WorldWideScience

Sample records for lethal skin barrier

  1. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  2. Skin barrier composition

    International Nuclear Information System (INIS)

    Osburn, F.G.

    1985-01-01

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices. (author)

  3. Skin barrier composition

    Energy Technology Data Exchange (ETDEWEB)

    Osburn, F G

    1985-06-12

    A skin barrier composition comprises a mixture of a copolymer resin of ethylene and vinyl acetate (EVA), and a water-insoluble dry tack-providing elastomer such as polyisobutylene. The composition after mixing and molding, is subjected to ionizing irradiation to form cross-linked polymer networks of the EVA. The compositions have exceptional properties for use as barrier sheets, rings, or strips in ostomy, wound drainage, and incontinence devices.

  4. Penetration through the Skin Barrier

    DEFF Research Database (Denmark)

    Nielsen, Jesper Bo; Benfeldt, Eva; Holmgaard, Rikke

    2016-01-01

    The skin is a strong and flexible organ with barrier properties essential for maintaining homeostasis and thereby human life. Characterizing this barrier is the ability to prevent some chemicals from crossing the barrier while allowing others, including medicinal products, to pass at varying rates......-through diffusion cells) as well as in vivo methods (microdialysis and microperfusion). Then follows a discussion with examples of how different characteristics of the skin (age, site and integrity) and of the penetrants (size, solubility, ionization, logPow and vehicles) affect the kinetics of percutaneous...

  5. Skin Barrier Function and Allergens

    DEFF Research Database (Denmark)

    Engebretsen, Kristiane Aasen; Thyssen, Jacob Pontoppidan

    2016-01-01

    The skin is an important barrier protecting us from mechanical insults, microorganisms, chemicals and allergens, but, importantly, also reducing water loss. A common hallmark for many dermatoses is a compromised skin barrier function, and one could suspect an elevated risk of contact sensitization...... and skin barrier status. Psoriasis has traditionally been regarded a Th1-dominated disease, but the discovery of Th17 cells and IL-17 provides new and interesting information regarding the pathogenesis of the disease. Research suggests an inverse relationship between psoriasis and CA, possibly due......) and Th2 (AD) have been proposed as an explanation. Finally, there is convincing evidence that exposure to irritants increases the risk of CS, and patients with ICD are, therefore, at great risk of developing CA. Skin irritation leads to the release of IL-1 and TNF-α, which affects the function of antigen...

  6. The Effects of Anthrax Lethal Toxin on Host Barrier Function

    Directory of Open Access Journals (Sweden)

    David M. Frucht

    2011-06-01

    Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

  7. Antimicrobial Peptides, Infections and the Skin Barrier

    DEFF Research Database (Denmark)

    Clausen, Maja Lisa; Agner, Tove

    2016-01-01

    The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis and trans......The skin serves as a strong barrier protecting us from invading pathogens and harmful organisms. An important part of this barrier comes from antimicrobial peptides (AMPs), which are small peptides expressed abundantly in the skin. AMPs are produced in the deeper layers of the epidermis...

  8. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

  9. Ceramides and barrier function in healthy skin

    DEFF Research Database (Denmark)

    Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

    2010-01-01

    Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

  10. Matching the skin barrier to the skin type.

    Science.gov (United States)

    Thompson, Hyacinth; North, Jacqui; Davenport, Rebecca; Williams, Julia

    Peristomal skin problems are thought to be common (Herlufsson et al, 2006; Williams et al, 2010), and can interfere with the security of stoma products. Stoma patients are reliant on the integrity of their peristomal skin to maintain a normal lifestyle. Bekkers et al (1996) highlighted that, if the peristomal skin becomes damaged, it not only affects the person physically, but also psychologically, ultimately prolonging rehabilitation and adaptation to the stoma. Therefore, it can be concluded that maintaining skin integrity is a basic and essential skill in ensuring good stoma management. This article explores the assessment of four stoma patients, highlighting the importance of matching their skin type with their skin barrier for optimum skin protection. The patients have kindly agreed for their case studies to be published as a means of informing others. All names have been changed in line with Nursing and Midwifery Council (2010) guidelines to maintain patient confidentiality. This article was originally presented at the World Council of Enterostomal Therapists' (WCET) annual conference in 2010, receiving first prize at poster presentations.

  11. Development of human skin equivalents to unravel the impaired skin barrier in atopic dermatitis skin

    NARCIS (Netherlands)

    Eweje, M.O.

    2016-01-01

    The studies in this thesis describes the barrier defects in Atopic Dermatitis (AD) skin and various techniques to develop AD Human Skin Equivalents (HSEs) which can be used to better understand the role of several factors in the pathogenesis of AD skin. The results described show that Inflammation

  12. Recovery from UV-induced potentially lethal damage in systemic lupus erythematosus skin fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Zamansky, G B

    1986-08-01

    The repair of ultraviolet light-induced potentially lethal damage was investigated in density-inhibited skin fibroblast cell strains derived from patients with systemic lupus erythematosus. The effect of exposure to polychromatic ultraviolet light composed of environmentally relevant wavelengths or to the more commonly studied, short wavelength (254 nm) ultraviolet light was studied. Systemic lupus erythematosus cells, which are hypersensitive to ultraviolet light under growth promoting conditions, were able to repair potentially lethal damage as well as normal cells.

  13. Recovery from UV-induced potentially lethal damage in systemic lupus erythematosus skin fibroblasts

    International Nuclear Information System (INIS)

    Zamansky, G.B.

    1986-01-01

    The repair of ultraviolet light-induced potentially lethal damage was investigated in density-inhibited skin fibroblast cell strains derived from patients with systemic lupus erythematosus. The effect of exposure to polychromatic ultraviolet light composed of environmentally relevant wavelengths or to the more commonly studied, short wavelength (254 nm) ultraviolet light was studied. Systemic lupus erythematosus cells, which are hypersensitive to ultraviolet light under growth promoting conditions, were able to repair potentially lethal damage as well as normal cells. (author)

  14. Notch-deficient skin induces a lethal systemic B-lymphoproliferative disorder by secreting TSLP, a sentinel for epidermal integrity.

    Directory of Open Access Journals (Sweden)

    Shadmehr Demehri

    2008-05-01

    Full Text Available Epidermal keratinocytes form a highly organized stratified epithelium and sustain a competent barrier function together with dermal and hematopoietic cells. The Notch signaling pathway is a critical regulator of epidermal integrity. Here, we show that keratinocyte-specific deletion of total Notch signaling triggered a severe systemic B-lymphoproliferative disorder, causing death. RBP-j is the DNA binding partner of Notch, but both RBP-j-dependent and independent Notch signaling were necessary for proper epidermal differentiation and lipid deposition. Loss of both pathways caused a persistent defect in skin differentiation/barrier formation. In response, high levels of thymic stromal lymphopoietin (TSLP were released into systemic circulation by Notch-deficient keratinocytes that failed to differentiate, starting in utero. Exposure to high TSLP levels during neonatal hematopoiesis resulted in drastic expansion of peripheral pre- and immature B-lymphocytes, causing B-lymphoproliferative disorder associated with major organ infiltration and subsequent death, a previously unappreciated systemic effect of TSLP. These observations demonstrate that local skin perturbations can drive a lethal systemic disease and have important implications for a wide range of humoral and autoimmune diseases with skin manifestations.

  15. Standards for the Protection of Skin Barrier Function.

    Science.gov (United States)

    Giménez-Arnau, Ana

    2016-01-01

    The skin is a vital organ, and through our skin we are in close contact with the entire environment. If we lose our skin we lose our life. The barrier function of the skin is mainly driven by the sophisticated epidermis in close relationship with the dermis. The epidermal epithelium is a mechanically, chemically, biologically and immunologically active barrier submitted to continuous turnover. The barrier function of the skin needs to be protected and restored. Its own physiology allows its recovery, but many times this is not sufficient. This chapter is focused on the standards to restore, treat and prevent barrier function disruption. These standards were developed from a scientific, academic and clinical point of view. There is a lack of standardized administrative recommendations. Still, there is a walk to do that will help to reduce the social and economic burden of diseases characterized by an abnormal skin barrier function. © 2016 S. Karger AG, Basel.

  16. A study on the quantitative evaluation of skin barrier function

    Science.gov (United States)

    Maruyama, Tomomi; Kabetani, Yasuhiro; Kido, Michiko; Yamada, Kenji; Oikaze, Hirotoshi; Takechi, Yohei; Furuta, Tomotaka; Ishii, Shoichi; Katayama, Haruna; Jeong, Hieyong; Ohno, Yuko

    2015-03-01

    We propose a quantitative evaluation method of skin barrier function using Optical Coherence Microscopy system (OCM system) with coherency of near-infrared light. There are a lot of skin problems such as itching, irritation and so on. It has been recognized skin problems are caused by impairment of skin barrier function, which prevents damage from various external stimuli and loss of water. To evaluate skin barrier function, it is a common strategy that they observe skin surface and ask patients about their skin condition. The methods are subjective judgements and they are influenced by difference of experience of persons. Furthermore, microscopy has been used to observe inner structure of the skin in detail, and in vitro measurements like microscopy requires tissue sampling. On the other hand, it is necessary to assess objectively skin barrier function by quantitative evaluation method. In addition, non-invasive and nondestructive measuring method and examination changes over time are needed. Therefore, in vivo measurements are crucial for evaluating skin barrier function. In this study, we evaluate changes of stratum corneum structure which is important for evaluating skin barrier function by comparing water-penetrated skin with normal skin using a system with coherency of near-infrared light. Proposed method can obtain in vivo 3D images of inner structure of body tissue, which is non-invasive and non-destructive measuring method. We formulate changes of skin ultrastructure after water penetration. Finally, we evaluate the limit of performance of the OCM system in this work in order to discuss how to improve the OCM system.

  17. Noninvasive evaluation of the barrier properties of the skin

    Directory of Open Access Journals (Sweden)

    Utz S.R.

    2014-09-01

    Full Text Available Skin as an organ of protection covers the body and accomplishes multiple defensive functions. The intact skin represents a barrier to the uncontrolled loss of water, proteins, and plasma components from the organism. Due to its complex structure, the epidermal barrier with its major component, stratum corneum, is the rate-limiting unit for the penetration of exogenous substances through the skin. The epidermal barrier is not a static structure. The permeability barrier status can be modified by different external and internal factors such as climate, physical stressors, and a number of skin and systemic diseases. Today, different non-invasive approaches are used to monitor the skin barrier physical properties in vivo. The quantification of parameters such as transepidermal water loss, stratum corneum hydration, and skin surface acidity is essential for the integral evaluation of the epidermal barrier status. This paper will allow the readership to get acquainted with the non-invasive, in vivo methods for the investigation of the skin barrier.

  18. Effect of glove occlusion on the skin barrier

    DEFF Research Database (Denmark)

    Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe

    2016-01-01

    that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused...... by detergents/soaps in a dose-response fashion....

  19. Multiphoton STED and FRET in human skin: Resolving the skin barrier

    DEFF Research Database (Denmark)

    Antonescu, Irina; Dreier, Jes; Brewer, Jonathan R.

    intercellular spaces. Characterization of the structural and dynamical processes occurring across the skin barrier is essential for understanding healthy and diseased skin and for designing successful transdermal drug delivery strategies. In this study we use Stimulated emission depletion (STED), two photon...

  20. Skin barrier disruption by acetone: observations in a hairless mouse skin model

    NARCIS (Netherlands)

    Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

  1. LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM

    Science.gov (United States)

    Martinez-Palomo, A.; Erlij, D.; Bracho, H.

    1971-01-01

    Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611

  2. Lethal genes surviving by mosaicism: a possible explanation for sporadic birth defects involving the skin.

    Science.gov (United States)

    Happle, R

    1987-04-01

    A genetic concept is advanced to explain the origin of several sporadic syndromes characterized by a mosaic distribution of skin defects. It is postulated that these disorders are due to the action of a lethal gene surviving by mosaicism. The presence of the mutation in the zygote will lead to death of the embryo at an early stage of development. Cells bearing the mutation can survive only in a mosaic state, in close proximity with normal cells. The mosaic may arise either from a gametic half chromatid mutation or from an early somatic mutation. This concept of origin is proposed to apply to the Schimmelpenning-Feuerstein-Mims syndrome, the McCune-Albright syndrome, the Klippel-Trenaunay syndrome, the Sturge-Weber syndrome, and neurocutaneous melanosis. Moreover, this etiologic hypothesis may apply to two other birth defects that have recently been delineated, the Proteus syndrome (partial gigantism of hands or feet, hemihypertrophy, macrocephaly, linear papillomatous epidermal nevus, subcutaneous hemangiomas and lipomas, accelerated growth, and visceral anomalies), and the Delleman-Oorthuys syndrome (orbital cyst, porencephaly, periorbital appendages, and focal aplasia of the skin.

  3. Disturbed skin barrier in children with chronic kidney disease.

    Science.gov (United States)

    Wojtowicz-Prus, Elzbieta; Kilis-Pstrusinska, Katarzyna; Reich, Adam; Zachwieja, Katarzyna; Miklaszewska, Monika; Szczepanska, Maria; Szepietowski, Jacek C

    2015-02-01

    There are limited data on skin lesions in children with end-stage renal failure. The aim of the study was an evaluation of the skin barrier in children with different stages of chronic kidney disease (CKD). The prevalence of xerosis, its severity, as well as its link selected demographic factors, were examined. The study included 103 children: 72 with CKD stages 3-5 (38 on conservative treatment and 34 on dialysis) and 31 patients with primary monosymptomatic nocturnal enuresis as a control group. Initially, the study subjects described the localisation and severity of dry skin by themselves. Next, clinical evaluation of xerosis, non-invasive corneometric assessment of epidermis moisturising and the measurement of transepidermal water loss were performed. Most CKD children reported dry skin. The problem of xerosis was identified more frequently in patients on dialysis (67.6 %) than on conservative treatment (42.1 %) (p = 0.01). CKD patients divided according to skin dryness did not differ with regards to age, sex, initial kidney disease and CKD duration. Disturbed skin barrier is an important concern of children with CKD, intensifying as the disease progresses. This symptom occurs on early stages of CKD and it should be taken into consideration in the CKD management.

  4. An ex vivo human skin model for studying skin barrier repair.

    Science.gov (United States)

    Danso, Mogbekeloluwa O; Berkers, Tineke; Mieremet, Arnout; Hausil, Farzia; Bouwstra, Joke A

    2015-01-01

    In the studies described in this study, we introduce a novel ex vivo human skin barrier repair model. To develop this, we removed the upper layer of the skin, the stratum corneum (SC) by a reproducible cyanoacrylate stripping technique. After stripping the explants, they were cultured in vitro to allow the regeneration of the SC. We selected two culture temperatures 32 °C and 37 °C and a period of either 4 or 8 days. After 8 days of culture, the explant generated SC at a similar thickness compared to native human SC. At 37 °C, the early and late epidermal differentiation programmes were executed comparably to native human skin with the exception of the barrier protein involucrin. At 32 °C, early differentiation was delayed, but the terminal differentiation proteins were expressed as in stripped explants cultured at 37 °C. Regarding the barrier properties, the SC lateral lipid organization was mainly hexagonal in the regenerated SC, whereas the lipids in native human SC adopt a more dense orthorhombic organization. In addition, the ceramide levels were higher in the cultured explants at 32 °C and 37 °C than in native human SC. In conclusion, we selected the stripped ex vivo skin model cultured at 37 °C as a candidate model to study skin barrier repair because epidermal and SC characteristics mimic more closely the native human skin than the ex vivo skin model cultured at 32 °C. Potentially, this model can be used for testing formulations for skin barrier repair. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Anthrax lethal toxin disrupts intestinal barrier function and causes systemic infections with enteric bacteria.

    Directory of Open Access Journals (Sweden)

    Chen Sun

    Full Text Available A variety of intestinal pathogens have virulence factors that target mitogen activated protein kinase (MAPK signaling pathways, including Bacillus anthracis. Anthrax lethal toxin (LT has specific proteolytic activity against the upstream regulators of MAPKs, the MAPK kinases (MKKs. Using a murine model of intoxication, we show that LT causes the dose-dependent disruption of intestinal epithelial integrity, characterized by mucosal erosion, ulceration, and bleeding. This pathology correlates with an LT-dependent blockade of intestinal crypt cell proliferation, accompanied by marked apoptosis in the villus tips. C57BL/6J mice treated with intravenous LT nearly uniformly develop systemic infections with commensal enteric organisms within 72 hours of administration. LT-dependent intestinal pathology depends upon its proteolytic activity and is partially attenuated by co-administration of broad spectrum antibiotics, indicating that it is both a cause and an effect of infection. These findings indicate that targeting of MAPK signaling pathways by anthrax LT compromises the structural integrity of the mucosal layer, serving to undermine the effectiveness of the intestinal barrier. Combined with the well-described immunosuppressive effects of LT, this disruption of the intestinal barrier provides a potential mechanism for host invasion via the enteric route, a common portal of entry during the natural infection cycle of Bacillus anthracis.

  6. Penetration of radionuclides across skin barriers of animal skin models in vitro

    International Nuclear Information System (INIS)

    Koprda, V.; Harangozo, M.; Bohacik, L.; Kassai, Z.

    1998-01-01

    In this paper: (i) the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model has been studied, (ii) the biologic structure mostly responsible for the barrier effect was selected and proved, (iii) the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ (the diffusion across the intact skin and the diffusion through the hair channels) was assessed. All experiments were done using radioactive tracers. Experimental arrangement consisted of Franz-type vertical permeation cells used with fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), respectively. 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used in full form (intact), and then with decreasing thickness of horny layer after the skin had been stripped with Scotch type (3M) 5-20 times respectively, or the skin was splitted under 60 degC hot water so that the whole epidermis was removed. The penetrated amounts of ions were found to be proportional to the time at least in the first 7 hours. The permeation resistance of the skin is proportional to the thickness of the horny layer, the principal barrier mostly restricting the flux of ions. The more the skin is stripped, the more enhanced is the penetration of ions. This corroborates the fact that stratum corneum represents the most important barrier function of the whole skin (of rats). The additional diffusion through channels along hairs (follicules) can be of important value also in case of human skin where hair density is many times lower than in the case of the animal models used

  7. Defective channels lead to an impaired skin barrier.

    Science.gov (United States)

    Blaydon, Diana C; Kelsell, David P

    2014-10-15

    Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

  8. Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

    International Nuclear Information System (INIS)

    Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

    1985-01-01

    Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

  9. The outcomes of barrier protection in periwound skin and stoma care.

    Science.gov (United States)

    Stephen-Haynes, Jackie

    This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

  10. Lipids and skin barrier function - a clinical perspective

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

    2008-01-01

    The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

  11. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  12. Composite of microgels and lipids as biofilm to restore skin barrier function

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.

    2008-01-01

    The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

  13. Evaluation of a cyanoacrylate dressing to manage peristomal skin alterations under ostomy skin barrier wafers.

    Science.gov (United States)

    Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet

    2011-01-01

    Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.

  14. Cost-effectiveness of a Ceramide-Infused Skin Barrier Versus a Standard Barrier

    Science.gov (United States)

    Berger, Ariel; Inglese, Gary; Skountrianos, George; Karlsmark, Tonny; Oguz, Mustafa

    2018-01-01

    PURPOSE: To assess the cost-effectiveness of a ceramide-infused skin barrier (CIB) versus other skin barriers (standard of care) among patients who have undergone ostomy creation. DESIGN: Cost-effectiveness analysis, based on a decision-analytic model that was estimated using data from the ADVOCATE (A Study Determining Variances in Ostomy Skin Conditions And The Economic Impact) trial, which investigated stoma-related healthcare costs over 12 weeks among patients who recently underwent fecal ostomy, and from other sources. SUBJECTS AND SETTING: Analysis was based on a hypothetical cohort of 1000 patients who recently underwent fecal ostomy; over a 1-year period, 500 patients were assumed to use CIB and 500 were assumed to use standard of care. METHODS: We adapted a previous economic model to estimate expected 1-year costs and outcomes among persons with a new ostomy assumed to use CIB versus standard of care. Outcomes of interest included peristomal skin complications (PSCs) (up to 2 during the 1-year period of interest) and quality-adjusted life days (QALDs); QALDs vary from 1, indicating a day of perfect health to 0, indicating a day with the lowest possible health (deceased). Subjects were assigned QALDs on a daily basis, with the value of the QALD on any given day based on whether the patient was experiencing a PSC. Costs included those related to skin barriers, ostomy accessories, and care of PSCs. The incremental cost-effectiveness of CIB versus standard of care was estimated as the incremental cost per PSC averted and QALD gained, respectively; net monetary benefit of CIB was also estimated. All analyses were run using the perspective of an Australian payer. RESULTS: On a per-patient basis, use of CIB was expected over a 1-year period to result in 0.16 fewer PSCs, an additional 0.35 QALDs, and a savings of A$180 (Australian dollars, US $137) in healthcare costs all versus standard of care. Management with CIB provided a net monetary benefit (calculated as

  15. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Skin allografts in lethally irradiated animals repopulated with syngeneic hemopoietic cells

    International Nuclear Information System (INIS)

    Schwadron, R.B.

    1983-01-01

    Total body irradiation and repopulation with syngeneic hemopoietic cells can be used to induce tolerance to major histocompatibility complex (MHC) mismatched heart and kidney grafts in rats and mice. However, this protocol does not work for MHC mismatched skin grafts in rats or mice. Furthermore, LEW rats that accept WF cardiac allografts after irradiation and repopulation reject subsequent WF skin grafts. Treatment of skin allograft donors with methotrexate prior to grafting onto irradiated and reconstituted mice resulted in doubling of the mean survival time. Analysis of which antigens provoked skin graft rejection by irradiation and reconstituted animals revealed the importance of I region antigens. Cardiac allograft acceptance by irradiated and reconstituted animals is mediated by suppressor cells found in the spleen. Adoptively tolerant LEW rats accepted WF skin grafts in 50% of grafted animals. Analysis of this phenomenon revealed that the adoptive transfer procedure itself was important in achieving skin allograft acceptance by these animals. In general, it seems that the lack of ability of irradiated and reconstituted animals to accept fully MHC disparate skin grafts results from the inability of these animals to suppress lymph node effector cells against I region antigen seen on highly immunogenic allogeneic Langerhans cells in the skin

  17. Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

    NARCIS (Netherlands)

    den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

    2008-01-01

    The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

  18. Atopic dermatitis-like disease and associated lethal myeloproliferative disorder arise from loss of Notch signaling in the murine skin.

    Directory of Open Access Journals (Sweden)

    Alexis Dumortier

    2010-02-01

    Full Text Available The Notch pathway is essential for proper epidermal differentiation during embryonic skin development. Moreover, skin specific loss of Notch signaling in the embryo results in skin barrier defects accompanied by a B-lymphoproliferative disease. However, much less is known about the consequences of loss of Notch signaling after birth.To study the function of Notch signaling in the skin of adult mice, we made use of a series of conditional gene targeted mice that allow inactivation of several components of the Notch signaling pathway specifically in the skin. We demonstrate that skin-specific inactivation of Notch1 and Notch2 simultaneously, or RBP-J, induces the development of a severe form of atopic dermatitis (AD, characterized by acanthosis, spongiosis and hyperkeratosis, as well as a massive dermal infiltration of eosinophils and mast cells. Likewise, patients suffering from AD, but not psoriasis or lichen planus, have a marked reduction of Notch receptor expression in the skin. Loss of Notch in keratinocytes induces the production of thymic stromal lymphopoietin (TSLP, a cytokine deeply implicated in the pathogenesis of AD. The AD-like associated inflammation is accompanied by a myeloproliferative disorder (MPD characterized by an increase in immature myeloid populations in the bone marrow and spleen. Transplantation studies revealed that the MPD is cell non-autonomous and caused by dramatic microenvironmental alterations. Genetic studies demontrated that G-CSF mediates the MPD as well as changes in the bone marrow microenvironment leading to osteopenia.Our data demonstrate a critical role for Notch in repressing TSLP production in keratinocytes, thereby maintaining integrity of the skin and the hematopoietic system.

  19. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    Directory of Open Access Journals (Sweden)

    Magdalena Boer

    2016-02-01

    Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  20. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    ) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

  1. Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

    Science.gov (United States)

    Egawa, Gyohei; Kabashima, Kenji

    2016-08-01

    Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  2. Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.

    Science.gov (United States)

    Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

    2010-08-13

    Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

  3. Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

    Directory of Open Access Journals (Sweden)

    Hyosun Jang

    2018-01-01

    Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

  4. Clinical spectrum of females with HCCS mutation: from no clinical signs to a neonatal lethal form of the microphthalmia with linear skin defects (MLS) syndrome

    NARCIS (Netherlands)

    van Rahden, V.A.; Rau, I.; Fuchs, S.; Kosyna, F.K.; de Almeida, H.L.; Fryssira, H.; Isidor, B.; Jauch, A.; Joubert, M.; Lachmeijer, A.M.A.; Zweier, C.; Moog, U.; Kutsche, K.

    2014-01-01

    Background: Segmental Xp22.2 monosomy or a heterozygous HCCS mutation is associated with the microphthalmia with linear skin defects (MLS) or MIDAS (microphthalmia, dermal aplasia, and sclerocornea) syndrome, an X-linked disorder with male lethality. HCCS encodes the holocytochrome c-type synthase

  5. Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery

    Science.gov (United States)

    Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.

    2010-01-01

    Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044

  6. Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

    Science.gov (United States)

    Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

    2014-01-01

    We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

  7. Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

    Science.gov (United States)

    Kawano, Ken-Ichi; Umemura, Kazuo

    2013-05-01

    The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

    NARCIS (Netherlands)

    Bogaard, E.H. van den; Bergboer, J.G.M.; Vonk-Bergers, M.; Vlijmen-Willems, I.M. van; Hato, S.V.; Valk, P.G. van der; Schroder, J.M.; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

    2013-01-01

    Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte-mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular

  10. Effects of industrial detergents on the barrier function of human skin

    DEFF Research Database (Denmark)

    Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

    2000-01-01

    Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

  11. Skin barrier properties in patients with recessive X-linked ichthyosis

    DEFF Research Database (Denmark)

    Johansen, J D; Ramsing, D; Vejlsgaard, G

    1995-01-01

    Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

  12. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin

    NARCIS (Netherlands)

    Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

    2009-01-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which

  13. Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science.

    Science.gov (United States)

    Vaughn, Alexandra R; Clark, Ashley K; Sivamani, Raja K; Shi, Vivian Y

    2018-02-01

    Natural plant oils are commonly used as topical therapy worldwide. They are usually easily accessible and are relatively inexpensive options for skin care. Many natural oils possess specific compounds with antimicrobial, antioxidant, anti-inflammatory, and anti-itch properties, making them attractive alternative and complementary treatments for xerotic and inflammatory dermatoses associated with skin-barrier disruption. Unique characteristics of various oils are important when considering their use for topical skin care. Differing ratios of essential fatty acids are major determinants of the barrier repair benefits of natural oils. Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential, whereas oils with higher amounts of irritating oleic acid may be detrimental to skin-barrier function. Various extraction methods for oils exist, including cold pressing to make unrefined oils, heat and chemical distillation to make essential oils, and the addition of various chemicals to simulate a specific scent to make fragranced oils. The method of oil processing and refinement is an important component of selecting oil for skin care, and cold pressing is the preferred method of oil extraction as the heat- and chemical-free process preserves beneficial lipids and limits irritating byproducts. This review summarizes evidence on utility of natural plant-based oils in dermatology, particularly in repairing the natural skin-barrier function, with the focus on natural oils, including Olea europaea (olive oil), Helianthus annus (sunflower seed oil), Cocos nucifera (coconut oil), Simmondsia chinesis (jojoba oil), Avena sativa (oat oil), and Argania spinosa (argan oil).

  14. Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

    Science.gov (United States)

    Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

    2000-08-01

    The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

  15. Mechanism for initiation of food allergy: Dependence on skin barrier mutations and environmental allergen costimulation.

    Science.gov (United States)

    Walker, Matthew T; Green, Jeremy E; Ferrie, Ryan P; Queener, Ashley M; Kaplan, Mark H; Cook-Mills, Joan M

    2018-02-15

    Mechanisms for the development of food allergy in neonates are unknown but clearly linked in patient populations to a genetic predisposition to skin barrier defects. Whether skin barrier defects contribute functionally to development of food allergy is unknown. The purpose of the study was to determine whether skin barrier mutations, which are primarily heterozygous in patient populations, contribute to the development of food allergy. Mice heterozygous for the filaggrin (Flg) ft and Tmem79 ma mutations were skin sensitized with environmental and food allergens. After sensitization, mice received oral challenge with food allergen, and then inflammation, inflammatory mediators, and anaphylaxis were measured. We define development of inflammation, inflammatory mediators, and food allergen-induced anaphylaxis in neonatal mice with skin barrier mutations after brief concurrent cutaneous exposure to food and environmental allergens. Moreover, neonates of allergic mothers have increased responses to suboptimal sensitization with food allergens. Importantly, responses to food allergens by these neonatal mice were dependent on genetic defects in skin barrier function and on exposure to environmental allergens. ST2 blockade during skin sensitization inhibited the development of anaphylaxis, antigen-specific IgE, and inflammatory mediators. Neonatal anaphylactic responses and antigen-specific IgE were also inhibited by oral pre-exposure to food allergen, but interestingly, this was blunted by concurrent pre-exposure of the skin to environmental allergen. These studies uncover mechanisms for food allergy sensitization and anaphylaxis in neonatal mice that are consistent with features of human early-life exposures and genetics in patients with clinical food allergy and demonstrate that changes in barrier function drive development of anaphylaxis to food allergen. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  16. Physiological and Molecular Effects of in vivo and ex vivo Mild Skin Barrier Disruption.

    Science.gov (United States)

    Pfannes, Eva K B; Weiss, Lina; Hadam, Sabrina; Gonnet, Jessica; Combardière, Béhazine; Blume-Peytavi, Ulrike; Vogt, Annika

    2018-01-01

    The success of topically applied treatments on skin relies on the efficacy of skin penetration. In order to increase particle or product penetration, mild skin barrier disruption methods can be used. We previously described cyanoacrylate skin surface stripping as an efficient method to open hair follicles, enhance particle penetration, and activate Langerhans cells. We conducted ex vivo and in vivo measurements on human skin to characterize the biological effect and quantify barrier disruption-related inflammation on a molecular level. Despite the known immunostimulatory effects, this barrier disruption and hair follicle opening method was well accepted and did not result in lasting changes of skin physiological parameters, cytokine production, or clinical side effects. Only in ex vivo human skin did we find a discrete increase in IP-10, TGF-β, IL-8, and GM-CSF mRNA. The data underline the safety profile of this method and demonstrate that the procedure per se does not cause substantial inflammation or skin damage, which is also of interest when applied to non-invasive sampling of biomarkers in clinical trials. © 2018 S. Karger AG, Basel.

  17. Ion microbeam analysis. Application to the study of the skin barrier and its nano-toxicology

    International Nuclear Information System (INIS)

    Simon, M.

