Mutational robustness of gene regulatory networks.

Directory of Open Access Journals (Sweden)

Aalt D J van Dijk

Full Text Available Mutational robustness of gene regulatory networks refers to their ability to generate constant biological output upon mutations that change network structure. Such networks contain regulatory interactions (transcription factor-target gene interactions but often also protein-protein interactions between transcription factors. Using computational modeling, we study factors that influence robustness and we infer several network properties governing it. These include the type of mutation, i.e. whether a regulatory interaction or a protein-protein interaction is mutated, and in the case of mutation of a regulatory interaction, the sign of the interaction (activating vs. repressive. In addition, we analyze the effect of combinations of mutations and we compare networks containing monomeric with those containing dimeric transcription factors. Our results are consistent with available data on biological networks, for example based on evolutionary conservation of network features. As a novel and remarkable property, we predict that networks are more robust against mutations in monomer than in dimer transcription factors, a prediction for which analysis of conservation of DNA binding residues in monomeric vs. dimeric transcription factors provides indirect evidence.

[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

Science.gov (United States)

Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

2016-08-01

To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

677C to T mutation in the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene and plasma homocyst(e)ine levels in patients with TIA or minor stroke.

Science.gov (United States)

Lalouschek, W; Aull, S; Korninger, L; Mannhalter, C; Pabinger-Fasching, I; Schmid, R W; Schnider, P; Zeiler, K

1998-03-05

It was the aim of this study to determine the associations of clinical and laboratory data with plasma homocyst(e)ine levels in patients with transient ischemic attack (TIA) or minor stroke (MS), with special reference to their 677C to T mutation status in the 5,10-methylenetetrahydrofolate reductase (5,10-MTHFR) gene. Seventy-six patients with TIA or MS were investigated at least 3 months after their (last) clinical event. By means of univariate analysis, significant correlations of homocyst(e)ine levels with male gender (Pine levels. After adjustment for age, creatinine levels and homocyst(e)ine levels remained significantly correlated to each other (Pine levels was no longer significant (P=0.10). Mutation-positive patients exhibited moderately and statistically non-significantly higher homocyst(e)ine levels than mutation-negative patients, particularly those who were homozygous positive. Homocyst(e)ine levels were closely correlated with creatinine levels (Pine levels in patients with TIA or MS are dependent on the 5,10-MTHFR mutation status. Significant correlations between these variables were found only in mutation-positive but not in mutation-negative patients.

An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

Science.gov (United States)

Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

2017-07-01

We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

Nonsense mutations in the human β-globin gene affect mRNA metabolism

International Nuclear Information System (INIS)

Baserga, S.J.; Benz, E.J. Jr.

1988-01-01

A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

Mutation update for the PORCN gene

DEFF Research Database (Denmark)

Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo

2011-01-01

Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum......, the pentalogy of Cantrell and Limb-Body Wall Complex. Here we present a review of the published mutations in the PORCN gene to date and report on seven new mutations together with the corresponding clinical data. Based on the review we have created a Web-based locus-specific database that lists all identified...... variants and allows the inclusion of future reports. The database is based on the Leiden Open (source) Variation Database (LOVD) software, and is accessible online at http://www.lovd.nl/porcn. At present, the database contains 106 variants, representing 68 different mutations, scattered along the whole...

Glucokinase gene mutations (MODY 2) in Asian Indians.

Science.gov (United States)

Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

2014-03-01

Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

Science.gov (United States)

Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

2011-07-01

Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

[FANCA gene mutation analysis in Fanconi anemia patients].

Science.gov (United States)

Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

2005-10-01

To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

Gene-specific function prediction for non-synonymous mutations in monogenic diabetes genes.

Directory of Open Access Journals (Sweden)

Quan Li

Full Text Available The rapid progress of genomic technologies has been providing new opportunities to address the need of maturity-onset diabetes of the young (MODY molecular diagnosis. However, whether a new mutation causes MODY can be questionable. A number of in silico methods have been developed to predict functional effects of rare human mutations. The purpose of this study is to compare the performance of different bioinformatics methods in the functional prediction of nonsynonymous mutations in each MODY gene, and provides reference matrices to assist the molecular diagnosis of MODY. Our study showed that the prediction scores by different methods of the diabetes mutations were highly correlated, but were more complimentary than replacement to each other. The available in silico methods for the prediction of diabetes mutations had varied performances across different genes. Applying gene-specific thresholds defined by this study may be able to increase the performance of in silico prediction of disease-causing mutations.

Mutated Genes in Schizophrenia Map to Brain Networks

Science.gov (United States)

... Matters NIH Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks ... have a high number of spontaneous mutations in genes that form a network in the front region ...

Mapping the fitness landscape of gene expression uncovers the cause of antagonism and sign epistasis between adaptive mutations.

Directory of Open Access Journals (Sweden)

Hsin-Hung Chou

2014-02-01

Full Text Available How do adapting populations navigate the tensions between the costs of gene expression and the benefits of gene products to optimize the levels of many genes at once? Here we combined independently-arising beneficial mutations that altered enzyme levels in the central metabolism of Methylobacterium extorquens to uncover the fitness landscape defined by gene expression levels. We found strong antagonism and sign epistasis between these beneficial mutations. Mutations with the largest individual benefit interacted the most antagonistically with other mutations, a trend we also uncovered through analyses of datasets from other model systems. However, these beneficial mutations interacted multiplicatively (i.e., no epistasis at the level of enzyme expression. By generating a model that predicts fitness from enzyme levels we could explain the observed sign epistasis as a result of overshooting the optimum defined by a balance between enzyme catalysis benefits and fitness costs. Knowledge of the phenotypic landscape also illuminated that, although the fitness peak was phenotypically far from the ancestral state, it was not genetically distant. Single beneficial mutations jumped straight toward the global optimum rather than being constrained to change the expression phenotypes in the correlated fashion expected by the genetic architecture. Given that adaptation in nature often results from optimizing gene expression, these conclusions can be widely applicable to other organisms and selective conditions. Poor interactions between individually beneficial alleles affecting gene expression may thus compromise the benefit of sex during adaptation and promote genetic differentiation.

Diverse growth hormone receptor gene mutations in Laron syndrome.

Science.gov (United States)

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

Science.gov (United States)

Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

1997-04-01

Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

Science.gov (United States)

Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

2006-01-01

To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

Gene mutations in children with chronic pancreatitis.

Science.gov (United States)

Witt, H

2001-01-01

In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

Science.gov (United States)

Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

2012-06-26

Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

Relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms

Directory of Open Access Journals (Sweden)

Xiao-Nan Zhang

2017-05-01

Full Text Available Objective: To study the relationship of JAK2V617F gene mutation with cell proliferation and coagulation function in myeloproliferative neoplasms. Methods: Patients who were diagnosed with BCR-ABL-negative myeloproliferative neoplasms in Anyang District Hospital between June 2014 and August 2016 were selected, JAK2V617F gene mutation was detected, and according to the test results, the patients were divided into mutation-positive group and mutation-negative group. The expression of JAK2/STATs signaling pathway molecules and cell proliferation genes in bone marrow fluid as well as the coagulation function indexes in peripheral blood were detected. Results: p-JAK2, p-STAT3, p-STAT5, Survivin, C-myc, CyclinD1 and ASXL1 protein expression in myeloproliferative neoplasms of mutation-positive group were significantly higher than those of mutation-negative group, and peripheral blood PT and APTT levels were significantly lower than those of mutation-negative group while TT and FIB levels were not significantly different from those of mutation-negative group. Conclusion: JAK2V617F gene mutation in myeloproliferative neoplasms can promote the cell proliferation and cause the hypercoagulable state.

Novel mutations in the SCNN1A gene causing Pseudohypoaldosteronism type 1.

Directory of Open Access Journals (Sweden)

Jian Wang

Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare inherited disease characterized by resistance to the actions of aldosterone. Mutations in the subunit genes (SCNN1A, SCNN1B, SCNN1G of the epithelial sodium channel (ENaC and the NR3C2 gene encoding the mineralocorticoid receptor, result in systemic PHA1 and renal PHA1 respectively. Common clinical manifestations of PHA1 include salt wasting, hyperkalaemia, metabolic acidosis and elevated plasma aldosterone levels in the neonatal period. In this study, we describe the clinical and biochemical manifestations in two Chinese patients with systemic PHA1. Sequence analysis of the SCNN1A gene revealed a compound heterozygous mutation (c.1311delG and c.1439+1G>C in one patient and a homozygous mutation (c.814_815insG in another patient, all three variants are novel. Further analysis of the splicing pattern in a minigene construct showed that the c.1439+1G>C mutation can lead to the retainment of intron 9 as the 5'-donor splice site disappears during post-transcriptional processing of mRNA. In conclusion, our study identified three novel SCNN1A gene mutations in two Chinese patients with systemic PHA1.

Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

Science.gov (United States)

Steinacher, Arno; Bates, Declan G; Akman, Ozgur E; Soyer, Orkun S

2016-01-01

Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability) under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest an explanation for

Nonlinear Dynamics in Gene Regulation Promote Robustness and Evolvability of Gene Expression Levels.

Directory of Open Access Journals (Sweden)

Arno Steinacher

Full Text Available Cellular phenotypes underpinned by regulatory networks need to respond to evolutionary pressures to allow adaptation, but at the same time be robust to perturbations. This creates a conflict in which mutations affecting regulatory networks must both generate variance but also be tolerated at the phenotype level. Here, we perform mathematical analyses and simulations of regulatory networks to better understand the potential trade-off between robustness and evolvability. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics, through the creation of regions presenting sudden changes in phenotype with small changes in genotype. For genotypes embedding low levels of nonlinearity, robustness and evolvability correlate negatively and almost perfectly. By contrast, genotypes embedding nonlinear dynamics allow expression levels to be robust to small perturbations, while generating high diversity (evolvability under larger perturbations. Thus, nonlinearity breaks the robustness-evolvability trade-off in gene expression levels by allowing disparate responses to different mutations. Using analytical derivations of robustness and system sensitivity, we show that these findings extend to a large class of gene regulatory network architectures and also hold for experimentally observed parameter regimes. Further, the effect of nonlinearity on the robustness-evolvability trade-off is ensured as long as key parameters of the system display specific relations irrespective of their absolute values. We find that within this parameter regime genotypes display low and noisy expression levels. Examining the phenotypic effects of mutations, we find an inverse correlation between robustness and evolvability that breaks only with nonlinearity in the network dynamics. Our results provide a possible solution to the robustness-evolvability trade-off, suggest

Mutation update for the PORCN gene

NARCIS (Netherlands)

Lombardi, Maria Paola; Bulk, Saskia; Celli, Jacopo; Lampe, Anne; Gabbett, Michael T.; Ousager, Lillian Bomme; van der Smagt, Jasper J.; Soller, Maria; Stattin, Eva-Lena; Mannens, Marcel A. M. M.; Smigiel, Robert; Hennekam, Raoul C.

2011-01-01

Mutations in the PORCN gene were first identified in Goltz-Gorlin syndrome patients in 2007. Since then, several reports have been published describing a large variety of genetic defects resulting in the Goltz-Gorlin syndrome, and mutations or deletions were also reported in angioma serpiginosum,

Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers

NARCIS (Netherlands)

L.H.H. Meeter (Lieke H.H.); Patzke, H. (Holger); Loewen, G. (Gordon); E.G.P. Dopper (Elise); Y. Pijnenburg (Yolande); A.S. Thornton (Andrew); J.C. van Swieten (John)

2016-01-01

textabstractBackground: Pathogenic mutations in the granulin gene (GRN) are causative in 5-10% of patients with frontotemporal dementia (FTD), mostly leading to reduced progranulin protein (PGRN) levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN

MUTATIONS IN CALMODULIN GENES

DEFF Research Database (Denmark)

2013-01-01

The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

Mutations of the Norrie gene in Korean ROP infants.

Science.gov (United States)

Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

2002-12-01

The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

Gene mutations in hepatocellular adenomas

DEFF Research Database (Denmark)

Raft, Marie B; Jørgensen, Ernö N; Vainer, Ben

2015-01-01

is associated with bi-allelic mutations in the TCF1 gene and morphologically has marked steatosis. β-catenin activating HCA has increased activity of the Wnt/β-catenin pathway and is associated with possible malignant transformation. Inflammatory HCA is characterized by an oncogene-induced inflammation due...... to alterations in the Janus kinase/signal transducer and activator of transcription (JAK/STAT) pathway. In the diagnostic setting, sub classification of HCA is based primarily on immunohistochemical analyzes, and has had an increasing impact on choice of treatment and individual prognostic assessment....... This review offers an overview of the reported gene mutations associated with hepatocellular adenomas together with a discussion of the diagnostic and prognostic value....

Rare suprasellar chordoid meningioma with INI1 gene mutation ...

African Journals Online (AJOL)

Background: Chordoid Meningioma is a rare brain tumour characterized genetically by loss of genetic material from chromosome 22q at cytogenetic level resulting in mutation of NF2 gene. Objectives and case report: In the present report, we described a rare case of suprasellar chordoid meningioma, which presented in a ...

DRUMS: a human disease related unique gene mutation search engine.

Science.gov (United States)

Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

2011-10-01

With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

Screening for mutations in two exons of FANCG gene in Pakistani population.

Science.gov (United States)

Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

2017-06-01

Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

Nonsense and missense mutation of mitochondrial ND6 gene promotes cell migration and invasion in human lung adenocarcinoma

International Nuclear Information System (INIS)

Yuan, Yang; Wang, Weixing; Li, Huizhong; Yu, Yongwei; Tao, Jin; Huang, Shengdong; Zeng, Zhiyong

2015-01-01

Previous study showed that mitochondrial ND6 (mitND6) gene missense mutation resulted in NADH dehydrogenase deficiency and was associated with tumor metastasis in several mouse tumor cell lines. In the present study, we investigated the possible role of mitND6 gene nonsense and missense mutations in the metastasis of human lung adenocarcinoma. The presence of mitND6 gene mutations was screened by DNA sequencing of tumor tissues from 87 primary lung adenocarcinoma patients and the correlation of the mutations with the clinical features was analyzed. In addition, we constructed cytoplasmic hybrid cells with denucleared primary lung adenocarcinoma cell as the mitochondria donor and mitochondria depleted lung adenocarcinoma A549 cell as the nuclear donor. Using these cells, we studied the effects of mitND6 gene nonsense and missense mutations on cell migration and invasion through wounding healing and matrigel-coated transwell assay. The effects of mitND6 gene mutations on NADH dehydrogenase activity and ROS production were analyzed by spectrophotometry and flow cytometry. mitND6 gene nonsense and missense mutations were detected in 11 of 87 lung adenocarcinoma specimens and was correlated with the clinical features including age, pathological grade, tumor stage, lymph node metastasis and survival rate. Moreover, A549 cell containing mitND6 gene nonsense and missense mutation exhibited significantly lower activity of NADH dehydrogenase, higher level of ROS, higher capacity of cell migration and invasion, and higher pAKT and pERK1/ERK2 expression level than cells with the wild type mitND6 gene. In addition, NADH dehydrogenase inhibitor rotenone was found to significantly promote the migration and invasion of A549 cells. Our data suggest that mitND6 gene nonsense and missense mutation might promote cell migration and invasion in lung adenocarcinoma, probably by NADH dehydrogenase deficiency induced over-production of ROS

Targeted Exon Skipping to Address “Leaky” Mutations in the Dystrophin Gene

Directory of Open Access Journals (Sweden)

Sue Fletcher

2012-01-01

Full Text Available Protein-truncating mutations in the dystrophin gene lead to the progressive muscle wasting disorder Duchenne muscular dystrophy, whereas in-frame deletions typically manifest as the milder allelic condition, Becker muscular dystrophy. Antisense oligomer-induced exon skipping can modify dystrophin gene expression so that a disease-associated dystrophin pre-mRNA is processed into a Becker muscular dystrophy-like mature transcript. Despite genomic deletions that may encompass hundreds of kilobases of the gene, some dystrophin mutations appear “leaky”, and low levels of high molecular weight, and presumably semi-functional, dystrophin are produced. A likely causative mechanism is endogenous exon skipping, and Duchenne individuals with higher baseline levels of dystrophin may respond more efficiently to the administration of splice-switching antisense oligomers. We optimized excision of exons 8 and 9 in normal human myoblasts, and evaluated several oligomers in cells from eight Duchenne muscular dystrophy patients with deletions in a known “leaky” region of the dystrophin gene. Inter-patient variation in response to antisense oligomer induced skipping in vitro appeared minimal. We describe oligomers targeting exon 8, that unequivocally increase dystrophin above baseline in vitro, and propose that patients with leaky mutations are ideally suited for participation in antisense oligomer mediated splice-switching clinical studies.

Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

Science.gov (United States)

Nakazawa, M; Wada, Y; Tamai, M

1998-04-01

To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

Clinical impact of recurrently mutated genes on lymphoma diagnostics: state-of-the-art and beyond.

Science.gov (United States)

Rosenquist, Richard; Rosenwald, Andreas; Du, Ming-Qing; Gaidano, Gianluca; Groenen, Patricia; Wotherspoon, Andrew; Ghia, Paolo; Gaulard, Philippe; Campo, Elias; Stamatopoulos, Kostas

2016-09-01

Similar to the inherent clinical heterogeneity of most, if not all, lymphoma entities, the genetic landscape of these tumors is markedly complex in the majority of cases, with a rapidly growing list of recurrently mutated genes discovered in recent years by next-generation sequencing technology. Whilst a few genes have been implied to have diagnostic, prognostic and even predictive impact, most gene mutations still require rigorous validation in larger, preferably prospective patient series, to scrutinize their potential role in lymphoma diagnostics and patient management. In selected entities, a predominantly mutated gene is identified in almost all cases (e.g. Waldenström's macroglobulinemia/lymphoplasmacytic lymphoma and hairy-cell leukemia), while for the vast majority of lymphomas a quite diverse mutation pattern is observed, with a limited number of frequently mutated genes followed by a seemingly endless tail of genes with mutations at a low frequency. Herein, the European Expert Group on NGS-based Diagnostics in Lymphomas (EGNL) summarizes the current status of this ever-evolving field, and, based on the present evidence level, segregates mutations into the following categories: i) immediate impact on treatment decisions, ii) diagnostic impact, iii) prognostic impact, iv) potential clinical impact in the near future, or v) should only be considered for research purposes. In the coming years, coordinated efforts aiming to apply targeted next-generation sequencing in large patient series will be needed in order to elucidate if a particular gene mutation will have an immediate impact on the lymphoma classification, and ultimately aid clinical decision making. Copyright© Ferrata Storti Foundation.

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

Science.gov (United States)

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

High Mutation Levels are Compatible with Normal Embryonic Development in Mlh1-Deficient Mice.

Science.gov (United States)

Fan, Xiaoyan; Li, Yan; Zhang, Yulong; Sang, Meixiang; Cai, Jianhui; Li, Qiaoxia; Ozaki, Toshinori; Ono, Tetsuya; He, Dongwei

2016-10-01

To elucidate the role of the mismatch repair gene Mlh1 in genome instability during the fetal stage, spontaneous mutations were studied in Mlh1-deficient lacZ-transgenic mouse fetuses. Mutation levels were high at 9.5 days post coitum (dpc) and gradually increased during the embryonic stage, after which they remained unchanged. In addition, mutations that were found in brain, liver, spleen, small intestine and thymus showed similar levels and no statistically significant difference was found. The molecular nature of mutations at 12.5 dpc in fetuses of Mlh1 +/+ and Mlh1 -/- mice showed their own unique spectra, suggesting that deletion mutations were the main causes in the deficiency of the Mlh1 gene. Of note, fetuses of irradiated mice exhibited marked differences such as post-implantation loss and Mendelian distribution. Collectively, these results strongly suggest that high mutation ofMlh1 -/- -deficient fetuses has little effect on the fetuses during their early developmental stages, whereas Mlh1 -/- -deficient fetuses from X-ray irradiated mothers are clearly effected.

Mutations in the Norrie disease gene.

Science.gov (United States)

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

Science.gov (United States)

Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

2012-01-01

The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

Science.gov (United States)

Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

2006-10-01

Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

Clinical significance of FLG gene mutations in children with atopic dermatitis

Directory of Open Access Journals (Sweden)

E. E. Varlamov

2015-01-01

Full Text Available Skin barrier dysfunction due to deficiency of the skin protein filaggrin is one of the factors involved in the pathogenesis of atopic dermatitis. Objective: to determine the clinical significance of 2282 del CAGT, R501X, R2447X, and S3247X mutations in the FLG gene in children with atopic dermatitis. The investigation included 58 children with atopic dermatitis. A molecular genetic analysis of the four mutations in the FLG gene was done in all the children. In the patients with FLG gene mutations, there was a tendency towards a higher frequency of sensitization to house dust allergens, significantly more often sensitization to cat epidermal allergen, and significantly higher levels of specific IgE to the cat epidermis. Conclusion. Mutations in the FLG gene encoding the protein filaggrin raise the risk for sensitization to domestic and epidermal allergens and, in case of already existing sensitization to the cat epidermis, the patients are found with a high degree of probability to have the high concentration of specific IgE to this allergen. The above fact justifies the need to place special emphasis on measures to eliminate house dust allergens, and cat epidermis allergen in particular, and to personalize approaches to therapy and prevention of atopic dermatitis in children. 

Advances in sarcoma gene mutations and therapeutic targets.

Science.gov (United States)

Gao, Peng; Seebacher, Nicole A; Hornicek, Francis; Guo, Zheng; Duan, Zhenfeng

2018-01-01

Sarcomas are rare and complex malignancies that have been associated with a poor prognostic outcome. Over the last few decades, traditional treatment with surgery and/or chemotherapy has not significantly improved outcomes for most types of sarcomas. In recent years, there have been significant advances in the understanding of specific gene mutations that are important in driving the pathogenesis and progression of sarcomas. Identification of these new gene mutations, using next-generation sequencing and advanced molecular techniques, has revealed a range of potential therapeutic targets. This, in turn, may lead to the development of novel agents targeted to different sarcoma subtypes. In this review, we highlight the advances made in identifying sarcoma gene mutations, including those of p53, RB, PI3K and IDH genes, as well as novel therapeutic strategies aimed at utilizing these mutant genes. In addition, we discuss a number of preclinical studies and ongoing early clinical trials in sarcoma targeting therapies, as well as gene editing technology, which may provide a better choice for sarcoma patient management. Published by Elsevier Ltd.

Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

Science.gov (United States)

Kim, Myeong Hee; Kang, So Young; Lee, Woo In

2017-05-01

The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene.

Science.gov (United States)

Luszczyk, Marcin; Kaczorowska-Hac, Barbara; Milosz, Ewa; Adamkiewicz-Drozynska, Elzbieta; Ziemann, Ewa; Laskowski, Radoslaw; Flis, Damian; Rokicka-Hebel, Magdalena; Antosiewicz, Jedrzej

2017-01-01

Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE) mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

Amelogenesis Imperfecta and Screening of Mutation in Amelogenin Gene

Directory of Open Access Journals (Sweden)

Fernanda Veronese Oliveira

2014-01-01

Full Text Available The aim of this study was to report the clinical findings and the screening of mutations of amelogenin gene of a 7-year-old boy with amelogenesis imperfecta (AI. The genomic DNA was extracted from saliva of patient and his family, followed by PCR and direct DNA sequencing. The c.261C>T mutation was found in samples of mother, father, and brother, but the mutation was not found in the sequence of the patient. This mutation is a silent mutation and a single-nucleotide polymorphism (rs2106416. Thus, it is suggested that the mutation found was not related to the clinical presence of AI. Further research is necessary to examine larger number of patients and genes related to AI.

Hereditary thrombophilia: identification of nonsense and missense mutations in the protein C gene

International Nuclear Information System (INIS)

Romeo, G.; Hassan, H.J.; Staempfli, S.

1987-01-01

The structure of the gene for protein C, an anticoagulant serine protease, was analyzed in 29 unrelated patients with hereditary thrombophilia and protein C deficiency. Gene deletion(s) or gross rearrangement(s) was not demonstrable by Southern blot hybridization to cDNA probes. However, two unrelated patients showed a variant restriction pattern after Pvu II or BamHi digestion, due to mutations in the last exon: analysis of their pedigrees, including three or seven heterozygotes, respectively, with ∼50% reduction of both enzymatic and antigen level, showed the abnormal restriction pattern in all heterozygous individuals, but not in normal relatives. Cloning of protein C gene and sequencing of the last exon allowed the authors to identify a nonsense and a missense mutation, respectively. In the first case, codon 306 (CGA, arginine) is mutated to an inframe stop codon, thus generating a new Pvu II recognition site. In the second case, a missense mutation in the BamHI palindrome (GGATCC → GCATCC) leads to substitution of a key amino acid (a tryptophan to cysteine substitution at position 402), invariantly conserved in eukaryotic serine proteases. These point mutations may explain the protein C-deficiency phenotype of heterozygotes in the two pedigrees

Mutation analysis of the NRXN1 gene in autism spectrum disorders

Directory of Open Access Journals (Sweden)

Onay H

2016-12-01

Full Text Available The aim of this study was to identify the sequence mutations in the Neurexin 1 (NRXN1 gene that has been considered as one of the strong candidate genes. A total of 30 children and adolescents (aged 3-18 with non syndromic autism were enrolled this study. Sequencing of the coding exons and the exon-intron boundaries of the NRXN1 gene was performed. Two known mutations were described in two different cases. Heterozygous S14L was determined in one patient and heterozygous L748I was determined in another patient. The S14L and L748I mutations have been described in the patients with autism before. Both of these mutations were inherited from their father. In this study, two of 30 (6.7% autism spectrum disorder (ASD patients carrying NRXN1 gene mutations were detected. It indicates that variants in the NRXN1 gene might confer a risk of developing nonsyndromic ASD. However, due to the reduced penetrance in the gene, the causal role of the NRXN1 gene mutations must be evaluated carefully in all cases.

