cv Caiapó and intra specific upland rice lines for drought tolerance. The experiment, carried out at Porangatu in the State of Goiás, was submitted to adequate soil moisture for up to 30 days following emergence when a moderate water stress treatment was imposed (about 50% of the applied irrigation in a control plot in which adequate conditions of soil moisture were maintained. It has been observed that lines with higher
Perseghin, Paolo; D'Amico, Giovanna; Dander, Erica; Gaipa, Giuseppe; Dassi, Maria; Biagi, Ettore; Biondi, Andrea
2008-08-01
Dendritic cells (DC) act as antigen-presenting cells in immune response-mediated mechanisms against malignant cells and/or viral or fungal pathogens. CD14+ monocytes have been so far isolated by techniques of plastic adherence or by using immunomagnetic methods. Here the effectiveness of a commercially available cell separation system (Elutra, Gambro BCT) in the separation of monocytes and the large-scale production of cytomegalovirus (CMV)-specific T-cell lines were investigated. Six mononuclear cell (MNC) collections were processed with the Elutra system. Monocyte-enriched fraction was differentiated into DCs by addition of granulocyte-macrophage-colony-stimulating factor and interleukin (IL)-4. After 6 days of culture, DCs were matured in the presence of interferon (IFN)-gamma, IFN-alpha, IL-1beta, tumor necrosis factor-alpha, and poly(I:C) and pulsed with a pool of 48 MHC Class I and II-binding CMV peptides. Lymphocytes were then stimulated with mature autologous CMV peptide-pulsed DCs. After elutriation, the mean monocyte yield was 0.89 x 10(9) +/- 0.65 x 10(9), with a 51.0 +/- 31.6 percent recovery and a 51.1 +/- 35.4 percent purity. A significant correlation was observed when basal monocyte content was related to the postelutriation recovery (p < 0.0116). More than 60 percent of plated monocytes were differentiated into DCs, which after pulsing with CMV peptides, were able to stimulate a robust enrichment in CMV antigen-specific T cells in all tested samples (mean percentage of pentamer-positive CD8+ cells, 35% compared to the initial 2%). Our findings might be helpful for an appropriate MNC collection, to maximize the efficiency of the elutriation system and subsequently obtain an optimal monocyte-enriched yield for further DC generation and T-cell stimulation.
Directory of Open Access Journals (Sweden)
Brett E. Etchebarne
2017-12-01
Full Text Available Battling infection is a major healthcare objective. Untreated infections can rapidly evolve toward the condition of sepsis in which the body begins to fail and resuscitation becomes critical and tenuous. Identification of infection followed by rapid antimicrobial treatment are primary goals of medical care, but precise identification of offending organisms by current methods is slow and broad spectrum empirical therapy is employed to cover most potential pathogens. Current methods for identification of bacterial pathogens in a clinical setting typically require days of time, or a 4- to 8-h growth phase followed by DNA extraction, purification and PCR-based amplification. We demonstrate rapid (70–120 min genetic diagnostics methods utilizing loop-mediated isothermal amplification (LAMP to test for 15 common infection pathogen targets, called the Infection Diagnosis Panel (In-Dx. The method utilizes filtration to rapidly concentrate bacteria in sample matrices with lower bacterial loads and direct LAMP amplification without DNA purification from clinical blood, urine, wound, sputum and stool samples. The In-Dx panel was tested using two methods of detection: (1 real-time thermocycler fluorescent detection of LAMP amplification and (2 visual discrimination of color change in the presence of Eriochrome Black T (EBT dye following amplification. In total, 239 duplicate samples were collected (31 blood, 122 urine, 73 mucocutaneous wound/swab, 11 sputum and two stool from 229 prospectively enrolled hospital patients with suspected clinical infection and analyzed both at the hospital and by In-Dx. Sensitivity (Se of the In-Dx panel targets pathogens from urine samples by In-Dx was 91.1% and specificity (Sp was 97.3%, with a positive predictive value (PPV of 53.7% and a negative predictive value (NPV of 99.7% as compared to clinical microbial detection methods. Sensitivity of detection of the In-Dx panel from mucocutaneous swab samples was 65.5% with a
Warford, Anthony; Akbar, Hameed; Riberio, Deise
2014-11-01
To achieve specificity and sensitivity using immunohistochemistry it is necessary to combine the application of validated primary antibodies with optimised pre-treatment, detection and visualisation steps. The influence of these surrounding procedures is reviewed. A practical evaluation of tyramide signal amplification and rolling circle amplification detection methods is provided in which formalin fixed paraffin embedded sections of adenocarcinomas of breast, colon and lung together with squamous metaplasia of lung were immunostained with CD20 and CK19 primary antibodies. The results indicate that the detection systems are of comparable sensitivity and specificity. Copyright © 2014 Elsevier Inc. All rights reserved.