    2009-12-01

    This work is dedicated to the use of ion microbeam irradiation to the study of a complex biological tissue like skin. Up to now, it has been very difficult to detect and track metallic oxides and manufactured nano-particles in biological tissues, most particularly in skin. Thus, it is essential to precise the mechanisms involved in skin barrier function processes face to exogenous agents like nano-particles and to characterize them in biological models in vitro/in vivo. During my work, I have had the opportunity to combine quantitative methods of analysis with high resolution imagery techniques (confocal microscopy, transmission electron microscopy and ion beam analysis) in order to characterize: (i) the skin barrier function of an ex vivo pig ear skin model understanding the ion homeostasis behavior face to different chemical or physical stresses; (ii) the impact on viability, accumulation and intracellular distribution of nano-particles (Titanium Oxides) naked or functionalized with fluorescent dyes (FITC, Rhodamine)

  18. Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

    Science.gov (United States)

    Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

    2004-03-01

    Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

  19. Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

    Science.gov (United States)

    Draelos, Zoe D

    2005-01-01

    The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

  20. The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

    Science.gov (United States)

    Draelos, Zoe D

    2006-07-01

    Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

  1. Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

    Science.gov (United States)

    Chaudhuri, R K; Bojanowski, K

    2017-10-01

    The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  2. Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

    DEFF Research Database (Denmark)

    Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

    2010-01-01

    chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

  3. A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

    Science.gov (United States)

    Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

    2016-10-01

    Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

  4. Enhancement of percutaneous penetration of aniline and o-toluidine in vitro using skin barrier creams.

    Science.gov (United States)

    Korinth, Gintautas; Lüersen, Lars; Schaller, Karl Heinz; Angerer, Jürgen; Drexler, Hans

    2008-04-01

    Aniline (ANI) and the human carcinogen o-toluidine (OT) are released at the workplace during the production and processing of rubber. Recently, we showed in rubber industry workers that a frequent use of skin barrier creams (SBC) increased the internal exposure of ANI and OT. In the present study, diffusion cells were used to investigate the effects of two SBC and one skin care cream (SCC) on percutaneous penetration of neat ANI and OT as well as of OT from a mixture with a workplace specific lubricant. The experiments were carried out with untreated and with skin creams treated human skin. A considerable percutaneous penetration enhancement of test compounds was observed for treated skin compared with untreated skin; the highest enhancement (mean factors 6.2-12.3) was found for SBC (based on oil in water emulsion) treated skin. The lowest penetration enhancement showed SCC treated skin (mean factors 4.2-9.7). The in vitro data support our findings in workers that the percutaneous absorption of aromatic amines significantly increases in presence of skin creams. The efficacy of skin creams to protect the percutaneous penetration of aromatic amines is not confirmed by our own experiments.

  5. Permeability Barrier and Microstructure of Skin Lipid Membrane Models of Impaired Glucosylceramide Processing

    OpenAIRE

    Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina

    2017-01-01

    Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...

  6. Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.

    Science.gov (United States)

    Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M

    2016-07-01

    The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Controlling the hydration of the skin though the application of occluding barrier creams.

    Science.gov (United States)

    Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard

    2013-03-06

    The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.

  8. Skin barrier properties in patients with recessive X-linked ichthyosis

    DEFF Research Database (Denmark)

    Johansen, J D; Ramsing, D; Vejlsgaard, G

    1995-01-01

    increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...

  9. Skin Barrier Restoration and Moisturization Using Horse Oil-Loaded Dissolving Microneedle Patches.

    Science.gov (United States)

    Lee, Chisong; Eom, Younghyon Andrew; Yang, Huisuk; Jang, Mingyu; Jung, Sang Uk; Park, Ye Oak; Lee, Si Eun; Jung, Hyungil

    2018-01-01

    Horse oil (HO) has skin barrier restoration and skin-moisturizing effects. Although cream formulations have been used widely and safely, their limited penetration through the stratum corneum is a major obstacle to maximizing the cosmetic efficacy of HO. Therefore, we aimed to encapsulate HO in a cosmetic dissolving microneedle (DMN) for efficient transdermal delivery. To overcome these limitations of skin permeation, HO-loaded DMN (HO-DMN) patches were developed and evaluated for their efficacy and safety using in vitro and clinical studies. Despite the lipophilic nature of HO, the HO-DMN patches had a sharp shape and uniform array, with an average length and tip diameter of 388.36 ± 16.73 and 38.54 ± 5.29 µm, respectively. The mechanical strength of the HO-DMN patches was sufficient (fracture force of 0.29 ± 0.01 N), and they could successfully penetrate pig skin. During the 4-week clinical evaluation, HO-DMN patches caused significant improvements in skin and dermal density, skin elasticity, and moisturization. Additionally, a brief safety assessment showed that the HO-DMN patches induced negligible adverse events. The HO-DMNs are efficient, safe, and convenient for wide use in cosmetic applications for skin barrier restoration and moisturization. © 2018 S. Karger AG, Basel.

  10. Abnormal sensitivity of diploid skin fibroblasts from a family with Gardner's syndrome to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C

    International Nuclear Information System (INIS)

    Little, J.B.; Nove, J.; Weichselbaum, R.R.

    1980-01-01

    Skin fibroblasts isolated from two members of the same family with the cancer-prone disease Gardner's Syndrome (intestinal polyposis, colon cancer, bone and soft tissue tumors) showed enhanced sensitivity to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C. These cells showed no liquid-holding type recovery following UV-irradiation of confluent cultures, but were normal in their capacity for UV-induced unscheduled DNA synthesis. UV survival was not influenced by post-irradiation incubation with caffeine. (orig.)

  11. Effect of olive and sunflower seed oil on the adult skin barrier: implications for neonatal skin care.

    Science.gov (United States)

    Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J

    2013-01-01

    Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research. © 2012 Wiley Periodicals, Inc.

  12. Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2017-12-01

    Full Text Available Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter. Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

  13. Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils.

    Science.gov (United States)

    Lin, Tzu-Kai; Zhong, Lily; Santiago, Juan Luis

    2017-12-27

    Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter). Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

  14. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier.

    Directory of Open Access Journals (Sweden)

    Jes Dreier

    Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.

  15. Metabolic and redox barriers in the skin exposed to drugs and xenobiotics.

    Science.gov (United States)

    Korkina, Liudmila

    2016-01-01

    Growing exposure of human skin to environmental and occupational hazards, to numerous skin care/beauty products, and to topical drugs led to a biomedical concern regarding sustainability of cutaneous chemical defence that is essential for protection against intoxication. Since skin is the largest extra-hepatic drug/xenobiotic metabolising organ where redox-dependent metabolic pathways prevail, in this review, publications on metabolic processes leading to redox imbalance (oxidative stress) and its autocrine/endocrine impact to cutaneous drug/xenobiotic metabolism were scrutinised. Chemical and photo-chemical skin barriers contain metabolic and redox compartments: their protective and homeostatic functions. The review will examine the striking similarity of adaptive responses to exogenous chemical/photo-chemical stressors and endogenous toxins in cutaneous metabolic and redox system; the role(s) of xenobiotics/drugs and phase II enzymes in the endogenous antioxidant defence and maintenance of redox balance; redox regulation of interactions between metabolic and inflammatory responses in skin cells; skin diseases sharing metabolic and redox problems (contact dermatitis, lupus erythematosus, and vitiligo) Due to exceptional the redox dependence of cutaneous metabolic pathways and interaction of redox active metabolites/exogenous antioxidants with drug/xenobiotic metabolism, metabolic tests of topical xenobiotics/drugs should be combined with appropriate redox analyses and performed on 3D human skin models.

  16. Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

    Directory of Open Access Journals (Sweden)

    Tzu-Kai Lin

    2015-06-01

    Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

  17. Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

    Science.gov (United States)

    Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

    2009-08-01

    The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

  18. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  19. The effects of using a moldable skin barrier on peristomal skin condition in persons with an ostomy: results of a prospective, observational, multinational study.

    Science.gov (United States)

    Szewczyk, Maria Teresa; Majewska, Grazyna; Cabral, Mary V; Hölzel-Piontek, Karin

    2014-12-01

    Peristomal skin problems are the most commonly experienced physical complication following ostomy surgery and often are caused by leakage or a poorly fitting skin barrier. A prospective, multicenter, observational evaluation of persons with a colostomy, ileostomy, or urostomy was conducted to assess the incidence of peristomal lesions and level of patient satisfaction with moldable skin barriers. Peristomal skin was assessed using the Studio Alterazoni Cutanee Stomale (SACS™) scale, and patients were asked to rate barrier application and usage variables. During a period of 12 months, and using convenience sampling, 561 patients from 90 centers in 3 countries were enrolled: 28 in Germany, 48 in Poland, and 14 in the United States. Participants included 277 new stoma patients (average time since surgery 0.3 months; average age 64.7 ± 12.86 years) who had a colostomy (174), ileostomy (72), or urostomy (10); and 284 patients with an existing stoma (average time since surgery 18.2 months; average age 66 ± 12.62 years) who had a colostomy (174), ileostomy (88), or urostomy (22) who experienced skin complications using a traditional skin barrier (ie, a solid or flexible barrier with precut opening or one requiring cutting an opening to accommodate the stoma). All patients were assessed at baseline and after 1 and 2 months. In the patients with a new stoma, 225 (90.4%) had intact skin at baseline, 239 (95.6%) had intact skin after 2 months, and 98% rated overall satisfaction with the barrier as good or excellent. In the patients with an existing stoma, intact skin was observed in 103 patients (39.5%) at baseline and 225 (86.2%) after 2 months, with 96.5% of patients rating overall satisfaction with the barrier as good or excellent. In this group, the proportion of patients who used accessory products (eg, belt, deodorants, powder) was 73% at baseline and 64.2% at the 2-month follow-up. The moldable skin barriers evaluated were effective in preventing and healing

  20. Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study.

    Science.gov (United States)

    Hahnel, Elisabeth; Blume-Peytavi, Ulrike; Trojahn, Carina; Kottner, Jan

    2017-11-13

    Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Mean age (n = 223) was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%). The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%), of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2%) and of skin tears 6.3% (95% CI: 3.2% - 9.5%). Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis have been detected, that might limit the diagnostic value of skin

  1. Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study

    Directory of Open Access Journals (Sweden)

    Elisabeth Hahnel

    2017-11-01

    Full Text Available Abstract Background Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. Methods This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Results Mean age (n = 223 was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%. The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%, of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2% and of skin tears 6.3% (95% CI: 3.2% - 9.5%. Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Conclusion Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis

  2. Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

    Science.gov (United States)

    Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

    2018-04-24

    In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

  3. The role of social closeness during tape stripping to facilitate skin barrier recovery: Preliminary findings.

    Science.gov (United States)

    Robinson, Hayley; Ravikulan, Abhimati; Nater, Urs M; Skoluda, Nadine; Jarrett, Paul; Broadbent, Elizabeth

    2017-07-01

    Social support is known to reduce the negative effects of stress on health, but there is mixed evidence for the effects of social support on wound healing. This study aimed to investigate whether undergoing a task designed to promote social closeness with a fellow participant and being paired with that person during a tape-stripping procedure could reduce stress and improve skin barrier recovery compared to going through tape stripping alone. Seventy-two healthy adults were randomized to either a social closeness condition where participants completed a relationship-building task and tape stripping in pairs or a control condition where they completed tape stripping alone. Skin barrier recovery was measured using transepidermal water loss. Salivary cortisol and alpha-amylase were collected at four time points as markers of the endocrine and autonomic stress response. Social closeness had a beneficial effect on skin barrier recovery compared to the control condition, t(54) = 2.86, p = .006, r = .36. Social closeness significantly reduced self-reported stress. The effects of the intervention on skin barrier recovery were moderated by self-reported stress reduction (p = .035). There were no significant differences in cortisol between groups, but alpha-amylase increased significantly more from baseline to after tape stripping in the control group compared to the intervention group. This is the first study to show that social closeness with a person going through a similar unfamiliar procedure can positively influence wound healing. Future research needs to replicate these findings in other wound types and in clinical settings. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  4. Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

    Science.gov (United States)

    Ohno, Yusuke

    2017-01-01

    The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

  5. Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

    Directory of Open Access Journals (Sweden)

    Reiko J Tanaka

    Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

  6. Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

    OpenAIRE

    Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

    2008-01-01

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

  7. Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

    Science.gov (United States)

    Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

    2017-08-01

    Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Thiolated silicone oils as adhesive skin protectants for improved barrier function.

    Science.gov (United States)

    Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

    2016-06-01

    The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  9. Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

    Science.gov (United States)

    Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

    2012-01-01

    Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

  10. Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

    Science.gov (United States)

    Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

    2013-11-01

    The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

    Science.gov (United States)

    Kubota, Takahiro

    2012-06-01

    Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

  12. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

    NARCIS (Netherlands)

    Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

    2005-01-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

  13. Nanocrystal: a novel approach to overcome skin barriers for improved topical drug delivery.

    Science.gov (United States)

    Patel, Viral; Sharma, Om Prakash; Mehta, Tejal

    2018-04-01

    Skin is an important route of drug delivery for the treatment of various dermatological conditions. The advent of nanotechnology is paving the roadmaps for topical drug delivery by providing sustained release as well as maintaining a localized effect, outweighing the toxicity concern. Area covered: This review highlighted the morphology of skin, its barrier nature as well as drug penetration pathways after topical application of formulations. The existing methods to improve topical drug delivery, by infringing or permeating the skin barriers, are discussed. This context concretes the foundation to accentuate the need for the development of nanocrystal-based topical formulation. The mechanism of drug release, immediate as well as sustained release, after topical administration of drug nanocrystals is also elaborated. The special emphasis is given on the breakthrough achieved, in topical drug delivery using drug nanocrystals, so far in the plethora of literature, patents, and products, under clinical trial as well as in the market. Expert opinion: The current research on nanocrystals for topical drug delivery is highlighting the breakthroughs achieved so far. The output of these research envisages that topical nanocrystals based formulations can be a novel strategy for the drugs which are facing solubility, bioavailability and toxicity concerns.

  14. Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

    Science.gov (United States)

    Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

    2017-01-01

    Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

  15. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  16. Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

    Science.gov (United States)

    Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

    2008-11-15

    Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

  17. Skin barrier integrity and natural moisturising factor levels after cumulative dermal exposure to alkaline agents in atopic dermatitis

    NARCIS (Netherlands)

    Angelova-Fischer, Irena; Dapic, Irena; Hoek, Anne-Karin; Jakasa, Ivone; Fischer, Tobias W.; Zillikens, Detlef; Kezic, Sanja

    2014-01-01

    Dermal exposure to alkaline agents may lead to skin barrier damage and irritant contact dermatitis. The objective of this study was to investigate the effects of cumulative exposure to 0.5% sodium lauryl sulphate (SLS) and 0.15% NaOH on the barrier function and natural moisturising factor (NMF)

  18. Examination of the skin barrier repair/wound healing process using a living skin equivalent model and matrix-assisted laser desorption-ionization-mass spectrometry imaging.

    Science.gov (United States)

    Lewis, E E L; Barrett, M R T; Freeman-Parry, L; Bojar, R A; Clench, M R

    2018-04-01

    Examination of the skin barrier repair/wound healing process using a living skin equivalent (LSE) model and matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI) to identify lipids directly involved as potential biomarkers. These biomarkers may be used to determine whether an in vivo wound is going to heal for example if infected. An in vitro LSE model was wounded with a scalpel blade and assessed at day 4 post-wounding by histology and MALDI-MSI. Samples were sectioned at wound site and were either formalin-fixed paraffin-embedded (FFPE) for histology or snapped frozen (FF) for MSI analysis. The combination of using an in vitro wounded skin model with MSI allowed the identification of lipids involved in the skin barrier repair/wound healing process. The technique was able to highlight lipids directly in the wound site and distinguish differences in lipid distribution between the epidermis and wound site. This novel method of coupling an in vitro LSE with MSI allowed in-depth molecular analysis of the skin barrier repair/wound healing process. The technique allowed the identification of lipids directly involved in the skin barrier repair/wound healing process, indicating these biomarkers may be potentially be used within the clinic. These biomarkers will help to determine, which stage of the skin barrier repair/wound healing process the wound is in to provide the best treatment. © 2018 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  19. Effects of UVA (320-400 nm) on the barrier characteristics of the skin

    International Nuclear Information System (INIS)

    McAuliffe, D.J.; Blank, I.H.

    1991-01-01

    The stratum corneum serves as the major barrier to the entrance of most molecules into the skin. In the studies presented here, the effects of UVA radiation (320-400 nm) on the barrier capacity of human stratum corneum were examined. Penetration of a homologous series of primary alcohols through unirradiated (control) and UVA-irradiated (test) human epidermis was determined in vitro. Permeability constants, kp, were calculated. Mean ratios of permeability constants for UVA-irradiated and unirradiated epidermis (mean kp test)/(mean kp control) ranged from 2.3 to 3.0 for methanol and from 2.2 to 2.5 for ethanol. These mean ratios were determined using different pieces of epidermis from the same piece of skin for test and control samples. When kp control and kp test were determined on the same piece of epidermis on successive days, the ratios (kp test/kp control) were similar to the mean ratios determined on different pieces of epidermis. For other primary alcohols, propanol, butanol, hexanol, and heptanol, UVA radiation did not alter their permeability constants significantly. Partition coefficients, Km, were determined for ethanol and heptanol using UVA-irradiated and unirradiated stratum corneum. For ethanol, irradiation resulted in a 1.5 to 2.6 times increase in Km. For heptanol, irradiation caused no change in Km. These results demonstrate that the barrier capacity of stratum corneum for small, polar, primary alcohols is diminished (permeability increases) and for higher molecular weight less polar alcohols, is unaffected by small doses of UVA radiation. This increased permeability of small polar alcohols through human skin may be due to enhanced partitioning into UVA-irradiated stratum corneum, which was not apparent for a higher molecular weight less polar alcohol

  20. Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

    Science.gov (United States)

    Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

    2017-12-01

    Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

  1. Efficacy of a Hand Regimen in Skin Barrier Protection in Individuals With Occupational Irritant Contact Dermatitis.

    Science.gov (United States)

    Jordan, Laura

    2016-11-01

    Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..

  2. Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

    Science.gov (United States)

    Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

    2017-02-08

    Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

  3. NANODERM. Quality of skin as a barrier to ultra-fine particles

    International Nuclear Information System (INIS)

    Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.

    2007-01-01

    ultra-fine particles on healthy skin. On the other hand, micronised titanium-dioxide particles are internalized by melanocytes and fibroblasts in cell culture. Particles disturb cell viability and proliferation as well as keratinocyte differentiation. Outlook Although this EU project has ended, there are still several questions to be answered. In view of the cellular effects, we are currently investigating the penetration of nanosized particles into skin with impaired barrier function. Long term exposure studies are also required

  4. Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

    Science.gov (United States)

    van Smeden, Jeroen; Bouwstra, Joke A

    2016-01-01

    Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

  5. Emu oil-based lotion effects on neonatal skin barrier during transition from intrauterine to extrauterine life

    Directory of Open Access Journals (Sweden)

    Zanardo V

    2017-08-01

    Full Text Available Vincenzo Zanardo,1 David Giarrizzo,2 Francesca Volpe,1 Lara Giliberti,1 Gianluca Straface1 1Division of Perinatal Medicine, Policlinico Abano Terme, Abano Terme, 2CALANTHA Physiology of Lactation Laboratory, Padua, Italy Abstract: Both appropriate hydration and skin surface pH are fundamental in preventing baby skin barrier damage during transition from intrauterine to extrauterine life. However, effects of topical moisturizers on neonatal stratum corneum temperature, pH, hydration, and elasticity have not been scientifically evaluated in vivo. We checked 31 full-term breastfeeding neonates by non-invasive bioengineering method, which is able to evaluate the basal skin barrier (left heel, and assessed at 6±1 hours after birth, and at 1 and 24 hours after emu oil-based topical treatment. The basal skin barrier of right heel (no oil exposure of each newborn was considered as control. We found that a single application of an emu oil-based lotion was effective in improving heel stratum corneum hydration, which increases both skin pH and elasticity without any effect on temperature. Further studies are needed to confirm long-term beneficial effects of this treatment in a very sensitive patient population. Keywords: skin barrier, neonate, emu oil-based lotion, topical treatment

  6. Microspectroscopic Confocal Raman and Macroscopic Biophysical Measurements in the in vivo Assessment of the Skin Barrier: Perspective for Dermatology and Cosmetic Sciences

    NARCIS (Netherlands)

    Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van

    2015-01-01

    Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual

  7. Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

    Science.gov (United States)

    Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

    2016-09-01

    Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

  8. Barreira cutânea na dermatite atópica Skin barrier in atopic dermatitis

    Directory of Open Access Journals (Sweden)

    Flavia Alvim Sant'Anna Addor

    2010-04-01

    Full Text Available O estudo da barreira cutânea e de suas propriedades ganhou impulso a partir da década de 60, com estudos que apontaram sua resistência de forma isolada e suas propriedades com relação à permeação cutânea. Paralelamente, a descrição dos corpos de Odland auxiliou a compreensão da manutenção da estabilidade da camada córnea. O modelo brick & mortar, em que os corneócitos são os tijolos e o cimento são os lipídeos intercelulares, é o mais aceito, até o momento. Atualmente, há evidências consistentes de que o estrato córneo é uma estrutura metabolicamente ativa e exerce funções adaptativas. A barreira cutânea também tem um papel na resposta inflamatória, com ativação de melanócitos, angiogênese e fibroplasia, cuja intensidade depende, basicamente, da intensidade da agressão. As anormalidades da barreira cutânea da dermatite atópica são clinicamente observáveis pela presença de pele seca, achado muito frequente e significativo, que constitui parâmetro iagnóstico e de acompanhamento. O grau de hidratação da camada córnea, assim como a perda de água transepidérmica (transepidermal water loss - TEWL, estão relacionados com o grau de dano à barreira, constituindo parâmetros biofísicos que permitem acompanhar os pacientes de maneira não invasiva e com maior grau de sensibilidade.Research about the skin barrier and its properties has increased significantly since the 60s, with studies that indicated its resistance when isolated, as well as its particularities in relation to skin permeability. At the same time, description of Odland bodies helped to understand how stratum corneum stability is maintained. The “brick and mortarâ€� model is the most accepted so far. In this analogy, the corneocytes are the bricks and the intercellular lipids are the mortar. Currently, there is concrete evidence that the stratum corneum is an active metabolic structure that holds adaptive functions, interacting

  9. [Basic therapeutics : What are the features of modern personal care products to protect and regenerate the skin barrier?

    Science.gov (United States)

    Daniels, R

    2017-11-01

    It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.

  10. Loss of Corneodesmosin Leads to Severe Skin Barrier Defect, Pruritus, and Atopy: Unraveling the Peeling Skin Disease

    OpenAIRE

    Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

    2010-01-01

    Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disea...

  11. Oral administration of Bifidobacterium breve attenuates UV-induced barrier perturbation and oxidative stress in hairless mice skin.

    Science.gov (United States)

    Ishii, Yuki; Sugimoto, Saho; Izawa, Naoki; Sone, Toshiro; Chiba, Katsuyoshi; Miyazaki, Kouji

    2014-07-01

    Recent studies have shown that some probiotics affect not only the gut but also the skin. However, the effects of probiotics on ultraviolet (UV)-induced skin damage are poorly understood. In this study, we aim to examine whether oral administration of live Bifidobacterium breve strain Yakult (BBY), a typical probiotic, can attenuate skin barrier perturbation caused by UV and reactive oxygen species (ROS) in hairless mice. The mice were orally supplemented with a vehicle only or BBY once a day for nine successive days. Mouse dorsal skin was irradiated with UV from days 6 to 9. The day after the final irradiation, the transepidermal water loss (TEWL), stratum corneum hydration, and oxidation-related factors of the skin were evaluated. We elucidated that BBY prevented the UV-induced increase in TEWL and decrease in stratum corneum hydration. In addition, BBY significantly suppressed the UV-induced increase in hydrogen peroxide levels, oxidation of proteins and lipids, and xanthine oxidase activity in the skin. Conversely, antioxidant capacity did not change regardless of whether BBY was administered or not. In parameters we evaluated, there was a positive correlation between the increase in TEWL and the oxidation levels of proteins and lipids. Our results suggest that oral administration of BBY attenuates UV-induced barrier perturbation and oxidative stress of the skin, and this antioxidative effect is not attributed to enhancement of antioxidant capacity but to the prevention of ROS generation.

  12. Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

    Science.gov (United States)

    Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

    2005-10-01

    The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

  13. The Tritiated Water Skin Barrier Integrity Test: Considerations for Acceptance Criteria with and Without 14C-Octanol.

    Science.gov (United States)

    Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J

    2017-01-01

    A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.

  14. Measurement of transepidermal water loss (TEWL) in cats with experimental skin barrier dysfunction using a closed chamber system.

    Science.gov (United States)

    Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori

    2016-10-01

    A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.

  15. The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

    Science.gov (United States)

    Del Rosso, James Q; Kircik, Leon H

    2013-07-01

    Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

  16. A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

    Science.gov (United States)

    Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

    2015-08-01

    The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

  17. Structural modification of the skin barrier by OH radicals: a reactive molecular dynamics study for plasma medicine

    International Nuclear Information System (INIS)

    Van der Paal, J; Verlackt, C C; Yusupov, M; Neyts, E C; Bogaerts, A

    2015-01-01

    While plasma treatment of skin diseases and wound healing has been proven highly effective, the underlying mechanisms, and more generally the effect of plasma radicals on skin tissue, are not yet completely understood. In this paper, we perform ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of plasma generated OH radicals with a model system composed of free fatty acids, ceramides, and cholesterol molecules. This model system is an approximation of the upper layer of the skin (stratum corneum). All interaction mechanisms observed in our simulations are initiated by H-abstraction from one of the ceramides. This reaction, in turn, often starts a cascade of other reactions, which eventually lead to the formation of aldehydes, the dissociation of ceramides or the elimination of formaldehyde, and thus eventually to the degradation of the skin barrier function. (paper)

  18. Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

    Science.gov (United States)

    Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

    2018-04-26

    Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

  19. Effect of Fluid Intake on Hydration Status and Skin Barrier Characteristics in Geriatric Patients: An Explorative Study.

    Science.gov (United States)

    Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan

    2018-04-03

    Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.

  20. Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

    DEFF Research Database (Denmark)

    Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

    2007-01-01

    12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

  1. Lethal Epistaxis.

    Science.gov (United States)

    Byard, Roger W

    2016-09-01

    Epistaxis or nosebleed refers to bleeding from the nostrils, nasal cavity, or nasopharynx. Occasional cases may present with torrential lethal hemorrhage. Three cases are reported to demonstrate particular features: Case 1: A 51-year-old woman with lethal epistaxis with no obvious bleeding source; Case 2: A 77-year-old man with treated nasopharyngeal carcinoma who died from epistaxis arising from a markedly neovascularized tumor bed; Case 3: A 2-year-old boy with hemophilia B who died from epistaxis with airway obstruction in addition to gastrointestinal bleeding. Epistaxis may be associated with trauma, tumors, vascular malformations, bleeding diatheses, infections, pregnancy, endometriosis, and a variety of different drugs. Careful dissection of the nasal cavity is required to locate the site of hemorrhage and to identify any predisposing conditions. This may be guided by postmortem computerized tomographic angiography (PCTA). Despite careful dissection, however, a source of bleeding may never be identified. © 2016 American Academy of Forensic Sciences.

  2. Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    ) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months...

  3. Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

    Science.gov (United States)

    Törmä, Hans; Lindberg, Magnus; Berne, Berit

    2008-05-01

    Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

  4. Recovery Effects of Oral Administration of Glucosylceramide and Beet Extract on Skin Barrier Destruction by UVB in Hairless Mice

    Directory of Open Access Journals (Sweden)

    Yoshihiro Tokudome

    2017-10-01

    Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.

  5. Permeability of skin and oral mucosa to water and horseradish peroxidase as related to the thickness of the permeability barrier

    International Nuclear Information System (INIS)

    Squier, C.A.; Hall, B.K.

    1985-01-01

    The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material

  6. [Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

    Science.gov (United States)

    Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

    2014-01-01

    Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

  7. From microscopic to macroscopic dynamics in mean-field theory: effect of neutron skin on fusion barrier and dissipation

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, D

    2001-07-01

    In this work, we introduce a method to reduce the microscopic mean-field theory to a classical macroscopic dynamics at the initial stage of fusion reaction. We show that TDHF (Time-dependent Hartree-Fock) could be a useful tool to infer information on the fusion barrier as well as on one-body dissipation effect. We apply the reduction of information to the case of head-on reaction between a {sup 16}O and {sup 16,22,24,28}O in order to quantify the effect of neutron skin on fusion. We show that the precise determination of fusion barrier requires, in addition to the relative distance between center of mass, the introduction of an additional collective coordinate that explicitly breaks the neutron-proton symmetry. With this additional collective variable, we obtain a rather precise determination of the barrier position, height and diffuseness as well as one-body friction. (author)

  8. Female Rats are Less Susceptible during Puberty to Lethal Effects of Percutaneous Exposure to VX

    Science.gov (United States)

    2015-12-17

    lethal dose determination for percutaneous exposure to soman and VX in guinea pigs and the effectiveness of decontamination with M291 SDK or SANDIA...di-isopropylamino) ethyl] methyl phosphonthioate) through pig , human and guinea pig skin in vitro, Toxicol. In Vitro 20 (2006) 1532–1536. [6] R... production and transepidermal water loss [TEWL]) change with age [3,14,15]. As reviewed in Ref. [28], the barrier function of the stratum corneum is

  9. Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier

    DEFF Research Database (Denmark)

    Dreier, Jes; Sørensen, Jens A; Brewer, Jonathan R

    2016-01-01

    In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human...... skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm...... liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers...

  10. The rational design of biomimetic skin barrier lipid formulations using biophysical methods.

    Science.gov (United States)

    Bulsara, P A; Varlashkin, P; Dickens, J; Moore, D J; Rawlings, A V; Clarke, M J

    2017-04-01

    The focus of this communication was to study phospholipid-structured emulsions whose phase behaviour is modified with monoalkyl fatty amphiphiles. Ideally, these systems would mimic key physical and structural attributes observed in human stratum corneum (SC) so that they better alleviate xerotic skin conditions. Phosphatidylcholine-structured emulsions were prepared, and their phase behaviour modified with monoalkyl fatty amphiphiles. The effect of molecular volume, acyl chain length and head-group interactions was studied using a combination of physical methods. Water vapour transmission rate (WVTR) was used as a primary test to assess occlusive character. Changes in the vibrational modes observed in Fourier transform infrared (FTIR) spectroscopy and bilayer spacing measured by X-ray diffraction (XRD) were then applied to elucidate the lateral and lamellar microstructural characteristics in the systems. Water vapour transmission rate demonstrated that as the phosphatidylcholine acyl chain length increased from C14, to C18, to C22, there was a corresponding increase in occlusive character. The addition of monoalkyl fatty amphiphiles such as behenic acid, behenyl alcohol or cetostearyl alcohol to a base formulation incorporating dipalmitoyl and distearoylphosphatidylcholine (C18) was seen to further increase barrier characteristics of the emulsions. FTIR methods used to probe lipid-chain conformational ordering demonstrated that as phosphatidylcholine acyl chain lengths increased, there was a corresponding improvement in acyl chain ordering, with an increase in thermal transition temperatures. The addition of a monoalkyl fatty amphiphile resulted in conformational order and thermal transition temperature improvements trending towards those observed in stratum corneum. FTIR also demonstrated that systems containing behenic acid or behenyl alcohol exhibited features associated with orthorhombic character. X-ray diffraction data showed that addition of monoalkyl fatty

  11. Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

    Science.gov (United States)

    DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

    2012-01-01

    Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

  12. Comfort and microbial barrier properties of garments worn next to the skin

    Science.gov (United States)

    Kopitar, D.; Rogina-Car, B.; Skenderi, Z.