Update of the androgen receptor gene mutations database.

Science.gov (United States)

Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

1999-01-01

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

A mutation in the mitochondrial fission gene Dnm1l leads to cardiomyopathy.

Directory of Open Access Journals (Sweden)

Houman Ashrafian

2010-06-01

Full Text Available Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM. However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease.

Hotspots of missense mutation identify novel neurodevelopmental disorder genes and functional domains

Science.gov (United States)

Geisheker, Madeleine R.; Heymann, Gabriel; Wang, Tianyun; Coe, Bradley P.; Turner, Tychele N.; Stessman, Holly A.F.; Hoekzema, Kendra; Kvarnung, Malin; Shaw, Marie; Friend, Kathryn; Liebelt, Jan; Barnett, Christopher; Thompson, Elizabeth M.; Haan, Eric; Guo, Hui; Anderlid, Britt-Marie; Nordgren, Ann; Lindstrand, Anna; Vandeweyer, Geert; Alberti, Antonino; Avola, Emanuela; Vinci, Mirella; Giusto, Stefania; Pramparo, Tiziano; Pierce, Karen; Nalabolu, Srinivasa; Michaelson, Jacob J.; Sedlacek, Zdenek; Santen, Gijs W.E.; Peeters, Hilde; Hakonarson, Hakon; Courchesne, Eric; Romano, Corrado; Kooy, R. Frank; Bernier, Raphael A.; Nordenskjöld, Magnus; Gecz, Jozef; Xia, Kun; Zweifel, Larry S.; Eichler, Evan E.

2017-01-01

Although de novo missense mutations have been predicted to account for more cases of autism than gene-truncating mutations, most research has focused on the latter. We identified the properties of de novo missense mutations in patients with neurodevelopmental disorders (NDDs) and highlight 35 genes with excess missense mutations. Additionally, 40 amino acid sites were recurrently mutated in 36 genes, and targeted sequencing of 20 sites in 17,689 NDD patients identified 21 new patients with identical missense mutations. One recurrent site (p.Ala636Thr) occurs in a glutamate receptor subunit, GRIA1. This same amino acid substitution in the homologous but distinct mouse glutamate receptor subunit Grid2 is associated with Lurcher ataxia. Phenotypic follow-up in five individuals with GRIA1 mutations shows evidence of specific learning disabilities and autism. Overall, we find significant clustering of de novo mutations in 200 genes, highlighting specific functional domains and synaptic candidate genes important in NDD pathology. PMID:28628100

Avian metapneumovirus SH gene end and G protein mutations influence the level of protection of live-vaccine candidates.

Science.gov (United States)

Naylor, Clive J; Ling, Roger; Edworthy, Nicole; Savage, Carol E; Easton, Andrew J

2007-06-01

A prototype avian metapneumovirus (AMPV) vaccine (P20) was previously shown to give variable outcomes in experimental trials. Following plaque purification, three of 12 viruses obtained from P20 failed to induce protection against virulent challenge, whilst the remainder retained their protective capacity. The genome sequences of two protective viruses were identical to the P20 consensus, whereas two non-protective viruses differed only in the SH gene transcription termination signal. Northern blotting showed that the alterations in the SH gene-end region of the non-protective viruses led to enhanced levels of dicistronic mRNA produced by transcriptional readthrough. A synthetic minigenome was used to demonstrate that the altered SH gene-end region reduced the level of protein expression from a downstream gene. The genomes of the remaining eight plaque-purified viruses were sequenced in the region where the P20 consensus sequence differed from the virulent progenitor. The seven protective clones were identical, whereas the non-protective virus retained the virulent progenitor sequence at two positions and contained extensive alterations in its attachment (G) protein sequence associated with a reduced or altered expression pattern of G protein on Western blots. The data indicate that the efficacy of a putative protective vaccine strain is affected by mutations altering the balance of G protein expression.

Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

Science.gov (United States)

Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

2009-10-01

Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

Clinical study of DMD gene point mutation causing Becker muscular dystrophy

Directory of Open Access Journals (Sweden)

Ji-qing CAO

2015-07-01

Full Text Available Background  DMD gene point mutation, mainly nonsense mutation, always cause the most severe Duchenne muscular dystrophy (DMD. However, we also observed some cases of Becker muscular dystrophy (BMD carrying DMD point mutation. This paper aims to explore the mechanism of DMD point mutation causing BMD, in order to enhance the understanding of mutation types of BMD.  Methods  Sequence analysis was performed in 11 cases of BMD confirmed by typical clinical manifestations and muscle biopsy. The exon of DMD gene was detected non-deletion or duplication by multiplex ligation-dependent probe amplification (MLPA.  Results  Eleven patients carried 10 mutation types without mutational hotspot. Six patients carried nonsense mutations [c.5002G>T, p.(Glu1668X; c.1615C > T, p.(Arg539X; c.7105G > T, p.(Glu2369X; c.5287C > T, p.(Arg1763X; c.9284T > G, p.(Leu3095X]. One patient carried missense mutation [c.5234G > A, p.(Arg1745His]. Two patients carried frameshift mutations (c.10231dupT, c.10491delC. Two patients carried splicing site mutations (c.4518 + 3A > T, c.649 + 2T > C.  Conclusions  DMD gene point mutation may result in BMD with mild clinical symptoms. When clinical manifestations suggest the possibility of BMD and MLPA reveals non?deletion or duplication mutation of DMD gene, BMD should be considered. Study on the mechanism of DMD point mutation causing BMD is very important for gene therapy of DMD. DOI: 10.3969/j.issn.1672-6731.2015.06.005

MUTATIONS OF THE SMARCB1 GENE IN HUMAN CANCERS

Directory of Open Access Journals (Sweden)

D. S. Mikhaylenko

2016-01-01

Full Text Available In the recent years, the full exome sequencing helped to reveal a  set of mutations in the genes that are not oncogenes or tumor suppressor genes by definition, but play an important role in carcinogenesis and encode proteins involved in chromatin remodeling. Among chromatin remodeling systems, which operate through the ATP-dependent mechanism, the complex SWI/ SNF attracts the great attention. The complex consists of the catalytic ATPase (SMARCA2/4, a group of conservative core subunits (SMARCB1, SMARCC1/2, and variant subunits. Abnormalities in the genes coding for each of these components have been identified as driver mutations in various human tumors. The SMARCB1 gene is of interest for practical oncogenetics, with its typical genotype-phenotype correlations. Germinal inactivating mutations (frameshift insertions/deletions, full deletions of the gene, nonsense mutations lead to development of rhabdoid tumors in the kidneys and the brain in children in their first years of life, or even in utero. These tumors are highly malignant (Rhabdoid Tumor Predisposition Syndrome 1 – RTPS1. If a mutation carrier survives his/hers four years of life without manifestation RTPS1 with a missense mutation or has the mutation in the "hot spot" of the first or the last exon, then he/she will not develop rhabdoid tumors, but after 20 years of life, shwannomatosis may develop as multiple benign tumors of peripheral nerves. Finally, some point mutations in the exons 8–9 can result in Coffin-Siris syndrome characterized by mental retardation and developmental disorders, but no neoplasms. In this regard, rational referral of patients for direct DNA diagnostics of each of the described disease entities plays an important role, based on respective minimal criteria, as well as necessity of further development of NGS technologies (full genome and full exome sequencing that are able to sequence not only individual exons, but all candidate genes of the

Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

Science.gov (United States)

Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

2008-01-01

The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

Mutational analysis of the HGO gene in Finnish alkaptonuria patients

Science.gov (United States)

de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

1999-01-01

Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

Functioning Mediastinal Paraganglioma Associated with a Germline Mutation of von Hippel-Lindau Gene

Directory of Open Access Journals (Sweden)

Thibault Bahougne

2018-05-01

Full Text Available We report the case of a 21-year old woman presenting with high blood pressure and raised normetanephrine levels. Indium-111-pentetreotide single photon-emission computed tomography with computed tomography (SPECT/CT and 2-deoxy-2-[fluorine-18]fluoro-d-glucose (FDG positron emission tomography/computed tomography (PET/CT imaging showing isolated tracer-uptake by a 2 cm tumor close to the costovertebral angle of the third thoracic vertebra. Thoracic surgery led to normalization of normetanephrine levels. Histological findings were consistent with the presence of a paraganglioma. Mutations in SDHA, SDHB, SDHC, SDHD, RET, SDHAF2, TMEM127, MAX, NF1, FH, MDH2, and EPAS1 were absent, but a heterozygous missense mutation, c.311G > T, was found in exon 1 of the von Hippel-Lindau gene, VHL, resulting in a glycine to valine substitution in the VHL protein at position 104, p.Gly104Val. This same mutation was found in both the mother and the 17-year old sister in whom a small retinal hemangioblastoma was also found. We diagnose an unusual functional mediastinal paraganglioma in this young patient with a germline VHL gene mutation, a mutation previously described as inducing polycythemia and/or pheochromocytoma but not paraganglioma or retinal hemangioblastoma.

Association between nucleotide mutation of eNOS gene and serum ...

African Journals Online (AJOL)

Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

Gene mutation-based and specific therapies in precision medicine.

Science.gov (United States)

Wang, Xiangdong

2016-04-01

Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

Science.gov (United States)

Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

2013-01-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

Directory of Open Access Journals (Sweden)

Marcin Luszczyk

2017-01-01

Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

[Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

Science.gov (United States)

Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

2014-10-18

To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

Novel mutations in the USH1C gene in Usher syndrome patients.

Science.gov (United States)

Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

2010-12-31

Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

Science.gov (United States)

Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

2007-11-01

Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

Functional features of gene expression profiles differentiating gastrointestinal stromal tumours according to KIT mutations and expression

International Nuclear Information System (INIS)

Ostrowski, Jerzy; Dobosz, Anna Jerzak Vel; Jarosz, Dorota; Ruka, Wlodzimierz; Wyrwicz, Lucjan S; Polkowski, Marcin; Paziewska, Agnieszka; Skrzypczak, Magdalena; Goryca, Krzysztof; Rubel, Tymon; Kokoszyñska, Katarzyna; Rutkowski, Piotr; Nowecki, Zbigniew I

2009-01-01

Gastrointestinal stromal tumours (GISTs) represent a heterogeneous group of tumours of mesenchymal origin characterized by gain-of-function mutations in KIT or PDGFRA of the type III receptor tyrosine kinase family. Although mutations in either receptor are thought to drive an early oncogenic event through similar pathways, two previous studies reported the mutation-specific gene expression profiles. However, their further conclusions were rather discordant. To clarify the molecular characteristics of differentially expressed genes according to GIST receptor mutations, we combined microarray-based analysis with detailed functional annotations. Total RNA was isolated from 29 frozen gastric GISTs and processed for hybridization on GENECHIP ® HG-U133 Plus 2.0 microarrays (Affymetrix). KIT and PDGFRA were analyzed by sequencing, while related mRNA levels were analyzed by quantitative RT-PCR. Fifteen and eleven tumours possessed mutations in KIT and PDGFRA, respectively; no mutation was found in three tumours. Gene expression analysis identified no discriminative profiles associated with clinical or pathological parameters, even though expression of hundreds of genes differentiated tumour receptor mutation and expression status. Functional features of genes differentially expressed between the two groups of GISTs suggested alterations in angiogenesis and G-protein-related and calcium signalling. Our study has identified novel molecular elements likely to be involved in receptor-dependent GIST development and allowed confirmation of previously published results. These elements may be potential therapeutic targets and novel markers of KIT mutation status

A novel mutation of the fibrillin gene causing Ectopia lentis

Energy Technology Data Exchange (ETDEWEB)

Loennqvist, L.; Kainulainen, K.; Puhakka, L.; Peltonen, L. (National Public Health Institute, Helsinki (Finland)); Child, A. (St. George' s Hospital Medical School, London (United Kingdom)); Peltonen, L. (Duncan Guthrie Institute, Glasgow, Scotland (United Kingdom))

1994-02-01

Ectopia lentis (EL), a dominantly inherited connective tissue disorder, has been genetically linked to the fibrillin gene on chromosome 15 (FBN1) in earlier studies. Here, the authors report the first EL mutation in the FBN1 gene confirming that EL is caused by mutations of this gene. So far, several mutations in the FBN1 gene have been reported in patients with Marfan syndrome (MFS). EL and MFS are clinically related but distinct conditions with typical manifestations in the ocular and skeletal systems, the fundamental difference between them being the absence of cardiovascular involvement in EL. They report a point mutation, cosegregating with the disease in the described family, that displays EL over four generations. The mutation changes a conserved glutamic acid residue in an EGF-like motif, which is the major structural component of the fibrillin and is repeated throughout the polypeptide. In vitro mutagenetic studies have demonstrated the necessity of an analogous glutamic acid residue for calcium binding in an EGF-like repeat of human factor IX. This provides a possible explanation for the role of this mutation in the disease pathogenesis. 32 refs., 2 figs., 1 tab.

Neurocognitive Profiles in Duchenne Muscular Dystrophy and Gene Mutation Site

Science.gov (United States)

D’Angelo, Maria Grazia; Lorusso, Maria Luisa; Civati, Federica; Comi, Giacomo Pietro; Magri, Francesca; Del Bo, Roberto; Guglieri, Michela; Molteni, Massimo; Turconi, Anna Carla; Bresolin, Nereo

2011-01-01

The presence of nonprogressive cognitive impairment is recognized as a common feature in a substantial proportion of patients with Duchenne muscular dystrophy. To investigate the possible role of mutations along the dystrophin gene affecting different brain dystrophin isoforms and specific cognitive profiles, 42 school-age children affected with Duchenne muscular dystrophy, subdivided according to sites of mutations along the dystrophin gene, underwent a battery of tests tapping a wide range of intellectual, linguistic, and neuropsychologic functions. Full-scale intelligence quotient was approximately 1 S.D. below the population average in the whole group of dystrophic children. Patients with Duchenne muscular dystrophy and mutations located in the distal portion of the dystrophin gene (involving the 140-kDa brain protein isoform, called Dp140) were generally more severely affected and expressed different patterns of strengths and impairments, compared with patients with Duchenne muscular dystrophy and mutations located in the proximal portion of the dystrophin gene (not involving Dp140). Patients with Duchenne muscular dystrophy and distal mutations demonstrated specific impairments in visuospatial functions and visual memory (which seemed intact in proximally mutated patients) and greater impairment in syntactic processing. PMID:22000308

New Mutation Identified in the SRY Gene High Mobility Group (HMG

Directory of Open Access Journals (Sweden)

Feride İffet Şahin

2013-06-01

Full Text Available Mutations in the SRY gene prevent the differentiation of the fetal gonads to testes and cause developing female phenotype, and as a result sex reversal and pure gonadal dysgenesis (Swyer syndrome can be developed. Different types of mutations identified in the SRY gene are responsible for 15% of the gonadal dysgenesis. In this study, we report a new mutation (R132P in the High Mobility Group (HMG region of SRY gene was detected in a patient with primary amenorrhea who has 46,XY karyotype. This mutation leads to replacement of the polar and basic arginine with a nonpolar hydrophobic proline residue at aminoacid 132 in the nuclear localization signal region of the protein. With this case report we want to emphasize the genetic approach to the patients with gonadal dysgenesis. If Y chromosome is detected during cytogenetic analysis, revealing the presence of the SRY gene and identification of mutations in this gene by sequencing analysis is become important in.

Suppression of different classes of somatic mutations in Arabidopsis by vir gene-expressing Agrobacterium strains.

Science.gov (United States)

Shah, Jasmine M; Ramakrishnan, Anantha Maharasi; Singh, Amit Kumar; Ramachandran, Subalakshmi; Unniyampurath, Unnikrishnan; Jayshankar, Ajitha; Balasundaram, Nithya; Dhanapal, Shanmuhapreya; Hyde, Geoff; Baskar, Ramamurthy

2015-08-26

Agrobacterium infection, which is widely used to generate transgenic plants, is often accompanied by T-DNA-linked mutations and transpositions in flowering plants. It is not known if Agrobacterium infection also affects the rates of point mutations, somatic homologous recombinations (SHR) and frame-shift mutations (FSM). We examined the effects of Agrobacterium infection on five types of somatic mutations using a set of mutation detector lines of Arabidopsis thaliana. To verify the effect of secreted factors, we exposed the plants to different Agrobacterium strains, including wild type (Ach5), its derivatives lacking vir genes, oncogenes or T-DNA, and the heat-killed form for 48 h post-infection; also, for a smaller set of strains, we examined the rates of three types of mutations at multiple time-points. The mutation detector lines carried a non-functional β-glucuronidase gene (GUS) and a reversion of mutated GUS to its functional form resulted in blue spots. Based on the number of blue spots visible in plants grown for a further two weeks, we estimated the mutation frequencies. For plants co-cultivated for 48 h with Agrobacterium, if the strain contained vir genes, then the rates of transversions, SHRs and FSMs (measured 2 weeks later) were lower than those of uninfected controls. In contrast, co-cultivation for 48 h with any of the Agrobacterium strains raised the transposition rates above control levels. The multiple time-point study showed that in seedlings co-cultivated with wild type Ach5, the reduced rates of transversions and SHRs after 48 h co-cultivation represent an apparent suppression of an earlier short-lived increase in mutation rates (peaking for plants co-cultivated for 3 h). An increase after 3 h co-cultivation was also seen for rates of transversions (but not SHR) in seedlings exposed to the strain lacking vir genes, oncogenes and T-DNA. However, the mutation rates in plants co-cultivated for longer times with this strain subsequently

Identification of a novel frameshift mutation in the ILDR1 gene in a UAE family, mutations review and phenotype genotype correlation.

Directory of Open Access Journals (Sweden)

Abdelaziz Tlili

Full Text Available Autosomal recessive non-syndromic hearing loss is one of the most common monogenic diseases. It is characterized by high allelic and locus heterogeneities that make a precise diagnosis difficult. In this study, whole-exome sequencing was performed for an affected patient allowing us to identify a new frameshift mutation (c.804delG in the Immunoglobulin-Like Domain containing Receptor-1 (ILDR1 gene. Direct Sanger sequencing and segregation analysis were performed for the family pedigree. The mutation was homozygous in all affected siblings but heterozygous in the normal consanguineous parents. The present study reports a first ILDR1 gene mutation in the UAE population and confirms that the whole-exome sequencing approach is a robust tool for the diagnosis of monogenic diseases with high levels of allelic and locus heterogeneity. In addition, by reviewing all reported ILDR1 mutations, we attempt to establish a genotype phenotype correlation to explain the phenotypic variability observed at low frequencies.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

Directory of Open Access Journals (Sweden)

Maryam Taghdiri

2017-08-01

Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

Science.gov (United States)

Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

2017-01-01

Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

Science.gov (United States)

Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

2016-10-31

To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

Endocrine metabolic disorders in patients with breast cancer, carriers of BRCA1 gene mutations.

Science.gov (United States)

Berstein, L M; Boyarkina, M P; Vasilyev, D A; Poroshina, T E; Kovalenko, I G; Imyanitov, E N; Semiglazov, V F

2012-03-01

Two groups of breast cancer patients (53±2 years) in clinical remission receiving no specific therapy were examined: group 1, with BRCA1 gene mutations (N=11) and group 2, without mutations of this kind (N=11). The two groups did not differ by insulinemia and glycemia, insulin resistance index, blood levels of thyrotropic hormone, sex hormone-binding globulin, insulin-like growth factor-1, triglycerides, or lipoproteins. In group 1, blood estradiol level was higher. Intensive glucose-induced generation of reactive oxygen species in these patients was associated with a decrease of cholesterolemia, of the C-peptide/insulin proportion, and a trend to higher urinary excretion of 4-hydroxyestrone, one of the most genotoxic catecholestrogens. BRCA1 gene mutations in breast cancer patients were associated with signs of estrogenization and a pro-genotoxic shift in the estrogen and glucose system, which could modulate the disease course and requires correction.

DNA mutation motifs in the genes associated with inherited diseases.

Directory of Open Access Journals (Sweden)

Michal Růžička

Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

Correlation Between C677T and A1298C Mutations on the MTHFR Gene With Plasma Homocysteine Levels and Venous Thrombosis in Pregnant Women at Risk of Thrombosis

Directory of Open Access Journals (Sweden)

Kazem Ghaffari

2015-12-01

Full Text Available Background: Deep venous thrombosis (DVT is a common disease with a high morbidity, mortality and increase in miscarriages. Objectives: The purpose of this study was to assessment the correlation between C677T and A1298C mutations on the methylenetetrahydrofolate reductase (MTHFR gene with total plasma homocysteine levels and deep venous thrombosis in pregnant women at risk of thrombosis. Patients and Methods: In this case-control study, 120 pregnant women with risk of DVT and 100 pregnant women without risk of DVT were included in the study. Assay for identification of MTHFR mutations was carried out by PCR-RFLP. Total plasma homocysteine was measured by ELISA method. Results: Homozygous (MM mutations of MTHFR C677T and A1298C were not associated with DVT in pregnant women with and without DVT, respectively. Plasma homocysteine levels were significantly higher in pregnant women with DVT (18.3 ± 5.9 μmol/L than in the pregnant women without DVT (8.9 ± 6.4 μmol/L in C677T and A1298C mutations on the MTHFR gene, respectively (P = 0.021. Conclusions: Our results showed that MTHFR C677T and MTHFR A1289C polymorphisms are not connected with total plasma homocysteine levels in pregnant women with and without DVT. Also, plasma homocysteine levels were significantly higher in pregnant women with DVT.

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Science.gov (United States)

2010-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

Intellectual Ability in the Duchenne Muscular Dystrophy and Dystrophin Gene Mutation Location

Directory of Open Access Journals (Sweden)

Rasic Milic V.

2014-12-01

Full Text Available Duchenne muscular dystrophy (DMD is the most common form of muscular dystrophy during childhood. Mutations in dystrophin (DMD gene are also recognized as a cause of cognitive impairment. We aimed to determine the association between intelligence level and mutation location in DMD genes in Serbian patients with DMD. Forty-one male patients with DMD, aged 3 to 16 years, were recruited at the Clinic for Neurology and Psychiatry for Children and Youth in Belgrade, Serbia. All patients had defined DMD gene deletions or duplications [multiplex ligation- dependent probe amplification (MLPA, polymerase chain reaction (PCR] and cognitive status assessment (Wechsler Intelligence Scale for Children, Brunet-Lezine scale, Vineland-Doll scale. In 37 patients with an estimated full scale intelligence quotient (FSIQ, six (16.22% had borderline intelligence (70mutations when boundaries were set at exons 30 and 45. However, FSIQ was statistically significantly associated with mutation location when we assumed their functional consequence on dystrophin isoforms and when mutations in the 5’-untranslated region (5’UTR of Dp140 (exons 45-50 were assigned to affect only Dp427 and Dp260. Mutations affecting Dp140 and Dp71/Dp40 have been associated with more frequent and more severe cognitive impairment. Finally, the same classification of mutations explained the greater proportion of FSIQ variability associated with cumulative loss of dystrophin isoforms. In conclusion, cumulative loss of dystrophin isoforms increases the risk of intellectual impairment in DMD and characterizing the genotype can define necessity of early cognitive interventions in DMD patients.

Genetic influence of radiation measured by the effect on the mutation rate of human minisatellite genes

International Nuclear Information System (INIS)

Kodaira, Mieko

2002-01-01

Human minisatellite genes are composed from 0.1-30 kb with a high frequency of polymorphism. The genes exist in mammalian genomes and mice's ones are well studied after irradiation of their gonad cells by X-ray and γ-ray. Following five reports concerning the significant and/or insignificant increases of the mutation rate of the genes post A-bomb exposure, Chernobyl accident and nuclear weapons test in Semipalatinsk are reviewed and discussed on the subject number, exposed dose, problems of the control group, regions examined of loci and exposure conditions. Genetic influences of radiation examined by the author's facility are not recognized in the mutation rate (3.21% vs 4.94% in the control) of minisatellite genes in children of A-bomb survivors and their parents. The mutation rates are 4.27 vs 2.52% (positive influence) and 4.2-6.01% vs 3.5-6.34% in Chernobyl, and 4.3 (parents) and 3.8% (F 1 ) vs 2.5% (positive). Mutation of human minisatellite genes can be an important measure of genetic influences at the medical level. (K.H.)

APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

NARCIS (Netherlands)

Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

1997-01-01

Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family.

Science.gov (United States)

Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping

2007-08-01

Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

A Mutation in the Dmp1 Gene Alters Phosphate Responsiveness in Mice

Science.gov (United States)

Gerard-O'Riley, Rita L.; Acton, Dena; McQueen, Amie K.; Strobel, Isabel E.; Witcher, Phillip C.; Feng, Jian Q.; Econs, Michael J.