Zhang, Li-rong; Zhu, Guichi; Zhang, Chun-yang
2014-07-01
MicroRNAs (miRNAs) are an emerging class of biomarkers and therapeutic targets for various diseases including cancers. Here, we develop a homogeneous and label-free method for sensitive detection of let-7a miRNA based on bifunctional strand displacement amplification (SDA)-mediated hyperbranched rolling circle amplification (HRCA). The binding of target miRNA with the linear template initiates the bifunctional SDA reaction, generating two different kinds of triggers which can hybridize with the linear template to initiate new rounds of SDA reaction for the production of more and more triggers. In the meantime, the released two different kinds of triggers can function as the first and the second primers, respectively, to initiate the HRCA reaction whose products can be simply monitored by a standard fluorometer with SYBR Green I as the fluorescent indicator. The proposed method exhibits high sensitivity with a detection limit of as low as 1.8 × 10(-13) M and a large dynamic range of 5 orders of magnitude from 0.1 pM to 10 nM, and it can even discriminate the single-base difference among the miRNA family members. Moreover, this method can be used to analyze the total RNA samples from the human lung tissues and might be further applied for sensitive detection of various proteins, small molecules, and metal ions in combination with specific aptamers.
Wang, Dennis Y; Chang, Chien-Wei; Lagacé, Robert E; Oldroyd, Nicola J; Hennessy, Lori K
2011-07-01
The AmpFℓSTR(®) Identifiler(®) Direct PCR Amplification Kit is a new short tandem repeat multiplex assay optimized to allow the direct amplification of single-source blood and buccal samples on FTA(®) card without the need for sample purification and quantification. This multiplex assay has been validated according to the FBI/National Standards and SWGDAM guidelines. Validation results revealed that slight variations in primer concentration, master mix component concentration, and thermal cycling parameters did not affect the performance of the chemistry. The assay's sensitivity was demonstrated by amplifying known amounts of white blood cells spotted onto FTA(®) cards, and the assay's specificity was verified by establishing minimal cross-reactivity with nonhuman DNA. No effect on the age of the sample stored on the FTA(®) substrate was observed and full concordance was established in the population study. These findings of the validation study support the use of the Identifiler(®) Direct Kit for forensic standards and database samples genotyping. © 2011 American Academy of Forensic Sciences.