    2017-10-01

    Compared with viscose fibre, modal fibre is characterized by some advantageous properties such as higher dry and wet tenacities, higher wet modulus, lower water retention capacity and lower level of swelling. Impact of different knitted fabric structure made of cotton and 97 % CMD/3 % EL fibres on thermo-physiological comfort and microbial barrier properties were investigated. All knitted fabrics have very good physiological properties. The microbial barrier permeability of knitted fabric after extreme contamination with bacterial spores in dry state showed that double jersey offered more effective microbial barrier than the single jersey knitted fabrics respectively the greater thickness of double jersey knitted fabric provide more difficult barrier to bacterial spores to pass. In wet state all knitted fabrics have more effective microbial barrier which could be explained by cellulose fibres swelling. In wet state 97 % CMD/3 % EL single jersey knitted fabric have more effective microbial barrier then cotton double and single jersey knitted fabrics.

  13. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

    Science.gov (United States)

    Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

    2017-12-18

    The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  14. Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

    Directory of Open Access Journals (Sweden)

    Montserrat Rojo de la Vega

    2017-12-01

    Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

  15. Development of a vernix caseosa substitute : a novel strategy to improve skin barrier function and repair

    NARCIS (Netherlands)

    Rißmann, Robert

    2009-01-01

    Vernix caseosa (VC) is the cheesy, white cream that covers the skin of the human fetus and the newborn. VC is a protective cream, which consists of water containing dead cells that are embedded in lipids. This natural cream is suggested to feature multiple biological functions such as facilitating

  16. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  17. Evaluation of Barrier Skin Cream Effectiveness Against JP-8 Jet Fuel Absorption and Irritation

    Science.gov (United States)

    2009-04-01

    quantify the colorimeter measurements. This system uses spectral chromaticity coordinates and corresponding color- matching functions based on...in the caudal thigh or lumbar muscles and the rabbit was monitored throughout the procedure. Once anesthetized, a baseline visual and colorimeter ...Visual Scoring Technique All barrier creams were scored in 3 ways; by visual scoring described in the Draize method, by colorimeter , and by

  18. Hataedock treatment has preventive therapeutic effects for atopic dermatitis through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice.

    Science.gov (United States)

    Cha, Ho-Yeol; Ahn, Sang-Hyun; Cheon, Jin-Hong; Park, Sun-Young; Kim, Kibong

    2017-07-12

    Hataedock treatment is traditionally used for the purpose of preventing the future skin disease by feeding herbal extracts to the newborn in traditional Chinese and Korean medicine. This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment for atopic dermatitis (AD) through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice. To the HTD treatment group, the extract of Coptis japonica Makino and Glycyrrhiza uralensis Fischer, which analyzed with High Performance Liquid Chromatography (HPLC)-fingerprint for quality consistency, was administered orally to the 3-week-old mice before inducing AD. After that, Dermatophagoides farinae was applied except the control group to induce AD-like skin lesions. We confirmed the effects of HTD on morphological changes, protection of skin barrier, regulation of Th2 differentiation, inflammation regulation and induction of apoptosis through histochemistry, immunohistochemistry, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. HTD effectively reduced edema, angiogenesis and skin lesion. HTD also increased the levels of liver X receptor (LXR) and filaggrin but decreased the level of protein kinase C (PKC) (pprotection of skin barrier. Therefore, HTD may have potential applications for alternative and preventive treatment in the management of AD. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

  19. Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

    Science.gov (United States)

    Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

    2010-01-01

    Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

  20. Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

    Science.gov (United States)

    Han, Seung Hoon; Park, Ji Woong

    2017-11-01

    The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

  1. Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer.

    Science.gov (United States)

    Berger, Antoine; Regueiro, Carlos; Hijal, Tarek; Pasquier, David; De La Fuente, Cristina; Le Tinier, Florence; Coche-Dequeant, Bernard; Lartigau, Eric; Moyal, Dominique; Seité, Sophie; Bensadoun, René-Jean

    2018-01-01

    As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant) for breast cancer. Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation) before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low). Average age was 60 years (range: 34-85). Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031). Positive physician's opinion on product use was more frequent for high (66.6%) versus low (32%) users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

  2. Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer

    Directory of Open Access Journals (Sweden)

    Antoine Berger

    2018-01-01

    Full Text Available Purpose: As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant for breast cancer. Methods: Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low. Results: Average age was 60 years (range: 34-85. Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031. Positive physician’s opinion on product use was more frequent for high (66.6% versus low (32% users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. Conclusions: These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

  3. The effect of postirradiation holding at 22 degrees C on the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in gamma-irradiated HeLa x skin fibroblast human hybrid cells

    International Nuclear Information System (INIS)

    Redpath, J.L.; Antoniono, R.J.; Mendonca, M.S.; Sun, C.

    1994-01-01

    The effect of postirradiation holding at 22 degrees C on cell growth, progression of cells through the cell cycle, and the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in γ-irradiated HeLa x skin fibroblast human hybrid cells has been examined. Cell growth and cell cycle progression were essentially stopped at this reduced temperature. Cell survival was dramatically reduced by holding confluent cultures for 6 h at 22 degrees C, as opposed to 37 degrees C, after 7.5 Gy γ radiation delivered at a rate of 2 Gy/min. Return of the cells to 37 degrees C for 6 h after holding at 22 degrees C did not result in increased survival. A similar effect was obtained when the cells were held at 22 degrees C between split-dose irradiation of log-phase cultures where no increase in survival was observed over a split-dose interval of 4 h. In this case a partial increase in survival was observed upon returning the cells to 37 degrees C for 3 h after holding at 22 degrees C for the first 3 h of the split-dose interval. Neoplastic transformation frequency was not enhanced by holding confluent cultures for 6 h at 22 degrees C after 7.5 Gy γ radiation. This is consistent with previous observations that misrepair of potentially neoplastic transforming damage already occurs at 37 degrees C. The overall results are interpreted in terms of the reduced temperature favoring misrepair, rather than inhibition of repair, of sublethal, potentially lethal and potentially transforming radiation damage. 24 refs., 5 figs., 3 tabs

  4. Development of a stratum corneum substitute for in vitro percutaneous penetration studies : a skin barrier model comprising synthetic stratum corneum lipids

    NARCIS (Netherlands)

    Jager, Miranda Wilhelmina de

    2006-01-01

    The research outlined in this thesis was focused on the development of a skin barrier model, which can substitute for stratum corneum in diffusion studies. This so-called stratum corneum substitute (SCS) was prepared with reconstituted SC lipids (cholesterol, free fatty acids and ceramides) on a

  5. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  6. Dietary Cerebroside from Sea Cucumber (Stichopus japonicus): Absorption and Effects on Skin Barrier and Cecal Short-Chain Fatty Acids.

    Science.gov (United States)

    Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya

    2016-09-21

    Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.

  7. A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

    Science.gov (United States)

    Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

    2017-06-01

    Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  8. No Sting Barrier Film to Protect Skin in Adult Patients: Findings From a Scoping Review With Implications for Evidence-Based Practice.

    Science.gov (United States)

    Micheli, Chiara; Palese, Alvisa; Canzan, Federica; Ambrosi, Elisa

    2017-10-01

    In the industrialized world, approximately 1-1.5% of the population has received treatments for skin lesions. In the 1990s, a polymeric barrier film called the No Sting Barrier Film (NSBF) was developed as an alternative to petrolatum-based ointments and zinc oxide formulas. To date, few studies have explored the effectiveness of NSBF in protecting skin integrity. To map the methods, fields and outcomes used to produce evidence on NSBF effectiveness. A scoping review was performed in 2015. A search strategy for identifying relevant studies was designed and performed. Systematic reviews, meta-analyses, randomized controlled trials, controlled clinical trials, and comparative studies for all types of interventions were included; research conducted in any clinical context was eligible for inclusion. Studies were selected by two reviewers; data extraction and analysis also was performed by two reviewers and disagreements were discussed. Six studies were included. NSBF's potential as a skin protector was investigated with respect to (a) chronic wounds (pressure ulcers or vascular leg ulcers); (b) urinary or fecal incontinence; and (c) post-mastectomy irradiation. The principal clinical outcomes investigated were, respectively: (a) wound healing, wound exudates and erythema control; (b) incidence of incontinence-associated dermatitis and skin reactions; and (c) intensity of pruritus and skin reactions. Pain and comfort were measured in all clinical applications. The main process outcomes investigated were: (a) ease of application, (b) application and removal time, and (c) costs. Zinc oxide and petroleum formulations were the most common comparison interventions in research on chronic ulcers and incontinence; sorbolene cream and topical corticosteroids were the most frequent comparisons in the context of post-mastectomy irradiation. NBSF may be used for peri-wound skin protection in patients with chronic wounds, with urinary or fecal incontinence and for women undergoing

  9. Ultraviolet A photosensitivity profile of dexchlorpheniramine maleate and promethazine-based creams: Anti-inflammatory, antihistaminic, and skin barrier protection properties.

    Science.gov (United States)

    Facchini, Gustavo; Eberlin, Samara; Clerici, Stefano Piatto; Alves Pinheiro, Ana Lucia Tabarini; Costa, Adilson

    2017-12-01

    Unwanted side effects such as dryness, hypersensitivity, and cutaneous photosensitivity are challenge for adherence and therapeutical success for patients using treatments for inflammatory and allergic skin response. In this study, we compared the effects of two dermatological formulations, which are used in inflammatory and/or allergic skin conditions: dexchlorpheniramine maleate (DCP; 10 mg/g) and promethazine (PTZ; 20 mg/g). We evaluated both formulations for phototoxicity potential, skin irritation, anti-inflammatory and antihistaminic abilities, and skin barrier repair in vitro and ex vivo using the standard OECD test guideline n° 432, the ECVAM protocol n° 78, and cultured skin explants from a healthy patient. Ultraviolet A was chosen as exogenous agent to induce allergic and inflammatory response. Both PTZ and DCP promoted increases in interleukin-1 (IL-1) synthesis in response to ultraviolet A (UVA) radiation compared to control. However, the increase observed with PTZ was significantly greater than the DCP, indicating that the latter has a lower irritant potential. DCP also demonstrated a protective effect on UVA-induced leukotriene B4 and nuclear factor kappa B (NF-κB) synthesis. Conversely, PTZ demonstrates more robust UVA antihistaminic activity. Likewise, PTZ promoted a significantly greater increase in the production of involucrin and keratin 14, both associated with protective skin barrier property. In conclusion, these data suggest possible diverging UVA response mechanisms of DCP and PTZ, which gives greater insight into the contrasting photosensitizing potential between DCP and PTZ observed in the patients. © 2017 Wiley Periodicals, Inc.

  10. Quality of skin as a barrier to ultra-fine particles. Contribution of the IBA group to the NANODERM EU-5 project in 2003-2004

    International Nuclear Information System (INIS)

    Kertesz, Zs.; Szikszai, Z.; Kiss, A.Z.

    2004-01-01

    Complete text of publication follows. Micronised titanium-, zinc- or silicon-oxide is a widely used physical photoprotective agent as a component of various cosmetic products. Due to the small particle size (down to 15 nm) it is supposed, that the particles may pass through the uppermost horny skin layer, and penetrate into deeper vital skin layers. However, only a few experiments have been carried out on its penetration through the human epidermal barrier and its possible biological effects in vivo and in vitro, using the tape stripping method which has no lateral and limited depth resolution. A consortium consisting of 12 European universities and scientific institutes has been established under the leadership of the Fakultat fuer Physik und Geowissenchaft Universitat Leipzig, whose goal is to get quantitative information on the penetration of ultrafine particles in all strata of skin, on their penetration pathways as well as on their impact on human health [1]. The IBA group of the Atomki takes part in this project as a subcontractor of the Department of Dermatology, University of Debrecen, Hungary. Ion microscopy, electron microscopy and autoradiography are used to trace the penetration of the nanoparticles into the skin layers, molecular and cell-biological methods are applied to assess the skin response and activation of dermal cells. The IBA group of the Atomki takes part in WP3: Ion Microscopy Work Package together with five other nuclear microprobe laboratories. The participants provide quantitative elemental composition in all strata of skin with detection limits of about 1 μg/g and lateral resolution of 1-2 μm by applying various ion beam analytical techniques. Samples investigated by ion microscopy are 14-16 μm thick cryo-fixed freeze-dried sections of porcine and human skin. Since the sample preparation requires completely different treatment for ion microscopy than for conventional microscopy, the members of the IBA group, who already have

  11. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

    Science.gov (United States)

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

    2015-03-01

    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

  12. Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.

    Science.gov (United States)

    Shah, D K; Khandavilli, S; Panchagnula, R

    2008-09-01

    Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier.

    Science.gov (United States)

    Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

    2017-01-01

    The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier.

  15. The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier*

    Science.gov (United States)

    Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

    2017-01-01

    The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier. PMID:29166523

  16. Xanes and SR-XRF Study of Skin as a Barrier to Ultra-Fine Nanocrystals of TiO2

    International Nuclear Information System (INIS)

    Kwiatek, W.M.; Lekki, J.; Stachura, Z.; Hanson, A.; Ablett, J.

    2007-01-01

    Nanocrystalline TiO 2 is commonly used in cosmetic industry as a photoprotective agent. With recent advances in nanomaterial processing, the size of TiO 2 crystals decreased into the nanometre regime. There is no satisfactory evidence that crystals of such small size are harmless to the human population. An EU project NANODERM has been launched where several techniques have been applied to investigate the possibility of particle penetration through the protective horny layer into vital skin regions. Skin biopsies of the animal and human skin have been collected after exposition to formulations containing TiO 2 nanocrystals. The Ti depth distributions were measured by electron and ion microscopy. The microscopy studies did not detect penetration into vital tissue of healthy skin what does not exclude a possibility that TiO 2 could penetrate pathological skin with lowered barrier efficiency. Due to literature the physical effect of the UV irradiation of the TiO 2 nanoparticle is the shift from 4 th to 3 rd oxidation state of the Ti. Titanium at 3 rd oxidation state interact with environment producing free radicals and Reactive Oxygen Species. In order to quantify the oxidation state shift, XANES experiments were carried out with commercially available TiO 2 nanocrystals (6 - 100 nm size), both in anatase and rutile phase. The samples were irradiated with X-rays with, and without accompanying UV illumination at the NSLS X27A beam line. The corresponding XANES spectra were registered and the absorption edge was compared in UV - illuminated and not illuminated spectra. A shift of about 1 eV in the absorption edge position of the rutile sample exposed to UVA light (365 nm, 20 mW/cm 2 ) has been measured and attributed to the changed electron configuration. However, the direction of the shift detected in measured samples was opposite to the expected. (author)

  17. Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

    Energy Technology Data Exchange (ETDEWEB)

    J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari

    2011-12-31

    The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

  18. Skin graft - slideshow

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

  19. Mathematical models to describe iontophoretic transport in vitro and in vivo and the effect of current application on the skin barrier.

    Science.gov (United States)

    Gratieri, Taís; Kalia, Yogeshvar N

    2013-02-01

    The architecture and composition of the stratum corneum make it a particularly effective barrier against the topical and transdermal delivery of hydrophilic molecules and ions. As a result, different strategies have been explored in order to expand the range of therapeutic agents that can be administered by this route. Iontophoresis involves the application of a small electric potential to increase transport into and across the skin. Since current flow is preferentially via transport pathways with at least some aqueous character, it is ideal for hydrosoluble molecules containing ionisable groups. Hence, the physicochemical properties that limit partitioning and passive diffusion through the intercellular lipid matrix are beneficial for electrically-assisted delivery. The presence of fixed ionisable groups in the skin (pI 4-4.5) means that application of the electric field results in a convective solvent flow (i.e., electroosmosis) in the direction of ion motion so as to neutralise membrane charge. Hence, under physiological conditions, cation electrotransport is due to both electromigration and electroosmosis-their relative contribution depends on the formulation conditions and the physicochemical properties of the permeant. Different mathematical models have been developed to provide a theoretical framework in order to explain iontophoretic transport kinetics. They usually involve solutions of the Nernst-Planck equation - using either the constant field (Goldman) or electroneutrality (Nernst) approximations - with or without terms for the convective solvent flow component. Investigations have also attempted to elucidate the nature of ion transport pathways and to explain the effect of current application on the electrical properties of the skin-more specifically, the stratum corneum. These studies have led to the development of different equivalent circuit models. These range from simple parallel arrangements of a resistor and a capacitor to the inclusion of the

  20. Characteristics of histocompatibility barriers in congenis strains of mice. III. Passive enhancement of skin allografts in x-irradiated hosts

    International Nuclear Information System (INIS)

    Cantrell, J.L.; Kaliss, N.; Hildemann, W.H.

    1975-01-01

    Passive immunological enhancement of skin allografts was investigated in three donor-host combinations of congenic mice disparate at non-H-2 loci. Serum against the graft donor was derived from mice that had received donor strain lymphoid cells as neonates, and thereby were rendered specifically tolerant of a skin allograft. We refer to this serum as ''allograft-tolerant'' serum. Each strain combination was chosen to provide only two non-H-2 histoincompatibilities present in the donor and absent in the host. The differences are categorized as immunogenetically strong, moderate, or weak, on the basis of skin allograft survival times. With passively administered allograft-tolerant serum, significantly prolonged graft survivals were noted for the weakest combination only. Combined treatment with sublethal x-irradiation and allograft-tolerant serum significantly prolonged graft survival in both the moderate and weak combinations, with the largest effect present in the weakest disparity. A hyperimmune alloantiserum (produced in adults) directed against the graft donor prolonged allograft survival in the strongest disparity when given in combination with irradiation. In this combination, graft survival time was increased in hosts exposed to x-ray alone, but joint treatment with x-ray and the alloantiserum gave the largest increment. In contrast, combined treatment with the serum and an antithymocyte alloantiserum did not affect graft survival times. Treatment with both radiation and antithymocyte serum did not prolong graft survival beyond that in mice given only x-radiation. Immunological enhancement with central inhibition is assumed as the mechanism underlying prolonged graft survival, and it is suggested that a population of thymus-derived killer cells, sensitive to x-irradiation, is required for normal graft rejection. (U.S.)

  1. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    Energy Technology Data Exchange (ETDEWEB)

    Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)

    2013-05-01

    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

  2. A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

    International Nuclear Information System (INIS)

    Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne

    2013-01-01

    Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies

  3. The skin barrier function gene SPINK5 is associated with challenge-proven IgE-mediated food allergy in infants.

    Science.gov (United States)

    Ashley, S E; Tan, H-T T; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Gurrin, L C; Lowe, A; Lodge, C; Ponsonby, A-L; Molloy, J; Martin, P; Matheson, M C; Saffery, R; Allen, K J; Ellis, J A; Martino, D

    2017-09-01

    A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery sample) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these individuals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent sample group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery sample (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy. © 2017 EAACI and John Wiley and Sons A

  4. Nanoscale alterations of corneocytes indicate skin disease

    NARCIS (Netherlands)

    Franz, J.; Beutel, M.; Gevers, K.; Kramer, A.; Thyssen, J. P.; Kezic, S.; Riethmüller, C.

    2016-01-01

    The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here, we extended

  5. Oily skin: an overview.

    Science.gov (United States)

    Sakuma, Thais H; Maibach, Howard I

    2012-01-01

    Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

  6. Histopathological effects of lethal and sub-lethal concentrations of ...

    African Journals Online (AJOL)

    The histopathological effects of lethal and sub-lethal concentrations of glyphosate on African catfish Clarias gariepinus were investigated. C. gariepinus juveniles were assessed in a static renewal bioassay for 96 hours (acute toxicity) and 28 days (chronic toxicity) using varying concentrations (0.0 mg/l 20.0 mg/l, 30.0 mg/l, ...

  7. Portulaca oleracea L. aids calcipotriol in reversing keratinocyte differentiation and skin barrier dysfunction in psoriasis through inhibition of the nuclear factor κB signaling pathway

    Science.gov (United States)

    ZHAO, HENGGUANG; LI, SHUANG; LUO, FULING; TAN, QIAN; LI, HUI; ZHOU, WEIKANG

    2015-01-01

    Psoriasis affects 2–4% of the population worldwide and its treatment is currently far from satisfactory. Calcipotriol and Portulaca oleracea have been reported to exhibit the capacity to inhibit inflammation in psoriatic patients and improve their clinical condition. However, the efficacy of a combination regimen of these two components remains unknown. The aim of the present study was to explore the therapeutic efficacy of P. oleracea extract combined with calcipotriol on plaque psoriasis and its potential mechanism. Eleven patients with plaque psoriasis were treated with humectant containing the active ingredients of P. oleracea extract, with or without 0.005% calcipotriol ointment in a right-left bilateral lesion self-control study. Differences were evaluated by investigation of the clinical efficacy, adverse effects, skin barrier function, histological structure, expression and proliferation of keratinocytes, differentiation markers (cytokeratin 10, filaggrin and loricrin), inflammatory factors [tumor necrosis factor (TNF)-α and interleukin (IL)-8], as well as the status of the nuclear factor κB (NF-κB) pathway. The combination of P. oleracea and calcipotriol was revealed to decrease adverse effects, reduce transepidermal water loss, potently reverse keratinocyte differentiation dysfunction, and inhibit the expression of TNF-α and IL-8 and the phosphorylation of the NF-κB inhibitor IκBα. This treatment is therefore anticipated to be suitable for use as a novel adjuvant therapy for psoriatic patients. PMID:25574190

  8. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to flaxseed oil and vitamin E and maintenance of the skin permeability barrier function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...

  9. Suicide Lethality: A Concept Analysis.

    Science.gov (United States)

    DeBastiani, Summer; De Santis, Joseph P

    2018-02-01

    Suicide is a significant health problem internationally. Those who complete suicide may have different behaviors and risk factors than those who attempt a non-fatal suicide. The purpose of this article is to analyze the concept of suicide lethality and propose a clear definition of the concept through the identification of antecedents, attributes, and consequences. A literature search for articles published in the English language between 1970 and 2016 was conducted using MEDLINE, the Cochrane Library, Pubmed, Psychlit, Ovid, PsycINFO, and Proquest. The bibliographies of all included studies were also reviewed to identify additional relevant citations. A concept analysis was conducted on the literature findings using six stages of Walker and Avant's method. The concept analysis differentiated between suicide, lethality, suicidal behavior, and suicide lethality. Presence of a suicide plan or a written suicide note was not found to be associated with the majority of completed suicides included in the definition of suicide lethality. There are a few scales that measure the lethality of a suicide attempt, but none that attempt to measure the concept of suicide lethality as described in this analysis. Clarifying the concept of suicide lethality encourages awareness of the possibility of different suicidal behaviors associated with different suicide outcomes and will inform the development of future nursing interventions. A clearer definition of the concept of suicide lethality will guide clinical practice, research, and policy development aimed at suicide prevention.

  10. Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Eriko Kage-Nakadai

    Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.

  11. Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

    Science.gov (United States)

    Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

    2015-10-01

    Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

  12. Barrier protective use of skin care to prevent chemotherapy-induced cutaneous symptoms and to maintain quality of life in patients with breast cancer

    Directory of Open Access Journals (Sweden)

    Wohlrab J

    2014-08-01

    Full Text Available Johannes Wohlrab,1 Nikola Bangemann,2 Anke Kleine-Tebbe,3 Marc Thill,4,5 Sherko Kümmel,6 Eva-Maria Grischke,7 Rainer Richter,8 Sophie Seite,9 Diana Lüftner10 1Martin Luther University Halle-Wittenberg, Department of Dermatology and Venereology, Halle (Saale, 2Interdisciplinary Breast Centre, University Hospital Charité Berlin, Campus Benjamin Franklin, Berlin, Germany, 3Breast Centre DRK Hospital, Berlin, 4Breast Centre University of Lübeck, Department of Gynaecology and Obstetrics, Lübeck, 5Department of Gynaecology and Obstetrics, Agaplesion Markus Hospital, Frankfurt am Main, 6Breast Centre and Clinic of Senology, Hospital Essen-Mitte, Essen, 7Breast Centre University of Tübingen, Department of Gynaecology, Tübingen, 8L'Oréal, Deutschland GmbH, Düsseldorf, 9La Roche-Posay, Dermatological Laboratories, Asnières, France; 10University Hospital Charité Berlin, Campus Benjamin Franklin, Department of Hematology, Oncology and Tumour Immunology, Berlin, Germany Purpose: Chemotherapy with anthracyclines, taxanes, or alkylating agents often causes cutaneous side effects. Nonspecific inhibition of the proliferative activity of keratinocytes has antidifferentiation effects that lead to defects in the barrier function and, thus, to dry, itchy, and irritable skin. These cutaneous symptoms reduce the quality of life of the patients considerably. Conditioning with topical application of niacinamide uses the cytoprotective and barrier stabilizing effect of vitamin B3. Patients and methods: A multicenter randomized crossover study investigated the influence of the test preparation on the quality of life compared to standard care for 73 patients with breast cancer undergoing adjuvant or neoadjuvant cytostatic therapy. Primary target parameter was the Dermatology Life Quality Index with its respective subscales after 6 weeks of a twice-daily application of the respective preparations. Additionally, specific symptoms such as pruritus, dryness, and

  13. Quantifying rates of cell migration and cell proliferation in co-culture barrier assays reveals how skin and melanoma cells interact during melanoma spreading and invasion.

    Science.gov (United States)

    Haridas, Parvathi; Penington, Catherine J; McGovern, Jacqui A; McElwain, D L Sean; Simpson, Matthew J

    2017-06-21

    Malignant spreading involves the migration of cancer cells amongst other native cell types. For example, in vivo melanoma invasion involves individual melanoma cells migrating through native skin, which is composed of several distinct subpopulations of cells. Here, we aim to quantify how interactions between melanoma and fibroblast cells affect the collective spreading of a heterogeneous population of these cells in vitro. We perform a suite of circular barrier assays that includes: (i) monoculture assays with fibroblast cells; (ii) monoculture assays with SK-MEL-28 melanoma cells; and (iii) a series of co-culture assays initiated with three different ratios of SK-MEL-28 melanoma cells and fibroblast cells. Using immunostaining, detailed cell density histograms are constructed to illustrate how the two subpopulations of cells are spatially arranged within the spreading heterogeneous population. Calibrating the solution of a continuum partial differential equation to the experimental results from the monoculture assays allows us to estimate the cell diffusivity and the cell proliferation rate for the melanoma and the fibroblast cells, separately. Using the parameter estimates from the monoculture assays, we then make a prediction of the spatial spreading in the co-culture assays. Results show that the parameter estimates obtained from the monoculture assays lead to a reasonably accurate prediction of the spatial arrangement of the two subpopulations in the co-culture assays. Overall, the spatial pattern of spreading of the melanoma cells and the fibroblast cells is very similar in monoculture and co-culture conditions. Therefore, we find no clear evidence of any interactions other than cell-to-cell contact and crowding effects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The 24-hour skin hydration and barrier function effects of a hyaluronic 1%, glycerin 5%, and Centella asiatica stem cells extract moisturizing fluid: an intra-subject, randomized, assessor-blinded study.

    Science.gov (United States)

    Milani, Massimo; Sparavigna, Adele

    2017-01-01

    Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid

  15. Application of protease technology in dermatology: rationale for incorporation into skin care with initial observations on formulations designed for skin cleansing, maintenance of hydration, and restoration of the epidermal permeability barrier.

    Science.gov (United States)

    Del Rosso, James Q

    2013-06-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article.

  16. Application of Protease Technology in Dermatology: Rationale for Incorporation into Skin Care with Initial Observations on Formulations Designed for Skin Cleansing, Maintenance of Hydration, and Restoration of the Epidermal Permeability Barrier

    OpenAIRE

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also ...

  17. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  18. Effective lethal mutagenesis of influenza virus by three nucleoside analogs.

    Science.gov (United States)

    Pauly, Matthew D; Lauring, Adam S

    2015-04-01

    Lethal mutagenesis is a broad-spectrum antiviral strategy that exploits the high mutation rate and low mutational tolerance of many RNA viruses. This approach uses mutagenic drugs to increase viral mutation rates and burden viral populations with mutations that reduce the number of infectious progeny. We investigated the effectiveness of lethal mutagenesis as a strategy against influenza virus using three nucleoside analogs, ribavirin, 5-azacytidine, and 5-fluorouracil. All three drugs were active against a panel of seasonal H3N2 and laboratory-adapted H1N1 strains. We found that each drug increased the frequency of mutations in influenza virus populations and decreased the virus' specific infectivity, indicating a mutagenic mode of action. We were able to drive viral populations to extinction by passaging influenza virus in the presence of each drug, indicating that complete lethal mutagenesis of influenza virus populations can be achieved when a sufficient mutational burden is applied. Population-wide resistance to these mutagenic agents did not arise after serial passage of influenza virus populations in sublethal concentrations of drug. Sequencing of these drug-passaged viral populations revealed genome-wide accumulation of mutations at low frequency. The replicative capacity of drug-passaged populations was reduced at higher multiplicities of infection, suggesting the presence of defective interfering particles and a possible barrier to the evolution of resistance. Together, our data suggest that lethal mutagenesis may be a particularly effective therapeutic approach with a high genetic barrier to resistance for influenza virus. Influenza virus is an RNA virus that causes significant morbidity and mortality during annual epidemics. Novel therapies for RNA viruses are needed due to the ease with which these viruses evolve resistance to existing therapeutics. Lethal mutagenesis is a broad-spectrum strategy that exploits the high mutation rate and the low

  19. Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi’s Granuloma: The Consequences of Skin Barrier Dysfunction

    Directory of Open Access Journals (Sweden)

    Tao Wang

    2015-09-01

    Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

  20. The Human Skin Barrier Is Organized as Stacked Bilayers of Fully Extended Ceramides with Cholesterol Molecules Associated with the Ceramide Sphingoid Moiety

    DEFF Research Database (Denmark)

    Iwai, Ichiro; Han, Hongmei; Hollander, Lianne den

    2012-01-01

    not previously described in a biological system-stacked bilayers of fully extended ceramides (CERs) with cholesterol molecules associated with the CER sphingoid moiety. This arrangement rationalizes the skin's low permeability toward water and toward hydrophilic and lipophilic substances, as well as the skin...