2017-01-01

Mutations in the dentin matrix protein 1 (DMP1) gene cause autosomal recessive hypophosphatemic rickets (ARHR). Hypophosphatemia in ARHR results from increased circulating levels of the phosphaturic hormone, fibroblast growth factor 23 (FGF23). Similarly, elevated FGF23, caused by mutations in the PHEX gene, is responsible for the hypophosphatemia in X-linked hypophosphatemic rickets (XLH). Previously, we demonstrated that a Phex mutation in mice creates a lower set point for extracellular phosphate, where an increment in phosphorus further stimulates Fgf23 production to maintain low serum phosphorus levels. To test the presence of the similar set point defect in ARHR, we generated 4- and 12-week-old Dmp1/Galnt3 double knockout mice and controls, including Dmp1 knockout mice (a murine model of ARHR), Galnt3 knockout mice (a murine model of familial tumoral calcinosis), and phenotypically normal double heterozygous mice. Galnt3 knockout mice had increased proteolytic cleavage of Fgf23, leading to low circulating intact Fgf23 levels with consequent hyperphosphatemia. In contrast, Dmp1 knockout mice had little Fgf23 cleavage and increased femoral Fgf23 expression, resulting in hypophosphatemia and low femoral bone mineral density (BMD). However, introduction of the Galnt3 null allele to Dmp1 knockout mice resulted in a significant increase in serum phosphorus and normalization of BMD. This increased serum phosphorus was accompanied by markedly elevated Fgf23 expression and circulating Fgf23 levels, an attempt to reduce serum phosphorus in the face of improving phosphorus levels. These data indicate that a Dmp1 mutation creates a lower set point for extracellular phosphate and maintains it through the regulation of Fgf23 cleavage and expression. PMID:28005411

Three novel and two known androgen receptor gene mutations ...

Indian Academy of Sciences (India)

gene mutations associated with androgen insensitivity syndrome in sex-reversed XY female patients. J. Genet. ... signal and a C-terminal. Keywords. androgen insensitivity syndrome; androgen receptor; truncation mutation; N-terminal domain; XY sex reversal. .... and an increased risk of gonadal tumour. Mutations in SRY.

Law-medicine interfacing: patenting of human genes and mutations.

Science.gov (United States)

Fialho, Arsenio M; Chakrabarty, Ananda M

2011-08-01

Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

Science.gov (United States)

Jia, Peilin; Zhao, Zhongming

2014-02-01

A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

Science.gov (United States)

Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

2000-08-01

We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

Optimal control of gene mutation in DNA replication.

Science.gov (United States)

Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

2012-01-01

We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

Mutation and Expression of the DCC Gene in Human Lung Cancer

Directory of Open Access Journals (Sweden)

Takashi Kohno

2000-07-01

Full Text Available Chromosome 18q is frequently deleted in lung cancers, a common region of 18q deletions was mapped to chromosome 18g21. Since the DCC candidate tumor suppressor gene has been mapped in this region, mutation and expression of the DCC gene were examined in 46 lung cancer cell lines, consisting of 14 small cell lung carcinomas (SCLCs and 32 non-small cell lung carcinomas (NSCLCs, to elucidate the pathogenetic significance of DCC alterations in human lung carcinogenesis. A heterozygous missense mutation was detected in a NSCLC cell line, Ma26, while homozygous deletion was not detected in any of the cell lines. The DCC gene was expressed in 11 (24% of the 46 cell lines, the incidence of DCC expression was significantly higher in SCLCs (7/14, 50% than in NSCLCs (4/32, 13% (P = .01, Fisher's exact test. Therefore, genetic alterations of DCC are infrequent; however, the levels of DCC expression vary among lung cancer cells, in particular, between SCLCs and NSCLCs. The present result does not implicate DCC as a specific mutational target of 18q deletions in human lung cancer; however, it suggests that DCC is a potential target of inactivation by genetic defects including intron or promoter mutations and/or epigenetic alterations. The present result also suggests that DCC expression is associated with some properties of SCLCs, such as a neuroendocrine (NE feature.

Analysis of Y chromosome microdeletions and CFTR gene mutations as genetic markers of infertility in Serbian men

Directory of Open Access Journals (Sweden)

Dinić Jelena

2007-01-01

Full Text Available Background/Aim. Impaired fertility of a male partner is the main cause of infertility in up to one half of all infertile couples. At the genetic level, male infertility can be caused by chromosome aberrations or gene mutations. The presence and types of Y chromosome microdeletions and cystic fybrosis transmembrane conductance regulator (CFTR gene mutations as genetic cause of male infertility was tested in Serbian men. The aim of this study was to analyze CFTR gene mutations and Y chromosome microdelations as potential causes of male infertility in Serbian patients, as well as to test the hypothesis that CFTR mutations in infertile men are predominantly located in the several last exons of the gene. Methods. This study has encompassed 33 men with oligo- or azoospermia. The screening for Y chromosome microdeletions in the azoospermia factor (AZF region was performed by multiplex PCR analysis. The screening of the CFTR gene was performed by denaturing gradient gel electrophoresis (DGGE method. Results. Deletions on Y chromosome were detected in four patients, predominantly in AZFc region (four of total six deletions. Mutations in the CFTR gene were detected on eight out of 66 analyzed chromosomes of infertile men. The most common mutation was F508del (six of total eight mutations. Conclusion. This study confirmed that both Y chromosome microdeletions and CFTR gene mutations played important role in etiology of male infertility in Serbian infertile men. Genetic testing for Y chromosome microdeletions and CFTR gene mutations has been introduced in routine diagnostics and offered to couples undergoing assisted reproduction techniques. Considering that both the type of Y chromosome microdeletion and the type of CFTR mutation have a prognostic value, it is recommended that AZF and CFTR genotyping should not only be performed in patients with reduced sperm quality before undergoing assisted reproduction, but also for the purpose of preimplantation and

TINF2 Gene Mutation in a Patient with Pulmonary Fibrosis

Directory of Open Access Journals (Sweden)

T. W. Hoffman

2016-01-01

Full Text Available Pulmonary fibrosis is a frequent manifestation of telomere syndromes. Telomere gene mutations are found in up to 25% and 3% of patients with familial disease and sporadic disease, respectively. The telomere gene TINF2 encodes an eponymous protein that is part of the shelterin complex, a complex involved in telomere protection and maintenance. A TINF2 gene mutation was recently reported in a family with pulmonary fibrosis. We identified a heterozygous Ser245Tyr mutation in the TINF2 gene of previously healthy female patient that presented with progressive cough due to pulmonary fibrosis as well as panhypogammaglobulinemia at age 52. Retrospective multidisciplinary evaluation classified her as a case of possible idiopathic pulmonary fibrosis. Telomere length-measurement indicated normal telomere length in the peripheral blood compartment. This is the first report of a TINF2 mutation in a patient with sporadic pulmonary fibrosis, which represents another association between TINF2 mutations and this disease. Furthermore, this case underlines the importance of telomere dysfunction and not telomere length alone in telomere syndromes and draws attention to hypogammaglobulinemia as a manifestation of telomere syndromes.

Consequences of Marfan mutations to expression of fibrillin gene and to the structure of microfibrils

Energy Technology Data Exchange (ETDEWEB)

Peltonen, L.; Karttunen, L.; Rantamaeki, T. [NPHI, Helsinki (Finland)] [and others

1994-09-01

Marfan syndrome (MFS) is a dominantly inherited connective tissue disorder which is caused by mutations in the fibrillin-1 gene (FBN1). Over 40 family-specific FBN1 mutations have been identified. We have characterized 18 different heterozygous mutations including amino acid substitutions, premature stop, and splicing defects leading to deletions or one insertion, and one compound heterozygote with two differently mutated FBN1 alleles inherited from his affected parents. To unravel the consequences of FBN1 mutations to the transcription of FBN1 gene, we have measured the steady state levels of mRNA transcribed from the normal and mutated alleles. The missense mutations do not affect the transcription of the allele while the nonsense mutation leads to lower steady state amount of mutated allele. For the dissection of molecular pathogenesis of FBN1 mutations we have performed rotary shadowing of the microfibrils produced by the cell cultures from MFS patients. The cells from the neonatal patients with established mutations produced only disorganized fibrillin aggregates but no clearly defined microfibrils could be detected, suggesting a major role of this gene region coding for exons 24-26 in stabilization and organization of the bead structure of microfibrils. From the cells of a rare compound heterozygote case carrying two different mutations, no detectable microfibrils could be detected whereas the cells of his parents with heterozygous mutations were able to form identifiable but disorganized microfibrils. In the cells of an MFS case caused by a premature stop removing the C-terminus of fibrillin, the microfibril assembly takes place but the appropriate packing of the microfibrils is disturbed suggesting that C-terminae are actually located within the interbead domain of the microfibrils.

Deep learning of mutation-gene-drug relations from the literature.

Science.gov (United States)

Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

2018-01-25

Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be

Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

NARCIS (Netherlands)

Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

2001-01-01

Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

Detection of mutations in mtrR gene in quinolone resistant strains of N.gonorrhoeae isolated from India

Directory of Open Access Journals (Sweden)

S V Kulkarni

2015-01-01

Full Text Available Background and Objectives: Emergence of multi-drug resistant Neisseria gonorrhoeae resulting from new genetic mutation is a serious threat in controlling gonorrhea. This study was undertaken to identify and characterise mutations in the mtrR genes in N.gonorrhoeae isolates resistant to six different antibiotics in the quinolone group. Materials and Methods: The Minimum inhibitory concentrations (MIC of five quinolones for 64 N.gonorrhoeae isolates isolated during Jan 2007-Jun 2009 were determined by E-test method. Mutations in MtrR loci were examined by deoxyribonucleic acid (DNA sequencing. Results: The proportion of N.gonorrhoeae strains resistant to anti-microbials was 98.4% for norfloxacin and ofloxacin, 96.8% for enoxacin and ciprofloxacin, 95.3% for lomefloxacin. Thirty-one (48.4% strains showed mutation (single/multiple in mtrR gene. Ten different mutations were observed and Gly-45 → Asp, Tyr-105 → His being the most common observed mutation. Conclusion: This is the first report from India on quinolone resistance mutations in MtrRCDE efflux system in N.gonorrhoeae. In conclusion, the high level of resistance to quinolone and single or multiple mutations in mtrR gene could limit the drug choices for gonorrhoea.

Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

Science.gov (United States)

Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

2014-05-01

Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

The Analysis Mutation Of The CARD 15 Gene Variants In Chronic Periodontis

OpenAIRE

Bahruddin Thalib, Dr.drg. M.Kes,Sp.Pros.

2014-01-01

As Conclusion, CARD 15 gene mutation with chronic periodontitis was found to have heterozygote mutation and homozygote mutation variants, and also found genetics variation that changed the composition of C??? T nucleotide at codon 802 in exon 4 amino acid changed from alanine to valine. Purpose of This study was to determine the variant of card 15 gene mutation with periodontitis chronic.

rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

Science.gov (United States)

Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

2018-03-01

The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

Science.gov (United States)

Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

2015-10-01

Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.

Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

Science.gov (United States)

Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

2014-05-01

Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

Mutational and Evolutionary Analyses of Bovine Reprimo Gene ...

African Journals Online (AJOL)

It can therefore be concluded that bovine RPRM gene contained 4 transition mutations and 5 indels that can be used in marker assisted selection. Evolutionary findings also demonstrated the existence of a divergent evolution between bovine RPRM gene and RPRM gene of fishes and frog. Keywords: Identity, phylogeny ...

A case of pseudohypoaldosteronism type 1 with a mutation in the mineralocorticoid receptor gene

Directory of Open Access Journals (Sweden)

Se Eun Lee

2011-02-01

Full Text Available Pseudohypoaldosteronism type 1 (PHA1 is a rare form of mineralocorticoid resistance characterized in newborns by salt wasting with dehydration, hyperkalemia and failure to thrive. This disease is heterogeneous in etiology and includes autosomal dominant PHA1 owing to mutations of the NR3C2 gene encoding the mineralocorticoid receptor, autosomal recessive PHA1 due to mutations of the epithelial sodium channel (ENaC gene, and secondary PHA1 associated with urinary tract diseases. Amongst these diseases, autosomal dominant PHA1 shows has manifestations restricted to renal tubules including a mild salt loss during infancy and that shows a gradual improvement with advancing age. Here, we report a neonatal case of PHA1 with a NR3C2 gene mutation (a heterozygous c.2146_2147insG in exon 5, in which the patient showed failure to thrive, hyponatremia, hyperkalemia, and elevated plasma renin and aldosterone levels. This is the first case of pseudohypoaldosteronism type 1 confirmed by genetic analysis in Korea.

Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

Science.gov (United States)

Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

2016-10-01

Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

GPR143 gene mutation analysis in pediatric patients with albinism.

Science.gov (United States)

Trebušak Podkrajšek, Katarina; Stirn Kranjc, Branka; Hovnik, Tinka; Kovač, Jernej; Battelino, Tadej

2012-09-01

X-linked ocular albinism type 1 is difficult to differentiate clinically from other forms of albinism in young patients. X-linked ocular albinism type 1 is caused by mutations in the GPR143 gene, encoding melanosome specific G-protein coupled receptor. Patients typically present with moderately to severely reduced visual acuity, nystagmus, strabismus, photophobia, iris translucency, hypopigmentation of the retina, foveal hypoplasia and misrouting of optic nerve fibers at the chiasm. Following clinical ophthalmological evaluation, GPR143 gene mutational analyses were performed in a cohort of 15 pediatric male patients with clinical signs of albinism. Three different mutations in the GPR143 gene were identified in four patients, including a novel c.886G>A (p.Gly296Arg) mutation occurring "de novo" and a novel intronic c.360 + 5G>A mutation, identified in two related boys. Four patients with X-linked ocular albinism type 1 were identified from a cohort of 15 boys with clinical signs of albinism using mutation detection methods. Genetic analysis offers the possibility of early definitive diagnosis of ocular albinism type 1 in a significant portion of boys with clinical signs of albinism.

KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

Science.gov (United States)

Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

2010-06-01

KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

Mutations du gene de la filamine et syndromes malformatifs | Koffi ...

African Journals Online (AJOL)

Filamin is a cytoskeletal protein that occurs in the control of cytoskeleton structure and activity, the modulation of cell shape and migration as well as in the maintaining of cell shape. Mutations in the genes FLNA and FLNB provoke diverse malformative diseases in human. Mutations in the gene FLNA cause four X-Linked ...

Towards linked open gene mutations data

Science.gov (United States)

2012-01-01

Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

Towards linked open gene mutations data.

Science.gov (United States)

Zappa, Achille; Splendiani, Andrea; Romano, Paolo

2012-03-28

With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

Science.gov (United States)

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

2011-11-24

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

NMD Microarray Analysis for Rapid Genome-Wide Screen of Mutated Genes in Cancer

Directory of Open Access Journals (Sweden)

Maija Wolf

2005-01-01

Full Text Available Gene mutations play a critical role in cancer development and progression, and their identification offers possibilities for accurate diagnostics and therapeutic targeting. Finding genes undergoing mutations is challenging and slow, even in the post-genomic era. A new approach was recently developed by Noensie and Dietz to prioritize and focus the search, making use of nonsense-mediated mRNA decay (NMD inhibition and microarray analysis (NMD microarrays in the identification of transcripts containing nonsense mutations. We combined NMD microarrays with array-based CGH (comparative genomic hybridization in order to identify inactivation of tumor suppressor genes in cancer. Such a “mutatomics” screening of prostate cancer cell lines led to the identification of inactivating mutations in the EPHB2 gene. Up to 8% of metastatic uncultured prostate cancers also showed mutations of this gene whose loss of function may confer loss of tissue architecture. NMD microarray analysis could turn out to be a powerful research method to identify novel mutated genes in cancer cell lines, providing targets that could then be further investigated for their clinical relevance and therapeutic potential.

Mutation of the S and 3c genes in genomes of feline coronaviruses.

Science.gov (United States)

Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

2018-05-17

Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.

An experimental study of BIGH3 gene mutations in the patients with corneal dystrophies

International Nuclear Information System (INIS)

Jin Tao; Zou Liuhe; Yang Ling

2004-01-01

Objective: To evaluate BIGH3 gene mutations in Chinese patents with corneal dystrophies. Methods: 2ml peripheral venous blood was collected from 15 patients with granular corneal dystrophies and 5 normal subjects. Leucocytes DNA was extracted with standard method. With two pairs of oligonucleotide primers, exon 4 and exon 12 of the BIGH3 gene were amplified using the polymerase chain reaction. Amplified DNA fragments were purified and sequenced directly. Results: Mutations in BIGH3 gene were detected in all the patients with corneal dystrophies. BIGH3 gene mutations were not found in normal subjects. 12 patients with Avellino corneal dystrophy had the missense mutation R124H in the BIGH3 gene. 3 patients with granular corneal dystrophy had the missense mutation R555W in the BIGH3 gene. Conclusion: R124H and R555W mutations in BIGH3 gene were also found in the Chinese patients with Avellino and granular corneal dystrophies. In China, Avellino corneal dystrophy associated with the R124H mutation is the most common form in the corneal dystrophies resulted by BIGH3 gene mutions. Condon 124 and 555 are also the hot spots for the mutations in the BIGH3 gene in the Chinese patients with corneal dystrophies. Molecular genetic analysis may be repuired for proper diagnosis and subclassification of corneal dystrophies. (authors)

Relationship between serum carcinoembryonic antigen level and epidermal growth factor receptor mutations with the influence on the prognosis of non-small-cell lung cancer patients

Directory of Open Access Journals (Sweden)

Cai ZX

2016-06-01

Full Text Available Zuxun Cai Department of Thoracic Surgery, Henan Provincial Chest Hospital, Zhengzhou City, People’s Republic of China Objective: To investigate the relationship between serum carcinoembryonic antigen (CEA level and epidermal growth factor receptor (EGFR gene mutations in non-small-cell lung cancer (NSCLC patients and to analyze the influence of CEA level on postoperative survival time in lung cancer patients. Methods: A total of 296 patients who were treated in Thoracic Surgery Department of Henan Provincial Chest Hospital from September 2011 to September 2013 were recruited. The level of tumor markers, such as CEA, was determined before the surgery, and EGFR gene mutations were detected after surgery. Thereby, the relationship between tumor makers, including CEA, and EGFR mutation and its influence on prognosis could be investigated. Results: Among 296 patients, the positive rate of EGFR gene mutation was 37.84% (112/296; the mutation occurred more frequently in nonsmokers, adenocarcinoma patients, women, and patients aged <60 years (P<0.05. Both tumor markers and chemosensitivity indicators were related to the profile of EGFR mutations. Elevated squamous cell carcinoma and Cyfra21-1 as well as positively expressed ERCC1 were more common in patients with wild-type EGFR (P<0.05, whereas increased CEA level was observed more frequently in patients with EGFR gene mutation (P=0.012. The positive rate of EGFR gene mutations was higher as the serum CEA level increased, that is, the positive rate in patients with serum CEA level <5, 5–20, and >20 µg/L was 39.81%, 45.32%, and 65.47%, respectively (P=0.004. Logistic regression analysis showed that CEA level was an independent factor in predicting EGFR gene mutations, and serum CEA level was also an independent factor in affecting the prognosis of NSCLC patients, as the overall 2-year survival rate was 73.86% in elevated CEA group and 86.43% in normal group (P<0.01. Conclusion: The prognosis of

Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

Directory of Open Access Journals (Sweden)

Simon Leuchs

Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

Directory of Open Access Journals (Sweden)

Jakub Piotr Fichna

Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

Science.gov (United States)

Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

2014-01-01

Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis.

Science.gov (United States)

Jiang, Jingjing; Wang, Yuhui; Ling, Yan; Kayoumu, Abudurexiti; Liu, George; Gao, Xin

2016-01-16

The severe forms of hypertriglyceridemia are usually caused by genetic defects. In this study, we described a Chinese female with severe hypertriglyceridemia caused by a novel homozygous mutation in the APOC2 gene. Lipid profiles of the pedigree were studied in detail. LPL and HL activity were also measured. The coding regions of 5 candidate genes (namely LPL, APOC2, APOA5, LMF1, and GPIHBP1) were sequenced using genomic DNA from peripheral leucocytes. The ApoE gene was also genotyped. Serum triglyceride level was extremely high in the proband, compared with other family members. Plasma LPL activity was also significantly reduced in the proband. Serum ApoCII was very low in the proband as well as in the heterozygous mutation carriers. A novel mutation (c.86A > CC) was identified on exon 3 [corrected] of the APOC2 gene, which converted the Asp [corrected] codon at position 29 into Ala, followed by a termination codon (TGA). This study presented the first case of ApoCII deficiency in the Chinese population, with a novel mutation c.86A > CC in the APOC2 gene identified. Serum ApoCII protein might be a useful screening test for identifying mutation carriers.

Analysis of gene mutations in children with cholestasis of undefined etiology.

Science.gov (United States)

Matte, Ursula; Mourya, Reena; Miethke, Alexander; Liu, Cong; Kauffmann, Gregory; Moyer, Katie; Zhang, Kejian; Bezerra, Jorge A

2010-10-01

The discovery of genetic mutations in children with inherited syndromes of intrahepatic cholestasis allows for diagnostic specificity despite similar clinical phenotypes. Here, we aimed to determine whether mutation screening of target genes could assign a molecular diagnosis in children with idiopathic cholestasis. DNA samples were obtained from 51 subjects with cholestasis of undefined etiology and surveyed for mutations in the genes SERPINA1, JAG1, ATP8B1, ABCB11, and ABCB4 by a high-throughput gene chip. Then, the sequence readouts for all 5 genes were analyzed for mutations and correlated with clinical phenotypes. Healthy subjects served as controls. Sequence analysis of the genes identified 14 (or 27%) subjects with missense, nonsense, deletion, and splice site variants associated with disease phenotypes based on the type of mutation and/or biallelic involvement in the JAG1, ATP8B1, ABCB11, or ABCB4 genes. These patients had no syndromic features and could not be differentiated by biochemical markers or histopathology. Among the remaining subjects, 10 (or ∼20%) had sequence variants in ATP8B1 or ABCB11 that involved only 1 allele, 8 had variants not likely to be associated with disease phenotypes, and 19 had no variants that changed amino acid composition. Gene sequence analysis assigned a molecular diagnosis in 27% of subjects with idiopathic cholestasis based on the presence of variants likely to cause disease phenotypes.

The p. N103K mutation of leptin (LEP gene and severe early onset obesity in Pakistan

Directory of Open Access Journals (Sweden)

Shabana

Full Text Available BACKGROUND: Obesity is a complex disorder and has been increasing globally at alarming rates including Pakistan. However, there is scarce research on understanding obesity genetics in Pakistan. Leptin is a hormone secreted by adipocytes in response to satiety and correlates with body weight. Any mutations in the LEP gene have an adverse effect on energy regulation pathway and lead to severe, early onset obesity. To date, only eight mutations have been described in the LEP gene of which p. N103K is one. METHODS: We aimed to analyze the prevalence of this mutation in Pakistani subjects. A total of 475 subjects were genotyped by PCR-RFLP analysis and their serum profiling was done. RESULTS: Results showed that this mutation was present only in one male child with early onset obesity (10 year. He had very low serum leptin levels suggestive of functional impact of the mutation. The prevalence of such mutations is, however, low due to the drastic effects on the energy regulation. CONCLUSION: In conclusion, LEP gene mutations contribute significantly to the monogenic forms of obesity and are important due to the availability of treatment options. Such mutations may exert their effect by directly affecting energy regulation pathway and are more prominent in the early stages of life only.

Geographical distribution of β-globin gene mutations in Syria.

Science.gov (United States)

Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

2018-04-11

Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

Mutational analysis of EGFR and related signaling pathway genes in lung adenocarcinomas identifies a novel somatic kinase domain mutation in FGFR4.

Directory of Open Access Journals (Sweden)

Jenifer L Marks

2007-05-01

Full Text Available Fifty percent of lung adenocarcinomas harbor somatic mutations in six genes that encode proteins in the EGFR signaling pathway, i.e., EGFR, HER2/ERBB2, HER4/ERBB4, PIK3CA, BRAF, and KRAS. We performed mutational profiling of a large cohort of lung adenocarcinomas to uncover other potential somatic mutations in genes of this signaling pathway that could contribute to lung tumorigenesis.We analyzed genomic DNA from a total of 261 resected, clinically annotated non-small cell lung cancer (NSCLC specimens. The coding sequences of 39 genes were screened for somatic mutations via high-throughput dideoxynucleotide sequencing of PCR-amplified gene products. Mutations were considered to be somatic only if they were found in an independent tumor-derived PCR product but not in matched normal tissue. Sequencing of 9MB of tumor sequence identified 239 putative genetic variants. We further examined 22 variants found in RAS family genes and 135 variants localized to exons encoding the kinase domain of respective proteins. We identified a total of 37 non-synonymous somatic mutations; 36 were found collectively in EGFR, KRAS, BRAF, and PIK3CA. One somatic mutation was a previously unreported mutation in the kinase domain (exon 16 of FGFR4 (Glu681Lys, identified in 1 of 158 tumors. The FGFR4 mutation is analogous to a reported tumor-specific somatic mutation in ERBB2 and is located in the same exon as a previously reported kinase domain mutation in FGFR4 (Pro712Thr in a lung adenocarcinoma cell line.This study is one of the first comprehensive mutational analyses of major genes in a specific signaling pathway in a sizeable cohort of lung adenocarcinomas. Our results suggest the majority of gain-of-function mutations within kinase genes in the EGFR signaling pathway have already been identified. Our findings also implicate FGFR4 in the pathogenesis of a subset of lung adenocarcinomas.

Numerous BAF complex genes are mutated in Coffin-Siris syndrome.