Zhang, Wenjun; McElhinny, Abigail; Nielsen, Alma; Wang, Maria; Miller, Melanie; Singh, Shalini; Rueger, Ruediger; Rubin, Brian P; Wang, Zhen; Tubbs, Raymond R; Nagle, Raymond B; Roche, Pat; Wu, Ping; Pestic-Dragovich, Lidija
2011-01-01
The human homolog of the mouse double minute 2 (MDM2) oncogene is amplified in about 20% of sarcomas. The measurement of the MDM2 amplification can aid in classification and may provide a predictive value for recently formulated therapies targeting MDM2. We have developed and validated an automated bright field dual-color in situ hybridization application to detect MDM2 gene amplification. A repeat-depleted MDM2 probe was constructed to target the MDM2 gene region at 12q15. A chromosome 12-specific probe (CHR12) was generated from a pα12H8 plasmid. The in situ hybridization assay was developed by using a dinitrophenyl-labeled MDM2 probe and a digoxigenin-labeled CHR12 probe on the Ventana Medical Systems' automated slide-staining platforms. The specificity of the MDM2 and CHR12 probes was shown on metaphase spreads and further validated against controls, including normal human tonsil and known MDM2-amplified samples. The assay performance was evaluated on a cohort of 100 formalin-fixed, paraffin-embedded specimens by using a conventional bright field microscope. Simultaneous hybridization and signal detection for MDM2 and CHR12 showed that both DNA targets were present in the same cells. One hundred soft tissue specimens were stained for MDM2 and CHR12. Although 26 of 29 lipomas were nonamplified and eusomic, MDM2 amplification was noted in 78% of atypical lipomatous tumors or well-differentiated liposarcomas. Five of 6 dedifferentiated liposarcoma cases were amplified for MDM2. MDM2 amplification was observed in 1 of 8 osteosarcomas; 3 showed CHR12 aneusomy. MDM2 amplification was present in 1 of 4 chondrosarcomas. Nine of 10 synovial sarcomas displayed no evidence of MDM2 amplification in most tumor cells. In pleomorphic sarcoma, not otherwise specified (pleomorphic malignant fibrous histiocytoma), MDM2 was amplified in 38% of cases, whereas 92% were aneusomic for CHR12. One alveolar rhabdomyosarcoma and 2 embryonal rhabdomyosarcomas displayed low-level aneusomy
Methods for microbial DNA extraction from soil for PCR amplification
Directory of Open Access Journals (Sweden)
Yeates C
1998-01-01
Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.
Weak value amplification via second-order correlated technique
International Nuclear Information System (INIS)
Cui Ting; Huang Jing-Zheng; Zeng Gui-Hua; Liu Xiang
2016-01-01
We propose a new framework combining weak measurement and second-order correlated technique. The theoretical analysis shows that weak value amplification (WVA) experiment can also be implemented by a second-order correlated system. We then build two-dimensional second-order correlated function patterns for achieving higher amplification factor and discuss the signal-to-noise ratio influence. Several advantages can be obtained by our proposal. For instance, detectors with high resolution are not necessary. Moreover, detectors with low saturation intensity are available in WVA setup. Finally, type-one technical noise can be effectively suppressed. (paper)
[Prognostic significance of MYCN amplification in children neuroblastic tumors].
Niu, Huilin; Xu, Tao; Wang, Fenghua; Chen, Zhengrong; Gao, Qiu; Yi, Peng; Xia, Jianqing
2015-02-01
To summarize the clinicopathologic features of neuroblastic tumors (NT), and to explore the prognostic significance of MYCN amplification in NT. The clinicopathologic data of 267 NT were reviewed. MYCN gene amplification was detected by fluorescence in situ hybridization (FISH) in 119 cases and the relationship with pathological characteristics and prognostic significance were analyzed. The study included 267 cases of children NT from patients aged from 1 day to 13 years (median 27 months). The male to female ratio was 1.43. There were 38 cases (14.2%), 43 cases (16.1%), 71 cases (26.6%), and 115 cases (43.1%) of INSS stages I, II, III and IV respectively.Favorable histology group had 157 cases (59.9%); unfavorable histology group had 110 cases (40.1%).Of the 119 NT cases with MYCN FISH performed, 18 cases (15.1%) showed amplification and the signal ratio of MYCN to CEP2 was 4.08-43.29. One hundred and one cases of non-amplified MYCN included MYCN gain in 79 cases (66.3%) and MYCN negative in 22 cases (18.5%). MYCN expression showed significant difference (P = 0.000) between ages, gender, NT type and MKI, but not INPC and clinical stage (P > 0.05).Of the 18 cases with MYCN amplification, 3 were undifferentiated, and 15 poorly differentiated; 17 had high MKI and one moderate MKI. All 18 cases were in unfavorable histology group; the overall survival rate was 3/18, with an average survival time of (17.9 ± 2.4) months.Of the 101 MYCN non-amplification cases, the overall survival rate was 68.3% (69/101), with an average survival time of (29.8 ± 1.3) months. Survival analysis showed the cases with MYCN amplification had worse prognosis (P < 0.05). NT were commonly diagnosed in early ages and easily to metastasize. Most of cases with favorable histology. The cases of MYCN amplification showed unfavorable histology, and the majority cases with high MKI; The patients with MYCN gene amplification had poor prognosis.
The laser integration line (LIL)
International Nuclear Information System (INIS)
Roussel, A.