  1. Theories of Lethal Mutagenesis: From Error Catastrophe to Lethal Defection.

    Science.gov (United States)

    Tejero, Héctor; Montero, Francisco; Nuño, Juan Carlos

    2016-01-01

    RNA viruses get extinct in a process called lethal mutagenesis when subjected to an increase in their mutation rate, for instance, by the action of mutagenic drugs. Several approaches have been proposed to understand this phenomenon. The extinction of RNA viruses by increased mutational pressure was inspired by the concept of the error threshold. The now classic quasispecies model predicts the existence of a limit to the mutation rate beyond which the genetic information of the wild type could not be efficiently transmitted to the next generation. This limit was called the error threshold, and for mutation rates larger than this threshold, the quasispecies was said to enter into error catastrophe. This transition has been assumed to foster the extinction of the whole population. Alternative explanations of lethal mutagenesis have been proposed recently. In the first place, a distinction is made between the error threshold and the extinction threshold, the mutation rate beyond which a population gets extinct. Extinction is explained from the effect the mutation rate has, throughout the mutational load, on the reproductive ability of the whole population. Secondly, lethal defection takes also into account the effect of interactions within mutant spectra, which have been shown to be determinant for the understanding the extinction of RNA virus due to an augmented mutational pressure. Nonetheless, some relevant issues concerning lethal mutagenesis are not completely understood yet, as so survival of the flattest, i.e. the development of resistance to lethal mutagenesis by evolving towards mutationally more robust regions of sequence space, or sublethal mutagenesis, i.e., the increase of the mutation rate below the extinction threshold which may boost the adaptability of RNA virus, increasing their ability to develop resistance to drugs (including mutagens). A better design of antiviral therapies will still require an improvement of our knowledge about lethal

  2. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  3. Non-Lethal Weapons Program

    Science.gov (United States)

    Sheets Frequently Asked Questions Non-Lethal Weapons FAQs Active Denial System FAQs Human Electro -Muscular Incapacitation FAQs Related Links Business Opportunities Contact JNLWD Congressional Engagement , Wednesday, Sept 20, 2017. The Active Denial System, blunt-impact munitions, dazzling lasers, LRAD 100X

  4. SKIN CARE IN INFANTS

    Directory of Open Access Journals (Sweden)

    I. N. Zakharova

    2014-01-01

    Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

  5. Structure and Function of Your Skin

    Science.gov (United States)

    ... Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . ... in the dermis. What It Does . . . The major function of skin is to provide a barrier between ...

  6. Nanoscale alterations of corneocytes indicate skin disease

    DEFF Research Database (Denmark)

    Franz, J; Beutel, M; Gevers, K

    2016-01-01

    BACKGROUND: The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here...... dermatitis, a common inflammatory skin condition. CONCLUSION: The presence of these corneocyte-nanostructures might be used as a diagnostic parameter for skin disorders - even in cases below a clinical threshold....

  7. Lethal mechanisms in gastric volvulus.

    Science.gov (United States)

    Omond, Kimberley J; Byard, Roger W

    2017-01-01

    A 55-year-old wheelchair-bound woman with severe cerebral palsy was found at autopsy to have marked distention of the stomach due to a volvulus. The stomach was viable, and filled with air and fluid and had pushed the left dome of the diaphragm upwards causing marked compression of the left lung with a mediastinal shift to the right (including the heart). There was no evidence of gastric perforation, ischaemic necrosis or peritonitis. Removal of the organ block revealed marked kyphoscoliosis. Histology confirmed the viability of the stomach and biochemistry showed no dehydration. Death in cases of acute gastric volvulus usually occurs because of compromise of the gastric blood supply resulting in ischaemic necrosis with distention from swallowed air and fluid resulting in perforation with lethal peritonitis. Hypovolaemic shock may also occur. However, the current case demonstrates an alternative lethal mechanism, that of respiratory compromise due to marked thoracic organ compression.

  8. Dietary Yeast Cell Wall Extract Alters the Proteome of the Skin Mucous Barrier in Atlantic Salmon (Salmo salar: Increased Abundance and Expression of a Calreticulin-Like Protein.

    Directory of Open Access Journals (Sweden)

    Giulia Micallef

    Full Text Available In order to improve fish health and reduce use of chemotherapeutants in aquaculture production, the immunomodulatory effect of various nutritional ingredients has been explored. In salmon, there is evidence that functional feeds can reduce the abundance of sea lice. This study aimed to determine if there were consistent changes in the skin mucus proteome that could serve as a biomarker for dietary yeast cell wall extract. The effect of dietary yeast cell wall extract on the skin mucus proteome of Atlantic salmon was examined using two-dimensional gel electrophoresis. Forty-nine spots showed a statistically significant change in their normalised volumes between the control and yeast cell wall diets. Thirteen spots were successfully identified by peptide fragment fingerprinting and LC-MS/MS and these belonged to a variety of functions and pathways. To assess the validity of the results from the proteome approach, the gene expression of a selection of these proteins was studied in skin mRNA from two different independent feeding trials using yeast cell wall extracts. A calreticulin-like protein increased in abundance at both the protein and transcript level in response to dietary yeast cell wall extract. The calreticulin-like protein was identified as a possible biomarker for yeast-derived functional feeds since it showed the most consistent change in expression in both the mucus proteome and skin transcriptome. The discovery of such a biomarker is expected to quicken the pace of research in the application of yeast cell wall extracts.

  9. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  10. The structure, function, and importance of ceramides in skin and their use as therapeutic agents in skin-care products.

    Science.gov (United States)

    Meckfessel, Matthew H; Brandt, Staci

    2014-07-01

    Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  11. Skin absorption through atopic dermatitis skin

    DEFF Research Database (Denmark)

    Halling-Overgaard, A-S; Kezic, S; Jakasa, I

    2017-01-01

    Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

  12. Deadly hairs, lethal feathers--convergent evolution of poisonous integument in mammals and birds.

    Science.gov (United States)

    Plikus, Maksim V; Astrowski, Aliaksandr A

    2014-07-01

    Hairs and feathers are textbook examples of the convergent evolution of the follicular appendage structure between mammals and birds. While broadly recognized for their convergent thermoregulatory, camouflage and sexual display functions, hairs and feathers are rarely thought of as deadly defence tools. Several recent studies, however, show that in some species of mammals and birds, the integument can, in fact, be a de facto lethal weapon. One mammalian example is provided by African crested rats, which seek for and chew on the bark of plants containing the highly potent toxin, ouabain. These rats then coat their fur with ouabain-containing saliva. For efficient toxin retention, the rodents have evolved highly specialized fenestrated and mostly hollow hair shafts that soak up liquids, which essentially function as wicks. On the avian side of the vertebrate integumental variety spectrum, several species of birds of New Guinea have evolved resistance to highly potent batrachotoxins, which they acquire from their insect diet. While the mechanism of bird toxicity remains obscure, in a recently published issue of the journal, Dumbacher and Menon explore the intriguing idea that to achieve efficient storage of batrachotoxins in their skin, some birds exploit the basic permeability barrier function of their epidermis. Batrachotoxins become preferentially sequestered in their epidermis and are then transferred to feathers, likely through the exploitation of specialized avian lipid-storing multigranular body organelles. Here, we discuss wider implications of this intriguing concept. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Xenobiotic metabolism in human skin and 3D human skin reconstructs: A review

    NARCIS (Netherlands)

    Gibbs, S.; Sandt, J.J.M. van de; Merk, H.F.; Lockley, D.J.; Pendlington, R.U.; Pease, C.K.

    2007-01-01

    In this review, we discuss and compare studies of xenobiotic metabolism in both human skin and 3D human skin reconstructs. In comparison to the liver, the skin is a less studied organ in terms of characterising metabolic capability. While the skin forms the major protective barrier to environmental

  14. Probing the role of ceramide hydroxylation in skin barrier lipid models by 2H solid-state NMR spectroscopy and X-ray powder diffraction.

    Science.gov (United States)

    Kováčik, Andrej; Vogel, Alexander; Adler, Juliane; Pullmannová, Petra; Vávrová, Kateřina; Huster, Daniel

    2018-05-01

    In this work, we studied model stratum corneum lipid mixtures composed of the hydroxylated skin ceramides N-lignoceroyl 6-hydroxysphingosine (Cer[NH]) and α-hydroxylignoceroyl phytosphingosine (Cer[AP]). Two model skin lipid mixtures of the composition Cer[NH] or Cer[AP], N-lignoceroyl sphingosine (Cer[NS]), lignoceric acid (C24:0) and cholesterol in a 0.5:0.5:1:1 molar ratio were compared. Model membranes were investigated by differential scanning calorimetry and 2 H solid-state NMR spectroscopy at temperatures from 25 °C to 80 °C. Each component of the model mixture was specifically deuterated for selective detection by 2 H NMR. Thus, the exact phase composition of the mixture at varying temperatures could be quantified. Moreover, using X-ray powder diffraction we investigated the lamellar phase formation. From the solid-state NMR and DSC studies, we found that both hydroxylated Cer[NH] and Cer[AP] exhibit a similar phase behavior. At physiological skin temperature of 32 °C, the lipids form a crystalline (orthorhombic) phase. With increasing temperature, most of the lipids become fluid and form a liquid-crystalline phase, which converts to the isotropic phase at higher temperatures (65-80 °C). Interestingly, lignoceric acid in the Cer[NH]-containing mixture has a tendency to form two types of fluid phases at 65 °C. This tendency was also observed in Cer[AP]-containing membranes at 80 °C. While Cer[AP]-containing lipid models formed a short periodicity phase featuring a repeat spacing of d = 5.4 nm, in the Cer[NH]-based model skin lipid membranes, the formation of unusual long periodicity phase with a repeat spacing of d = 10.7 nm was observed. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Electroshock weapons can be lethal!

    Science.gov (United States)

    Lundquist, Marjorie

    2008-03-01

    Electroshock weapons (EWs)-stun guns, tasers, riot shields-are electroconductive devices designed to safely incapacitate healthy men neuromuscularly, so they are called nonlethal or less-lethal. EW firms seeking large nonmilitary markets targeted law enforcement and corrections personnel, who began using EWs in prisons/jails and on public patrol in 1980 in the USA. This shifted the EW-shocked population from healthy soldiers to a heterogeneous mix of both sexes, ages 6-92, in a wide variety of health conditions! An EW operates by disrupting normal physiological processes, producing transient effects in healthy people. But if a person's health is sufficiently compromised, the margin of safety can be lost, resulting in death or permanent health problems. 325 people have died after EW shock since 1980. Did the EW cause these deaths? Evidence indicates that EWs do play a causal role in most such deaths. EWs can be lethal for people in diabetic shock^1 (hypoglycemia), which may be why Robert Dziekanski-a Polish immigrant to Canada-died so quickly after he was tasered at Vancouver Airport: not having eaten for over 10 hours, he likely was severely hypoglycemic. The EW death rate in North America is 30 times higher than need be, because EW users have not been properly trained to use EWs on a heterogeneous population safely! ^1J. Clinical Engineering 30(3):111(2005).

  16. Barrier function and natural moisturizing factor levels after cumulative exposure to a fruit-derived organic acid and a detergent: different outcomes in atopic and healthy skin and relevance for occupational contact dermatitis in the food industry.

    Science.gov (United States)

    Angelova-Fischer, Irena; Hoek, Anne-Karin; Dapic, Irena; Jakasa, Ivone; Kezic, Sanja; Fischer, Tobias W; Zillikens, Detlef

    2015-12-01

    Fruit-derived organic compounds and detergents are relevant exposure factors for occupational contact dermatitis in the food industry. Although individuals with atopic dermatitis (AD) are at risk for development of occupational contact dermatitis, there have been no controlled studies on the effects of repeated exposure to multiple irritants, relevant for the food industry, in atopic skin. The aim of the study was to investigate the outcomes of repeated exposure to a fruit-derived organic acid and a detergent in AD compared to healthy volunteers. The volunteers were exposed to 2.0% acetic acid (AcA) and/or 0.5% sodium lauryl sulfate (SLS) in controlled tandem repeated irritation test. The outcomes were assessed by measurements of erythema, transepidermal water loss (TEWL) and natural moisturizing factor (NMF) levels. In the AD volunteers, repeated AcA exposure led to barrier disruption and significant TEWL increase; no significant differences after the same exposure in the healthy controls were found. Repeated exposure to SLS and the irritant tandems enhanced the reactions and resulted in a significantly higher increase in TEWL in the AD compared to the control group. Cumulative irritant exposure reduced the NMF levels in both groups. Differences in the severity of irritant-induced barrier impairment in atopic individuals contribute to the risk for occupational contact dermatitis in result of multiple exposures to food-derived irritants and detergents. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Percutaneous penetration through slightly damaged skin

    DEFF Research Database (Denmark)

    Nielsen, Jesper B

    2005-01-01

    with human skin. A slight damage to the barrier integrity was induced by pre-treatment of the skin with sodium lauryl sulphate (SLS) before pesticide exposure. The experimental model with 3 h pre-treatment with SLS (0.1% or 0.3%) assured a significant but controlled damage to the barrier integrity, a damage...

  18. Water vapour loss measurements on human skin.

    NARCIS (Netherlands)

    Valk, Petrus Gerardus Maria van der

    1984-01-01

    In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions

  19. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  20. First Safety and Performance Evaluation of T45K, a Self-Assembling Peptide Barrier Hemostatic Device, After Skin Lesion Excision.

    Science.gov (United States)

    Rahmani, George; Prats, Jayne; Norchi, Terrence; Kates, Steven; McInerney, Veronica; Woods, Jack; Kelly, Jack

    2018-01-29

    The self-assembling peptide barrier T45K (SAPB-T45K) is an oligopeptide that rapidly forms a biocompatible hemostatic barrier when applied to wounds. Evaluate safety and performance of SAPB-T45K in cutaneous surgery. In this single-blind study, after sequential shave excision of 2 lesions, wounds were randomized (intrapatient) to SAPB-T45K or control treatment. Safety was assessed at treatment, Day 7, and Day 30. Performance was evaluated using time to hemostasis (TTH) and ASEPSIS wound scores, with a subgroup analysis for patients with or without antiplatelet therapy. Each of 46 patients (10 [22%] with antiplatelet therapy) received randomized SAPB-T45K or control treatment for 2 wounds. Safety assessments were similar, and ASEPSIS scores reflected normal healing in both wound groups. SAPB-T45K demonstrated significantly faster median TTH (24.5 [range, 7-165] seconds) compared with control (44 [10-387] seconds), for a 41% median TTH reduction (18 [95% confidence interval, 7-35] seconds, p safety profiles were similar.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

  1. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  2. Effect of lethal and sub-lethal concentrations of tobacco (Nicotiana ...

    African Journals Online (AJOL)

    Lethal and sub-lethal bioassays on Clarias gariepinus were conducted to evaluate the toxicity of tobacco (Nicotiana tobaccum) leaf dust on weight gain and haematological indices of Clarias gariepinus (mean weight 10.5±0.70g) in glass aquaria with aeration system. The concentrations used during the lethal exposure are: ...

  3. Skin moisturization mechanisms: new data.

    Science.gov (United States)

    Bonté, F

    2011-05-01

    The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  4. Screening for skin cancer.

    Science.gov (United States)

    Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T

    2001-04-01

    Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers

  5. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  7. Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

    DEFF Research Database (Denmark)

    Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

    2010-01-01

    BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

  8. Facial skin care products and cosmetics.

    Science.gov (United States)

    Draelos, Zoe Diana

    2014-01-01

    Facial skin care products and cosmetics can both aid or incite facial dermatoses. Properly selected skin care can create an environment for barrier repair aiding in the re-establishment of a healing biofilm and diminution of facial redness; however, skin care products that aggressively remove intercellular lipids or cause irritation must be eliminated before the red face will resolve. Cosmetics are an additive variable either aiding or challenging facial skin health. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Factors influencing circadian rhythms in acetaminophen lethality.

    Science.gov (United States)

    Schnell, R C; Bozigian, H P; Davies, M H; Merrick, B A; Park, K S; McMillan, D A

    1984-01-01

    Experiments were conducted to examine the effects of changes in lighting schedules and food consumption on circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice. Under a normal lighting schedule (light: 06.00-18.00 h), male mice exhibited a circadian rhythm in acetaminophen lethality (peak: 18.00 h; nadir: 06.00, 10.00 h) and an inverse rhythm in hepatic glutathione concentrations (peak: 06.00, 10.00 h; nadir: 18.00 h). Under a reversed lighting schedule (light: 18.00-06.00 h) the glutathione rhythm was reversed and the rhythm in acetaminophen lethality was altered showing greater sensitivity to the drug. Under continuous light, there was a shift in the acetaminophen lethality and the hepatic glutathione rhythms. Under continuous dark, both rhythms were abolished. Under a normal lighting regimen, hepatic glutathione levels were closely correlated with food consumption; i.e., both were increased during the dark phase and decreased during the light phase. Fasting the mice for 12 h abolished the rhythms in acetaminophen lethality and hepatic glutathione levels; moreover, the lethality was increased and the hepatic glutathione levels were decreased. These experiments show that both lighting schedules and feeding can alter the circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice.

  10. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  11. Comparison of the lethal effects of chemical warfare nerve agents across multiple ages.

    Science.gov (United States)

    Wright, Linnzi K M; Lee, Robyn B; Vincelli, Nicole M; Whalley, Christopher E; Lumley, Lucille A

    2016-01-22

    Children may be inherently more vulnerable than adults to the lethal effects associated with chemical warfare nerve agent (CWNA) exposure because of their closer proximity to the ground, smaller body mass, higher respiratory rate, increased skin permeability and immature metabolic systems. Unfortunately, there have only been a handful of studies on the effects of CWNA in pediatric animal models, and more research is needed to confirm this hypothesis. Using a stagewise, adaptive dose design, we estimated the 24h median lethal dose for subcutaneous exposure to seven CWNA in both male and female Sprague-Dawley rats at six different developmental times. Perinatal (postnatal day [PND] 7, 14 and 21) and adult (PND 70) rats were more susceptible than pubertal (PND 28 and 42) rats to the lethal effects associated with exposure to tabun, sarin, soman and cyclosarin. Age-related differences in susceptibility were not observed in rats exposed to VM, Russian VX or VX. Published by Elsevier Ireland Ltd.

  12. Transporting Patients with Lethal Contagious Infections

    National Research Council Canada - National Science Library

    Swartz, Colleen

    2002-01-01

    .... The AIT is a unique military medical team capable of worldwide air evacuation and management of a limited number of patients who are potentially exposed to known and unknown lethal communicable...

  13. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  14. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  15. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  16. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  17. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  18. Experiences in therapy for lethal midline granuloma

    International Nuclear Information System (INIS)

    Tosaka, Kaoru; Ishikawa, Takeru

    1982-01-01

    Four cases of the lethal midline granuloma or malignant granuloma of the nose were treated by irradiation and chemotherapy, which are generally prescribed for malignant lymphomas. Clinical, histological and laboratory examination indicated that they were the lethal midline granuloma and clearly differentiated from Wegener's granulomatosis or malignant lymphoma. All of the cases exhibited primary remission. The four cases were observed up to 38, 22, 14, and 10 months since the beginning of the therapy, showing no local or general recurrence. (author)

  19. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  20. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  1. Lethality Index 2008-2014: Less shootings, same lethality, more opacity

    Directory of Open Access Journals (Sweden)

    Carlos Silva Forné

    2017-11-01

    Full Text Available This article evaluates the use of lethal force by Mexican federal security forces during shootings with presumed members of organized crime from 2008-2014. The authors use official data and press reports on deaths and wounded in shootings to construct indicators such as the number of dead civilians over the number of dead officials from the federal security forces and the number of dead civilians over the number of wounded civilians. In a context where certain factors that contribute to an excessive use of force become more common, the results of the study show a growing use of lethal force. This raises questions over the possible excessive use of lethal force as a normal or systematic practice. The study also shows a growing context of opacity in the information available to evaluate the use of lethal force and the general lack of a legal framework to regulate the use of lethal force in Mexico.

  2. Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

    Directory of Open Access Journals (Sweden)

    Dirk Breitkreutz

    2013-01-01

    Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

  3. Personnel decontamination and preventive skin care

    International Nuclear Information System (INIS)

    Henning, Klaus; Gojowczyk, Peter

    2010-01-01

    Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

  4. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  5. Stratum corneum damage and ex vivo porcine skin water absorption - a pilot study

    DEFF Research Database (Denmark)

    Duch Lynggaard, C; Bang Knudsen, D; Jemec, G B E

    2009-01-01

    A simple ex vivo screening technique would be of interest for mass screening of substances for potential barrier disruptive qualities. Ex vivo water absorption as a marker of skin barrier integrity was studied on pig ear skin. Skin water absorption was quantified by weighing and weight changes were...... found to reflect prehydration barrier damage. It is suggested that this simple model may be elaborated to provide a rapid, economical screening tool for potential skin irritants....

  6. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  7. Genetics Home Reference: Amish lethal microcephaly

    Science.gov (United States)

    ... 1 in 500 newborns in the Old Order Amish population of Pennsylvania. It has not been found outside this population. Related Information What information about a genetic condition can statistics provide? Why are some genetic ... gene cause Amish lethal microcephaly . The SLC25A19 gene provides instructions for ...

  8. The evolution of lethal intergroup violence

    OpenAIRE

    Kelly, Raymond C.

    2005-01-01

    Recent findings and analyses in evolutionary biology, archaeology, and ethnology provide a favorable conjuncture for examining the evolution of lethal intergroup violence among hominids during the 2.9-million-year Paleolithic time span. Here, I seek to identify and investigate the main turning points in this evolutionary trajectory and to delineate the periodization that follows from this inquiry.

  9. The evolution of lethal intergroup violence.

    Science.gov (United States)

    Kelly, Raymond C

    2005-10-25

    Recent findings and analyses in evolutionary biology, archaeology, and ethnology provide a favorable conjuncture for examining the evolution of lethal intergroup violence among hominids during the 2.9-million-year Paleolithic time span. Here, I seek to identify and investigate the main turning points in this evolutionary trajectory and to delineate the periodization that follows from this inquiry.

  10. A new lethal sclerosing bone dysplasia

    International Nuclear Information System (INIS)

    Kingston, H.M.; Freeman, J.S.; Hall, C.M.

    1991-01-01

    A neonate is described with a lethal sclerosing bone dysplasia associated with prenatal fractures and craniofacial abnormalities including microcephaly, exophthalmos, hypoplastic nose and mid-face, small jaw and nodular hyperplasia of the gums. Parental consanguinity suggests that an autosomal recessive mutation is the likely aetiology. (orig.)

  11. Skin Dictionary

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  12. Hyperelastic skin

    Science.gov (United States)

    ... is most often seen in people who have Ehlers-Danlos syndrome. People with this disorder have very elastic skin. ... any member of your family been diagnosed with Ehlers-Danlos syndrome? What other symptoms are present? Genetic counseling may ...

  13. Skin Cancer

    Science.gov (United States)

    ... sunlamps. There are 2 types of UV rays: UVA rays (long-wave) – UVA rays penetrate clouds and glass. They penetrate the ... to cancer. But studies have shown that both UVA and UVB damage the skin and can cause ...

  14. Lethal neonatal short-limbed dwarfism

    International Nuclear Information System (INIS)

    Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee

    1986-01-01

    We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

  15. Lethal neonatal short-limbed dwarfism

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee [Catholic Medical College, Seoul (Korea, Republic of)

    1986-02-15

    We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

  16. Mining of lethal recessive genetic variation in Danish cattle

    DEFF Research Database (Denmark)

    Das, Ashutosh

    2015-01-01

    in fertility. The primary objective of this PhD projekt was to identify recessive lethal gentic variants in the main Danish dairy cattle breed. Holstein-Friesian utilzing next generation sequencing (NGS) data. This study shows a potential for the use of the NGS-based reverse genetic approach in identifying...... lethal or semi-lethal recessive gentic variation...

  17. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  18. Lethal midline granuloma syndrome: a diagnostic dilemma

    International Nuclear Information System (INIS)

    Ribeiro, Bruno Niemeyer de Freitas; Bahia, Paulo Roberto Valle; Oliveira, Ana Luiza Vianna Sobral de Magalhaes; Marchon Junior, Joao Luiz

    2012-01-01

    The rare lethal midline granuloma syndrome is difficult to diagnose because of the wide array of related diseases and lack of knowledge by the majority of physicians. In the present report, the authors describe the case of a patient with this disease, caused by squamous cell carcinoma, drawing attention to differential diagnoses and to clinical and radiological findings that may be useful to define the diagnosis. (author)

  19. Lethal Interpersonal Violence in the Middle Pleistocene

    OpenAIRE

    Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-P?rez, Ana; Pablos, Adri?n; Mart?nez, Ignacio; Quam, Rolf M.; G?mez-Olivencia, Asier; Berm?dez de Castro, Jos? Mar?a; Carbonell, Eudald

    2015-01-01

    Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force ...

  20. Lethal midline granuloma syndrome: a diagnostic dilemma

    Energy Technology Data Exchange (ETDEWEB)

    Ribeiro, Bruno Niemeyer de Freitas; Bahia, Paulo Roberto Valle [Radiology, Hospital Universitario Clementino Fraga Filho - Universidade Federal do Rio de Janeiro (HUCFF-UFRJ), Rio de Janeiro, RJ (Brazil); Oliveira, Ana Luiza Vianna Sobral de Magalhaes [Resident of Medical Practice, Hospital Federal da Lagoa, Rio de Janeiro, RJ (Brazil); Marchon Junior, Joao Luiz [Unit of Computed Tomography, Hospital Federal da Lagoa, Rio de Janeiro, RJ (Brazil)

    2012-11-15

    The rare lethal midline granuloma syndrome is difficult to diagnose because of the wide array of related diseases and lack of knowledge by the majority of physicians. In the present report, the authors describe the case of a patient with this disease, caused by squamous cell carcinoma, drawing attention to differential diagnoses and to clinical and radiological findings that may be useful to define the diagnosis. (author)

  1. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  2. Lethal interpersonal violence in the Middle Pleistocene.

    Directory of Open Access Journals (Sweden)

    Nohemi Sala

    Full Text Available Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

  3. Lethal interpersonal violence in the Middle Pleistocene.

    Science.gov (United States)

    Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-Pérez, Ana; Pablos, Adrián; Martínez, Ignacio; Quam, Rolf M; Gómez-Olivencia, Asier; Bermúdez de Castro, José María; Carbonell, Eudald

    2015-01-01

    Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

  4. [Skin hydration and hydrating products].

    Science.gov (United States)

    Duplan, H; Nocera, T

    2018-05-01

    One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

  5. Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

    Science.gov (United States)

    Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

    2016-05-01

    Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

  6. MKLN1 splicing defect in dogs with lethal acrodermatitis.

    Directory of Open Access Journals (Sweden)

    Anina Bauer

    2018-03-01

    Full Text Available Lethal acrodermatitis (LAD is a genodermatosis with monogenic autosomal recessive inheritance in Bull Terriers and Miniature Bull Terriers. The LAD phenotype is characterized by poor growth, immune deficiency, and skin lesions, especially at the paws. Utilizing a combination of genome wide association study and haplotype analysis, we mapped the LAD locus to a critical interval of ~1.11 Mb on chromosome 14. Whole genome sequencing of an LAD affected dog revealed a splice region variant in the MKLN1 gene that was not present in 191 control genomes (chr14:5,731,405T>G or MKLN1:c.400+3A>C. This variant showed perfect association in a larger combined Bull Terrier/Miniature Bull Terrier cohort of 46 cases and 294 controls. The variant was absent from 462 genetically diverse control dogs of 62 other dog breeds. RT-PCR analysis of skin RNA from an affected and a control dog demonstrated skipping of exon 4 in the MKLN1 transcripts of the LAD affected dog, which leads to a shift in the MKLN1 reading frame. MKLN1 encodes the widely expressed intracellular protein muskelin 1, for which diverse functions in cell adhesion, morphology, spreading, and intracellular transport processes are discussed. While the pathogenesis of LAD remains unclear, our data facilitate genetic testing of Bull Terriers and Miniature Bull Terriers to prevent the unintentional production of LAD affected dogs. This study may provide a starting point to further clarify the elusive physiological role of muskelin 1 in vivo.

  7. Skin decontamination

    International Nuclear Information System (INIS)

    Moehrle, G.

    1975-01-01

    A general survey of skin decontamination is given. The success of every decontamination treatments depends mainly on the speed, but also on the care, with which the action is taken. The best way to remove the skin contaminants is thorough washing under lukewarm running water with mild soap and a soft brush. This washing is to be repeated several times for a period of several minutes. If results are not satisfactory, light duty detergents and wetting agents available commercially may also be used. Some solutions which have proved useful are mentioned. The decontamination solutions are best used in the order given. When one has no satisfactory decontamination effect, the next one is to be used. If necessary, these agents must be used several times in the stated order as long as this does not involve too much strain for the skin. All the decontamination measures mentioned refer, of course, to intact healthy skin. After decontamination has been completed, the skin should be treated with a protective cream

  8. Successful Treatment of Acute Lethal Dose of Acrylamide Poisoning

    Directory of Open Access Journals (Sweden)

    Ali Banagozar Mohammadi

    2015-03-01

    Full Text Available Background: Acrylamide (C3H5NO is a vinyl monomer. This water-soluble crystalline solid is a colorless, odorless agent which is used in scientific laboratories and some industries. Acrylamide has cellular oxidative effects. Acute or chronic poisoning with this agent happens as a result of skin, respiratory, or oral contacts. Clinical manifestations depend on the dose, duration, and frequency of contact. Management of these patients consists of conservative and palliative therapies to reduce the oxidative effects. Case: The case was a 29-year-old girl with a Master of Sciences degree in genetics who worked in a university research center with previous history of depression. She had ingested 100cc of 30% Acrylamide solution for intentional suicide attempt. The patient was successfully managed using N-acetyl cysteine, vitamin C, and melatonin. Conclusion: Early diagnosis and appropriate treatment with recommended agents together with supportive therapies can save the life of patients exposed to potentially lethal doses of acrylamide, although intentional or accidental.

  9. Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.

    Science.gov (United States)

    Segger, Dörte; Matthies, Andreas; Saldeen, Tom

    2008-01-01

    To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.

  10. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  11. Topical Nano and Microemulsions for Skin Delivery

    Directory of Open Access Journals (Sweden)

    Christofori M. R. R. Nastiti

    2017-09-01

    Full Text Available Nanosystems such as microemulsions (ME and nanoemulsions (NE offer considerable opportunities for targeted drug delivery to and via the skin. ME and NE are stable colloidal systems composed of oil and water, stabilised by a mixture of surfactants and cosurfactants, that have received particular interest as topical skin delivery systems. There is considerable scope to manipulate the formulation components and characteristics to achieve optimal bioavailability and minimal skin irritancy. This includes the incorporation of established chemical penetration enhancers to fluidize the stratum corneum lipid bilayers, thus reducing the primary skin barrier and increasing permeation. This review discusses nanosystems with utility in skin delivery and focuses on the composition and characterization of ME and NE for topical and transdermal delivery. The mechanism of skin delivery across the stratum corneum and via hair follicles is reviewed with particular focus on the influence of formulation.