Science.gov (United States)

Miyake, Noriko; Tsurusaki, Yoshinori; Matsumoto, Naomichi

2014-09-01

Coffin-Siris syndrome (CSS; OMIM#135900) is a rare congenital anomaly syndrome characterized by intellectual disability, coarse face, hypertrichosis, and absence/hypoplasia of the fifth digits' nails. As the majority of patients are sporadic, an autosomal dominant inheritance model has been postulated. Recently, whole exome sequencing (WES) emerged as a comprehensive analytical method for rare variants. We applied WES on five CSS patients and found two de novo mutations in SMARCB1. SMARCB1 was completely sequenced in 23 CSS patients and the mutations were found in two more patients. As SMARCB1 encodes a subunit of the BAF complex functioning as a chromatin remodeling factor, mutations in 15 other subunit genes may cause CSS and thus were analyzed in 23 CSS patients. We identified heterozygous mutations in either of six genes (SMARCA4, SMARCB1, SMARCA2, SMARCE1, ARID1A, and ARID1B) in 20 out of 23 CSS patients. The patient with a SMARCA2 mutation was re-evaluated and identified as having Nicolaides-Baraitser syndrome (OMIM#601358), which is similar to but different from CSS. Additionally, 49 more CSS patients were analyzed as a second cohort. Together with the first cohort, 37 out of 71 (22 plus 49) patients were found to have a mutation in either one of five BAF complex genes. Furthermore, two CSS patients were reported to have a PHF6 abnormality, which can also cause Borjeson-Forssman-Lehmann syndrome (OMIM#301900), an X-linked intellectual disability syndrome with epilepsy and endocrine abnormalities. The current list of mutated genes in CSS is far from being complete and analysis of more patients is required. © 2014 Wiley Periodicals, Inc.

Mutations in the maize zeta-carotene desaturase gene lead to viviparous kernel.

Directory of Open Access Journals (Sweden)

Yan Chen

Full Text Available Preharvest sprouting reduces the maize quality and causes a significant yield loss in maize production. vp-wl2 is a Mutator (Mu-induced viviparous mutant in maize, causing white or pale yellow kernels, dramatically reduced carotenoid and ABA content, and a high level of zeta-carotene accumulation. Here, we reported the cloning of the vp-wl2 gene using a modified digestion-ligation-amplification method (DLA. The results showed that an insertion of Mu9 in the first intron of the zeta-carotene desaturase (ZDS gene results in the vp-wl2 mutation. Previous studies have suggested that ZDS is likely the structural gene of the viviparous9 (vp9 locus. Therefore, we performed an allelic test using vp-wl2 and three vp9 mutants. The results showed that vp-wl2 is a novel allele of the vp9 locus. In addition, the sequences of ZDS gene were identified in these three vp9 alleles. The vp-wl2 mutant gene was subsequently introgressed into four maize inbred lines, and a viviparous phenotype was observed with yield losses from 7.69% to 13.33%.

Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

Directory of Open Access Journals (Sweden)

Diaz-Llopis Manuel

2011-10-01

Full Text Available Abstract Background Usher Syndrome type II (USH2 is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP. Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin.

Mice overexpressing both non-mutated human SOD1 and mutated SOD1G93A genes: a competent experimental model for studying iron metabolism in amyotrophic lateral sclerosis

Directory of Open Access Journals (Sweden)

Anna eGajowiak

2016-01-01

Full Text Available Amyotrophic lateral sclerosis (ALS is a progressive neurodegenerative disease characterized by degeneration and loss of motor neurons in the spinal cord, brainstem and motor cortex. Up to 10% of ALS cases are inherited (familial, fALS and associated with mutations, frequently in the superoxide dismutase 1 (SOD1 gene. Rodent transgenic models of ALS are often used to elucidate a complex pathogenesis of this disease. Of importance, both ALS patients and animals carrying mutated human SOD1 gene show symptoms of oxidative stress and iron metabolism misregulation. The aim of our study was to characterize changes in iron metabolism in one of the most commonly used models of ALS – transgenic mice overexpressing human mutated SOD1G93A gene. We analyzed the expression of iron-related genes in asymptomatic, 2-month old and symptomatic, 4-month old SOD1G93A mice. In parallel, respective age-matched mice overexpressing human non-mutated SOD1 transgene and control mice were analyzed. We demonstrate that the overexpression of both SOD1 and SOD1G93A genes account for a substantial increase in SOD1 protein levels and activity in selected tissues and that not all the changes in iron metabolism genes expression are specific for the overexpression of the mutated form of SOD1.

The Androgen Receptor Gene Mutations Database.

Science.gov (United States)

Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

1998-01-01

The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

Science.gov (United States)

Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

2017-07-01

HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

Science.gov (United States)

Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

2006-02-01

Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Directory of Open Access Journals (Sweden)

Dunham Stephen

2009-11-01

Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

Pure myopathy with enlarged mitochondria associated to a new mutation in MTND2 gene

Directory of Open Access Journals (Sweden)

Alice Zanolini

2017-03-01

Full Text Available To date, only few mutations in the mitochondrial DNA (mtDNA-encoded ND2 subunit of Complex I have been reported, usually presenting a severe phenotype characterized by early onset encephalomyopathy and early death. In this report, we describe a new mutation in the MTND2 gene in a 21-year-old man with a mild myopathic phenotype characterized by exercise intolerance and increased plasma lactate at rest. Electromyography and brain NMR were normal, and no cardiac involvement was present. Muscle biopsy showed a massive presence of ragged red – COX-positive fibres, with enlarged mitochondria containing osmiophilic inclusions. Biochemical assays revealed a severe isolated complex I deficiency. We identified a novel, heteroplasmic mutation m.4831G>A in the MTND2 gene, causing the p.Gly121Asp substitution in the ND2 protein. The mutation was present in the 95% of mitochondrial genomes from patient's muscle tissue, at a lower level in cells from the urinary tract and at a lowest level in lymphocytes from patient's blood; the base substitution was absent in fibroblasts and in the tissues from proband's healthy mother and brother. The specific skeletal muscle tissue involvement can explain the childhood-onset and the relatively benign, exclusively myopathic course of the disease.

Hemochromatosis C282Y gene mutation as a potential susceptibility ...

African Journals Online (AJOL)

G.M. Mokhtar

2017-08-12

Aug 12, 2017 ... Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene's mutation especially the C282Y mutation. The interaction between hemoglo- bin chain synthesis' disorders and the C282Y mutation may worsen the clinical picture of beta-.

Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect

Directory of Open Access Journals (Sweden)

Wakako Jo

2010-01-01

Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.

Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

Directory of Open Access Journals (Sweden)

Udhaya H Kotecha

2014-01-01

Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

A targeted constitutive mutation in the APC tumor suppressor gene underlies mammary but not intestinal tumorigenesis.

Directory of Open Access Journals (Sweden)

Claudia Gaspar

2009-07-01

Full Text Available Germline mutations in the adenomatous polyposis coli (APC gene are responsible for familial adenomatous polyposis (FAP, an autosomal dominant hereditary predisposition to the development of multiple colorectal adenomas and of a broad spectrum of extra-intestinal tumors. Moreover, somatic APC mutations play a rate-limiting and initiating role in the majority of sporadic colorectal cancers. Notwithstanding its multifunctional nature, the main tumor suppressing activity of the APC gene resides in its ability to regulate Wnt/beta-catenin signaling. Notably, genotype-phenotype correlations have been established at the APC gene between the length and stability of the truncated proteins encoded by different mutant alleles, the corresponding levels of Wnt/beta-catenin signaling activity they encode for, and the incidence and distribution of intestinal and extra-intestinal tumors. Here, we report a novel mouse model, Apc1572T, obtained by targeting a truncated mutation at codon 1572 in the endogenous Apc gene. This hypomorphic mutant allele results in intermediate levels of Wnt/beta-catenin signaling activation when compared with other Apc mutations associated with multifocal intestinal tumors. Notwithstanding the constitutive nature of the mutation, Apc(+/1572T mice have no predisposition to intestinal cancer but develop multifocal mammary adenocarcinomas and subsequent pulmonary metastases in both genders. The histology of the Apc1572T primary mammary tumours is highly heterogeneous with luminal, myoepithelial, and squamous lineages and is reminiscent of metaplastic carcinoma of the breast in humans. The striking phenotype of Apc(+/1572T mice suggests that specific dosages of Wnt/beta-catenin signaling activity differentially affect tissue homeostasis and initiate tumorigenesis in an organ-specific fashion.

A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

Directory of Open Access Journals (Sweden)

NING Huibin

2017-01-01

Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

Profiling cancer gene mutations in clinical formalin-fixed, paraffin-embedded colorectal tumor specimens using targeted next-generation sequencing.

Science.gov (United States)

Zhang, Liangxuan; Chen, Liangjing; Sah, Sachin; Latham, Gary J; Patel, Rajesh; Song, Qinghua; Koeppen, Hartmut; Tam, Rachel; Schleifman, Erica; Mashhedi, Haider; Chalasani, Sreedevi; Fu, Ling; Sumiyoshi, Teiko; Raja, Rajiv; Forrest, William; Hampton, Garret M; Lackner, Mark R; Hegde, Priti; Jia, Shidong

2014-04-01

The success of precision oncology relies on accurate and sensitive molecular profiling. The Ion AmpliSeq Cancer Panel, a targeted enrichment method for next-generation sequencing (NGS) using the Ion Torrent platform, provides a fast, easy, and cost-effective sequencing workflow for detecting genomic "hotspot" regions that are frequently mutated in human cancer genes. Most recently, the U.K. has launched the AmpliSeq sequencing test in its National Health Service. This study aimed to evaluate the clinical application of the AmpliSeq methodology. We used 10 ng of genomic DNA from formalin-fixed, paraffin-embedded human colorectal cancer (CRC) tumor specimens to sequence 46 cancer genes using the AmpliSeq platform. In a validation study, we developed an orthogonal NGS-based resequencing approach (SimpliSeq) to assess the AmpliSeq variant calls. Validated mutational analyses revealed that AmpliSeq was effective in profiling gene mutations, and that the method correctly pinpointed "true-positive" gene mutations with variant frequency >5% and demonstrated high-level molecular heterogeneity in CRC. However, AmpliSeq enrichment and NGS also produced several recurrent "false-positive" calls in clinically druggable oncogenes such as PIK3CA. AmpliSeq provided highly sensitive and quantitative mutation detection for most of the genes on its cancer panel using limited DNA quantities from formalin-fixed, paraffin-embedded samples. For those genes with recurrent "false-positive" variant calls, caution should be used in data interpretation, and orthogonal verification of mutations is recommended for clinical decision making.

Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

Directory of Open Access Journals (Sweden)

Kentaro Mori

Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

Inactivating Mutation screening of Exon 6 and Exon 10E of FSHR gene in women with Polycystic Ovarian Syndrome in Vellore population

Science.gov (United States)

Sekar, Nishu; Sapre, Madhura; Kale, Vaikhari; Prabhu, Yogamaya D.; Renu, Kaviyarasi; Ramgir, Shalaka S.; Abilash, V. G.

2017-11-01

Polycystic Ovarian syndrome (PCOS) is a major cause of infertility in females of reproducing age and is typified by oligo-anovulation, hyperandrogenism, hirsutism and polycystic ovaries. FSHR gene located on chromosome 2 p21 is responsible for the normal follicular development and any deletion or mutation in the gene affects the interaction of FSH with its receptor. Thus, it becomes the candidate gene for PCOS study. Inactivating mutation in FSHR gene limits the receptor’s function by creating a complete block, changing the receptor-ligand complex or the basic hormone signal transduction.To screen the inactivating mutations in Exon 6 and Exon 10E of FSHR gene in women diagnosed with PCOS.PCR-RFLP analysis indicated that there were no inactivating mutations found in Exon 6 and Exon 10E. Variations in hormone levels were seen amongst the PCOS patients. There were no inactivating mutations found in FSHR gene of the women diagnosed with PCOS according to the Rotterdam criteria in Vellore population.

A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

Science.gov (United States)

2014-01-01

Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

Frequency of common CFTR gene mutations in Venezuelan patients with cystic fibrosis

OpenAIRE

Sánchez, Karen; Arcia, Orlando; Matute, Xiorama; Mindiola, Luz; Chaustre, Ismenia; Takiff, Howard

2014-01-01

Mutations in the CFTR gene in Cystic Fibrosis (CF) patients have geographic differences and there is scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in these patients. We amplified and sequenced exons 7, 10, 11, 19, 20 and 21, which contain the most common CFTR mutations, from 105 Venezuelan patients in the National CF Program. Eleven different mutations were identified, four with frequencies greater than 1%: p.Phe508del...

Mutations in the NOT Genes or in the Translation Machinery Similarly Display Increased Resistance to Histidine Starvation

Directory of Open Access Journals (Sweden)

Martine A. Collart

2017-05-01

Full Text Available The NOT genes encode subunits of the conserved Ccr4-Not complex, a global regulator of gene expression, and in particular of mRNA metabolism. They were originally identified in a selection for increased resistance to histidine starvation in the yeast S. cerevisiae. Recent work indicated that the Not5 subunit, ortholog of mammalian CNOT3, determines global translation levels by defining binding of the Ccr4-Not scaffold protein Not1 to ribosomal mRNAs during transcription. This is needed for optimal translation of ribosomal proteins. In this work we searched for mutations in budding yeast that were resistant to histidine starvation using the same selection that originally led to the isolation of the NOT genes. We thereby isolated mutations in ribosome-related genes. This common phenotype of ribosome mutants and not mutants is in good agreement with the positive role of the Not proteins for translation. In this regard, it is interesting that frequent mutations in RPL5 and RPL10 or in CNOT3 have been observed to accumulate in adult T-cell acute lymphoblastic leukemia (T-ALL. This suggests that in metazoans a common function implicating ribosome subunits and CNOT3 plays a role in the development of cancer. In this perspective we suggest that the Ccr4-Not complex, according to translation levels and fidelity, could itself be involved in the regulation of amino acid biosynthesis levels. We discuss how this could explain why mutations have been identified in many cancers.

Novel mutations in the TBX5 gene in patients with Holt-Oram Syndrome

Directory of Open Access Journals (Sweden)

Marianna P.R. Porto

2010-01-01

Full Text Available The Holt-Oram syndrome (HOS is an autosomal dominant condition characterized by upper limb and cardiac malformations. Mutations in the TBX5 gene cause HOS and have also been associated with isolated heart and arm defects. Interactions between the TBX5, GATA4 and NKX2.5 proteins have been reported in humans. We screened the TBX5, GATA4, and NKX2.5 genes for mutations, by direct sequencing, in 32 unrelated patients presenting classical (8 or atypical HOS (1, isolated congenital heart defects (16 or isolated upper-limb malformations (7. Pathogenic mutations in the TBX5 gene were found in four HOS patients, including two new mutations (c.374delG; c.678G > T in typical patients, and the hotspot mutation c.835C > T in two patients, one of them with an atypical HOS phenotype involving lower-limb malformations. Two new mutations in the GATA4 gene were found in association with isolated upper-limb malformations, but their clinical significance remains to be established. A previously described possibly pathogenic mutation in the NKX2.5 gene (c.73C > 7 was detected in a patient with isolated heart malformations and also in his clinically normal father.

Splice Site Mutations in the ATP7A Gene

DEFF Research Database (Denmark)

Skjørringe, Tina; Tümer, Zeynep; Møller, Lisbeth Birk

2011-01-01

Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12...... mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation...... to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations...

A low-pungency S3212 genotype of Capsicum frutescens caused by a mutation in the putative aminotransferase (p-AMT) gene.

Science.gov (United States)

Park, Young-Jun; Nishikawa, Tomotaro; Minami, Mineo; Nemoto, Kazuhiro; Iwasaki, Tomohiro; Matsushima, Kenichi

2015-12-01

The purpose of this study was to identify the genetic mechanism underlying capsinoid biosynthesis in S3212, a low-pungency genotype of Capsicum frutescens. Screening of C. frutescens accessions for capsaicinoid and capsiate contents by high-performance liquid chromatography revealed that low-pungency S3212 contained high levels of capsiate but no capsaicin. Comparison of DNA coding sequences of pungent (T1 and Bird Eye) and low-pungency (S3212) genotypes uncovered a significant 12-bp deletion mutation in exon 7 of the p-AMT gene of S3212. In addition, p-AMT gene transcript levels in placental tissue were positively correlated with the degree of pungency. S3212, the low-pungency genotype, exhibited no significant p-AMT transcript levels, whereas T1, one of the pungent genotypes, displayed high transcript levels of this gene. We therefore conclude that the deletion mutation in the p-AMT gene is related to the loss of pungency in placental tissue and has given rise to the low-pungency S3212 C. frutescens genotype. C. frutescens S3212 represents a good natural source of capsinoids. Finally, our basic characterization of the uncovered p-AMT gene mutation should contribute to future studies of capsinoid biosynthesis in Capsicum.

Mutations in 23S rRNA gene associated with decreased susceptibility to tiamulin and valnemulin in Mycoplasma gallisepticum.

Science.gov (United States)

Li, Bei-Bei; Shen, Jian-Zhong; Cao, Xing-Yuan; Wang, Yang; Dai, Lei; Huang, Si-Yang; Wu, Cong-Ming

2010-07-01

Mycoplasma gallisepticum is a major etiological agent of chronic respiratory disease (CRD) in chickens and sinusitis in turkeys. The pleuromutilin antibiotics tiamulin and valnemulin are currently used in the treatment of M. gallisepticum infection. We studied the in vitro development of pleuromutilin resistance in M. gallisepticum and investigated the molecular mechanisms involved in this process. Pleuromutilin-resistant mutants were selected by serial passages of M. gallisepticum strains PG31 and S6 in broth medium containing subinhibitory concentrations of tiamulin or valnemulin. A portion of the gene encoding 23S rRNA gene (domain V) and the gene encoding ribosome protein L3 were amplified and sequenced. No mutation could be detected in ribosome protein L3. Mutations were found at nucleotide positions 2058, 2059, 2061, 2447 and 2503 of 23S rRNA gene (Escherichia coli numbering). Although a single mutation could cause elevation of tiamulin and valnemulin MICs, combinations of two or three mutations were necessary to produce high-level resistance. All the mutants were cross-resistant to lincomycin, chloramphenicol and florfenicol. Mutants with the A2058G or the A2059G mutation exhibited cross-resistance to macrolide antibiotics erythromycin, tilmicosin and tylosin.

Small Mutations of the DMD Gene in Taiwanese Families

Directory of Open Access Journals (Sweden)

Hsiao-Lin Hwa

2008-06-01

Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

Mechanistic study on the nuclear modifier gene MSS1 mutation suppressing neomycin sensitivity of the mitochondrial 15S rRNA C1477G mutation in Saccharomyces cerevisiae.

Science.gov (United States)

Zhou, Qiyin; Wang, Wei; He, Xiangyu; Zhu, Xiaoyu; Shen, Yaoyao; Yu, Zhe; Wang, Xuexiang; Qi, Xuchen; Zhang, Xuan; Fan, Mingjie; Dai, Yu; Yang, Shuxu; Yan, Qingfeng

2014-01-01

The phenotypic manifestation of mitochondrial DNA (mtDNA) mutations can be modulated by nuclear genes and environmental factors. However, neither the interaction among these factors nor their underlying mechanisms are well understood. The yeast Saccharomyces cerevisiae mtDNA 15S rRNA C1477G mutation (PR) corresponds to the human 12S rRNA A1555G mutation. Here we report that a nuclear modifier gene mss1 mutation suppresses the neomycin-sensitivity phenotype of a yeast C1477G mutant in fermentable YPD medium. Functional assays show that the mitochondrial function of the yeast C1477G mutant was impaired severely in YPD medium with neomycin. Moreover, the mss1 mutation led to a significant increase in the steady-state level of HAP5 (heme activated protein), which greatly up-regulated the expression of glycolytic transcription factors RAP1, GCR1, and GCR2 and thus stimulated glycolysis. Furthermore, the high expression of the key glycolytic enzyme genes HXK2, PFK1 and PYK1 indicated that enhanced glycolysis not only compensated for the ATP reduction from oxidative phosphorylation (OXPHOS) in mitochondria, but also ensured the growth of the mss1(PR) mutant in YPD medium with neomycin. This study advances our understanding of the phenotypic manifestation of mtDNA mutations.

[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

Science.gov (United States)

Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

2017-08-10

To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

Major gene mutations and domestication of plants

International Nuclear Information System (INIS)

Ashri, A.

1989-01-01

From the approximately 200,000 species of flowering plants known, only about 200 have been domesticated. The process has taken place in many regions over long periods. At present there is great interest in domesticating new species and developing new uses for existing ones in order to supply needed food, industrial raw materials, etc. It is proposed that major gene mutations were important in domestication; many key characters distinguishing cultivated from related wild species are controlled by one or very few major genes. The deliberate effort to domesticate new species requires at least the following: identification of needs and potential sources, establishment of suitable niches, choice of taxa to be domesticated, specification of the desired traits and key characters to be modified, as well as the potential role of induced mutations. (author). 14 refs

A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

Science.gov (United States)

Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

2003-04-08

We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

Science.gov (United States)

Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

2014-01-01

Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

The Human Gene Mutation Database: building a comprehensive mutation repository for clinical and molecular genetics, diagnostic testing and personalized genomic medicine.

Science.gov (United States)

Stenson, Peter D; Mort, Matthew; Ball, Edward V; Shaw, Katy; Phillips, Andrew; Cooper, David N

2014-01-01

The Human Gene Mutation Database (HGMD®) is a comprehensive collection of germline mutations in nuclear genes that underlie, or are associated with, human inherited disease. By June 2013, the database contained over 141,000 different lesions detected in over 5,700 different genes, with new mutation entries currently accumulating at a rate exceeding 10,000 per annum. HGMD was originally established in 1996 for the scientific study of mutational mechanisms in human genes. However, it has since acquired a much broader utility as a central unified disease-oriented mutation repository utilized by human molecular geneticists, genome scientists, molecular biologists, clinicians and genetic counsellors as well as by those specializing in biopharmaceuticals, bioinformatics and personalized genomics. The public version of HGMD (http://www.hgmd.org) is freely available to registered users from academic institutions/non-profit organizations whilst the subscription version (HGMD Professional) is available to academic, clinical and commercial users under license via BIOBASE GmbH.

Glaucoma and Cytochrome P4501B1 Gene Mutations

Directory of Open Access Journals (Sweden)

Mukesh Tanwar

2010-01-01

Full Text Available Developmental anomalies of the ocular anterior chamber angle may lead to an incomplete development of the structures that form the conventional aqueous outflow pathway. Thus, disorders that present with such dysfunction tend to be associated with glaucoma. Among them, Axenfeld-Rieger (ARS malformation is a rare clinical entity with an estimated prevalence of one in every 200,000 individuals. The changes in eye morphogenesis in ARS are highly penetrant and are associated with 50% risk of development of glaucoma. Mutations in the cytochrome P4501B1 (CYP1B1 gene have been reported to be associated with primary congenital glaucoma and other forms of glaucoma and mutations in pituitary homeobox 2 (PITX2 gene have been identified in ARS in various studies. This case was negative for PITX2 mutations and compound heterozygote for CYP1B1 mutations. Clinical manifestations of this patient include bilateral elevated intraocular pressure (>40 mmHg with increased corneal diameter (>14 mm and corneal opacity. Patient also had iridocorneal adhesions, anteriorly displaced Schwalbe line, anterior insertion of iris, broad nasal bridge and protruding umbilicus. This is the first study from north India reporting CYP1B1 mutations in Axenfeld-Rieger syndrome with bilateral buphthalmos and early onset glaucoma. Result of this study supports the role of CYP1B1 as a causative gene in ASD disorders and its role in oculogenesis.

Low-level APC mutational mosaicism is the underlying cause in a substantial fraction of unexplained colorectal adenomatous polyposis cases.

Science.gov (United States)

Spier, Isabel; Drichel, Dmitriy; Kerick, Martin; Kirfel, Jutta; Horpaopan, Sukanya; Laner, Andreas; Holzapfel, Stefanie; Peters, Sophia; Adam, Ronja; Zhao, Bixiao; Becker, Tim; Lifton, Richard P; Perner, Sven; Hoffmann, Per; Kristiansen, Glen; Timmermann, Bernd; Nöthen, Markus M; Holinski-Feder, Elke; Schweiger, Michal R; Aretz, Stefan

2016-03-01

In 30-50% of patients with colorectal adenomatous polyposis, no germline mutation in the known genes APC, causing familial adenomatous polyposis, MUTYH, causing MUTYH-associated polyposis, or POLE or POLD1, causing polymerase-proofreading-associated polyposis can be identified, although a hereditary aetiology is likely. This study aimed to explore the impact of APC mutational mosaicism in unexplained polyposis. To comprehensively screen for somatic low-level APC mosaicism, high-coverage next-generation sequencing of the APC gene was performed using DNA from leucocytes and a total of 53 colorectal tumours from 20 unrelated patients with unexplained sporadic adenomatous polyposis. APC mosaicism was assumed if the same loss-of-function APC mutation was present in ≥ 2 anatomically separated colorectal adenomas/carcinomas per patient. All mutations were validated using diverse methods. In 25% (5/20) of patients, somatic mosaicism of a pathogenic APC mutation was identified as underlying cause of the disease. In 2/5 cases, the mosaic level in leucocyte DNA was slightly below the sensitivity threshold of Sanger sequencing; while in 3/5 cases, the allelic fraction was either very low (0.1-1%) or no mutations were detectable. The majority of mosaic mutations were located outside the somatic mutation cluster region of the gene. The present data indicate a high prevalence of pathogenic mosaic APC mutations below the detection thresholds of routine diagnostics in adenomatous polyposis, even if high-coverage sequencing of leucocyte DNA alone is taken into account. This has important implications for both routine work-up and strategies to identify new causative genes in this patient group. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

[Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

Science.gov (United States)

Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

2017-10-02

Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

A Mutation in the Bacillus subtilis rsbU Gene That Limits RNA Synthesis during Sporulation.

