WorldWideScience

Sample records for levels mutations genes

  1. Mutations in the gene for lipoprotein lipase. A cause for low HDL cholesterol levels in individuals heterozygous for familial hypercholesterolemia

    NARCIS (Netherlands)

    Pimstone, S. N.; Gagné, S. E.; Gagné, C.; Lupien, P. J.; Gaudet, D.; Williams, R. R.; Kotze, M.; Reymer, P. W.; Defesche, J. C.; Kastelein, J. J.

    1995-01-01

    Familial hypercholesterolemia (FH) is characterized by elevated plasma concentrations of LDL cholesterol resulting from mutations in the gene for the LDL receptor. Low HDL cholesterol levels are seen frequently in patients both heterozygous and homozygous for mutations in this gene. Suggested

  2. Missense mutation in GRN gene affecting RNA splicing and plasma progranulin level in a family affected by frontotemporal lobar degeneration.

    Science.gov (United States)

    Luzzi, Simona; Colleoni, Lara; Corbetta, Paola; Baldinelli, Sara; Fiori, Chiara; Girelli, Francesca; Silvestrini, Mauro; Caroppo, Paola; Giaccone, Giorgio; Tagliavini, Fabrizio; Rossi, Giacomina

    2017-06-01

    Gene coding for progranulin, GRN, is a major gene linked to frontotemporal lobar degeneration. While most of pathogenic GRN mutations are null mutations leading to haploinsufficiency, GRN missense mutations do not have an obvious pathogenicity, and only a few have been revealed to act through different pathogenetic mechanisms, such as cytoplasmic missorting, protein degradation, and abnormal cleavage by elastase. The aim of this study was to disclose the pathogenetic mechanisms of the GRN A199V missense mutation, which was previously reported not to alter physiological progranulin features but was associated with a reduced plasma progranulin level. After investigating the family pedigree, we performed genetic and biochemical analysis on its members and performed RNA expression studies. We found that the mutation segregates with the disease and discovered that its pathogenic feature is the alteration of GRN mRNA splicing, actually leading to haploinsufficiency. Thus, when facing with a missense GRN mutation, its pathogenetic effects should be investigated, especially if associated with low plasma progranulin levels, to determine its nature of either benign polymorphism or pathogenic mutation. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Genetic interaction analysis of point mutations enables interrogation of gene function at a residue-level resolution

    Science.gov (United States)

    Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.

    2014-01-01

    We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270

  4. Mutations in the gene for methylenetetrahydrofolate reductase, homocysteine levels, and vitamin status in women with a history of preeclampsia

    NARCIS (Netherlands)

    Lachmeijer, AMA; Arngrimsson, R; Bastiaans, EJ; Pals, G; ten Kate, LP; de Vries, JIP; Kostense, PJ; Aarnoudse, JG; Dekker, GA

    OBJECTIVE: This study was undertaken to assess frequencies of the methylenetetrahydrofolate reductase gene mutations cytosine-to-thymine substitution at base 677 (C677T) and adenine-to-cytosine substitution at base 1298 (A1298C) and their interactions with homocysteine and vitamin levels among Dutch

  5. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  6. Avian metapneumovirus SH gene end and G protein mutations influence the level of protection of live-vaccine candidates.

    Science.gov (United States)

    Naylor, Clive J; Ling, Roger; Edworthy, Nicole; Savage, Carol E; Easton, Andrew J

    2007-06-01

    A prototype avian metapneumovirus (AMPV) vaccine (P20) was previously shown to give variable outcomes in experimental trials. Following plaque purification, three of 12 viruses obtained from P20 failed to induce protection against virulent challenge, whilst the remainder retained their protective capacity. The genome sequences of two protective viruses were identical to the P20 consensus, whereas two non-protective viruses differed only in the SH gene transcription termination signal. Northern blotting showed that the alterations in the SH gene-end region of the non-protective viruses led to enhanced levels of dicistronic mRNA produced by transcriptional readthrough. A synthetic minigenome was used to demonstrate that the altered SH gene-end region reduced the level of protein expression from a downstream gene. The genomes of the remaining eight plaque-purified viruses were sequenced in the region where the P20 consensus sequence differed from the virulent progenitor. The seven protective clones were identical, whereas the non-protective virus retained the virulent progenitor sequence at two positions and contained extensive alterations in its attachment (G) protein sequence associated with a reduced or altered expression pattern of G protein on Western blots. The data indicate that the efficacy of a putative protective vaccine strain is affected by mutations altering the balance of G protein expression.

  7. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    Science.gov (United States)

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  8. 677C to T mutation in the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene and plasma homocyst(e)ine levels in patients with TIA or minor stroke.

    Science.gov (United States)

    Lalouschek, W; Aull, S; Korninger, L; Mannhalter, C; Pabinger-Fasching, I; Schmid, R W; Schnider, P; Zeiler, K

    1998-03-05

    It was the aim of this study to determine the associations of clinical and laboratory data with plasma homocyst(e)ine levels in patients with transient ischemic attack (TIA) or minor stroke (MS), with special reference to their 677C to T mutation status in the 5,10-methylenetetrahydrofolate reductase (5,10-MTHFR) gene. Seventy-six patients with TIA or MS were investigated at least 3 months after their (last) clinical event. By means of univariate analysis, significant correlations of homocyst(e)ine levels with male gender (Pine levels. After adjustment for age, creatinine levels and homocyst(e)ine levels remained significantly correlated to each other (Pine levels was no longer significant (P=0.10). Mutation-positive patients exhibited moderately and statistically non-significantly higher homocyst(e)ine levels than mutation-negative patients, particularly those who were homozygous positive. Homocyst(e)ine levels were closely correlated with creatinine levels (Pine levels in patients with TIA or MS are dependent on the 5,10-MTHFR mutation status. Significant correlations between these variables were found only in mutation-positive but not in mutation-negative patients.

  9. Association of TMEM106B gene polymorphism with age at onset in granulin mutation carriers and plasma granulin protein levels.

    Science.gov (United States)

    Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B; Morris, John C; Goate, Alison

    2011-05-01

    To test whether rs1990622 (TMEM106B) is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy, elderly individuals. Rs1990622 (TMEM106B) was identified as a risk factor for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP) in a recent genome-wide association. Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier method and a Cox proportional hazards model. Alzheimer's Disease Research Center. Subjects  We analyzed 50 affected and unaffected GRN mutation carriers from 4 previously reported FTLD-TDP families (HDDD1, FD1, HDDD2, and the Karolinska family). The GRN plasma levels were also measured in 73 healthy, elderly individuals. Age at onset and GRN plasma levels. The risk allele of rs1990622 was associated with a mean decrease of the AAO of 13 years (P = 9.9 × 10(-7)) and with lower plasma GRN levels in both healthy older adults (P = 4 × 10(-4)) and GRN mutation carriers (P = .0027). Analysis of the HapMap database identified a nonsynonymous single-nucleotide polymorphism rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. The association of rs1990622 with AAO explains, in part, the wide range in the AAO of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN.

  10. TMEM106B gene polymorphism is associated with age at onset in granulin mutation carriers and plasma granulin protein levels

    Science.gov (United States)

    Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L.; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B.; Morris, John C.; Goate, Alison

    2011-01-01

    Objective A recent genome-wide association study for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP), identified rs1990622 (TMEM106B) as a risk factor for FTLD-TDP. In this study we tested whether rs1990622 is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy elderly individuals. Design Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier and a Cox proportional hazards model. Subjects We analyzed 50 affected and unaffected GRN mutation carriers from four previously reported FTLD-TDP families (HDDD1, FD1, HDDD2 and the Karolinska family). GRN plasma levels were also measured in 73 healthy, elderly individuals. Results The risk allele of rs1990622 is associated with a mean decrease of the age at onset of thirteen years (p=9.9×10−7), with lower plasma granulin levels in both healthy older adults (p = 4×10−4) and GRN mutation carriers (p=0.0027). Analysis of the HAPMAP database identified a non-synonymous single nucleotide polymorphism, rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. Conclusions The association of rs1990622 with AAO explains, in part, the wide range in the age at onset of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer’s disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN. PMID:21220649

  11. Mutated genes as research tool

    International Nuclear Information System (INIS)

    1981-01-01

    Green plants are the ultimate source of all resources required for man's life, his food, his clothes, and almost all his energy requirements. Primitive prehistoric man could live from the abundance of nature surrounding him. Man today, dominating nature in terms of numbers and exploiting its limited resources, cannot exist without employing his intelligence to direct natural evolution. Plant sciences, therefore, are not a matter of curiosity but an essential requirement. From such considerations, the IAEA and FAO jointly organized a symposium to assess the value of mutation research for various kinds of plant science, which directly or indirectly might contribute to sustaining and improving crop production. The benefit through developing better cultivars that plant breeders can derive from using the additional genetic resources resulting from mutation induction has been assessed before at other FAO/IAEA meetings (Rome 1964, Pullman 1969, Ban 1974, Ibadan 1978) and is also monitored in the Mutation Breeding Newsletter, published by IAEA twice a year. Several hundred plant cultivars which carry economically important characters because their genes have been altered by ionizing radiation or other mutagens, are grown by farmers and horticulturists in many parts of the world. But the benefit derived from such mutant varieties is without any doubt surpassed by the contribution which mutation research has made towards the advancement of genetics. For this reason, a major part of the papers and discussions at the symposium dealt with the role induced-mutation research played in providing insight into gene action and gene interaction, the organization of genes in plant chromosomes in view of homology and homoeology, the evolutionary role of gene duplication and polyploidy, the relevance of gene blocks, the possibilities for chromosome engineering, the functioning of cytroplasmic inheritance and the genetic dynamics of populations. In discussing the evolutionary role of

  12. Correlation Between C677T and A1298C Mutations on the MTHFR Gene With Plasma Homocysteine Levels and Venous Thrombosis in Pregnant Women at Risk of Thrombosis

    Directory of Open Access Journals (Sweden)

    Kazem Ghaffari

    2015-12-01

    Full Text Available Background: Deep venous thrombosis (DVT is a common disease with a high morbidity, mortality and increase in miscarriages. Objectives: The purpose of this study was to assessment the correlation between C677T and A1298C mutations on the methylenetetrahydrofolate reductase (MTHFR gene with total plasma homocysteine levels and deep venous thrombosis in pregnant women at risk of thrombosis. Patients and Methods: In this case-control study, 120 pregnant women with risk of DVT and 100 pregnant women without risk of DVT were included in the study. Assay for identification of MTHFR mutations was carried out by PCR-RFLP. Total plasma homocysteine was measured by ELISA method. Results: Homozygous (MM mutations of MTHFR C677T and A1298C were not associated with DVT in pregnant women with and without DVT, respectively. Plasma homocysteine levels were significantly higher in pregnant women with DVT (18.3 ± 5.9 μmol/L than in the pregnant women without DVT (8.9 ± 6.4 μmol/L in C677T and A1298C mutations on the MTHFR gene, respectively (P = 0.021. Conclusions: Our results showed that MTHFR C677T and MTHFR A1289C polymorphisms are not connected with total plasma homocysteine levels in pregnant women with and without DVT. Also, plasma homocysteine levels were significantly higher in pregnant women with DVT.

  13. Gene mutations in hepatocellular adenomas

    DEFF Research Database (Denmark)

    Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

    2015-01-01

    is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

  14. The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

    Directory of Open Access Journals (Sweden)

    Mohammad Soleiman Soltanpour

    2018-01-01

    Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

  15. Mutation scanning of peach floral genes

    Directory of Open Access Journals (Sweden)

    Wilde H Dayton

    2011-05-01

    Full Text Available Abstract Background Mutation scanning technology has been used to develop crop species with improved traits. Modifications that improve screening throughput and sensitivity would facilitate the targeted mutation breeding of crops. Technical innovations for high-resolution melting (HRM analysis are enabling the clinic-based screening for human disease gene polymorphism. We examined the application of two HRM modifications, COLD-PCR and QMC-PCR, to the mutation scanning of genes in peach, Prunus persica. The targeted genes were the putative floral regulators PpAGAMOUS and PpTERMINAL FLOWER I. Results HRM analysis of PpAG and PpTFL1 coding regions in 36 peach cultivars found one polymorphic site in each gene. PpTFL1 and PpAG SNPs were used to examine approaches to increase HRM throughput. Cultivars with SNPs could be reliably detected in pools of twelve genotypes. COLD-PCR was found to increase the sensitivity of HRM analysis of pooled samples, but worked best with small amplicons. Examination of QMC-PCR demonstrated that primary PCR products for further analysis could be produced from variable levels of genomic DNA. Conclusions Natural SNPs in exons of target peach genes were discovered by HRM analysis of cultivars from a southeastern US breeding program. For detecting natural or induced SNPs in larger populations, HRM efficiency can be improved by increasing sample pooling and template production through approaches such as COLD-PCR and QMC-PCR. Technical advances developed to improve clinical diagnostics can play a role in the targeted mutation breeding of crops.

  16. Mutation update for the PORCN gene

    NARCIS (Netherlands)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

  17. Gene mutations in children with chronic pancreatitis.

    Science.gov (United States)

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  18. Mutation update for the PORCN gene

    DEFF Research Database (Denmark)

    Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

    2011-01-01

    Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

  19. Hemochromatosis (HFE gene mutations in Brazilian chronic hemodialysis patients

    Directory of Open Access Journals (Sweden)

    F.V. Perícole

    2005-09-01

    Full Text Available Patients with chronic renal insufficiency (CRI have reduced hemoglobin levels, mostly as a result of decreased kidney production of erythropoietin, but the relation between renal insufficiency and the magnitude of hemoglobin reduction has not been well defined. Hereditary hemochromatosis is an inherited disorder of iron metabolism. The importance of the association of hemochromatosis with treatment for anemia among patients with CRI has not been well described. We analyzed the frequency of the C282Y and H63D mutations in the HFE gene in 201 Brazilian individuals with CRI undergoing hemodialysis. The analysis of the effects of HFE mutations on iron metabolism and anemia with biochemical parameters was possible in 118 patients of this study (hemoglobin, hematocrit, ferritin levels, transferrin saturation, and serum iron. A C282Y heterozygous mutation was found in 7/201 (3.4% and H63D homozygous and heterozygous mutation were found in 2/201 (1.0% and 46/201 (22.9%, respectively. The allelic frequencies of the HFE mutations (0.017 for C282Y mutation and 0.124 for H63D mutation did not differ between patients with CRI and healthy controls. Regarding the biochemical parameters, no differences were observed between HFE heterozygous and mutation-negative patients, although ferritin levels were not higher among patients with the H63D mutation (P = 0.08. From what we observed in our study, C282Y/H63D HFE gene mutations are not related to degrees of anemia or iron stores in CRI patients receiving intravenous iron supplementation (P > 0.10. Nevertheless, the present data suggest that the H63D mutation may have an important function as a modulating factor of iron overload in these patients.

  20. Mutational robustness of gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Aalt D J van Dijk

    Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

  1. Mutations in the Norrie disease gene.

    Science.gov (United States)

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Thyroglobulin Gene Mutation with Cold Nodule on Thyroid Scintigraphy

    Directory of Open Access Journals (Sweden)

    Toshio Kahara

    2012-01-01

    Full Text Available Thyroglobulin gene mutation is a rare cause of congenital hypothyroidism, but thyroglobulin gene mutations are thought to be associated with thyroid cancer development. A 21-year-old Japanese man treated with levothyroxine for congenital hypothyroidism had an enlarged thyroid gland with undetectable serum thyroglobulin despite elevated serum TSH level. The patient was diagnosed with thyroglobulin gene mutation, with compound heterozygosity for Gly304Cys missense mutation and Arg432X nonsense mutation. Ultrasonography showed a hypovascular large tumor in the left lobe that appeared as a cold nodule on thyroid scintigraphy. He underwent total thyroidectomy, but pathological study did not reveal findings of thyroid carcinoma, but rather a hyperplastic nodule with hemorrhage. Strong cytoplasmic thyroglobulin immunostaining was observed, but sodium iodide symporter immunostaining was hardly detected in the hyperplastic nodule. The clinical characteristics of patients with thyroglobulin gene mutations are diverse, and some patients are diagnosed by chance on examination of goiter in adults. The presence of thyroid tumors that appear as cold nodules on thyroid scintigraphy should consider the potential for thyroid carcinoma, if the patient has relatively low serum thyroglobulin concentration in relation to the degree of TSH without thyroglobulin autoantibody.

  3. Rare suprasellar chordoid meningioma with INI1 gene mutation ...

    African Journals Online (AJOL)

    Background: Chordoid Meningioma is a rare brain tumour characterized genetically by loss of genetic material from chromosome 22q at cytogenetic level resulting in mutation of NF2 gene. Objectives and case report: In the present report, we described a rare case of suprasellar chordoid meningioma, which presented in a ...

  4. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  5. Tumor mismatch repair immunohistochemistry and DNA MLH1 methylation testing of patients with endometrial cancer diagnosed at age younger than 60 years optimizes triage for population-level germline mismatch repair gene mutation testing.

    Science.gov (United States)

    Buchanan, Daniel D; Tan, Yen Y; Walsh, Michael D; Clendenning, Mark; Metcalf, Alexander M; Ferguson, Kaltin; Arnold, Sven T; Thompson, Bryony A; Lose, Felicity A; Parsons, Michael T; Walters, Rhiannon J; Pearson, Sally-Ann; Cummings, Margaret; Oehler, Martin K; Blomfield, Penelope B; Quinn, Michael A; Kirk, Judy A; Stewart, Colin J; Obermair, Andreas; Young, Joanne P; Webb, Penelope M; Spurdle, Amanda B

    2014-01-10

    Clinicopathologic data from a population-based endometrial cancer cohort, unselected for age or family history, were analyzed to determine the optimal scheme for identification of patients with germline mismatch repair (MMR) gene mutations. Endometrial cancers from 702 patients recruited into the Australian National Endometrial Cancer Study (ANECS) were tested for MMR protein expression using immunohistochemistry (IHC) and for MLH1 gene promoter methylation in MLH1-deficient cases. MMR mutation testing was performed on germline DNA of patients with MMR-protein deficient tumors. Prediction of germline mutation status was compared for combinations of tumor characteristics, age at diagnosis, and various clinical criteria (Amsterdam, Bethesda, Society of Gynecologic Oncology, ANECS). Tumor MMR-protein deficiency was detected in 170 (24%) of 702 cases. Germline testing of 158 MMR-deficient cases identified 22 truncating mutations (3% of all cases) and four unclassified variants. Tumor MLH1 methylation was detected in 99 (89%) of 111 cases demonstrating MLH1/PMS2 IHC loss; all were germline MLH1 mutation negative. A combination of MMR IHC plus MLH1 methylation testing in women younger than 60 years of age at diagnosis provided the highest positive predictive value for the identification of mutation carriers at 46% versus ≤ 41% for any other criteria considered. Population-level identification of patients with MMR mutation-positive endometrial cancer is optimized by stepwise testing for tumor MMR IHC loss in patients younger than 60 years, tumor MLH1 methylation in individuals with MLH1 IHC loss, and germline mutations in patients exhibiting loss of MSH6, MSH2, or PMS2 or loss of MLH1/PMS2 with absence of MLH1 methylation.

  6. Mutated Genes in Schizophrenia Map to Brain Networks

    Science.gov (United States)

    ... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

  7. The Androgen Receptor Gene Mutations Database.

    Science.gov (United States)

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  8. Major gene mutations and domestication of plants

    International Nuclear Information System (INIS)

    Ashri, A.

    1989-01-01

    From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

  9. Towards linked open gene mutations data

    Science.gov (United States)

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  10. Towards linked open gene mutations data.

    Science.gov (United States)

    Zappa, Achille; Splendiani, Andrea; Romano, Paolo

    2012-03-28

    With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

  11. Characteristics of gene mutation in Chinese patients with hereditary hemochromatosis

    Directory of Open Access Journals (Sweden)

    LYU Tingxia

    2016-08-01

    Full Text Available ObjectiveTo investigate the characteristics of gene mutation in Chinese patients with hereditary hemochromatosis (HH. MethodsA total of 9 patients with HH who visited Beijing Friendship Hospital, Capital Medical University from January 2013 to December 2015 were enrolled. The genomic DNA was extracted, and PCR amplification and Sanger sequencing were performed for all the exons of four genotypes of HH, i.e., HFE (type Ⅰ, HJV (type ⅡA, HAMP (type ⅡB, TFR2 (type Ⅲ, and SLC40A1 (type Ⅳ to analyze gene mutations. A total of 50 healthy subjects were enrolled as control group to analyze the prevalence of identified gene mutations in a healthy population. ResultsOf all patients, 2 had H63D mutation of HFE gene in type Ⅰ HH, 1 had E3D mutation of HJV gene in type ⅡA HH, 2 had I238M mutation of TFR2 gene in type Ⅲ HH, and 1 had IVS 3+10 del GTT splice mutation of SLC40A1 gene in type Ⅳ HH. No patients had C282Y mutation of HFE gene in type Ⅰ HH which was commonly seen in European and American populations. Five patients had no missense mutation or splice mutation. In addition, it was found in a family that a HH patient had E3D mutation of HJV gene, H63D mutation of HFE gene, and I238M mutation of TFR2 gene, but the healthy brother and sister carrying two of these mutations did not had the phenotype of HH. ConclusionHH gene mutations vary significantly across patients of different races, and non-HFE-HH is dominant in the Chinese population. There may be HH genes which are different from known genes, and further investigation is needed.

  12. Collodion Baby with TGM1 gene mutation

    Directory of Open Access Journals (Sweden)

    Sharma D

    2015-09-01

    Full Text Available Deepak Sharma,1 Basudev Gupta,2 Sweta Shastri,3 Aakash Pandita,1 Smita Pawar4 1Department of Neonatology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, 2Department of Pediatrics, Civil Hospital, Palwal, Haryana, 3Department of Pathology, NKP Salve Medical College, Nagpur, Maharashtra, 4Department of Obstetrics and Gynaecology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, IndiaAbstract: Collodion baby (CB is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin-like membrane encompassing the total body surface. CB is not a specific disease entity, but is a common phenotype in conditions like harlequin ichthyosis, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, and trichothiodystrophy. We report a CB that was brought to our department and later diagnosed to have TGM1 gene c.984+1G>A mutation. However, it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma (both having the same mutation. The infant was lost to follow-up.Keywords: cellophane membrane, c.984+1G>A mutation, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, parchment membrane, TGM1 gene

  13. HFE gene mutations in coronary atherothrombotic disease

    Directory of Open Access Journals (Sweden)

    Calado R.T.

    2000-01-01

    Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

  14. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  15. ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

    Directory of Open Access Journals (Sweden)

    Amit Kumar Tiwari

    2016-11-01

    Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

  16. Hereditary cancer genes are highly susceptible to splicing mutations

    Science.gov (United States)

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  17. Hereditary cancer genes are highly susceptible to splicing mutations.

    Directory of Open Access Journals (Sweden)

    Christy L Rhine

    2018-03-01

    Full Text Available Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5' and 3' splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77% of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36% of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.

  18. [Study of gene mutation in 62 hemophilia A children].

    Science.gov (United States)

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  19. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

  20. Hemochromatosis C282Y gene mutation as a potential susceptibility ...

    African Journals Online (AJOL)

    G.M. Mokhtar

    2017-08-12

    Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

  1. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  2. Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

    African Journals Online (AJOL)

    Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

  3. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  4. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  5. Splice Site Mutations in the ATP7A Gene

    DEFF Research Database (Denmark)

    Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...

  6. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

    Science.gov (United States)

    Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

    2002-04-01

    The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

  7. Optimal control of gene mutation in DNA replication.

    Science.gov (United States)

    Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

    2012-01-01

    We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

  8. DRUMS: a human disease related unique gene mutation search engine.

    Science.gov (United States)

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  9. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    Science.gov (United States)

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  10. Mutations of the Norrie gene in Korean ROP infants.

    Science.gov (United States)

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  11. Ferredoxin Gene Mutation in Iranian Trichomonas Vaginalis Isolates

    Directory of Open Access Journals (Sweden)

    Soudabeh Heidari

    2013-09-01

    Full Text Available Background: Trichomonas vaginalis causes trichomoniasis and metronidazole is its chosen drug for treatment. Ferredoxin has role in electron transport and carbohydrate metabolism and the conversion of an inactive form of metronidazole (CO to its active form (CPR. Ferredoxin gene mutations reduce gene expression and increase its resistance to metronidazole. In this study, the frequency of ferredoxin gene mutations in clinical isolates of T.vaginalis in Tehran has been studied.Methods: Forty six clinical T. vaginalis isolates of vaginal secretions and urine sediment were collected from Tehran Province since 2011 till 2012. DNA was extracted and ferredoxin gene was amplified by PCR technique. The ferredoxin gene PCR products were sequenced to determine gene mutations.Results: In four isolates (8.69% point mutation at nucleotide position -239 (the translation start codon of the ferredoxin gene were detected in which adenosine were converted to thymine.Conclusion: Mutation at nucleotide -239 ferredoxin gene reduces translational regulatory protein’s binding affinity which concludes reduction of ferredoxin expression. For this reduction, decrease in activity and decrease in metronidazole drug delivery into the cells occur. Mutations in these four isolates may lead to resistance of them to metronidazole.

  12. Mutational analysis of the HGO gene in Finnish alkaptonuria patients

    Science.gov (United States)

    de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

    1999-01-01

    Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

  13. Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

    Directory of Open Access Journals (Sweden)

    Fernanda Veronese Oliveira

    2014-01-01

    Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

  14. Glucokinase gene mutations (MODY 2) in Asian Indians.

    Science.gov (United States)

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  15. Diverse growth hormone receptor gene mutations in Laron syndrome.

    Science.gov (United States)

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  16. Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...

    African Journals Online (AJOL)

    It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...

  17. Functional features of gene expression profiles differentiating gastrointestinal stromal tumours according to KIT mutations and expression

    International Nuclear Information System (INIS)

    Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I

    2009-01-01

    Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status

  18. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  19. High incidence of GJB2 gene mutations among assortatively mating ...

    Indian Academy of Sciences (India)

    High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra, Justin Margret Jeffrey, Jayasankaran Chandru, Arabandi Ramesh and C. R. Srikumari Srisailapathy. J. Genet. 93, 207–213. Table 1. Consolidated table of GJB2 mutation status ...

  20. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  1. Phenotypic Involvement in Females with the FMR1 Gene Mutation.

    Science.gov (United States)

    Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.

    1998-01-01

    A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)

  2. Nonsense mutations in the human β-globin gene affect mRNA metabolism

    International Nuclear Information System (INIS)

    Baserga, S.J.; Benz, E.J. Jr.

    1988-01-01

    A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

  3. Three novel and two known androgen receptor gene mutations ...

    Indian Academy of Sciences (India)

    with androgen insensitivity syndrome in sex-reversed XY female patients. BALACHANDRAN .... Three novel AR gene mutations associated with AIS in XY sex-reversed females. Ta b le. 1 . ( contd. ) ..... disease, 1st edition. Springer Science + ...

  4. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    Science.gov (United States)

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  5. Consequences of Marfan mutations to expression of fibrillin gene and to the structure of microfibrils

    Energy Technology Data Exchange (ETDEWEB)

    Peltonen, L.; Karttunen, L.; Rantamaeki, T. [NPHI, Helsinki (Finland)] [and others

    1994-09-01

    Marfan syndrome (MFS) is a dominantly inherited connective tissue disorder which is caused by mutations in the fibrillin-1 gene (FBN1). Over 40 family-specific FBN1 mutations have been identified. We have characterized 18 different heterozygous mutations including amino acid substitutions, premature stop, and splicing defects leading to deletions or one insertion, and one compound heterozygote with two differently mutated FBN1 alleles inherited from his affected parents. To unravel the consequences of FBN1 mutations to the transcription of FBN1 gene, we have measured the steady state levels of mRNA transcribed from the normal and mutated alleles. The missense mutations do not affect the transcription of the allele while the nonsense mutation leads to lower steady state amount of mutated allele. For the dissection of molecular pathogenesis of FBN1 mutations we have performed rotary shadowing of the microfibrils produced by the cell cultures from MFS patients. The cells from the neonatal patients with established mutations produced only disorganized fibrillin aggregates but no clearly defined microfibrils could be detected, suggesting a major role of this gene region coding for exons 24-26 in stabilization and organization of the bead structure of microfibrils. From the cells of a rare compound heterozygote case carrying two different mutations, no detectable microfibrils could be detected whereas the cells of his parents with heterozygous mutations were able to form identifiable but disorganized microfibrils. In the cells of an MFS case caused by a premature stop removing the C-terminus of fibrillin, the microfibril assembly takes place but the appropriate packing of the microfibrils is disturbed suggesting that C-terminae are actually located within the interbead domain of the microfibrils.

  6. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  7. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  8. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  9. [FANCA gene mutation analysis in Fanconi anemia patients].

    Science.gov (United States)

    Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

    2005-10-01

    To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

  10. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Science.gov (United States)

    2010-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

  11. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  12. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  13. Mutation analysis of the preproghrelin gene

    DEFF Research Database (Denmark)

    Larsen, Lesli H; Gjesing, Anette P; Sørensen, Thorkild I A

    2005-01-01

    To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes.......To investigate the preproghrelin gene for variants and their association with obesity and type 2 diabetes....

  14. Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

    Science.gov (United States)

    Nakazawa, M; Wada, Y; Tamai, M

    1998-04-01

    To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

  15. Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

    Science.gov (United States)

    D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

    2011-01-01

    The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

  16. A novel mutation of the fibrillin gene causing Ectopia lentis

    Energy Technology Data Exchange (ETDEWEB)

    Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

    1994-02-01

    Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

  17. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    Science.gov (United States)

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  18. A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy.

    Directory of Open Access Journals (Sweden)

    Houman Ashrafian

    2010-06-01

    Full Text Available Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM. However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease.

  19. Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

    Science.gov (United States)

    Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

    2012-01-01

    The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

  20. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  1. Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

    Science.gov (United States)

    Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

    2015-08-26

    Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

  2. Clinical impact of recurrently mutated genes on lymphoma diagnostics: state-of-the-art and beyond.

    Science.gov (United States)

    Rosenquist, Richard; Rosenwald, Andreas; Du, Ming-Qing; Gaidano, Gianluca; Groenen, Patricia; Wotherspoon, Andrew; Ghia, Paolo; Gaulard, Philippe; Campo, Elias; Stamatopoulos, Kostas

    2016-09-01

    Similar to the inherent clinical heterogeneity of most, if not all, lymphoma entities, the genetic landscape of these tumors is markedly complex in the majority of cases, with a rapidly growing list of recurrently mutated genes discovered in recent years by next-generation sequencing technology. Whilst a few genes have been implied to have diagnostic, prognostic and even predictive impact, most gene mutations still require rigorous validation in larger, preferably prospective patient series, to scrutinize their potential role in lymphoma diagnostics and patient management. In selected entities, a predominantly mutated gene is identified in almost all cases (e.g. Waldenström's macroglobulinemia/lymphoplasmacytic lymphoma and hairy-cell leukemia), while for the vast majority of lymphomas a quite diverse mutation pattern is observed, with a limited number of frequently mutated genes followed by a seemingly endless tail of genes with mutations at a low frequency. Herein, the European Expert Group on NGS-based Diagnostics in Lymphomas (EGNL) summarizes the current status of this ever-evolving field, and, based on the present evidence level, segregates mutations into the following categories: i) immediate impact on treatment decisions, ii) diagnostic impact, iii) prognostic impact, iv) potential clinical impact in the near future, or v) should only be considered for research purposes. In the coming years, coordinated efforts aiming to apply targeted next-generation sequencing in large patient series will be needed in order to elucidate if a particular gene mutation will have an immediate impact on the lymphoma classification, and ultimately aid clinical decision making. Copyright© Ferrata Storti Foundation.