  12. Epidemiology of "fragile skin": results from a survey of different skin types

    Directory of Open Access Journals (Sweden)

    Haftek M

    2013-12-01

    findings need to be confirmed through objective evaluation, the current survey demonstrated that "fragile skin" is perceived to occur in a substantial proportion of individuals from any given country, particularly in the age range of 15–34 years, regardless of skin type. Keywords: fragile skin, prevalence, skin barrier, skin type, survey

  13. Lethal congenital contracture syndrome (LCCS) and other lethal arthrogryposes in Finland--an epidemiological study.

    Science.gov (United States)

    Pakkasjärvi, Niklas; Ritvanen, Annukka; Herva, Riitta; Peltonen, Leena; Kestilä, Marjo; Ignatius, Jaakko

    2006-09-01

    Arthrogryposis multiplex congenita is a heterogeneous group of disorders characterized by multiple contractures with an estimated frequency of 1 in 3,000 births. With improving diagnostic methods, increasing numbers of fetuses with arthrogryposis are found. The pathogenetic mechanisms are relatively well known but the epidemiology and genetics of the prenatally lethal forms of arthrogryposis are less well known. In this study we collected all cases of a multiple contractures diagnosed in Finland during 1987-2002 including live born infants, stillbirths, and terminated pregnancies. Ninety-two cases of 214 suffered intrauterine demise (68 selective pregnancy terminations and 24 stillbirths) and 58 died in infancy. In 141 out of these cases the diagnosis could be included within lethal arthrogryposes, with a prevalence of 1 in 6,985 (1.43/10,000) births. Of these, 59 had spinal cord pathology at autopsy and thus were of neurogenic origin. Thirty-nine cases had lethal congenital contracture syndrome (LCCS) clinically characterized by total immobility of the fetus at all ultrasound examinations (12 weeks or later), multiple joint contractures in both upper and lower limbs, hydrops, and fetal death before the 32nd week of pregnancy. LCCS is noted as a unique Finnish disorder with a prevalence of 1 in 25,250 (0.40/10,000) births and is a major cause of lethal arthrogryposis in Finland.

  14. Suicide Intent and Accurate Expectations of Lethality: Predictors of Medical Lethality of Suicide Attempts

    Science.gov (United States)

    Brown, Gregory K.; Henriques, Gregg R.; Sosdjan, Daniella; Beck, Aaron T.

    2004-01-01

    The degree of intent to commit suicide and the severity of self-injury were examined in individuals (N = 180) who had recently attempted suicide. Although a minimal association was found between the degree of suicide intent and the degree of lethality of the attempt, the accuracy of expectations about the likelihood of dying was found to moderate…

  15. Potentially lethal damage and its repair

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1989-01-01

    Two forms termed fast-and slow-potentially lethal lethal damage (PLD) are introduced and discussed. The effect on the survival of x-irradiated Chinese hamster cells (V79) of two different post-treatments is examined in plateau- and in log-phases of growth. The postirradiation treatments used : a) incubation in hypertonic solution, and b) incubation in conditioned medium obtained from plateau-phase. Similar reduction in survival was caused by postirradiation treatment with hypertonic phosphate buffered saline, and similar increased in survival was effected by treatment in conditioned medium in plateau- and in log-phases cells. However, repair of PLD sensitive to hypertonic treatment was faster (half time, 5-10 min)(f-PLD repair) and independent from the repair of PLD (half time, 1-2 hour)(s-PLD repair) observed in conditioned medium. The results indicate the induction of two forms of PLD by radiation. Induction of both PLD was found to decrease with increasing LET of the radiation used. Identification of the molecular processes underlying repair and fixation of PLD is a task of particular interest, since it may allow replacement of a phenomenological definition with a molecular definition. Evidence is reviewed indicating the DNA double strand breaks (directly or indirectly induced) may be the DNA lesions underlying PLD. (author)

  16. Presence of virus neutralizing antibodies in cerebral spinal fluid correlates with non-lethal rabies in dogs.

    Directory of Open Access Journals (Sweden)

    Clement W Gnanadurai

    Full Text Available Rabies is traditionally considered a uniformly fatal disease after onset of clinical manifestations. However, increasing evidence indicates that non-lethal infection as well as recovery from flaccid paralysis and encephalitis occurs in laboratory animals as well as humans.Non-lethal rabies infection in dogs experimentally infected with wild type dog rabies virus (RABV, wt DRV-Mexico correlates with the presence of high level of virus neutralizing antibodies (VNA in the cerebral spinal fluid (CSF and mild immune cell accumulation in the central nervous system (CNS. By contrast, dogs that succumbed to rabies showed only little or no VNA in the serum or in the CSF and severe inflammation in the CNS. Dogs vaccinated with a rabies vaccine showed no clinical signs of rabies and survived challenge with a lethal dose of wild-type DRV. VNA was detected in the serum, but not in the CSF of immunized dogs. Thus the presence of VNA is critical for inhibiting virus spread within the CNS and eventually clearing the virus from the CNS.Non-lethal infection with wt RABV correlates with the presence of VNA in the CNS. Therefore production of VNA within the CNS or invasion of VNA from the periphery into the CNS via compromised blood-brain barrier is important for clearing the virus infection from CNS, thereby preventing an otherwise lethal rabies virus infection.

  17. Lethal domestic violence in eastern North Carolina.

    Science.gov (United States)

    Gilliland, M G; Spence, P R; Spence, R L

    2000-01-01

    Strategies for preventing domestic violence can be tailored to a particular geographic or socioeconomic area if the patterns of domestic violence in the area are known. National statistics, although widely available, may not be applicable to a specific region. We reviewed homicide deaths in Eastern North Carolina between 1978 and 1999 to identify patterns in this rural area. Approximately 20% of the homicide deaths in eastern North Carolina are caused by intimate partners. Women accounted for 53% of the victims in 1976, similar to national figures but not rising to 72% as seen nationally in 1998. Latinos are an increasing presence in the area, but had only one recorded episode of lethal violence against an intimate partner. Gunshots accounted for most of the deaths (59% in men, 72% in women). Knowledge of such patterns can assist in selecting prevention strategies for this particular area. Over the last 25 years increasing attention has been devoted to domestic violence (DV), initially defined as abuse committed against a spouse, former spouse, fiancée, boy- or girlfriend, or cohabitant. As time has passed, the definition has been broadened to include other family members--elders, children, and siblings. The Centers for Disease Control and Prevention (CDC) now uses the term "intimate partner violence" for intentional emotional or physical abuse inflicted by a spouse, ex-spouse, a present or former boy- or girlfriend, or date. For the purposes of this paper, we consider DV interchangeable with intimate partner violence. There has been a national concern that abusive events are under-reported. The National Crime Victimization Survey, an anonymous household survey, indicated nearly 1 million incidents of non-lethal intimate partner violence per year between 1992 and 1996. The number decreased from 1.1 million in 1993 to 840,000 in 1996. Attempts to validate such data for a given geographic area often require subjects to violate anonymity--this may account for lower

  18. Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

    Science.gov (United States)

    Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

    2016-09-01

    Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

  19. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  20. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... Handbook A "Sunscreen Gene"? Skin Cancer Facts & Statistics Skin Cancer Treatment Glossary Information on medications and procedures ...

  1. Skin Cancer Treatment

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  2. Stages of Skin Cancer

    Science.gov (United States)

    ... Unusual Cancers of Childhood Treatment Genetics of Skin Cancer Skin color and being exposed to sunlight can increase ... is based on the type of nonmelanoma skin cancer or other skin condition diagnosed: Basal cell carcinoma Enlarge Basal cell ...

  3. Innate lymphoid cells and the skin

    OpenAIRE

    Salimi, Maryam; Ogg, Graham

    2014-01-01

    Innate lymphoid cells are an emerging family of effector cells that contribute to lymphoid organogenesis, metabolism, tissue remodelling and protection against infections. They maintain homeostatic immunity at barrier surfaces such as lung, skin and gut (Nature 464:1367?1371, 2010, Nat Rev Immunol 13: 145?149, 2013). Several human and mouse studies suggest a role for innate lymphoid cells in inflammatory skin conditions including atopic eczema and psoriasis. Here we review the innate lymphoid...

  4. Optimal barrier zones for stopping the invasion of Aedes aegypti mosquitoes via transgenic or sterile insect techniques

    KAUST Repository

    Lee, S. Seirin; Baker, Ruth E.; Gaffney, Eamonn A.; White, Steven M.

    2013-01-01

    (Release of Insects carrying a Dominant Lethal), for controlling invasion of the mosquito Aedes aegypti using a spatial stage-structured mathematical model. In particular, we explore the use of a barrier zone of sterile/transgenic insects to prevent

  5. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  6. Lethal complication after abdominal wall reduction

    NARCIS (Netherlands)

    van Samkar, G.; van der Hoeven, J.; Hollmann, M. W.; Goslings, J. C.

    2009-01-01

    Obesity is a growing medical problem in Europe and the USA. Plastic surgery is increasing in popularity as a treatment option for correcting skin surplus after dieting. This is often done in private clinics, and is not without risk. In this case, the early symptoms of disproportionate pain and

  7. Efficacy of a shower cream and a lotion with skin-identical lipids in healthy subjects with atopic dry skin.

    Science.gov (United States)

    Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria

    2018-05-10

    Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.

  8. Sub-Lethal Dose of Shiga toxin 2 from Enterohemorrhagic Escherichia coli Affects Balance and Cerebellar Cythoarquitecture.

    Directory of Open Access Journals (Sweden)

    Luciana eD’Alessio

    2016-02-01

    Full Text Available Shiga toxin producing Escherichia coli may damage the central nervous system before or concomitantly to manifested hemolytic uremic syndrome symptoms. The cerebellum is frequently damaged during this syndrome, however the deleterious effects of Shiga toxin 2 has never been integrally reported by ultrastructural, physiological and behavioral means. The aim of this study was to determine the cerebellar compromise after intravenous administration of a sub-lethal dose of Shiga toxin 2 by measuring the cerebellar blood brain barrier permeability, behavioral task of cerebellar functionality (inclined plane test, and ultrastructural analysis (transmission electron microscope. Intravenous administration of vehicle (control group, sub-lethal dose of 0.5 ηg and 1 ηg of Stx2 per mouse were tested for behavioral and ultrastructural studies. A set of three independent experiments were performed for each study (n=6. Blood–Brain Barrier resulted damaged and consequently its permeability was significantly increased. Lower scores obtained in the inclined plane task denoted poor cerebellar functionality in comparison to their controls. The most significant lower score was obtained after 5 days of 1ηg of toxin administration. Transmission electron microscope micrographs from the Stx2-treated groups showed neurons with a progressive neurodegenerative condition in a dose dependent manner. As sub-lethal intravenous Shiga toxin 2 altered the blood brain barrier permeability in the cerebellum the toxin penetrated the cerebellar parenchyma and produced cell damaged with significant functional implications in the test balance.

  9. Computed tomography of lethal medline granuloma

    International Nuclear Information System (INIS)

    Lee, Ho Suk; Kim, Tae Ho; Suh, Kyung Jin; Kim, Tae Hun; Kim, Yong Joo; Kang, Duk Sik

    1991-01-01

    In order to clarify the CT findings of lethal midline granuloma (LMG) diagnosed clinically or histopathologically, the authors retrospectively analyzed 12 patients who were seen at Kyungpook National University Hospital from February 1985 to August 1989. CT showed nasal mucosal thickening and / or soft tissue mass (9 case), spreading of the lesions along the facial subcutaneous fat plane (8 cases), invasion into the paranasal sinuses (5 cases), bone destruction (5 cases), nasopharyngeal mass lesion (2 cases), and extension of the lesion into the infratemporal fossa (1 case). In spite of the fact that CT does not make definitive diagnosis of LMG, it permits evaluation of the extent of the lesion, detection of the combined lesion, differential diagnosis, and close monitoring of its evolution under treatment

  10. Gluconeogenesis in lethally X-irradiated rats

    International Nuclear Information System (INIS)

    Paulikova, E.; Ahlers, I.; Praslicka, M.

    1983-01-01

    The in vivo incorporation of U- 14 C-alanine into blood glucose and liver glycogen was measured in rats irradiated with a single whole body lethal dose of X-rays. Changes in gluconeogenic enzyme activities were studied in the liver. Increased incorporation of 14 C-alanine into blood glucose and liver glycogen were found after irradiation. Liver phosphoenolpyruvate carboxykinase and glycogenic activity underwent almost parallel changes and were significantly elevated from the 6th to the 48th hour, with resultant accumulation of glycogen. Glucose-6-phosphatase activity was depressed and there was a negative correlation between it and liver glycogen concentration. Maximum fructose-1,6-diphosphatase activity was found at 48 hours. The results show that glycogen accumulation in the liver and the raised blood glucose level in X-irradiated rats are based on raised gluconeogenesis. (author)

  11. Gluconeogenesis in lethally X-irradiated rats

    Energy Technology Data Exchange (ETDEWEB)

    Paulikova, E.; Ahlers, I.; Praslicka, M. (Univerzita P.J. Safarika, Kosice (Czechoslovakia). Katedra Vseobecnej Biologie)

    1983-02-01

    The in vivo incorporation of U-/sup 14/C-alanine into blood glucose and liver glycogen was measured in rats irradiated with a single whole body lethal dose of X-rays. Changes in gluconeogenic enzyme activities were studied in the liver. Increased incorporation of /sup 14/C-alanine into blood glucose and liver glycogen were found after irradiation. Liver phosphoenolpyruvate carboxykinase and glycogenic activity underwent almost parallel changes and were significantly elevated from the 6th to the 48th hour, with resultant accumulation of glycogen. Glucose-6-phosphatase activity was depressed and there was a negative correlation between it and liver glycogen concentration. Maximum fructose-1,6-diphosphatase activity was found at 48 hours. The results show that glycogen accumulation in the liver and the raised blood glucose level in X-irradiated rats are based on raised gluconeogenesis.

  12. Ants defend aphids against lethal disease

    Science.gov (United States)

    Nielsen, Charlotte; Agrawal, Anurag A.; Hajek, Ann E.

    2010-01-01

    Social insects defend their own colonies and some species also protect their mutualist partners. In mutualisms with aphids, ants typically feed on honeydew produced by aphids and, in turn guard and shelter aphid colonies from insect natural enemies. Here we report that Formica podzolica ants tending milkweed aphids, Aphis asclepiadis, protect aphid colonies from lethal fungal infections caused by an obligate aphid pathogen, Pandora neoaphidis. In field experiments, bodies of fungal-killed aphids were quickly removed from ant-tended aphid colonies. Ant workers were also able to detect infective conidia on the cuticle of living aphids and responded by either removing or grooming these aphids. Our results extend the long-standing view of ants as mutualists and protectors of aphids by demonstrating focused sanitizing and quarantining behaviour that may lead to reduced disease transmission in aphid colonies. PMID:19923138

  13. Lethal photosensitization of biofilm-grown bacteria

    Science.gov (United States)

    Wilson, Michael

    1997-12-01

    Antibacterial agents are increasingly being used for the prophylaxis and treatment of oral diseases. As these agents can be rendered ineffective by resistance development in the target organisms there is a need to develop alternative antimicrobial approaches. Light-activated antimicrobial agents release singlet oxygen and free radicals which can kill adjacent bacteria and a wide range of cariogenic and periodontopathogenic bacteria has been shown to be susceptible to such agents. In the oral cavity these organisms are present as biofilms (dental plaques) which are less susceptible to traditional antimicrobial agents than bacterial suspensions. The results of these studies have shown that biofilm-grown oral bacteria are also susceptible to lethal photosensitization although the light energy doses required are grater than those needed to kill the organisms when they are grown as aqueous suspensions.

  14. Tityus serrulatus venom--A lethal cocktail.

    Science.gov (United States)

    Pucca, Manuela Berto; Cerni, Felipe Augusto; Pinheiro Junior, Ernesto Lopes; Bordon, Karla de Castro Figueiredo; Amorim, Fernanda Gobbi; Cordeiro, Francielle Almeida; Longhim, Heloisa Tavoni; Cremonez, Caroline Marroni; Oliveira, Guilherme Honda; Arantes, Eliane Candiani

    2015-12-15

    Tityus serrulatus (Ts) is the main scorpion species of medical importance in Brazil. Ts venom is composed of several compounds such as mucus, inorganic salts, lipids, amines, nucleotides, enzymes, kallikrein inhibitor, natriuretic peptide, proteins with high molecular mass, peptides, free amino acids and neurotoxins. Neurotoxins are considered the most responsible for the envenoming syndrome due to their pharmacological action on ion channels such as voltage-gated sodium (Nav) and potassium (Kv) channels. The major goal of this review is to present important advances in Ts envenoming research, correlating both the crude Ts venom and isolated toxins with alterations observed in all human systems. The most remarkable event lies in the Ts induced massive releasing of neurotransmitters influencing, directly or indirectly, the entire body. Ts venom proved to extremely affect nervous and muscular systems, to modulate the immune system, to induce cardiac disorders, to cause pulmonary edema, to decrease urinary flow and to alter endocrine, exocrine, reproductive, integumentary, skeletal and digestive functions. Therefore, Ts venom possesses toxins affecting all anatomic systems, making it a lethal cocktail. However, its low lethality may be due to the low venom mass injected, to the different venom compositions, the body characteristics and health conditions of the victim and the local of Ts sting. Furthermore, we also described the different treatments employed during envenoming cases. In particular, throughout the review, an effort will be made to provide information from an extensive documented studies concerning Ts venom in vitro, in animals and in humans (a total of 151 references). Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Lethal action of soluble metallic salts on fishes

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, K E

    1927-01-01

    A study of pollution of Welsh rivers by lead-mine effluents revealed the fact that fishes were killed by the action of soluble salts of lead, which proved lethal at concentrations so low as pb i : 3,000,000. A physiological investigation of the action of lead-salts revealed the following facts: the action does not correspond to the normal toxic type. The graph of survival-times in different concentrations closely follows the equation: K = i/t log i/conc. The speed of the reaction is dependent upon the total quantity of metallic ion present, as well as upon the actual concentrations. The speed of the reaction varies in inverse relation to the size and weight of fishes employed. The most marked symptom is the formation of a film over gills and skin, by interaction of the metallic ion with a mucus-constituent. Death by suffocation is the final result. Where insufficient lead ion is present, the film is shed off, and complete recovery takes place. The speed of the reaction varies in direct relation to the temperature. Chemical analysis of residues shows that no trace of metallic ion penetrates into the body itself. The action is thus held to be purely external in process, chemical in type, and mechanical in effect; i.e., it is not a toxic action in the ordinary sense of the term. The action of soluble salts of zinc, iron, copper, cadmium, and mercury is shown to follow the same law as that of lead. Attention is directed to the economic importance of the facts, in connection with the pollution of rivers.

  16. [Considerations on photoprotection and skin disorders].

    Science.gov (United States)

    Cestari, T Ferreira; de Oliveira, F Bazanella; Boza, J Catucci

    2012-11-01

    Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  17. Considerations on photoprotection and skin disorders.

    Science.gov (United States)

    Cestari, T Ferreira; Oliveira, F Bazanella de; Boza, J Catucci

    2012-12-01

    Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  18. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival.

    Science.gov (United States)

    Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen

    2015-12-22

    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

  19. Barrier Systems

    NARCIS (Netherlands)

    Heteren, S. van

    2015-01-01

    Barrier-system dynamics are a function of antecedent topography and substrate lithology, Relative sea-level (RSL) changes, sediment availability and type, climate, vegetation type and cover, and various aero- and hydrodynamic processes during fair-weather conditions and extreme events. Global change

  20. Melatonin, mitochondria, and the skin.

    Science.gov (United States)

    Slominski, Andrzej T; Zmijewski, Michal A; Semak, Igor; Kim, Tae-Kang; Janjetovic, Zorica; Slominski, Radomir M; Zmijewski, Jaroslaw W

    2017-11-01

    The skin being a protective barrier between external and internal (body) environments has the sensory and adaptive capacity to maintain local and global body homeostasis in response to noxious factors. An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism through the indolic and kynuric pathways. Indeed, melatonin and its metabolites have emerged as indispensable for physiological skin functions and for effective protection of a cutaneous homeostasis from hostile environmental factors. Moreover, they attenuate the pathological processes including carcinogenesis and other hyperproliferative/inflammatory conditions. Interestingly, mitochondria appear to be a central hub of melatonin metabolism in the skin cells. Furthermore, substantial evidence has accumulated on the protective role of the melatonin against ultraviolet radiation and the attendant mitochondrial dysfunction. Melatonin and its metabolites appear to have a modulatory impact on mitochondrion redox and bioenergetic homeostasis, as well as the anti-apoptotic effects. Of note, some metabolites exhibit even greater impact than melatonin alone. Herein, we emphasize that melatonin-mitochondria axis would control integumental functions designed to protect local and perhaps global homeostasis. Given the phylogenetic origin and primordial actions of melatonin, we propose that the melatonin-related mitochondrial functions represent an evolutionary conserved mechanism involved in cellular adaptive response to skin injury and repair.

  1. Impact of chemical peeling combined with negative pressure on human skin.

    Science.gov (United States)

    Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J

    2016-10-01

    In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  2. Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.

    Science.gov (United States)

    Mitragotri, Samir

    2013-01-01

    Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.

  3. Chronic exposure of corals to fine sediments: lethal and sub-lethal impacts.

    Directory of Open Access Journals (Sweden)

    Florita Flores

    Full Text Available Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata more than the upright branching species (Acropora millepora. The lowest sediment treatments that caused full colony mortality were 30 mg l(-1 TSS (25 mg cm(-2 day(-1 for M. aequituberculata and 100 mg l(-1 TSS (83 mg cm(-2 day(-1 for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue.

  4. Chronic Exposure of Corals to Fine Sediments: Lethal and Sub-Lethal Impacts

    Science.gov (United States)

    Flores, Florita; Hoogenboom, Mia O.; Smith, Luke D.; Cooper, Timothy F.; Abrego, David; Negri, Andrew P.

    2012-01-01

    Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS) for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata) more than the upright branching species (Acropora millepora). The lowest sediment treatments that caused full colony mortality were 30 mg l−1 TSS (25 mg cm−2 day−1) for M. aequituberculata and 100 mg l−1 TSS (83 mg cm−2 day−1) for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue. PMID:22662225

  5. Effects of various vehicles on skin hydration in vivo.

    Science.gov (United States)

    Wiedersberg, S; Leopold, C S; Guy, R H

    2009-01-01

    The stratum corneum, the outermost layer of the skin, regulates the passive loss of water to the environment. Furthermore, it is well accepted that drug penetration is influenced by skin hydration, which may be manipulated by the application of moisturizing or oleaginous vehicles. Measurements of transepidermal water loss (TEWL), and of skin hydration using a corneometer, were used to assess the effect of different vehicles on stratum corneum barrier function in vivo in human volunteers. A microemulsion significantly increased skin hydration relative to a reference vehicle based on medium chain triglycerides; in contrast, Transcutol(R) lowered skin hydration. TEWL measurements confirmed these observations. Copyright 2009 S. Karger AG, Basel.

  6. Natural considerations for skin of color.

    Science.gov (United States)

    Baumann, Leslie; Rodriguez, David; Taylor, Susan C; Wu, Jessica

    2006-12-01

    Changing US demographics indicate that dermatologists will treat an increasing number of individuals of color. Early research on cutaneous anatomy and physiology was performed mostly in white populations. However, new research is elucidating similarities and differences in skin of color and white skin with regard to skin barrier, pigmentation, and sensitivity. Two of the most important issues are skin lightening and brightening. Products for use on skin of color typically should be gentle because of the proclivity of more deeply pigmented skin to develop pigmentary abnormalities in response to skin irritation or trauma. Increasing patient interest in natural remedies has been matched by research on the use of natural ingredients in dermatology. The relative gentleness of many of these products, coupled with excellent efficacy, makes natural ingredients such as soy and licorice excellent choices in the treatment of disorders such as postinflammatory hyperpigmentation (PIH) and melasma. For daily skin care, ingredients such as oatmeal and feverfew are good choices for gentle cleansing and moisturizing of dry, sensitive, or ashy skin. Sun protection is an increasing concern due to rising rates of melanoma. Several botanical products are useful in augmenting photoprotection with conventional sunscreens.

  7. MicroRNAs in skin tissue engineering.

    Science.gov (United States)

    Miller, Kyle J; Brown, David A; Ibrahim, Mohamed M; Ramchal, Talisha D; Levinson, Howard

    2015-07-01

    35.2 million annual cases in the U.S. require clinical intervention for major skin loss. To meet this demand, the field of skin tissue engineering has grown rapidly over the past 40 years. Traditionally, skin tissue engineering relies on the "cell-scaffold-signal" approach, whereby isolated cells are formulated into a three-dimensional substrate matrix, or scaffold, and exposed to the proper molecular, physical, and/or electrical signals to encourage growth and differentiation. However, clinically available bioengineered skin equivalents (BSEs) suffer from a number of drawbacks, including time required to generate autologous BSEs, poor allogeneic BSE survival, and physical limitations such as mass transfer issues. Additionally, different types of skin wounds require different BSE designs. MicroRNA has recently emerged as a new and exciting field of RNA interference that can overcome the barriers of BSE design. MicroRNA can regulate cellular behavior, change the bioactive milieu of the skin, and be delivered to skin tissue in a number of ways. While it is still in its infancy, the use of microRNAs in skin tissue engineering offers the opportunity to both enhance and expand a field for which there is still a vast unmet clinical need. Here we give a review of skin tissue engineering, focusing on the important cellular processes, bioactive mediators, and scaffolds. We further discuss potential microRNA targets for each individual component, and we conclude with possible future applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

    2013-02-15

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

  9. Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

    International Nuclear Information System (INIS)

    Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

    2013-01-01

    Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

  10. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... of Skin Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can ... rarely, younger children can develop skin cancer. How can people with dark skin get skin cancer? Although ...

  11. Information barriers

    International Nuclear Information System (INIS)

    Fuller, J.L.; Wolford, J.

    2001-01-01

    Full text: An information barrier (IB) consists of procedures and technology that prevent the release of sensitive information during a joint inspection of a sensitive nuclear item, and provides confidence that the measurement system into which it has been integrated functions exactly as designed and constructed. Work in the U.S. on radiation detection system information barriers dates back at least to 1990, even though the terminology is more recent. In January 1999 the Joint DoD-DOE Information Barrier Working Group was formed in the United States to help coordinate technical efforts related to information barrier R and D. This paper presents an overview of the efforts of this group, by its Chairs, as well as recommendations for further information barrier R and D. Progress on the demonstration of monitoring systems containing IBs is also provided. From the U.S. perspective, the basic, top-level functional requirements for the information barrier portion of an integrated radiation signature-information barrier inspection system are twofold: The host must be assured that his classified information is protected from disclosure to the inspecting party; and The inspecting party must be confident that the integrated inspection system measures, processes, and presents the radiation-signature-based measurement conclusion in an accurate and reproducible manner. It is the position of the United States that in the absence of any agreement to share classified nuclear weapons design information in the conduct of an inspection regime, the requirement to protect host country classified warhead design information is paramount and admits no tradeoff versus the confidence provided to the inspecting party in the accuracy and reproducibility of the measurements. The U.S. has reached an internal consensus on several critical design elements that define a general standard for radiation signature information barrier design. These criteria have stood the test of time under intense

  12. Lethal and sub-lethal effects of five pesticides used in rice farming on the earthworm Eisenia fetida

    NARCIS (Netherlands)

    Rico, Andreu; Sabater, Consuelo; Castillo, María Ángeles

    2016-01-01

    The toxicity of five pesticides typically used in rice farming (trichlorfon, dimethoate, carbendazim, tebuconazole and prochloraz) was evaluated on different lethal and sub-lethal endpoints of the earthworm Eisenia fetida. The evaluated endpoints included: avoidance behaviour after an exposure

  13. Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.

    Science.gov (United States)

    Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas

    2017-07-15

    A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H 2 O 2 and the amperometric current response was recorded. The observed current is due to H 2 O 2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O 2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H 2 O 2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H 2 O 2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H 2 O 2 ). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Floating barrier

    Energy Technology Data Exchange (ETDEWEB)

    1968-05-06

    This floating barrier consists of relatively long elements which can be connected to form a practically continuous assembly. Each element consists of an inflatable tube with an apron of certain height, made of impregnated fabric which is resistant to ocean water and also to hydrocarbons. Means for connecting one element to the following one, and means for attaching ballast to the apron are also provided.

  15. Lethal endomyocarditis caused by chronic "Krokodil" intoxication.

    Science.gov (United States)

    Sorrentino, Antonella; Trotta, Silvia; Colucci, Anna Pia; Aventaggiato, Lucia; Marzullo, Andrea; Solarino, Biagio

    2018-03-19

    "Krokodil" is a home-made opioid drug obtained by synthesizing desomorphine from codeine and combining it with other low-cost additives. Initially introduced in the former Soviet countries, it was then imported to Western Europe as a heroin substitute. To our knowledge, this is the first report of an Italian case of lethal krokodil abuse, that occurred in a 39-year-old man, who died suddenly after transportation to the Emergency Department (ED) for hyperthermia associated with sweating, dyspnoea and tachycardia. Post-mortem examination revealed extensive necrotic ulcerative lesions on the forearms, and autopsy showed a hypertrophic heart with ample endocardial vegetation on the aortic valve and patency of the foramen ovale. Histopathological examination of the heart showed ulcero-vegetative lesions of the aortic valve with an abscess on the annulus and extension to the periaortic adipose tissue, as well as diffuse myocardial interstitial inflammatory neutrophilic infiltrates. Toxicological analysis demonstrated a desomorphine metabolite in urine. On the basis of all these findings the cause of death was ruled to be congestive heart failure caused by endocarditis and myocarditis, correlated with chronic abuse of krokodil.

  16. Tumor clone dynamics in lethal prostate cancer.

    Science.gov (United States)

    Carreira, Suzanne; Romanel, Alessandro; Goodall, Jane; Grist, Emily; Ferraldeschi, Roberta; Miranda, Susana; Prandi, Davide; Lorente, David; Frenel, Jean-Sebastien; Pezaro, Carmel; Omlin, Aurelius; Rodrigues, Daniel Nava; Flohr, Penelope; Tunariu, Nina; S de Bono, Johann; Demichelis, Francesca; Attard, Gerhardt

    2014-09-17

    It is unclear whether a single clone metastasizes and remains dominant over the course of lethal prostate cancer. We describe the clonal architectural heterogeneity at different stages of disease progression by sequencing serial plasma and tumor samples from 16 ERG-positive patients. By characterizing the clonality of commonly occurring deletions at 21q22, 8p21, and 10q23, we identified multiple independent clones in metastatic disease that are differentially represented in tissue and circulation. To exemplify the clinical utility of our studies, we then showed a temporal association between clinical progression and emergence of androgen receptor (AR) mutations activated by glucocorticoids in about 20% of patients progressing on abiraterone and prednisolone or dexamethasone. Resistant clones showed a complex dynamic with temporal and spatial heterogeneity, suggesting distinct mechanisms of resistance at different sites that emerged and regressed depending on treatment selection pressure. This introduces a management paradigm requiring sequential monitoring of advanced prostate cancer patients with plasma and tumor biopsies to ensure early discontinuation of agents when they become potential disease drivers. Copyright © 2014, American Association for the Advancement of Science.

  17. Human cooperation by lethal group competition.

    Science.gov (United States)

    Egas, Martijn; Kats, Ralph; van der Sar, Xander; Reuben, Ernesto; Sabelis, Maurice W

    2013-01-01

    Why humans are prone to cooperate puzzles biologists, psychologists and economists alike. Between-group conflict has been hypothesized to drive within-group cooperation. However, such conflicts did not have lasting effects in laboratory experiments, because they were about luxury goods, not needed for survival ("looting"). Here, we find within-group cooperation to last when between-group conflict is implemented as "all-out war" (eliminating the weakest groups). Human subjects invested in helping group members to avoid having the lowest collective pay-off, whereas they failed to cooperate in control treatments with random group elimination or with no subdivision in groups. When the game was repeated, experience was found to promote helping. Thus, not within-group interactions alone, not random group elimination, but pay-off-dependent group elimination was found to drive within-group cooperation in our experiment. We suggest that some forms of human cooperation are maintained by multi-level selection: reciprocity within groups and lethal competition among groups acting together.