Science.gov (United States)

Rothstein, David M; Lazinski, David; Osburne, Marcia S; Sonenshein, Abraham L

2017-07-15

Mutants of Bacillis subtilis that are temperature sensitive for RNA synthesis during sporulation were isolated after selection with a 32 P suicide agent. Whole-genome sequencing revealed that two of the mutants carried an identical lesion in the rsbU gene, which encodes a phosphatase that indirectly activates SigB, the stress-responsive RNA polymerase sigma factor. The mutation appeared to cause RsbU to be hyperactive, because the mutants were more resistant than the parent strain to ethanol stress. In support of this hypothesis, pseudorevertants that regained wild-type levels of sporulation at high temperature had secondary mutations that prevented expression of the mutant rsbU gene. The properties of these RsbU mutants support the idea that activation of SigB diminishes the bacterium's ability to sporulate. IMPORTANCE Most bacterial species encode multiple RNA polymerase promoter recognition subunits (sigma factors). Each sigma factor directs RNA polymerase to different sets of genes; each gene set typically encodes proteins important for responses to specific environmental conditions, such as changes in temperature, salt concentration, and nutrient availability. A selection for mutants of Bacillus subtilis that are temperature sensitive for RNA synthesis during sporulation unexpectedly yielded strains with a point mutation in rsbU , a gene that encodes a protein that normally activates sigma factor B (SigB) under conditions of salt stress. The mutation appears to cause RsbU, and therefore SigB, to be active inappropriately, thereby inhibiting, directly or indirectly, the ability of the cells to transcribe sporulation genes. Copyright © 2017 American Society for Microbiology.

Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

Energy Technology Data Exchange (ETDEWEB)

Poussaint, T.Y. [Dept. of Radiology, Children' s Hospital, Boston, MA (United States); Fox, J.W.; Walsh, C.A. [Program in Biological and Biomedical Sciences, Harvard Medical School, Boston, MA (United States); Dept. of Neurology, Beth Israel Deaconess Medical Center, Harvard Institutes of Medicine, Boston, MA (United States); Dobyns, W.B. [Department of Human Genetics, The University of Chicago, Chicago, IL (United States); Radtke, R. [Division of Neurology, Duke University Medical Center, Durham, NC (United States); Scheffer, I.E.; Berkovic, S.F. [Department of Neurology, University of Melbourne, Austin and Repatriation Medical Centre, Heidelberg (Australia); Barnes, P.D. [Department of Radiology, Children' s Hospital and Harvard Medical School, Boston, MA (United States); Huttenlocher, P.R. [Department of Pediatrics, University of Chicago, Chicago, Illinois (United States)

2000-11-01

Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

Periventricular nodular heterotopia in patients with filamin-1 gene mutations: neuroimaging findings

International Nuclear Information System (INIS)

Poussaint, T.Y.; Fox, J.W.; Walsh, C.A.; Dobyns, W.B.; Radtke, R.; Scheffer, I.E.; Berkovic, S.F.; Barnes, P.D.; Huttenlocher, P.R.

2000-01-01

Background. The filamin-1 (FLN-1) gene is responsible for periventricular nodular heterotopia (PNH), which is an X-linked dominant neuronal migration disorder. Objective. To review the clinical and imaging findings in a series of patients with documented filamin-1 mutations. Materials and methods. A retrospective review of the medical records and MR studies of a series of patients with PNH and confirmed FLN-1 mutations was done. There were 16 female patients (age range:.67-71 years; mean = 28.6) with filamin-1 gene mutations. Results. In six of the patients the same mutation was inherited in four generations in one pedigree. In a second pedigree, a distinct mutation was found in two patients in two generations. In a third pedigree, a third mutation was found in four patients in two generations. The remaining four patients had sporadic de novo mutations that were not present in the parents. Ten patients had seizures, and all patients had normal intelligence. In all 16 patients MR demonstrated bilateral near-continuous PNH. There were no consistent radiographic or clinical differences between patients carrying different mutations. Conclusion. Patients with confirmed FLN-1 gene mutations are usually female and have a distinctive MR pattern of PNH. Other female patients with this same MR pattern probably harbor FLN-1 mutations and risk transmission to their progeny. This information is important for genetic counseling. (orig.)

Gitelman or Bartter type 3 syndrome? A case of distal convoluted tubulopathy caused by CLCNKB gene mutation.

Science.gov (United States)

Cruz, António José; Castro, Alexandra

2013-01-22

A 32-year-old woman with no significant medical history was sent to our consultation due to hypokalaemia (syndrome (GS) came negative. CLCNKB gene mutation analysis present in both GS and Bartter (BS) type 3 syndromes was positive. The patient is now being treated with potassium and magnesium oral supplements, ramipril and spironolactone with stable near-normal potassium and magnesium levels. This article presents the case of a patient with hypokalaemia caused by CLCNKB gene mutation hard to categorise as GS or BS type 3.

MicroRNA genes and their target 3'-untranslated regions are infrequently somatically mutated in ovarian cancers.

Directory of Open Access Journals (Sweden)

Georgina L Ryland

Full Text Available MicroRNAs are key regulators of gene expression and have been shown to have altered expression in a variety of cancer types, including epithelial ovarian cancer. MiRNA function is most often achieved through binding to the 3'-untranslated region of the target protein coding gene. Mutation screening using massively-parallel sequencing of 712 miRNA genes in 86 ovarian cancer cases identified only 5 mutated miRNA genes, each in a different case. One mutation was located in the mature miRNA, and three mutations were predicted to alter the secondary structure of the miRNA transcript. Screening of the 3'-untranslated region of 18 candidate cancer genes identified one mutation in each of AKT2, EGFR, ERRB2 and CTNNB1. The functional effect of these mutations is unclear, as expression data available for AKT2 and EGFR showed no increase in gene transcript. Mutations in miRNA genes and 3'-untranslated regions are thus uncommon in ovarian cancer.

Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation: indicators of tumor staging and metastasis in adenocarcinomatous sporadic colorectal cancer in Indian population.

Directory of Open Access Journals (Sweden)

Rupal Sinha

Full Text Available Colorectal cancer (CRC development involves underlying modifications at genetic/epigenetic level. This study evaluated the role of Kras gene mutation and RASSF1A, FHIT and MGMT gene promoter hypermethylation together/independently in sporadic CRC in Indian population and correlation with clinicopathological variables of the disease.One hundred and twenty four consecutive surgically resected tissues (62 tumor and equal number of normal adjacent controls of primary sporadic CRC were included and patient details including demographic characteristics, lifestyle/food or drinking habits, clinical and histopathological profiles were recorded. Polymerase chain reaction - Restriction fragment length polymorphism and direct sequencing for Kras gene mutation and Methylation Specific-PCR for RASSF1A, FHIT and MGMT genes was performed.Kras gene mutation at codon 12 & 13 and methylated RASSF1A, FHIT and MGMT gene was observed in 47%, 19%, 47%, 37% and 47% cases, respectively. Alcohol intake and smoking were significantly associated with presence of Kras mutation (codon 12 and MGMT methylation (p-value <0.049. Tumor stage and metastasis correlated with presence of mutant Kras codon 12 (p-values 0.018, 0.044 and methylated RASSF1A (p-values 0.034, 0.044, FHIT (p-values 0.001, 0.047 and MGMT (p-values 0.018, 0.044 genes. Combinatorial effect of gene mutation/methylation was also observed (p-value <0.025. Overall, tumor stage 3, moderately differentiated tumors, presence of lymphatic invasion and absence of metastasis was more frequently observed in tumors with mutated Kras and/or methylated RASSF1A, FHIT and MGMT genes.Synergistic interrelationship between these genes in sporadic CRC may be used as diagnostic/prognostic markers in assessing the overall pathological status of CRC.

Induced mutations of rust resistance genes in wheat

International Nuclear Information System (INIS)

McIntosh, R.A.

1983-01-01

Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

Science.gov (United States)

Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

2016-12-01

This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

Science.gov (United States)

Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

2015-01-01

Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

Mutations of alpha-galactosidase A gene in two unusual cases of Fabry disease

NARCIS (Netherlands)

Beyer, EM; Kopishinskaya, SV; Van Amstel, JKP; Tsvetkova, [No Value

1999-01-01

The mutation analysis of alpha-galactosidase A gene was carried out in two families with Fabry disease described by us earlier. In the family P. a new point mutation E341K (a G to A transition at position 10999 of the gene) was identified. The mutation causes a Glu341Lys substitution in

GCK gene mutations are a common cause of childhood-onset MODY (maturity-onset diabetes of the young) in Turkey.

Science.gov (United States)

Haliloglu, Belma; Hysenaj, Gerald; Atay, Zeynep; Guran, Tulay; Abalı, Saygın; Turan, Serap; Bereket, Abdullah; Ellard, Sian

2016-09-01

Inactivating heterozygous mutations in the GCK gene are a common cause of MODY and result in mild fasting hyperglycaemia, which does not require treatment. We aimed to identify the frequency, clinical and molecular features of GCK mutations in a Turkish paediatric cohort. Fifty-four unrelated probands were selected based on the following criteria: age of diagnosis ≤17 years, family history of diabetes in at least two generations, anti-GAD/ICA negative, BMIMODY probability score (www.diabetesgenes.org) was calculated and 21 patients with a score ≥75%, HbA1c levels ≤7·5% (58·5 mmol/mol) and fasting blood glucose (FBG) levels 99-145 mg/dl (5·5-8·0 mmol/l) were selected for Sanger sequencing of the GCK gene. Targeted next-generation sequencing for all known monogenic diabetes genes was undertaken for any patient without a GCK gene mutation. GCK gene mutations (pathogenic or likely pathogenic variants) and a novel intronic variant of uncertain significance (c.208 + 3A>T) were identified in 13/54 probands (24%). Twelve of these patients had a MODY probability score ≥75%. FBG level and 2-h glucose level in OGTT were 123 ± 14 mg/dl (6·8 ± 0·7 mmol/l) (107-157 mg/dl) and 181 ± 30 mg/dl (10·1 ± 1·6 mmol/l) (136-247 mg/dl), respectively. Average of glucose increment in OGTT was 58 ± 27 mg/dl (3·2 ± 1·5 mmol/l) (19-120 mg/dl), and mean HbA1c level was 6·5 ± 0·5% (47·5 ± 5·5 mmol/mol) (5·9-7·6%). Five novel missense mutations were identified (p.F123S, p.L58P, p.G246A, p.F419C, and p.S151C). Two patients treated with low-dose insulin before the molecular analysis were able to stop treatment. Approximately 1 in 4 MODY cases in this Turkish paediatric cohort have a GCK mutation. Selection of patients for GCK gene analysis using the MODY probability score was an effective way of identifying most (11/12) patients with a GCK mutation. © 2016 The Authors. Clinical Endocrinology Published by John Wiley & Sons Ltd.

Retinal phenotype-genotype correlation of pediatric patients expressing mutations in the Norrie disease gene.

Science.gov (United States)

Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy

2007-02-01

To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

Science.gov (United States)

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

Collodion Baby with TGM1 gene mutation

Directory of Open Access Journals (Sweden)

Sharma D

2015-09-01

Full Text Available Deepak Sharma,1 Basudev Gupta,2 Sweta Shastri,3 Aakash Pandita,1 Smita Pawar4 1Department of Neonatology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, 2Department of Pediatrics, Civil Hospital, Palwal, Haryana, 3Department of Pathology, NKP Salve Medical College, Nagpur, Maharashtra, 4Department of Obstetrics and Gynaecology, Fernandez Hospital, Hyderguda, Hyderabad, Andhra Pradesh, IndiaAbstract: Collodion baby (CB is normally diagnosed at the time of birth and refers to a newborn infant that is delivered with a lambskin-like membrane encompassing the total body surface. CB is not a specific disease entity, but is a common phenotype in conditions like harlequin ichthyosis, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, and trichothiodystrophy. We report a CB that was brought to our department and later diagnosed to have TGM1 gene c.984+1G>A mutation. However, it could not be ascertained whether the infant had lamellar ichthyosis or congenital ichthyosiform erythroderma (both having the same mutation. The infant was lost to follow-up.Keywords: cellophane membrane, c.984+1G>A mutation, lamellar ichthyosis, nonbullous congenital ichthyosiform erythroderma, parchment membrane, TGM1 gene

Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

Science.gov (United States)

Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

2006-12-01

To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

Science.gov (United States)

Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

2015-01-01

To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

Gene mutation in ATM/PI3K region of nasopharyngeal carcinoma cell lines

International Nuclear Information System (INIS)

Wang Hongmei; Wu Xinyao; Xia Yunfei

2002-01-01

Objective: To define the correlation between nasopharyngeal carcinoma (NPC) cell radiosensitivity and gene mutation in the ATM/PI3K coding region. Methods: The gene mutation in the ATM/PI3K region of nasopharyngeal carcinoma cell lines which vary in radiosensitivity, was monitored by reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence-marked ddNTP cycle sequencing technique. Results: No gene mutation was detected in the ATM/PI3K region of either CNE1 or CNE2. Conclusion: Disparity in intrinsic radiosensitivity between different NPC cell lines depends on some other factors and mechanism without being related to ATM/PI3K mutations

Somatic Mutational Landscape of Splicing Factor Genes and Their Functional Consequences across 33 Cancer Types

Directory of Open Access Journals (Sweden)

Michael Seiler

2018-04-01

Full Text Available Summary: Hotspot mutations in splicing factor genes have been recently reported at high frequency in hematological malignancies, suggesting the importance of RNA splicing in cancer. We analyzed whole-exome sequencing data across 33 tumor types in The Cancer Genome Atlas (TCGA, and we identified 119 splicing factor genes with significant non-silent mutation patterns, including mutation over-representation, recurrent loss of function (tumor suppressor-like, or hotspot mutation profile (oncogene-like. Furthermore, RNA sequencing analysis revealed altered splicing events associated with selected splicing factor mutations. In addition, we were able to identify common gene pathway profiles associated with the presence of these mutations. Our analysis suggests that somatic alteration of genes involved in the RNA-splicing process is common in cancer and may represent an underappreciated hallmark of tumorigenesis. : Seiler et al. report that 119 splicing factor genes carry putative driver mutations over 33 tumor types in TCGA. The most common mutations appear to be mutually exclusive and are associated with lineage-independent altered splicing. Samples with these mutations show deregulation of cell-autonomous pathways and immune infiltration. Keywords: splicing, SF3B1, U2AF1, SRSF2, RBM10, FUBP1, cancer, mutation

A novel missense mutation of ADAR1 gene in a Chinese family ...

Indian Academy of Sciences (India)

This study was mainlyto explore the pathogenic mutation of ADAR1 gene and provide genetics counselling and prenatal diagnostic testing for childbearing individuals.Mutational analysis of ADAR1 gene was performed by polymerase chain reaction (PCR) and electrophoretic separation of PCR products by 1.5% agarose ...

Leu452His mutation in lipoprotein lipase gene transfer associated with hypertriglyceridemia in mice in vivo.

Directory of Open Access Journals (Sweden)

Kaiyue Sun

Full Text Available Mutated mouse lipoprotein lipase (LPL containing a leucine (L to histidine (H substitution at position 452 was transferred into mouse liver by hydrodynamics-based gene delivery (HD. Mutated-LPL (MLPL gene transfer significantly increased the concentrations of plasma MLPL and triglyceride (TG but significantly decreased the activity of plasma LPL. Moreover, the gene transfer caused adiposis hepatica and significantly increased TG content in mouse liver. To understand the effects of MLPL gene transfer on energy metabolism, we investigated the expression of key functional genes related to energy metabolism in the liver, epididymal fat, and leg muscles. The mRNA contents of hormone-sensitive lipase (HSL, adipose triglyceride lipase (ATGL, fatty acid-binding protein (FABP, and uncoupling protein (UCP were found to be significantly reduced. Furthermore, we investigated the mechanism by which MLPL gene transfer affected fat deposition in the liver, fat tissue, and muscle. The gene expression and protein levels of forkhead Box O3 (FOXO3, AMP-activated protein kinase (AMPK, and peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α were found to be remarkably decreased in the liver, fat and muscle. These results suggest that the Leu452His mutation caused LPL dysfunction and gene transfer of MLPL in vivo produced resistance to the AMPK/PGC-1α signaling pathway in mice.

[Mutations of ACVRL1 gene in a pedigree with hereditary hemorrhagic telangiectasia].

Science.gov (United States)

Luo, Jie-wei; Chen, Hui; Yang, Liu-qing; Zhu, Ai-lan; Wu, Yan-an; Li, Jian-wei

2008-06-01

To identify the activin A receptor type II-like 1 gene (ACVRL1) mutations in a Chinese family with hereditary hemorrhagic telangiectasia (HHT2). The exons 3, 7 and 8 of ACVRL1 gene of the proband and her five family members were amplified by polymerase chain reaction (PCR), and the PCR products were sequenced. The proband had obvious telangiectasis of gastric mucosa, and small arteriovenous fistula in the right kidney. All the patients in the HHT2 family had iterative epistaxis or bleeding in other sites, and had telangiectasis of nasal mucosa, tunica mucosa oris and finger tips. ACVRL1 gene analysis confirmed that there is frameshift mutation caused by deletion of G145 in exon 3 in the 4 patients, but the mutation is absent in 2 members without HHT2. The HHT2 family is caused by a 145delG mutation of ACVRL1 gene, resulting in frameshift and a new stop codon at codon 53.

Eight previously unidentified mutations found in the OA1 ocular albinism gene

Directory of Open Access Journals (Sweden)

Dufier Jean-Louis

2006-04-01

Full Text Available Abstract Background Ocular albinism type 1 (OA1 is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand.

A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

Science.gov (United States)

Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

2014-02-25

Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

Science.gov (United States)

Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

2009-01-01

Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis

Directory of Open Access Journals (Sweden)

Paulo Lisboa Bittencourt

2009-01-01

Full Text Available BACKGROUND: Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2 and ferroportin 1 (SCL40A1. AIMS: To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. PATIENTS AND METHODS: Nineteen male subjects (median age 42 [range: 20-72] years with HH were evaluated using the Haemochromatosis StripAssay A®. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. RESULTS: In our cohort, nine (47% patients were homozygous for the C282Y mutation, two (11% were heterozygous for the H63D mutation, and one each (5% was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. CONCLUSIONS: One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

Science.gov (United States)

Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

2018-04-01

Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

Molecular cytogenetics of radiation-induced gene mutations in Drosophila melanogaster

International Nuclear Information System (INIS)

Aleksandrov, I.D.; Aleksandrova, M.V.; Lapidus, I.L.; Karpovskij, A.L.

1996-01-01

The classical paradigm of spatially unrelated lesions for gene mutations and chromosomal exchange breakpoints induced by ionizing radiations in eukaryotic cells was re-examined in the experiments on the mapping of gamma-ray- or neutron-induced breakpoints in and outside of white (w) and vestigial (vg) genes of Drosophila melanogaster using the in situ hybridization of the large fragments of the genes under study with the polythene chromosomes of the relevant mutants. The results for the random sample of 60 inversion and translocation breakpoints analysed to date have shown that (i) 50% of them are mapped as the hot spots within big introns of both the genes, and (ii) 21 of 60 breaks (35%) are located outside of genes. It is important to note that 26% (16/60) of the breakpoints analysed are flanked by the deletions, the sizes of which vary from the quarter to a whole of the gene. It was found that the deletions flank both the inversion and translocation breakpoints and arise more often after action of neutrons than photons. An unexpectedly high frequency of the multiple-damaged w and vg mutants that have the gene/point mutation and additional, but separate, chromosome exchange (the so-called double- or triple-site mutants) has shown that the genetic danger of ionizing radiation is higher than usually accepted on the base of single gene/point mutation assessments. 11 refs., 3 figs

Association of mutations in the hemochromatosis gene with shorter life expectancy

DEFF Research Database (Denmark)

Bathum, L; Christiansen, L; Nybo, H

2001-01-01

BACKGROUND: To investigate whether the frequency of carriers of mutations in the HFE gene associated with hereditary hemochromatosis diminishes with age as an indication that HFE mutations are associated with increased mortality. It is of value in the debate concerning screening for hereditary...... hemochromatosis to determine the significance of heterozygosity. METHODS: Genotyping for mutations in exons 2 and 4 of the HFE gene using denaturing gradient gel electrophoresis in 1784 participants aged 45 to 100 years from 4 population-based studies: all 183 centenarians from the Danish Centenarian Study, 601...... in the distribution of mutations in exon 2 in the different age groups. CONCLUSIONS: In a high-carrier frequency population like Denmark, mutations in HFE show an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy....

Identification and functional analysis of a novel mutation in the SOX10 gene associated with Waardenburg syndrome type IV.

Science.gov (United States)

Wang, Hong-Han; Chen, Hong-Sheng; Li, Hai-Bo; Zhang, Hua; Mei, Ling-Yun; He, Chu-Feng; Wang, Xing-Wei; Men, Mei-Chao; Jiang, Lu; Liao, Xin-Bin; Wu, Hong; Feng, Yong

2014-03-15

Waardenburg syndrome type IV (WS4) is a rare genetic disorder, characterized by auditory-pigmentary abnormalities and Hirschsprung disease. Mutations of the EDNRB gene, EDN3 gene, or SOX10 gene are responsible for WS4. In the present study, we reported a case of a Chinese patient with clinical features of WS4. In addition, the three genes mentioned above were sequenced in order to identify whether mutations are responsible for the case. We revealed a novel nonsense mutation, c.1063C>T (p.Q355*), in the last coding exon of SOX10. The same mutation was not found in three unaffected family members or 100 unrelated controls. Then, the function and mechanism of the mutation were investigated in vitro. We found both wild-type (WT) and mutant SOX10 p.Q355* were detected at the expected size and their expression levels are equivalent. The mutant protein also localized in the nucleus and retained the DNA-binding activity as WT counterpart; however, it lost its transactivation capability on the MITF promoter and acted as a dominant-negative repressor impairing function of the WT SOX10. Copyright © 2014 Elsevier B.V. All rights reserved.

Molecular screening of pituitary adenomas for gene mutations and rearrangements

Energy Technology Data Exchange (ETDEWEB)

Herman, V.; Drazin, N.Z.; Gonskey, R.; Melmed, S. (Cedars-Sinai Medical Center, Los Angeles, CA (United States))

1993-07-01

Although pituitary tumors arise as benign monoclonal neoplasms, genetic alterations have not readily been identified in these adenomas. The authors studied restriction fragment abnormalities involving the GH gene locus, and mutations in the p53 and H-, K-, and N-ras genes in 22 human GH cell adenomas. Twenty two nonsecretory adenomas were also examined for p53 and ras gene mutations. Seven prolactinoma DNA samples were tested for deletions in the multiple endocrine neoplasia-1 (MEN-1) locus, as well as for rearrangements in the hst gene, a member of the fibroblast growth factor family. In DNA from GH-cell adenomas, identical GH restriction patterns were detected in both pituitary and lymphocyte DNA in all patients and in one patient with a mixed GH-TSH cell adenoma. Using polymerase chain reaction (PCR)-single stranded conformation polymorphism analysis, no mutations were detected in exons 5, 6, 7 and 8 of the p53 gene in GH cell adenomas nor in 22 nonsecretory adenomas. Codons 12/13 and 61 of H-ras, K-ras, and N-ras genes were also intact on GH cell adenomas and in nonsecretory adenomas. Site-specific probes for chromosome 11q13 including, PYGM, D11S146, and INT2 were used in 7 sporadic PRL-secreting adenomas to detect deletions of the MEN-1 locus on chromosome 11. One patient was identified with a loss of 11p, and the remaining 6 patients did not demonstrate loss of heterozygosity in the pituitary 11q13 locus, compared to lymphocyte DNA. None of these patients demonstrated hst gene rearrangements which also maps to this locus. These results show that p53 and ras gene mutations are not common events in the pathogenesis of acromegaly and nonsecretory tumors. Although hst gene rearrangements and deletions of 11q13 are not associated with sporadic PRl-cell adenoma formation, a single patient was detected with a partial loss of chromosome 11, including the putative MEN-1 site. 31 refs., 5 figs., 2 tabs.

ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

Science.gov (United States)

Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

2011-01-01

We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

Analysis of HFE gene mutations and HLA-A alleles in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo Delfini Cançado

Full Text Available CONTEXT AND OBJECTIVE: Hemochromatosis is a common inherited disorder of iron metabolism and one of the most important causes of iron overload. The objective was to analyze the presence of C282Y, H63D and S65C mutations in the HFE gene and HLA-A alleles for a group of Brazilian patients with iron overload, and to correlate genotype with clinical and laboratory variables. DESIGN AND SETTING: Prospective study, in Discipline of Hematology and Oncology, Faculdade de Ciências Médicas da Santa Casa de Misericórdia de São Paulo. METHODS: We studied 35 patients with iron overload seen at our outpatient unit between January 2001 and December 2003. Fasting levels of serum iron and ferritin, and total iron-binding capacity, were assayed using standard techniques. Determinations of C282Y, H63D and S65C mutations in the HFE gene and of HLA-A alleles were performed by polymerase chain reaction (PCR. RESULTS: Twenty-six out of 35 patients (74% presented at least one of the HFE gene mutations analyzed. Among these, five (14% were C282Y/C282Y, four (11% C282Y/H63D, one (3% H63D/H63D, six (17% C282Y/WT and ten (29% H63D/WT. No patients had the S65C mutation and nine (25% did not present any of the three HFE mutations. Four out of five patients with C282Y/C282Y genotype (80% and three out of four patients with C282Y/H63D genotype (75% were HLA A*03. CONCLUSION: Analysis of HFE gene mutations constitutes an important procedure in identifying patients with hereditary hemochromatosis, particularly for patients with iron overload.