  3. Novel growth hormone receptor gene mutation in a patient with Laron syndrome.

    Science.gov (United States)

    Arman, Ahmet; Yüksel, Bilgin; Coker, Ajda; Sarioz, Ozlem; Temiz, Fatih; Topaloglu, Ali Kemal

    2010-04-01

    Growth Hormone (GH) is a 22 kDa protein that has effects on growth and glucose and fat metabolisms. These effects are initiated by binding of growth hormone (GH) to growth hormone receptors (GHR) expressed in target cells. Mutations or deletions in the growth hormone receptor cause an autosomal disorder called Laron-type dwarfism (LS) characterized by high circulating levels of serum GH and low levels of insulin like growth factor-1 (IGF-1). We analyzed the GHR gene for genetic defect in seven patients identified as Laron type dwarfism. We identified two missense mutations (S40L and W104R), and four polymorphisms (S473S, L526I, G168G and exon 3 deletion). We are reporting a mutation (W104R) at exon 5 of GHR gene that is not previously reported, and it is a novel mutation.

  4. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  5. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    Science.gov (United States)

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  6. GPR143 gene mutation analysis in pediatric patients with albinism.

    Science.gov (United States)

    Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

    2012-09-01

    X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

  7. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    Science.gov (United States)

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  8. Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

    Directory of Open Access Journals (Sweden)

    Quan Li

    Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

  9. TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    T. W. Hoffman

    2016-01-01

    Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

  10. Law-medicine interfacing: patenting of human genes and mutations.

    Science.gov (United States)

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  11. Update of the androgen receptor gene mutations database.

    Science.gov (United States)

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  12. HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

    Science.gov (United States)

    Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

    2017-07-01

    Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

  13. Glaucoma and Cytochrome P4501B1 Gene Mutations

    Directory of Open Access Journals (Sweden)

    Mukesh Tanwar

    2010-01-01

    Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

  14. Major gene mutations in fruit tree domestication

    International Nuclear Information System (INIS)

    Spiegel-Roy, P.

    1989-01-01

    Though fruit gathering from the wild began long before domestication, fruit tree domestication started only after the establishment of grain agriculture. Banana, fig, date, grape and olive were among the first fruit trees domesticated. Most fruit trees are outbreeders, highly heterozygous and vegetatively propagated. Knowledge of genetics and economic traits controlled by major genes is limited. Ease of vegetative propagation has played a prominent part in domestication; advances in propagation technology will play a role in domestication of new crops. Changes toward domestication affected by major genes include self-fertility in peach, apricot and sour cherry, while the emergence of self-fertile almond populations is more recent and due probably to introgression from Amygdalus webbii. Self-compatibility in the sweet cherry has been attained only by pollen irradiation. A single gene controls sex in Vitis. Wild grapes are dioecious, with most domesticated cultivars hermaphrodite, and only a few females. In the papaya changes from dioecism to hermaphroditism have also occurred. Self-compatible systems have also been selected during domestication in Rubus. Changes towards parthenocarpy and seedlessness during domestication occurred in the banana, citrus, grape, fig and pineapple. In the banana, parthenocarpy is due to three complementary dominant genes; stenospermocarpy in the grape depends on two complementary recessive genes; parthenocarpy and sterility in citrus seems more complicated; however, it can be induced in genetic material of suitable background with ease by irradiation. Presence of persistent syconia in the fig is controlled by a mutant allele P dominant to wild +. Thornlessness in blackberry is recessive, while in the pineapple spineless forms are dominant. Changes affecting fruit composition owing to major genes include the disappearance of amygdalin present in bitter almonds (bitter kernel recessive to sweet), shell hardness in almond, and a recessive

  15. Common filaggrin gene mutations and risk of cervical cancer

    DEFF Research Database (Denmark)

    Bager, Peter; Wohlfahrt, Jan; Sørensen, Erik

    2015-01-01

    BACKGROUND: As carriers of filaggrin gene (FLG) mutations may have a compromised cervical mucosal barrier against human papillomavirus infection, our primary objective was to study their risk of cervical cancer. METHODS: We genotyped 586 cervical cancer patients for the two most common FLG...... mutations, R501X and 2282del4, using blood from the Copenhagen Hospital Biobank, Denmark. Controls (n = 8050) were genotyped in previous population-based studies. Information on cervical cancer, mortality and emigration were obtained from national registers. Odds ratios (OR) were estimated by logistic...... and stratification by cancer stage. RESULTS: The primary results showed that FLG mutations were not associated with the risk of cervical cancer (6.3% of cases and 7.7% of controls were carriers; OR adjusted 0.81, 95% CI 0.57-1.14; OR adjusted+ weighted 0.96, 95% CI 0.58-1.57). Among cases, FLG mutations increased...

  16. Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers

    NARCIS (Netherlands)

    L.H.H. Meeter (Lieke H.H.); Patzke, H. (Holger); Loewen, G. (Gordon); E.G.P. Dopper (Elise); Y. Pijnenburg (Yolande); A.S. Thornton (Andrew); J.C. van Swieten (John)

    2016-01-01

    textabstractBackground: Pathogenic mutations in the granulin gene (GRN) are causative in 5-10% of patients with frontotemporal dementia (FTD), mostly leading to reduced progranulin protein (PGRN) levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN

  17. MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

    Directory of Open Access Journals (Sweden)

    D. S. Mikhaylenko

    2016-01-01

    Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

  18. Identification of Constrained Cancer Driver Genes Based on Mutation Timing

    Science.gov (United States)

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

  19. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  20. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Hofstra, Robert M. W.

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive

  1. Olaparib Approved for Breast Cancers with BRCA Gene Mutations

    Science.gov (United States)

    The Food and Drug Administration has approved olaparib (Lynparza®) to treat metastatic breast cancers that have inherited mutations in the BRCA1 or BRCA2 genes as well as a companion diagnostic test for selecting candidates for the therapy.

  2. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Dörfler, Arnd; Kinning, Esther; Megarbane, André; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Dörr, Helmuth-Günther; Reis, André

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism

  3. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Doerfler, Arnd; Kinning, Esther; Megarbane, Andre; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Doerr, Helmuth-Guenther; Reis, Andre

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss- of- function mutations in the centrosomal pericentrin ( PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial

  4. Mutations in the AXIN1 gene in advanced prostate cancer

    DEFF Research Database (Denmark)

    Yardy, George W; Bicknell, David C; Wilding, Jennifer L

    2009-01-01

    The Wnt signalling pathway directs aspects of embryogenesis and is thought to contribute to maintenance of certain stem cell populations. Disruption of the pathway has been observed in many different tumour types. In bowel, stomach, and endometrial cancer, this is usually due to mutation of genes...

  5. Two novel mutations in ILDR1 gene cause autosomal recessive ...

    Indian Academy of Sciences (India)

    In a recent screening programme on hearing loss (HL), we examined 17 common autosomal recessive nonsyndromic hearing loss (ARNSHL) genes in every consanguineous Ira- nian family with ARNSHL that was referred to our centre. We first screened GJB2 mutations and then utilized a panel of three to four short ...

  6. Hypocaeruloplasminaemia with heteroallelic caeruloplasmin gene mutation: MRI of the brain

    International Nuclear Information System (INIS)

    Daimon, M.; Moriai, S.; Susa, S.; Yamatani, K.; Kato, T.; Hosoya, T.

    1999-01-01

    We present two patients with hypocaeruloplasminaemia and a heteroallelic caeruloplasmin gene mutation (HypoCPGM). These patients had diabetes mellitus and tremor of the hands, respectively. T2-weighted fast spin-echo MRI showed mildly reduced intensity of the putamen, much more marked on echo-planar imaging. (orig.) (orig.)

  7. Mutational landscape of the human Y chromosome-linked genes ...

    Indian Academy of Sciences (India)

    Mutational landscape of the human Y chromosome-linked genes and loci in patients with hypogonadism. Deepali Pathak, Sandeep Kumar Yadav, Leena Rawal and Sher Ali. J. Genet. 94, 677–687. Table 1. Details showing age, sex, karyotype, clinical features and diagnosis results of the patients with H. Hormone profile.

  8. Advances in sarcoma gene mutations and therapeutic targets.

    Science.gov (United States)

    Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

    2018-01-01

    Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

  9. Specific gene mutations induced by heavy ions

    International Nuclear Information System (INIS)

    Freeling, M.; Karoly, C.W.; Cheng, D.S.K.

    1980-01-01

    This report summarizes our heavy-ion research rationale, progress, and plans for the near future. The major project involves selecting a group of maize Adh1 mutants induced by heavy ions and correlating their altered behavior with altered DNA nucleotide sequences and sequence arrangements. This research requires merging the techniques of classical genetics and recombinant DNA technology. Our secondary projects involve (1) the use of the Adh gene in the fruit fly, Drosophila melanogaster, as a second system with which to quantify the sort of specific gene mutants induced by heavy ions as compared to x rays, and (2) the development of a maize Adh1 pollen in situ monitor for environmental mutagens

  10. Mapping of gene mutations in drosophila melanogaster

    OpenAIRE

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  11. Geographical distribution of β-globin gene mutations in Syria.

    Science.gov (United States)

    Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

    2018-04-11

    Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

  12. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  13. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  14. Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

    NARCIS (Netherlands)

    Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

    2001-01-01

    Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

  15. Induced marker gene mutations in soybean

    International Nuclear Information System (INIS)

    Sawada, S.; Palmer, R.G.

    1989-01-01

    Full text: Non-fluorescent root mutants in soybean are useful as markers in genetic studies. 13 such mutants were detected among more than 150 000 seedlings derived from soybean lines treated with 6 mutagens. One of them, derived from variety 'Williams' treated with 20 kR gamma rays, did not correspond to the already known spontaneous non-fluorescent mutants. It was assigned the identification no. T285 and the gene symbol fr5. The other mutants corresponded with known loci fr1, fr2 or fr4. (author)

  16. The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

    OpenAIRE

    Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

    2014-01-01

    As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

  17. FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Rene L. Begay, BS

    2016-08-01

    Full Text Available A genetic etiology has been identified in 30% to 40% of dilated cardiomyopathy (DCM patients, yet only 50% of these cases are associated with a known causative gene variant. Thus, in order to understand the pathophysiology of DCM, it is necessary to identify and characterize additional genes. In this study, whole exome sequencing in combination with segregation analysis was used to identify mutations in a novel gene, filamin C (FLNC, resulting in a cardiac-restricted DCM pathology. Here we provide functional data via zebrafish studies and protein analysis to support a model implicating FLNC haploinsufficiency as a mechanism of DCM.

  18. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    Science.gov (United States)

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  19. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    Science.gov (United States)

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  20. Glucokinase gene mutations: structural and genotype-phenotype analyses in MODY children from South Italy.

    Directory of Open Access Journals (Sweden)

    Nadia Tinto

    Full Text Available BACKGROUND: Maturity onset diabetes of the young type 2 (or GCK MODY is a genetic form of diabetes mellitus provoked by mutations in the glucokinase gene (GCK. METHODOLOGY/PRINCIPAL FINDINGS: We screened the GCK gene by direct sequencing in 30 patients from South Italy with suspected MODY. The mutation-induced structural alterations in the protein were analyzed by molecular modeling. The patients' biochemical, clinical and anamnestic data were obtained. Mutations were detected in 16/30 patients (53%; 9 of the 12 mutations identified were novel (p.Glu70Asp, p.Phe123Leu, p.Asp132Asn, p.His137Asp, p.Gly162Asp, p.Thr168Ala, p.Arg392Ser, p.Glu290X, p.Gln106_Met107delinsLeu and are in regions involved in structural rearrangements required for catalysis. The prevalence of mutation sites was higher in the small domain (7/12: approximately 59% than in the large (4/12: 33% domain or in the connection (1/12: 8% region of the protein. Mild diabetic phenotypes were detected in almost all patients [mean (SD OGTT = 7.8 mMol/L (1.8] and mean triglyceride levels were lower in mutated than in unmutated GCK patients (p = 0.04. CONCLUSIONS: The prevalence of GCK MODY is high in southern Italy, and the GCK small domain is a hot spot for MODY mutations. Both the severity of the GCK mutation and the genetic background seem to play a relevant role in the GCK MODY phenotype. Indeed, a partial genotype-phenotype correlation was identified in related patients (3 pairs of siblings but not in two unrelated children bearing the same mutation. Thus, the molecular approach allows the physician to confirm the diagnosis and to predict severity of the mutation.

  1. Non-functional genes repaired at the RNA level.

    Science.gov (United States)

    Burger, Gertraud

    2016-01-01

    Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  2. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

    Science.gov (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

    2012-06-26

    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  3. Detecting negative selection on recurrent mutations using gene genealogy

    Science.gov (United States)

    2013-01-01

    Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

  4. Endocrine metabolic disorders in patients with breast cancer, carriers of BRCA1 gene mutations.

    Science.gov (United States)

    Berstein, L M; Boyarkina, M P; Vasilyev, D A; Poroshina, T E; Kovalenko, I G; Imyanitov, E N; Semiglazov, V F

    2012-03-01

    Two groups of breast cancer patients (53±2 years) in clinical remission receiving no specific therapy were examined: group 1, with BRCA1 gene mutations (N=11) and group 2, without mutations of this kind (N=11). The two groups did not differ by insulinemia and glycemia, insulin resistance index, blood levels of thyrotropic hormone, sex hormone-binding globulin, insulin-like growth factor-1, triglycerides, or lipoproteins. In group 1, blood estradiol level was higher. Intensive glucose-induced generation of reactive oxygen species in these patients was associated with a decrease of cholesterolemia, of the C-peptide/insulin proportion, and a trend to higher urinary excretion of 4-hydroxyestrone, one of the most genotoxic catecholestrogens. BRCA1 gene mutations in breast cancer patients were associated with signs of estrogenization and a pro-genotoxic shift in the estrogen and glucose system, which could modulate the disease course and requires correction.

  5. Relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms

    Directory of Open Access Journals (Sweden)

    Xiao-Nan Zhang

    2017-05-01

    Full Text Available Objective: To study the relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms. Methods: Patients who were diagnosed with BCR-ABL-negative myeloproliferative neoplasms in Anyang District Hospital between June 2014 and August 2016 were selected, JAK2V617F gene mutation was detected, and according to the test results, the patients were divided into mutation-positive group and mutation-negative group. The expression of JAK2/STATs signaling pathway molecules and cell proliferation genes in bone marrow fluid as well as the coagulation function indexes in peripheral blood were detected. Results: p-JAK2, p-STAT3, p-STAT5, Survivin, C-myc, CyclinD1 and ASXL1 protein expression in myeloproliferative neoplasms of mutation-positive group were significantly higher than those of mutation-negative group, and peripheral blood PT and APTT levels were significantly lower than those of mutation-negative group while TT and FIB levels were not significantly different from those of mutation-negative group. Conclusion: JAK2V617F gene mutation in myeloproliferative neoplasms can promote the cell proliferation and cause the hypercoagulable state.

  6. Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

    Directory of Open Access Journals (Sweden)

    Jian Wang

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

  7. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  8. Leu452His mutation in lipoprotein lipase gene transfer associated with hypertriglyceridemia in mice in vivo.

    Directory of Open Access Journals (Sweden)

    Kaiyue Sun

    Full Text Available Mutated mouse lipoprotein lipase (LPL containing a leucine (L to histidine (H substitution at position 452 was transferred into mouse liver by hydrodynamics-based gene delivery (HD. Mutated-LPL (MLPL gene transfer significantly increased the concentrations of plasma MLPL and triglyceride (TG but significantly decreased the activity of plasma LPL. Moreover, the gene transfer caused adiposis hepatica and significantly increased TG content in mouse liver. To understand the effects of MLPL gene transfer on energy metabolism, we investigated the expression of key functional genes related to energy metabolism in the liver, epididymal fat, and leg muscles. The mRNA contents of hormone-sensitive lipase (HSL, adipose triglyceride lipase (ATGL, fatty acid-binding protein (FABP, and uncoupling protein (UCP were found to be significantly reduced. Furthermore, we investigated the mechanism by which MLPL gene transfer affected fat deposition in the liver, fat tissue, and muscle. The gene expression and protein levels of forkhead Box O3 (FOXO3, AMP-activated protein kinase (AMPK, and peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α were found to be remarkably decreased in the liver, fat and muscle. These results suggest that the Leu452His mutation caused LPL dysfunction and gene transfer of MLPL in vivo produced resistance to the AMPK/PGC-1α signaling pathway in mice.

  9. Mu Opioid Receptor Gene: New Point Mutations in Opioid Addicts

    Directory of Open Access Journals (Sweden)

    Amin Dinarvand

    2014-02-01

    Full Text Available Introduction: Association between single-nucleotide polymorphisms (SNPs in mu opioid receptor gene and drug addiction has been shown in various studies. Here, we have evaluated the existence of polymorphisms in exon 3 of this gene in Iranian population and investigated the possible association between these mutations and opioid addiction.  Methods: 79 opioid-dependent subjects (55 males, 24 females and 134 non-addict or control individuals (74 males, 60 females participated in the study. Genomic DNA was extracted from volunteers’ peripheral blood and exon 3 of the mu opioid receptor gene was amplified by polymerase chain reaction (PCR whose products were then sequenced.  Results: Three different heterozygote polymorphisms were observed in 3 male individuals: 759T>C and 877G>A mutations were found in 2 control volunteers and 1043G>C substitution was observed in an opioid-addicted subject. Association between genotype and opioid addiction for each mutation was not statistically significant.  Discussion: It seems that the sample size used in our study is not enough to confirm or reject any association between 759T>C, 877G>A and 1043G>C substitutions in exon 3 of the mu opioid receptor gene and opioid addiction susceptibility in Iranian population.

  10. Mapping the fitness landscape of gene expression uncovers the cause of antagonism and sign epistasis between adaptive mutations.

    Directory of Open Access Journals (Sweden)

    Hsin-Hung Chou

    2014-02-01

    Full Text Available How do adapting populations navigate the tensions between the costs of gene expression and the benefits of gene products to optimize the levels of many genes at once? Here we combined independently-arising beneficial mutations that altered enzyme levels in the central metabolism of Methylobacterium extorquens to uncover the fitness landscape defined by gene expression levels. We found strong antagonism and sign epistasis between these beneficial mutations. Mutations with the largest individual benefit interacted the most antagonistically with other mutations, a trend we also uncovered through analyses of datasets from other model systems. However, these beneficial mutations interacted multiplicatively (i.e., no epistasis at the level of enzyme expression. By generating a model that predicts fitness from enzyme levels we could explain the observed sign epistasis as a result of overshooting the optimum defined by a balance between enzyme catalysis benefits and fitness costs. Knowledge of the phenotypic landscape also illuminated that, although the fitness peak was phenotypically far from the ancestral state, it was not genetically distant. Single beneficial mutations jumped straight toward the global optimum rather than being constrained to change the expression phenotypes in the correlated fashion expected by the genetic architecture. Given that adaptation in nature often results from optimizing gene expression, these conclusions can be widely applicable to other organisms and selective conditions. Poor interactions between individually beneficial alleles affecting gene expression may thus compromise the benefit of sex during adaptation and promote genetic differentiation.

  11. HFE gene: Structure, function, mutations, and associated iron abnormalities.

    Science.gov (United States)

    Barton, James C; Edwards, Corwin Q; Acton, Ronald T

    2015-12-15

    The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Science.gov (United States)

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  13. Indian hedgehog mutations causing brachydactyly type A1 impair Hedgehog signal transduction at multiple levels

    Science.gov (United States)

    Ma, Gang; Yu, Jiang; Xiao, Yue; Chan, Danny; Gao, Bo; Hu, Jianxin; He, Yongxing; Guo, Shengzhen; Zhou, Jian; Zhang, Lingling; Gao, Linghan; Zhang, Wenjuan; Kang, Yan; Cheah, Kathryn SE; Feng, Guoyin; Guo, Xizhi; Wang, Yujiong; Zhou, Cong-zhao; He, Lin

    2011-01-01

    Brachydactyly type A1 (BDA1), the first recorded Mendelian autosomal dominant disorder in humans, is characterized by a shortening or absence of the middle phalanges. Heterozygous missense mutations in the Indian Hedgehog (IHH) gene have been identified as a cause of BDA1; however, the biochemical consequences of these mutations are unclear. In this paper, we analyzed three BDA1 mutations (E95K, D100E, and E131K) in the N-terminal fragment of Indian Hedgehog (IhhN). Structural analysis showed that the E95K mutation changes a negatively charged area to a positively charged area in a calcium-binding groove, and that the D100E mutation changes the local tertiary structure. Furthermore, we showed that the E95K and D100E mutations led to a temperature-sensitive and calcium-dependent instability of IhhN, which might contribute to an enhanced intracellular degradation of the mutant proteins via the lysosome. Notably, all three mutations affected Hh binding to the receptor Patched1 (PTC1), reducing its capacity to induce cellular differentiation. We propose that these are common features of the mutations that cause BDA1, affecting the Hh tertiary structure, intracellular fate, binding to the receptor/partners, and binding to extracellular components. The combination of these features alters signaling capacity and range, but the impact is likely to be variable and mutation-dependent. The potential variation in the signaling range is characterized by an enhanced interaction with heparan sulfate for IHH with the E95K mutation, but not the E131K mutation. Taken together, our results suggest that these IHH mutations affect Hh signaling at multiple levels, causing abnormal bone development and abnormal digit formation. PMID:21537345

  14. Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

    International Nuclear Information System (INIS)

    Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

    2015-01-01

    Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

  15. Molecular screening of pituitary adenomas for gene mutations and rearrangements

    Energy Technology Data Exchange (ETDEWEB)

    Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

    1993-07-01

    Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

  16. Biochemical Diagnosis of Common Gene Mutations in Galactosemia

    Directory of Open Access Journals (Sweden)

    Farzaneh Mirzajani

    2005-04-01

    Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.

  17. Congenital Hypopituitarism due to POU1F1 Gene Mutation

    Directory of Open Access Journals (Sweden)

    Ni-Chung Lee

    2011-01-01

    Full Text Available POU1F1 (Pit-1; Gene ID 5449 is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome, elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S mutation. The rarity of the disease can result in delayed diagnosis and treatment.

  18. Congenital hypopituitarism due to POU1F1 gene mutation.

    Science.gov (United States)

    Lee, Ni-Chung; Tsai, Wen-Yu; Peng, Shinn-Forng; Tung, Yi-Ching; Chien, Yin-Hsiu; Hwu, Wuh-Liang

    2011-01-01

    POU1F1 (Pit-1; Gene ID 5449) is an anterior pituitary transcriptional factor, and POU1F1 mutation is known to cause anterior pituitary hypoplasia, growth hormone and prolactin deficiency and various degree of hypothyroidism. We report here a patient who presented with growth failure and central hypothyroidism since early infancy. However, treatment with thyroxine gave no effect and he subsequently developed calf muscle pseudohypertrophy (Kocher-Debre-Semelaigne syndrome), elevation of creatinine kinase, dilated cardiomyopathy and pericardial effusion. Final diagnosis was made by combined pituitary function test and sequencing analysis that revealed POU1F1 gene C.698T > C (p.F233S) mutation. The rarity of the disease can result in delayed diagnosis and treatment. Copyright © 2011 Formosan Medical Association & Elsevier. Published by Elsevier B.V. All rights reserved.

  19. Genetic influence of radiation measured by the effect on the mutation rate of human minisatellite genes

    International Nuclear Information System (INIS)

    Kodaira, Mieko

    2002-01-01

    Human minisatellite genes are composed from 0.1-30 kb with a high frequency of polymorphism. The genes exist in mammalian genomes and mice's ones are well studied after irradiation of their gonad cells by X-ray and γ-ray. Following five reports concerning the significant and/or insignificant increases of the mutation rate of the genes post A-bomb exposure, Chernobyl accident and nuclear weapons test in Semipalatinsk are reviewed and discussed on the subject number, exposed dose, problems of the control group, regions examined of loci and exposure conditions. Genetic influences of radiation examined by the author's facility are not recognized in the mutation rate (3.21% vs 4.94% in the control) of minisatellite genes in children of A-bomb survivors and their parents. The mutation rates are 4.27 vs 2.52% (positive influence) and 4.2-6.01% vs 3.5-6.34% in Chernobyl, and 4.3 (parents) and 3.8% (F 1 ) vs 2.5% (positive). Mutation of human minisatellite genes can be an important measure of genetic influences at the medical level. (K.H.)

  20. Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

    Directory of Open Access Journals (Sweden)

    Dinić Jelena

    2007-01-01

    Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

  1. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Directory of Open Access Journals (Sweden)

    Guilhem Lignon

    2017-05-01

    Full Text Available Background and objective:FAM20A gene mutations result in enamel renal syndrome (ERS associated with amelogenesis imperfecta (AI, nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects.Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM, Energy Dispersive Spectroscopy (EDS, X-Ray Diffraction (XRD, and X-Ray Fluorescence (XRF.Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel. XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin.Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  2. FAM20A Gene Mutation: Amelogenesis or Ectopic Mineralization?

    Science.gov (United States)

    Lignon, Guilhem; Beres, Fleur; Quentric, Mickael; Rouzière, Stephan; Weil, Raphael; De La Dure-Molla, Muriel; Naveau, Adrien; Kozyraki, Renata; Dessombz, Arnaud; Berdal, Ariane

    2017-01-01

    Background and objective: FAM20A gene mutations result in enamel renal syndrome (ERS) associated with amelogenesis imperfecta (AI), nephrocalcinosis, gingival fibromatosis, and impaired tooth eruption. FAM20A would control the phosphorylation of enamel peptides and thus enamel mineralization. Here, we characterized the structure and chemical composition of unerupted tooth enamel from ERS patients and healthy subjects. Methods: Tooth sections were analyzed by Scanning Electron Microscopy (SEM), Energy Dispersive Spectroscopy (EDS), X-Ray Diffraction (XRD), and X-Ray Fluorescence (XRF). Results: SEM revealed that prisms were restricted to the inner-most enamel zones. The bulk of the mineralized matter covering the crown was formed by layers with varying electron-densities organized into lamellae and micronodules. Tissue porosity progressively increased at the periphery, ending with loose and unfused nanonodules also observed in the adjoining soft tissues. Thus, the enamel layer covering the dentin in all ERS patients (except a limited layer of enamel at the dentino-enamel junction) displayed an ultrastructural globular pattern similar to one observed in ectopic mineralization of soft tissue, notably in the gingiva of Fam20a knockout mice. XRD analysis confirmed the existence of alterations in crystallinity and composition (vs. sound enamel). XRF identified lower levels of calcium and phosphorus in ERS enamel. Finally, EDS confirmed the reduced amount of calcium in ERS enamel, which appeared similar to dentin. Conclusion: This study suggests that, after an initial normal start to amelogenesis, the bulk of the tissue covering coronal dentin would be formed by different mechanisms based on nano- to micro-nodule aggregation. This evocated ectopic mineralization process is known to intervene in several soft tissues in FAM20A gene mutant.

  3. High Mutation Levels are Compatible with Normal Embryonic Development in Mlh1-Deficient Mice.

    Science.gov (United States)

    Fan, Xiaoyan; Li, Yan; Zhang, Yulong; Sang, Meixiang; Cai, Jianhui; Li, Qiaoxia; Ozaki, Toshinori; Ono, Tetsuya; He, Dongwei

    2016-10-01

    To elucidate the role of the mismatch repair gene Mlh1 in genome instability during the fetal stage, spontaneous mutations were studied in Mlh1-deficient lacZ-transgenic mouse fetuses. Mutation levels were high at 9.5 days post coitum (dpc) and gradually increased during the embryonic stage, after which they remained unchanged. In addition, mutations that were found in brain, liver, spleen, small intestine and thymus showed similar levels and no statistically significant difference was found. The molecular nature of mutations at 12.5 dpc in fetuses of Mlh1 +/+ and Mlh1 -/- mice showed their own unique spectra, suggesting that deletion mutations were the main causes in the deficiency of the Mlh1 gene. Of note, fetuses of irradiated mice exhibited marked differences such as post-implantation loss and Mendelian distribution. Collectively, these results strongly suggest that high mutation ofMlh1 -/- -deficient fetuses has little effect on the fetuses during their early developmental stages, whereas Mlh1 -/- -deficient fetuses from X-ray irradiated mothers are clearly effected.

  4. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  5. Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

    International Nuclear Information System (INIS)

    Romeo, G.; Hassan, H.J.; Staempfli, S.

    1987-01-01

    The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

  6. Sarcomeric gene mutations in sudden infant death syndrome (SIDS).

    Science.gov (United States)

    Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel

    2012-06-10

    In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. HFE gene mutations and iron status of Brazilian blood donors.

    Science.gov (United States)

    Santos, P C J L; Cançado, R D; Terada, C T; Rostelato, S; Gonzales, I; Hirata, R D C; Hirata, M H; Chiattone, C S; Guerra-Shinohara, E M

    2010-01-01

    Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542) were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC) than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018) and a 83.65% decrease (P = 0.007) in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001) and the HFE 63HD plus DD genotype (55.84%, P = 0.021). In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  8. HFE gene mutations and iron status of Brazilian blood donors

    Directory of Open Access Journals (Sweden)

    P.C.J.L. Santos

    2010-01-01

    Full Text Available Mutations of the HFE and TFR2 genes have been associated with iron overload. HFE and TFR2 mutations were assessed in blood donors, and the relationship with iron status was evaluated. Subjects (N = 542 were recruited at the Hemocentro da Santa Casa de São Paulo, São Paulo, Brazil. Iron status was not influenced by HFE mutations in women and was independent of blood donation frequency. In contrast, men carrying the HFE 282CY genotype had lower total iron-binding capacity (TIBC than HFE 282CC genotype carriers. Men who donated blood for the first time and were carriers of the HFE 282CY genotype had higher transferrin saturation values and lower TIBC concentrations than those with the homozygous wild genotype for the HFE C282Y mutation. Moreover, in this group of blood donors, carriers of HFE 63DD plus 63HD genotypes had higher serum ferritin values than those with the homozygous wild genotype for HFE H63D mutation. Multiple linear regression analysis showed that HFE 282CY leads to a 17.21% increase (P = 0.018 and a 83.65% decrease (P = 0.007 in transferrin saturation and TIBC, respectively. In addition, serum ferritin is influenced by age (3.91%, P = 0.001 and the HFE 63HD plus DD genotype (55.84%, P = 0.021. In conclusion, the HFE 282Y and 65C alleles were rare, while the HFE 63D allele was frequent in Brazilian blood donors. The HFE C282Y and H63D mutations were associated with alterations in iron status in blood donors in a gender-dependent manner.