  18. Abnormally dark or light skin

    Science.gov (United States)

    Hyperpigmentation; Hypopigmentation; Skin - abnormally light or dark ... Normal skin contains cells called melanocytes. These cells produce melanin , the substance that gives skin its color. Skin with ...

  19. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  20. Histoplasma skin test

    Science.gov (United States)

    Histoplasmosis skin test ... health care provider cleans an area of your skin, usually the forearm. An allergen is injected just below the cleaned skin surface. An allergen is a substance that causes ...

  1. Skin Condition Finder

    Science.gov (United States)

    ... SKIN CONDITIONS HEALTH TOPICS FOR PROFESSIONALS Rash and Skin Condition Finder 1 Select Age Group Infant Child ... Toe Toe Webspace Toe Nail CLOSE About the Skin Condition Finder Have a health question or concern? ...

  2. Skin Complications of IBD

    Science.gov (United States)

    ... Home > Resources > Skin Complications of IBD Go Back Skin Complications of IBD Email Print + Share After arthritis, ... about 5% of people with inflammatory bowel disease. SKIN DISORDERS COMMONLY SEEN IN IBD ERHTHEMA NODOSUM The ...

  3. Skin Peeling Syndrome

    Directory of Open Access Journals (Sweden)

    Sharma Rajeev

    2000-01-01

    Full Text Available Peeling of the skin is an uncommonly encountered disorder. Occurrence of vesicles and bullae in peeling skin syndrome is very rare. We report a case of idiopathic peeling skin syndrome with vesicular lesions.

  4. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-01-01

    positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking

  5. Chromium-induced skin damage among Taiwanese cement workers.

    Science.gov (United States)

    Chou, Tzu-Chieh; Wang, Po-Chih; Wu, Jyun-De; Sheu, Shiann-Cherng

    2016-10-01

    Little research has been done on the relationships between chromium exposure, skin barrier function, and other hygienic habits in cement workers. Our purpose was to investigate chromium-induced skin barrier disruption due to cement exposure among cement workers. One hundred and eight cement workers were recruited in this study. Urinary chromium concentration was used to characterize exposure levels. The biological exposure index was used to separate high and low chromium exposure. Transepidermal water loss (TEWL) was used to assess the skin barrier function. TEWL was significantly increased in workers with high chromium exposure levels than those with low chromium exposure levels (p = 0.048). A positive correlation was also found between urinary chromium concentration and TEWL (R = 0.28, p = 0.004). After adjusting for smoking status and glove use, a significant correlation between urinary chromium concentrations and TEWL remained. Moreover, workers who smoked and had a high chromium exposure had significantly increased TEWL compared to nonsmokers with low chromium exposure (p = 0.01). Skin barrier function of cement workers may have been disrupted by chromium in cement, and smoking might significantly enhance such skin barrier perturbation with chromium exposure. Decreased chromium skin exposure and smoking cessation should be encouraged at work. © The Author(s) 2015.

  6. A new type of lethal short-limbed dwarfism

    International Nuclear Information System (INIS)

    Nairn, E.R.; Chapman, S.

    1989-01-01

    Details are presented of a most unusual osteo-chondrodysplasia which presents with lethal neonatal short-limbed dwarfism, defective ossification and nodular calcification with cartilage. The features resemble one case previously described in the literature. (orig.)

  7. Back to the future: revisiting HIV-1 lethal mutagenesis

    Science.gov (United States)

    Dapp, Michael J.; Patterson, Steven E.; Mansky, Louis M.

    2012-01-01

    The concept of eliminating HIV-1 infectivity by elevating the viral mutation rate was first proposed over a decade ago, even though the general concept had been conceived earlier for RNA viruses. Lethal mutagenesis was originally viewed as a novel chemotherapeutic approach for treating HIV-1 infection in which use of a viral mutagen would over multiple rounds of replication lead to the lethal accumulation of mutations, rendering the virus population non infectious – known as the slow mutation accumulation model. There have been limitations in obtaining good efficacy data with drug leads, leaving some doubt into clinical translation. More recent studies of the APOBEC3 proteins as well as new progress in the use of nucleoside analogs for inducing lethal mutagenesis have helped to refocus attention on rapid induction of HIV-1 lethal mutagenesis in a single or limited number of replication cycles leading to a rapid mutation accumulation model. PMID:23195922

  8. New type of lethal short-limbed dwarfism

    Energy Technology Data Exchange (ETDEWEB)

    Nairn, E.R.; Chapman, S.

    1989-05-01

    Details are presented of a most unusual osteo-chondrodysplasia which presents with lethal neonatal short-limbed dwarfism, defective ossification and nodular calcification with cartilage. The features resemble one case previously described in the literature.

  9. Perinatal-lethal Gaucher disease presenting as hydrops fetalis.

    Science.gov (United States)

    BenHamida, Emira; Ayadi, Imene; Ouertani, Ines; Chammem, Maroua; Bezzine, Ahlem; BenTmime, Riadh; Attia, Leila; Mrad, Ridha; Marrakchi, Zahra

    2015-01-01

    Perinatal-lethal Gaucher disease is very rare and is considered a variant of type 2 Gaucher disease that occurs in the neonatal period. The most distinct features of perinatal-lethal Gaucher disease are non-immune hydrops fetalis. Less common signs of the disease are hepatosplenomegaly, ichthyosis and arthrogryposis. We report a case of Gaucher's disease (type 2) diagnosed in a newborn who presented with Hydrops Fetalis.

  10. Conflict Without Casualties: Non-Lethal Weapons in Irregular Warfare

    Science.gov (United States)

    2007-09-01

    the body,” and the Geneva Protocol of 1925, bans the use of chemical and biological weapons .11 On 8 April 1975, President Ford issued Executive...E Funding – PE 63851M) (accessed 15 December 2006). The American Journal of Bioethics . “Medical Ethics and Non-Lethal Weapons .” Bioethics.net...CASUALTIES: NON-LETHAL WEAPONS IN IRREGULAR WARFARE by Richard L. Scott September 2007 Thesis Advisor: Robert McNab Second Reader

  11. Non-Lethal Weapons: Opportunities for R&D

    Science.gov (United States)

    2004-12-01

    during the Vietnam War. US; emulsifying agents are used in food processing, drilling fluids, cosmetics , pharmaceuticals, heavy- duty cleaners, textile...conducted in a professional manner, with no threat to public safety or the environment. 11 References [1] Fenton , G., (2001). NLW Technology Taxonomy...W.A., Mason, R.L., Collins, K.R., (2000). Non-Lethal Applicants of Slippery Substances. NDIA Non-Lethal Defense IV. [24] Fenton , G., (2000). Overview

  12. Lethal synergy involving bicyclomycin: an approach for reviving old antibiotics.

    Science.gov (United States)

    Malik, Muhammad; Li, Liping; Zhao, Xilin; Kerns, Robert J; Berger, James M; Drlica, Karl

    2014-12-01

    One way to address the growing problem of antimicrobial resistance is to revive old compounds that may have intrinsic lethal activity that is obscured by protective factors. Bicyclomycin is an old inhibitor of the Rho transcription terminator that by itself shows little rapid lethal activity. However, bicyclomycin participates in bacteriostatic synergy, which raises the possibility that conditions for lethal synergy may exist, perhaps through a suppression of protective factors. Bicyclomycin was combined with bacteriostatic inhibitors of gene expression, and bactericidal activity was measured with several cultured Gram-negative pathogens. When used alone, bicyclomycin failed to rapidly kill growing cultures of Escherichia coli; however, the additional presence of bacteriostatic concentrations of tetracycline, chloramphenicol or rifampicin led to rapid killing. Four other pathogen species, Acinetobacter baumannii, Klebsiella pneumoniae, Salmonella enterica serotype Typhimurium and Shigella dysenteriae, also exhibited enhanced killing when bicyclomycin was combined with tetracycline or rifampicin. This lethal synergy was achieved at low concentrations (slightly above the MIC) for all agents tested in combinations. Follow-up work with E. coli indicated that lethal synergy arose from a blockage of transcription elongation. Moreover, lethal synergy was reduced when bicyclomycin was added 60 min before tetracycline, suggesting that bicyclomycin induces a protective factor. The action of bicyclomycin illustrates the potential present in a largely abandoned antibacterial agent; it exhibits lethal synergy when coadministered with known, bacteriostatic inhibitors of gene expression. The identification of protective factors, which are currently uncharacterized, may reveal new ways to promote the lethal action of some old antibiotics. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved

  13. Sonographic features of lethal multiple pterygium syndrome at 14 weeks.

    Science.gov (United States)

    Chen, Min; Chan, Gavin Shueng Wai; Lee, Chin Peng; Tang, Mary Hoi Yin

    2005-06-01

    Lethal multiple pterygium syndrome is a rare inherited disorder. Previous reports suggest that the diagnosis may be based on prenatal sonographic demonstration of severe limb flexion, absence of fetal motion, and a large cystic hygroma in the second and third trimesters. We present the sonographic features and postmortem features of a fetus with lethal multiple pterygium syndrome at 13 weeks of gestation, which shows that the condition can possibly be diagnosed in the first trimester of pregnancy.

  14. Protective properties of plasma of burnt and irradiated rats against lethal effect of endotoxins in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Budagov, R S; Chureyeva, L N

    1984-10-01

    The purpose of this work was to estimate protective properties of plasma in disease with increased endotoxemia. Burns and acute radiation sickness were used as models of suppression of physiological mechanisms of detoxication. Experiments were performed on male Wistar rats and mice, which received 3rd degree burns over 15% of the body surface, whole body gamma irradiation at 7.5 Gr or both. At 3 hours, 3, 7 and 12 days after the exposure the animals were decapitated and blood collected. The irradiated mice received 0.2 ml endotoxin intraperitoneally, 1.0 ml freshly prepared rat plasma, then the lethality of the mice in 24 hours was observed. It was found that the plasma of intact rats was capable of decreasing the lethal effects of S. typhimurium and E. coli endotoxins in vivo in mice. Deep skin burns, acute radiation sickness and the combined effects of radiation and thermal injury did not change this phenomenon. The plasma of the experimental rats retained the protective properties at various periods of time after the thermal, radiation and combined exposures. The functioning of the humoral detoxication mechanism is radioresistant, indirectly indicating the nonimmunoglobulin nature of endotoxin inactivators. 19 references.

  15. Prevalence and lethality among patients with histoplasmosis and AIDS in the Midwest Region of Brazil.

    Science.gov (United States)

    Silva, Thaísa C; Treméa, Carolina M; Zara, Ana Laura S A; Mendonça, Ana Flávia; Godoy, Cássia S M; Costa, Carolina R; Souza, Lúcia K H; Silva, Maria R R

    2017-01-01

    Histoplasmosis is a systemic mycosis that is considered an important public health problem. In this work, we performed a descriptive, observational, cross-sectional and retrospective study with a secondary data analysis of medical records from 2000 to 2012 at a tertiary hospital. The study sample consisted of 275 patients with laboratory-confirmed Disseminated Histoplasmosis (DH)/AIDS. The results showed that the prevalence of DH associated with AIDS was 4.4%. The majority of patients were young adult men with fever in 84.2%, cough in 63.4%, weight loss in 63.1%, diarrhoea in 44.8% and skin manifestations in 27.6% of patients. In the overall cohort, the CD4 counts were low, but not significantly different in survivors and non-survivors. Higher levels of urea and lower levels of haemoglobin and platelets were observed in non-survivor patients (<.05). The global lethality was 71.3% (196/275). The results with high prevalence and lethality highlight the need to adopt measures to facilitate early diagnosis, proper treatment and improved prognosis. © 2016 Blackwell Verlag GmbH.

  16. Skin, Hair, and Nails

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Skin, Hair, and Nails KidsHealth / For Parents / Skin, Hair, and ... piel, el cabello y las uñas About Skin, Hair and Nails Skin is our largest organ. If ...

  17. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  18. Urostomy - stoma and skin care

    Science.gov (United States)

    ... it well before you attach the pouch. Avoid skin care products that contain alcohol. These can make your skin ... the pouch to your skin. Use fewer special skin care products. This will make problems with your skin less ...

  19. Risks of Skin Cancer Screening

    Science.gov (United States)

    ... factors increase or decrease the risk of skin cancer. Skin cancer is a disease in which malignant (cancer) ... following PDQ summaries for more information about skin cancer: Skin Cancer Prevention Skin Cancer Treatment Melanoma Treatment Genetics ...

  20. The biological basis for dose limitation to the skin

    International Nuclear Information System (INIS)

    Fry, R.J.M.

    1992-01-01

    Ionizing radiation may cause deterministic effects and cancer. It has been the policy to base dose limits for radiation protection of the skin on the prevention of deterministic effects (1). In the case of cancer in general, dose limitation for radiation protection is based on limiting excess cancer mortality to low levels of radiation. Since skin cancers are seldom lethal, the general radiation protection standards will protect against an increase in excess mortality from skin cancer. However, with the dose limits selected to prevent deterministic effects, there is a significant probability of an excess incidence of skin cancer occurring as a result of exposure during a working lifetime. The induction of skin cancer by radiation is influenced significantly by subsequent exposure to ultraviolet radiation (UVR) from sunlight. This finding raises not only interesting questions about the mechanisms involved, but also about the differences in risk of skin cancer in different populations. The amount and distribution of melanin in the skin determines the degree of the effect of UVR. This paper discusses the mechanisms of the induction of both deterministic and stochastic effects in skin exposed to radiation in relation to radiation protection. (author)

  1. New lethal disease involving type I and III collagen defect resembling geroderma osteodysplastica, De Barsy syndrome, and Ehlers-Danlos syndrome IV.

    OpenAIRE

    Jukkola, A; Kauppila, S; Risteli, L; Vuopala, K; Risteli, J; Leisti, J; Pajunen, L

    1998-01-01

    We describe the clinical findings and biochemical features of a male child suffering from a so far undescribed lethal connective tissue disorder characterised by extreme hypermobility of the joints, lax skin, cataracts, severe growth retardation, and insufficient production of type I and type III procollagens. His features are compared with Ehlers-Danlos type IV, De Barsy syndrome, and geroderma osteodysplastica, as these disorders show some symptoms and signs shared with our patient. The chi...

  2. Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

    Science.gov (United States)

    Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

    2009-05-01

    Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

  3. Diffusion of [2-14C]diazepam across hairless mouse skin and human skin

    International Nuclear Information System (INIS)

    Koch, R.L.; Palicharla, P.; Groves, M.J.

    1987-01-01

    The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. [ 14 C]Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the 14 C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber

  4. The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

    Directory of Open Access Journals (Sweden)

    Jang Hwan Min

    2014-07-01

    Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

  5. In vivo skin penetration of macromolecules in irritant contact dermatitis.

    Science.gov (United States)

    Abdel-Mottaleb, Mona M A; Lamprecht, Alf

    2016-12-30

    Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Empirical complexities in the genetic foundations of lethal mutagenesis.

    Science.gov (United States)

    Bull, James J; Joyce, Paul; Gladstone, Eric; Molineux, Ian J

    2013-10-01

    From population genetics theory, elevating the mutation rate of a large population should progressively reduce average fitness. If the fitness decline is large enough, the population will go extinct in a process known as lethal mutagenesis. Lethal mutagenesis has been endorsed in the virology literature as a promising approach to viral treatment, and several in vitro studies have forced viral extinction with high doses of mutagenic drugs. Yet only one empirical study has tested the genetic models underlying lethal mutagenesis, and the theory failed on even a qualitative level. Here we provide a new level of analysis of lethal mutagenesis by developing and evaluating models specifically tailored to empirical systems that may be used to test the theory. We first quantify a bias in the estimation of a critical parameter and consider whether that bias underlies the previously observed lack of concordance between theory and experiment. We then consider a seemingly ideal protocol that avoids this bias-mutagenesis of virions-but find that it is hampered by other problems. Finally, results that reveal difficulties in the mere interpretation of mutations assayed from double-strand genomes are derived. Our analyses expose unanticipated complexities in testing the theory. Nevertheless, the previous failure of the theory to predict experimental outcomes appears to reside in evolutionary mechanisms neglected by the theory (e.g., beneficial mutations) rather than from a mismatch between the empirical setup and model assumptions. This interpretation raises the specter that naive attempts at lethal mutagenesis may augment adaptation rather than retard it.

  7. A multivariate model of stakeholder preference for lethal cat management.

    Science.gov (United States)

    Wald, Dara M; Jacobson, Susan K

    2014-01-01

    Identifying stakeholder beliefs and attitudes is critical for resolving management conflicts. Debate over outdoor cat management is often described as a conflict between two groups, environmental advocates and animal welfare advocates, but little is known about the variables predicting differences among these critical stakeholder groups. We administered a mail survey to randomly selected stakeholders representing both of these groups (n=1,596) in Florida, where contention over the management of outdoor cats has been widespread. We used a structural equation model to evaluate stakeholder intention to support non-lethal management. The cognitive hierarchy model predicted that values influenced beliefs, which predicted general and specific attitudes, which in turn, influenced behavioral intentions. We posited that specific attitudes would mediate the effect of general attitudes, beliefs, and values on management support. Model fit statistics suggested that the final model fit the data well (CFI=0.94, RMSEA=0.062). The final model explained 74% of the variance in management support, and positive attitudes toward lethal management (humaneness) had the largest direct effect on management support. Specific attitudes toward lethal management and general attitudes toward outdoor cats mediated the relationship between positive (pstakeholder intention to support non-lethal cat management. Our findings suggest that stakeholders can simultaneously perceive both positive and negative beliefs about outdoor cats, which influence attitudes toward and support for non-lethal management.

  8. Rheological and sensory properties of hydrophilic skin protection gels based on polyacrylates.

    Science.gov (United States)

    Kulawik-Pióro, Agnieszka; Kurpiewska, Joanna; Kułaszka, Agnieszka

    2018-03-01

    With the current increases in occupational skin diseases, literature data attesting the decreasing efficiency of barrier creams with respect to the manufacturer's declarations and legal regulations granting skin protection gels for employees, research is required to analyse and evaluate the recipes used for hydrophilic skin protection gels based on polyacrylates. This study investigated the rheological properties, pH and sensory perception of hydrophilic barrier gels based on polyacrylates. The acrylic acid derivatives used were good thickeners, and helped to form transparent gels of adequate durability. They could be used to create hydrophilic films on the surface of the skin to protect it against hydrophobic substances. A correlation was shown between the results of the rheological properties and the barrier properties of the gels. This confirms the possibility of monitoring the quality of the gels at the stage of recipe development. Polyacrylates are viable for use in industry to produce hydrophilic barrier creams suitable for skin protection.

  9. Effects of air pollution on the skin: A review.

    Science.gov (United States)

    Puri, Poonam; Nandar, Shashi Kumar; Kathuria, Sushruta; Ramesh, V

    2017-01-01

    The increase in air pollution over the years has had major effects on the human skin. Various air pollutants such as ultraviolet radiation, polycyclic aromatic hydrocarbons, volatile organic compounds, oxides, particulate matter, ozone and cigarette smoke affect the skin as it is the outermost barrier. Air pollutants damage the skin by inducing oxidative stress. Although human skin acts as a biological shield against pro-oxidative chemicals and physical air pollutants, prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure to ultraviolet radiation has been associated with extrinsic skin aging and skin cancers. Cigarette smoke contributes to premature aging and an increase in the incidence of psoriasis, acne and skin cancers. It is also implicated in allergic skin conditions such as atopic dermatitis and eczema. Polyaromatic hydrocarbons are associated with extrinsic skin aging, pigmentation, cancers and acneiform eruptions. Volatile organic compounds have been associated with atopic dermatitis. Given the increasing levels of air pollution and its detrimental effects on the skin, it is advisable to use strategies to decrease air pollution.

  10. Infant Skin Care Products: What Are the Issues?

    Science.gov (United States)

    Kuller, Joanne McManus

    2016-10-01

    Infant skin is susceptible to dryness and irritation from external factors, including topical skin care products not formulated for the infant's skin. This may increase the risk of contact dermatitis. Parents frequently express concern regarding potential harm from ingredients in skin care products and seek information. This is complicated by several skin care myths. The purpose of this literature review was to provide evidence-based information to educate parents on the use of products for preterm and term infants. Multiple searches using PubMed were conducted including the search terms "infant skin care," "infant products," "infant bath," "emollients," "diaper skin care," and "diaper wipes." Reference lists of comprehensive reviews were also scanned. Google searches were used to assess consumer information, product information, and regulatory guidelines. There is little scientific evidence to support safety of natural/organic products on infant skin. Raw materials originate from different sources, complicating testing and comparisons of ingredients. Research shows that cleansers formulated for infant skin do not weaken the skin barrier the way harsher soaps and detergents can. Oils with the lowest oleic acid content provide a lower risk of irritant contact dermatitis. Nurses must be informed about natural and organic products, preservatives, and fragrances and know the definition of commonly used marketing terms. Decisions regarding the use of infant products in preterm and term infants should be evidence based. More research is needed to support claims regarding the safety of products used on infant skin.

  11. Sprache als Barriere (Language as a Barrier)

    Science.gov (United States)

    Mattheier, Klaus

    1974-01-01

    The concept of language barrier has its derivations in the fields of dialectology, sociology and psychology. In contemporary usage however, the concept has two meanings i.e. regional-cultural barrier and socio-cultural barrier. (Text is in German.) (DS)

  12. Experimental skin carcinoma by UVB application

    Directory of Open Access Journals (Sweden)

    Andrada Iftode

    2016-12-01

    Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier function of the skin was degraded in UVB exposed mice. DMBA and TPA depended on carcinogens schedule and corelated with skin carcinoma. Graphical abstract: Schematic protocol of experimental skin carcinoma REFERENCES 1. Lee Ja, Ko Jh, Jung Bg, Kim Th, Hong Ji, Park Ys, Lee Bj. Fermented Prunus mume with Probiotics Inhibits 7,12- Dimethylbenz[a]anthracene and 12-OTetradecanoyl phorbol-13-acetate Induced Skin Carcinogenesis through Alleviation of Oxidative Stress. Asian Pac J Cancer Prev. 2013;14:2973-2978. 2. Firooz A, Sadr B, Babakoohi S, Sarraf-Yazdy M, Fanian F, Kazerouni-Timsar A, NassiriKashani M, Naghizadeh MM, Dowlati Y. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region. Scientific World Journal. 2012; doi.org/10.1100/2012/386936 3. Gheorgheosu (Coricovac D, Borcan F, Balasz NI, Soica C, Simu G, Kemeny L, Dehelean CA. Evaluation of skin parameters in C57BL/6J mice exposed to chemical and environmental factors using non-invasive methods. J Agroalim Proc Technol. 2014;20:14-20.

  13. Effects of lethal and non-lethal malaria on the mononuclear phagocyte system

    Directory of Open Access Journals (Sweden)

    Carlos Eduardo Tosta

    1983-03-01

    Full Text Available The effects ofone non-lethal species ofmalarialparasite, Plasmodium yoelii, and one lethal species, P. berghei, on the mononuclear phagocyte system (MPS of BALB/c mice were studied. P. yoelii caused a greater and more sustained expansion and activation of the MPS, and the two major populations of spleen phagocytic cells-red pulp and marginal zone macrophages - exhibited a greater increase in numbers in this infection. During the course of P. berghei mataria, the spleen was progressively occupied by haematopoietic tissue and, at the terminal stage of infection, an extensive depletion of lymphocytes and macrophages was apparent. The possibility was suggested that the outcome of mataria may be inftuenced by the particular way the parasite interacts with the MPS.Estudou-se o efeito da infecção causada por espécie letal (Plasmodium berghei e não- letal (P. yoelii de plasmódio sobre o sistema de fagócitos mononucleares de camundongo BALB/c. O P. yoelii causou maior e mais prolongada expansão e ativação do sistema de macrófagos. As duas mais importantes populações de fagócitos esplênicos - macrófagos de polpa vermelha e da zona marginal - exibiam maior aumento do número de células nesta infecção. Durante a evolução da malária por P. berghei, o baço foi progressivamente ocupado por tecido hematopoiético e, na fase terminal da infecção, observou-se significativa depleção dos linfócitos e macrófagos esplênicos. Os dados apresentados indicam que a evolução da malária depende do tipo de interação entre o plasmódio e o sistema de fagócitos mononucleares.

  14. Analysis of time of death of prenatally lethal Steeloid mutations

    International Nuclear Information System (INIS)

    Rinchik, E.M.; Cummings, C.C.; Bangham, J.W.; Hunsicker, P.R.; Phipps, E.L.; Stelzner, K.F.

    1987-01-01

    Deletion mutations have been extremely useful in initiating the functional and molecular dissections of regions of the mouse genome. For the d-se and c regions, for example, it was observed that radiation mutations carrying lethal factors separable, by complementation analysis, from the primary d, se, or c mutation itself, could often be associated at both the genetic and molecular levels with multilocus chromosomal deletions. Since many of the Oak Ridge Sld mutations arose in radiation mutagenesis experiments, a substantial number may carry chromosomal deletions that involve the Sl locus in chromosome 10. Because of the great value of deletion mutations for the genetic and molecular analysis of chromosomal regions and complex genetic loci, they have initiated a series of experiments designed to test whether radiation-induced Sld mutations carry other lethal factors, in addition to the lethality caused by severe alleles of the Sl locus itself, as one prescreen for identifying Sld's that are caused by deletions

  15. Early events of lethal action by tobramycin in Pseudomonas aeruginosa

    International Nuclear Information System (INIS)

    Raulston, J.E.

    1988-01-01

    The immediate activities of the aminoglycoside antibiotic, tobramycin, were investigated in Pseudomonas aeruginosa PAO1. The influence of carbon growth substate and the antibiotic exposure environment in the magnitude of activity were examined. Lethality by 8 μg/ml tobramycin occurred rapidly (1 to 3 minutes). The release of specific cellular components into the supernatant was associated with lethality. This material was initially detected as an increase in UV-absorbance. Magnesium in the reaction mixture provided protection against lethality and leakage, but did not reverse lethal damage after a 3 minute tobramycin treatment. Also, uptake of 3 H-tobramycin was reduced in the presence of magnesium. Cells grown with glucose as a carbon source were more susceptible than organic acid grown cells as was the rapidity and amount of cell damage. Analyses of the leakage material revealed a 2-fold increase of protein in the supernatant after a 1-3 minute treatment which paralleled lethality. A prominent 29 kDa protein was observed by SDS-PAGE in the released material, which has been identified as the periplasmic enzyme, β-lactamase. The immediate activities of tobramycin did not involve (i) release of overall cell protein, (ii) massive loss of total pool amino acids, (iii) cell lysis, (iv) inhibition of proline uptake, (v) release of lipopolysaccharide, or (vi) leakage of ATP. Electron microscopy showed no apparent damage after a 3 minute exposure. 40% inhibition of protein synthesis had occurred by 3 minutes of exposure, while release of UV-absorbing material and lethality were detectable after only 1 minute. Resistant cystic fibrosis isolates of P. aeruginosa did not leak under the same experimental conditions, but one of two susceptible strains examined did show increased UV-absorbance following treatment

  16. Impact of acute alcohol consumption on lethality of suicide methods.

    Science.gov (United States)

    Park, C Hyung Keun; Yoo, Seong Ho; Lee, Jaewon; Cho, Sung Joon; Shin, Min-Sup; Kim, Eun Young; Kim, Se Hyun; Ham, Keunsoo; Ahn, Yong Min

    2017-05-01

    The influence of acute alcohol consumption on the factors related to suicide remains understudied. Thus, the present study investigated the relationship between blood alcohol content (BAC) and the lethality of suicide methods. Autopsy data on 315 South Korean suicide completers with a positive BAC were collected from a nationwide pool between May 2015 and November 2015, and the methods were dichotomised as suicide methods of low lethality (SMLL; drug/chemical overdose and sharp objects, n=67) and suicide methods of high lethality (SMHL; everything else, n=243). BAC at the time of autopsy and various suicide-related factors of these two groups were compared with logistic regression analyses. Compared to suicide completers with a BAC in the lowest range of 0.011-0.049%, suicide completers with a BAC in the range of 0.150-0.199% were more likely to use SMHL (odds ratio [OR]: 3.644, 95% confidence interval [CI]: 1.221-10.874). Additionally, the adoption of SMHL was significantly associated with the absence of a psychiatric illness (OR: 0.433, 95% CI: 0.222-0.843) and a younger age; the OR for high BAC among subjects in their 40s was 0.266 (95% CI: 0.083-0.856); in their 50s, 0.183 (95% CI: 0.055-0.615); and in their 60s, 0.057 (95% CI: 0.015-0.216). The relationship between BAC and suicide method lethality was represented by a bell-shaped pattern in which suicide methods of high lethality were more likely to be used by suicide completers with mid-range BAC levels. The increased impulsivity and impairments in particular executive functions, including planning and organization, associated with acute alcohol use may influence the selection of a particular suicide method based on its lethality. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Skin Stem Cells in Skin Cell Therapy

    Directory of Open Access Journals (Sweden)

    Mollapour Sisakht

    2015-12-01

    Full Text Available Context Preclinical and clinical research has shown that stem cell therapy is a promising therapeutic option for many diseases. This article describes skin stem cells sources and their therapeutic applications. Evidence Acquisition Compared with conventional methods, cell therapy reduces the surgical burden for patients because it is simple and less time-consuming. Skin cell therapy has been developed for variety of diseases. By isolation of the skin stem cell from the niche, in vitro expansion and transplantation of cells offers a surprising healing capacity profile. Results Stem cells located in skin cells have shown interesting properties such as plasticity, transdifferentiation, and specificity. Mesenchymal cells of the dermis, hypodermis, and other sources are currently being investigated to promote regeneration. Conclusions Because skin stem cells are highly accessible from autologous sources and their immunological profile is unique, they are ideal for therapeutic approaches. Optimization of administrative routes requires more investigation own to the lack of a standard protocol.

  18. Lethals induced by γ-radiation in drosophila somatic cells

    International Nuclear Information System (INIS)

    Ivanov, A.I.

    1989-01-01

    Exposure of 3-hour drosophila male embryos to γ-radiation during the topographic segregation of the germ anlage nuclei caused recessive sex-linked lethals in somatic cells only. The selectivity of the screening was determined by the ratio of mutation frequencies induced in embryos and adult males. Analysis of lethal mutations shows that a minimal rate of the divergence between germinal and somatic patterns of the cell development is observed in the embryogenesis, the 3d instar larva and prepupa, and maximal in the 1st and 2nd larva and pupa

  19. Examine Your Skin

    Science.gov (United States)

    ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  20. Examine Your Skin

    Medline Plus

    Full Text Available ... Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, ...

  1. Bleeding into the skin

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003235.htm Bleeding into the skin To use the sharing features on this page, please enable JavaScript. Bleeding into the skin can occur from broken blood ...

  2. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.

  3. Laser surgery - skin

    Science.gov (United States)

    ... Bleeding Problem not going away Infection Pain Scarring Skin color changes Some laser surgery is done when you are asleep and ... TG, Elston DM, eds. Andrews' Diseases of the Skin: Clinical ... lasers, lights, and tissue interactions. In: Hruza GJ, Avram ...