Study of the effect of HFE gene mutations on iron overload in ...

African Journals Online (AJOL)

Background: HFE gene mutations have been shown to be responsible for hereditary hemochromatosis. Their effect on iron load in β-thalassemia patients and carriers remains controversial. Objectives: We aimed to determine the prevalence of HFE gene mutations (C282Y and H63D) in β-thalassemia patients and carriers ...

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

Science.gov (United States)

Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

2016-05-01

Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS.

Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

Science.gov (United States)

Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

2017-11-01

High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

Science.gov (United States)

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Application of DNA chips in the analysis of gene mutation in HBV

International Nuclear Information System (INIS)

Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

2005-01-01

Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

Analysis of mutations in the entire coding sequence of the factor VIII gene

Energy Technology Data Exchange (ETDEWEB)

Bidichadani, S.I.; Lanyon, W.G.; Connor, J.M. [Glascow Univ. (United Kingdom)] [and others

1994-09-01

Hemophilia A is a common X-linked recessive disorder of bleeding caused by deleterious mutations in the gene for clotting factor VIII. The large size of the factor VIII gene, the high frequency of de novo mutations and its tissue-specific expression complicate the detection of mutations. We have used a combination of RT-PCR of ectopic factor VIII transcripts and genomic DNA-PCRs to amplify the entire essential sequence of the factor VIII gene. This is followed by chemical mismatch cleavage analysis and direct sequencing in order to facilitate a comprehensive search for mutations. We describe the characterization of nine potentially pathogenic mutations, six of which are novel. In each case, a correlation of the genotype with the observed phenotype is presented. In order to evaluate the pathogenicity of the five missense mutations detected, we have analyzed them for evolutionary sequence conservation and for their involvement of sequence motifs catalogued in the PROSITE database of protein sites and patterns.

[An overview of oculocutaneous albinism: TYR gene mutations in five Colombian individuals].

Science.gov (United States)

Sanabria, Diana; Groot, Helena; Guzmán, Julio; Lattig, María Claudia

2012-06-01

Oculocutaneus albinism is a pigment-related inherited disorder characterized by hypopigmentation of the skin, hair and eyes, foveal hypoplasia and low vision. To date, 230 mutations in the TYR gene have been reported as responsible for oculocutaneus albinism type 1 worldwide. TYR gene encodes the enzyme tyrosinase involved in the metabolic pathway of melanin synthesis. Mutations were identified in the TYR gene as responsible for oculocutaneous albinism type 1 in five Colombian individuals, and a new ophthalmic system was tested that corrected visual defects and symptoms in a patient with oculocutaneous albinism. Samples were taken from 5 individuals, four of whom belong to a single family, along with a fifth individual not related to the family. Five exons in the TYR gene were sequenced to search for the gene carriers in the family and in the non-related individual. In addition, clinical ophthalmological evaluation and implementation of an new oculo-visual system was undertaken. A G47D and 1379delTT mutation was identified in the family. The unrelated individual carried a compound heterozygote for the G47D and D42N mutations. The oculo-visual corrective system was able to increase visual acuity and to diminish the nystagmus and photophobia. This is the first study in Colombia where albinism mutations are reported. The methods developed will enable future molecular screening studies in Colombian populations.

Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

Science.gov (United States)

Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

2018-05-12

Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

Science.gov (United States)

Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

2013-01-01

Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

Science.gov (United States)

Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

2012-01-01

Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides

Energy Technology Data Exchange (ETDEWEB)

Jingyong, Zhao; Yongzhong, Xu; Tao, Zhao; Fengmei, Cui; Liuyi, Wang; Qinhua, Lao [Suzhou Univ., Suzhou (China). Radiation Medicine Department

2001-07-01

HPRT gene locus mutation in peripheral blood lymphocytes induced by internal exposure to radionuclides was performed and the relationships between mutation frequency and dose were studied. Rats were injected intravenously with radionuclides, the blood was sampled at different time after injection; HPRT gene locus mutation frequency (GMF) were examined by methods of multi-nucleus cell and Brdurd assay, working out the Dose-response function. GMF rose with the increase of dose and dose-rates and were clearly interrelated. The HPRT gene locus mutation is very sensitive to radiation and may be used as a biological dosimeter.

Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

Science.gov (United States)

Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

2015-01-01

Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

INVESTIGATION OF RANGES AND FREQUENCY OF MUTATIONS IN THE embB GENE IN MYCOBACTERIUMTUBERCULOSIS ASSOCIATED WITH RESISTANCE TO ETHAMBUTOL USING REAL-TIME POLYMERASE CHAINREACTION

Directory of Open Access Journals (Sweden)

Yu. S. Аlyapkinа

2017-01-01

Full Text Available Based on real-time allele-specific polymerase chain reaction, the ranges of potential mutations in codons of 306 and 405 of the embBgene in Mycobacterium tuberculosis associated with resistance to ethambutol were investigated. 5 different mutations were detected in codon 306 and 3 mutations were found in codon 406 of the embB gene. The detected mutations were confirmed by sequencing and mass spectrometry. By analyzing the frequency of detected mutations of , the set of reagents was developed for rapid testing of susceptibility tuberculous mycobacteria to ethambutol by multi-competitive allele-specific real-time PCR. Out of 107 tested specimens of clinical isolates, mutations of the embB gene of M. tuberculosis were detected in 49 (45.8% specimens, and no mutations were found in 58 (52.2% specimens. 39 (36.4% specimens had mutations in codon 306 of the embB gene, and 9 (8.4% specimens had a mutation in codon 406, and 1 (0.9% specimen had mutations in both codons 306 and 406. The high level of agreement in the results of molecular genetic and bacteriological tests (84% proved the significance of mutations in codons 306 and 406 of the embB gene in M. tuberculosis and the need for their identification in order to detect ethambutol resistant strains of M. tuberculosis. When using molecular genetic tests, the sensitivity level made 75.8%, while the specificity of standard culture-based methods makes 95.6%.

Glucokinase gene mutations: structural and genotype-phenotype analyses in MODY children from South Italy.

Directory of Open Access Journals (Sweden)

Nadia Tinto

Full Text Available BACKGROUND: Maturity onset diabetes of the young type 2 (or GCK MODY is a genetic form of diabetes mellitus provoked by mutations in the glucokinase gene (GCK. METHODOLOGY/PRINCIPAL FINDINGS: We screened the GCK gene by direct sequencing in 30 patients from South Italy with suspected MODY. The mutation-induced structural alterations in the protein were analyzed by molecular modeling. The patients' biochemical, clinical and anamnestic data were obtained. Mutations were detected in 16/30 patients (53%; 9 of the 12 mutations identified were novel (p.Glu70Asp, p.Phe123Leu, p.Asp132Asn, p.His137Asp, p.Gly162Asp, p.Thr168Ala, p.Arg392Ser, p.Glu290X, p.Gln106_Met107delinsLeu and are in regions involved in structural rearrangements required for catalysis. The prevalence of mutation sites was higher in the small domain (7/12: approximately 59% than in the large (4/12: 33% domain or in the connection (1/12: 8% region of the protein. Mild diabetic phenotypes were detected in almost all patients [mean (SD OGTT = 7.8 mMol/L (1.8] and mean triglyceride levels were lower in mutated than in unmutated GCK patients (p = 0.04. CONCLUSIONS: The prevalence of GCK MODY is high in southern Italy, and the GCK small domain is a hot spot for MODY mutations. Both the severity of the GCK mutation and the genetic background seem to play a relevant role in the GCK MODY phenotype. Indeed, a partial genotype-phenotype correlation was identified in related patients (3 pairs of siblings but not in two unrelated children bearing the same mutation. Thus, the molecular approach allows the physician to confirm the diagnosis and to predict severity of the mutation.

Analysis of the GCK gene in 79 MODY type 2 patients: A multicenter Turkish study, mutation profile and description of twenty novel mutations.

Science.gov (United States)

Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda

2018-01-30

Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.

Defining the Sequence Elements and Candidate Genes for the Coloboma Mutation.

Directory of Open Access Journals (Sweden)

Elizabeth A. Robb

Full Text Available The chicken coloboma mutation exhibits features similar to human congenital developmental malformations such as ocular coloboma, cleft-palate, dwarfism, and polydactyly. The coloboma-associated region and encoded genes were investigated using advanced genomic, genetic, and gene expression technologies. Initially, the mutation was linked to a 990 kb region encoding 11 genes; the application of the genetic and genomic tools led to a reduction of the linked region to 176 kb and the elimination of 7 genes. Furthermore, bioinformatics analyses of capture array-next generation sequence data identified genetic elements including SNPs, insertions, deletions, gaps, chromosomal rearrangements, and miRNA binding sites within the introgressed causative region relative to the reference genome sequence. Coloboma-specific variants within exons, UTRs, and splice sites were studied for their contribution to the mutant phenotype. Our compiled results suggest three genes for future studies. The three candidate genes, SLC30A5 (a zinc transporter, CENPH (a centromere protein, and CDK7 (a cyclin-dependent kinase, are differentially expressed (compared to normal embryos at stages and in tissues affected by the coloboma mutation. Of these genes, two (SLC30A5 and CENPH are considered high-priority candidate based upon studies in other vertebrate model systems.

Progranulin Levels in Plasma and Cerebrospinal Fluid in Granulin Mutation Carriers

Directory of Open Access Journals (Sweden)

Lieke H.H. Meeter

2016-07-01

Full Text Available Background: Pathogenic mutations in the granulin gene (GRN are causative in 5-10% of patients with frontotemporal dementia (FTD, mostly leading to reduced progranulin protein (PGRN levels. Upcoming therapeutic trials focus on enhancing PGRN levels. Methods: Fluctuations in plasma PGRN (n = 41 and its relationship with cerebrospinal fluid (CSF, n = 32 and specific single nucleotide polymorphisms were investigated in pre- and symptomatic GRN mutation carriers and controls. Results: Plasma PGRN levels were lower in carriers than in controls and showed a mean coefficient of variation of 5.3% in carriers over 1 week. Although plasma PGRN correlated with CSF PGRN in carriers (r = 0.54, p = 0.02, plasma only explained 29% of the variability in CSF PGRN. rs5848, rs646776 and rs1990622 genotypes only partly explained the variability of PGRN levels between subjects. Conclusions: Plasma PGRN is relatively stable over 1 week and therefore seems suitable for treatment monitoring of PGRN-enhancing agents. Since plasma PGRN only moderately correlated with CSF PGRN, CSF sampling will additionally be needed in therapeutic trials.

Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

Science.gov (United States)

Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

2015-05-01

This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

Science.gov (United States)

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Diffusion tensor imaging of brain white matter in Huntington gene mutation individuals

Directory of Open Access Journals (Sweden)

Roberta Arb Saba

Full Text Available ABSTRACT Objective To evaluate the role of the involvement of white matter tracts in huntingtin gene mutation patients as a potential biomarker of the progression of the disease. Methods We evaluated 34 participants (11 symptomatic huntingtin gene mutation, 12 presymptomatic huntingtin gene mutation, and 11 controls. We performed brain magnetic resonance imaging to assess white matter integrity using diffusion tensor imaging, with measurement of fractional anisotropy. Results We observed a significant decrease of fractional anisotropy in the cortical spinal tracts, corona radiate, corpus callosum, external capsule, thalamic radiations, superior and inferior longitudinal fasciculus, and inferior frontal-occipital fasciculus in the Huntington disease group compared to the control and presymptomatic groups. Reduction of fractional anisotropy is indicative of a degenerative process and axonal loss. There was no statistically significant difference between the presymptomatic and control groups. Conclusion White matter integrity is affected in huntingtin gene mutation symptomatic individuals, but other studies with larger samples are required to assess its usefulness in the progression of the neurodegenerative process.

[Relation between gene mutations and pancreatic exocrine function in patients with cystic fibrosis].

Science.gov (United States)

Radivojević, D; Guć-Sćekić, M; Djurisić, M; Lalić, T; Minić, P; Kanavakis, E

2001-01-01

Cystic fibrosis (CF), is the most common autosomal-recessive disease in Caucasians, with an incidence of approximately 1:2500 live births and a carrier frequency of approximately 4-5%. Causes of the disease are mutations in the CF gene which is located on chromosome 7 (region 7q31). Although a single mutation, a deletion of phenylalanine at position 508 (DF508) in exon 10, accounts for almost 70% of all CF chromosomes, over 900 other mutations have been identified in this large gene. CF gene encodes a membrane protein, which functions as aion channel- CFTR (cystic fibrosis transmembrane regulator protein). The exocrine pancreas is a gland that secretes water, enzymes and electrolytes into the intestinal lumen. These enzymes are needed for the normal digestion of food, and their reduced secretion in cystic fibrosis will cause malabsortion and malnutrition in CF patients. Pancreatic dysfunction in CF begins in uteri. Most patients with CF typically present insufficient pancreatic exocrine function (PI phenotype) and 10-15% of CF patients are pancreatic sufficient (PS phenotype). It has been shown elsewhere that the pancreatic function status in CF could be correlated to mutations in the CFTR gene. To determine the relation between genotype and pancreatic status, we analyzed 32 CF patients in whom both CF gene mutant alleles were identified (Table 1). Patients included in this study attended the Paediatric Department of Mother and Child Health Institute in Belgrade. The diagnosis was based on typical clinical manifestations and high levels of sweat chloride concentration (higher than 60 mmol/L). Of the 32 patients studied, only one (3.12%) was PS and the rest (96.88%) had PI phenotype. For each CF genotype the number of patients who were PI or PS is given in Table 1. The most striking observation was that all given genotypes correlated with either PI or PS, but not with both. On the basis of both preceding hypotheses and our present data (Table 2 and Table 3), it was

Female mating preferences determine system-level evolution in a gene network model.

Science.gov (United States)

Fierst, Janna L

2013-06-01

Environmental patterns of directional, stabilizing and fluctuating selection can influence the evolution of system-level properties like evolvability and mutational robustness. Intersexual selection produces strong phenotypic selection and these dynamics may also affect the response to mutation and the potential for future adaptation. In order to to assess the influence of mating preferences on these evolutionary properties, I modeled a male trait and female preference determined by separate gene regulatory networks. I studied three sexual selection scenarios: sexual conflict, a Gaussian model of the Fisher process described in Lande (in Proc Natl Acad Sci 78(6):3721-3725, 1981) and a good genes model in which the male trait signalled his mutational condition. I measured the effects these mating preferences had on the potential for traits and preferences to evolve towards new states, and mutational robustness of both the phenotype and the individual's overall viability. All types of sexual selection increased male phenotypic robustness relative to a randomly mating population. The Fisher model also reduced male evolvability and mutational robustness for viability. Under good genes sexual selection, males evolved an increased mutational robustness for viability. Females choosing their mates is a scenario that is sufficient to create selective forces that impact genetic evolution and shape the evolutionary response to mutation and environmental selection. These dynamics will inevitably develop in any population where sexual selection is operating, and affect the potential for future adaptation.

High incidence of GJB2 gene mutations among assortatively mating ...

Indian Academy of Sciences (India)

High incidence of GJB2 gene mutations among assortatively mating hearing impaired families in Kerala: future implications. Amritkumar Pavithra, Justin Margret Jeffrey, Jayasankaran Chandru, Arabandi Ramesh and C. R. Srikumari Srisailapathy. J. Genet. 93, 207–213. Table 1. Consolidated table of GJB2 mutation status ...

[Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

Science.gov (United States)

Shiba, Norio

2015-12-01

A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

Science.gov (United States)

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

[Analysis of gene mutation in a Chinese family with Norrie disease].

Science.gov (United States)

Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

2012-09-01

To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

The spectrum of HNF1A gene mutations in Greek patients with MODY3: relative frequency and identification of seven novel germline mutations.

Science.gov (United States)

Tatsi, Christina; Kanaka-Gantenbein, Christina; Vazeou-Gerassimidi, Adriani; Chrysis, Dionysios; Delis, Dimitrios; Tentolouris, Nikolaos; Dacou-Voutetakis, Catherine; Chrousos, George P; Sertedaki, Amalia

2013-11-01

Maturity-Onset Diabetes of the Young (MODY) is the most common type of monogenic diabetes accounting for 1-2% of the population with diabetes. The relative incidence of HNF1A-MODY (MODY3) is high in European countries; however, data are not available for the Greek population. The aims of this study were to determine the relative frequency of MODY3 in Greece, the type of the mutations observed, and their relation to the phenotype of the patients. Three hundred ninety-five patients were referred to our center because of suspected MODY during a period of 15 yr. The use of Denaturing Gradient Gel Electrophoresis of polymerase chain reaction amplified DNA revealed 72 patients carrying Glucokinase gene mutations (MODY2) and 8 patients carrying HNF1A gene mutations (MODY3). After using strict criteria, 54 patients were selected to be further evaluated by direct sequencing or by multiplex ligation probe amplification (MLPA) for the presence of HNF1A gene mutations. In 16 unrelated patients and 13 of their relatives, 15 mutations were identified in the HNF1A gene. Eight of these mutations were previously reported, whereas seven were novel. Clinical features, such as age of diabetes at diagnosis or severity of hyperglycemia, were not related to the mutation type or location. In our cohort of patients fulfilling strict clinical criteria for MODY, 12% carried an HNF1A gene mutation, suggesting that defects of this gene are responsible for a significant proportion of monogenic diabetes in the Greek population. No clear phenotype-genotype correlations were identified. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The mthA mutation conferring low-level resistance to streptomycin enhances antibiotic production in Bacillus subtilis by increasing the S-adenosylmethionine pool size.

Science.gov (United States)

Tojo, Shigeo; Kim, Ji-Yun; Tanaka, Yukinori; Inaoka, Takashi; Hiraga, Yoshikazu; Ochi, Kozo

2014-04-01

Certain Str(r) mutations that confer low-level streptomycin resistance result in the overproduction of antibiotics by Bacillus subtilis. Using comparative genome-sequencing analysis, we successfully identified this novel mutation in B. subtilis as being located in the mthA gene, which encodes S-adenosylhomocysteine/methylthioadenosine nucleosidase, an enzyme involved in the S-adenosylmethionine (SAM)-recycling pathways. Transformation experiments showed that this mthA mutation was responsible for the acquisition of low-level streptomycin resistance and overproduction of bacilysin. The mthA mutant had an elevated level of intracellular SAM, apparently acquired by arresting SAM-recycling pathways. This increase in the SAM level was directly responsible for bacilysin overproduction, as confirmed by forced expression of the metK gene encoding SAM synthetase. The mthA mutation fully exerted its effect on antibiotic overproduction in the genetic background of rel(+) but not the rel mutant, as demonstrated using an mthA relA double mutant. Strikingly, the mthA mutation activated, at the transcription level, even the dormant ability to produce another antibiotic, neotrehalosadiamine, at concentrations of 150 to 200 μg/ml, an antibiotic not produced (antibiotic production, by introducing either the rsmG mutation to Streptomyces or the mthA mutation to eubacteria, since many eubacteria have mthA homologues.

Non-functional genes repaired at the RNA level.

Science.gov (United States)

Burger, Gertraud

2016-01-01

Genomes and genes continuously evolve. Gene sequences undergo substitutions, deletions or nucleotide insertions; mobile genetic elements invade genomes and interleave in genes; chromosomes break, even within genes, and pieces reseal in reshuffled order. To maintain functional gene products and assure an organism's survival, two principal strategies are used - either repair of the gene itself or of its product. I will introduce common types of gene aberrations and how gene function is restored secondarily, and then focus on systematically fragmented genes found in a poorly studied protist group, the diplonemids. Expression of their broken genes involves restitching of pieces at the RNA-level, and substantial RNA editing, to compensate for point mutations. I will conclude with thoughts on how such a grotesquely unorthodox system may have evolved, and why this group of organisms persists and thrives since tens of millions of years. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

Science.gov (United States)

Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

2011-12-01

To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

Science.gov (United States)

Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

2014-06-01

Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

Rapid detection of single nucleotide mutation in p53 gene based on ...

Indian Academy of Sciences (India)

mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

Spectrum of mutations in homozygous familial hypercholesterolemia in India, with four novel mutations.

Science.gov (United States)

Setia, Nitika; Saxena, Renu; Arora, Anjali; Verma, Ishwar C

2016-12-01

Homozygous familial hypercholesterolemia (FH) is a rare but serious, inherited disorder of lipid metabolism characterized by very high total and LDL cholesterol levels from birth. It presents as cutaneous and tendon xanthomas since childhood, with or without cardiac involvement. FH is commonly caused by mutations in three genes, i.e. LDL receptor (LDLR), apolipoprotein B (ApoB) and PCSK9. We aimed to determine the spectrum of mutations in cases of homozygous FH in Asian Indians and evaluate if there was any similarity to the mutations observed in Caucasians. Sixteen homozygous FH subjects from eleven families were analyzed for mutations by Sanger sequencing. Large rearrangements in LDLR gene were evaluated by multiplex ligation probe dependent amplification (MLPA) technique. Ten mutations were observed in LDLR gene, of which four mutations were novel. No mutation was detected in ApoB gene and common PCSK9 mutation (p.D374Y). Fourteen cases had homozygous mutations; one had compound heterozygous mutation, while no mutation was detected in one clinically homozygous case. We report an interesting "Triple hit" case with features of homozygous FH. The spectrum of mutations in the Asian Indian population is quite heterogeneous. Of the mutations identified, 40% were novel. No mutation was observed in exons 3, 9 and 14 of LDLR gene, which are considered to be hot spots in studies done on Asian Indians in South Africa. Early detection followed by aggressive therapy, and cascade screening of extended families has been initiated to reduce the morbidity and mortality in these patients. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa

International Nuclear Information System (INIS)

Dryja, T.P.; Han, L.B.; Cowley, G.S.; McGee, T.L.; Berson, E.L.

1991-01-01

The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150 patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene

Detecting negative selection on recurrent mutations using gene genealogy

Science.gov (United States)

2013-01-01

Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

[Mutation analysis of FAH gene in patients with tyrosinemia type 1].

Science.gov (United States)

Dou, Li-Min; Fang, Ling-Juan; Wang, Xiao-Hong; Lu, Wei; Chen, Rui; Li, Li-Ting; Zhao, Jing; Wang, Jian-She

2013-04-01

To investigate the clinical features and mutations of the FAH gene. Clinical records of two cases were collected, and diagnosis was made according to the diagnostic criteria of the International Organization for Rare Disorders (NORD). Genomic DNA was extracted from peripheral blood leukocytes with QIAamp DNA Mini Kit. The DNA extracts were subjected to direct sequencing for 14 exons together with adjacent fragments of FAH gene using ABI Prism 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA) after PCR based on genomic DNA. The mutation source was verified by analyzing parents' exons corresponding to patients' mutation exons. The homology between human FAH enzyme and that of other species was surveyed using software Clustal X(European Bioinformatics Institute, Hinxton, Saffron Walde, UK). Polyphen (Polymorphism Phenotyping), available online, were used to predict possible impact of an amino acid substitution on structure and function of FAH enzyme. Polyphen calculates position-specific independent counts (PISC) scores for two amino acid variants in polymorphic position. A PISC scores that differ by > 2 were regarded as indicating the probability of damaging variants. Patient 1 was a 5 months and 21 days-old boy who suffered from persistent diarrhea, hepatomegaly, ascites; Alpha-fetoprotein > 1210 µg/L, levels of tyrosine in blood and succinylacetone in urine were 110.8 µmol/L and 83.7 µmol/L. His sister suffered from tyrosinemia type 1. Direct sequencing showed a G to A transition in CDS position 455 and 1027. He was compound heterozygous for the mutation c.455G > A/c.1027G > A, which predicts a change from tryptophan to a stop codon (TGG > TAG) at position 152 (W152X) and a change from glycine to arginine (GGG > AGG) at position 343 respectively. Patient 2 was a 6 year and 1 month-old girl with late-onset rickets who had signs of hepatosplenomegaly, rachitic rosary, windswept knees. Hypophosphatemia and alkaline phosphatase 1620 IU/L were detected

A novel mutation in the sterol 27-hydroxylase gene of a woman with autosomal recessive cerebrotendinous xanthomatosis

Directory of Open Access Journals (Sweden)

Garuti Rita

2010-10-01

Full Text Available Article abstract Mutations of the gene encoding the mitochondrial enzyme sterol 27-hydroxylase (CYP27A1 gene cause defects in the cholesterol pathway to bile acids that lead to the storage of cholestanol and cholesterol in tendons, lenses and the central nervous system. This disorder is the cause of a clinical syndrome known as cerebrotendinous xanthomatosis (CTX. Since 1991 several mutations of the CYP27A1 gene have been reported. We diagnosed the clinical features of CTX in a caucasian woman. Serum levels of cholestanol and 7α-hydroxycholesterol were elevated and the concentration of 27-hydroxycholesterol was reduced. Bile alcohols in the urine and faeces were increased. The analysis of the CYP27A1 gene showed that the patient was a compound heterozygote carrying two mutations both located in exon 8. One mutation is a novel four nucleotide deletion (c.1330-1333delTTCC that results in a frameshift and the occurrence of a premature stop codon leading to the formation of a truncated protein of 448 amino acids. The other mutation, previously reported, is a C - > T transition (c. c.1381C > T that converts the glutamine codon at position 461 into a termination codon (p.Q461X. These truncated proteins are expected to have no biological function being devoid of the cysteine residue at position 476 of the normal enzyme that is crucial for heme binding and enzyme activity.