  9. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    Science.gov (United States)

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Functioning Mediastinal Paraganglioma Associated with a Germline Mutation of von Hippel-Lindau Gene

    Directory of Open Access Journals (Sweden)

    Thibault Bahougne

    2018-05-01

    Full Text Available We report the case of a 21-year old woman presenting with high blood pressure and raised normetanephrine levels. Indium-111-pentetreotide single photon-emission computed tomography with computed tomography (SPECT/CT and 2-deoxy-2-[fluorine-18]fluoro-d-glucose (FDG positron emission tomography/computed tomography (PET/CT imaging showing isolated tracer-uptake by a 2 cm tumor close to the costovertebral angle of the third thoracic vertebra. Thoracic surgery led to normalization of normetanephrine levels. Histological findings were consistent with the presence of a paraganglioma. Mutations in SDHA, SDHB, SDHC, SDHD, RET, SDHAF2, TMEM127, MAX, NF1, FH, MDH2, and EPAS1 were absent, but a heterozygous missense mutation, c.311G > T, was found in exon 1 of the von Hippel-Lindau gene, VHL, resulting in a glycine to valine substitution in the VHL protein at position 104, p.Gly104Val. This same mutation was found in both the mother and the 17-year old sister in whom a small retinal hemangioblastoma was also found. We diagnose an unusual functional mediastinal paraganglioma in this young patient with a germline VHL gene mutation, a mutation previously described as inducing polycythemia and/or pheochromocytoma but not paraganglioma or retinal hemangioblastoma.

  11. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  12. Clinical significance of FLG gene mutations in children with atopic dermatitis

    Directory of Open Access Journals (Sweden)

    E. E. Varlamov

    2015-01-01

    Full Text Available Skin barrier dysfunction due to deficiency of the skin protein filaggrin is one of the factors involved in the pathogenesis of atopic dermatitis. Objective: to determine the clinical significance of 2282 del CAGT, R501X, R2447X, and S3247X mutations in the FLG gene in children with atopic dermatitis. The investigation included 58 children with atopic dermatitis. A molecular genetic analysis of the four mutations in the FLG gene was done in all the children. In the patients with FLG gene mutations, there was a tendency towards a higher frequency of sensitization to house dust allergens, significantly more often sensitization to cat epidermal allergen, and significantly higher levels of specific IgE to the cat epidermis. Conclusion. Mutations in the FLG gene encoding the protein filaggrin raise the risk for sensitization to domestic and epidermal allergens and, in case of already existing sensitization to the cat epidermis, the patients are found with a high degree of probability to have the high concentration of specific IgE to this allergen. The above fact justifies the need to place special emphasis on measures to eliminate house dust allergens, and cat epidermis allergen in particular, and to personalize approaches to therapy and prevention of atopic dermatitis in children. 

  13. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  14. Intellectual Ability in the Duchenne Muscular Dystrophy and Dystrophin Gene Mutation Location

    Directory of Open Access Journals (Sweden)

    Rasic Milic V.

    2014-12-01

    Full Text Available Duchenne muscular dystrophy (DMD is the most common form of muscular dystrophy during childhood. Mutations in dystrophin (DMD gene are also recognized as a cause of cognitive impairment. We aimed to determine the association between intelligence level and mutation location in DMD genes in Serbian patients with DMD. Forty-one male patients with DMD, aged 3 to 16 years, were recruited at the Clinic for Neurology and Psychiatry for Children and Youth in Belgrade, Serbia. All patients had defined DMD gene deletions or duplications [multiplex ligation- dependent probe amplification (MLPA, polymerase chain reaction (PCR] and cognitive status assessment (Wechsler Intelligence Scale for Children, Brunet-Lezine scale, Vineland-Doll scale. In 37 patients with an estimated full scale intelligence quotient (FSIQ, six (16.22% had borderline intelligence (70mutations when boundaries were set at exons 30 and 45. However, FSIQ was statistically significantly associated with mutation location when we assumed their functional consequence on dystrophin isoforms and when mutations in the 5’-untranslated region (5’UTR of Dp140 (exons 45-50 were assigned to affect only Dp427 and Dp260. Mutations affecting Dp140 and Dp71/Dp40 have been associated with more frequent and more severe cognitive impairment. Finally, the same classification of mutations explained the greater proportion of FSIQ variability associated with cumulative loss of dystrophin isoforms. In conclusion, cumulative loss of dystrophin isoforms increases the risk of intellectual impairment in DMD and characterizing the genotype can define necessity of early cognitive interventions in DMD patients.

  15. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  16. A patient with Werner syndrome and adiponectin gene mutation.

    Science.gov (United States)

    Hashimoto, Naotake; Hatanaka, Sachiko; Yokote, Koutaro; Kurosawa, Hiroko; Yoshida, Tomohiko; Iwai, Rie; Takahashi, Hidenori; Yoshida, Katsuya; Horie, Atsuya; Sakurai, Kenichi; Yagui, Kazuo; Saito, Yasushi; Yoshida, Shouji

    2007-01-01

    Werner syndrome is a premature aging disease characterized by genomic instability and increased cancer risk. Here, we report a 45-year-old diabetic man as the first Werner syndrome patient found to have an adiponectin gene mutation. Showing graying and loss of hair, skin atrophy, and juvenile cataract, he was diagnosed with Werner syndrome type 4 by molecular analysis. His serum adiponectin concentration was low. In the globular domain of the adiponectin gene, I164T in exon 3 was detected. When we examined effects of pioglitazone (15 mg/day) on serum adiponectin multimer and monomer concentrations using selective assays, the patient's relative percentage increased in adiponectin concentration was almost same as that in the 18 diabetic patients without an adiponectin mutation, but the absolute adiponectin concentration was half of those seen in diabetic patients treated with the same pioglitazone dose who had no adiponectin mutation. The response suggested that pioglitazone treatment might help to prevent future Werner syndrome-related acceleration of atherosclerosis. Present and further clinical relevant to atherosclerosis in this patient should be imformative concerning the pathogenesis and treatment of atherosclerosis in the presence of hypoadiponectinemia and insulin resistance.

  17. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    Science.gov (United States)

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  18. Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

    Science.gov (United States)

    Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

    2017-01-01

    Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

  19. Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

    Directory of Open Access Journals (Sweden)

    Rodolfo Delfini Cançado

    Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

  20. Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

    NARCIS (Netherlands)

    Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

    1999-01-01

    The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

  1. Diaphanous gene mutation affects spiral cleavage and chirality in snails

    Science.gov (United States)

    Kuroda, Reiko; Fujikura, Kohei; Abe, Masanori; Hosoiri, Yuji; Asakawa, Shuichi; Shimizu, Miho; Umeda, Shin; Ichikawa, Futaba; Takahashi, Hiromi

    2016-01-01

    L-R (left and right) symmetry breaking during embryogenesis and the establishment of asymmetric body plan are key issues in developmental biology, but the onset including the handedness-determining gene locus still remains unknown. Using pure dextral (DD) and sinistral (dd) strains of the pond snail Lymnaea stagnalis as well as its F2 through to F10 backcrossed lines, the single handedness-determining-gene locus was mapped by genetic linkage analysis, BAC cloning and chromosome walking. We have identified the actin-related diaphanous gene Lsdia1 as the strongest candidate. Although the cDNA and derived amino acid sequences of the tandemly duplicated Lsdia1 and Lsdia2 genes are very similar, we could discriminate the two genes/proteins in our molecular biology experiments. The Lsdia1 gene of the sinistral strain carries a frameshift mutation that abrogates full-length LsDia1 protein expression. In the dextral strain, it is already translated prior to oviposition. Expression of Lsdia1 (only in the dextral strain) and Lsdia2 (in both chirality) decreases after the 1-cell stage, with no asymmetric localization throughout. The evolutionary relationships among body handedness, SD/SI (spiral deformation/spindle inclination) at the third cleavage, and expression of diaphanous proteins are discussed in comparison with three other pond snails (L. peregra, Physa acuta and Indoplanorbis exustus). PMID:27708420

  2. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    Science.gov (United States)

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

  3. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    Science.gov (United States)

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  4. A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

    Directory of Open Access Journals (Sweden)

    Claudia Gaspar

    2009-07-01

    Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

  5. the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

    International Nuclear Information System (INIS)

    Abass, M.M.E.

    2004-01-01

    β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

  6. Targeted Exon Skipping to Address “Leaky” Mutations in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Sue Fletcher

    2012-01-01

    Full Text Available Protein-truncating mutations in the dystrophin gene lead to the progressive muscle wasting disorder Duchenne muscular dystrophy, whereas in-frame deletions typically manifest as the milder allelic condition, Becker muscular dystrophy. Antisense oligomer-induced exon skipping can modify dystrophin gene expression so that a disease-associated dystrophin pre-mRNA is processed into a Becker muscular dystrophy-like mature transcript. Despite genomic deletions that may encompass hundreds of kilobases of the gene, some dystrophin mutations appear “leaky”, and low levels of high molecular weight, and presumably semi-functional, dystrophin are produced. A likely causative mechanism is endogenous exon skipping, and Duchenne individuals with higher baseline levels of dystrophin may respond more efficiently to the administration of splice-switching antisense oligomers. We optimized excision of exons 8 and 9 in normal human myoblasts, and evaluated several oligomers in cells from eight Duchenne muscular dystrophy patients with deletions in a known “leaky” region of the dystrophin gene. Inter-patient variation in response to antisense oligomer induced skipping in vitro appeared minimal. We describe oligomers targeting exon 8, that unequivocally increase dystrophin above baseline in vitro, and propose that patients with leaky mutations are ideally suited for participation in antisense oligomer mediated splice-switching clinical studies.

  7. Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

    2014-01-01

    The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

  8. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    Science.gov (United States)

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  9. Mutation and Expression of the DCC Gene in Human Lung Cancer

    Directory of Open Access Journals (Sweden)

    Takashi Kohno

    2000-07-01

    Full Text Available Chromosome 18q is frequently deleted in lung cancers, a common region of 18q deletions was mapped to chromosome 18g21. Since the DCC candidate tumor suppressor gene has been mapped in this region, mutation and expression of the DCC gene were examined in 46 lung cancer cell lines, consisting of 14 small cell lung carcinomas (SCLCs and 32 non-small cell lung carcinomas (NSCLCs, to elucidate the pathogenetic significance of DCC alterations in human lung carcinogenesis. A heterozygous missense mutation was detected in a NSCLC cell line, Ma26, while homozygous deletion was not detected in any of the cell lines. The DCC gene was expressed in 11 (24% of the 46 cell lines, the incidence of DCC expression was significantly higher in SCLCs (7/14, 50% than in NSCLCs (4/32, 13% (P = .01, Fisher's exact test. Therefore, genetic alterations of DCC are infrequent; however, the levels of DCC expression vary among lung cancer cells, in particular, between SCLCs and NSCLCs. The present result does not implicate DCC as a specific mutational target of 18q deletions in human lung cancer; however, it suggests that DCC is a potential target of inactivation by genetic defects including intron or promoter mutations and/or epigenetic alterations. The present result also suggests that DCC expression is associated with some properties of SCLCs, such as a neuroendocrine (NE feature.

  10. Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

    Science.gov (United States)

    Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

    2015-05-01

    Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

  11. Epidural Analgesia with Ropivacaine during Labour in a Patient with a SCN5A Gene Mutation

    Directory of Open Access Journals (Sweden)

    A. L. M. J. van der Knijff-van Dortmont

    2016-01-01

    Full Text Available SCN5A gene mutations can lead to ion channel defects which can cause cardiac conduction disturbances. In the presence of specific ECG characteristics, this mutation is called Brugada syndrome. Many drugs are associated with adverse events, making anesthesia in patients with SCN5A gene mutations or Brugada syndrome challenging. In this case report, we describe a pregnant patient with this mutation who received epidural analgesia using low dose ropivacaine and sufentanil during labour.

  12. Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

    OpenAIRE

    Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

    2014-01-01

    Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

  13. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    Science.gov (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  14. Trichloroethylene exposure and somatic mutations of the VHL gene in patients with Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Fevotte Joelle

    2007-11-01

    Full Text Available Abstract Background We investigated the association between exposure to trichloroethylene (TCE and mutations in the von Hippel-Lindau (VHL gene and the subsequent risk for renal cell carcinoma (RCC. Methods Cases were recruited from a case-control study previously carried out in France that suggested an association between exposures to high levels of TCE and increased risk of RCC. From 87 cases of RCC recruited for the epidemiological study, 69 were included in the present study. All samples were evaluated by a pathologist in order to identify the histological subtype and then be able to focus on clear cell RCC. The majority of the tumour samples were fixed either in formalin or Bouin's solutions. The majority of the tumours were of the clear cell RCC subtype (48 including 2 cystic RCC. Mutation screening of the 3 VHL coding exons was carried out. A descriptive analysis was performed to compare exposed and non exposed cases of clear cell RCC in terms of prevalence of mutations in both groups. Results In the 48 cases of RCC, four VHL mutations were detected: within exon 1 (c.332G>A, p.Ser111Asn, at the exon 2 splice site (c.463+1G>C and c.463+2T>C and within exon 3 (c.506T>C, p.Leu169Pro. No difference was observed regarding the frequency of mutations in exposed versus unexposed groups: among the clear cell RCC, 25 had been exposed to TCE and 23 had no history of occupational exposure to TCE. Two patients with a mutation were identified in each group. Conclusion This study does not confirm the association between the number and type of VHL gene mutations and exposure to TCE previously described.

  15. Cytogenetic Profile and Gene Mutations of Childhood Acute Lymphoblastic Leukemia

    Directory of Open Access Journals (Sweden)

    Nawaf Alkhayat

    2017-07-01

    Full Text Available Background: Childhood acute lymphoblastic leukemia (ALL is characterized by recurrent genetic aberrations. The identification of those abnormalities is clinically important because they are considered significant risk-stratifying markers. Aims: There are insufficient data of cytogenetic profiles in Saudi Arabian patients with childhood ALL leukemia. We have examined a cohort of 110 cases of ALL to determine the cytogenetic profiles and prevalence of FLT3 mutations and analysis of the more frequently observed abnormalities and its correlations to other biologic factors and patient outcomes and to compare our results with previously published results. Materials and methods: Patients —We reviewed all cases from 2007 to 2016 with an established diagnosis of childhood ALL. Of the 110 patients, 98 were B-lineage ALL and 12 T-cell ALL. All the patients were treated by UKALL 2003 protocol and risk stratified according previously published criteria. Cytogenetic analysis —Chromosome banding analysis and fluorescence in situ hybridization were used to detect genetic aberrations. Analysis of FLT3 mutations —Bone marrow or blood samples were screened for FLT3 mutations (internal tandem duplications, and point mutations, D835 using polymerase chain reaction methods. Result: Cytogenetic analysis showed chromosomal anomalies in 68 out of 102 cases with an overall incidence 66.7%. The most frequent chromosomal anomalies in ALL were hyperdiploidy, t(9;22, t(12;21, and MLL gene rearrangements. Our data are in accordance with those published previously and showed that FLT3 mutations are not common in patients with ALL (4.7% and have no prognostic relevance in pediatric patients with ALL. On the contrary, t(9;22, MLL gene rearrangements and hypodiploidy were signs of a bad prognosis in childhood ALL with high rate of relapse and shorter overall survival compared with the standard-risk group ( P  = .031.The event-free survival was also found to be worse ( P

  16. A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

    Science.gov (United States)

    Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

    2017-07-15

    Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

  17. Detection of mutations in mtrR gene in quinolone resistant strains of N.gonorrhoeae isolated from India

    Directory of Open Access Journals (Sweden)

    S V Kulkarni

    2015-01-01

    Full Text Available Background and Objectives: Emergence of multi-drug resistant Neisseria gonorrhoeae resulting from new genetic mutation is a serious threat in controlling gonorrhea. This study was undertaken to identify and characterise mutations in the mtrR genes in N.gonorrhoeae isolates resistant to six different antibiotics in the quinolone group. Materials and Methods: The Minimum inhibitory concentrations (MIC of five quinolones for 64 N.gonorrhoeae isolates isolated during Jan 2007-Jun 2009 were determined by E-test method. Mutations in MtrR loci were examined by deoxyribonucleic acid (DNA sequencing. Results: The proportion of N.gonorrhoeae strains resistant to anti-microbials was 98.4% for norfloxacin and ofloxacin, 96.8% for enoxacin and ciprofloxacin, 95.3% for lomefloxacin. Thirty-one (48.4% strains showed mutation (single/multiple in mtrR gene. Ten different mutations were observed and Gly-45 → Asp, Tyr-105 → His being the most common observed mutation. Conclusion: This is the first report from India on quinolone resistance mutations in MtrRCDE efflux system in N.gonorrhoeae. In conclusion, the high level of resistance to quinolone and single or multiple mutations in mtrR gene could limit the drug choices for gonorrhoea.

  18. The p. N103K mutation of leptin (LEP gene and severe early onset obesity in Pakistan

    Directory of Open Access Journals (Sweden)

    Shabana

    Full Text Available BACKGROUND: Obesity is a complex disorder and has been increasing globally at alarming rates including Pakistan. However, there is scarce research on understanding obesity genetics in Pakistan. Leptin is a hormone secreted by adipocytes in response to satiety and correlates with body weight. Any mutations in the LEP gene have an adverse effect on energy regulation pathway and lead to severe, early onset obesity. To date, only eight mutations have been described in the LEP gene of which p. N103K is one. METHODS: We aimed to analyze the prevalence of this mutation in Pakistani subjects. A total of 475 subjects were genotyped by PCR-RFLP analysis and their serum profiling was done. RESULTS: Results showed that this mutation was present only in one male child with early onset obesity (10 year. He had very low serum leptin levels suggestive of functional impact of the mutation. The prevalence of such mutations is, however, low due to the drastic effects on the energy regulation. CONCLUSION: In conclusion, LEP gene mutations contribute significantly to the monogenic forms of obesity and are important due to the availability of treatment options. Such mutations may exert their effect by directly affecting energy regulation pathway and are more prominent in the early stages of life only.

  19. Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    Directory of Open Access Journals (Sweden)

    Hsien-Yang Lee

    2012-01-01

    Full Text Available Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast majority (24/25 of well-characterized families with PKD/IC. PRRT2 truncating mutations were also detected in 28 of 78 additional families. PRRT2 encodes a proline-rich transmembrane protein of unknown function that has been reported to interact with the t-SNARE, SNAP25. PRRT2 localizes to axons but not to dendritic processes in primary neuronal culture, and mutants associated with PKD/IC lead to dramatically reduced PRRT2 levels, leading ultimately to neuronal hyperexcitability that manifests in vivo as PKD/IC.

  20. Synonymous Mutations at the Beginning of the Influenza A Virus Hemagglutinin Gene Impact Experimental Fitness.

    Science.gov (United States)

    Canale, Aneth S; Venev, Sergey V; Whitfield, Troy W; Caffrey, Daniel R; Marasco, Wayne A; Schiffer, Celia A; Kowalik, Timothy F; Jensen, Jeffrey D; Finberg, Robert W; Zeldovich, Konstantin B; Wang, Jennifer P; Bolon, Daniel N A

    2018-04-13

    The fitness effects of synonymous mutations can provide insights into biological and evolutionary mechanisms. We analyzed the experimental fitness effects of all single-nucleotide mutations, including synonymous substitutions, at the beginning of the influenza A virus hemagglutinin (HA) gene. Many synonymous substitutions were deleterious both in bulk competition and for individually isolated clones. Investigating protein and RNA levels of a subset of individually expressed HA variants revealed that multiple biochemical properties contribute to the observed experimental fitness effects. Our results indicate that a structural element in the HA segment viral RNA may influence fitness. Examination of naturally evolved sequences in human hosts indicates a preference for the unfolded state of this structural element compared to that found in swine hosts. Our overall results reveal that synonymous mutations may have greater fitness consequences than indicated by simple models of sequence conservation, and we discuss the implications of this finding for commonly used evolutionary tests and analyses. Copyright © 2018. Published by Elsevier Ltd.

  1. Molecular genetic analysis of the calcium sensing receptor gene in patients clinically suspected to have familial hypocalciuric hypercalcemia: phenotypic variation and mutation spectrum in a Danish population

    DEFF Research Database (Denmark)

    Nissen, Peter H; Christensen, Signe E; Heickendorff, Lene

    2007-01-01

    CONTEXT: The autosomal dominantly inherited condition familial hypocalciuric hypercalcemia (FHH) is characterized by elevated plasma calcium levels, relative or absolute hypocalciuria, and normal to moderately elevated plasma PTH. The condition is difficult to distinguish clinically from primary...... hyperparathyroidism and is caused by inactivating mutations in the calcium sensing receptor (CASR) gene. OBJECTIVE: We sought to define the mutation spectrum of the CASR gene in a Danish FHH population and to establish genotype-phenotype relationships regarding the different mutations. DESIGN AND PARTICIPANTS...

  2. RAI1 gene mutations: mechanisms of Smith–Magenis Syndrome

    Directory of Open Access Journals (Sweden)

    Falco M

    2017-11-01

    Full Text Available Mariateresa Falco,1,* Sonia Amabile,1,* Fabio Acquaviva2 1Department of Molecular Medicine and Medical Biotechnology, University of Naples “Federico II”, Naples, Italy; 2Department of Translational Medical Sciences (DISMET, Section of Pediatric Clinical Genetics, University of Naples “Federico II”, Naples, Italy *These authors contributed equally to this work Abstract: Smith–Magenis syndrome (SMS; OMIM #182290 is a complex genetic disorder characterized by distinctive physical features, developmental delay, cognitive impairment, and a typical behavioral phenotype. SMS is caused by interstitial 17p11.2 deletions, encompassing multiple genes and including the retinoic acid-induced 1 gene (RAI1, or by mutations in RAI1 itself. About 10% of all the SMS patients, in fact, carry an RAI1 mutation responsible for the phenotype. RAI1 (OMIM *607642 is a dosage-sensitive gene expressed in many tissues and highly conserved among species. Over the years, several studies have demonstrated that RAI1 (or its homologs in animal models acts as a transcriptional factor implicated in embryonic neurodevelopment, neuronal differentiation, cell growth and cell cycle regulation, bone and skeletal development, lipid and glucose metabolisms, behavioral functions, and circadian activity. Patients with RAI1 pathogenic variants show some phenotypic differences when compared to those carrying the typical deletion. They usually have lower incidence of hypotonia and less cognitive impairment than those with 17p11.2 deletions but more frequently show the behavioral characteristics of the syndrome and overeating issues. These differences reflect the primary pathogenetic role of RAI1 without the pathogenetic contribution of the other genes included in the typical 17p11.2 deletion. The better comprehension of physiological roles of RAI1, its molecular co-workers and interactors, and its contribution in determining the typical SMS phenotype will certainly open a new path

  3. Pure myopathy with enlarged mitochondria associated to a new mutation in MTND2 gene

    Directory of Open Access Journals (Sweden)

    Alice Zanolini

    2017-03-01

    Full Text Available To date, only few mutations in the mitochondrial DNA (mtDNA-encoded ND2 subunit of Complex I have been reported, usually presenting a severe phenotype characterized by early onset encephalomyopathy and early death. In this report, we describe a new mutation in the MTND2 gene in a 21-year-old man with a mild myopathic phenotype characterized by exercise intolerance and increased plasma lactate at rest. Electromyography and brain NMR were normal, and no cardiac involvement was present. Muscle biopsy showed a massive presence of ragged red – COX-positive fibres, with enlarged mitochondria containing osmiophilic inclusions. Biochemical assays revealed a severe isolated complex I deficiency. We identified a novel, heteroplasmic mutation m.4831G>A in the MTND2 gene, causing the p.Gly121Asp substitution in the ND2 protein. The mutation was present in the 95% of mitochondrial genomes from patient's muscle tissue, at a lower level in cells from the urinary tract and at a lowest level in lymphocytes from patient's blood; the base substitution was absent in fibroblasts and in the tissues from proband's healthy mother and brother. The specific skeletal muscle tissue involvement can explain the childhood-onset and the relatively benign, exclusively myopathic course of the disease.

  4. The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

    Science.gov (United States)

    Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

    2006-10-01

    Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

  5. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  6. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    Science.gov (United States)

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  7. [Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

    Science.gov (United States)

    Li, M Y; Chao, H Y; Sun, A N; Qiu, H Y; Jin, Z M; Tang, X W; Han, Y; Fu, C C; Chen, S N; Wu, D P

    2017-04-14

    Objective: To explore the prevalences of JAK2, CALR and MPL gene mutations and the mutation types in patients with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs) , and to compare their clinical characteristics of different mutation types with each other and mutation negative group. Methods: The mutations of JAK2 V617F, JAK2 gene at exon 12, CALR gene at exon 9 and MPL gene at exon 10 in 1 648 Ph negative MPNs patients were detected by direct sequencing. Results: ① The JAK2V617F mutation was found in 471 (92.7%) of 508 PV patients, 819 (78.1%) of 1 049 ET patients and 74 (81.3%) of 91 PMF patients respectively, with the total mutation rate as 82.8% (1 364/1 648) . The JAK2 exon12 mutation was found in 9 (1.7%) of 508 PV patients, none was found in ET or PMF patients, with the total mutation rate as 0.5% (9/1 648) . The CALR mutation was found in 132 (12.6%) of 1 049 ET patients and 11 (12.1%) of 91 PMF patients respectively, with the total mutation rate as 8.7% (143/1 648) ; the MPL mutation was found in 9 (0.9%) of 1 049 ET patients and 1 (1.1%) of 91 PMF patients respectively, with the total mutation rate as 0.6% (10/1 648) . The co-occurrence of any two types of driver gene mutations was not detected by direct sequencing. ②The median onset age of patients with JAK2V617F[61 (15-95) y] was significant higher than of with JAK2 exon12 mutation[49 (33-62) y] or without mutations[42 (3-78) y] ( P MPL mutation[59 (22-71) y] ( P >0.05) . Patients with JAK2V617F had higher white blood cell count and hemoglobin level ( P MPL mutation ( P =0.013) . The platelet count of patients with CALR mutation was significantly higher than of with JAK2V617F[966 (400-2 069) ×10(9)/L vs 800 (198-3 730) ×10(9)/L, P MPL gene mutation revealed normal karyotype. Conclusions: Driver gene mutations detection could ensure the diagnosis and prognosis judgment of MPN more reliable, different subtypes of MPNs had different profiles of driver gene mutations, the latter

  8. New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

    Science.gov (United States)

    Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

    2013-01-30

    The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

    Directory of Open Access Journals (Sweden)

    Marcin Luszczyk

    2017-01-01

    Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

  10. Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

    Science.gov (United States)

    Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

    2017-01-01

    Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

  11. [Relation between gene mutations and pancreatic exocrine function in patients with cystic fibrosis].

    Science.gov (United States)

    Radivojević, D; Guć-Sćekić, M; Djurisić, M; Lalić, T; Minić, P; Kanavakis, E

    2001-01-01

    Cystic fibrosis (CF), is the most common autosomal-recessive disease in Caucasians, with an incidence of approximately 1:2500 live births and a carrier frequency of approximately 4-5%. Causes of the disease are mutations in the CF gene which is located on chromosome 7 (region 7q31). Although a single mutation, a deletion of phenylalanine at position 508 (DF508) in exon 10, accounts for almost 70% of all CF chromosomes, over 900 other mutations have been identified in this large gene. CF gene encodes a membrane protein, which functions as aion channel- CFTR (cystic fibrosis transmembrane regulator protein). The exocrine pancreas is a gland that secretes water, enzymes and electrolytes into the intestinal lumen. These enzymes are needed for the normal digestion of food, and their reduced secretion in cystic fibrosis will cause malabsortion and malnutrition in CF patients. Pancreatic dysfunction in CF begins in uteri. Most patients with CF typically present insufficient pancreatic exocrine function (PI phenotype) and 10-15% of CF patients are pancreatic sufficient (PS phenotype). It has been shown elsewhere that the pancreatic function status in CF could be correlated to mutations in the CFTR gene. To determine the relation between genotype and pancreatic status, we analyzed 32 CF patients in whom both CF gene mutant alleles were identified (Table 1). Patients included in this study attended the Paediatric Department of Mother and Child Health Institute in Belgrade. The diagnosis was based on typical clinical manifestations and high levels of sweat chloride concentration (higher than 60 mmol/L). Of the 32 patients studied, only one (3.12%) was PS and the rest (96.88%) had PI phenotype. For each CF genotype the number of patients who were PI or PS is given in Table 1. The most striking observation was that all given genotypes correlated with either PI or PS, but not with both. On the basis of both preceding hypotheses and our present data (Table 2 and Table 3), it was

  12. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  13. Molecular genetic analysis of the F11 gene in 14 Turkish patients with factor XI deficiency: identification of novel and recurrent mutations and their inheritance within families.

    Science.gov (United States)

    Colakoglu, Seyma; Bayhan, Turan; Tavil, Betül; Keskin, Ebru Yılmaz; Cakir, Volkan; Gümrük, Fatma; Çetin, Mualla; Aytaç, Selin; Berber, Ergul

    2018-01-01

    Factor XI (FXI) deficiency is an autosomal bleeding disease associated with genetic defects in the F11 gene which cause decreased FXI levels or impaired FXI function. An increasing number of mutations has been reported in the FXI mutation database, most of which affect the serine protease domain of the protein. FXI is a heterogeneous disorder associated with a variable bleeding tendency and a variety of causative F11 gene mutations. The molecular basis of FXI deficiency in 14 patients from ten unrelated families in Turkey was analysed to establish genotype-phenotype correlations and inheritance of the mutations in the patients' families. Fourteen index cases with a diagnosis of FXI deficiency and family members of these patients were enrolled into the study. The patients' F11 genes were amplified by polymerase chain reaction and subjected to direct DNA sequencing analysis. The findings were analysed statistically using bivariate correlations, Pearson's correlation coefficient and the nonparametric Mann-Whitney test. Direct DNA sequencing analysis of the F11 genes revealed that all of the 14 patients had a F11 gene mutation. Eight different mutations were identified in the apple 1, apple 2 or serine protease domains, except one which was a splice site mutation. Six of the mutations were recurrent. Two of the mutations were novel missense mutations, p.Val522Gly and p.Cys581Arg, within the catalytic domain. The p.Trp519Stop mutation was observed in two families whereas all the other mutations were specific to a single family. Identification of mutations confirmed the genetic heterogeneity of FXI deficiency. Most of the patients with mutations did not have any bleeding complications, whereas some had severe bleeding symptoms. Genetic screening for F11 gene mutations is important to decrease the mortality and morbidity rate associated with FXI deficiency, which can be life-threatening if bleeding occurs in tissues with high fibrinolytic activity.

  14. Filaggrin Gene Mutations and Risk of Basal Cell Carcinoma

    DEFF Research Database (Denmark)

    Kaae, Jesper Rabølle; Thyssen, J P; Johansen, J D

    2013-01-01

    ) . Mice with knockdown of filaggrin, or lack of functional histidase, show decreased epidermal trans-UCA levels and increased UVB-induced skin damage (5) . FLG mutation carriers also have 10% increased serum vitamin D levels suggesting increased penetration of UVB (6) . We evaluated the prevalence of FLG......Basal cell carcinoma (BCC) is prevalent in lightly-pigmented Europeans. While ultraviolet (UV) radiation is an important risk factor, genetic predispositions to BCC have also been identified (1) . Atopic dermatitis (AD), a condition with a heritability that reaches 71-84%, might increase the risk...