  4. Examine Your Skin

    Medline Plus

    Full Text Available ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ... Suggestions Examine Your Skin Newly Diagnosed? Understanding Your Pathology Biopsy: The First Step Sentinel Node Biopsy Melanoma ...

  5. Skin self-exam

    Science.gov (United States)

    Skin cancer - self-exam; Melanoma - self-exam; Basal cell cancer - self-exam; Squamous cell - self-exam; Skin mole - self-exam ... Checking your skin regularly can help you notice any unusual changes. Follow your health care provider's recommendations on how often to ...

  6. Skin Conditions during Pregnancy

    Science.gov (United States)

    ... during pregnancy. For most skin changes, however, health care providers are not sure of the exact cause. Why do dark spots and patches appear on the skin during pregnancy? Dark spots and patches are caused by an increase in the body’s melanin—a natural substance that gives color to the skin and ...

  7. Psychoneuroimmunology and the Skin.

    Science.gov (United States)

    Honeyman, Juan F

    2016-08-23

    The nervous, immune, endocrine and integumentary systems are closely related and interact in a number of normal and pathological conditions. Nervous system mediators may bring about direct changes to the skin or may induce the release of immunological or hormonal mediators that cause pathological changes to the skin. This article reviews the psychological mechanisms involved in the development of skin diseases.

  8. Skin layer mechanics

    NARCIS (Netherlands)

    Geerligs, M.

    2010-01-01

    The human skin is composed of several layers, each with an unique structure and function. Knowledge about the mechanical behavior of these skin layers is important for clinical and cosmetic research, such as the development of personal care products and the understanding of skin diseases. Until

  9. The role of innate lymphoid cells in healthy and inflamed skin

    DEFF Research Database (Denmark)

    Bonefeld, Charlotte M.; Geisler, Carsten

    2016-01-01

    system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...

  10. Taking Care of Your Skin

    Science.gov (United States)

    ... Educators Search English Español Taking Care of Your Skin KidsHealth / For Kids / Taking Care of Your Skin ... you're in. Why Be Nice to Your Skin? Like the heart, stomach, and brain, your skin ...

  11. The cutaneous citadel: a holistic view of skin and immunity.

    Science.gov (United States)

    Spellberg, B

    2000-06-23

    Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.

  12. KLK5 and KLK7 Ablation Fully Rescues Lethality of Netherton Syndrome-Like Phenotype

    Czech Academy of Sciences Publication Activity Database

    Kašpárek, Petr; Ileninová, Zuzana; Žbodáková, Olga; Kanchev, Ivan; Benada, Oldřich; Chalupský, Karel; Brattsand, M.; Beck, Inken; Sedláček, Radislav

    2017-01-01

    Roč. 13, č. 1 (2017), č. článku e1006566. ISSN 1553-7404 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2011032; GA MŠk(CZ) LO1509 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : corneum chymotryptic enzyme * serine-protease inhibitor * skin barrier function * mouse model * hair-follicle * subtilisin-a * lekti * kallikrein * expression * mice Subject RIV: EB - Genetics ; Molecular Biology; EE - Microbiology, Virology (MBU-M) OBOR OECD: Microbiology Impact factor: 6.100, year: 2016

  13. Perforated appendicitis presenting as a thigh abscess: A lethal ...

    African Journals Online (AJOL)

    Typical cases of acute appendicitis have excellent treatment outcomes, if managed appropriately.1 We discuss an unusual case of perforated retrocaecal appendicitis that presented as a right thigh abscess without prominent abdominal symptoms, which highlights the lethal nature of advanced appendicitis even when ...

  14. Dominant-lethal mutations and heritable translocations in mice

    International Nuclear Information System (INIS)

    Generoso, W.M.

    1983-01-01

    Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed

  15. The "Lethal Chamber": Further Evidence of the Euthanasia Option.

    Science.gov (United States)

    Elks, Martin A.

    1993-01-01

    Historical discussions of the euthanasia or "lethal chamber" option in relation to people with mental retardation are presented. The paper concludes that eugenic beliefs in the primacy of heredity over environment and the positive role of natural selection may have condoned the poor conditions characteristic of large, segregated institutions and…

  16. Papaya Lethal Yellowing Virus (PLYV) Infects Vasconcellea cauliflora

    NARCIS (Netherlands)

    Amaral, P.P.R.; Resende, de R.O.; Souza, M.T.

    2006-01-01

    Papaya lethal yellowing virus (PLYV) é um dos três vírus descritos infectando mamoeiros (Carica papaya L.) no Brasil. Vasconcellea cauliflora (Jacq.) A. DC., antes denominada de Carica cauliflora (Jacq.), é uma reconhecida fonte de resistência natural ao Papaya ringspot virus (PRSV), causador da

  17. Dominant-lethal mutations and heritable translocations in mice

    Energy Technology Data Exchange (ETDEWEB)

    Generoso, W.M.

    1983-01-01

    Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed.

  18. Fighting Lethal Yellowing Disease for Coconut Farmers (CIFSRF ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Copra is the dried kernel of the coconut, which is used to extract coconut oil. Coconut is the main income source for the coastal region's poor farmers. Over the past 10 years, Côte d'Ivoire lethal yellowing disease has destroyed more than 350 hectares of coconut and caused losses of 12,000 tons of copra per year.

  19. Why the United States Must Adopt Lethal Autonomous Weapon Systems

    Science.gov (United States)

    2017-05-25

    intelligence , Lethal Autonomous Weapon Systems, energy production, energy storage, three-dimensional printing , bandwidth improvements, computer...views on the morality of artificial intelligence (AI) and robotics technology. Eastern culture sees artificial intelligence as an economic savior...capable of improving their society. In contrast, Western culture regards artificial intelligence with paranoia, anxiety, and skepticism. As Eastern

  20. Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.

    Science.gov (United States)

    Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida

    2011-01-01

    Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.

  1. Human age and skin physiology shape diversity and abundance of Archaea on skin.

    Science.gov (United States)

    Moissl-Eichinger, Christine; Probst, Alexander J; Birarda, Giovanni; Auerbach, Anna; Koskinen, Kaisa; Wolf, Peter; Holman, Hoi-Ying N

    2017-06-22

    The human skin microbiome acts as an important barrier protecting our body from pathogens and other environmental influences. Recent investigations have provided evidence that Archaea are a constant but highly variable component of the human skin microbiome, yet factors that determine their abundance changes are unknown. Here, we tested the hypothesis that the abundance of archaea on human skin is influenced by human age and skin physiology by quantitative PCR of 51 different skin samples taken from human subjects of various age. Our results reveal that archaea are more abundant in human subjects either older than 60 years or younger than 12 years as compared to middle-aged human subjects. These results, together with results obtained from spectroscopy analysis, allowed us gain first insights into a potential link of lower sebum levels and lipid content and thus reduced skin moisture with an increase in archaeal signatures. Amplicon sequencing of selected samples revealed the prevalence of specific eury- and mainly thaumarchaeal taxa, represented by a core archaeome of the human skin.

  2. In vitro permeation of platinum through African and Caucasian skin.

    Science.gov (United States)

    Franken, A; Eloff, F C; du Plessis, J; Badenhorst, C J; Du Plessis, J L

    2015-02-03

    The majority of the South African workforce are Africans, therefore potential racial differences should be considered in risk and exposure assessments in the workplace. Literature suggests African skin to be a superior barrier against permeation and irritants. Previous in vitro studies on metals only included skin from Caucasian donors, whereas this study compared the permeation of platinum through African and Caucasian skin. A donor solution of 0.3 mg/ml of potassium tetrachloroplatinate (K₂PtCl₄) dissolved in synthetic sweat was applied to the vertical Franz diffusion cells with full thickness abdominal skin. Skin from three female African and three female Caucasian donors were included (n=21). The receptor solution was removed at various intervals during the 24 h experiment, and analysed with high resolution inductively coupled plasma-mass spectrometry (ICP-MS). Skin was digested and analysed by inductively coupled plasma-optical emission spectrometry (ICP-OES). Significantly higher permeation of platinum through intact African skin (p=0.044), as well as a significantly higher mass of platinum retention in African skin in comparison with Caucasian skin (p=0.002) occurred. Significant inter-donor variation was found in both racial groups (pskin and further investigation is necessary to explain the higher permeation through African skin. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Nutrition and skin.

    Science.gov (United States)

    Pappas, Apostolos; Liakou, Aikaterini; Zouboulis, Christos C

    2016-09-01

    Nutrition has long been associated with skin health, including all of its possible aspects from beauty to its integrity and even the aging process. Multiple pathways within skin biology are associated with the onset and clinical course of various common skin diseases, such as acne, atopic dermatitis, aging, or even photoprotection. These conditions have been shown to be critically affected by nutritional patterns and dietary interventions where well-documented studies have demonstrated beneficial effects of essential nutrients on impaired skin structural and functional integrity and have restored skin appearance and health. Although the subject could be vast, the intention of this review is to provide the most relevant and the most well-documented information on the role of nutrition in common skin conditions and its impact on skin biology.

  4. Influence of temperature and pressure on the lethality of ultrasound

    International Nuclear Information System (INIS)

    Raso, J.; Pagan, R.; Condon, S.; Sala, F.J.

    1998-01-01

    A specially designed resistometer was constructed, and the lethal effect on Yersinia enterocolitica of ultrasonic waves (UW) at different static pressures (manosonication [MS]) and of combined heat-UW under pressure treatments (manothermosonication [MTS]) was investigated. During MS treatments at 30 degrees C and 200 kPa, the increase in the amplitude of UW of 20 kHz from 21 to 150 micrometers exponentially decreased decimal reduction time values (D(MS)) from 4 to 0.37 min. When pressure was increased from 0 to 600 kPa at a constant amplitude (150 micrometers) and temperature (30 degrees C), D(MS) values decreased from 1.52 to 0.20 min. The magnitude of this decrease in D(MS) declined progressively as pressure was increased. The influence of pressure on D(MS) values was greater with increased amplitude of UW. Pressure alone of as much as 600 kPa did not influence the heat resistance of Y. enterocolitica (D60 = 0.094; zeta = 5.65). At temperatures of as much as 58 degrees C, the lethality of UW under pressure was greater than that of heat treatment alone at the same temperature. At higher temperatures, this difference disappeared. Heat and UW under pressure seemed to act independently. The lethality of MTS treatments appeared to result from the added effects of UW under pressure and the lethal effect of heat. The individual contributions of heat and of UW under pressure to the total lethal effect of MTS depended on temperature. The inactivating effect of UW was not due to titanium particles eroded from the sonication horn. The addition to the MS media of cysteamine did not increase the resistance of Y. enterocolitica to MS treatment. MS treatment caused cell disruption

  5. Annotating novel genes by integrating synthetic lethals and genomic information

    Directory of Open Access Journals (Sweden)

    Faty Mahamadou

    2008-01-01

    Full Text Available Abstract Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process.

  6. An antivector vaccine protects against a lethal vector-borne pathogen.

    Directory of Open Access Journals (Sweden)

    Milan Labuda

    2006-04-01

    Full Text Available Vaccines that target blood-feeding disease vectors, such as mosquitoes and ticks, have the potential to protect against the many diseases caused by vector-borne pathogens. We tested the ability of an anti-tick vaccine derived from a tick cement protein (64TRP of Rhipicephalus appendiculatus to protect mice against tick-borne encephalitis virus (TBEV transmitted by infected Ixodes ricinus ticks. The vaccine has a "dual action" in immunized animals: when infested with ticks, the inflammatory and immune responses first disrupt the skin feeding site, resulting in impaired blood feeding, and then specific anti-64TRP antibodies cross-react with midgut antigenic epitopes, causing rupture of the tick midgut and death of engorged ticks. Three parameters were measured: "transmission," number of uninfected nymphal ticks that became infected when cofeeding with an infected adult female tick; "support," number of mice supporting virus transmission from the infected tick to cofeeding uninfected nymphs; and "survival," number of mice that survived infection by tick bite and subsequent challenge by intraperitoneal inoculation of a lethal dose of TBEV. We show that one dose of the 64TRP vaccine protects mice against lethal challenge by infected ticks; control animals developed a fatal viral encephalitis. The protective effect of the 64TRP vaccine was comparable to that of a single dose of a commercial TBEV vaccine, while the transmission-blocking effect of 64TRP was better than that of the antiviral vaccine in reducing the number of animals supporting virus transmission. By contrast, the commercial antitick vaccine (TickGARD that targets only the tick's midgut showed transmission-blocking activity but was not protective. The 64TRP vaccine demonstrates the potential to control vector-borne disease by interfering with pathogen transmission, apparently by mediating a local cutaneous inflammatory immune response at the tick-feeding site.

  7. Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

    Science.gov (United States)

    Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

    2016-01-01

    Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

  8. Smart parking barrier

    KAUST Repository

    Alharbi, Abdulrazaq M.

    2016-05-06

    Various methods and systems are provided for smart parking barriers. In one example, among others, a smart parking barrier system includes a movable parking barrier located at one end of a parking space, a barrier drive configured to control positioning of the movable parking barrier, and a parking controller configured to initiate movement of the parking barrier, via the barrier drive. The movable parking barrier can be positioned between a first position that restricts access to the parking space and a second position that allows access to the parking space. The parking controller can initiate movement of the movable parking barrier in response to a positive identification of an individual allowed to use the parking space. The parking controller can identify the individual through, e.g., a RFID tag, a mobile device (e.g., a remote control, smartphone, tablet, etc.), an access card, biometric information, or other appropriate identifier.

  9. Active agents in common skin care products.

    Science.gov (United States)

    Draelos, Zoe Diana

    2010-02-01

    Skin care products are numerous and perplexing, yet the majority fall into the moisturizer category. Moisturizers are substances designed to improve and maintain the skin barrier. They serve as a vehicle for the delivery of active ingredients that minimize facial lines of dehydration, deliver photoprotection, and provide antioxidant properties. Moisturizers are based on occlusive substances, such as petrolatum and dimethicone, and humectant substances, such as glycerin, with a variety of sunscreens and botanicals for added functionality and marketing impact. This article reviews these common active agents. The plethora of over-the-counter skin care products available for patient purchase is overwhelming, yet there is certain commonality among 80 percent of the formulations. The majority of the products are moisturizers with added ingredients to support marketing claims. Whether the product is a facial foundation, an antiaging night cream, a sunscreen, a topical antioxidant, or a skin-lightening serum, the formulation is basically a moisturizer. Sunscreen is the most biologically active antiaging ingredient in skin care products, but the antiinflammatory and antioxidant effects of botanicals possess tremendous marketing appeal.

  10. Recommendations for skin decontamination

    International Nuclear Information System (INIS)

    1989-01-01

    Further to the reecommendations for determining the surface contamination of the skin and estimating the radiation exposure of the skin after contamination (SAAS-Mitt--89-16), measures for skin decontamination are recommended. They are necessary if (1) after simple decontamination by means of water, soap and brush without damaging the skin the surface contamination limits are exceeded and the radiation exposure to be expected for the undamaged healthy skin is estimated as to high, and if (2) a wound is contaminated. To remove skin contaminations, in general universally applicable, non-aggressive decontamination means and methods are sufficient. In special cases, nuclide-specific decontamination is required taking into account the properties of the radioactive substance

  11. Age-related percutaneous penetration part 1: skin factors.

    Science.gov (United States)

    Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I

    2012-05-01

    Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.

  12. A quick method for testing recessive lethal damage with a diploid strain of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Morpurgo, G.; Puppo, S.; Gualandi, G.; Conti, L.

    1978-01-01

    A simple method capable of detecting recessive lethal damage in a diploid strain of Aspergillus nidulans is described. The method scores the recessive lethals on the 1st, the 3rd and the 5th chromosomes, which represent about 40% of the total map of A. nidulans. Two examples of induced lethals, with ultraviolet irradiation and methyl methanesulfonate are shown. The frequency of lethals may reach 36% of the total population with UV irradiation. (Auth.)

  13. Humanitarian Algorithms : A Codified Key Safety Switch Protocol for Lethal Autonomy

    OpenAIRE

    Nyagudi, Nyagudi Musandu

    2014-01-01

    With the deployment of lethal autonomous weapons, there is the requirement that any such platform complies with the precepts of International Humanitarian Law. Humanitarian Algorithms[9: p. 9] ensure that lethal autonomous weapon systems perform military/security operations, within the confines of International Humanitarian Law. Unlike other existing techniques of regulating lethal autonomy this scheme advocates for an approach that enables Machine Learning. Lethal autonomous weapons must be ...

  14. Formation of thymine containing dimers in skin exposed to ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, B E [Dundee Univ. (UK)

    1978-01-01

    Nuclear DNA appears to be the major molecular target for the inhibitory, mutagenic and lethal effects of ultraviolet radiation on cells in culture. Cyclobutyl dimers between adjacent pyrimidine bases, the major photochemical lesions for these effects in prokaryotes, also play a part in UVR effects on eukaryotes cells. Pyrimidine dimers have been isolated from in vivo UV-irradiated guinea pig and mouse skin. The wavelength dependence for dimer induction is similar to that for acute skin reactions but no direct causal relationship has been established. Sunlight UVR may induce dimers in skin DNA. Excision of dimers from mouse skin in vivo is deficient as it is for most rodent cells in culture; human cell excision is efficient and the difficulties in interpretation of UV-carcinogenesis results with mice in terms of human skin cancer are therefore increased.

  15. Surface Dielectric Barrier Discharge Jet for Skin Disinfection

    Science.gov (United States)

    Creyghton, Yves; Meijer, Rogier; Verweij, Paul; van der Zanden, Frank; Leenders, Paul

    A consortium consisting of the research institute TNO, the medical ­university and hospital St Radboud and two industrial enterprises is working on a non-thermal plasma treatment method for hand disinfection. The group is seeking for cooperation, in particular in the field of validation methods and potential ­standardization for plasma based disinfection procedures. The present paper describes technical progress in plasma source development together with initial microbiological data. Particular properties of the sheet shaped plasma volume are the possibility of treating large irregular surfaces in a short period of time, effective plasma produced species transfer to the surface together with high controllability of the nature of plasma species by means of temperature conditioning.

  16. Surface dielectric barrier discharge jet for skin disinfection

    NARCIS (Netherlands)

    Creyghton, Y.; Meijer, R.; Verweij, P.; Zanden, F. van der; Leenders, P.

    2012-01-01

    A consortium consisting of the research institute TNO, the medical -university and hospital St Radboud and two industrial enterprises is working on a non-thermal plasma treatment method for hand disinfection. The group is seeking for cooperation, in particular in the field of validation methods and

  17. Skin barrier and contact allergy: Genetic risk factor analyses

    DEFF Research Database (Denmark)

    Ross-Hansen, Katrine

    2013-01-01

    allergy. Objectives To evaluate the effect of specific gene polymorphisms on the risk of developing contact allergy by a candidate gene approach. These included polymorphisms in the glutathione S-transferase genes (GSTM1, -T1 and -P1 variants), the claudin-1 gene (CLDN1), and the filaggrin gene (FLG......) in particular. Methods Epidemiological genetic association studies were performed on a general Danish population. Participants were patch tested, answered a questionnaire on general health and were genotyped for GST, CLDN1 and FLG polymorphisms. Filaggrin’s nickel binding potential was evaluated biochemically...

  18. Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

    Directory of Open Access Journals (Sweden)

    Nisbet SJ

    2018-04-01

    the exposed areas.Conclusion: This cosmetic moisturizer appears generally well tolerated and suitable for topical use in subjects with sensitive skin. Keywords: skin barrier, safety testing, sensitive skin, skin acceptability, irritation

  19. A Perspective on the Interplay of Ultraviolet-Radiation, Skin Microbiome and Skin Resident Memory TCRαβ+ Cells

    Directory of Open Access Journals (Sweden)

    VijayKumar Patra

    2018-05-01

    Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.

  20. Skin friction related behaviour of artificial turf systems.

    Science.gov (United States)

    Tay, Sock Peng; Fleming, Paul; Hu, Xiao; Forrester, Steph

    2017-08-01

    The occurrence of skin friction related injuries is an issue for artificial turf sports pitches and remains a barrier to their acceptance. The purpose of this study was to evaluate the current industry standard Securisport® Sports Surface Tester that measures skin surface related frictional behaviour of artificial turf. Little research has been published about the device and its efficacy, despite its widespread use as a standard FIFA test instrument. To achieve a range of frictional behaviours, several "third generation" (3G) carpet and infill combinations were investigated; friction time profiles throughout the Securisport rotations were assessed in combination with independent measurements of skin roughness before and after friction testing via 3D surface scanning. The results indicated that carpets without infill had greatest friction (coefficients of friction 0.97-1.20) while those completely filled with sand or rubber had similar and lower values independent of carpet type (coefficient of friction (COF) ≈0.57). Surface roughness of a silicone skin (s-skin) decreased after friction testing, with the largest change on sand infilled surfaces, indicating an "abrasive" polishing effect. The combined data show that the s-skin is damaged in a surface-specific manner, thus the Securisport COF values appear to be a poor measure of the potential for skin abrasion. It is proposed that the change in s-skin roughness improves assessment of the potential for skin damage when players slide on artificial turf.

  1. Effects of topical application of aqueous solutions of hexoses on epidermal permeability barrier recovery rate after barrier disruption.

    Science.gov (United States)

    Denda, Mitsuhiro

    2011-11-01

    Previous studies have suggested that hexose molecules influence the stability of phospholipid bilayers. Therefore, the effects of topical application of all 12 stereoisomers of dextro-hexose on the epidermal barrier recovery rate after barrier disruption were evaluated. Immediately after tape stripping, 0.1 m aqueous solution of each hexose was applied on hairless mouse skin. Among the eight dextro-aldohexoses, topical application of altose, idose, mannose and talose accelerated the barrier recovery, while allose, galactose, glucose and gulose had no effect. Among the four dextro-ketohexoses, psicose, fructose, sorbose and tagatose all accelerated the barrier recovery. As the effects of hexoses on the barrier recovery rate appeared within 1 h, the mechanism is unlikely to be genomic. Instead, these hexoses may influence phase transition of the lipid bilayers of lamellar bodies and cell membrane, a crucial step in epidermal permeability barrier homeostasis. © 2011 John Wiley & Sons A/S.

  2. Pacman dysplasia: a lethal skeletal dysplasia with variable radiographic features

    Energy Technology Data Exchange (ETDEWEB)

    Miller, S.F. [Dept. of Radiology, Children' s Hospital of the King' s Daughters, Norfolk (United States); Proud, V.K. [Dept. of Genetics, Children' s Hospital of the King' s Daughters, Norfolk (United States); Werner, A.L. [Dept. of Pathology, Children' s Hospital of the King' s Daughters, Norfolk (United States); Field, F.M.; Wilcox, W.F.; Lachman, R.S.; Rimoin, D.L. [International Skeletal Dysplasia Registry, Cedars-Sinai Medical Center, Los Angeles (United States)

    2003-04-01

    Background: Punctate or stippled cartilaginous calcifications are associated with many conditions, including chromosomal, infectious, endocrine, and teratogenic etiologies. Some of these conditions are clinically mild, while others are lethal. Accurate diagnosis can prove instrumental in clinical management and in genetic counseling. Objective: To describe the diagnostic radiographic features seen in Pacman dysplasia, a distinct autosomal recessive, lethal skeletal dysplasia. Materials and methods: We present the fourth reported case of Pacman dysplasia and compare the findings seen in our patient with the three previously described patients. Results: Invariable and variable radiographic findings were seen in all four cases of histologically proven Pacman dysplasia. Conclusion: Pacman dysplasia presents both constant and variable diagnostic radiographic features. (orig.)

  3. Neonatal lethal dwarfism with distinct skeletal malformations - a separate entity?

    Energy Technology Data Exchange (ETDEWEB)

    Rosendahl, K.; Maurseth, K.; Olsen, Oe.E. [Dept. of Paediatric Radiology, Haukeland University Hospital, Bergen (Norway); Halvorsen, O.J. [Dept. of Pathology, Haukeland University Hospital, Bergen (Norway); Gjelland, K. [Dept. of Gynaecology, Haukeland University Hospital, Bergen (Norway); Engebretsen, L. [Dept. of Genetics, Haukeland University Hospital, Bergen (Norway)

    2001-09-01

    We describe a case of neonatal lethal dwarfism characterised by short trunk, short, stick-like tubular bones, deficient ossification of the axial skeleton and broad, sclerotic horizontal ribs. Two similar cases have previously been reported as examples of the Neu-Laxova syndrome. However, the radiological findings of the Neu-Laxova syndrome, as reported in 16 out of 40 documented cases, show a heterogeneous pattern of minor features, which differ distinctively from those found in the previous two cases and by us. A literature research did not reveal similar cases, and we therefore suggest that our case, together with the two previous cases, may represent a new distinctive form of neonatal lethal dwarfism. (orig.)

  4. Neonatal lethal dwarfism with distinct skeletal malformations - a separate entity?

    International Nuclear Information System (INIS)

    Rosendahl, K.; Maurseth, K.; Olsen, Oe.E.; Halvorsen, O.J.; Gjelland, K.; Engebretsen, L.

    2001-01-01

    We describe a case of neonatal lethal dwarfism characterised by short trunk, short, stick-like tubular bones, deficient ossification of the axial skeleton and broad, sclerotic horizontal ribs. Two similar cases have previously been reported as examples of the Neu-Laxova syndrome. However, the radiological findings of the Neu-Laxova syndrome, as reported in 16 out of 40 documented cases, show a heterogeneous pattern of minor features, which differ distinctively from those found in the previous two cases and by us. A literature research did not reveal similar cases, and we therefore suggest that our case, together with the two previous cases, may represent a new distinctive form of neonatal lethal dwarfism. (orig.)

  5. Hematologic syndrome in man modeled from mammalian lethality

    International Nuclear Information System (INIS)

    Jones, T.D.

    1981-01-01

    Data on acute radiation lethality due to failure of the hematologic system in rats, mice, dogs, swine, monkeys and man are analyzed. Based on the available data, the mortality incidences for 1-100% levels can be computed directly if one has only an estimate of the dose lethal to 50% of the population (LD 50 ) for the mammalian strain and radiation environment of interest. The sole restriction is that the dose profile to the marrow be moderately uniform. If an LD 50 for any exposure situation has been measured, then one can readily scale to any desired situation through implicit-biological and empirical-physical relationships. The LD 50 for man, exposed to an isotropic cloud of photons, and knowledge of the bone-marrow dose profiles readily permit evaluation of the model for other levels of human mortality from different irradiating particles, partial body irradiation and spatially dependent and/or mixed radiation environments. (author)

  6. Chemical and radiation induced late dominant lethal effects in mice

    International Nuclear Information System (INIS)

    Favor, J.; Crenshaw, J.W. Jr.; Soares, E.R.

    1978-01-01

    Although theoretically expected, experimental data to date have not shown dominant lethal expression to occur throughout the developmental period. Specifically, late post-implantation effects have not been demonstrated. The authors routinely use an experimental technique in which parental females mated to mutagenically treated males are allowed to give birth and wean their litter, and their uterine horns are then inspected for uterine scars indicative of live and dead embryos. In a number of experiments in which males were mutagenically treated with either chemicals or X-irradiation, a discrepancy was observed between the number of live embryos as determined by the scar technique and the number of live observed at birth, suggesting the possibility of embryonic losses at a late stage in development. Initial analyses showed that mutagenic treatment increased the percentage of these late losses. These differences were statistically significant in 2 of 3 analyses. Factors affecting statistical significance and an understanding of dominant lethal mutations are discussed. (Auth.)

  7. An improved brine shrimp larvae lethality microwell test method.

    Science.gov (United States)

    Zhang, Yi; Mu, Jun; Han, Jinyuan; Gu, Xiaojie

    2012-01-01

    This article described an improved brine shrimp larvae lethality microwell test method. A simply designed connecting vessel with alternative photoperiod was used to culture and collect high yield of active Artemia parthenogenetica nauplii for brine shrimp larvae lethality microwell test. Using this method, pure A. parthenogenetica nauplii suspension was easily cultured and harvested with high density about 100-150 larvae per milliliter and the natural mortality was reduced to near zero by elimination of unnecessary artificial disturbance. And its sensitivity was validated by determination of LC(50)-24 h of different reference toxicants including five antitumor agents, two pesticides, three organic pollutants, and four heavy metals salts, most of which exhibited LC(50)-24 h between 0.07 and 58.43 mg/L except for bleomycin and mitomycin C with LC(50)-24 h over 300 mg/L.

  8. Dominant lethals following administration of tritium (THO) to rat males

    International Nuclear Information System (INIS)

    Yagova, A.; Baev, I.; Bajrakova, A.

    1976-01-01

    Adult rat males were given a single intraperitoneal tritium (THO) injection at 0,01 or 0,001 mCi/g body weight (1/100 or 1/1000 of LDsub(50/30), respectively). Twelve days after treatment each male was mated to 3-5 intact females, and the latter were replaced by fresh ones every 12 following days over a 120-day period. Mated females were killed to score conceptions, corpora lutea, and live and dead embryos. Estimations were made of F 1 prenatal death rate (according to Bateman, 1958) and the frequency of induction of dominant lethal mutations (according to Roehrborn, 1970). The results observed indicated paternal exposure to tritium (THO) to produce dominant lethals both in pre- and post-meiotic germ cells in the rat. The extent of the genetic damage studied was found to depend on the amount of activity administered as well as on the time interval between treatment and conception. (author)

  9. Non-Lethal Weaponry: A Framework for Future Integration

    Science.gov (United States)

    1998-04-01

    community, but was widely popularized by John Naisbitt in his 1982 work, Megatrends . In short, it asserts that much may be learned about a dynamic, but...Notes 1 John Naisbitt, Megatrends : Ten New Directions Transforming Our Lives (New York, NY: Warner Books, Inc., 1982), 3-5. 2 Robert J. Bunker...lethals by opponents of biological and chemical weapons. The use of chemical agents…is seen as a Trojan Horse to circumvent the Chemical Weapons

  10. Genome Replikin Count Predicts Increased Infectivity/Lethality of Viruses

    OpenAIRE

    Samuel Bogoch; Elenore S. Bogoch

    2012-01-01

    The genomes of all groups of viruses whose sequences are listed on Pubmed, specimens since 1918, analyzed by a software from Bioradar UK Ltd., contain Replikins which range in concentration from a Replikin Count (number of Replikins per 100 amino acids) of less than 1 to 30 (see accompanying communications for higher Counts in tuberculosis, malaria, and cancer, associated with higher lethality). Counts of less than 4.0 were found in ‘resting’ virus states; Counts greater than 4....

  11. Spondyloepiphyseal dysplasia congenita. A cause of lethal neonatal dwarfism

    Energy Technology Data Exchange (ETDEWEB)

    Macpherson, R.I.; Wood, B.P.

    1980-07-01

    Spondyloepiphyseal dysplasia congenita is a form of primarily short trunk dwarfism, that is manifest at birth but generally has not been regarded as a cause of lethal neonatal dwarfism. Seven neonates with severe dwarfism are presented. The first survived the newborn period, but the other six were early neonatal deaths. All displayed the clinical and radiologic features of spondyloepiphyseal dysplasia congenita. The striking similarities between spondyloepiphyseal dysplasia congenita and achondrogenesis type 2 are discussed.