 Mutations of noncollagen genes in osteogenesis imperfecta – implications of the gene products in collagen biosynthesis and pathogenesis of disease

Directory of Open Access Journals (Sweden)

Anna Galicka

2012-06-01

Full Text Available  Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.

Molecular nature of X-ray-induced mutations compared with that of spontaneous ones in human c-hprt gene integrated into mammalian chromosomal DNA

International Nuclear Information System (INIS)

Kimura, Hiroshi; Kato, Takesi.

1992-01-01

X-ray-induced mutations were analysed at molecular levels in comparison with spontaneous mutations. Altered sequences were determined tentatively of 30 independent X-ray-induced mutations in a cDNA of the human hprt gene which was integrated into mammalian chromosome as a part of a shuttle vector. Mutations consisted of base substitutions (37 %), frameshifts (27 %), deletions (27 %) and others (10 %). All these mutational events were distributed randomly over the gene without there being hot spots. The spectrum and distribution of X-ray-induced mutations resembled those of spontaneous mutations. Among base substitutions, transversions were predominant and base substitution mutations occurred more at A:T sites than at G:C sites, which is also the case in spontaneous mutations. Most of the frameshift and deletion mutations induced by X-rays, as well as those spontaneously arising, were characterized by the existence of short direct repeats of several identical bases in a row at the sites of the mutations. A slippage misalignment mechanism in replication well accounts for the generation of these classes of mutations. Judging from the data accumulated so far, it can be concluded that X-ray-induced mutations at molecular levels are similar to those spontaneously occurring. (author)

Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

Directory of Open Access Journals (Sweden)

Hsien-Yang Lee

2012-01-01

Full Text Available Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast majority (24/25 of well-characterized families with PKD/IC. PRRT2 truncating mutations were also detected in 28 of 78 additional families. PRRT2 encodes a proline-rich transmembrane protein of unknown function that has been reported to interact with the t-SNARE, SNAP25. PRRT2 localizes to axons but not to dendritic processes in primary neuronal culture, and mutants associated with PKD/IC lead to dramatically reduced PRRT2 levels, leading ultimately to neuronal hyperexcitability that manifests in vivo as PKD/IC.

Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

Directory of Open Access Journals (Sweden)

Srivastava Satish

2003-07-01

Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

The 95ΔG mutation in the 5'untranslated region of the norA gene increases efflux activity in Staphylococcus epidermidis isolates.

Science.gov (United States)

García-Gómez, Elizabeth; Jaso-Vera, Marcos E; Juárez-Verdayes, Marco A; Alcántar-Curiel, María D; Zenteno, Juan C; Betanzos-Cabrera, Gabriel; Peralta, Humberto; Rodríguez-Martínez, Sandra; Cancino-Díaz, Mario E; Jan-Roblero, Janet; Cancino-Diaz, Juan C

2017-02-01

In the Staphylococcus aureus ATCC25923 strain, the flqB mutation in the 5'untranslated region (5'UTR) of the norA gene causes increased norA mRNA expression and high efflux activity (HEA). The involvement of the norA gene 5'UTR in HEA has not been explored in S. epidermidis; therefore, we examined the function of this region in S. epidermidis clinical isolates. The selection of isolates with HEA was performed based on ethidium bromide (EtBr) MIC values and efflux efficiency (EF) using the semi-automated fluorometric method. The function of the 5'UTR was studied by quantifying the levels of norA expression (RT-qPCR) and by identifying 5'UTR mutations by sequence analysis. Only 10 isolates from a total of 165 (6.1%) had HEA (EtBr MIC = 300 μg/ml and EF ranged from 48.4 to 97.2%). Eight of 10 isolates with HEA had the 5'UTR 95 Δ G mutation. Isolates carrying the 95 Δ G mutation had higher levels of norA expression compared with those that did not. To corroborate that the 95 Δ G mutation is involved in HEA, a strain adapted to EtBr was obtained in vitro. This strain also presented the 95 Δ G mutation and had a high level of norA expression and EF, indicating that the 95 Δ G mutation is important for the HEA phenotype. The 95 Δ G mutation produces a different structure in the Shine-Dalgarno region, which may promote better translation of norA mRNA. To our knowledge, this is the first report to demonstrate the participation of the 5'UTR 95 Δ G mutation of the norA gene in the HEA phenotype of S. epidermidis isolates. Here, we propose that the efflux of EtBr is caused by an increment in the transcription and/or translation of the norA gene. Copyright © 2016 Elsevier Ltd. All rights reserved.

Metabolic alterations, HFE gene mutations and atherogenic lipoprotein modifications in patients with primary iron overload.

Science.gov (United States)

Meroño, Tomás; Brites, Fernando; Dauteuille, Carolane; Lhomme, Marie; Menafra, Martín; Arteaga, Alejandra; Castro, Marcelo; Saez, María Soledad; Ballerga, Esteban González; Sorroche, Patricia; Rey, Jorge; Lesnik, Philippe; Sordá, Juan Andrés; Chapman, M John; Kontush, Anatol; Daruich, Jorge

2015-05-01

Iron overload (IO) has been associated with glucose metabolism alterations and increased risk of cardiovascular disease (CVD). Primary IO is associated with mutations in the HFE gene. To which extent HFE gene mutations and metabolic alterations contribute to the presence of atherogenic lipoprotein modifications in primary IO remains undetermined. The present study aimed to assess small, dense low-density lipoprotein (LDL) levels, chemical composition of LDL and high-density lipoprotein (HDL) particles, and HDL functionality in IO patients. Eighteen male patients with primary IO and 16 sex- and age-matched controls were recruited. HFE mutations (C282Y, H63D and S65C), measures of insulin sensitivity and secretion (calculated from the oral glucose tolerance test), chemical composition and distribution profile of LDL and HDL subfractions (isolated by gradient density ultracentrifugation) and HDL functionality (as cholesterol efflux and antioxidative activity) were studied. IO patients compared with controls exhibited insulin resistance (HOMA-IR (homoeostasis model assessment-estimated insulin resistance): +93%, PHFE genotypes. C282Y homozygotes (n=7) presented a reduced β-cell function and insulin secretion compared with non-C282Y patients (n=11) (-58% and -73%, respectively, PHFE gene mutations are involved in the presence of atherogenic lipoprotein modifications in primary IO. To what extent such alterations could account for an increase in CVD risk remains to be determined.

HFE gene mutation and iron overload in Egyptian pediatric acute lymphoblastic leukemia survivors: a single-center study.

Science.gov (United States)

El-Rashedi, Farida H; El-Hawy, Mahmoud A; El-Hefnawy, Sally M; Mohammed, Mona M

2017-08-01

Hereditary hemochromatosis gene (HFE) mutations have a role in iron overload in pediatric acute lymphoblastic leukemia (ALL) survivors. We aimed to evaluate the genotype frequency and allelic distribution of the two HFE gene mutations (C282Y and H63D) in a sample of Egyptian pediatric ALL survivors and to detect the impact of these two mutations on their iron profile. This study was performed on 35 ALL survivors during their follow-up visits to the Hematology and Oncology Unit, Pediatric Department, Menoufia University Hospitals. Thirty-five healthy children of matched age and sex were chosen as controls. After completing treatment course, ALL survivors were screened for the prevalence of these two mutations by polymerase chain reaction-restriction fragment length polymorphism. Serum ferritin levels were measured by an enzyme-linked immunosorbent assay technique (ELISA). C282Y mutation cannot be detected in any of the 35 survivors or the 35 controls. The H63D heterozygous state (CG) was detected in 28.6% of the survivors group and in 20% of controls, while the H63D homozygous (GG) state was detected in 17.1% of survivors. No compound heterozygosity (C282Y/H63D) was detected at both groups with high G allele frequency (31.4%) in survivors more than controls (10%). There were significant higher levels of iron parameters in homozygote survivors than heterozygotes and the controls. H63D mutation aggravates the iron overload status in pediatric ALL survivors.

X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.

Science.gov (United States)

Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L

2017-01-01

We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.

Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

Science.gov (United States)

Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

2014-05-15

Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia.

Science.gov (United States)

Ponciano-Gómez, Alberto; Martínez-Tovar, Adolfo; Vela-Ojeda, Jorge; Olarte-Carrillo, Irma; Centeno-Cruz, Federico; Garrido, Efraín

2017-10-01

Acute myeloid leukemia is characterized by its high biological and clinical heterogeneity, which represents an important barrier for a precise disease classification and accurate therapy. While epigenetic aberrations play a pivotal role in acute myeloid leukemia pathophysiology, molecular signatures such as change in the DNA methylation patterns and genetic mutations in enzymes needed to the methylation process can also be helpful for classifying acute myeloid leukemia. Our study aims to unveil the relevance of DNMT3A and TET2 genes in global and specific methylation patterns in acute myeloid leukemia. Peripheral blood samples from 110 untreated patients with acute myeloid leukemia and 15 healthy control individuals were collected. Global 5-methylcytosine and 5-hydroxymethylcytosine in genomic DNA from peripheral blood leukocytes were measured by using the MethylFlashTM Quantification kits. DNMT3A and TET2 expression levels were evaluated by real-time quantitative polymerase chain reaction. The R882A hotspot of DNMT3A and exons 6-10 of TET2 were amplified by polymerase chain reaction and sequenced using the Sanger method. Methylation patterns of 16 gene promoters were evaluated by pyrosequencing after treating DNA with sodium bisulfite, and their transcriptional products were measured by real-time quantitative polymerase chain reaction.Here, we demonstrate altered levels of 5-methylcytosine and 5-hydroxymethylcytosine and highly variable transcript levels of DNMT3A and TET2 in peripheral blood leukocytes from acute myeloid leukemia patients. We found a mutation prevalence of 2.7% for DNMT3A and 11.8% for TET2 in the Mexican population with this disease. The average overall survival of acute myeloid leukemia patients with DNMT3A mutations was only 4 months. In addition, we showed that mutations in DNMT3A and TET2 may cause irregular DNA methylation patterns and transcriptional expression levels in 16 genes known to be involved in acute myeloid leukemia pathogenesis

Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Directory of Open Access Journals (Sweden)

Hashishe Mervat M

2010-06-01

Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

[Characteristics of phenylalanine hydroxylase gene mutations among patients with phenylketonuria from Linyi region of Shandong Province].

Science.gov (United States)

Li, Huafeng; Li, Yongli; Zhang, Li

2017-06-10

To explore the characteristics of (PAH) gene mutations among patients with phenylketonuria (PKU) from Linyi area of Shandong Province. For 51 children affected with PKU and their parents, the 13 exons and their flanking intronic sequences of the PAH gene were directly sequenced with Sanger method. PAH gene mutations were detected in all of the 102 alleles of the patients, which included 31 types of mutations. Common mutations included R243Q (17/102, 16.67%), IVS4-1G to A (9/102, 8.82%), R241C (8/102, 7.84%), R111X (8/102, 7.84%), and V399V (8/102, 7.84%). In addition, two novel mutations, D101N, 345-347del, have been detected. The 31 types of mutations included missense, nonsense, deletion, and splicing mutations, which were mainly located in exons 7 (29, 28.43%), 11 (18, 17.65%), 3 (16, 15.69%) and 12 (13, 12.75%). Mutations of the PAH gene in Linyi region mainly distributed in exons 7, 11, and 3, and the most common mutation were R243Q. Two novel mutations, D101N and 345-347del, have been detected.

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

Directory of Open Access Journals (Sweden)

Matei Irina

2001-08-01

Full Text Available Abstract Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP positive and negative gastric carcinomas (GCs. Methods We analyzed 50 gastric carcinomas (GCs for mutations in the BLM poly(A tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases but not in any of the MMP negative GCs (0/35 cases. The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %, BAX (27%, hMSH6 (20%,hMSH3 (13%, CBL (13%, IGFIIR (7%, RECQL (0% and WRN (0%. Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors.

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

Science.gov (United States)

Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

2001-01-01

Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

Identification of Constrained Cancer Driver Genes Based on Mutation Timing

Science.gov (United States)

Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

2015-01-01

Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

Energy Technology Data Exchange (ETDEWEB)

Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

2012-07-13

Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

International Nuclear Information System (INIS)

Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

2012-01-01

Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

Directory of Open Access Journals (Sweden)

Chia-Sui Hung

2007-01-01

Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

Science.gov (United States)

Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

2006-09-01

Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

Phenotypic Involvement in Females with the FMR1 Gene Mutation.

Science.gov (United States)

Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.

1998-01-01

A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)

MutaNET: a tool for automated analysis of genomic mutations in gene regulatory networks.

Science.gov (United States)

Hollander, Markus; Hamed, Mohamed; Helms, Volkhard; Neininger, Kerstin

2018-03-01

Mutations in genomic key elements can influence gene expression and function in various ways, and hence greatly contribute to the phenotype. We developed MutaNET to score the impact of individual mutations on gene regulation and function of a given genome. MutaNET performs statistical analyses of mutations in different genomic regions. The tool also incorporates the mutations in a provided gene regulatory network to estimate their global impact. The integration of a next-generation sequencing pipeline enables calling mutations prior to the analyses. As application example, we used MutaNET to analyze the impact of mutations in antibiotic resistance (AR) genes and their potential effect on AR of bacterial strains. MutaNET is freely available at https://sourceforge.net/projects/mutanet/. It is implemented in Python and supported on Mac OS X, Linux and MS Windows. Step-by-step instructions are available at http://service.bioinformatik.uni-saarland.de/mutanet/. volkhard.helms@bioinformatik.uni-saarland.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Mutations in rpoB and katG genes of multidrug resistant ...

African Journals Online (AJOL)

Introduction: Tuberculosis remains the leading causes of death worldwide with frequencies of mutations in rifampicin and isoniazid resistant Mycobacterium tuberculosis isolates varying according to geographical location. There is limited information in Zimbabwe on specific antibiotic resistance gene mutation patterns in ...

HFE gene mutations in coronary atherothrombotic disease

Directory of Open Access Journals (Sweden)

Calado R.T.

2000-01-01

Full Text Available Although iron can catalyze the production of free radicals involved in LDL lipid peroxidation, the contribution of iron overload to atherosclerosis remains controversial. The description of two mutations in the HFE gene (Cys282Tyr and His63Asp related to hereditary hemochromatosis provides an opportunity to address the question of the association between iron overload and atherosclerosis. We investigated the prevalence of HFE mutations in 160 survivors of myocardial infarction with angiographically demonstrated severe coronary atherosclerotic disease, and in 160 age-, gender- and race-matched healthy control subjects. PCR amplification of genomic DNA followed by RsaI and BclI restriction enzyme digestion was used to determine the genotypes. The frequency of the mutant Cys282Tyr allele was identical among patients and controls (0.022; carrier frequency, 4.4%, whereas the mutant His63Asp allele had a frequency of 0.143 (carrier frequency, 27.5% in controls and of 0.134 (carrier frequency, 24.5% in patients. Compound heterozygotes were found in 2 of 160 (1.2% controls and in 1 of 160 (0.6% patients. The finding of a similar prevalence of Cys282Tyr and His63Asp mutations in the HFE gene among controls and patients with coronary atherothrombotic disease, indirectly questions the possibility of an association between hereditary hemochromatosis and atherosclerosis.

Common mutations identified in the MLH1 gene in familial Lynch syndrome

Directory of Open Access Journals (Sweden)

Jisha Elias

2017-12-01

In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

Mu Opioid Receptor Gene: New Point Mutations in Opioid Addicts

Directory of Open Access Journals (Sweden)

Amin Dinarvand

2014-02-01

Full Text Available Introduction: Association between single-nucleotide polymorphisms (SNPs in mu opioid receptor gene and drug addiction has been shown in various studies. Here, we have evaluated the existence of polymorphisms in exon 3 of this gene in Iranian population and investigated the possible association between these mutations and opioid addiction.  Methods: 79 opioid-dependent subjects (55 males, 24 females and 134 non-addict or control individuals (74 males, 60 females participated in the study. Genomic DNA was extracted from volunteers’ peripheral blood and exon 3 of the mu opioid receptor gene was amplified by polymerase chain reaction (PCR whose products were then sequenced.  Results: Three different heterozygote polymorphisms were observed in 3 male individuals: 759T>C and 877G>A mutations were found in 2 control volunteers and 1043G>C substitution was observed in an opioid-addicted subject. Association between genotype and opioid addiction for each mutation was not statistically significant.  Discussion: It seems that the sample size used in our study is not enough to confirm or reject any association between 759T>C, 877G>A and 1043G>C substitutions in exon 3 of the mu opioid receptor gene and opioid addiction susceptibility in Iranian population.

HPRT gene mutation frequency and the factor of influence in adult peripheral blood lymphocytes

International Nuclear Information System (INIS)

Zhao Jingyong; Zheng Siying; Cui Fengmei; Wang Liuyi; Lao Qinhua; Wu Hongliang

2002-01-01

Objective: To study the HPRT gene loci mutation frequencies and the factor of influence in peripheral blood lymphocytes of adult with ages ranging from 21-50. Methods: HPRT gene mutation frequency (GMf) were examined by the technique of multinuclear cell assay. Relation between GMf and years were fitted with a computer. Results: Relation could be described by the following equation: y = 0.7555 + 0.0440x, r = 0.9829. Smoking has influence on GMf and sex hasn't. Conclusion: HPRT gene mutation frequency increases with increasing of age. Increasing rate is 0.00440% per year

Isocitrate dehydrogenase 1 and 2 genes mutations and MGMT methylation in gliomas

Directory of Open Access Journals (Sweden)

D. V. Tabakov

2017-01-01

Full Text Available Gliomas are the most common brain tumors. It is difficult to detect them at early stages of disease and there is a few available therapies providing significant improvement in survival. Mutations of isocitrate dehydrogenase 1 and 2 genes (IDH1 and IDH2 play significant role in gliomogenesis, diagnostics and selection of patient therapy. We tested the distribution of IDH1 and IDH2 mutations in gliomas of different histological types and grades of malignancy by DNA melting analysis using our protocol with a sensitivity of 5 %. The results of this assay were confirmed by conventional Sanger sequencing. IDH1/2 mutations were detected in 74 % of lower grade gliomas (II and III, World Health Organization and in 14 % of glioblastomas (IV, World Health Organization. Mutation rate in gliomas with oligodendroglioma component were significantly higher then in other glioma types (р = 0.014. The IDH1 mutations was the most common (79 % of general mutation number. IDH1/2 mutations can induce aberrant gene methylation. Detection of methylation rate of the gene encoding for O6-methylguanine-DNA-methyltransferase (MGMT, predictive biomarker for treatment of gliomas with the alkylating agents, has demonstrated a partial association with IDH1/2 mutations. In 73 % of IDH1/2-mutant tumors MGMT promoter methylation were observed. At the same time IDH1/2 mutations were not revealed in 67 % tumors with MGMT promoter methylation. These results indicate existence of another mechanism of MGMT methylation in gliomas. Our data strong support for necessity of both markers testing when patient therapy is selected.

[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

Science.gov (United States)

Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

2014-12-01

To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

A novel missense mutation of the DDHD1 gene associated with juvenile amyotrophic lateral sclerosis

Directory of Open Access Journals (Sweden)

Chujun Wu

2016-12-01

Full Text Available Background: Juvenile amyotrophic lateral sclerosis (jALS is a rare form of ALS with an onset age of less than 25 years and is frequently thought to be genetic in origin. DDHD1 gene mutations have been reported to be associated with the SPG28 subtype of autosomal recessive HSP but have never been reported in jALS patients.Methods: Gene screens for the causative genes of ALS, HSP and CMT using next-generation sequencing (NGS technologies were performed on a jALS patient. Sanger sequencing was used to validate identified variants and perform segregation analysis.Results: We identified a novel c.1483A>G (p.Met495Val homozygous missense mutation of the DDHD1 gene in the jALS patient. All of his parents and young bother were heterozygous for this mutation. The mutation was not found in 800 Chinese control subjects or the data of dbSNP, ExAC and 1000G.Conclusion: The novel c.1483A>G (p.Met495Val missense mutation of the DDHD1 gene could be a causative mutation of autosomal recessive jALS.

Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

NARCIS (Netherlands)

Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; van Kuilenburg, André B. P.

2016-01-01

Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA

Novel Missense Mitochondrial ND4L Gene Mutations in Friedreich's Ataxia

Directory of Open Access Journals (Sweden)

Mohammad Mehdi Heidari

2011-05-01

Full Text Available AbstractObjective(sThe mitochondrial defects in Friedreich's ataxia have been reported in many researches. Mitochondrial DNA is one of the candidates for defects in mitochondrion, and complex I is the first and one of the largest catalytic complexes of oxidative phosphorylation (OXPHOS system. Materials and MethodsWe searched the mitochondrial ND4L gene for mutations by TTGE and sequencing on 30 FRDA patients and 35 healthy controls.ResultsWe found 3 missense mutations [m.10506A>G (T13A, m.10530G>A (V21M, and m.10653G>A (A62T] in four patients whose m.10530G>A and m.10653G>A were not reported previously. In two patients, heteroplasmic m.10530G>A mutation was detected. They showed a very early ataxia syndrome. Our results showed that the number of mutations in FRDA patients was higher than that in the control cases (P= 0.0287.ConclusionAlthough this disease is due to nuclear gene mutation, the presence of these mutations might be responsible for further mitochondrial defects and the increase of the gravity of the disease. Thus, it should be considered in patients with this disorder.

Common Mediterranean Fever (MEFV Gene Mutations Associated with Ankylosing Spondylitis in Turkish Population

Directory of Open Access Journals (Sweden)

Serbulent Yigit

2012-01-01

Full Text Available Ankylosing spondylitis (AS is a common inflammatory rheumatic disease. Mediterranean fever (MEFV gene, which has already been identified as being responsible for familial Mediterranean fever (FMF, is also a suspicious gene for AS because of the clinical association of these two diseases. The aim of this study was to explore the frequency and clinical significance of MEFV gene mutations (M694V, M680I, V726A, E148Q and P369S in a cohort of Turkish patients with AS. Genomic DNAs of 103 AS patients and 120 controls were isolated and genotyped using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods. There was a statistically significant difference of the MEFV gene mutation carrier rates between AS patients and healthy controls (p = 0.004, OR: 2.5, 95% CI: 1.32–4.76. This association was also observed in allele frequencies (p = 0.005, OR: 2.3, 95% CI: 1.27–4.2. A relatively higher frequency was observed for M694V mutation in AS patients than controls (10.7% versus 4.2% , p = 0.060. There were no significant differences between MEFV mutation carriers and non-carriers with respect to the clinical and demographic characteristics. The results of this study suggest that MEFV gene mutations are positively associated with a predisposition to develop AS.

A study on tumor suppressor genes mutations associated with different pathological colorectal lesions

International Nuclear Information System (INIS)

Matar, S.N.A.

2011-01-01

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the Western world. In Egypt; there is an increasing incidence of the disease, especially among patients ≤40 years age. While CRC have been reported in low incidence rate in developing countries, it is the third most common tumor in male and the fifth common tumor in females in Egypt. Early diagnosis and surgical interference guarantee long survival of most CRC patients. Early diagnosis is impeded by the disease onset at young age and imprecise symptoms at the initial stages of the disease. As in most solid tumors, the malignant transformation of colonic epithelial cells is to arise through a multistep process during which they acquire genetic changes involving the activation of proto-oncogenes and the loss of tumor suppressor genes. Recently, a candidate tumor suppressor gene, KLF6, which is mapped to chromosome 10p, was found to be frequently mutated in a number of cancers. There are some evidences suggesting that the disruption of the functional activity of KLF6 gene products may be one of the early events in tumor genesis of the colon. The main objective of the present study was to detect mutational changes of KLF6 tumor suppressor gene and to study the loss of heterozygosity (LOH) markers at chromosome 10p15 (KLF6 locus) in colorectal lesions and colorectal cancer in Egyptian patients. The patients included in this study were 83 presented with different indications for colonoscopic examination. Selecting patients with colorectal pre-cancerous lesions or colorectal cancer was done according to the results of tissue biopsy from lesion and adjacent normal. The patients were classified into three main groups; (G I) Cancerous group, (G II) polyps group including patients with adenomatous polyps (AP), familial adenomatous polyps (FAP) and hyperplastic polyps (HP) and (G III) Inflammatory Bowel Diseases (IBD) including patients with ulcerative colitis (UC) and Crohn's disease (CD

Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

Science.gov (United States)

Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

2015-01-01

The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

Science.gov (United States)

Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

2018-05-31

Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

WS1 gene mutation analysis of Wolfram syndrome in a Chinese patient and a systematic review of literatures.