2006-01-01
The laser integration line (LIL) was originally built to validate the technological choices made for the Megajoule laser that is being built nearby. The LIL is made up of a single line composed of 8 laser beams. Each laser beam consists of 4 main modules: 1) the impulse generator that delivers a 40 mm * 40 mm square cross section infrared laser beam (λ = 1053 nm); 2) the amplification module that involves 2 steps in power amplifying, the output signal is a laser impulse of 5 ns of time duration carrying an energy of 20.10 3 Joule at a wavelength of 1053 nm; 3) the transport line that leads 4 elementary laser beams through a system of 6 mirrors; and 4) the optical block of the focusing and frequency conversion system (SCF). The purpose of SCF is twofold, first to turn the 4 infrared elementary beams into 4 ultraviolet (λ = 351 nm) beams thanks to 2 KDP (potassium di-hydrogeno-phosphate) crystals, and secondly to merge and focus the 4 elementary beams on a unique spot of the target thanks to diffraction gratings with curved slits. (A.C.)
Chandra, Amaresh; Keizerweerd, Amber T; Que, Youxiong; Grisham, Michael P
2015-08-01
Red rot, caused by Colletotrichum falcatum, is a destructive disease prevalent in most sugarcane-producing countries. Disease-free sugarcane planting materials (setts) are essential as the pathogen spreads primarily through infected setts. The present study was undertaken to develop a loop-mediated isothermal amplification (LAMP) assay for the detection of C. falcatum. C. falcatum genomic DNA was isolated from pure mycelium culture and infected tissues. Four sets of primers corresponding to a unique DNA sequence specific to C. falcatum were designed. Specificity of the LAMP test was checked with DNA of another fungal pathogen of sugarcane, Puccinia melanocephala, as well as two closely-related species, Colletotrichum fructivorum and Colletotrichum acutatum. No reaction was found with the three pathogens. When C. falcatum DNA from pure culture was used in a detection limit analysis, sensitivity of the LAMP method was observed to be ten times higher than that of conventional PCR; however, sensitivity was only 5 times higher when DNA from C. falcatum-infected tissues was used. Using the LAMP assay, C. falcatum DNA is amplified with high specificity, efficiency, and rapidity under isothermal conditions. Moreover, visual judgment of color change in <1 h without further post-amplification processing makes the LAMP method convenient, economical, and useful in diagnostic laboratories and the field.
Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of BK Virus▿
Bista, Bipin Raj; Ishwad, Chandra; Wadowsky, Robert M.; Manna, Pradip; Randhawa, Parmjeet Singh; Gupta, Gaurav; Adhikari, Meena; Tyagi, Rakhi; Gasper, Gina; Vats, Abhay
2007-01-01
Loop-mediated isothermal amplification (LAMP) is a novel method for rapid amplification of DNA. Its advantages include rapidity and minimal equipment requirement. The LAMP assay was developed for BK virus (BKV), which is a leading cause of morbidity in renal transplant recipients. The characteristics of the assay, including its specificity and sensitivity, were evaluated. BKV LAMP was performed using various incubation times with a variety of specimens, including unprocessed urine and plasma samples. A ladder pattern on gel electrophoresis, typical of successful LAMP reactions, was observed specifically only for BKV and not for other viruses. The sensitivity of the assay with 1 h of incubation was 100 copies/tube of a cloned BKV fragment. Additionally, a positive reaction was visually ascertained by a simple color reaction using SYBR green dye. BKV LAMP was also successful for urine and plasma specimens without the need for DNA extraction. Due to its simplicity and specificity, the LAMP assay can potentially be developed for “point of care” screening of BKV. PMID:17314224
Development of a loop-mediated isothermal amplification assay for rapid detection of BK virus.