  15. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    Science.gov (United States)

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  16. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    Science.gov (United States)

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  17. Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

    Directory of Open Access Journals (Sweden)

    Rupal Sinha

    Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

  18. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    Science.gov (United States)

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

  19. [Clinical characteristics of human recombination activating gene 1 mutations in 8 immunodeficiency patients with diverse phenotypes].

    Science.gov (United States)

    Yu, G; Wang, W J; Liu, D R; Tao, Z F; Hui, X Y; Hou, J; Sun, J Q; Wang, X C

    2018-03-02

    Objective: To investigate the clinical characteristics of 8 immunodeficiency cases caused by human recombination activating gene 1 (RAG1) mutations, and to explore the relationship among genotypes, clinical manifestations and immunophenotypes. Methods: Clinical data were collected and analyzed from patients with RAG1 mutations who visited the Department of Clinical Immunology, Children's Hospital of Fudan University between October 2013 and June 2017. The data included clinical manifestations, immunophenotypes and genotypes. Results: A total of 8 patients were diagnosed with RAG1 deficiency (6 boys and 2 girls). The minimum age of onset was 2 months, and the maximum age was 4 months. The minimum age of diagnosis was 2 months, and the maximum age was 13 years. Four patients had a family history of infant death due to severe infections. Two cases were born to the same consanguineous parents. All cases had recurrent infections, including involvement of respiratory tract (8 cases), digestive tract (6 cases), urinary tract (1 case), and central nervous system (1 case). The pathogens of infection included bacteria, viruses and fungi. Rotavirus was found in 3 cases, cytomegalovirus (CMV) in 5 cases, bacillus Calmette-Guérin adverse reaction in 2 cases (1 of whom had a positive acid-fast smear from lymph node puncture fluid), fungal infection in 3 cases. One case had multiple nodular space-occupying lesions in lungs and abdominal cavity complicated with multiple bone destruction. The peripheral blood lymphocyte counts of all patients ranged between 0.1 ×10(9)/L and 3.3×10(9)/L (median, 0.65×10(9)/L). Eosinophilia was found in 3 cases (range, (0.48-1.69) ×10(9)/L). The patients were classified according to immunophenotype as severe combined immunodeficiency phenotype (4 cases), leaky severe combined immunodeficiency (2 cases), Omenn syndrome (1 case) and combined immunodeficiency (1 case) . Decreased serum IgG levels were found in 3 cases, increased serum IgM levels in

  20. Mutational analysis of the promoter and the coding region of the 5-HT1A gene

    Energy Technology Data Exchange (ETDEWEB)

    Erdmann, J.; Noethen, M.M.; Shimron-Abarbanell, D. [Univ. of Bonn (Germany)] [and others

    1994-09-01

    Disturbances of serotonergic pathways have been implicated in many neuropsychiatric disorders. Serotonin (5HT) receptors can be subdivided into at least three major families (5HT1, 5HT2, and 5HT3). Five human 5HT1 receptor subtypes have been cloned, namely 1A, 1D{alpha}, 1D{beta}, 1E, and 1F. Of these, the 5HT1A receptor is the best characterized subtype. In the present study we sought to identify genetic variation in the 5HT1A receptor gene which through alteration of protein function or level of expression might contribute to the genetics of neuropsychiatric diseases. The coding region and the 5{prime} promoter region of the 5HT1A gene from 159 unrelated subjects (45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 controls) were analyzed using SSCA. SSCA revealed the presence of two mutations both located in the coding region of the 5HT1A receptor gene. The first mutation is a rare silent C{r_arrow}T substitution at nucleotide position 549. The second mutation is characterized by a base pair substitution (A{r_arrow}G) at the first position of codon 28 and results in an amino acid exchange (Ile{r_arrow}Val). Since Val28 was found only in a single schizophrenic patient and in none of the other patients or controls, we decided to extend our samples and to use a restriction assay for screening a further 74 schizophrenic, 95 bipolar affective, and 49 patients with Tourette`s syndrome, as well as 185 controls, for the presence of the mutation. In total, the mutation was found in 2 schizophrenic patients, in 3 bipolars, in 1 Tourette patient, and in 5 controls. To our knowledge the Ile-28-Val substitution reported here is the first natural occuring molecular variant which has been identified for a serotonin receptor so far.

  1. Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

    International Nuclear Information System (INIS)

    Kimura, Hiroshi; Kato, Takesi.

    1992-01-01

    X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

  2. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  3. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  4. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  5. A novel mutation in the Norrie disease gene.

    Science.gov (United States)

    Ott, S; Patel, R J; Appukuttan, B; Wang, X; Stout, J T

    2000-04-01

    Norrie disease is an X-linked recessive disorder characterized by congenital blindness and in some cases mental retardation and deafness.(1) The variability of signs among patients often complicates diagnosis. Signs such as an ocular pseudoglioma, progressive deafness, and mental disturbance are considered classic features.(2) Only one third of patients with Norrie disease have sensorineural deafness, and approximately one half of the affected individuals exhibit mental retardation, often with psychotic features.(3) Histologic analysis has suggested that retinal dysgenesis occurs early in eye development and involves cells in the inner wall of the optic cup.(4) The gene associated with Norrie disease was identified in 1992. (5,6) We report a novel mutation identified in a patient in whom Norrie disease was diagnosed.

  6. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  7. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    Science.gov (United States)

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  8. An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

    International Nuclear Information System (INIS)

    Jin Tao; Zou Liuhe; Yang Ling

    2004-01-01

    Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

  9. Autozygosity reveals recessive mutations and novel mechanisms in dominant genes: implications in variant interpretation

    KAUST Repository

    Monies, Dorota; Maddirevula, Sateesh; Kurdi, Wesam; Alanazy, Mohammed H.; Alkhalidi, Hisham; Al-Owain, Mohammed; Sulaiman, Raashda A.; Faqeih, Eissa; Goljan, Ewa; Ibrahim, Niema; Abdulwahab, Firdous; Hashem, Mais; Abouelhoda, Mohamed; Shaheen, Ranad; Arold, Stefan T.; Alkuraya, Fowzan S.

    2017-01-01

    The purpose of this study is to describe recessive alleles in strictly dominant genes. Identifying recessive mutations in genes for which only dominant disease or risk alleles have been reported can expand our understanding of the medical relevance

  10. A Mutation in the Dmp1 Gene Alters Phosphate Responsiveness in Mice

    Science.gov (United States)

    Gerard-O'Riley, Rita L.; Acton, Dena; McQueen, Amie K.; Strobel, Isabel E.; Witcher, Phillip C.; Feng, Jian Q.; Econs, Michael J.

    2017-01-01

    Mutations in the dentin matrix protein 1 (DMP1) gene cause autosomal recessive hypophosphatemic rickets (ARHR). Hypophosphatemia in ARHR results from increased circulating levels of the phosphaturic hormone, fibroblast growth factor 23 (FGF23). Similarly, elevated FGF23, caused by mutations in the PHEX gene, is responsible for the hypophosphatemia in X-linked hypophosphatemic rickets (XLH). Previously, we demonstrated that a Phex mutation in mice creates a lower set point for extracellular phosphate, where an increment in phosphorus further stimulates Fgf23 production to maintain low serum phosphorus levels. To test the presence of the similar set point defect in ARHR, we generated 4- and 12-week-old Dmp1/Galnt3 double knockout mice and controls, including Dmp1 knockout mice (a murine model of ARHR), Galnt3 knockout mice (a murine model of familial tumoral calcinosis), and phenotypically normal double heterozygous mice. Galnt3 knockout mice had increased proteolytic cleavage of Fgf23, leading to low circulating intact Fgf23 levels with consequent hyperphosphatemia. In contrast, Dmp1 knockout mice had little Fgf23 cleavage and increased femoral Fgf23 expression, resulting in hypophosphatemia and low femoral bone mineral density (BMD). However, introduction of the Galnt3 null allele to Dmp1 knockout mice resulted in a significant increase in serum phosphorus and normalization of BMD. This increased serum phosphorus was accompanied by markedly elevated Fgf23 expression and circulating Fgf23 levels, an attempt to reduce serum phosphorus in the face of improving phosphorus levels. These data indicate that a Dmp1 mutation creates a lower set point for extracellular phosphate and maintains it through the regulation of Fgf23 cleavage and expression. PMID:28005411

  11. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    Science.gov (United States)

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  12. Engineered mutations in fibrillin-1 leading to Marfan syndrome act at the protein, cellular and organismal levels.

    Science.gov (United States)

    Zeyer, Karina A; Reinhardt, Dieter P

    2015-01-01

    Fibrillins are the major components of microfibrils in the extracellular matrix of elastic and non-elastic tissues. They are multi-domain proteins, containing primarily calcium binding epidermal growth factor-like (cbEGF) domains and 8-cysteine/transforming growth factor-beta binding protein-like (TB) domains. Mutations in the fibrillin-1 gene give rise to Marfan syndrome, a connective tissue disorder with clinical complications in the cardiovascular, skeletal, ocular and other organ systems. Here, we review the consequences of engineered Marfan syndrome mutations in fibrillin-1 at the protein, cellular and organismal levels. Representative point mutations associated with Marfan syndrome in affected individuals have been introduced and analyzed in recombinant fibrillin-1 fragments. Those mutations affect fibrillin-1 on a structural and functional level. Mutations which impair folding of cbEGF domains can affect protein trafficking. Protein folding disrupted by some mutations can lead to defective secretion in mutant fibrillin-1 fragments, whereas fragments with other Marfan mutations are secreted normally. Many Marfan mutations render fibrillin-1 more susceptible to proteolysis. There is also evidence that some mutations affect heparin binding. Few mutations have been further analyzed in mouse models. An extensively studied mouse model of Marfan syndrome expresses mouse fibrillin-1 with a missense mutation (p.C1039G). The mice display similar characteristics to human patients with Marfan syndrome. Overall, the analyses of engineered mutations leading to Marfan syndrome provide important insights into the pathogenic molecular mechanisms exerted by mutated fibrillin-1. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene

    Directory of Open Access Journals (Sweden)

    Se Eun Lee

    2011-02-01

    Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.

  14. Spectrum of mismatch repair gene mutations and clinical presentation of Hispanic individuals with Lynch syndrome.

    Science.gov (United States)

    Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N

    2017-04-01

    Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.

  15. Low-level APC mutational mosaicism is the underlying cause in a substantial fraction of unexplained colorectal adenomatous polyposis cases.

    Science.gov (United States)

    Spier, Isabel; Drichel, Dmitriy; Kerick, Martin; Kirfel, Jutta; Horpaopan, Sukanya; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Adam, Ronja; Zhao, Bixiao; Becker, Tim; Lifton, Richard P; Perner, Sven; Hoffmann, Per; Kristiansen, Glen; Timmermann, Bernd; Nöthen, Markus M; Holinski-Feder, Elke; Schweiger, Michal R; Aretz, Stefan

    2016-03-01

    In 30-50% of patients with colorectal adenomatous polyposis, no germline mutation in the known genes APC, causing familial adenomatous polyposis, MUTYH, causing MUTYH-associated polyposis, or POLE or POLD1, causing polymerase-proofreading-associated polyposis can be identified, although a hereditary aetiology is likely. This study aimed to explore the impact of APC mutational mosaicism in unexplained polyposis. To comprehensively screen for somatic low-level APC mosaicism, high-coverage next-generation sequencing of the APC gene was performed using DNA from leucocytes and a total of 53 colorectal tumours from 20 unrelated patients with unexplained sporadic adenomatous polyposis. APC mosaicism was assumed if the same loss-of-function APC mutation was present in ≥ 2 anatomically separated colorectal adenomas/carcinomas per patient. All mutations were validated using diverse methods. In 25% (5/20) of patients, somatic mosaicism of a pathogenic APC mutation was identified as underlying cause of the disease. In 2/5 cases, the mosaic level in leucocyte DNA was slightly below the sensitivity threshold of Sanger sequencing; while in 3/5 cases, the allelic fraction was either very low (0.1-1%) or no mutations were detectable. The majority of mosaic mutations were located outside the somatic mutation cluster region of the gene. The present data indicate a high prevalence of pathogenic mosaic APC mutations below the detection thresholds of routine diagnostics in adenomatous polyposis, even if high-coverage sequencing of leucocyte DNA alone is taken into account. This has important implications for both routine work-up and strategies to identify new causative genes in this patient group. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  16. Recurrent and founder mutations in the PMS2 gene.

    Science.gov (United States)

    Tomsic, J; Senter, L; Liyanarachchi, S; Clendenning, M; Vaughn, C P; Jenkins, M A; Hopper, J L; Young, J; Samowitz, W; de la Chapelle, A

    2013-03-01

    Germline mutations in PMS2 are associated with Lynch syndrome (LS), the most common known cause of hereditary colorectal cancer. Mutation detection in PMS2 has been difficult due to the presence of several pseudogenes, but a custom-designed long-range PCR strategy now allows adequate mutation detection. Many mutations are unique. However, some mutations are observed repeatedly across individuals not known to be related due to the mutation being either recurrent, arising multiple times de novo at hot spots for mutations, or of founder origin, having occurred once in an ancestor. Previously, we observed 36 distinct mutations in a sample of 61 independently ascertained Caucasian probands of mixed European background with PMS2 mutations. Eleven of these mutations were detected in more than one individual not known to be related and of these, six were detected more than twice. These six mutations accounted for 31 (51%) ostensibly unrelated probands. Here, we performed genotyping and haplotype analysis in four mutations observed in multiple probands and found two (c.137G>T and exon 10 deletion) to be founder mutations and one (c.903G>T) a probable founder. One (c.1A>G) could not be evaluated for founder mutation status. We discuss possible explanations for the frequent occurrence of founder mutations in PMS2. © 2012 John Wiley & Sons A/S.

  17. Mutations in the maize zeta-carotene desaturase gene lead to viviparous kernel.

    Directory of Open Access Journals (Sweden)

    Yan Chen

    Full Text Available Preharvest sprouting reduces the maize quality and causes a significant yield loss in maize production. vp-wl2 is a Mutator (Mu-induced viviparous mutant in maize, causing white or pale yellow kernels, dramatically reduced carotenoid and ABA content, and a high level of zeta-carotene accumulation. Here, we reported the cloning of the vp-wl2 gene using a modified digestion-ligation-amplification method (DLA. The results showed that an insertion of Mu9 in the first intron of the zeta-carotene desaturase (ZDS gene results in the vp-wl2 mutation. Previous studies have suggested that ZDS is likely the structural gene of the viviparous9 (vp9 locus. Therefore, we performed an allelic test using vp-wl2 and three vp9 mutants. The results showed that vp-wl2 is a novel allele of the vp9 locus. In addition, the sequences of ZDS gene were identified in these three vp9 alleles. The vp-wl2 mutant gene was subsequently introgressed into four maize inbred lines, and a viviparous phenotype was observed with yield losses from 7.69% to 13.33%.

  18. Potential late-onset Alzheimer's disease-associated mutations in the ADAM10 gene attenuate {alpha}-secretase activity.

    Science.gov (United States)

    Kim, Minji; Suh, Jaehong; Romano, Donna; Truong, Mimy H; Mullin, Kristina; Hooli, Basavaraj; Norton, David; Tesco, Giuseppina; Elliott, Kathy; Wagner, Steven L; Moir, Robert D; Becker, K David; Tanzi, Rudolph E

    2009-10-15

    ADAM10, a member of a disintegrin and metalloprotease family, is an alpha-secretase capable of anti-amyloidogenic proteolysis of the amyloid precursor protein. Here, we present evidence for genetic association of ADAM10 with Alzheimer's disease (AD) as well as two rare potentially disease-associated non-synonymous mutations, Q170H and R181G, in the ADAM10 prodomain. These mutations were found in 11 of 16 affected individuals (average onset age 69.5 years) from seven late-onset AD families. Each mutation was also found in one unaffected subject implying incomplete penetrance. Functionally, both mutations significantly attenuated alpha-secretase activity of ADAM10 (>70% decrease), and elevated Abeta levels (1.5-3.5-fold) in cell-based studies. In summary, we provide the first evidence of ADAM10 as a candidate AD susceptibility gene, and report two potentially pathogenic mutations with incomplete penetrance for late-onset familial AD.

  19. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    Science.gov (United States)

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  20. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  1. HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides

    Energy Technology Data Exchange (ETDEWEB)

    Jingyong, Zhao; Yongzhong, Xu; Tao, Zhao; Fengmei, Cui; Liuyi, Wang; Qinhua, Lao [Suzhou Univ., Suzhou (China). Radiation Medicine Department

    2001-07-01

    HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides was performed and the relationships between mutation frequency and dose were studied. Rats were injected intravenously with radionuclides, the blood was sampled at different time after injection; HPRT gene locus mutation frequency (GMF) were examined by methods of multi-nucleus cell and Brdurd assay, working out the Dose-response function. GMF rose with the increase of dose and dose-rates and were clearly interrelated. The HPRT gene locus mutation is very sensitive to radiation and may be used as a biological dosimeter.

  2. Characterization of Eleusine indica with gene mutation or amplification in EPSPS to glyphosate.

    Science.gov (United States)

    Chen, Jingchao; Jiang, Cuilan; Huang, Hongjuan; Wei, Shouhui; Huang, Zhaofeng; Wang, Huimin; Zhao, Dandan; Zhang, Chaoxian

    2017-11-01

    The evolution of weed-resistant species threatens the sustainable use of glyphosate, which is the most important herbicide widely used in agriculture worldwide. Moreover, the high glyphosate resistance (>180-fold based on LD 50 ) of Eleusine indica found in Malaysia, which carries a double mutation in its 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), made the control of this species more difficult. By contrast, the same species carrying the same double mutation in EPSPS (T102I+P106S) but found in China only shows a resistance level of not more than 14-fold based on GR 50 . The resistance level of this population is four times higher than that of the population carrying a single mutation (P106L). Although the members of this population survive under a high glyphosate dosage of 10,080gaeha -1 , their growth was significantly inhibited by glyphosate under the recommend dose (840gaeha -1 ), where in the fresh weight was 85.4% of the control. EPSPS expression, relative copy number, and EPSPS activity in this population were similar to those of the susceptible population. In addition, the expression of two glutathione transferase (GST) genes (GST-U8 and GST-23) and the enzyme activity of the GST in this population did not significantly differ from those of the susceptible population. This finding is important in elucidating the resistance of the naturally evolved glyphosate-resistant (GR) weed species carrying a double mutation in EPSPS to glyphosate. Copyright © 2017. Published by Elsevier Inc.

  3. A novel missense mutation of ADAR1 gene in a Chinese family ...

    Indian Academy of Sciences (India)

    This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by 1.5% agarose ...

  4. Study of the effect of HFE gene mutations on iron overload in ...

    African Journals Online (AJOL)

    Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

  5. Somatic Mutational Landscape of Splicing Factor Genes and Their Functional Consequences across 33 Cancer Types

    Directory of Open Access Journals (Sweden)

    Michael Seiler

    2018-04-01

    Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation

  6. A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis.

    Science.gov (United States)

    Jiang, Jingjing; Wang, Yuhui; Ling, Yan; Kayoumu, Abudurexiti; Liu, George; Gao, Xin

    2016-01-16

    The severe forms of hypertriglyceridemia are usually caused by genetic defects. In this study, we described a Chinese female with severe hypertriglyceridemia caused by a novel homozygous mutation in the APOC2 gene. Lipid profiles of the pedigree were studied in detail. LPL and HL activity were also measured. The coding regions of 5 candidate genes (namely LPL, APOC2, APOA5, LMF1, and GPIHBP1) were sequenced using genomic DNA from peripheral leucocytes. The ApoE gene was also genotyped. Serum triglyceride level was extremely high in the proband, compared with other family members. Plasma LPL activity was also significantly reduced in the proband. Serum ApoCII was very low in the proband as well as in the heterozygous mutation carriers. A novel mutation (c.86A > CC) was identified on exon 3 [corrected] of the APOC2 gene, which converted the Asp [corrected] codon at position 29 into Ala, followed by a termination codon (TGA). This study presented the first case of ApoCII deficiency in the Chinese population, with a novel mutation c.86A > CC in the APOC2 gene identified. Serum ApoCII protein might be a useful screening test for identifying mutation carriers.

  7. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    Directory of Open Access Journals (Sweden)

    Diaz-Llopis Manuel

    2011-10-01

    Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

  8. New Mutation Identified in the SRY Gene High Mobility Group (HMG

    Directory of Open Access Journals (Sweden)

    Feride İffet Şahin

    2013-06-01

    Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

  9. Clinical study of DMD gene point mutation causing Becker muscular dystrophy

    Directory of Open Access Journals (Sweden)

    Ji-qing CAO

    2015-07-01

    Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

  10. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Science.gov (United States)

    Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

    2016-01-01

    Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

  11. Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

    Directory of Open Access Journals (Sweden)

    Arno Steinacher

    Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

  12. Gitelman or Bartter type 3 syndrome? A case of distal convoluted tubulopathy caused by CLCNKB gene mutation.

    Science.gov (United States)

    Cruz, António José; Castro, Alexandra

    2013-01-22

    A 32-year-old woman with no significant medical history was sent to our consultation due to hypokalaemia (syndrome (GS) came negative. CLCNKB gene mutation analysis present in both GS and Bartter (BS) type 3 syndromes was positive. The patient is now being treated with potassium and magnesium oral supplements, ramipril and spironolactone with stable near-normal potassium and magnesium levels. This article presents the case of a patient with hypokalaemia caused by CLCNKB gene mutation hard to categorise as GS or BS type 3.

  13. A novel homozygous mutation in the FSHR gene is causative for primary ovarian insufficiency.

    Science.gov (United States)

    Liu, Hongli; Xu, Xiaofei; Han, Ting; Yan, Lei; Cheng, Lei; Qin, Yingying; Liu, Wen; Zhao, Shidou; Chen, Zi-Jiang

    2017-12-01

    To identify the potential FSHR mutation in a Chinese woman with primary ovarian insufficiency (POI). Genetic and functional studies. University-based reproductive medicine center. A POI patient, her family members, and another 192 control women with regular menstruation. Ovarian biopsy was performed in the patient. Sanger sequencing was carried out for the patient, her sister, and parents. The novel variant identified was further confirmed with the use of control subjects. Sanger sequencing and genotype analysis to identify the potential variant of the FSHR gene; hematoxylin and eosin staining of the ovarian section to observe the follicular development; Western blotting and immunofluorescence to detect FSH receptor (FSHR) expression; and cyclic adenosine monophosphate (cAMP) assay to monitor FSH-induced signaling. Histologic examination of the ovaries in the patient revealed follicular development up to the early antral stage. Mutational screening and genotype analysis of the FSHR gene identified a novel homozygous mutation c.175C>T (p.R59X) in exon 2, which was inherited in the autosomal recessive mode from her heterozygous parents but was absent in her sister and the 192 control women. Functional studies demonstrated that in vitro the nonsense mutation caused the loss of full-length FSHR expression and that p.R59X mutant showed no response to FSH stimulation in the cAMP level. The mutation p.R59X in FSHR is causative for POI by means of arresting folliculogenesis. Copyright © 2017 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Screening for mutations in two exons of FANCG gene in Pakistani population.

    Science.gov (United States)

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  15. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  16. Autosomal dominant pseudohypoaldosteronism type 1 with a novel splice site mutation in MR gene

    Directory of Open Access Journals (Sweden)

    Kaito Hiroshi

    2009-11-01

    Full Text Available Abstract Background Autosomal dominant pseudohypoaldosteronism type 1 (PHA1 is a rare inherited condition that is characterized by renal resistance to aldosterone as well as salt wasting, hyperkalemia, and metabolic acidosis. Renal PHA1 is caused by mutations of the human mineralcorticoid receptor gene (MR, but it is a matter of debate whether MR mutations cause mineralcorticoid resistance via haploinsufficiency or dominant negative mechanism. It was previously reported that in a case with nonsense mutation the mutant mRNA was absent in lymphocytes because of nonsense mediated mRNA decay (NMD and therefore postulated that haploinsufficiency alone can give rise to the PHA1 phenotype in patients with truncated mutations. Methods and Results We conducted genomic DNA analysis and mRNA analysis for familial PHA1 patients extracted from lymphocytes and urinary sediments and could detect one novel splice site mutation which leads to exon skipping and frame shift result in premature termination at the transcript level. The mRNA analysis showed evidence of wild type and exon-skipped RT-PCR products. Conclusion mRNA analysis have been rarely conducted for PHA1 because kidney tissues are unavailable for this disease. However, we conducted RT-PCR analysis using mRNA extracted from urinary sediments. We could demonstrate that NMD does not fully function in kidney cells and that haploinsufficiency due to NMD with premature termination is not sufficient to give rise to the PHA1 phenotype at least in this mutation of our patient. Additional studies including mRNA analysis will be needed to identify the exact mechanism of the phenotype of PHA.

  17. Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

    Science.gov (United States)

    Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

    2006-12-01

    To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

  18. A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

    Science.gov (United States)

    Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

    2016-05-01

    Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

  19. [Characteristics of phenylalanine hydroxylase gene mutations among patients with phenylketonuria from Linyi region of Shandong Province].

    Science.gov (United States)

    Li, Huafeng; Li, Yongli; Zhang, Li

    2017-06-10

    To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.

  20. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    Science.gov (United States)

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  1. Neonatal diabetes mellitus: description of two Puerto Rican children with KCNJ11 activating gene mutation.

    Science.gov (United States)

    Nieves-Rivera, Francisco; González-Pijem, Lilliam

    2011-06-01

    Neonatal diabetes mellitus (NDM) is a rare disorder. A one-month-old boy presented with vomiting, hyperglycemia (968 mg/dl [53.8 mmol/L]), severe acetonemia, and metabolic acidosis (pH 6.95, HCO3-4.2 mmol/L). A second child (three months of age) presented with upper respiratory tract symptoms and a plasma glucose level of 835 mg/dl, without acetonemia or acidosis. Both were hospitalized and managed with intravenous fluids and then discharged on insulin. Genetic testing identified the presence of the de nova V59M and E322K activating mutations in the KCNJ11 gene encoding the sulphonylurea/potassium channel (Kir6.2 subunit) of the insulin beta cell. Both patients were switched to glibenclamide and remain off insulin. To our knowledge, these are the first children in Puerto Rico identified with NDM secondary to a KCNJ11 activating mutation. We conclude that NDM secondary to KCNJ11/Kir6.2 activating mutations, although unusual, should be considered in similar cases since patients with these mutations could come off insulin.

  2. A 1-month-old infant with chylomicronemia due to gene mutation treated by plasmapheresis

    Directory of Open Access Journals (Sweden)

    Mo Kyung Jung

    2017-03-01

    Full Text Available Chylomicronemia is a severe type of hypertriglyceridemia characterized by chylomicron accumulation that arises from a genetic defect in intravascular lipolysis. It requires urgent and proper management, because serious cases can be accompanied by pancreatic necrosis or persistent multiple organ failure. We present the case of a 1-month-old infant with chylomicronemia treated by plasmapheresis. His chylomicronemia was discovered incidentally when lactescent plasma was noticed during routine blood sampling during a hospital admission for fever and irritability. Laboratory investigation revealed marked triglyceridemia (>5,000 mg/dL with high chylomicron levels. We therefore decided to perform a therapeutic plasmapheresis to prevent acute pancreatitis. Sequence analysis revealed a homozygous novel mutation in exon 4 of GPIHBP1: c.476delG (p.Gly159Alafs. Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1 stabilizes the binding of chylomicrons near lipoprotein lipase and supports lipolysis. Mutations of GPIHBP1, the most recently discovered gene, can lead to severe hyperlipidemia and are known to make up only 2% of the monogenic mutations associated with chylomicronemia. The patient maintains mild hypertriglyceridemia without rebound after single plasmapheresis and maintenance fibrate medication so far. Here, we report an infant with chylomicronemia due to GPIHBP1 mutation, successfully treated by plasmapheresis.

  3. dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.

    Science.gov (United States)

    Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J

    2015-05-12

    Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

  4. Retinal phenotype-genotype correlation of pediatric patients expressing mutations in the Norrie disease gene.

    Science.gov (United States)

    Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy

    2007-02-01

    To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.

  5. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  6. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

    Science.gov (United States)

    Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

    2018-05-12

    Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  7. A new mutation of the fukutin gene causing late-onset limb girdle muscular dystrophy

    DEFF Research Database (Denmark)

    Riisager, Maria; Duno, M; Hansen, Flemming Juul

    2013-01-01

    to aberrations of FKTN is rare, with only eight reported cases of limb girdle phenotype (LGMD2M). We describe the mildest affected patient outside Japan with genetically confirmed LGMD2M and onset of symptoms at age 14. She was brought to medical attention at age 12, not because of muscle weakness, but due...... to episodes of tachycardia caused by Wolff-Parkinson-White syndrome. On examination, she had rigid spine syndrome, a typical limb girdle dystrophy pattern of muscle weakness, cardiomyopathy, and serum CK levels >2000 IU/L (normal G; p.Y306C mutation in the FKTN gene was found. The case confirms FKTN mutations...... as a cause of LGMD2M without mental retardation and expands the phenotypic spectrum for LGMD2M to include cardiomyopathy and rigid spine syndrome in the mildest affected non-Japanese patient reported so far....

  8. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  9. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    Science.gov (United States)

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  10. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    NARCIS (Netherlands)

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA

  11. A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

    Science.gov (United States)

    2014-01-01

    Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

  12. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  13. A Biallelic Mutation in the Homologous Recombination Repair Gene SPIDR Is Associated With Human Gonadal Dysgenesis.

    Science.gov (United States)

    Smirin-Yosef, Pola; Zuckerman-Levin, Nehama; Tzur, Shay; Granot, Yaron; Cohen, Lior; Sachsenweger, Juliane; Borck, Guntram; Lagovsky, Irina; Salmon-Divon, Mali; Wiesmüller, Lisa; Basel-Vanagaite, Lina

    2017-02-01

    Primary ovarian insufficiency (POI) is caused by ovarian follicle depletion or follicle dysfunction, characterized by amenorrhea with elevated gonadotropin levels. The disorder presents as absence of normal progression of puberty. To elucidate the cause of ovarian dysfunction in a family with POI. We performed whole-exome sequencing in 2 affected individuals. To evaluate whether DNA double-strand break (DSB) repair activities are altered in biallelic mutation carriers, we applied an enhanced green fluorescent protein-based assay for the detection of specific DSB repair pathways in blood-derived cells. Diagnoses were made at the Pediatric Endocrine Clinic, Clalit Health Services, Sharon-Shomron District, Israel. Genetic counseling and sample collection were performed at the Pediatric Genetics Unit, Schneider Children's Medical Center Israel, Petah Tikva, Israel. Two sisters born to consanguineous parents of Israeli Muslim Arab ancestry presented with a lack of normal progression of puberty, high gonadotropin levels, and hypoplastic or absent ovaries on ultrasound. Blood samples for DNA extraction were obtained from all family members. Exome analysis to elucidate the cause of POI in 2 affected sisters. Analysis revealed a stop-gain homozygous mutation in the SPIDR gene (KIAA0146) c.839G>A, p.W280*. This mutation altered SPIDR activity in homologous recombination, resulting in the accumulation of 53BP1-labeled DSBs postionizing radiation and γH2AX-labeled damage during unperturbed growth. SPIDR is important for ovarian function in humans. A biallelic mutation in this gene may be associated with ovarian dysgenesis in cases of autosomal recessive inheritance. Copyright © 2017 by the Endocrine Society

  14. Identification and functional analysis of a novel mutation in the SOX10 gene associated with Waardenburg syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong

    2014-03-15

    Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

    Science.gov (United States)

    Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

    2010-07-01

    Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

  16. A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Garuti Rita

    2010-10-01

    Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

  17. Novel splice site mutation in the growth hormone receptor gene in Turkish patients with Laron-type dwarfism.

    Science.gov (United States)

    Arman, Ahmet; Ozon, Alev; Isguven, Pinar S; Coker, Ajda; Peker, Ismail; Yordam, Nursen

    2008-01-01

    Growth hormone (GH) is involved in growth, and fat and carbohydrate metabolism. Interaction of GH with the GH receptor (GHR) is necessary for systemic and local production of insulin-like growth factor-I (IGF-I) which mediates GH actions. Mutations in the GHR cause severe postnatal growth failure; the disorder is an autosomal recessive genetic disease resulting in GH insensitivity, called Laron syndrome. It is characterized by dwarfism with elevated serum GH and low levels of IGF-I. We analyzed the GHR gene for mutations and polymorphisms in eight patients with Laron-type dwarfism from six families. We found three missense mutations (S40L, V125A, I526L), one nonsense mutation (W157X), and one splice site mutation in the extracellular domain of GHR. Furthermore, G168G and exon 3 deletion polymorphisms were detected in patients with Laron syndrome. The splice site mutation, which is a novel mutation, was located at the donor splice site of exon 2/ intron 2 within GHR. Although this mutation changed the highly conserved donor splice site consensus sequence GT to GGT by insertion of a G residue, the intron splicing between exon 2 and exon 3 was detected in the patient. These results imply that the splicing occurs arthe GT site in intron 2, leaving the extra inserted G residue at the end of exon 2, thus changing the open reading frame of GHR resulting in a premature termination codon in exon 3.