Science.gov (United States)

Yu, Guang; Yu, Man-li; Wang, Jia-feng; Gao, Cong-rong; Chen, Zhong-jin

2010-10-01

Wolfram syndrome is a rare hereditary disease characterized by diabetes mellitus and optic atrophy. The outcome of this disease is always poor. WFS1 gene mutation is the main cause of this disease. A patient with diabetes mellitus, diabetes insipidus, renal tract disorder, psychiatric abnormality, and cataract was diagnosed with Wolfram syndrome. Mutations in open reading frame (ORF) of WFS1 gene was analyzed by sequencing. Mutations in WFS1 gene was also summarized by a systematic review in Pubmed and Chinese biological and medical database. Sequencing of WFS1 gene in this patient showed a new mutation, 1962G>A, and two other non-sense mutations, 2433A>G and 2565G>A. Systematic review included 219 patients in total and identified 172 WFS1 gene mutations, most of which were located in Exon 8. These mutations in WFS1 gene might be useful in prenatal diagnosis of Wolfram syndrome.

Association between nucleotide mutation of eNOS gene and serum ...

African Journals Online (AJOL)

Galaxy

2013-05-15

May 15, 2013 ... spasm among Japanese (Nakayama et al., 1999; Casas et al., 2006). It is believed that these mutations might result in altered NO metabolism and impaired .... ship between T-786C mutation of eNOS gene and CAD specifically in the Iranian population. To our knowledge, this polymorphism has never been ...

Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

Science.gov (United States)

Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

2001-10-01

Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

Science.gov (United States)

Zaw, Myo T; Emran, Nor A; Lin, Zaw

2018-04-26

Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

International Nuclear Information System (INIS)

Ikehata, Hironobu

1998-01-01

Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

Science.gov (United States)

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Biochemical Diagnosis of Common Gene Mutations in Galactosemia

Directory of Open Access Journals (Sweden)

Farzaneh Mirzajani

2005-04-01

Full Text Available Objective: Galactosemia is an inborn error of galactose metabolism that is inherited in an autosomal recessive trait. Classical galactosemia is caused by deficient activity of the galactose-1-phosphate uridyltransferase (GALT enzyme that can result in galactosemia complications. Materials & Methods: 135 unrelated families, clinically suspected to galactosemia, were screened by qualitative measurement of galactose-1-phosphate uridyl transferase (GALT activity in blood RBCs by using Beutler method. Results: Deficient enzyme activity (classical galactosemia were confirmed in 16 families. All of these 16 families were submitted to the diagnosis of six common mutations in GALT gene including Q188R, K285N, S135L, L195P, X380R and Q169K by using PCR-RFLP method which resulted in detection of 68% of the mutated alleles. Eight patients were homozygote for Q188R mutation, while one patient homozygote for S135L mutation and one heterozygote for K285N mutation. Conclusion: Biochemnical diagnosis of Galactosemia in Grand infant hospital is very important and necessary.

Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

Science.gov (United States)

Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

2016-05-01

To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

New mutations and an updated database for the patched-1 (PTCH1) gene.

Science.gov (United States)

Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

2018-05-01

Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

[Clinical significance of JAK2、CALR and MPL gene mutations in 1 648 Philadelphia chromosome negative myeloproliferative neoplasms patients from a single center].

Science.gov (United States)

Li, M Y; Chao, H Y; Sun, A N; Qiu, H Y; Jin, Z M; Tang, X W; Han, Y; Fu, C C; Chen, S N; Wu, D P

2017-04-14

Objective: To explore the prevalences of JAK2, CALR and MPL gene mutations and the mutation types in patients with Philadelphia chromosome negative myeloproliferative neoplasms (MPNs) , and to compare their clinical characteristics of different mutation types with each other and mutation negative group. Methods: The mutations of JAK2 V617F, JAK2 gene at exon 12, CALR gene at exon 9 and MPL gene at exon 10 in 1 648 Ph negative MPNs patients were detected by direct sequencing. Results: ① The JAK2V617F mutation was found in 471 (92.7%) of 508 PV patients, 819 (78.1%) of 1 049 ET patients and 74 (81.3%) of 91 PMF patients respectively, with the total mutation rate as 82.8% (1 364/1 648) . The JAK2 exon12 mutation was found in 9 (1.7%) of 508 PV patients, none was found in ET or PMF patients, with the total mutation rate as 0.5% (9/1 648) . The CALR mutation was found in 132 (12.6%) of 1 049 ET patients and 11 (12.1%) of 91 PMF patients respectively, with the total mutation rate as 8.7% (143/1 648) ; the MPL mutation was found in 9 (0.9%) of 1 049 ET patients and 1 (1.1%) of 91 PMF patients respectively, with the total mutation rate as 0.6% (10/1 648) . The co-occurrence of any two types of driver gene mutations was not detected by direct sequencing. ②The median onset age of patients with JAK2V617F[61 (15-95) y] was significant higher than of with JAK2 exon12 mutation[49 (33-62) y] or without mutations[42 (3-78) y] ( P MPL mutation[59 (22-71) y] ( P >0.05) . Patients with JAK2V617F had higher white blood cell count and hemoglobin level ( P MPL mutation ( P =0.013) . The platelet count of patients with CALR mutation was significantly higher than of with JAK2V617F[966 (400-2 069) ×10(9)/L vs 800 (198-3 730) ×10(9)/L, P MPL gene mutation revealed normal karyotype. Conclusions: Driver gene mutations detection could ensure the diagnosis and prognosis judgment of MPN more reliable, different subtypes of MPNs had different profiles of driver gene mutations, the latter

Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

Science.gov (United States)

Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

2017-10-01

Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

[Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

Science.gov (United States)

Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

2018-02-10

OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

Science.gov (United States)

Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

2005-01-01

Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

International Nuclear Information System (INIS)

Kadowaki, T.; Kadowaki, H.; Taylor, S.I.

1990-01-01

Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

LENUS (Irish Health Repository)

Fernandez, Desiree M

2012-02-03

OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

DEFF Research Database (Denmark)

Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

2017-01-01

We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

Science.gov (United States)

Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

2017-01-01

Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

Science.gov (United States)

Al-sbou, Mohammed

2012-06-01

This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

[Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

Science.gov (United States)

He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

2015-11-01

To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

New insights into thyroglobulin gene: molecular analysis of seven novel mutations associated with goiter and hypothyroidism.

Science.gov (United States)

Citterio, Cintia E; Machiavelli, Gloria A; Miras, Mirta B; Gruñeiro-Papendieck, Laura; Lachlan, Katherine; Sobrero, Gabriela; Chiesa, Ana; Walker, Joanna; Muñoz, Liliana; Testa, Graciela; Belforte, Fiorella S; González-Sarmiento, Rogelio; Rivolta, Carina M; Targovnik, Héctor M

2013-01-30

The thyroglobulin (TG) gene is organized in 48 exons, spanning over 270 kb on human chromosome 8q24. Up to now, 62 inactivating mutations in the TG gene have been identified in patients with congenital goiter and endemic or non-endemic simple goiter. The purpose of the present study was to identify and characterize new mutations in the TG gene. We report 13 patients from seven unrelated families with goiter, hypothyroidism and low levels of serum TG. All patients underwent clinical, biochemical and imaging evaluation. Single-strand conformation polymorphism (SSCP) analysis, endonuclease restriction analysis, sequencing of DNA, genotyping, population screening, and bioinformatics studies were performed. Molecular analyses revealed seven novel inactivating TG mutations: c.378C>A [p.Y107X], c.2359C>T [p.R768X], c.2736delG [p.R893fsX946], c.3842G>A [p.C1262Y], c.5466delA [p.K1803fsX1833], c.6000C>G [p.C1981W] and c.6605C>G [p.P2183R] and three previously reported mutations: c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.7006C>T [p.R2317X]. Six patients from two families were homozygous for p.R277X mutation, four were compound heterozygous mutations (p.Y107X/p.C1262Y, p.R893fsX946/p.A2215D, p.K1803fsX1832/p.R2317X), one carried three identified mutations (p.R277X/p.C1981W-p.P2183R) together with a hypothetical micro deletion and the remaining two siblings from another family with typical phenotype had a single p.R768X mutated allele. In conclusion, our results confirm the genetic heterogeneity of TG defects and the pathophysiological importance of altered TG folding as a consequency of truncated TG proteins and missense mutations located in ACHE-like domain or that replace cysteine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Association of TMEM106B gene polymorphism with age at onset in granulin mutation carriers and plasma granulin protein levels.

Science.gov (United States)

Cruchaga, Carlos; Graff, Caroline; Chiang, Huei-Hsin; Wang, Jun; Hinrichs, Anthony L; Spiegel, Noah; Bertelsen, Sarah; Mayo, Kevin; Norton, Joanne B; Morris, John C; Goate, Alison

2011-05-01

To test whether rs1990622 (TMEM106B) is associated with age at onset (AAO) in granulin (GRN) mutation carriers and with plasma GRN levels in mutation carriers and healthy, elderly individuals. Rs1990622 (TMEM106B) was identified as a risk factor for frontotemporal lobar degeneration with TAR DNA-binding protein inclusions (FTLD-TDP) in a recent genome-wide association. Rs1990622 was genotyped in GRN mutation carriers and tested for association with AAO using the Kaplan-Meier method and a Cox proportional hazards model. Alzheimer's Disease Research Center. Subjects  We analyzed 50 affected and unaffected GRN mutation carriers from 4 previously reported FTLD-TDP families (HDDD1, FD1, HDDD2, and the Karolinska family). The GRN plasma levels were also measured in 73 healthy, elderly individuals. Age at onset and GRN plasma levels. The risk allele of rs1990622 was associated with a mean decrease of the AAO of 13 years (P = 9.9 × 10(-7)) and with lower plasma GRN levels in both healthy older adults (P = 4 × 10(-4)) and GRN mutation carriers (P = .0027). Analysis of the HapMap database identified a nonsynonymous single-nucleotide polymorphism rs3173615 (T185S) in perfect linkage disequilibrium with rs1990622. The association of rs1990622 with AAO explains, in part, the wide range in the AAO of disease among GRN mutation carriers. We hypothesize that rs1990622 or another variant in linkage disequilibrium could act in a manner similar to APOE in Alzheimer disease, increasing risk for disease in the general population and modifying AAO in mutation carriers. Our results also suggest that genetic variation in TMEM106B may influence risk for FTLD-TDP by modulating secreted levels of GRN.

Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

Science.gov (United States)

Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

2014-11-18

Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

UMD-USHbases: a comprehensive set of databases to record and analyse pathogenic mutations and unclassified variants in seven Usher syndrome causing genes.

Science.gov (United States)

Baux, David; Faugère, Valérie; Larrieu, Lise; Le Guédard-Méreuze, Sandie; Hamroun, Dalil; Béroud, Christophe; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

2008-08-01

Using the Universal Mutation Database (UMD) software, we have constructed "UMD-USHbases", a set of relational databases of nucleotide variations for seven genes involved in Usher syndrome (MYO7A, CDH23, PCDH15, USH1C, USH1G, USH3A and USH2A). Mutations in the Usher syndrome type I causing genes are also recorded in non-syndromic hearing loss cases and mutations in USH2A in non-syndromic retinitis pigmentosa. Usher syndrome provides a particular challenge for molecular diagnostics because of the clinical and molecular heterogeneity. As many mutations are missense changes, and all the genes also contain apparently non-pathogenic polymorphisms, well-curated databases are crucial for accurate interpretation of pathogenicity. Tools are provided to assess the pathogenicity of mutations, including conservation of amino acids and analysis of splice-sites. Reference amino acid alignments are provided. Apparently non-pathogenic variants in patients with Usher syndrome, at both the nucleotide and amino acid level, are included. The UMD-USHbases currently contain more than 2,830 entries including disease causing mutations, unclassified variants or non-pathogenic polymorphisms identified in over 938 patients. In addition to data collected from 89 publications, 15 novel mutations identified in our laboratory are recorded in MYO7A (6), CDH23 (8), or PCDH15 (1) genes. Information is given on the relative involvement of the seven genes, the number and distribution of variants in each gene. UMD-USHbases give access to a software package that provides specific routines and optimized multicriteria research and sorting tools. These databases should assist clinicians and geneticists seeking information about mutations responsible for Usher syndrome.

Accumulation of multiple mutations in linezolid-resistant Staphylococcus epidermidis causing bloodstream infections; in silico analysis of L3 amino acid substitutions that might confer high-level linezolid resistance.

Science.gov (United States)

Ikonomidis, Alexandros; Grapsa, Anastasia; Pavlioglou, Charikleia; Demiri, Antonia; Batarli, Alexandra; Panopoulou, Maria

2016-12-01

Fifty-six Staphylococcus epidermidis clinical isolates, showing high-level linezolid resistance and causing bacteremia in critically ill patients, were studied. All isolates belonged to ST22 clone and carried the T2504A and C2534T mutations in gene coding for 23SrRNA as well as the C189A, G208A, C209T and G384C missense mutations in L3 protein which resulted in Asp159Tyr, Gly152Asp and Leu94Val substitutions. Other silent mutations were also detected in genes coding for ribosomal proteins L3 and L22. In silico analysis of missense mutations showed that although L3 protein retained the sequence of secondary motifs, the tertiary structure was influenced. The observed alteration in L3 protein folding provides an indication on the putative role of L3-coding gene mutations in high-level linezolid resistance. Furthermore, linezolid pressure in health care settings where linezolid consumption is of high rates might lead to the selection of resistant mutants possessing L3 mutations that might confer high-level linezolid resistance.

Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

Science.gov (United States)

Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

2002-04-01

The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

657del5 mutation of the NBS1 gene in myelodysplastic syndrome

Directory of Open Access Journals (Sweden)

Bunjevacki Vera

2014-01-01

Full Text Available Myelodysplastic syndromes (MDS are clonal hematologic stem cell disorders with an as yet unknown molecular pathology. Genetic instability has been proposed as a cause of MDS. Mutations in the NBS1 gene, whose product nibrin (p95 is involved in DNA damage repair and cell-cycle control, might be associated with an elevated predisposition to the development of MDS. The aim of the study was to examine truncating 5 bp deletion (657del5, the most frequent NBS1 gene mutation in Slavic populations, in MDS patients. Among 71 MDS patients, we found one case that was heterozygous for the NBS1 657del5 mutation. To the best of our knowledge, this is the first report of a NBS1 mutation in MDS. [Projekat Ministarstva nauke Republike Srbije, br. 175091

Mutation in HFE gene decreases manganese accumulation and oxidative stress in the brain after olfactory manganese exposure.

Science.gov (United States)

Ye, Qi; Kim, Jonghan

2016-06-01

Increased accumulation of manganese (Mn) in the brain is significantly associated with neurobehavioral deficits and impaired brain function. Airborne Mn has a high systemic bioavailability and can be directly taken up into the brain, making it highly neurotoxic. While Mn transport is in part mediated by several iron transporters, the expression of these transporters is altered by the iron regulatory gene, HFE. Mutations in the HFE gene are the major cause of the iron overload disorder, hereditary hemochromatosis, one of the prevalent genetic diseases in humans. However, whether or not HFE mutation modifies Mn-induced neurotoxicity has not been evaluated. Therefore, our goal was to define the role of HFE mutation in Mn deposition in the brain and the resultant neurotoxic effects after olfactory Mn exposure. Mice carrying the H67D HFE mutation, which is homologous to the H63D mutation in humans, and their control, wild-type mice, were intranasally instilled with MnCl2 with different doses (0, 0.2, 1.0 and 5.0 mg kg(-1)) daily for 3 days. Mn levels in the blood, liver and brain were determined using inductively-coupled plasma mass spectrometry (ICP-MS). H67D mutant mice showed significantly lower Mn levels in the blood, liver, and most brain regions, especially in the striatum, while mice fed an iron-overload diet did not. Moreover, mRNA expression of ferroportin, an essential exporter of iron and Mn, was up-regulated in the striatum. In addition, the levels of isoprostane, a marker of lipid peroxidation, were increased in the striatum after Mn exposure in wild-type mice, but were unchanged in H67D mice. Together, our results suggest that the H67D mutation provides decreased susceptibility to Mn accumulation in the brain and neurotoxicity induced by inhaled Mn.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

Science.gov (United States)

Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

2016-01-01

The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

NDP gene mutations in 14 French families with Norrie disease.

Science.gov (United States)

Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

2003-12-01

Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

Hyperthyroidism caused by a germline activating mutation of the thyrotropin receptor gene: difficulties in diagnosis and therapy.

Science.gov (United States)

Bertalan, Rita; Sallai, Agnes; Sólyom, János; Lotz, Gábor; Szabó, István; Kovács, Balázs; Szabó, Eva; Patócs, Attila; Rácz, Károly

2010-03-01

Germline activating mutations of the thyrotropin receptor (TSHR) gene have been considered as the only known cause of sporadic nonautoimmune hyperthyroidism in the pediatric population. Here we describe the long-term follow-up and evaluation of a patient with sporadic nonautoimmune primary hyperthyroidism who was found to have a de novo germline activating mutation of the TSHR gene. The patient was an infant who presented at the age of 10 months in an unconscious state with exsiccation, wet skin, fever, and tachycardia. Nonautoimmune primary hyperthyroidism was diagnosed, and brain magnetic resonance imaging and computed tomography showed also Arnold-Chiari malformation type I. Continuous propylthiouracil treatment resulted in a prolonged clinical cure lasting for 10 years. At the age of 11 years and 5 months the patient underwent subtotal thyroidectomy because of symptoms of trachea compression caused by a progressive multinodular goiter. However, 2 months after surgery, hormonal evaluation indicated recurrent hyperthyroidism and the patient was treated with propylthiouracil during the next 4 years. At the age of 15 years the patient again developed symptoms of trachea compression. Radioiodine treatment resulted in a regression of the recurrent goiter and a permanent cure of hyperthyroidism without relapse during the last 3 years of his follow-up. Sequencing of exon 10 of the TSHR gene showed a de novo heterozygous germline I630L mutation, which has been previously described as activating mutation at somatic level in toxic thyroid nodules. The I630L mutation of the TSHR gene occurs not only at somatic level in toxic thyroid nodules, but also its presence in germline is associated with nonautoimmune primary hyperthyroidism. Our case report demonstrates that in this disorder a continuous growth of the thyroid occurs without any evidence of elevated TSH due to antithyroid drug overdosing. This may justify previous recommendations for early treatment of affected

Nitrogenase activity of Herbaspirillum seropedicae grown under low iron levels requires the products of nifXorf1 genes.

Science.gov (United States)

Klassen, Giseli; de Oliveira Pedrosa, Fábio; de Souza, Emanuel M; Yates, M Geoffrey; Rigo, Liu Un

2003-07-29

Herbaspirillum seropedicae strains mutated in the nifX or orf1 genes showed 90% or 50% reduction in nitrogenase activity under low levels of iron or molybdenum respectively. Mutations in nifX or orf1 genes did not affect nif gene expression since a nifH::lacZ fusion was fully active in both mutants. nifX and the contiguous gene orf1 are essential for maximum nitrogen fixation under iron limitation and are probably involved in synthesis of nitrogenase iron or iron-molybdenum clusters.

Mapping of the X-linked cataract (Xcat) mutation, the gene implicated in the Nance Horan syndrome, on the mouse X chromosome.

Science.gov (United States)

Stambolian, D; Favor, J; Silvers, W; Avner, P; Chapman, V; Zhou, E

1994-07-15

The Xcat mutation in the mouse, an X-linked inherited disorder, is characterized by the congenital onset of cataracts. The cataracts have morphologies similar to those of cataracts found in the human Nance Horan (X-linked cataract dental) syndrome, suggesting that Xcat is an animal model for Nance Horan. The Xcat mutation provides an opportunity to investigate, at the molecular level, the pathogenesis of cataract. As a first step to cloning the Xcat gene, we report the localization of the Xcat mutation with respect to known molecular markers on the mouse X chromosome. Back-cross progeny carrying the Xcat mutation were obtained from an interspecific cross. Genomic DNA from each mouse was subjected to Southern and PCR analysis to identify restriction fragment length polymorphisms and simple sequence length polymorphisms, respectively. Our results refine the location of Xcat to a 2-cM region, eliminate several genes from consideration as the Xcat mutation, identify molecular probes tightly linked with Xcat, and suggest candidate genes responsible for the Xcat phenotype.

Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

Energy Technology Data Exchange (ETDEWEB)

Putnam, E.A.; Cho, M.; Milewicz, D.M. [Univ. of Texas-Houston Medical School, Houston, TX (United States)] [and others

1996-03-29

Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-based exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.

Investigation of mutations in the HBB gene using the 1,000 genomes database.

Science.gov (United States)

Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

2017-01-01

Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

Energy Technology Data Exchange (ETDEWEB)

Upadhyaya, M.; Osborn, M.; Maynard, J.; Harper, P. [Institute of Medical Genetics, Cardiff, Wales (United Kingdom)

1996-07-26

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detected in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.

Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

International Nuclear Information System (INIS)

Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

2000-01-01

Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

FLNC Gene Splice Mutations Cause Dilated Cardiomyopathy

Directory of Open Access Journals (Sweden)

Rene L. Begay, BS

2016-08-01

Full Text Available A genetic etiology has been identified in 30% to 40% of dilated cardiomyopathy (DCM patients, yet only 50% of these cases are associated with a known causative gene variant. Thus, in order to understand the pathophysiology of DCM, it is necessary to identify and characterize additional genes. In this study, whole exome sequencing in combination with segregation analysis was used to identify mutations in a novel gene, filamin C (FLNC, resulting in a cardiac-restricted DCM pathology. Here we provide functional data via zebrafish studies and protein analysis to support a model implicating FLNC haploinsufficiency as a mechanism of DCM.

Somatic gene mutation in the human in relation to radiation risk

International Nuclear Information System (INIS)

Mendelsohn, M.L.

1992-01-01

This report discusses the measurement of somatic gene-mutation frequencies in the human. We ask the following questions. How well can they be measured? Do they respond to radiation? Can they also function as a dosimeter? What do they tell us about the somatic mutation theory of carcinogenesis?

Tumor-specific mutations in low-frequency genes affect their functional properties

NARCIS (Netherlands)

L. Erdem-Eraslan (Lale); D. Heijsman (Daphne); M. De Wit (Maurice); A.E. Kremer (Andreas); A. Sacchetti (Andrea); P.J. van der Spek (Peter); P.A.E. Sillevis Smitt (Peter); P.J. French (Pim)

2015-01-01

textabstractCausal genetic changes in oligodendrogliomas (OD) with 1p/19q co-deletion include mutations in IDH1, IDH2, CIC, FUBP1, TERT promoter and NOTCH1. However, it is generally assumed that more somatic mutations are required for tumorigenesis. This study aimed to establish whether genes

[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

Science.gov (United States)

Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

2017-08-10

To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

Application of gene targeting to designed mutation breeding of high-tryptophan rice.

Science.gov (United States)

Saika, Hiroaki; Oikawa, Akira; Matsuda, Fumio; Onodera, Haruko; Saito, Kazuki; Toki, Seiichi

2011-07-01

Site-directed mutagenesis via gene targeting (GT) based on homologous recombination is the ultimate mutation breeding technology because it enables useful information acquired from structural- and computational-based protein engineering to be applied directly to molecular breeding, including metabolic engineering, of crops. Here, we employed this rationale to introduce precise mutations in OASA2--an α-subunit of anthranilate synthase that is a key enzyme of tryptophan (Trp) biosynthesis in rice (Oryza sativa)--via GT, with subsequent selection of GT cells using a Trp analog. The expression level of OASA2 in plants homozygous and heterozygous for modified OASA2 was similar to that of nontransformants, suggesting that OASA2 transcription in GT plants was controlled in the same manner as endogenous OASA2, and that GT could lead to a lower risk of gene silencing than in conventional overexpression approaches. Moreover, we showed that enzymatic properties deduced from protein engineering or in vitro analysis could be reproduced in GT plants as evidenced by Trp accumulation levels. Interestingly, mature seeds of homozygous GT plants accumulated Trp levels 230-fold higher than in nontransformants without any apparent morphological or developmental changes. Thus, we have succeeded in producing a novel rice plant of great potential nutritional benefit for both man and livestock that could not have been selected using conventional mutagenesis approaches. Our results demonstrate the effectiveness of directed crop improvement by combining precision mutagenesis via GT with a knowledge of protein engineering.

Extensive overproduction of the AdhE protein by rng mutations depends on mutations in the cra gene or in the Cra-box of the adhE promoter.

Science.gov (United States)

Kaga, Naoko; Umitsuki, Genryou; Clark, David P; Nagai, Kazuo; Wachi, Masaaki

2002-07-05

Escherichia coli RNase G encoded by the rng gene is involved in degradation of adhE mRNA. Overproduction of the AdhE protein by rng mutants was found to depend on the genetic background of strains derived from DC272 (adhC81) or MC1061. We found that DC272 carried a point mutation in the Cra-binding site of the adhE promoter. The Cra protein encoded by the cra gene is known to act as a repressor of adhE. P1-phage-mediated transduction and lacZ fusion analysis with the mutant adhE promoter confirmed that this mutation is responsible for overproduction. On the other hand, Southern hybridization revealed that MC1061 had a 0.85-kb deletion of the cra gene. Overproduction of AdhE in the MC1061 background was reversed to the wild-type levels by introduction of a plasmid carrying the cra(+) gene. These results indicated that expression of the adhE gene was regulated transcriptionally by Cra and posttranscriptionally by RNase G. (c) 2002 Elsevier Science (USA).

PROP1 gene mutations in a 36-year-old female presenting with psychosis

Directory of Open Access Journals (Sweden)

Durgesh Prasad Chaudhary

2017-03-01

Full Text Available Combined pituitary hormonal deficiency (CPHD is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms.

Association of a novel point mutation in MSH2 gene with familial multiple primary cancers

Directory of Open Access Journals (Sweden)

Hai Hu

2017-10-01

Full Text Available Abstract Background Multiple primary cancers (MPC have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. Methods We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. Results We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Conclusion Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.