Bista, Bipin Raj; Ishwad, Chandra; Wadowsky, Robert M; Manna, Pradip; Randhawa, Parmjeet Singh; Gupta, Gaurav; Adhikari, Meena; Tyagi, Rakhi; Gasper, Gina; Vats, Abhay
2007-05-01
Loop-mediated isothermal amplification (LAMP) is a novel method for rapid amplification of DNA. Its advantages include rapidity and minimal equipment requirement. The LAMP assay was developed for BK virus (BKV), which is a leading cause of morbidity in renal transplant recipients. The characteristics of the assay, including its specificity and sensitivity, were evaluated. BKV LAMP was performed using various incubation times with a variety of specimens, including unprocessed urine and plasma samples. A ladder pattern on gel electrophoresis, typical of successful LAMP reactions, was observed specifically only for BKV and not for other viruses. The sensitivity of the assay with 1 h of incubation was 100 copies/tube of a cloned BKV fragment. Additionally, a positive reaction was visually ascertained by a simple color reaction using SYBR green dye. BKV LAMP was also successful for urine and plasma specimens without the need for DNA extraction. Due to its simplicity and specificity, the LAMP assay can potentially be developed for "point of care" screening of BKV.
Cha, Yongjun; Kim, Hwang-Phill; Lim, Yoojoo; Han, Sae-Won; Song, Sang-Hyun; Kim, Tae-You
2018-03-24
Although regorafenib has demonstrated survival benefits in patients with metastatic colorectal and gastrointestinal stromal tumors, no proven biomarker has been identified for predicting sensitivity to regorafenib. Here, we investigated preclinical activity of regorafenib in gastric and colorectal cancer cells to identify genetic alterations associated with sensitivity to regorafenib. Mutation profiles and copy number assays of regorafenib target molecules indicated that amplification of FGFR2 was the only genetic alteration associated with in vitro sensitivity to regorafenib. Regorafenib effectively inhibited phosphorylation of FGFR2 and its downstream signaling molecules in a dose-dependent manner and selectively in FGFR2 amplified cells. Regorafenib induced G1 arrest (SNU-16, KATO-III) and apoptosis (NCI-H716), however, no significant changes were seen in cell lines without FGFR2 amplification. In SNU-16 mice xenografts, regorafenib significantly inhibited tumor growth, proliferation, and FGFR signaling compared to treatment with control vehicle. Regorafenib effectively abrogates activated FGFR2 signaling in FGFR2 amplified gastric and colorectal cancer and therefore, might be considered for integration into treatment in patients with FGFR2 amplified gastric and colorectal cancers. This article is protected by copyright. All rights reserved. Molecular Oncology (2018) © 2018 The Authors. Published by FEBS Press and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Jingshan Li
2000-01-01
Full Text Available In this work, serial production lines with finished goods buffers operating in the pull regime are considered. The machines are assumed to obey Bernoulli reliability model. The problem of satisfying customers demand is addressed. The level of demand satisfaction is quantified by the due-time performance (DTP, which is defined as the probability to ship to the customer a required number of parts during a fixed time interval. Within this scenario, the definitions of DTP bottlenecks are introduced and a method for their identification is developed.
Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors
International Nuclear Information System (INIS)
Schneider, Katja U; Liebenberg, Volker; Kneip, Christoph; Seegebarth, Anke; Erdogan, Fikret; Rappold, Gudrun; Schmidt, Bernd; Dietrich, Dimo; Fleischhacker, Michael; Leschber, Gunda; Merk, Johannes; Schäper, Frank; Stapert, Henk R; Vossenaar, Erik R; Weickmann, Sabine
2011-01-01
DNA methylation in the SHOX2 locus was previously used to reliably detect lung cancer in a group of critical controls, including 'cytologically negative' samples with no visible tumor cell content, at a high specificity based on the analysis of bronchial lavage samples. This study aimed to investigate, if the methylation correlates with SHOX2 gene expression and/or copy number alterations. An amplification of the SHOX2 gene locus together with the observed tumor-specific hypermethylation might explain the good performance of this marker in bronchial lavage samples. SHOX2 expression, gene copy number and DNA methylation were determined in lung tumor tissues and matched morphologically normal adjacent tissues (NAT) from 55 lung cancer patients. Quantitative HeavyMethyl (HM) real-time PCR was used to detect SHOX2 DNA methylation levels. SHOX2 expression was assayed with quantitative real-time PCR, and copy numbers alterations were measured with conventional real-time PCR and array CGH. A hypermethylation of the SHOX2 locus in tumor tissue as compared to the matched NAT from the same patient was detected in 96% of tumors from a group of 55 lung cancer patients. This correlated highly significantly with the frequent occurrence of copy number amplification (p < 0.0001), while the expression of the SHOX2 gene showed no difference. Frequent gene amplification correlated with hypermethylation of the SHOX2 gene locus. This concerted effect qualifies SHOX2 DNA methylation as a biomarker for lung cancer diagnosis, especially when sensitive detection is needed, i.e. in bronchial lavage or blood samples
International Nuclear Information System (INIS)
1998-08-01
This book deals with line facilities. The contents of this book are outline line of wire telecommunication ; development of line, classification of section of line and theory of transmission of line, cable line ; structure of line, line of cable in town, line out of town, domestic cable and other lines, Optical communication ; line of optical cable, transmission method, measurement of optical communication and cable of the sea bottom, Equipment of telecommunication line ; telecommunication line facilities and telecommunication of public works, construction of cable line and maintenance and Regulation of line equipment ; regulation on technique, construction and maintenance.