  18. Spectrum of mutations in the renin-angiotensin system genes in autosomal recessive renal tubular dysgenesis

    DEFF Research Database (Denmark)

    Gribouval, Olivier; Morinière, Vincent; Pawtowski, Audrey

    2012-01-01

    , pulmonary hypoplasia, and refractory arterial hypotension. The disease is linked to mutations in the genes encoding several components of the renin-angiotensin system (RAS): AGT (angiotensinogen), REN (renin), ACE (angiotensin-converting enzyme), and AGTR1 (angiotensin II receptor type 1). Here, we review...... the series of 54 distinct mutations identified in 48 unrelated families. Most of them are novel and ACE mutations are the most frequent, observed in two-thirds of families (64.6%). The severity of the clinical course was similar whatever the mutated gene, which underlines the importance of a functional RAS...

  19. HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

    Science.gov (United States)

    El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

    2017-08-01

    Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

  20. Mutations in the NOT Genes or in the Translation Machinery Similarly Display Increased Resistance to Histidine Starvation

    Directory of Open Access Journals (Sweden)

    Martine A. Collart

    2017-05-01

    Full Text Available The NOT genes encode subunits of the conserved Ccr4-Not complex, a global regulator of gene expression, and in particular of mRNA metabolism. They were originally identified in a selection for increased resistance to histidine starvation in the yeast S. cerevisiae. Recent work indicated that the Not5 subunit, ortholog of mammalian CNOT3, determines global translation levels by defining binding of the Ccr4-Not scaffold protein Not1 to ribosomal mRNAs during transcription. This is needed for optimal translation of ribosomal proteins. In this work we searched for mutations in budding yeast that were resistant to histidine starvation using the same selection that originally led to the isolation of the NOT genes. We thereby isolated mutations in ribosome-related genes. This common phenotype of ribosome mutants and not mutants is in good agreement with the positive role of the Not proteins for translation. In this regard, it is interesting that frequent mutations in RPL5 and RPL10 or in CNOT3 have been observed to accumulate in adult T-cell acute lymphoblastic leukemia (T-ALL. This suggests that in metazoans a common function implicating ribosome subunits and CNOT3 plays a role in the development of cancer. In this perspective we suggest that the Ccr4-Not complex, according to translation levels and fidelity, could itself be involved in the regulation of amino acid biosynthesis levels. We discuss how this could explain why mutations have been identified in many cancers.

  1. Novel mutations in the USH1C gene in Usher syndrome patients.

    Science.gov (United States)

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  2. HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

    Science.gov (United States)

    Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

    2017-07-01

    HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

  3. Spectrum of MECP2 gene mutations in a cohort of Indian patients with Rett syndrome: report of two novel mutations.

    Science.gov (United States)

    Das, Dhanjit Kumar; Raha, Sarbani; Sanghavi, Daksha; Maitra, Anurupa; Udani, Vrajesh

    2013-02-15

    Rett syndrome (RTT) is an X-linked neurodevelopmental disorder, primarily affecting females and characterized by developmental regression, epilepsy, stereotypical hand movements, and motor abnormalities. Its prevalence is about 1 in 10,000 female births. Rett syndrome is caused by mutations within methyl CpG-binding protein 2 (MECP2) gene. Over 270 individual nucleotide changes which cause pathogenic mutations have been reported. However, eight most commonly occurring missense and nonsense mutations account for almost 70% of all patients. We screened 90 individuals with Rett syndrome phenotype. A total of 19 different MECP2 mutations and polymorphisms were identified in 27 patients. Of the 19 mutations, we identified 7 (37%) frameshift, 6 (31%) nonsense, 14 (74%) missense mutations and one duplication (5%). The most frequent pathogenic changes were: missense p.T158M (11%), p.R133C (7.4%), and p.R306C (7.4%) and nonsense p.R168X (11%), p.R255X (7.4%) mutations. We have identified two novel mutations namely p.385-388delPLPP present in atypical patients and p.Glu290AlafsX38 present in a classical patient of Rett syndrome. Sequence homology for p.385-388delPLPP mutation revealed that these 4 amino acids were conserved across mammalian species. This indicated the importance of these 4 amino acids in structure and function of the protein. A novel variant p.T479T has also been identified in a patient with atypical Rett syndrome. A total of 62 (69%) patients remained without molecular genetics diagnosis that necessitates further search for mutations in other genes like CDKL5 and FOXG1 that are known to cause Rett phenotype. The majority of mutations are detected in exon 4 and only one mutation was present in exon 3. Therefore, our study suggests the need for screening exon 4 of MECP2 as first line of diagnosis in these patients. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Directory of Open Access Journals (Sweden)

    Matei Irina

    2001-08-01

    Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

  5. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    Science.gov (United States)

    Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

    2001-01-01

    Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

  6. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    Science.gov (United States)

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  7. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    Science.gov (United States)

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  8. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    Energy Technology Data Exchange (ETDEWEB)

    Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)

    2000-11-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  9. Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

    International Nuclear Information System (INIS)

    Poussaint, T.Y.; Fox, J.W.; Walsh, C.A.; Dobyns, W.B.; Radtke, R.; Scheffer, I.E.; Berkovic, S.F.; Barnes, P.D.; Huttenlocher, P.R.

    2000-01-01

    Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

  10. [Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

    Science.gov (United States)

    Shiba, Norio

    2015-12-01

    A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

  11. Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa

    International Nuclear Information System (INIS)

    Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.

    1991-01-01

    The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene

  12. Application of gene targeting to designed mutation breeding of high-tryptophan rice.

    Science.gov (United States)

    Saika, Hiroaki; Oikawa, Akira; Matsuda, Fumio; Onodera, Haruko; Saito, Kazuki; Toki, Seiichi

    2011-07-01

    Site-directed mutagenesis via gene targeting (GT) based on homologous recombination is the ultimate mutation breeding technology because it enables useful information acquired from structural- and computational-based protein engineering to be applied directly to molecular breeding, including metabolic engineering, of crops. Here, we employed this rationale to introduce precise mutations in OASA2--an α-subunit of anthranilate synthase that is a key enzyme of tryptophan (Trp) biosynthesis in rice (Oryza sativa)--via GT, with subsequent selection of GT cells using a Trp analog. The expression level of OASA2 in plants homozygous and heterozygous for modified OASA2 was similar to that of nontransformants, suggesting that OASA2 transcription in GT plants was controlled in the same manner as endogenous OASA2, and that GT could lead to a lower risk of gene silencing than in conventional overexpression approaches. Moreover, we showed that enzymatic properties deduced from protein engineering or in vitro analysis could be reproduced in GT plants as evidenced by Trp accumulation levels. Interestingly, mature seeds of homozygous GT plants accumulated Trp levels 230-fold higher than in nontransformants without any apparent morphological or developmental changes. Thus, we have succeeded in producing a novel rice plant of great potential nutritional benefit for both man and livestock that could not have been selected using conventional mutagenesis approaches. Our results demonstrate the effectiveness of directed crop improvement by combining precision mutagenesis via GT with a knowledge of protein engineering.

  13. HPRT gene mutation frequency and the factor of influence in adult peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Zhao Jingyong; Zheng Siying; Cui Fengmei; Wang Liuyi; Lao Qinhua; Wu Hongliang

    2002-01-01

    Objective: To study the HPRT gene loci mutation frequencies and the factor of influence in peripheral blood lymphocytes of adult with ages ranging from 21-50. Methods: HPRT gene mutation frequency (GMf) were examined by the technique of multinuclear cell assay. Relation between GMf and years were fitted with a computer. Results: Relation could be described by the following equation: y = 0.7555 + 0.0440x, r = 0.9829. Smoking has influence on GMf and sex hasn't. Conclusion: HPRT gene mutation frequency increases with increasing of age. Increasing rate is 0.00440% per year

  14. Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family.

    Science.gov (United States)

    Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping

    2007-08-01

    Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

  15. Phenylalanine hydroxylase gene mutations in the United States: Report from the maternal PKU collaborative study

    Energy Technology Data Exchange (ETDEWEB)

    Guldberg, P.; Henriksen, K.F.; Guettler, F. [John F. Kennedy Inst., Glostrup (Denmark)] [and others

    1996-07-01

    The major cause of hyperphenylalaninemia is mutations in the gene encoding phenylalanine hydroxylase (PAH). The known mutations have been identified primarily in European patients. The purpose of this study was to determine the spectrum of mutations responsible for PAH deficiency in the United States. One hundred forty-nine patients enrolled in the Maternal PKU Collaborative Study were subjects for clinical and molecular investigations. PAH gene mutations associated with phenylketonuria (PKU) or mild hyperphenylalaninemia (MHP) were identified on 279 of 294 independent mutant chromosomes, a diagnostic efficiency of 95%. The spectrum is composed of 71 different mutations, including 47 missense mutations, 11 splice mutations, 5 nonsense mutations, and 8 microdeletions. Sixteen previously unreported mutations were identified. Among the novel mutations, five were found in patients with MHP, and the remainder were found in patients with PKU. The most common mutations were R408W, IVS12nt1g{r_arrow}a, and Y414C, accounting for 18.7%, 7.8% and 5.4% of the mutant chromosomes, respectively. Thirteen mutations had relative frequencies of 1%-5%, and 55 mutations each had frequencies {le}1%. The mutational spectrum corresponded to that observed for the European ancestry of the U.S. population. To evaluate the extent of allelic variation at the PAH locus within the United States in comparison with other populations, we used allele frequencies to calculate the homozygosity for 11 populations where >90% ascertainment has been obtained. The United States was shown to contain one of the most heterogeneous populations, with homozygosity values similar to Sicily and ethnically mixed sample populations in Europe. The extent of allelic heterogeneity must be a major determining factor in the choice of mutation-detection methodology for molecular diagnosis in PAH deficiency. 47 refs., 1 fig., 5 tabs.

  16. Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

    Science.gov (United States)

    Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

    2012-12-01

    NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

  17. Nelson`s syndrome associated with a somatic frame shift mutation in the glucocorticoid recepter gene

    Energy Technology Data Exchange (ETDEWEB)

    Karl, M.; Stratakis, C.A.; Chrousos, G.P.; Katz, D.A.; Ali, I.U.; Oldfield, E.H. [National Inst. of Neurological Disorders and Stroke, Bethesda, MD (United States)] [and others

    1996-01-01

    Nelson`s syndrome is the appearance and/or progression of ACTH-secreting pituitary macroadenomas in patients who had previously undergone bilateral adrenalectomy for Cushing`s disease. Extremely high plasma ACTH levels and aggressive neoplastic growth might be explained by the lack of appropriate glucocorticoid negative feedback due to defective glucocorticoid signal transduction. To study the glucocorticoid receptor (GR) gene in Nelson`s syndrome, DNA was extracted from pituitary adenomas and leukocytes of four patients with this condition and amplified by PCR for direct sequence analysis. In one of the tumors, a heterozygous mutation, consisting of an insertion of a thymine between complementary DNA nucleotides 1188 and 1189, was found in exon 2. This frame-shift mutation led to premature termination at amino acid residue 366 of the world-type coding sequence, excluding the expression of a functioning receptor protein from the defective allele. The mutation was not detected in the sequence of the GR gene in the patient`s leukocyte DNA, indicating a somatic origin. By lowering the receptor number in tumorous cells, this defect might have caused local resistance to negative glucocorticoid feedback similar to that caused by the presence of a null allele in a kindred with the generalized glucocorticoid resistance syndrome. P53 protein accumulation, previously reported in 60% of corticotropinomas, could not be detected in any of the four pituitary tumors examined by immunohistochemistry. We suggest that a somatic GR defect might have played a pathophysiological role in the tumorigenesis of the corticotropinoma bearing this mutation. 35 refs., 3 figs., 1 tab.

  18. A novel mutation in the albumin gene (c.1A>C) resulting in analbuminemia.

    Science.gov (United States)

    Caridi, Gianluca; Dagnino, Monica; Lugani, Francesca; Shalev, Stavit A; Campagnoli, Monica; Galliano, Monica; Spiegel, Ronen; Minchiotti, Lorenzo

    2013-01-01

    Analbuminemia (OMIM # 103600) is a rare autosomal recessive disorder manifested by the absence or severe reduction of circulating serum albumin in homozygous or compound heterozygous subjects. The trait is caused by a variety of mutations within the albumin gene. We report here the clinical and molecular characterisation of two new cases of congenital analbuminemia diagnosed in two members of the Druze population living in a Galilean village (Northern Israel) on the basis of their low level of circulating albumin. The albumin gene was screened by single-strand conformation polymorphism and heteroduplex analysis, and the mutated region was submitted to DNA sequencing. Both the analbuminemic subjects resulted homozygous for a previously unreported c.1 A>C transversion, for which we suggest the name Afula from the hospital where the two cases were investigated. This mutation causes the loss of the primary start codon ATG for Met1, which is replaced by a - then untranslated - triplet CTG for Leu. (p.Met1Leu). The use of an alternative downstream ATG codon would probably give rise to a completely aberrant polypeptide chain, leading to a misrouted intracellular transport and a premature degradation. The discovery of this new ALB mutation, probably inherited from a common ancestor, sheds light on the molecular mechanism underlying the analbuminemic trait and may serve in the development of a rapid genetic test for the identification of a-symptomatic heterozygous carriers in the Druze population in the Galilee. © 2012 The Authors. European Journal of Clinical Investigation © 2012 Stichting European Society for Clinical Investigation Journal Foundation.

  19. ABCG2 in peptic ulcer: gene expression and mutation analysis.

    Science.gov (United States)

    Salagacka-Kubiak, Aleksandra; Żebrowska, Marta; Wosiak, Agnieszka; Balcerczak, Mariusz; Mirowski, Marek; Balcerczak, Ewa

    2016-08-01

    The aim of this study was to evaluate the participation of polymorphism at position C421A and mRNA expression of the ABCG2 gene in the development of peptic ulcers, which is a very common and severe disease. ABCG2, encoded by the ABCG2 gene, has been found inter alia in the gastrointestinal tract, where it plays a protective role eliminating xenobiotics from cells into the extracellular environment. The materials for the study were biopsies of gastric mucosa taken during a routine endoscopy. For genotyping by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) at position C421A, DNA was isolated from 201 samples, while for the mRNA expression level by real-time PCR, RNA was isolated from 60 patients. The control group of healthy individuals consisted of 97 blood donors. The dominant genotype in the group of peptic ulcer patients and healthy individuals was homozygous CC. No statistically significant differences between healthy individuals and the whole group of peptic ulcer patients and, likewise, between the subgroups of peptic ulcer patients (infected and uninfected with Helicobacter pylori) were found. ABCG2 expression relative to GAPDH expression was found in 38 of the 60 gastric mucosa samples. The expression level of the gene varies greatly among cases. The statistically significant differences between the intensity (p = 0.0375) of H. pylori infection and ABCG2 gene expression have been shown. It was observed that the more intense the infection, the higher the level of ABCG2 expression.

  20. Novel heterozygous nonsense mutation of the OPTN gene segregating in a Danish family with ALS

    DEFF Research Database (Denmark)

    Tümer, Zeynep; Bertelsen, Birgitte; Gredal, Ole

    2012-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder. About 10% of ALS cases are familial (FALS) and the genetic defect is known only in approximately 20%-30% of these cases. The most common genetic cause of ALS is SOD1 (superoxide dismutase 1) mutation. Very recently......, mutations of the optineurin gene (OPTN), which is involved in open-angle glaucoma, were identified in 3 Japanese patients/families with ALS, and subsequently in a few FALS patients of European descent. We found a heterozygous nonsense mutation (c.493C>T, p.Gln165X, exon 6) in the OPTN gene in a Danish...... patient with ALS, and the mutation segregated from his affected father. The p.Gln165X mutation could not be detected in 1070 healthy Danish controls, in 1000 Danish individuals with metabolic phenotypes or in 64 sporadic ALS (SALS) cases. The p.Gln165X mutation described in this study is the first...

  1. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    Science.gov (United States)

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  2. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  3. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    Science.gov (United States)

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  4. X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.

    Science.gov (United States)

    Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L

    2017-01-01

    We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.

  5. Prevalence of alpha-1 antitrypsin deficiency and hereditary hemochromatosis gene mutations in Algarve, Portugal

    OpenAIRE

    Barreto da Silva, Marta; Gaio, Vânia; Fernandes, Aida; Mendonça, Francisco; Horta Correia, Filomena; Beleza, Álvaro; Gil, Ana Paula; Bourbon, Mafalda; Vicente, A.M.; Dias, Carlos Matias

    2012-01-01

    Alpha-1 antitrypsin (AAT) deficiency and hereditary hemochromatosis (HH) are two of the most fatal genetic disorders in adult life, affecting million individuals worldwide. They are often under-diagnosed conditions and diagnosis is only made when the patient is already in the advanced stages of damage. AAT deficiency results from mutations in one highly pleiomorphic gene located on chromosome 14, SERPINA 1, being Z and S mutations the most relevant clinically. These mutations will lead to an ...

  6. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

    Science.gov (United States)

    Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

    2017-10-03

    A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

  7. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

    Science.gov (United States)

    Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário

    2017-01-01

    A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564

  8. Activating HER2 mutations in HER2 gene amplification negative breast cancer.

    Science.gov (United States)

    Bose, Ron; Kavuri, Shyam M; Searleman, Adam C; Shen, Wei; Shen, Dong; Koboldt, Daniel C; Monsey, John; Goel, Nicholas; Aronson, Adam B; Li, Shunqiang; Ma, Cynthia X; Ding, Li; Mardis, Elaine R; Ellis, Matthew J

    2013-02-01

    Data from 8 breast cancer genome-sequencing projects identified 25 patients with HER2 somatic mutations in cancers lacking HER2 gene amplification. To determine the phenotype of these mutations, we functionally characterized 13 HER2 mutations using in vitro kinase assays, protein structure analysis, cell culture, and xenograft experiments. Seven of these mutations are activating mutations, including G309A, D769H, D769Y, V777L, P780ins, V842I, and R896C. HER2 in-frame deletion 755-759, which is homologous to EGF receptor (EGFR) exon 19 in-frame deletions, had a neomorphic phenotype with increased phosphorylation of EGFR or HER3. L755S produced lapatinib resistance, but was not an activating mutation in our experimental systems. All of these mutations were sensitive to the irreversible kinase inhibitor, neratinib. These findings show that HER2 somatic mutation is an alternative mechanism to activate HER2 in breast cancer and they validate HER2 somatic mutations as drug targets for breast cancer treatment. We show that the majority of HER2 somatic mutations in breast cancer patients are activating mutations that likely drive tumorigenesis. Several patients had mutations that are resistant to the reversible HER2 inhibitor lapatinib, but are sensitive to the irreversible HER2 inhibitor, neratinib. Our results suggest that patients with HER2 mutation–positive breast cancers could benefit from existing HER2-targeted drugs.

  9. An Undergraduate Laboratory Class Using CRISPR/Cas9 Technology to Mutate Drosophila Genes

    Science.gov (United States)

    Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L.; Chechenova, Maria B.; Guerin, Paul; Cripps, Richard M.

    2016-01-01

    CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using…

  10. Mutational analysis of the BRCA1 gene in 30 Czech ovarian cancer ...

    Indian Academy of Sciences (India)

    Ovarian cancer is one of the most severe of oncological diseases. Inherited mutations in cancer susceptibility genes play a causal role in 5–10% of newly diagnosed tumours. BRCA1 and BRCA2 gene alterations are found in the majority of these cases. The aim of this study was to analyse the BRCA1 gene in the ovarian ...

  11. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

    Science.gov (United States)

    He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

    2013-01-25

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  12. Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

    Directory of Open Access Journals (Sweden)

    Abdelaziz Tlili

    Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

  13. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    Science.gov (United States)

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  14. Profile of TP53 gene mutations in sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Suitiala, Tuula

    2010-01-01

    databases for head and neck squamous cell carcinoma (24%). Characteristically, in our SNC series, the mutations were scattered over a large number of codons, codon 248 being the most frequent target of base substitution. Codon 135 was the second most frequently mutated codon; this nucleotide position has...

  15. Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

    Science.gov (United States)

    Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

    2017-01-01

    Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  16. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

    Science.gov (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

    2016-07-02

    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  17. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  18. Mutation analysis of the NRXN1 gene in autism spectrum disorders

    Directory of Open Access Journals (Sweden)

    Onay H

    2016-12-01

    Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

  19. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    Science.gov (United States)

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  20. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    Science.gov (United States)

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  1. GJB2 and mitochondrial A1555G gene mutations in nonsyndromic ...

    Indian Academy of Sciences (India)

    GJB2 mutations in 21.4% of the families in this country. (Bayazit et al. 2003). In this study, GJB2 gene mutations were responsible for 14.7% of genetic nonsyndromic hear- ing losses and 12.5% of the familial cases. These results are lower than in the previous reports where the patient selec- tion criteria may play a role.

  2. Mutations in the S gene region of hepatitis B virus genotype D in ...

    Indian Academy of Sciences (India)

    The gene region of the hepatitis B virus (HBV) is responsible for the expression of surface antigens and includes the 'a'-determinant region. Thus, mutation(s) in this region would afford HBV variants a distinct survival advantage, permitting the mutant virus to escape from the immune system. The aim of this study was to ...

  3. Somatic gene mutation in the human in relation to radiation risk

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1992-01-01

    This report discusses the measurement of somatic gene-mutation frequencies in the human. We ask the following questions. How well can they be measured? Do they respond to radiation? Can they also function as a dosimeter? What do they tell us about the somatic mutation theory of carcinogenesis?

  4. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Galaxy

    2013-05-15

    May 15, 2013 ... spasm among Japanese (Nakayama et al., 1999; Casas et al., 2006). It is believed that these mutations might result in altered NO metabolism and impaired .... ship between T-786C mutation of eNOS gene and CAD specifically in the Iranian population. To our knowledge, this polymorphism has never been ...

  5. Tumor-specific mutations in low-frequency genes affect their functional properties

    NARCIS (Netherlands)

    L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)

    2015-01-01

    textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes

  6. Mutations in rpoB and katG genes of multidrug resistant ...

    African Journals Online (AJOL)

    Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

  7. Pleiotropic effect of his gene mutations on nitrogen fixation in Klebsiella pneumoniae

    DEFF Research Database (Denmark)

    Jensen, Jens Stougaard; Kennedy, C

    1982-01-01

    retained a Nif plate phenotype. A hisA mutation had a similar but more dramatic effect. At low concentrations of histidine the hisA mutant strain had only 5% of the nitrogenase activity found at high histidine concentration or in a his strain, and was also Nif on low histidine agar plates. Addition...... of adenine restored nitrogenase activity in the hisA but not the hisB, hisC, or hisD mutants. Low levels of intracellular ATP, a consequence of hisG enzyme activity, correlated with loss of nitrogen-fixing ability in the hisA mutant which failed to sustain nif gene expression under these conditions....... Synthesis of other major cell proteins was relatively unaffected indicating that nif gene expression is selectively regulated by the energy status of the organism....

  8. Mutation at codon 442 in the rpoB gene of Mycobacterium leprae does not confer resistance to rifampicin.

    Science.gov (United States)

    Lavania, Mallika; Hena, Abu; Reja, Hasanoor; Nigam, Astha; Biswas, Nibir Kumar; Singh, Itu; Turankar, Ravindra P; Gupta, Ud; Kumar, Senthil; Rewaria, Latika; Patra, Pradip K R; Sengupta, Utpal; Bhattacharya, Basudeb

    2016-03-01

    Rifampicin is the major drug in the treatment of leprosy. The rifampicin resistance of Mycobacterium leprae results from a mutation in the rpoB gene, encoding the β subunit of RNA polymerase. As M. leprae is a non-cultivable organism observation of its growth using mouse food-pad (MFP) is the only Gold Standard assay used for confirmation of "in-vivo" drug resistance. Any mutation at molecular level has to be verified by MFP assay for final confirmation of drug resistance in leprosy. In the present study, M. leprae strains showing a mutation only at codon 442 Gln-His and along with mutation either at codon 424 Val-Gly or at 438 Gln-Val within the Rifampicin Resistance Determining Region (RRDR) confirmed by DNA sequencing and by high resolution melting (HRM) analysis were subjected for its growth in MFP. The M. leprae strain having the new mutation at codon 442 Gln-His was found to be sensitive to all the three drugs and strains having additional mutations at 424 Val-Gly and 438 Gln-Val were conferring resistance with Multi drug therapy (MDT) in MFP. These results indicate that MFP is the gold standard method for confirming the mutations detected by molecular techniques.

  9. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  10. Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome

    Directory of Open Access Journals (Sweden)

    Mona L. Essawi

    2013-11-01

    Conclusion: Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS.

  11. six novel mutations in the TSC1 and TSC2 genes

    Indian Academy of Sciences (India)

    M. GLUSHKOVA

    2018-04-30

    Apr 30, 2018 ... RESEARCH ARTICLE ... nant disorder caused by inactivating TSC1 or TSC2 gene variants (Van ... premature protein truncation, while missense mutations are rare ..... TSC2 variants in our cohort are missense, frame-shift.

  12. Sequence analysis of tyrosinase gene in ocular and oculocutaneous albinism patients: introducing three novel mutations.

    Science.gov (United States)

    Khordadpoor-Deilamani, Faravareh; Akbari, Mohammad Taghi; Karimipoor, Morteza; Javadi, Gholamreza

    2015-01-01

    Albinism is a heterogeneous genetic disorder of melanin synthesis that results in hypopigmented eyes (in patients with ocular albinism) or hair, skin, and eyes (in individuals with oculocutaneous albinism). It is associated with decreased visual acuity, nystagmus, strabismus, and photophobia. The tyrosinase gene is known to be involved in both oculocutaneous albinism and autosomal recessive ocular albinism. In this study, we aimed to screen the mutations in the TYR gene in the nonsyndromic OCA and autosomal recessive ocular albinism patients from Iran. The tyrosinase gene was examined in 23 unrelated patients with autosomal recessive ocular albinism or nonsyndromic OCA using DNA sequencing and bioinformatics analysis. TYR gene mutations were identified in 14 (app. 60%) albinism patients. We found 10 mutations, 3 of which were novel. No mutation was found in our ocular albinism patients, but one of them was heterozygous for the p.R402Q polymorphism.

  13. Characterization of V71M mutation in the aquaporin-2 gene causing ...

    Indian Academy of Sciences (India)

    Introduction. The aquaporin-2 (AQP2) water channel plays an important ... X-ray structure of lens aquaporin-0 open form (Lens Mip) as template (pdb. Keywords. AQP2 gene; nephrogenic diabetes insipidus; mutation; structural modelling.

  14. [Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

    Science.gov (United States)

    Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

    2008-06-01

    To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

  15. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    Science.gov (United States)

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  16. Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

    Directory of Open Access Journals (Sweden)

    Marianna P.R. Porto

    2010-01-01

    Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

  17. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    Science.gov (United States)

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  18. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  19. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

    Directory of Open Access Journals (Sweden)

    Hai Hu

    2017-10-01

    Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  20. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  1. Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

    Science.gov (United States)

    Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

    2016-06-15

    This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

  2. Application of DNA chips in the analysis of gene mutation in HBV

    International Nuclear Information System (INIS)

    Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

    2005-01-01

    Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

  3. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  4. Adverse events in families with hypertrophic or dilated cardiomyopathy and mutations in the MYBPC3 gene

    Directory of Open Access Journals (Sweden)

    Lehrke Stephanie

    2008-10-01

    Full Text Available Abstract Background Mutations in MYBPC3 encoding myosin binding protein C belong to the most frequent causes of hypertrophic cardiomyopathy (HCM and may also lead to dilated cardiomyopathy (DCM. MYBPC3 mutations initially were considered to cause a benign form of HCM. The aim of this study was to examine the clinical outcome of patients and their relatives with 18 different MYBPC3 mutations. Methods 87 patients with HCM and 71 patients with DCM were screened for MYBPC3 mutations by denaturing gradient gel electrophoresis and sequencing. Close relatives of mutation carriers were genotyped for the respective mutation. Relatives with mutation were then evaluated by echocardiography and magnetic resonance imaging. A detailed family history regarding adverse clinical events was recorded. Results In 16 HCM (18.4% and two DCM (2.8% index patients a mutation was detected. Seven mutations were novel. Mutation carriers exhibited no additional mutations in genes MYH7, TNNT2, TNNI3, ACTC and TPM1. Including relatives of twelve families, a total number of 42 mutation carriers was identified of which eleven (26.2% had at least one adverse event. Considering the twelve families and six single patients with mutations, 45 individuals with cardiomyopathy and nine with borderline phenotype were identified. Among the 45 patients, 23 (51.1% suffered from an adverse event. In eleven patients of seven families an unexplained sudden death was reported at the age between 13 and 67 years. Stroke or a transient ischemic attack occurred in six patients of five families. At least one adverse event occurred in eleven of twelve families. Conclusion MYBPC3 mutations can be associated with cardiac events such as progressive heart failure, stroke and sudden death even at younger age. Therefore, patients with MYBPC3 mutations require thorough clinical risk assessment.

  5. NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

    Directory of Open Access Journals (Sweden)

    Maija Wolf

    2005-01-01

    Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

  6. Mutation of the S and 3c genes in genomes of feline coronaviruses.

    Science.gov (United States)

    Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

    2018-05-17

    Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

  7. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  8. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  9. Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

    Science.gov (United States)

    Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

    2016-12-01

    This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

  10. DGGE based whole-gene mutation scanning of the dystrophlin gene in Duchenne and Becker muscular dystrophy patients

    NARCIS (Netherlands)

    Hofstra, RMW; Mulder, IM; Vossen, R; de Koning-Gans, PAM; Kraak, M; Ginjaar, IB; van der Hout, AH; Bakker, E; Buys, CHCM; van Essen, AJ; den Dunnen, JT

    2004-01-01

    Duchenne and Becker muscular dystrophy (DMD and BMD) are caused by mutations in the dystrophin gene. Large rearrangements in the gene are found in about two,thirds of DMD patients, with similar to60% carrying deletions and 5-10% carrying duplications. Most of the remaining 30-35% of patients are

  11. Evaluation of point mutations in dystrophin gene in Iranian ...

    Indian Academy of Sciences (India)

    5Department of Biology, Science and Research Branch, Islamic Azad ... Dystrophin protein is found ... Duchenne and Becker muscular dystrophy; neuromuscular disorder; point mutation. ..... modern diagnostic techniques to a large cohort.

  12. RET gene mutations and polymorphisms in medullary thyroid ...

    Indian Academy of Sciences (India)

    51 clinically diagnosed MTC patients, 39 family members of patients and 50 normal individuals. The method of .... Documentation system (Amersham Pharmacia Biotech,. Uppsala ... direct nucleotide sequencing to identify the mutations, using.

  13. Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

    Directory of Open Access Journals (Sweden)

    Jenifer L Marks

    2007-05-01

    Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

  14. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    OpenAIRE

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.; Papadopoulos, Nickolas; Malek, Sami N.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell...

  15. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

    OpenAIRE

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among t...

  16. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    Science.gov (United States)

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  17. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    Science.gov (United States)

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  18. Staphylococcus aureus colonization in atopic eczema and its association with filaggrin gene mutations

    DEFF Research Database (Denmark)

    Clausen, M. L.; Edslev, S. M.; Andersen, P. S.

    2017-01-01

    was to assess differences in S. aureus colonization in patients with AD with and without filaggrin gene mutations. The secondary aim was to assess disease severity in relation to S. aureus colonization. Exploratory analyses were performed to investigate S. aureus genetic lineages in relation to filaggrin gene...... were characterized with respect to disease severity (Scoring Atopic Dermatitis) and FLG mutations (n = 88). Fisher's exact test was used to analyse differences in S. aureus colonization in relation to FLG mutations. Results: Of the 101 patients included, 74 (73%) were colonized with S. aureus....... Of the colonized patients, 70 (95%) carried only one CC type in all three different sampling sites. In lesional skin, S. aureus was found in 24 of 31 patients with FLG mutations vs. 24 of 54 wild-type patients (P = 0·0004). Staphylococcus aureusCC1 clonal lineage was more prevalent in patients with FLG mutations...

  19. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    Science.gov (United States)

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  20. Association of mutations in the hemochromatosis gene with shorter life expectancy

    DEFF Research Database (Denmark)

    Bathum, L; Christiansen, L; Nybo, H

    2001-01-01

    BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

  1. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

    1996-07-26

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

  2. Identification of four novel mutations of the WFS1 gene in Iranian Wolfram syndrome pedigrees.

    Science.gov (United States)

    Ghahraman, Martha; Abbaszadegan, Mohammad Reza; Vakili, Rahim; Hosseini, Sousan; Fardi Golyan, Fatemeh; Ghaemi, Nosrat; Forghanifard, Mohammad Mahdi

    2016-12-01

    Wolfram syndrome is a rare neurodegenerative disorder with an autosomal recessive pattern of inheritance characterized by various clinical manifestations. The related gene, WFS1, encodes a transmembrane glycoprotein, named wolframin. Genetic analyses demonstrated that mutations in this gene are associated with WS type 1. Our aim in this study was to sequence WFS1 coding region in Iranian Wolfram syndrome pedigrees. Genomic DNA was extracted from peripheral blood of 12 WS patients and their healthy parents. Exons 2-8 and the exon-intron junctions of WFS1 were sequenced. DNA sequences were compared to the reference using Sequencher software. Molecular analysis of WFS1 revealed six different mutations. Four novel and two previously reported mutations were identified. One novel mutation, c.1379_1381del, is predicted to produce an aberrant protein. A second novel mutation, c.1384G > T, encodes a truncated protein. Novel mutation, c.1097-1107dup (11 bp), causes a frameshift which results in a premature stop codon. We screened for the novel missense mutation, c.1010C > T, in 100 control alleles. This mutation was not found in any of the healthy controls. Our study increased the spectrum of WFS1 mutations and supported the role of WFS1 in susceptibility to WS. We hope that these findings open new horizons to future molecular investigations which may help to prevent and treat this devastating disease.

  3. INVESTIGATION OF RANGES AND FREQUENCY OF MUTATIONS IN THE embB GENE IN MYCOBACTERIUMTUBERCULOSIS ASSOCIATED WITH RESISTANCE TO ETHAMBUTOL USING REAL-TIME POLYMERASE CHAINREACTION

    Directory of Open Access Journals (Sweden)

    Yu. S. Аlyapkinа

    2017-01-01

    Full Text Available Based on real-time allele-specific polymerase chain reaction, the ranges of potential mutations in codons of 306 and 405 of the embBgene in Mycobacterium tuberculosis associated with resistance to ethambutol were investigated. 5 different mutations were detected in codon 306 and 3 mutations were found in codon 406 of the embB gene. The detected mutations were confirmed by sequencing and mass spectrometry. By analyzing the frequency of detected mutations of , the set of reagents was developed for rapid testing of susceptibility tuberculous mycobacteria to ethambutol by multi-competitive allele-specific real-time PCR. Out of 107 tested specimens of clinical isolates, mutations of the embB gene of M. tuberculosis were detected in 49 (45.8% specimens, and no mutations were found in 58 (52.2% specimens. 39 (36.4% specimens had mutations in codon 306 of the embB gene, and 9 (8.4% specimens had a mutation in codon 406, and 1 (0.9% specimen had mutations in both codons 306 and 406. The high level of agreement in the results of molecular genetic and bacteriological tests (84% proved the significance of mutations in codons 306 and 406 of the embB gene in M. tuberculosis and the need for their identification in order to detect ethambutol resistant strains of M. tuberculosis. When using molecular genetic tests, the sensitivity level made 75.8%, while the specificity of standard culture-based methods makes 95.6%.

  4. [Mutation analysis of FAH gene in patients with tyrosinemia type 1].

    Science.gov (United States)

    Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She

    2013-04-01

    To investigate the clinical features and mutations of the FAH gene. Clinical records of two cases were collected, and diagnosis was made according to the diagnostic criteria of the International Organization for Rare Disorders (NORD). Genomic DNA was extracted from peripheral blood leukocytes with QIAamp DNA Mini Kit. The DNA extracts were subjected to direct sequencing for 14 exons together with adjacent fragments of FAH gene using ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) after PCR based on genomic DNA. The mutation source was verified by analyzing parents' exons corresponding to patients' mutation exons. The homology between human FAH enzyme and that of other species was surveyed using software Clustal X(European Bioinformatics Institute, Hinxton, Saffron Walde, UK). Polyphen (Polymorphism Phenotyping), available online, were used to predict possible impact of an amino acid substitution on structure and function of FAH enzyme. Polyphen calculates position-specific independent counts (PISC) scores for two amino acid variants in polymorphic position. A PISC scores that differ by > 2 were regarded as indicating the probability of damaging variants. Patient 1 was a 5 months and 21 days-old boy who suffered from persistent diarrhea, hepatomegaly, ascites; Alpha-fetoprotein > 1210 µg/L, levels of tyrosine in blood and succinylacetone in urine were 110.8 µmol/L and 83.7 µmol/L. His sister suffered from tyrosinemia type 1. Direct sequencing showed a G to A transition in CDS position 455 and 1027. He was compound heterozygous for the mutation c.455G > A/c.1027G > A, which predicts a change from tryptophan to a stop codon (TGG > TAG) at position 152 (W152X) and a change from glycine to arginine (GGG > AGG) at position 343 respectively. Patient 2 was a 6 year and 1 month-old girl with late-onset rickets who had signs of hepatosplenomegaly, rachitic rosary, windswept knees. Hypophosphatemia and alkaline phosphatase 1620 IU/L were detected

  5. The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

    Science.gov (United States)

    Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

    2014-12-01

    Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

  6. WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures.

    Science.gov (United States)

    Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin

    2010-10-01

    Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.

  7. Generation and analysis of knock-in mice carrying pseudohypoaldosteronism type II-causing mutations in the cullin 3 gene.

    Science.gov (United States)

    Araki, Yuya; Rai, Tatemitsu; Sohara, Eisei; Mori, Takayasu; Inoue, Yuichi; Isobe, Kiyoshi; Kikuchi, Eriko; Ohta, Akihito; Sasaki, Sei; Uchida, Shinichi

    2015-10-21

    Pseudohypoaldosteronism type II (PHAII) is a hereditary hypertensive disease caused by mutations in four different genes: with-no-lysine kinases (WNK) 1 and 4, Kelch-like family member 3 (KLHL3), and cullin 3 (Cul3). Cul3 and KLHL3 form an E3 ligase complex that ubiquitinates and reduces the expression level of WNK4. PHAII-causing mutations in WNK4 and KLHL3 impair WNK4 ubiquitination. However, the molecular pathogenesis of PHAII caused by Cul3 mutations is unclear. In cultured cells and human leukocytes, PHAII-causing Cul3 mutations result in the skipping of exon 9, producing mutant Cul3 protein lacking 57 amino acids. However, whether this phenomenon occurs in the kidneys and is responsible for the pathogenesis of PHAII in vivo is unknown. We generated knock-in mice carrying a mutation in the C-terminus of intron 8 of Cul3, c.1207-1G>A, which corresponds to a PHAII-causing mutation in the human Cul3 gene. Heterozygous Cul3(G(-1)A/+) knock-in mice did not exhibit PHAII phenotypes, and the skipping of exon 9 was not evident in their kidneys. However, the level of Cul3 mRNA expression in the kidneys of heterozygous knock-in mice was approximately half that of wild-type mice. Furthermore, homozygous knock-in mice were nonviable. It suggested that the mutant allele behaved like a knockout allele and did not produce Cul3 mRNA lacking exon 9. A reduction in Cul3 expression alone was not sufficient to develop PHAII in the knock-in mice. Our findings highlighted the pathogenic role of mutant Cul3 protein and provided insight to explain why PHAII-causing mutations in Cul3 cause kidney-predominant PHAII phenotypes. © 2015. Published by The Company of Biologists Ltd.

  8. Analysis of gene mutations in children with cholestasis of undefined etiology.

    Science.gov (United States)

    Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A

    2010-10-01

    The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.

  9. Four Novel Mutations in the ALPL Gene in Chinese patients with Odonto, Childhood and Adult Hypophosphatasia.

    Science.gov (United States)

    Xu, Lijun; Pang, Qianqian; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiaoping; Xia, Weibo

    2018-05-03

    Background and purpose: Hypophosphatasiais (HPP) is a rare inherited disorder characterized by defective bone and/or dental mineralization, and decreased serum alkaline phosphatase activity. ALPL , the only gene related with HPP, encodes tissue non-specific alkaline phosphatase (TNSALP). Few studies were carried out in ALPL gene mutations in the Chinese population with HPP. The purpose of this study is to elucidate the clinical and genetic characteristics of HPP in 5 unrelated Chinese families and 2 sporadic patients. Methods : 10 clinically diagnosed HPP patients from 5 unrelated Chinese families and 2 sporadic patients and 50 healthy controls were genetic investigated. All 12 exons and exon-intron boundaries of the ALPL gene were amplified by polymerase chain reaction and directly sequenced. The laboratory and radiological investigations were conducted simultaneously in these 10 HPP patients. A three-dimensional model of the TNSALP was used to predict the dominant negative effect of identified missense mutations. Results : 3 odonto, 3 childhood and 4 adult types of HPP were clinically diagnosed. 10 mutations were identified in 5 unrelated Chinese families and 2 sporadic patients, including 8 missense mutations and 2 frameshift mutations. Of which, 4 were novel: 1 frameshift mutation (p.R138Pfsx45); 3 missense mutations (p.C201R, p.V459A, p.C497S). No identical mutations and any other new ALPL mutations were found in unrelated 50 healthy controls. Conclusions : Our study demonstrated that the ALPL  gene mutations are responsible for HPP in these Chinese families. These findings will be useful for clinicians to improve understanding of this heritable bone disorder. ©2018 The Author(s).

  10. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  11. De novo mutations in synaptic transmission genes including DNM1 cause epileptic encephalopathies

    DEFF Research Database (Denmark)

    2014-01-01

    in five individuals and de novo mutations in GABBR2, FASN, and RYR3 in two individuals each. Unlike previous studies, this cohort is sufficiently large to show a significant excess of de novo mutations in epileptic encephalopathy probands compared to the general population using a likelihood analysis (p...... = 8.2 × 10(-4)), supporting a prominent role for de novo mutations in epileptic encephalopathies. We bring statistical evidence that mutations in DNM1 cause epileptic encephalopathy, find suggestive evidence for a role of three additional genes, and show that at least 12% of analyzed individuals have...... analyzed exome-sequencing data of 356 trios with the "classical" epileptic encephalopathies, infantile spasms and Lennox Gastaut syndrome, including 264 trios previously analyzed by the Epi4K/EPGP consortium. In this expanded cohort, we find 429 de novo mutations, including de novo mutations in DNM1...

  12. Mutations in TP53 tumor suppressor gene in wood dust-related sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Bornholdt, Jette; Heikkilä, Pirjo

    2010-01-01

    The causal role of work-related exposure to wood dust in the development of sinonasal cancer has long been established by numerous epidemiologic studies. To study molecular changes in these tumors, we analyzed TP53 gene mutations in 358 sinonasal cancer cases with or without occupational exposure...... affected the ORs only slightly. Smoking did not influence the occurrence of TP53 mutation; however, it was associated with multiple mutations (p = 0.03). As far as we are aware, this is the first study to demonstrate a high prevalence of TP53 mutation-positive cases in a large collection of sinonasal...... cancers with data on occupational exposure. Our results indicate that mutational mechanisms, in particular TP53 mutations, are associated with work-related exposure to wood dust in sinonasal cancer....

  13. Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

    1994-03-01

    Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

  14. The prognostic impact of mutations in spliceosomal genes for myelodysplastic syndrome patients without ring sideroblasts

    International Nuclear Information System (INIS)

    Kang, Min-Gu; Kim, Hye-Ran; Seo, Bo-Young; Lee, Jun Hyung; Choi, Seok-Yong; Kim, Soo-Hyun; Shin, Jong-Hee; Suh, Soon-Pal; Ahn, Jae-Sook; Shin, Myung-Geun

    2015-01-01

    Mutations in genes that are part of the splicing machinery for myelodysplastic syndromes (MDS), including MDS without ring sideroblasts (RS), have been widely investigated. The effects of these mutations on clinical outcomes have been diverse and contrasting. We examined a cohort of 129 de novo MDS patients, who did not harbor RS, for mutations affecting three spliceosomal genes (SF3B1, U2AF1, and SRSF2). The mutation rates of SF3B1, U2AF1, and SRSF2 were 7.0 %, 7.8 %, and 10.1 %, respectively. Compared with previously reported results, these rates were relatively infrequent. The SRSF2 mutation strongly correlated with old age (P < 0.001), while the mutation status of SF3B1 did not affect overall survival (OS), progression-free survival (PFS), or acute myeloid leukemia (AML) transformation. In contrast, MDS patients with mutations in U2AF1 or SRSF2 exhibited inferior PFS. The U2AF1 mutation was associated with inferior OS in low-risk MDS patients (P = 0.035). The SRSF2 mutation was somewhat associated with AML transformation (P = 0.083). Our findings suggest that the frequencies of the SF3B1, U2AF1, and SRSF2 splicing gene mutations in MDS without RS were relatively low. We also demonstrated that the U2AF1 and SRSF2 mutations were associated with an unfavorable prognostic impact in MDS patients without RS. The online version of this article (doi:10.1186/s12885-015-1493-5) contains supplementary material, which is available to authorized users

  15. Mutational profile of KIT and PDGFRA genes in gastrointestinal stromal tumors in Peruvian samples

    Directory of Open Access Journals (Sweden)

    José Buleje

    2015-02-01

    Full Text Available Introduction: Gastrointestinal stromal tumors (GISTs are mesenchymal neoplasms usually caused by somatic mutations in the genes KIT (c-KIT or PDGFRA. Mutation characterization has become an important exam for GIST patients because it is useful in predicting the response to the inhibitors of receptor tyrosine kinase (RTK. Objectives: The aim of this study was to determine the frequency of KIT and PDGFRA mutations in 25 GIST samples collected over two years at two national reference hospitals in Peru. There were 21 samples collected from the Instituto Nacional de Enfermedades Neoplásicas (INEN, national cancer center and 4 samples collected from Hospital A. Loayza. Methods and materials: In this retrospective study, we performed polymerase chain reaction (PCR amplification and deoxyribonucleic acid (DNA sequencing of KIT (exons 9, 11, 13, and 17 and PDGFRA (exons 12 and 18 genes in 20 FFPE (formalin-fixed, paraffin-embedded and 5 frozen GIST samples. Results: We report 21 mutations, including deletions, duplications, and missense, no mutations in 2 samples, and 2 samples with no useful DNA for further analysis. Eighty-six percent of these mutations were located in exon 11 of KIT, and 14 % were located in exon 18 of PDGFRA. Conclusions: Our study identified mutations in 21 out of 25 GIST samples from 2 referential national hospitals in Peru, and the mutation proportion follows a global tendency observed from previous studies (i.e., the majority of samples presented KIT mutations followed by a minor percentage of PDGFRA mutations. This study presents the first mutation data of the KIT and PDGFRA genes from Peruvian individuals with GIST.

  16. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    Science.gov (United States)

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  17. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    Science.gov (United States)

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  18. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia

    Energy Technology Data Exchange (ETDEWEB)

    Stoilov, I.; Kilpatrick, M.W.; Tsipouras, P. [Univ. of Connecticut Health Center, Farmington, CT (United States)

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Futhermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3. 27 refs., 2 figs.

  19. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  20. Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Wang Hongmei; Wu Xinyao; Xia Yunfei

    2002-01-01

    Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations

  1. Case report of novel CACNA1A gene mutation causing episodic ataxia type 2

    Directory of Open Access Journals (Sweden)

    David Alan Isaacs

    2017-05-01

    Full Text Available Background: Episodic ataxia type 2 (OMIM 108500 is an autosomal dominant channelopathy characterized by paroxysms of ataxia, vertigo, nausea, and other neurologic symptoms. More than 50 mutations of the CACNA1A gene have been discovered in families with episodic ataxia type 2, although 30%–50% of all patients with typical episodic ataxia type 2 phenotype have no detectable mutation of the CACNA1A gene. Case: A 46-year-old Caucasian man, with a long history of bouts of imbalance, vertigo, and nausea, presented to our hospital with 2 weeks of ataxia and headache. Subsequent evaluation revealed a novel mutation in the CACNA1A gene: c.1364 G > A Arg455Gln. Acetazolamide was initiated with symptomatic improvement. Conclusion: This case report expands the list of known CACNA1A mutations associated with episodic ataxia type 2.

  2. Mutations of 3c and spike protein genes correlate with the occurrence of feline infectious peritonitis.

    Science.gov (United States)

    Bank-Wolf, Barbara Regina; Stallkamp, Iris; Wiese, Svenja; Moritz, Andreas; Tekes, Gergely; Thiel, Heinz-Jürgen

    2014-10-10

    The genes encoding accessory proteins 3a, 3b, 3c, 7a and 7b, the S2 domain of the spike (S) protein gene and the membrane (M) protein gene of feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV) samples were amplified, cloned and sequenced. For this faeces and/or ascites samples from 19 cats suffering from feline infectious peritonitis (FIP) as well as from 20 FECV-infected healthy cats were used. Sequence comparisons revealed that 3c genes of animals with FIP were heavily affected by nucleotide deletions and point mutations compared to animals infected with FECV; these alterations resulted either in early termination or destruction of the translation initiation codon. Two ascites-derived samples of cats with FIP which displayed no alterations of ORF3c harboured mutations in the S2 domain of the S protein gene which resulted in amino acid exchanges or deletions. Moreover, changes in 3c were often accompanied by mutations in S2. In contrast, in samples obtained from faeces of healthy cats, the ORF3c was never affected by such mutations. Similarly ORF3c from faecal samples of the cats with FIP was mostly intact and showed only in a few cases the same mutations found in the respective ascites samples. The genes encoding 3a, 3b, 7a and 7b displayed no mutations linked to the feline coronavirus (FCoV) biotype. The M protein gene was found to be conserved between FECV and FIPV samples. Our findings suggest that mutations of 3c and spike protein genes correlate with the occurrence of FIP. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    Science.gov (United States)

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  4. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    Science.gov (United States)

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  5. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  6. A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Chujun Wu

    2016-12-01

    Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

  7. Colorectal Adenomatous Polyposis: Heterogeneity of Susceptibility Gene Mutations and Phenotypes in a Cohort of Italian Patients.

    Science.gov (United States)

    Marabelli, Monica; Molinaro, Valeria; Abou Khouzam, Raefa; Berrino, Enrico; Panero, Mara; Balsamo, Antonella; Venesio, Tiziana; Ranzani, Guglielmina Nadia

    2016-12-01

    Colorectal adenomatous polyposis entailing cancer predisposition is caused by constitutional mutations in different genes. APC is associated with the familial adenomatous polyposis (FAP/AFAP) and MUTYH with the MUTYH-associated polyposis (MAP), while POLE and POLD1 mutations cause the polymerase proofreading-associated polyposis (PPAP). We screened for mutations in patients with multiple adenomas/FAP: 121 patients were analyzed for APC and MUTYH mutations, and 36 patients were also evaluated for POLE and POLD1 gene mutations. We found 20 FAP/AFAP, 15 MAP, and no PPAP subjects: pathogenic mutations proved to be heterogeneous, and included 5 APC and 1 MUTYH novel mutations. The mutation detection rate was significantly different between patients with 5-100 polyps and those with >100 polyps (p = 8.154 × 10 -7 ), with APC mutations being associated with an aggressive phenotype (p = 1.279 × 10 -9 ). Mean age at diagnosis was lower in FAP/AFAP compared to MAP (p = 3.055 × 10 -4 ). Mutation-negative probands showed a mean age at diagnosis that was significantly higher than FAP/AFAP (p = 3.46986 × 10 -7 ) and included 45.3% of patients with <30 polyps and 70.9% of patients with no family history. This study enlarges the APC and MUTYH mutational spectra, and also evaluated variants of uncertain significance, including the MUTYH p.Gln338His mutation. Moreover this study underscores the phenotypic heterogeneity and genotype-phenotype correlations in a cohort of Italian patients.

  8. Hyperthyroidism caused by a germline activating mutation of the thyrotropin receptor gene: difficulties in diagnosis and therapy.

    Science.gov (United States)

    Bertalan, Rita; Sallai, Agnes; Sólyom, János; Lotz, Gábor; Szabó, István; Kovács, Balázs; Szabó, Eva; Patócs, Attila; Rácz, Károly

    2010-03-01

    Germline activating mutations of the thyrotropin receptor (TSHR) gene have been considered as the only known cause of sporadic nonautoimmune hyperthyroidism in the pediatric population. Here we describe the long-term follow-up and evaluation of a patient with sporadic nonautoimmune primary hyperthyroidism who was found to have a de novo germline activating mutation of the TSHR gene. The patient was an infant who presented at the age of 10 months in an unconscious state with exsiccation, wet skin, fever, and tachycardia. Nonautoimmune primary hyperthyroidism was diagnosed, and brain magnetic resonance imaging and computed tomography showed also Arnold-Chiari malformation type I. Continuous propylthiouracil treatment resulted in a prolonged clinical cure lasting for 10 years. At the age of 11 years and 5 months the patient underwent subtotal thyroidectomy because of symptoms of trachea compression caused by a progressive multinodular goiter. However, 2 months after surgery, hormonal evaluation indicated recurrent hyperthyroidism and the patient was treated with propylthiouracil during the next 4 years. At the age of 15 years the patient again developed symptoms of trachea compression. Radioiodine treatment resulted in a regression of the recurrent goiter and a permanent cure of hyperthyroidism without relapse during the last 3 years of his follow-up. Sequencing of exon 10 of the TSHR gene showed a de novo heterozygous germline I630L mutation, which has been previously described as activating mutation at somatic level in toxic thyroid nodules. The I630L mutation of the TSHR gene occurs not only at somatic level in toxic thyroid nodules, but also its presence in germline is associated with nonautoimmune primary hyperthyroidism. Our case report demonstrates that in this disorder a continuous growth of the thyroid occurs without any evidence of elevated TSH due to antithyroid drug overdosing. This may justify previous recommendations for early treatment of affected

  9. Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers

    Directory of Open Access Journals (Sweden)

    Lieke H.H. Meeter

    2016-07-01

    Full Text Available Background: Pathogenic mutations in the granulin gene (GRN are causative in 5-10% of patients with frontotemporal dementia (FTD, mostly leading to reduced progranulin protein (PGRN levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN (n = 41 and its relationship with cerebrospinal fluid (CSF, n = 32 and specific single nucleotide polymorphisms were investigated in pre- and symptomatic GRN mutation carriers and controls. Results: Plasma PGRN levels were lower in carriers than in controls and showed a mean coefficient of variation of 5.3% in carriers over 1 week. Although plasma PGRN correlated with CSF PGRN in carriers (r = 0.54, p = 0.02, plasma only explained 29% of the variability in CSF PGRN. rs5848, rs646776 and rs1990622 genotypes only partly explained the variability of PGRN levels between subjects. Conclusions: Plasma PGRN is relatively stable over 1 week and therefore seems suitable for treatment monitoring of PGRN-enhancing agents. Since plasma PGRN only moderately correlated with CSF PGRN, CSF sampling will additionally be needed in therapeutic trials.

  10. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  11. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    Directory of Open Access Journals (Sweden)

    Kamakari Smaragda

    2018-01-01

    Full Text Available Aim. To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1. Materials and Methods. A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results. An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%. Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%. In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions. By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations.

  12. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  13. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  14. Glutaric acidemia type II: gene structure and mutations of the electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) gene.

    Science.gov (United States)

    Goodman, Stephen I; Binard, Robert J; Woontner, Michael R; Frerman, Frank E

    2002-01-01

    Glutaric acidemia type II is a human inborn error of metabolism which can be due to defects in either subunit of electron transfer flavoprotein (ETF) or in ETF:ubiquinone oxidoreductase (ETF:QO), but few disease-causing mutations have been described. The ETF:QO gene is located on 4q33, and contains 13 exons. Primers to amplify these exons are presented, together with mutations identified by molecular analysis of 20 ETF:QO-deficient patients. Twenty-one different disease-causing mutations were identified on 36 of the 40 chromosomes.

  15. Mice overexpressing both non-mutated human SOD1 and mutated SOD1G93A genes: a competent experimental model for studying iron metabolism in amyotrophic lateral sclerosis

    Directory of Open Access Journals (Sweden)

    Anna eGajowiak

    2016-01-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive neurodegenerative disease characterized by degeneration and loss of motor neurons in the spinal cord, brainstem and motor cortex. Up to 10% of ALS cases are inherited (familial, fALS and associated with mutations, frequently in the superoxide dismutase 1 (SOD1 gene. Rodent transgenic models of ALS are often used to elucidate a complex pathogenesis of this disease. Of importance, both ALS patients and animals carrying mutated human SOD1 gene show symptoms of oxidative stress and iron metabolism misregulation. The aim of our study was to characterize changes in iron metabolism in one of the most commonly used models of ALS – transgenic mice overexpressing human mutated SOD1G93A gene. We analyzed the expression of iron-related genes in asymptomatic, 2-month old and symptomatic, 4-month old SOD1G93A mice. In parallel, respective age-matched mice overexpressing human non-mutated SOD1 transgene and control mice were analyzed. We demonstrate that the overexpression of both SOD1 and SOD1G93A genes account for a substantial increase in SOD1 protein levels and activity in selected tissues and that not all the changes in iron metabolism genes expression are specific for the overexpression of the mutated form of SOD1.

  16. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  17. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese

    Indian Academy of Sciences (India)

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutationsin COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical ...

  18. Mutation screening of the Ectodysplasin-A receptor gene EDAR in hypohidrotic ectodermal dysplasia

    NARCIS (Netherlands)

    van der Hout, Annemarie H.; Oudesluijs, Gretel G.; Venema, Andrea; Verheij, Joke B. G. M.; Mol, Bart G. J.; Rump, Patrick; Brunner, Han G.; Vos, Yvonne J.; van Essen, Anthonie J.

    Hypohidrotic ectodermal dysplasia (HED) can be caused by mutations in the X-linked ectodysplasin A (ED1) gene or the autosomal ectodysplasin A-receptor (EDAR) and EDAR-associated death domain (EDARADD) genes. X-linked and autosomal forms are sometimes clinically indistinguishable. For genetic

  19. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  20. Mutation in HFE gene decreases manganese accumulation and oxidative stress in the brain after olfactory manganese exposure.

    Science.gov (United States)

    Ye, Qi; Kim, Jonghan

    2016-06-01

    Increased accumulation of manganese (Mn) in the brain is significantly associated with neurobehavioral deficits and impaired brain function. Airborne Mn has a high systemic bioavailability and can be directly taken up into the brain, making it highly neurotoxic. While Mn transport is in part mediated by several iron transporters, the expression of these transporters is altered by the iron regulatory gene, HFE. Mutations in the HFE gene are the major cause of the iron overload disorder, hereditary hemochromatosis, one of the prevalent genetic diseases in humans. However, whether or not HFE mutation modifies Mn-induced neurotoxicity has not been evaluated. Therefore, our goal was to define the role of HFE mutation in Mn deposition in the brain and the resultant neurotoxic effects after olfactory Mn exposure. Mice carrying the H67D HFE mutation, which is homologous to the H63D mutation in humans, and their control, wild-type mice, were intranasally instilled with MnCl2 with different doses (0, 0.2, 1.0 and 5.0 mg kg(-1)) daily for 3 days. Mn levels in the blood, liver and brain were determined using inductively-coupled plasma mass spectrometry (ICP-MS). H67D mutant mice showed significantly lower Mn levels in the blood, liver, and most brain regions, especially in the striatum, while mice fed an iron-overload diet did not. Moreover, mRNA expression of ferroportin, an essential exporter of iron and Mn, was up-regulated in the striatum. In addition, the levels of isoprostane, a marker of lipid peroxidation, were increased in the striatum after Mn exposure in wild-type mice, but were unchanged in H67D mice. Together, our results suggest that the H67D mutation provides decreased susceptibility to Mn accumulation in the brain and neurotoxicity induced by inhaled Mn.