Energy Technology Data Exchange (ETDEWEB)
Niwa, Ohtsura; Enoki, Yoshitaka; Yokoro, Kenjiro
1989-03-01
We examined expression of the c-myc gene by the dot blot hybridization of total cellular RNA from mouse primary tumors induced by chemicals and radiations. Expression of the c-myc gene was found to be elevated in 69 cases among 177 independently induced tumors of 12 different types. DNA from tumors overexpressing the myc gene was analyzed by Southern blotting. No case of rearrangement was detected. However, amplification of the c-myc gene was found in 7 cases of primary sarcomas. These included 4 cases out of 24 methylcholanthrene-induced sarcomas and 3 cases out of 7 /alpha/-tocopherol-induced sacromas. We also analyzed 8 cases of sarcomas induced by radiations, but could not find changes in the gene structure of the c-myc gene. Thus, our data indicate tumor type specificity and agent specificity of c-myc gene amplification. (author).
Conditional discrimination learning: A critique and amplification
Schrier, Allan M.; Thompson, Claudia R.
1980-01-01
Carter and Werner recently reviewed the literature on conditional discrimination learning by pigeons, which consists of studies of matching-to-sample and oddity-from-sample. They also discussed three models of such learning: the “multiple-rule” model (learning of stimulus-specific relations), the “configuration” model, and the “single-rule” model (concept learning). Although their treatment of the multiple-rule model, which seems most applicable to the pigeon data, is generally excellent, the...
Amplification and Attenuation across USArray using Ambient Noise Wavefront Tracking
Bowden, Daniel C.
2017-11-15
As seismic travel-time tomography continues to be refined using data from the vast USArray dataset, it is advantageous to also exploit the amplitude information carried by seismic waves. We use ambient noise cross correlation to make observations of surface-wave amplification and attenuation at shorter periods (8 – 32 seconds) than can be observed with only traditional teleseismic earthquake sources. We show that the wavefront tracking approach of [Lin et al., 2012a] can be successfully applied to ambient noise correlations, yielding results quite similar to those from earthquake observations at periods of overlap. This consistency indicates that the wavefront tracking approach is viable for use with ambient noise correlations, despite concerns of the inhomogeneous and unknown distribution of noise sources. The resulting amplification and attenuation maps correlate well with known tectonic and crustal structure; at the shortest periods, our amplification and attenuation maps correlate well with surface geology and known sedimentary basins, while our longest period amplitudes are controlled by crustal thickness and begin to probe upper mantle materials. These amplification and attenuation observations are sensitive to crustal materials in different ways than travel-time observations and may be used to better constrain temperature or density variations. We also value them as an independent means of describing the lateral variability of observed Rayleigh-wave amplitudes without the need for 3D tomographic inversions.
Single primer amplification reaction methods reveal exotic and ...
Indian Academy of Sciences (India)
Unknown
mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...
Nucleic Acid Amplification as used in the Diagnosis and ...
African Journals Online (AJOL)
Nucleic Acid Amplification as used in the Diagnosis and Management of Viral Diseases: A Review. ... Bayero Journal of Pure and Applied Sciences ... are highly unculturable, fastidious or hazardous to the laboratory personnel and diagnosis depends on serological methods or culture in an expensive bio-safety level.
Four-quadrant flyback converter for direct audio power amplification
DEFF Research Database (Denmark)
Ljusev, Petar; Andersen, Michael Andreas E.
2005-01-01
This paper presents a bidirectional, four-quadrant flyback converter for use in direct audio power amplification. When compared to the standard Class-D switching audio power amplifier with a separate power supply, the proposed four-quadrant flyback converter provides simple solution with better...
Four-quadrant flyback converter for direct audio power amplification
Ljusev, Petar; Andersen, Michael Andreas E.
2005-01-01
This paper presents a bidirectional, four-quadrant flyback converter for use in direct audio power amplification. When compared to the standard Class-D switching audio power amplifier with a separate power supply, the proposed four-quadrant flyback converter provides simple solution with better efficiency, higher level of integration and lower component count.
Loop-mediated isothermal amplification (LAMP) based detection of ...
African Journals Online (AJOL)
SAM
2014-05-07
May 7, 2014 ... 2 months for growing in a culture. Therefore, to control .... The LAMP reaction is carried out in a 25 µL reaction mixture containing ..... J. Fish Dis. 32(6):491-497. Goto M, Honda E, Ogura A, Nomoto A, Hanaki K (2009). Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy ...
Whole genome amplification: Use of advanced isothermal method
African Journals Online (AJOL)
Yomi
2010-12-29
Dec 29, 2010 ... 1Ph.D. Student, Department of Animal Science, Science and Research Branch, Islamic Azad University(IAU), ... sequence has a large effect on both the denaturation of ..... performance of multiple displacement amplification and OmniPlex ... Dean FB, Hosono S, Fang L, Wu L, Faruqi AF, Bray-Ward P, Sun Z,.
Controlling the amplification of chirality in hydrogen-bonded assemblies
Mateos timoneda, Miguel; Crego Calama, Mercedes; Reinhoudt, David
2005-01-01
The amplification of chirality (a high enantiomeric or diastereomeric excess induced by a small initial amount of chiral bias) on hydrogen-bonded assemblies has been studied using “sergeants-and-soldiers” experiments under thermodynamically controlled conditions. Here it is shown that different
Particle creation amplification in curved space due to thermal effects
International Nuclear Information System (INIS)
Laciana, C. E.
1997-01-01
A physical system composed by a scalar field minimally coupled to gravity and a thermal reservoir as in thermo field dynamics, all of them in curved space-time, is considered. When the formalism of thermo field dynamics is generalized to the above case, an amplification in the number of created particles is predicted
Probabilistic Sensitivity Amplification Control for Lower Extremity Exoskeleton
Directory of Open Access Journals (Sweden)
Likun Wang
2018-03-01
Full Text Available To achieve ideal force control of a functional autonomous exoskeleton, sensitivity amplification control is widely used in human strength augmentation applications. The original sensitivity amplification control aims to increase the closed-loop control system sensitivity based on positive feedback without any sensors between the pilot and the exoskeleton. Thus, the measurement system can be greatly simplified. Nevertheless, the controller lacks the ability to reject disturbance and has little robustness to the variation of the parameters. Consequently, a relatively precise dynamic model of the exoskeleton system is desired. Moreover, the human-robot interaction (HRI cannot be interpreted merely as a particular part of the driven torque quantitatively. Therefore, a novel control methodology, so-called probabilistic sensitivity amplification control, is presented in this paper. The innovation of the proposed control algorithm is two-fold: distributed hidden-state identification based on sensor observations and evolving learning of sensitivity factors for the purpose of dealing with the variational HRI. Compared to the other state-of-the-art algorithms, we verify the feasibility of the probabilistic sensitivity amplification control with several experiments, i.e., distributed identification model learning and walking with a human subject. The experimental result shows potential application feasibility.
Two-photon stimulated emission and pulse amplification
International Nuclear Information System (INIS)
Yuen, H.P.
1975-01-01
Threshold conditions are given for the sustained operation of standing-wave and long-pulse traveling-wave two-photon lasers. Pulse shortening in long-pulse two-photon amplification, a behavior absent in the one-photon case, is also demonstrated analytically. (U.S.)
Resonant amplification of quantum fluctuations in a spinor gas