  1. R102W mutation in the RS1 gene responsible for retinoschisis and recurrent glaucoma

    Directory of Open Access Journals (Sweden)

    Xiu-Feng Huang

    2014-02-01

    Full Text Available AIM: To identify the mutations in RS1 gene associated with typical phenotype of X-linked juvenile retinoschisis (XLRS and a rare condition of concomitant glaucoma.METHODS: Complete ophthalmic examinations were performed in the proband. The coding regions of the RS1 gene that encode retinoschisin were amplified by polymerase chain reaction and directly sequenced.RESULTS: The proband showed a typical phenotype of XLRS with large peripheral retinal schisis in both eyes, involving the macula and combined with foveal cystic change, reducing visual acuity. A typical phenotype of recurrent glaucoma with high intraocular pressure (IOP and reduced visual field was also demonstrated with the patient. Mutation analysis of RS1 gene revealed R102W (c.304C>T mutations in the affected male, and his mother was proved to be a carrier with the causative mutation and another synonymous polymorphism (c.576C>CT.CONCLUSION: We identified the genetic variations of a Chinese family with typical phenotype of XLRS and glaucoma. The severe XLRS phenotypes associated with R102W mutations reveal that the mutation determines a notable alteration in the function of the retinoschisin protein. Identification of the disease-causing mutation is beneficial for future clinical references.

  2. A comparative study of mutation screening of sarcomeric genes ...

    African Journals Online (AJOL)

    , TNNT2) using single gene approach versus targeted gene panel next generation sequencing in a cohort of HCM patients in Egypt. Heba Sh. Kassem, Roddy Walsh, Paul J. Barton, Besra S. Abdelghany, Remon S. Azer, Rachel Buchan, ...

  3. Mutation analysis of the STRA6 gene in isolated and non-isolated anophthalmia/microphthalmia.

    Science.gov (United States)

    Chassaing, N; Ragge, N; Kariminejad, A; Buffet, A; Ghaderi-Sohi, S; Martinovic, J; Calvas, P

    2013-03-01

    PDAC syndrome [Pulmonary hypoplasia/agenesis, Diaphragmatic hernia/eventration, Anophthalmia/microphthalmia (A/M) and Cardiac Defect] is a condition associated with recessive mutations in the STRA6 gene in some of these patients. Recently, cases with isolated anophthalmia have been associated with STRA6 mutations. To determine the minimal findings associated with STRA6 mutations, we performed mutation analysis of the STRA6 gene in 28 cases with anophthalmia. In 7 of the cases the anophthalmia was isolated, in 14 cases it was associated with one of the major features included in PDAC and 7 had other abnormalities. Mutations were identified in two individuals: one with bilateral anophthalmia and some features included in PDAC, who was a compound heterozygote for a missense mutation and a large intragenic deletion, and the second case with all the major features of PDAC and who had a homozygous splicing mutation. This study suggests that STRA6 mutations are more likely to be identified in individuals with A/M and other abnormalities included in the PDAC spectrum, rather than in isolated A/M cases. © 2012 John Wiley & Sons A/S.

  4. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  5. Mutation of the planar cell polarity gene VANGL1 in adolescent idiopathic scoliosis

    DEFF Research Database (Denmark)

    Andersen, Malene Rask; Farooq, Muhammad; Koefoed, Karen

    2017-01-01

    STUDY DESIGN: Mutation analysis of a candidate disease gene in a cohort of patients with moderate to severe Adolescent idiopathic scoliosis (AIS). OBJECTIVE: To investigate if damaging mutations in the planar cell polarity gene VANGL1 could be identified in AIS patients. SUMMARY OF BACKGROUND DATA......: AIS is a spinal deformity which occurs in 1-3% of the population. The cause of AIS is often unknown, but genetic factors are important in the etiology. Rare variants in genes encoding regulators of WNT/planar cell polarity (PCP) signaling were recently identified in AIS patients. METHODS: We analyzed...

  6. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    OpenAIRE

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and sev...

  7. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    Science.gov (United States)

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  8. BRCA1 and BRCA2 Gene Mutations Screening In Sporadic Breast Cancer Patients In Kazakhstan.

    Directory of Open Access Journals (Sweden)

    Ainur R. Akilzhanova

    2013-05-01

    Full Text Available Background: A large number of distinct mutations in the BRCA1 and BRCA2 genes have been reported worldwide, but little is known regarding the role of these inherited susceptibility genes in breast cancer risk among Kazakhstan women. Aim: To evaluate the role of BRCA1/2 mutations in Kazakhstan women presenting with sporadic breast cancer. Methods: We investigated the distribution and nature of polymorphisms in BRCA1 and BRCA2 entire coding regions in 156 Kazakhstan sporadic breast cancer cases and 112 age-matched controls using automatic direct sequencing. Results: We identified 22 distinct variants, including 16 missense mutations and 6 polymorphisms in BRCA1/2 genes. In BRCA1, 9 missense mutations and 3 synonymous polymorphisms were observed. In BRCA2, 7 missense mutations and 3 polymorphisms were detected. There was a higher prevalence of observed mutations in Caucasian breast cancer cases compared to Asian cases (p<0.05; higher frequencies of sequence variants were observed in Asian controls. No recurrent or founder mutations were observed in BRCA1/2 genes. There were no statistically significant differences in age at diagnosis, tumor histology, size of tumor, and lymph node involvement between women with breast cancer with or without the BRCA sequence alterations. Conclusions: Considering the majority of breast cancer cases are sporadic, the present study will be helpful in the evaluation of the need for the genetic screening of BRCA1/2 mutations and reliable genetic counseling for Kazakhstan sporadic breast cancer patients. Evaluation of common polymorphisms and mutations and breast cancer risk in families with genetic predisposition to breast cancer is ongoing in another current investigation. 

  9. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  10. Association between loss-of-function mutations in the filaggrin gene and self-reported food allergy and alcohol sensitivity

    DEFF Research Database (Denmark)

    Linneberg, Allan René; Fenger, Runa V; Husemoen, Lise Lotte Nystrup

    2013-01-01

    Loss-of-function mutations of the filaggrin (FLG) gene cause an impaired skin barrier and increase the risk of atopic dermatitis. Interestingly, FLG mutations have also been found to be associated with a high risk of peanut allergy.......Loss-of-function mutations of the filaggrin (FLG) gene cause an impaired skin barrier and increase the risk of atopic dermatitis. Interestingly, FLG mutations have also been found to be associated with a high risk of peanut allergy....

  11. Absence of mutations in the PCI gene in subfertile men

    NARCIS (Netherlands)

    Gianotten, Judith; Schimmel, Alinda W. M.; van der Veen, Fulco; Lombardi, M. Paola; Meijers, Joost C. M.

    2004-01-01

    The molecular aetiology of male subfertility is still unknown in the majority of cases and it is thought that multiple genes are involved. One of the genes that might play a role in male reproductive function is the protein C inhibitor (PCI) gene. In mice the presence of PCI is an absolute

  12. A mutation in the MATP gene causes the cream coat colour in the horse

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2003-01-01

    Full Text Available Abstract In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  13. Missense mutation in the USH2A gene: association with recessive retinitis pigmentosa without hearing loss.

    Science.gov (United States)

    Rivolta, C; Sweklo, E A; Berson, E L; Dryja, T P

    2000-06-01

    Microdeletions Glu767(1-bp del), Thr967(1-bp del), and Leu1446(2-bp del) in the human USH2A gene have been reported to cause Usher syndrome type II, a disorder characterized by retinitis pigmentosa (RP) and mild-to-severe hearing loss. Each of these three frameshift mutations is predicted to lead to an unstable mRNA transcript that, if translated, would result in a truncated protein lacking the carboxy terminus. Here, we report Cys759Phe, a novel missense mutation in this gene that changes an amino-acid residue within the fifth laminin-epidermal growth factor-like domain of the USH2A gene and that is associated with recessive RP without hearing loss. This single mutation was found in 4.5% of 224 patients with recessive RP, suggesting that USH2A could cause more cases of nonsyndromic recessive RP than does any other gene identified to date.

  14. MutaNET: a tool for automated analysis of genomic mutations in gene regulatory networks.

    Science.gov (United States)

    Hollander, Markus; Hamed, Mohamed; Helms, Volkhard; Neininger, Kerstin

    2018-03-01

    Mutations in genomic key elements can influence gene expression and function in various ways, and hence greatly contribute to the phenotype. We developed MutaNET to score the impact of individual mutations on gene regulation and function of a given genome. MutaNET performs statistical analyses of mutations in different genomic regions. The tool also incorporates the mutations in a provided gene regulatory network to estimate their global impact. The integration of a next-generation sequencing pipeline enables calling mutations prior to the analyses. As application example, we used MutaNET to analyze the impact of mutations in antibiotic resistance (AR) genes and their potential effect on AR of bacterial strains. MutaNET is freely available at https://sourceforge.net/projects/mutanet/. It is implemented in Python and supported on Mac OS X, Linux and MS Windows. Step-by-step instructions are available at http://service.bioinformatik.uni-saarland.de/mutanet/. volkhard.helms@bioinformatik.uni-saarland.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  15. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  16. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    Science.gov (United States)

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  17. Clinical and Prognostic Profiles of Cardiomyopathies Caused by Mutations in the Troponin T Gene.

    Science.gov (United States)

    Ripoll-Vera, Tomás; Gámez, José María; Govea, Nancy; Gómez, Yolanda; Núñez, Juana; Socías, Lorenzo; Escandell, Ángela; Rosell, Jorge

    2016-02-01

    Mutations in the troponin T gene (TTNT2) have been associated in small studies with the development of hypertrophic cardiomyopathy characterized by a high risk of sudden death and mild hypertrophy. We describe the clinical course of patients carrying mutations in this gene. We analyzed the clinical characteristics and prognosis of patients with mutations in the TNNT2 gene who were seen in an inherited cardiac disease unit. Of 180 families with genetically studied cardiomyopathies, 21 families (11.7%) were identified as having mutations in TNNT2: 10 families had Arg92Gln, 5 had Arg286His, 3 had Arg278Cys, 1 had Arg92Trp, 1 had Arg94His, and 1 had Ile221Thr. Thirty-three additional genetic carriers were identified through family assessment. The study included 54 genetic carriers: 56% were male, and the mean average age was 41 ± 17 years. There were 33 cases of hypertrophic cardiomyopathy, 9 of dilated cardiomyopathy, and 1 of noncompaction cardiomyopathy, and maximal myocardial thickness was 18.5 ± 6mm. Ventricular dysfunction was present in 30% of individuals and a history of sudden death in 62%. During follow-up, 4 patients died and 14 (33%) received a defibrillator (8 probands, 6 relatives). Mean survival was 54 years. Carriers of Arg92Gln had early disease development, high penetrance, a high risk of sudden death, a high rate of defibrillator implantation, and a high frequency of mixed phenotype. Mutations in the TNNT2 gene were more common in this series than in previous studies. The clinical and prognostic profiles depended on the mutation present. Carriers of the Arg92Gln mutation developed hypertrophic or dilated cardiomyopathy and had a significantly worse prognosis than those with other mutations in TNNT2 or other sarcomeric genes. Copyright © 2015 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  18. Mutations in the glucocerebrosidase gene are common in patients with Parkinson's disease from Eastern Canada.

    Science.gov (United States)

    Han, Fabin; Grimes, David A; Li, Fang; Wang, Ting; Yu, Zhe; Song, Na; Wu, Shichao; Racacho, Lemuel; Bulman, Dennis E

    2016-01-01

    Mutations in the β-glucocerebrosidase gene (GBA) have been implicated as a risk factor for Parkinson's disease (PD). However, GBA mutations in PD patients of different ethnic origins were reported to be inconsistent. We sequenced all exons of the GBA gene in 225 PD patients and 110 control individuals from Eastern Canada. Two novel GBA variants of c.-119 A/G and S(-35)N, five known GBA mutations of R120W, N370S, L444P, RecNciI and RecTL mutation (del55/D409H/RecNciI) as well as two non-pathological variants of E326K and T369M were identified from PD patients while only one mutation of S13L and two non-pathological variants of E326K and T369M were found in the control individuals. The frequency of GBA mutations within PD patients (4.4%) is 4.8 times higher than the 0.91% observed in control individuals (X(2) = 2.91, p = 0.088; odds ratio = 4.835; 95% confidence interval = 2.524-9.123). The most common mutations of N370S and L444P accounted for 36.0% (9/25) of all the GBA mutations in this Eastern Canadian PD cohort. The frequency (6.67%) of E326K and T369M in PD patients is comparable to 7.27% in control individuals (X(2) = 0.042, p = 0.8376), further supporting that these two variants have no pathological effects on PD. Phenotype analysis showed that no significant difference in family history, age at onset and cognitive impairment was identified between the GBA mutation carriers and non-GBA mutation carriers. GBA mutations were found to be a common genetic risk factor for PD in Eastern Canadian patients.

  19. Natural selection against a circadian clock gene mutation in mice.

    Science.gov (United States)

    Spoelstra, Kamiel; Wikelski, Martin; Daan, Serge; Loudon, Andrew S I; Hau, Michaela

    2016-01-19

    Circadian rhythms with an endogenous period close to or equal to the natural light-dark cycle are considered evolutionarily adaptive ("circadian resonance hypothesis"). Despite remarkable insight into the molecular mechanisms driving circadian cycles, this hypothesis has not been tested under natural conditions for any eukaryotic organism. We tested this hypothesis in mice bearing a short-period mutation in the enzyme casein kinase 1ε (tau mutation), which accelerates free-running circadian cycles. We compared daily activity (feeding) rhythms, survivorship, and reproduction in six replicate populations in outdoor experimental enclosures, established with wild-type, heterozygous, and homozygous mice in a Mendelian ratio. In the release cohort, survival was reduced in the homozygote mutant mice, revealing strong selection against short-period genotypes. Over the course of 14 mo, the relative frequency of the tau allele dropped from initial parity to 20%. Adult survival and recruitment of juveniles into the population contributed approximately equally to the selection for wild-type alleles. The expression of activity during daytime varied throughout the experiment and was significantly increased by the tau mutation. The strong selection against the short-period tau allele observed here contrasts with earlier studies showing absence of selection against a Period 2 (Per2) mutation, which disrupts internal clock function, but does not change period length. These findings are consistent with, and predicted by the theory that resonance of the circadian system plays an important role in individual fitness.

  20. Splicing aberrations caused by constitutional RB1 gene mutations in ...

    Indian Academy of Sciences (India)

    in this family revealed skipping of exon 22 in three members of this family. In one proband, a ... This study reveals novel effects of RB1 mutations on splicing and suggests the utility of RNA analysis as an ... of life) and presence of multiple tumors (multifocal). The ..... spliced RNA have been linked to parent of origin as well as.

  1. Two novel missense mutations in bovine ATGL gene and their ...

    African Journals Online (AJOL)

    Adipose triglyceride lipase (ATGL) as a triglyceride-specific lipase, plays a key role in the triglyceride liposis mobilization of fat tissue. In this study, based on the pyrosequencing technology, two novel missense mutations were identified, which were 3289 G>C in exon 6 bringing E277Q and 3514 A>T in exon 7 bringing ...

  2. The Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine.

    Science.gov (United States)

    Stenson, Peter D; Mort, Matthew; Ball, Edward V; Shaw, Katy; Phillips, Andrew; Cooper, David N

    2014-01-01

    The Human Gene Mutation Database (HGMD®) is a comprehensive collection of germline mutations in nuclear genes that underlie, or are associated with, human inherited disease. By June 2013, the database contained over 141,000 different lesions detected in over 5,700 different genes, with new mutation entries currently accumulating at a rate exceeding 10,000 per annum. HGMD was originally established in 1996 for the scientific study of mutational mechanisms in human genes. However, it has since acquired a much broader utility as a central unified disease-oriented mutation repository utilized by human molecular geneticists, genome scientists, molecular biologists, clinicians and genetic counsellors as well as by those specializing in biopharmaceuticals, bioinformatics and personalized genomics. The public version of HGMD (http://www.hgmd.org) is freely available to registered users from academic institutions/non-profit organizations whilst the subscription version (HGMD Professional) is available to academic, clinical and commercial users under license via BIOBASE GmbH.

  3. Increased missense mutation burden of Fatty Acid metabolism related genes in nunavik inuit population.

    Science.gov (United States)

    Zhou, Sirui; Xiong, Lan; Xie, Pingxing; Ambalavanan, Amirthagowri; Bourassa, Cynthia V; Dionne-Laporte, Alexandre; Spiegelman, Dan; Turcotte Gauthier, Maude; Henrion, Edouard; Diallo, Ousmane; Dion, Patrick A; Rouleau, Guy A

    2015-01-01

    Nunavik Inuit (northern Quebec, Canada) reside along the arctic coastline where for generations their daily energy intake has mainly been derived from animal fat. Given this particular diet it has been hypothesized that natural selection would lead to population specific allele frequency differences and unique variants in genes related to fatty acid metabolism. A group of genes, namely CPT1A, CPT1B, CPT1C, CPT2, CRAT and CROT, encode for three carnitine acyltransferases that are important for the oxidation of fatty acids, a critical step in their metabolism. Exome sequencing and SNP array genotyping were used to examine the genetic variations in the six genes encoding for the carnitine acyltransferases in 113 Nunavik Inuit individuals. Altogether ten missense variants were found in genes CPT1A, CPT1B, CPT1C, CPT2 and CRAT, including three novel variants and one Inuit specific variant CPT1A p.P479L (rs80356779). The latter has the highest frequency (0.955) compared to other Inuit populations. We found that by comparison to Asians or Europeans, the Nunavik Inuit have an increased mutation burden in CPT1A, CPT2 and CRAT; there is also a high level of population differentiation based on carnitine acyltransferase gene variations between Nunavik Inuit and Asians. The increased number and frequency of deleterious variants in these fatty acid metabolism genes in Nunavik Inuit may be the result of genetic adaptation to their diet and/or the extremely cold climate. In addition, the identification of these variants may help to understand some of the specific health risks of Nunavik Inuit.

  4. Female mating preferences determine system-level evolution in a gene network model.

    Science.gov (United States)

    Fierst, Janna L

    2013-06-01

    Environmental patterns of directional, stabilizing and fluctuating selection can influence the evolution of system-level properties like evolvability and mutational robustness. Intersexual selection produces strong phenotypic selection and these dynamics may also affect the response to mutation and the potential for future adaptation. In order to to assess the influence of mating preferences on these evolutionary properties, I modeled a male trait and female preference determined by separate gene regulatory networks. I studied three sexual selection scenarios: sexual conflict, a Gaussian model of the Fisher process described in Lande (in Proc Natl Acad Sci 78(6):3721-3725, 1981) and a good genes model in which the male trait signalled his mutational condition. I measured the effects these mating preferences had on the potential for traits and preferences to evolve towards new states, and mutational robustness of both the phenotype and the individual's overall viability. All types of sexual selection increased male phenotypic robustness relative to a randomly mating population. The Fisher model also reduced male evolvability and mutational robustness for viability. Under good genes sexual selection, males evolved an increased mutational robustness for viability. Females choosing their mates is a scenario that is sufficient to create selective forces that impact genetic evolution and shape the evolutionary response to mutation and environmental selection. These dynamics will inevitably develop in any population where sexual selection is operating, and affect the potential for future adaptation.

  5. Relationship between serum carcinoembryonic antigen level and epidermal growth factor receptor mutations with the influence on the prognosis of non-small-cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Cai ZX

    2016-06-01

    Full Text Available Zuxun Cai Department of Thoracic Surgery, Henan Provincial Chest Hospital, Zhengzhou City, People’s Republic of China Objective: To investigate the relationship between serum carcinoembryonic antigen (CEA level and epidermal growth factor receptor (EGFR gene mutations in non-small-cell lung cancer (NSCLC patients and to analyze the influence of CEA level on postoperative survival time in lung cancer patients. Methods: A total of 296 patients who were treated in Thoracic Surgery Department of Henan Provincial Chest Hospital from September 2011 to September 2013 were recruited. The level of tumor markers, such as CEA, was determined before the surgery, and EGFR gene mutations were detected after surgery. Thereby, the relationship between tumor makers, including CEA, and EGFR mutation and its influence on prognosis could be investigated. Results: Among 296 patients, the positive rate of EGFR gene mutation was 37.84% (112/296; the mutation occurred more frequently in nonsmokers, adenocarcinoma patients, women, and patients aged <60 years (P<0.05. Both tumor markers and chemosensitivity indicators were related to the profile of EGFR mutations. Elevated squamous cell carcinoma and Cyfra21-1 as well as positively expressed ERCC1 were more common in patients with wild-type EGFR (P<0.05, whereas increased CEA level was observed more frequently in patients with EGFR gene mutation (P=0.012. The positive rate of EGFR gene mutations was higher as the serum CEA level increased, that is, the positive rate in patients with serum CEA level <5, 5–20, and >20 µg/L was 39.81%, 45.32%, and 65.47%, respectively (P=0.004. Logistic regression analysis showed that CEA level was an independent factor in predicting EGFR gene mutations, and serum CEA level was also an independent factor in affecting the prognosis of NSCLC patients, as the overall 2-year survival rate was 73.86% in elevated CEA group and 86.43% in normal group (P<0.01. Conclusion: The prognosis of

  6. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

    Directory of Open Access Journals (Sweden)

    Paulo Lisboa Bittencourt

    2009-01-01

    Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  7. A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

    Science.gov (United States)

    Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

    2014-02-25

    Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    Science.gov (United States)

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  9. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    Directory of Open Access Journals (Sweden)

    Jose Miguel Moreno-Ortiz

    2016-01-01

    Full Text Available Background. Lynch Syndrome (LS is characterized by germline mutations in the DNA mismatch repair (MMR genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC, and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del and c.1852_1853delinsGC (p.K618A in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  10. Mutations of dual oxidase 2 (DUOX2) gene among patients with permanent and transient congenital hypothyroidism

    International Nuclear Information System (INIS)

    Rostampour, N.; Tajaddini, M.H.; Hashemipour, M

    2012-01-01

    Objective: The prevalence of congenital hypothyroidism (CH) is high in Isfahan, Iran. In addition, it has different etiologies compared with other countries. The rate of parental consanguinity is also high in the city. Moreover, DUOX2 gene is effective in transient CH and permanent CH due to dyshormonogenesis. Therefore, the aim of this research was to investigate the mutations of DUOX2 gene in patients with transient CH and permanent CH due to dyshormonogenesis. Methodology: In this descriptive, prospective study, patients diagnosed with transient and permanent CH due to dyshormonogenesis during CH screening program were selected. Venous blood samples were obtained to determine the 3 mutations (Q36H, R376W, and D506N) of DUOX2 gene using polymerase chain reaction (PCR) method by specific primers and complementary methods such as restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP). Results: In this study, 25 patients with transient CH and 33 subjects with permanent CH due to dyshormonogenesis were studied. In addition, 30 children were studied as the control group. We did not find any mutations of the 3 mentioned mutations of DUOX2 gene. Conclusion: Considering the findings of the current study, further studies with other methods are required to evaluate other gene mutations such as pendrin, sodium-iodide symporter (NIS) and thyroglobulin. (author)

  11. [An overview of oculocutaneous albinism: TYR gene mutations in five Colombian individuals].

    Science.gov (United States)

    Sanabria, Diana; Groot, Helena; Guzmán, Julio; Lattig, María Claudia

    2012-06-01

    Oculocutaneus albinism is a pigment-related inherited disorder characterized by hypopigmentation of the skin, hair and eyes, foveal hypoplasia and low vision. To date, 230 mutations in the TYR gene have been reported as responsible for oculocutaneus albinism type 1 worldwide. TYR gene encodes the enzyme tyrosinase involved in the metabolic pathway of melanin synthesis. Mutations were identified in the TYR gene as responsible for oculocutaneous albinism type 1 in five Colombian individuals, and a new ophthalmic system was tested that corrected visual defects and symptoms in a patient with oculocutaneous albinism. Samples were taken from 5 individuals, four of whom belong to a single family, along with a fifth individual not related to the family. Five exons in the TYR gene were sequenced to search for the gene carriers in the family and in the non-related individual. In addition, clinical ophthalmological evaluation and implementation of an new oculo-visual system was undertaken. A G47D and 1379delTT mutation was identified in the family. The unrelated individual carried a compound heterozygote for the G47D and D42N mutations. The oculo-visual corrective system was able to increase visual acuity and to diminish the nystagmus and photophobia. This is the first study in Colombia where albinism mutations are reported. The methods developed will enable future molecular screening studies in Colombian populations.

  12. Common Mediterranean Fever (MEFV Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

    Directory of Open Access Journals (Sweden)

    Serbulent Yigit

    2012-01-01

    Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.

  13. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    Science.gov (United States)

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  14. Cancer risk and clinicopathological characteristics of thyroid nodules harboring thyroid-stimulating hormone receptor gene mutations.

    Science.gov (United States)

    Mon, Sann Y; Riedlinger, Gregory; Abbott, Collette E; Seethala, Raja; Ohori, N Paul; Nikiforova, Marina N; Nikiforov, Yuri E; Hodak, Steven P

    2018-05-01

    Thyroid-stimulating hormone receptor (TSHR) gene mutations play a critical role in thyroid cell proliferation and function. They are found in 20%-82% of hyperfunctioning nodules, hyperfunctioning follicular thyroid cancers (FTC), and papillary thyroid cancers (PTC). The diagnostic importance of TSHR mutation testing in fine needle aspiration (FNA) specimens remains unstudied. To examine the association of TSHR mutations with the functional status and surgical outcomes of thyroid nodules, we evaluated 703 consecutive thyroid FNA samples with indeterminate cytology for TSHR mutations using next-generation sequencing. Testing for EZH1 mutations was performed in selected cases. The molecular diagnostic testing was done as part of standard of care treatment, and did not require informed consent. TSHR mutations were detected in 31 (4.4%) nodules and were located in exons 281-640, with codon 486 being the most common. Allelic frequency ranged from 3% to 45%. Of 16 cases (12 benign, 3 FTC, 1 PTC) with surgical correlation, 15 had solitary TSHR mutations and 1 PTC had comutation with BRAF V600E. Hyperthyroidism was confirmed in all 3 FTC (2 overt, 1 subclinical). Of 5 nodules with solitary TSHR mutations detected at high allelic frequency, 3 (60%) were FTC. Those at low allelic frequency (3%-22%) were benign. EZH1 mutations were detected in 2 of 4 TSHR-mutant malignant nodules and neither of 2 benign nodules. We report that TSHR mutations occur in ∼5% thyroid nodules in a large consecutive series with indeterminate cytology. TSHR mutations may be associated with an increased cancer risk when present at high allelic frequency, even when the nodule is hyperfunctioning. Benign nodules were however most strongly correlated with TSHR mutations at low allelic frequency. © 2018 Wiley Periodicals, Inc.

  15. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    Science.gov (United States)

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  16. A Novel Mutation in the Transglutaminase-1 Gene in an Autosomal Recessive Congenital Ichthyosis Patient

    Directory of Open Access Journals (Sweden)

    D. Vaigundan

    2014-01-01

    Full Text Available Structure-function implication on a novel homozygous Trp250/Gly mutation of transglutaminase-1 (TGM1 observed in a patient of autosomal recessive congenital ichthyosis is invoked from a bioinformatics analysis. Structural consequences of this mutation are hypothesized in comparison to homologous enzyme human factor XIIIA accepted as valid in similar structural analysis and are projected as guidelines for future studies at an experimental level on TGM1 thus mutated.

  17. 657del5 mutation of the NBS1 gene in myelodysplastic syndrome

    Directory of Open Access Journals (Sweden)

    Bunjevacki Vera

    2014-01-01

    Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  18. Two Mutations in Surfactant Protein C Gene Associated with Neonatal Respiratory Distress

    Directory of Open Access Journals (Sweden)

    Anna Tarocco

    2015-01-01

    Full Text Available Multiple mutations of surfactant genes causing surfactant dysfunction have been described. Surfactant protein C (SP-C deficiency is associated with variable clinical manifestations ranging from neonatal respiratory distress syndrome to lethal lung disease. We present an extremely low birth weight male infant with an unusual course of respiratory distress syndrome associated with two mutations in the SFTPC gene: C43-7G>A and 12T>A. He required mechanical ventilation for 26 days and was treated with 5 subsequent doses of surfactant with temporary and short-term efficacy. He was discharged at 37 weeks of postconceptional age without any respiratory support. During the first 16 months of life he developed five respiratory infections that did not require hospitalization. Conclusion. This mild course in our patient with two mutations is peculiar because the outcome in patients with a single SFTPC mutation is usually poor.

  19. Mutation Profile of the CDH23 Gene in 56 Probands with Usher Syndrome Type I

    Science.gov (United States)

    Oshima, A.; Jaijo, T.; Aller, E.; Millan, J.M.; Carney, C.; Usami, S.; Moller, C.; Kimberling, W.J.

    2008-01-01

    Mutations in the human gene encoding cadherin 23 (CDH23) cause Usher syndrome type 1D (USH1D) and nonsyndromic hearing loss. Individuals with Usher syndrome type I have profound congenital deafness, vestibular areflexia and usually begin to exhibit signs of RP in early adolescence. In the present study, we carried out the mutation analysis in all 69 exons of the CDH23 gene in 56 Usher type 1 probands already screened for mutations in MYO7A. A total of 18 of 56 subjects (32.1%) were observed to have one or two CDH23 variants that are presumed to be pathologic. Twenty one different pathologic genome variants were observed of which 15 were novel. Out of a total of 112 alleles, 31 (27.7%) were considered pathologic. Based on our results it is estimated that about 20% of patients with Usher syndrome type I have CDH23 mutations. PMID:18429043

  20. [A case of colchicine-responsive Mollaret's meningitis with MEFV gene mutation].

    Science.gov (United States)

    Kinohshita, Tomomi; Matsushima, Akira; Satoh, Shunichi; Hoshi, Kenichi; Kishida, Dai; Yahikozawa, Hiroyuki

    2014-01-01

    A 66-year-old woman was admitted to our hospital with recurrent meningitis. She presented with 10 episodes of meningitis in 10 months. Examination of cerebrospinal fluid demonstrated pleocytosis, with neutrophils dominant at the early stage, and lymphocytes dominant at the late stage. Mollaret cells were found and the level of IL-6 was increased in cerebrospinal fluid. Several antibiotics and antiviral agents failed to prevent relapse. However, colchicine therapy successfully prevented the recurrence of meningitis. Genetic testing for familial Mediterranean fever (FMF) showed a mutation in the MEFV gene. It is difficult to diagnose the cause of Mollaret's meningitis in some patients. FMF, neuro-Behçet's disease, and neuro-Sweet disease should be included in the differential diagnosis of recurrent meningitis. In addition, colchicine therapy can prevent the relapse of meningitis in such cases.

  1. Isocitrate dehydrogenase 1 and 2 genes mutations and MGMT methylation in gliomas

    Directory of Open Access Journals (Sweden)

    D. V. Tabakov

    2017-01-01

    Full Text Available Gliomas are the most common brain tumors. It is difficult to detect them at early stages of disease and there is a few available therapies providing significant improvement in survival. Mutations of isocitrate dehydrogenase 1 and 2 genes (IDH1 and IDH2 play significant role in gliomogenesis, diagnostics and selection of patient therapy. We tested the distribution of IDH1 and IDH2 mutations in gliomas of different histological types and grades of malignancy by DNA melting analysis using our protocol with a sensitivity of 5 %. The results of this assay were confirmed by conventional Sanger sequencing. IDH1/2 mutations were detected in 74 % of lower grade gliomas (II and III, World Health Organization and in 14 % of glioblastomas (IV, World Health Organization. Mutation rate in gliomas with oligodendroglioma component were significantly higher then in other glioma types (р = 0.014. The IDH1 mutations was the most common (79 % of general mutation number. IDH1/2 mutations can induce aberrant gene methylation. Detection of methylation rate of the gene encoding for O6-methylguanine-DNA-methyltransferase (MGMT, predictive biomarker for treatment of gliomas with the alkylating agents, has demonstrated a partial association with IDH1/2 mutations. In 73 % of IDH1/2-mutant tumors MGMT promoter methylation were observed. At the same time IDH1/2 mutations were not revealed in 67 % tumors with MGMT promoter methylation. These results indicate existence of another mechanism of MGMT methylation in gliomas. Our data strong support for necessity of both markers testing when patient therapy is selected.

  2. Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD).

    Science.gov (United States)

    Torniainen, Suvi; Freddara, Roberta; Routi, Taina; Gijsbers, Carolien; Catassi, Carlo; Höglund, Pia; Savilahti, Erkki; Järvelä, Irma

    2009-01-22

    Congenital lactase deficiency (CLD) is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT) gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  3. Four novel mutations in the lactase gene (LCT underlying congenital lactase deficiency (CLD

    Directory of Open Access Journals (Sweden)

    Höglund Pia

    2009-01-01

    Full Text Available Abstract Background Congenital lactase deficiency (CLD is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Methods Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Results Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. Conclusion This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  4. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    Science.gov (United States)

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  5. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    Science.gov (United States)

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  6. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-04-01

    Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

  7. The Nature and Extent of Mutational Pleiotropy in Gene Expression of Male Drosophila serrata

    OpenAIRE

    McGuigan, Katrina; Collet, Julie M.; McGraw, Elizabeth A.; Ye, Yixin H.; Allen, Scott L.; Chenoweth, Stephen F.; Blows, Mark W.

    2014-01-01

    The nature and extent of mutational pleiotropy remain largely unknown, despite the central role that pleiotropy plays in many areas of biology, including human disease, agricultural production, and evolution. Here, we investigate the variation in 11,604 gene expression traits among 41 mutation accumulation (MA) lines of Drosophila serrata. We first confirmed that these expression phenotypes were heritable, detecting genetic variation in 96% of them in an outbred, natural population of D. serr...

  8. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  9. Acral peeling skin syndrome associated with a novel CSTA gene mutation.

    Science.gov (United States)

    Muttardi, K; Nitoiu, D; Kelsell, D P; O'Toole, E A; Batta, K

    2016-06-01

    Acral peeling skin syndrome (APSS) is a rare autosomal recessive condition, characterized by asymptomatic peeling of the skin of the hands and feet, often linked to mutations in the gene TGM5. However, more recently recessive loss of function mutations in CSTA, encoding cystatin A, have been linked with APSS and exfoliative ichthyosis. We describe the clinical features in two sisters with APSS, associated with a novel large homozygous deletion encompassing exon 1 of CSTA. © 2015 British Association of Dermatologists.

  10. Mutation screening of the PCDH15 gene in Spanish patients with Usher syndrome type I.

    Science.gov (United States)

    Jaijo, Teresa; Oshima, Aki; Aller, Elena; Carney, Carol; Usami, Shin-ichi; Millán, José M; Kimberling, William J

    2012-01-01

    PCDH15 codes for protocadherin-15, a cell-cell adhesion protein essential in the morphogenesis and cohesion of stereocilia bundles and in the function or preservation of photoreceptor cells. Mutations in the PCDH15 gene are responsible for Usher syndrome type I (USH1F) and non-syndromic hearing loss (DFNB23). The purpose of this work was to perform PCDH15 mutation screening to identify the genetic cause of the disease in a cohort of Spanish patients with Usher syndrome type I and establish phenotype-genotype correlation. Mutation analysis of PCDH15 included additional exons recently identified and was performed by direct sequencing. The screening was performed in 19 probands with USH already screened for mutations in the most prevalent USH1 genes, myosin VIIA (MYO7A) and cadherin-23 (CDH23), and for copy number variants in PCDH15. Seven different point mutations, five novel, were detected. Including the large PCDH15 rearrangements previously reported in our cohort of patients, a total of seven of 19 patients (36.8%) were carriers of at least one pathogenic allele. Thirteen out of the 38 screened alleles carried pathogenic PCDH15 variants (34.2%). Five out of the seven point mutations reported in the present study are novel, supporting the idea that most PCDH15 mutations are private. Furthermore, no mutational hotspots have been identified. In most patients, detected mutations led to a truncated protein, reinforcing the hypothesis that severe mutations cause the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  11. Mitchell-Riley Syndrome: A Novel Mutation in RFX6 Gene

    Directory of Open Access Journals (Sweden)

    Marta Zegre Amorim

    2015-01-01

    Full Text Available A novel RFX6 homozygous missense mutation was identified in an infant with Mitchell-Riley syndrome. The most common features of Mitchell-Riley syndrome were present, including severe neonatal diabetes associated with annular pancreas, intestinal malrotation, gallbladder agenesis, cholestatic disease, chronic diarrhea, and severe intrauterine growth restriction. Perijejunal tissue similar to pancreatic tissue was found in the submucosa, a finding that has not been previously reported in this syndrome. This case associating RFX6 mutation with structural and functional pancreatic abnormalities reinforces the RFX6 gene role in pancreas development and β-cell function, adding information to the existent mutation databases.

  12. Relationship between ELA2 gene mutations, clinical and laboratory parameters in severe congenital and cyclic neutropenia

    Directory of Open Access Journals (Sweden)

    Farhoodi A

    2007-09-01

    Full Text Available   Background: Mutations of ELA2, the gene encoding neutrophil elastase (NE are known to be associated with cyclic neutropenia (CN and severe congenital neutropenia (SCN. However, high variability of these mutations has been reported. This study was designed to describe the analysis of the ELA2 gene, clinical manifestations and demographic characteristics in patients with CN and SCN.Methods: A series of 21 patients with CN or SCN were selected, based on SCINR criteria, from the immunology ward of the Pediatric Medicine Center, Tehran, Iran, from March 2004 to August 2005. The ELA2 gene, isolated from blood samples, was analyzed using RT-PCR and automated capillary sequencing. Informed consent was obtained under the tenets of the Helsinki Declaration and the Ethical Committee of the Tehran University of Medical Sciences.Results: Kostmann's syndrome and CN was diagnosed in three and 18 patients respectively. Of all the patients, one or two mutations were found in 18 cases (85.7%, including all three patients with SCN and 15 of the patients with CN. Exons two and four had the most mutations (eight and seven cases, respectively. Seven patients had double mutations in two distinct exons. Overall, 16 different mutations were found. At the time of presentation, the mean age of patients was 13.4 ±17.6 months, ranging from one month to seven years. Overall, 61.9% of patients had consanguineous parents. The mean absolute neutrophil count was 830.5 ±419.4 (150-2000/mm3. On average, each patient had been admitted to the hospital 2.2 ±1.6 times. The neutrophil counts of the SCN patients were significantly higher than those of the CN patients. However, there was no significant difference in the neutrophil counts between patients with mutations and those without mutations. All patients with SCN had two or more infectious complications, although the prevalence of infectious or non-infectious complications did not correlate with ELA2 mutations or the

  13. Screening for mutations in the uroporphyrinogen decarboxylase gene using denaturing gradient gel electrophoresis

    DEFF Research Database (Denmark)

    Christiansen, L; Ged, C; Hombrados, I

    1999-01-01

    to exon skipping, and a 2-bp deletion (415-416delTA) resulting in a frameshift and the introduction of a premature stop codon. Heterologous expression and enzymatic studies of the mutant proteins demonstrate that the three mutations leading to shortening or truncation of the UROD protein have no residual......, confirming the heterogeneity of the underlying genetic defects of these diseases. We have established a denaturing gradient gel electrophoresis (DGGE) assay for mutation detection in the UROD gene, enabling the simultaneous screening for known and unknown mutations. The established assay has proved able...

  14. Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Chia-Sui Hung

    2007-01-01

    Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

  15. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  16. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  17. Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.

    Science.gov (United States)

    Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F

    2006-07-01

    Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.

  18. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  19. Serum AMH levels in healthy women from BRCA1/2 mutated families : are they reduced?

    NARCIS (Netherlands)

    van Tilborg, Theodora C; Derks-Smeets, Inge A P; Bos, Anna M E; Oosterwijk, Jan C; van Golde, Ron J; de Die-Smulders, Christine E; van der Kolk, Lizet E; van Zelst-Stams, Wendy A G; Velthuizen, Maria E; Hoek, Annemieke; Eijkemans, Marinus J C; Laven, Joop S E; Ausems, Margreet G E M; Broekmans, Frank J M

    2016-01-01

    STUDY QUESTION: Do BRCA1/2 mutation carriers have a compromised ovarian reserve compared to proven non-carriers, based on serum anti-Müllerian hormone (AMH) levels? SUMMARY ANSWER: BRCA1/2 mutation carriers do not show a lower serum AMH level in comparison to proven non-carriers, after adjustment

  20. Serum AMH levels in healthy women from BRCA1/2 mutated families : are they reduced?

    NARCIS (Netherlands)

    van Tilborg, Theodora C.; Derks-Smeets, Inge A. P.; Bos, Anna M. E.; Oosterwijk, Jan C.; van Golde, Ron J.; de Die-Smulders, Christine E.; van der Kolk, Lizet E.; van Zelst-Stams, Wendy A. G.; Velthuizen, Maria E.; Hoek, Annemieke; Eijkemans, Marinus J. C.; Laven, Joop S. E.; Ausems, Margreet G. E. M.; Broekmans, Frank J. M.

    Do BRCA1/2 mutation carriers have a compromised ovarian reserve compared to proven non-carriers, based on serum anti-Mullerian hormone (AMH) levels? BRCA1/2 mutation carriers do not show a lower serum AMH level in comparison to proven non-carriers, after adjustment for potential confounders. It has

  1. Analysis of mutations in the entire coding sequence of the factor VIII gene

    Energy Technology Data Exchange (ETDEWEB)

    Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

    1994-09-01

    Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

  2. A Restricted Spectrum of Mutations in the SMAD4 Tumor-Suppressor Gene Underlies Myhre Syndrome

    Science.gov (United States)

    Caputo, Viviana; Cianetti, Luciano; Niceta, Marcello; Carta, Claudio; Ciolfi, Andrea; Bocchinfuso, Gianfranco; Carrani, Eugenio; Dentici, Maria Lisa; Biamino, Elisa; Belligni, Elga; Garavelli, Livia; Boccone, Loredana; Melis, Daniela; Andria, Generoso; Gelb, Bruce D.; Stella, Lorenzo; Silengo, Margherita; Dallapiccola, Bruno; Tartaglia, Marco

    2012-01-01

    Myhre syndrome is a developmental disorder characterized by reduced growth, generalized muscular hypertrophy, facial dysmorphism, deafness, cognitive deficits, joint stiffness, and skeletal anomalies. Here, by performing exome sequencing of a single affected individual and coupling the results to a hypothesis-driven filtering strategy, we establish that heterozygous mutations in SMAD4, which encodes for a transducer mediating transforming growth factor β and bone morphogenetic protein signaling branches, underlie this rare Mendelian trait. Two recurrent de novo SMAD4 mutations were identified in eight unrelated subjects. Both mutations were missense changes altering Ile500 within the evolutionary conserved MAD homology 2 domain, a well known mutational hot spot in malignancies. Structural analyses suggest that the substituted residues are likely to perturb the binding properties of the mutant protein to signaling partners. Although SMAD4 has been established as a tumor suppressor gene somatically mutated in pancreatic, gastrointestinal, and skin cancers, and germline loss-of-function lesions and deletions of this gene have been documented to cause disorders that predispose individuals to gastrointestinal cancer and vascular dysplasias, the present report identifies a previously unrecognized class of mutations in the gene with profound impact on development and growth. PMID:22243968

  3. Two novel mutations in the PPIB gene cause a rare pedigree of osteogenesis imperfecta type IX.

    Science.gov (United States)

    Jiang, Yu; Pan, Jingxin; Guo, Dongwei; Zhang, Wei; Xie, Jie; Fang, Zishui; Guo, Chunmiao; Fang, Qun; Jiang, Weiying; Guo, Yibin

    2017-06-01

    Osteogenesis imperfecta (OI) is a rare genetic skeletal disorder characterized by increased bone fragility and vulnerability to fractures. PPIB is identified as a candidate gene for OI-IX, here we detect two pathogenic mutations in PPIB and analyze the genotype-phenotype correlation in a Chinese family with OI. Next-generation sequencing (NGS) was used to screen the whole exome of the parents of proband. Screening of variation frequency, evolutionary conservation comparisons, pathogenicity evaluation, and protein structure prediction were conducted to assess the pathogenicity of the novel mutations. Sanger sequencing was used to confirm the candidate variants. RTQ-PCR was used to analyze the PPIB gene expression. All mutant genes screened out by NGS were excluded except PPIB. Two novel heterozygous PPIB mutations (father, c.25A>G; mother, c.509G>A) were identified in relation to osteogenesis imperfecta type IX. Both mutations were predicted to be pathogenic by bioinformatics analysis and RTQ-PCR analysis revealed downregulated PPIB expression in the two carriers. We report a rare pedigree with an autosomal recessive osteogenesis imperfecta type IX (OI-IX) caused by two novel PPIB mutations identified for the first time in China. The current study expands our knowledge of PPIB mutations and their associated phenotypes, and provides new information on the genetic defects associated with this disease for clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Mutation analysis of GJB2 gene and prenatal diagnosis in a non-syndromic deafness family

    Directory of Open Access Journals (Sweden)

    Xiao-hua CHEN

    2014-08-01

    Full Text Available Objective To identify the pathogenic gene in a non-syndromic deafness family, provide an accurate genetic consultation and early intervention for deaf family to reduce the incidence of congenital deafness. Methods Mutation analysis was carried out by polymerase chain reaction followed by DNA sequencing of coding region of GJB2 gene. The fetal DNA was extracted from the amniotic fluid cells by amniocentesis at 20 weeks during pregnancy. The genotype of the fetus was characterized for predicting the status of hearing. Results Complex heterozygous mutations 235delC and 176-191del16bp were detected in the proband of the family, heterozygous mutation 176-191del16bp was detected in the father, and 235delC was detected in the mother. Fetus carried 235delC heterozygous mutation inherited from his mother. Conclusions The proband's hearing loss is resulted from the complex heterozygous mutations 235delC and 176-191del16bp in GJB2 gene. Fetus is a heterozygous mutation 235delC carrier. Prenatal diagnosis for deafness assisted by genetic test can provide efficient guidance about offspring's hearing condition, and prevent another deaf-mute member from birth. DOI: 10.11855/j.issn.0577-7402.2014.07.09

  5. New mutations and an updated database for the patched-1 (PTCH1) gene.

    Science.gov (United States)

    Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

    2018-05-01

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  6. EPILEPSY CAUSED BY PCDH19 GENE MUTATION: A REVIEW OF LITERATURE AND THE AUTHORS’ OBSERVATIONS

    Directory of Open Access Journals (Sweden)

    K. Yu. Mukhin

    2016-01-01

    Full Text Available Mutation in the PCDH19 gene was first described by L.M. Dibbens et al. in 2008. Mutations in this gene are associated with epilepsy and mental retardation limited to females. The clinical manifestations that are observed in some patients with PCDH19 mutation and Dravet syndrome that is caused by mutation in the SCN1A gene include the onset of febrile and afebrile seizures in infancy, serial seizures during fever, and regression in development after the onset of seizures. Due to the fact that the two diseases have common clinical signs, it is best to test for PCDH19 mutation in patients with the clinical picture of Dravet syndrome and a negative test for SCN1A. In general, the number of scientific papers devoted to analysis and recommendations for the choice of therapy in patients with rare genetic pathology is small now. We analyzed the specific features of clinical signs and therapy in our two observed female patients aged 4 and 11 years with verified PCDH19 mutation. Both patients were noted to have severe epilepsy with febrile convulsions with the development of status epilepticus and to be unresponsive to antiepileptic therapy. The use of different antiepileptic drugs (valproate, oxcarbazepine, phenobarbital, topiramate, levetiracetam at different combinations failed to control the course of epilepsy in the 4-year-old patient whereas the 11-year-old patient who took a combination of valproic acid and benzodiazepines achieved a positive effect.

  7. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Directory of Open Access Journals (Sweden)

    Mehul Mistri

    Full Text Available Tay Sachs disease (TSD is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients. Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K, c.964 G>A (p.D322N, c.964 G>T (p.D322Y, c.1178C>G (p.R393P and c.1385A>T (p.E462V, c.1432 G>A (p.G478R and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W. The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  8. Identification of novel mutations in HEXA gene in children affected with Tay Sachs disease from India.

    Science.gov (United States)

    Mistri, Mehul; Tamhankar, Parag M; Sheth, Frenny; Sanghavi, Daksha; Kondurkar, Pratima; Patil, Swapnil; Idicula-Thomas, Susan; Gupta, Sarita; Sheth, Jayesh

    2012-01-01

    Tay Sachs disease (TSD) is a neurodegenerative disorder due to β-hexosaminidase A deficiency caused by mutations in the HEXA gene. The mutations leading to Tay Sachs disease in India are yet unknown. We aimed to determine mutations leading to TSD in India by complete sequencing of the HEXA gene. The clinical inclusion criteria included neuroregression, seizures, exaggerated startle reflex, macrocephaly, cherry red spot on fundus examination and spasticity. Neuroimaging criteria included thalamic hyperdensities on CT scan/T1W images of MRI of the brain. Biochemical criteria included deficiency of hexosaminidase A (less than 2% of total hexosaminidase activity for infantile patients). Total leukocyte hexosaminidase activity was assayed by 4-methylumbelliferyl-N-acetyl-β-D-glucosamine lysis and hexosaminidase A activity was assayed by heat inactivation method and 4-methylumbelliferyl-N-acetyl-β-D-glucosamine-6-sulphate lysis method. The exons and exon-intron boundaries of the HEXA gene were bidirectionally sequenced using an automated sequencer. Mutations were confirmed in parents and looked up in public databases. In silico analysis for mutations was carried out using SIFT, Polyphen2, MutationT@ster and Accelrys Discovery Studio softwares. Fifteen families were included in the study. We identified six novel missense mutations, c.340 G>A (p.E114K), c.964 G>A (p.D322N), c.964 G>T (p.D322Y), c.1178C>G (p.R393P) and c.1385A>T (p.E462V), c.1432 G>A (p.G478R) and two previously reported mutations. c.1277_1278insTATC and c.508C>T (p.R170W). The mutation p.E462V was found in six unrelated families from Gujarat indicating a founder effect. A previously known splice site mutation c.805+1 G>C and another intronic mutation c.672+30 T>G of unknown significance were also identified. Mutations could not be identified in one family. We conclude that TSD patients from Gujarat should be screened for the common mutation p.E462V.

  9. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene.

    Science.gov (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan

    2016-12-12

    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  10. P63 gene mutations and human developmental syndromes.

    NARCIS (Netherlands)

    Brunner, H.G.; Hamel, B.C.J.; Bokhoven, J.H.L.M. van

    2002-01-01

    The P63 gene is a recently discovered member of the p53 family. While P53 is ubiquitously expressed, p63 is expressed specifically in embryonic ectoderm and in the basal regenerative layers of epithelial tissues in the adult. Complete abrogation of P63 gene function in an animal model points to the

  11. Identification of a Variety of Mutations in Cancer Predisposition Genes in Patients With Suspected Lynch Syndrome.

    Science.gov (United States)

    Yurgelun, Matthew B; Allen, Brian; Kaldate, Rajesh R; Bowles, Karla R; Judkins, Thaddeus; Kaushik, Praveen; Roa, Benjamin B; Wenstrup, Richard J; Hartman, Anne-Renee; Syngal, Sapna

    2015-09-01

    Multigene panels are commercially available tools for hereditary cancer risk assessment that allow for next-generation sequencing of numerous genes in parallel. However, it is not clear if these panels offer advantages over traditional genetic testing. We investigated the number of cancer predisposition gene mutations identified by parallel sequencing in individuals with suspected Lynch syndrome. We performed germline analysis with a 25-gene, next-generation sequencing panel using DNA from 1260 individuals who underwent clinical genetic testing for Lynch syndrome from 2012 through 2013. All patients had a history of Lynch syndrome-associated cancer and/or polyps. We classified all identified germline alterations for pathogenicity and calculated the frequencies of pathogenic mutations and variants of uncertain clinical significance (VUS). We also analyzed data on patients' personal and family history of cancer, including fulfillment of clinical guidelines for genetic testing. Of the 1260 patients, 1112 met National Comprehensive Cancer Network (NCCN) criteria for Lynch syndrome testing (88%; 95% confidence interval [CI], 86%-90%). Multigene panel testing identified 114 probands with Lynch syndrome mutations (9.0%; 95% CI, 7.6%-10.8%) and 71 with mutations in other cancer predisposition genes (5.6%; 95% CI, 4.4%-7.1%). Fifteen individuals had mutations in BRCA1 or BRCA2; 93% of these met the NCCN criteria for Lynch syndrome testing and 33% met NCCN criteria for BRCA1 and BRCA2 analysis (P = .0017). An additional 9 individuals carried mutations in other genes linked to high lifetime risks of cancer (5 had mutations in APC, 3 had bi-allelic mutations in MUTYH, and 1 had a mutation in STK11); all of these patients met NCCN criteria for Lynch syndrome testing. A total of 479 individuals had 1 or more VUS (38%; 95% CI, 35%-41%). In individuals with suspected Lynch syndrome, multigene panel testing identified high-penetrance mutations in cancer predisposition genes, many

  12. The mthA mutation conferring low-level resistance to streptomycin enhances antibiotic production in Bacillus subtilis by increasing the S-adenosylmethionine pool size.

    Science.gov (United States)

    Tojo, Shigeo; Kim, Ji-Yun; Tanaka, Yukinori; Inaoka, Takashi; Hiraga, Yoshikazu; Ochi, Kozo

    2014-04-01

    Certain Str(r) mutations that confer low-level streptomycin resistance result in the overproduction of antibiotics by Bacillus subtilis. Using comparative genome-sequencing analysis, we successfully identified this novel mutation in B. subtilis as being located in the mthA gene, which encodes S-adenosylhomocysteine/methylthioadenosine nucleosidase, an enzyme involved in the S-adenosylmethionine (SAM)-recycling pathways. Transformation experiments showed that this mthA mutation was responsible for the acquisition of low-level streptomycin resistance and overproduction of bacilysin. The mthA mutant had an elevated level of intracellular SAM, apparently acquired by arresting SAM-recycling pathways. This increase in the SAM level was directly responsible for bacilysin overproduction, as confirmed by forced expression of the metK gene encoding SAM synthetase. The mthA mutation fully exerted its effect on antibiotic overproduction in the genetic background of rel(+) but not the rel mutant, as demonstrated using an mthA relA double mutant. Strikingly, the mthA mutation activated, at the transcription level, even the dormant ability to produce another antibiotic, neotrehalosadiamine, at concentrations of 150 to 200 μg/ml, an antibiotic not produced (antibiotic production, by introducing either the rsmG mutation to Streptomyces or the mthA mutation to eubacteria, since many eubacteria have mthA homologues.

  13. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Choi, Seong-Jun [Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Shim, Hosup, E-mail: shim@dku.edu [Department of Nanobiomedical Science and BK21 PLUS NBM Global Research Center for Regenerative Medicine, Dankook University, Cheonan (Korea, Republic of); Institute of Tissue Regeneration Engineering, Dankook University, Cheonan (Korea, Republic of); Department of Physiology, Dankook University School of Medicine, Cheonan (Korea, Republic of)

    2014-10-03

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies.

  14. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    Science.gov (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Targeted disruption of Ataxia-telangiectasia mutated gene in miniature pigs by somatic cell nuclear transfer

    International Nuclear Information System (INIS)

    Kim, Young June; Ahn, Kwang Sung; Kim, Minjeong; Kim, Min Ju; Park, Sang-Min; Ryu, Junghyun; Ahn, Jin Seop; Heo, Soon Young; Kang, Jee Hyun; Choi, You Jung; Choi, Seong-Jun; Shim, Hosup

    2014-01-01

    Highlights: • ATM gene-targeted pigs were produced by somatic cell nuclear transfer. • A novel large animal model for ataxia telangiectasia was developed. • The new model may provide an alternative to the mouse model. - Abstract: Ataxia telangiectasia (A-T) is a recessive autosomal disorder associated with pleiotropic phenotypes, including progressive cerebellar degeneration, gonad atrophy, and growth retardation. Even though A-T is known to be caused by the mutations in the Ataxia telangiectasia mutated (ATM) gene, the correlation between abnormal cellular physiology caused by ATM mutations and the multiple symptoms of A-T disease has not been clearly determined. None of the existing ATM mouse models properly reflects the extent to which neurological degeneration occurs in human. In an attempt to provide a large animal model for A-T, we produced gene-targeted pigs with mutations in the ATM gene by somatic cell nuclear transfer. The disrupted allele in the ATM gene of cloned piglets was confirmed via PCR and Southern blot analysis. The ATM gene-targeted pigs generated in the present study may provide an alternative to the current mouse model for the study of mechanisms underlying A-T disorder and for the development of new therapies

  16. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis.

    Science.gov (United States)

    Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A

    2004-10-01

    The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.

  17. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    Directory of Open Access Journals (Sweden)

    Durgesh Prasad Chaudhary

    2017-03-01

    Full Text Available Combined pituitary hormonal deficiency (CPHD is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms.

  18. X-linked juvenile retinoschisis: mutations at the retinoschisis and Norrie disease gene loci?

    Science.gov (United States)

    Hiraoka, M; Rossi, F; Trese, M T; Shastry, B S

    2001-01-01

    Juvenile retinoschisis (RS) and Norrie disease (ND) are X-linked recessive retinal disorders. Both disorders, in the majority of cases, are monogenic and are caused by mutations in the RS and ND genes, respectively. Here we report the identification of a family in which mutations in both the RS and ND genes are segregating with RS pathology. Although the mutations identified in this report were not functionally characterized with regard to their pathogenicity, it is likely that both of them are involved in RS pathology in the family analyzed. This suggests the complexity and digenic nature of monogenic human disorders in some cases. If this proves to be a widespread problem, it will complicate the strategies used to identify the genes involved in diseases and to develop methods for intervention.

  19. Pitt-Hopkins syndrome: report of a case with a TCF4 gene mutation

    Directory of Open Access Journals (Sweden)

    Orsini Alessandro

    2010-02-01

    Full Text Available Abstract Aims We will discuss the clinical and genetic diagnosis of a child with severe psychomotor delay, who at 3 years of age presented with paroxysms of hyperpnea-apnea and seizures unrelated to breathing anomalies. Methods The child underwent genetic (karyotype, FISH telomeres and neuroradiological (cranial CT and MRI tests, which proved to be normal. He came under our clinical observation at 3 years and 5 months of age. Due to severe psychomotor delay and facial dysmorphisms we completed the genetic investigations based on his clinical feature and analysis of the available literature. Results The presence of severe mental retardation associated with anomalous breathing pattern may suggest the Joubert and Rett syndrome, however these were excluded on the basis of clinical and genetic examination. Angelman syndrome, suspected for facial dysmorphisms and absent language, was also excluded because of the presence of a normal pattern of methylation at SNRPN locus. Another possible diagnosis was the Pitt-Hopkins Syndrome (PHS, characterized by severe mental retardation, breathing anomalies (paroxisms of hyperpnea-apnea, dysmorphisms and sometimes epilepsy. Haploinsufficiency of TCF4 gene located at 18q21.2 region has been recently identified as causative of this syndrome. In our patient the research of TCF4 mutation by the Institute of Human Genetics, University Hospital Erlangen (Germany, showed a de novo mutation. Conclusions The diagnosis of Pitt-Hopkins syndrome, an underdiagnosed cause of mental retardation, was based on clinical and genetic findings. Searching for TCF4 mutations is highly recommended when others overlapping syndromes was excluded. At our knowledge our patient is the first italian case of PHS diagnosed at molecular level.

  20. Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity.

    Science.gov (United States)

    Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T

    1997-05-01

    Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.

  1. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  2. Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

    Science.gov (United States)

    Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

    2016-05-01

    To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

  3. Mismatch repair gene mutation spectrum in the Swedish Lynch syndrome population

    DEFF Research Database (Denmark)

    Lagerstedt-Robinson, Kristina; Rohlin, Anna; Aravidis, Christos

    2016-01-01

    Lynch syndrome caused by constitutional mismatch‑repair defects is one of the most common hereditary cancer syndromes with a high risk for colorectal, endometrial, ovarian and urothelial cancer. Lynch syndrome is caused by mutations in the mismatch repair (MMR) genes i.e., MLH1, MSH2, MSH6 and PMS2...... Lynch syndrome families. These mutations affected MLH1 in 40%, MSH2 in 36%, MSH6 in 18% and PMS2 in 6% of the families. A large variety of mutations were identified with splice site mutations being the most common mutation type in MLH1 and frameshift mutations predominating in MSH2 and MSH6. Large...... deletions of one or several exons accounted for 21% of the mutations in MLH1 and MSH2 and 22% in PMS2, but were rare (4%) in MSH6. In 66% of the Lynch syndrome families the variants identified were private and the effect from founder mutations was limited and predominantly related to a Finnish founder...

  4. Mutation analysis of breast cancer gene BRCA among breast cancer Jordanian females

    International Nuclear Information System (INIS)

    Atoum, Manar F.; Al-Kayed, Sameer A.

    2004-01-01

    To screen mutations of the tumor suppressor breast cancer susceptibility gene 1 (BRCA1) within 3 exons among Jordanian breast cancer females. A total of 135 Jordanian breast cancer females were genetically analyzed by denaturing gradient electrophoresis (DGGE) for mutation detection in 3 BRCA1 exons (2, 11 and 20) between 2000-2002 in Al-Basheer Hospital, Amman, Jordan. Of the studied patients 50 had a family history of breast cancer, 28 had a family history of cancer other than breast cancer, and 57 had no family history of any cancer. Five germline mutations were detected among breast cancer females with a family history of breast cancers (one in exon 2 and 4 mutations in exon 11). Another germline mutation (within exon 11) was detected among breast cancer females with family history of cancer other than breast cancer, and no mutation was detected among breast cancer females with no family history of any cancer or among normal control females. Screening mutations within exon 2, exon 11 and exon 20 showed that most screened mutations were within BRCA1 exon 11 among breast cancer Jordanian families with a family history of breast cancer. (author)

  5. Recurrent mutations in the CDKL5 gene: genotype-phenotype relationships.

    Science.gov (United States)

    Bahi-Buisson, Nadia; Villeneuve, Nathalie; Caietta, Emilie; Jacquette, Aurélia; Maurey, Helene; Matthijs, Gert; Van Esch, Hilde; Delahaye, Andrée; Moncla, Anne; Milh, Mathieu; Zufferey, Flore; Diebold, Bertrand; Bienvenu, Thierry

    2012-07-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been described in epileptic encephalopathies in females with infantile spasms with features that overlap with Rett syndrome. With more than 80 reported patients, the phenotype of CDKL5-related encephalopathy is well-defined. The main features consist of seizures starting before 6 months of age, severe intellectual disability with absent speech and hand stereotypies and deceleration of head grow