  12. Torrance type of lethal neonatal short-limbed platyspondylic dwarfism

    International Nuclear Information System (INIS)

    Kaibara, N.; Yokoyama, K.; Nakano, H.

    1983-01-01

    A rare case of lethal neonatal short-limbed platyspondylic dwarfism is described. Roentgenographic features of this case, distinctly different from those of the classical thanatophoric dysplasia, are indistinguishable from the other three types of short-limbed platyspondylic dwarfism. Histologic features of the cartilage in this case are not very different from those of the Torrance type, but the presence of focal disruption of column formation in this case suggests a wider spectrum for this entity. (orig.)

  13. Torrance type of lethal neonatal short-limbed platyspondylic dwarfism

    Energy Technology Data Exchange (ETDEWEB)

    Kaibara, N.; Yokoyama, K.; Nakano, H.

    1983-06-01

    A rare case of lethal neonatal short-limbed platyspondylic dwarfism is described. Roentgenographic features of this case, distinctly different from those of the classical thanatophoric dysplasia, are indistinguishable from the other three types of short-limbed platyspondylic dwarfism. Histologic features of the cartilage in this case are not very different from those of the Torrance type, but the presence of focal disruption of column formation in this case suggests a wider spectrum for this entity.

  14. First diagnosed lethal case of lyssavirus infection in Primorsky krai

    OpenAIRE

    Leonova, G.; Chentsova, I.; Petukhova, S.; Somova, L.; Belikov, S.; Kondratov, I.; Kryilova, N.; Plekhova, N.; Pavlenko, E.; Romanova, E.; Matsak, V.; Smirnov, G.; Novikov, D.

    2010-01-01

    The paper provides data of comprehensive study of lethal case of lyssavirus infection first diagnosed in Yakovlevsky municipal district in Primorsky Krai. The data of epidemiologic analysis (contact with a rattle mouse), clinical picture and results of virologic, morphological and molecular genetic tests allow attributing this case to lyssavirus infection. This is the first diagnosed case of lyssavirus infection in the Siberia and Far East.

  15. Transplantation of bone marrow cells into lethally irradiated mice

    International Nuclear Information System (INIS)

    Viktora, L.; Hermanova, E.

    1978-01-01

    Morphological changes were studied of megakaryocytes in the bone marrow and spleen of lethally irradiated mice (0.2 C/kg) after transplantation of living bone marrow cells. It was observed that functional trombopoietic megakaryocytes occur from day 15 after transplantation and that functional active megakaryocytes predominate in bone marrow and spleen from day 20. In addition, other types of cells, primarily granulocytes, were detected in some megakaryocytes. (author)

  16. Efectividad de la Película Barrera No Irritante en la prevención de lesiones de piel: Revisión sistemática Effectiveness of No Sting Barrier Film for preventing skin damage: A systematic review

    Directory of Open Access Journals (Sweden)

    Francisco Pedro García-Fernández

    2009-03-01

    coste-efectividad. Los resultados de estos estudios encuentran una reducción del coste por proceso al utilizar la PBNI frente al uso de otros productos. Conclusiones: La aplicación de la PBNI reduce de forma significativa la presencia de eritema en los bordes de úlceras venosas exudativas (evidencia: alta con una efectividad clínica global similar a las pomadas de óxido de zinc (moderada. La PBNI resulta más fácil de aplicar y de retirar y es considerada más confortable que las pomadas de óxido de zinc (moderada. En pacientes con lesiones por humedad, la aplicación de la PBNI reduce la presencia de dermatitis mejor que las cremas hidratantes habituales (NNT= 5 (moderada y tiene la misma efectividad en la prevención de dermatitis que las pomadas de óxido de zinc o vaselina (alta, pero con mejor efecto en la disminución del área de enrojecimiento y de denudación (alta. En pacientes tratados con radioterapia, reduce el área y la gravedad de la radiodermitis (moderada. El coste por proceso, incluyendo el coste del tiempo de enfermería, es significativamente menor con el uso de la PBNI que con pomadas de óxido de zinc (alta.Aim: To get the available evidences about the product No Sting Barrier Film (NSBF (CavilonTM clinical efficacy and cost-effectiveness for protecting skin against irritating agents. Methods: Literature systematic review on the use of NSBF. The main bibliographic databases were searched without date or language limits. Also references lists and congress abstracts were searched. Inclusion criteria: studies with a prospective and comparative design (randomized or no and/or costs evaluation studies. Each paper was independently assessed by two reviewers; in case of disagreement a third reviewer decided. For methodological assessment of the studies, the clinical trial tool of the Critical Appraisal Skills Programme (CASP was used. Also, for each paper included in the review we made an evaluation of the evidence quality by using the system

  17. Lethal mutagenesis: targeting the mutator phenotype in cancer.

    Science.gov (United States)

    Fox, Edward J; Loeb, Lawrence A

    2010-10-01

    The evolution of cancer and RNA viruses share many similarities. Both exploit high levels of genotypic diversity to enable extensive phenotypic plasticity and thereby facilitate rapid adaptation. In order to accumulate large numbers of mutations, we have proposed that cancers express a mutator phenotype. Similar to cancer cells, many viral populations, by replicating their genomes with low fidelity, carry a substantial mutational load. As high levels of mutation are potentially deleterious, the viral mutation frequency is thresholded at a level below which viral populations equilibrate in a traditional mutation-selection balance, and above which the population is no longer viable, i.e., the population undergoes an error catastrophe. Because their mutation frequencies are fine-tuned just below this error threshold, viral populations are susceptible to further increases in mutational load and, recently this phenomenon has been exploited therapeutically by a concept that has been termed lethal mutagenesis. Here we review the application of lethal mutagenesis to the treatment of HIV and discuss how lethal mutagenesis may represent a novel therapeutic approach for the treatment of solid cancers. Copyright © 2010 Elsevier Ltd. All rights reserved.

  18. Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

    DEFF Research Database (Denmark)

    Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

    2015-01-01

    are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

  19. Barrier cell sheath formation

    International Nuclear Information System (INIS)

    Kesner, J.

    1980-04-01

    The solution for electrostatic potential within a simply modeled tandem mirror thermal barrier is seen to exhibit a sheath at each edge of the cell. The formation of the sheath requires ion collisionality and the analysis assmes that the collisional trapping rate into the barrier is considerably slower than the barrier pump rate

  20. Protecting the radiation-damaged skin from friction: a mini review

    International Nuclear Information System (INIS)

    Herst, Patries M

    2014-01-01

    Radiation-induced skin reactions are an unavoidable side effect of external beam radiation therapy, particularly in areas prone to friction and excess moisture such as the axilla, head and neck region, perineum and skin folds. Clinical studies investigating interventions for preventing or managing these reactions have largely focussed on formulations with moisturising, anti-inflammatory, anti-microbial and wound healing properties. However, none of these interventions has emerged as a consistent candidate for best practice. Much less emphasis has been placed on evaluating ways to protect the radiation-damaged skin from friction and excess moisture. This mini review analyses the clinical evidence for barrier products that form a protective layer by adhering very closely to the skin folds and do not cause further trauma to the radiation-damaged skin upon removal. A database search identified only two types of barrier products that fitted these criteria and these were tested in two case series and six controlled clinical trials. Friction protection was most effective when the interventions were used from the start of treatment and continued for several weeks after completion of treatment. Soft silicone dressings (Mepilex Lite and Mepitel Film) and Cavilon No Sting Barrier Film, but not Cavilon Moisturizing Barrier Cream, decreased skin reaction severity, most likely due to differences in formulation and skin build-up properties. It seems that prophylactic use of friction protection of areas at risk could be a worthwhile addition to routine care of radiation-damaged skin

  1. Skin Diseases: Skin and Sun—Not a good mix

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin and Sun —Not a good mix Past Issues / ... of this page please turn Javascript on. Good skin care begins with sun safety. Whether it is ...

  2. Lethal and Sub-lethal Effects of Four Insecticides on the Aphidophagous Coccinellid Adalia bipunctata (Coleoptera: Coccinellidae).

    Science.gov (United States)

    Depalo, Laura; Lanzoni, Alberto; Masetti, Antonio; Pasqualini, Edison; Burgio, Giovanni

    2017-12-05

    Conventional insecticide assays, which measure the effects of insecticide exposure on short-term mortality, overlook important traits, including persistence of toxicity or sub-lethal effects. Therefore, such approaches are especially inadequate for prediction of the overall impact of insecticides on beneficial arthropods. In this study, the side effects of four modern insecticides (chlorantraniliprole, emamectin benzoate, spinosad, and spirotetramat) on Adalia bipunctata (L.) (Coleoptera: Coccinellidae) were evaluated under laboratory conditions by exposition on treated potted plants. In addition to investigation of acute toxicity and persistence of harmful activity in both larvae and adults of A. bipunctata, demographic parameters were evaluated, to provide a comprehensive picture of the nontarget effects of these products. Field doses of the four insecticides caused detrimental effects to A. bipunctata; but in different ways. Overall, spinosad showed the best toxicological profile among the products tested. Emamectin benzoate could be considered a low-risk insecticide, but had high persistence. Chlorantraniliprole exhibited lethal effects on early instar larvae and adults, along with a long-lasting activity, instead spirotetramat showed a low impact on larval and adult mortality and can be considered a short-lived insecticide. However, demographic analysis demonstrated that chlorantraniliprole and spirotetramat caused sub-lethal effects. Our findings highlight that sole assessment of mortality can lead to underestimation of the full impact of pesticides on nontarget insects. Demographic analysis was demonstrated to be a sensitive method for detection of the sub-lethal effects of insecticides on A. bipunctata, and this approach should be considered for evaluation of insecticide selectivity. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. International guidelines for the in vivo assessment of skin properties in non-clinical settings

    DEFF Research Database (Denmark)

    du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz

    2013-01-01

    There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, repre......, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings....

  4. Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series

    OpenAIRE

    R. W. Knackstedt; J. A. Dixon; P. J. O’Neill; F. A. Herrera

    2015-01-01

    Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-ad...

  5. Skin tribology: Science friction?

    NARCIS (Netherlands)

    van der Heide, Emile; Zeng, Xiangqiong; Masen, Marc Arthur

    2013-01-01

    The application of tribological knowledge is not just restricted to optimizing mechanical and chemical engineering problems. In fact, effective solutions to friction and wear related questions can be found in our everyday life. An important part is related to skin tribology, as the human skin is

  6. Examine Your Skin

    Medline Plus

    Full Text Available ... Facebook Twitter Newsletter Examine Your Skin Watch the video below and in only two minutes, you can learn to examine your skin. A special thanks to Dr. Martin Weinstock, MD, PhD, Professor of Dermatology, Brown University, for permission to use this video. UPDATED: ... Melanoma Facts Melanoma Prevention ...

  7. The menstrual cycle and the skin.

    Science.gov (United States)

    Raghunath, R S; Venables, Z C; Millington, G W M

    2015-03-01

    Perimenstrual exacerbations of dermatoses are commonly recognized, yet our knowledge of the underlying pathophysiological mechanisms remains imperfect. Research into the effects of oestrogen on the skin has provided evidence to suggest that oestrogen is associated with increases in skin thickness and dermal water content, improved barrier function, and enhanced wound healing. Research into the effects of progesterone suggests that the presence of various dermatoses correlates with peak levels of progesterone. Dermatoses that are exacerbated perimenstrually include acne, psoriasis, atopic eczema and irritant dermatitis, and possibly also erythema multiforme. Exacerbations occur at the peak levels of progesterone in the menstrual cycle. Underlying mechanisms include reduced immune and barrier functions as a result of cyclical fluctuations in oestrogen and/or progesterone. Autoimmune progesterone and oestrogen dermatitis are the best-characterized examples of perimenstrual cutaneous reactions to hormones produced during the menstrual cycle. In this review, we describe the current understanding of the menstrual cycle, and its effect on the skin and cutaneous disorders. © 2015 British Association of Dermatologists.

  8. p120-catenin mediates inflammatory responses in the skin

    DEFF Research Database (Denmark)

    Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

    2006-01-01

    but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

  9. The important role of stratum corneum lipids for the cutaneous barrier function.

    Science.gov (United States)

    van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

    2014-03-01

    The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Bionanomaterials for skin regeneration

    CERN Document Server

    Leonida, Mihaela D

    2016-01-01

    This book gives a concise overview of bionanomaterials with applications for skin regeneration. The advantages and challenges of nanoscale materials are covered in detail, giving a basic view of the skin structure and conditions that require transdermal or topical applications. Medical applications, such as wound healing, care for burns, skin disease, and cosmetic care, such as aging of the skin and photodamage, and how they benefit from bionanomaterials, are described in detail. A final chapter is devoted to the ethical and social issues related to the use of bionanomaterials for skin regeneration. This is an ideal book for researchers in materials science, medical scientists specialized in dermatology, and cosmetic chemists working in formulations. It can also serve as a reference for nanotechnologists, dermatologists, microbiologists, engineers, and polymer chemists, as well as students studying in these fields.

  11. Barriers to fusion

    International Nuclear Information System (INIS)

    Berriman, A.C.; Butt, R.D.; Dasgupta, M.; Hinde, D.J.; Morton, C.R.; Newton, J.O.

    1999-01-01

    The fusion barrier is formed by the combination of the repulsive Coulomb and attractive nuclear forces. Recent research at the Australian National University has shown that when heavy nuclei collide, instead of a single fusion barrier, there is a set of fusion barriers. These arise due to intrinsic properties of the interacting nuclei such deformation, rotations and vibrations. Thus the range of barrier energies depends on the properties of both nuclei. The transfer of matter between nuclei, forming a neck, can also affect the fusion process. High precision data have been used to determine fusion barrier distributions for many nuclear reactions, leading to new insights into the fusion process

  12. Extremal surface barriers

    International Nuclear Information System (INIS)

    Engelhardt, Netta; Wall, Aron C.

    2014-01-01

    We present a generic condition for Lorentzian manifolds to have a barrier that limits the reach of boundary-anchored extremal surfaces of arbitrary dimension. We show that any surface with nonpositive extrinsic curvature is a barrier, in the sense that extremal surfaces cannot be continuously deformed past it. Furthermore, the outermost barrier surface has nonnegative extrinsic curvature. Under certain conditions, we show that the existence of trapped surfaces implies a barrier, and conversely. In the context of AdS/CFT, these barriers imply that it is impossible to reconstruct the entire bulk using extremal surfaces. We comment on the implications for the firewall controversy

  13. Safety- barrier diagrams

    DEFF Research Database (Denmark)

    Duijm, Nijs Jan

    2008-01-01

    Safety-barrier diagrams and the related so-called 'bow-tie' diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation of safety-barrier diagrams to other methods such as fault...... trees and Bayesian networks is discussed. A simple method for quantification of safety-barrier diagrams is proposed. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk analysis with operational safety management....

  14. Safety-barrier diagrams

    DEFF Research Database (Denmark)

    Duijm, Nijs Jan

    2007-01-01

    Safety-barrier diagrams and the related so-called "bow-tie" diagrams have become popular methods in risk analysis. This paper describes the syntax and principles for constructing consistent and valid safety-barrier diagrams. The relation with other methods such as fault trees and Bayesian networks...... are discussed. A simple method for quantification of safety-barrier diagrams is proposed, including situations where safety barriers depend on shared common elements. It is concluded that safety-barrier diagrams provide a useful framework for an electronic data structure that integrates information from risk...... analysis with operational safety management....

  15. [Bladder tumor lethality. Results in the autonomous community of Rioja between 1975-1991].

    Science.gov (United States)

    Fernández Fernández, A; Gil Fabra, J; Fernández Ruíz, M; Angulo Castellanos, M G; Blanco Martín, E; Otero Mauricio, G

    1998-01-01

    Between 1975-1991, a total of 557 cases of bladder carcinoma were identified in the Autonomous Community of La Rioja (CAR) which were followed up to December 1994. The overall lethality was 21.9%. 492 cases with 22.35% lethality were identified in males. In females, however, there was 65 cases with 18.46% lethality. The comparison of males and females lethality resulted in p = 0.525. Lethality between cases diagnosed within each 5-year period analyzed is: 1975-1981: 177 cases, lethality 23.72%. 1982-1986: 168 cases, lethality 30.95%. 1987-1991: 212 cases, lethality 13.20%. Between the first and the second 5-year periods, p = 0.132; between the first and third 5-year periods p = 0.007 and between the second and third 5-year periods p CAR for a 22.35% lethality. Lethality is higher in males that in females but the difference is not statistically significant. In the last 5-year period assessed, 1987-1991, a reduction of lethality from bladder neoplasms has been documented.

  16. Contribution to the penetration of radionuclides across the skin

    International Nuclear Information System (INIS)

    Koprda, V.; Harangozo, M.; Kassai, Z.

    2000-01-01

    The human skin as well as the skin of animal species represent a strong barrier against the permeation of ionic forms of substances into an organism. Radionuclides of cesium, cobalt and actinides belong to frequent potential contaminants of human body at an accidental radioactive contamination. Regarding the actual composition of contaminating mixture of radionuclides the damage of an organism after internal contamination is proportional to the extent of penetrated amounts of radionuclides across the skin. In this paper: the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model was studied, the biologic structure mostly responsible for the barrier effect was selected and proved, the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ , the diffusion across the intact skin and the diffusion through the hair channels was assessed, the effect of isotopic carrier on the penetration process was studied, and the retarding capacities of different substances were researched. In all experiments the radioactive tracers were used. The experimental arrangement consisted of Franz-type vertical permeation cells. The well standardized animal skin models were chosen: fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), resp.. The skins of 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used intact, and also with decreasing thickness of horny layer after it had been stripped with Scotch type (3M) 5-20 times respectively, or the skin had been splitted in 60degC hot water, whereby the whole epidermis was removed. Ions penetrated in vitro through the skin from donor solution (vehicle water) to receptor solution (phosphate buffered saline), were determined in aliquots sampled in 1,3,5,7 a 24 hours. The penetrated amounts of ions were found proportional to the time at least in the first 7

  17. The Relative Utility of Skin Resistance and Skin Conductance

    National Research Council Canada - National Science Library

    Barland, Gordon

    1990-01-01

    The effectiveness of two circuits (constant current = skin resistance; constant voltage = skin conductance) used for measuring electrodermal activity during a psychophysiological detection of deception...

  18. Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.

    Science.gov (United States)

    Cheong, Wai Kwong

    2009-01-01

    Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.

  19. Dry skin - self-care

    Science.gov (United States)

    ... pat skin dry then apply your moisturizer. Avoid skin care products and soaps that contain alcohol, fragrances, dyes, or other chemicals. Take short, warm baths or showers. Limit your ... gentle skin cleansers or soap with added moisturizers. Only use ...

  20. 6 Common Cancers - Skin Cancer

    Science.gov (United States)

    ... Bar Home Current Issue Past Issues 6 Common Cancers - Skin Cancer Past Issues / Spring 2007 Table of Contents ... AP Photo/Herald-Mail, Kevin G. Gilbert Skin Cancer Skin cancer is the most common form of cancer ...

  1. Cryogen therapy of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular cryogen therapy of skin cancer. They noted that cryogen therapy of skin cancer carried new possibilities and improved results of neoplasms treatment

  2. Next generation human skin constructs as advanced tools for drug development.

    Science.gov (United States)

    Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

    2017-11-01

    Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

  3. Acute skin reaction after fractionated irradiation

    International Nuclear Information System (INIS)

    Kozubek, S.

    1983-01-01

    Experimental data on acute mouse and pig skin reaction after fractionated γ or X irradiation have been analysed in terms of a new cell tissue kinetic model. The exponential-quadratic and generalized Huggett formulae have been used for cell lethality description. Fairly better results could be demonstrated with generalized Huggett formula. The speed of repopulation has been determined for fractionated regimes as well as for some irregular schedules. The repopulation is slower in the case of fractionated treatment. On considering the normal cell loss factor in the tissue, minimum cell cycle time has been calculated. Its value differs for various strains (Tsub(d)=28.8 hours for SAS/TO mice and Tsub(d) < or approximately 17 hours for WHT/Ht mice) and does not differ for plucked skin. The repopulation has been shown to follow exponential dependence after some latent period. Other factors influencing the effectiveness of radiation treatment (the length of the latent period or the changes of the survival curve during fractionated irradiation) have been considered, too

  4. Factors of skin decontamination as derived from experimental studies

    International Nuclear Information System (INIS)

    Pratzel, H.G.

    1992-01-01

    The processes occuring during radioactive contamination of the skin are reminiscent of those observed in connection with skin penetration by drugs. Explained are the laws determining the penetration of substances through the skin surface, their spreading between the corneocystes into the deeper layers of the stratum corneum and their final concentrations, the decrease of which with the depth of the corneal layer can be described by an exponential curve. The extent to which the penetrating substances are transferred from the solvent to the corneal layer's lipid phase depends on their relative solubility. The intercellular lipid layer in the lower third of the stratum corneum creates the greatest obstacle to permeation through the skin. The lipid content in this part of the corneal layer is seen to be inversely proportional to the degree of natural barrier dysfunction and, thus, to permeation. For measurements of skin permeation, experiments were performed in young pigs using aqueous radioactive solutions. Part of the substances penetrated into the organism through the follicles, where the corneal layer is more permeable. In cases of very hairy skin the amount of substance deposited as a result of additional follicle penetration is seen to be higher. The greatest proportion of radioactivity by far is taken up into the stratum corneum, while only little is seen to reach the follicles and even less the deeper layers of the skin. Decontamination of the skin cannot be carried out for areas beyond the boundary of the corneal layer. (orig./HP) [de

  5. BP180 dysfunction triggers spontaneous skin inflammation in mice.

    Science.gov (United States)

    Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi

    2018-06-04

    BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.

  6. The Roles of Vitamin C in Skin Health.

    Science.gov (United States)

    Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M

    2017-08-12

    The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.

  7. DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.

    Science.gov (United States)

    Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim

    2017-12-01

    In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.

  8. Skin and antioxidants.

    Science.gov (United States)

    Poljsak, Borut; Dahmane, Raja; Godic, Aleksandar

    2013-04-01

    It is estimated that total sun exposure occurs non-intentionally in three quarters of our lifetimes. Our skin is exposed to majority of UV radiation during outdoor activities, e.g. walking, practicing sports, running, hiking, etc. and not when we are intentionally exposed to the sun on the beach. We rarely use sunscreens during those activities, or at least not as much and as regular as we should and are commonly prone to acute and chronic sun damage of the skin. The only protection of our skin is endogenous (synthesis of melanin and enzymatic antioxidants) and exogenous (antioxidants, which we consume from the food, like vitamins A, C, E, etc.). UV-induced photoaging of the skin becomes clinically evident with age, when endogenous antioxidative mechanisms and repair processes are not effective any more and actinic damage to the skin prevails. At this point it would be reasonable to ingest additional antioxidants and/or to apply them on the skin in topical preparations. We review endogenous and exogenous skin protection with antioxidants.

  9. Occupational skin cancers

    Energy Technology Data Exchange (ETDEWEB)

    Gawkrodger, D.J. [Royal Hallamshire Hospital, Sheffield (United Kingdom). Dept. of Dermatology

    2004-10-01

    Skin cancer due to occupation is more common than is generally recognized, although it is difficult to obtain an accurate estimate of its prevalence. Over the past two centuries, occupational skin cancers have particularly been due to industrial exposure of men (it seems more so than women) to chemical carcinogens such as polycyclic hydrocarbons (e.g. from coal tar products) or to arsenic. Industrial processes have improved in most Western countries to limit this type of exposure, but those with outdoor occupations are still exposed to solar ultraviolet irradiation without this being widely recognized as an industrial hazard. Ionizing radiation such as X-rays can also cause skin cancer. Occupational skin cancers often resemble skin tumours found in non-occupational subjects, e.g. basal cell carcinoma, squamous cell carcinoma and malignant melanoma, but some pre-malignant lesions can be more specific and point to an occupational origin, e.g. tar keratoses or arsenical keratoses. An uncommon but well-recognized cause of occupational skin cancer is that which results from scar formation following an industrial burn. In the future it will be necessary to focus on preventative measures, e.g. for outdoor workers, the need to cover up in the sun and use sun protective creams and a campaign for earlier recognition of skin cancers, which are usually curable if treated in their early stages.

  10. Skin Picking Disorder

    Directory of Open Access Journals (Sweden)

    Pinar Cetinay Aydin

    2014-08-01

    Full Text Available Skin picking disorder is not a dermatological disorder and it is a table characterized with picking skin excessively and repetitively, leading to damage in skin tissue. Unlike normal picking behaviour, psychogenic skin picking is repetitive and it can lead to severe damage in the skin and even complications which constitute vital danger. While some patients define frequent but short lasting picking attacks, others define rarer attacks which last a few hours. Skin picking disorder, which is not included in the classification systems up to DSM-5 as a separate diagnosis category, is included as an independent diagnosis in Obsessive Compulsive Disorder and Associated Disorders category in DSM-5. In case reports, open label studies and double blind studies selective serotonin reuptake inhibitors are shown to be effective in the treatment of skin picking disorder. Mostly, cognitive-behaviourial techniques are used and have been proven to be useful in psychotherapy. Habit reversal is one of the behaviourial techniques which are frequently applied, give positive results in which well-being state can be maintained. [Psikiyatride Guncel Yaklasimlar - Current Approaches in Psychiatry 2014; 6(4.000: 401-428

  11. Quantification of changes in skin hydration and sebum after tape stripping using infrared spectroscopy

    Science.gov (United States)

    Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.

    2017-02-01

    Skin barrier function relies on well balanced water and lipid system of stratum corneum. Optimal hydration and oiliness levels are indicators of skin health and integrity. We demonstrate an accurate and sensitive depth profiling of stratum corneum sebum and hydration levels using short wave infrared spectroscopy in the spectral range around 1720 nm. We demonstrate that short wave infrared spectroscopic technique combined with tape stripping can provide morequantitative and more reliable skin barrier function information in the low hydration regime, compared to conventional biophysical methods.

  12. Measurement of skin permeation/penetration of nanoparticles for their safety evaluation.

    Science.gov (United States)

    Kimura, Eriko; Kawano, Yuichiro; Todo, Hiroaki; Ikarashi, Yoshiaki; Sugibayashi, Kenji

    2012-01-01

    The aim of the present study was to quantitatively evaluate the skin permeation/penetration of nanomaterials and to consider their penetration pathway through skin. Firstly, penetration/permeation of a model fluorescent nanoparticle, Fluoresbrite®, was determined through intact rat skin and several damaged skins. Fluoresbrite® permeated through only needle-punctured skin. The permeation profiles of soluble high molecular compounds, fluorescein isothiocyanate-dextrans (FITC-dextrans, FDs), with different molecular weights were also measured for comparison. The effects of molecular sizes and different skin pretreatments on the skin barrier were determined on the skin penetration/permeation of Fluoresbrite® and FDs. Fluoresbrite® was not permeated the intact skin, but FDs were permeated the skin. The skin distribution of titanium dioxide and zinc oxide nanoparticles was also observed after topical application of commercial cosmetics. Nanoparticles in sunscreen cosmetics were easily distributed into the groove and hair follicles after their topical application, but seldom migrated from the groove or follicles to viable epidermis and dermis. The obtained results suggested that nanoparticles did not permeate intact skin, but permeated pore-created skin. No or little permeation was observed for these nanomaterials through the stratum corneum.

  13. Skin Fungi from Colonization to Infection.

    Science.gov (United States)

    de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne

    2017-07-01

    Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).

  14. 5-Lipoxygenase Deficiency Reduces Acetaminophen-Induced Hepatotoxicity and Lethality

    Directory of Open Access Journals (Sweden)

    Miriam S. N. Hohmann

    2013-01-01

    Full Text Available 5-Lipoxygenase (5-LO converts arachidonic acid into leukotrienes (LTs and is involved in inflammation. At present, the participation of 5-LO in acetaminophen (APAP-induced hepatotoxicity and liver damage has not been addressed. 5-LO deficient (5-LO-/- mice and background wild type mice were challenged with APAP (0.3–6 g/kg or saline. The lethality, liver damage, neutrophil and macrophage recruitment, LTB4, cytokine production, and oxidative stress were assessed. APAP induced a dose-dependent mortality, and the dose of 3 g/kg was selected for next experiments. APAP induced LTB4 production in the liver, the primary target organ in APAP toxicity. Histopathological analysis revealed that 5-LO-/- mice presented reduced APAP-induced liver necrosis and inflammation compared with WT mice. APAP-induced lethality, increase of plasma levels of aspartate aminotransferase and alanine aminotransferase, liver cytokine (IL-1β, TNF-α, IFN-γ, and IL-10, superoxide anion, and thiobarbituric acid reactive substances production, myeloperoxidase and N-acetyl-β-D-glucosaminidase activity, Nrf2 and gp91phox mRNA expression, and decrease of reduced glutathione and antioxidant capacity measured by 2,2′-azinobis(3-ethylbenzothiazoline 6-sulfonate assay were prevented in 5-LO-/- mice compared to WT mice. Therefore, 5-LO deficiency resulted in reduced mortality due to reduced liver inflammatory and oxidative damage, suggesting 5-LO is a promising target to reduce APAP-induced lethality and liver inflammatory/oxidative damage.

  15. Left ventricular function during lethal and sublethal endotoxemia in swine

    International Nuclear Information System (INIS)

    Goldfarb, R.D.; Nightingale, L.M.; Kish, P.; Weber, P.B.; Loegering, D.J.

    1986-01-01

    Previous studies suggested that after a median lethal dose (LD 50 ) of endotoxin, cardiac contractility was depressed in nonsurviving dogs. The canine cardiovascular system is unlike humans in that dogs have a hepatic vein sphincter that is susceptible to adrenergic stimulation capable of raising hepatic and splanchnic venous pressures. The authors retested the hypothesis that lethality after endotoxin administration is associated with cardiac contractile depression in pigs, because of the hepatic circulation in this species is similar to that of humans. They compared cardiac mechanical function of pigs administered a high dose (250 μg/kg) or a low dose (100 μg/kg) endotoxin by use of the slope of the end-systolic pressure-diameter relationship (ESPDR) as well as other measurements of cardiac performance. In all the pigs administered a high dose, ESPDR demonstrated a marked, time-dependent depression whereas we observed no significant ESPDR changes after low endotoxin doses. The other cardiodynamic variables were uninterpretable, due to the significant changes in heart rate, end-diastolic diameter (preload), and aortic diastolic pressure (afterload). Plasma myocardia depressant factor activity accumulated in all endotoxin-administered animals, tending to be greater in the high-dose group. In this group, both subendocardial blood flow and global function were depressed, whereas pigs administered the low dose endotoxin demonstrated slight, but nonsignificant, increases in flow and function. These observations indicate that myocardial contractile depression is associated with a lethal outcome to high doses of endotoxin. Myocardial perfusion was measured using radiolabeled microspheres infused into the left atria

  16. Rifaximin diminishes neutropenia following potentially lethal whole-body radiation.

    Science.gov (United States)

    Jahraus, Christopher D; Schemera, Bettina; Rynders, Patricia; Ramos, Melissa; Powell, Charles; Faircloth, John; Brawner, William R

    2010-07-01

    Terrorist attacks involving radiological or nuclear weapons are a substantial geopolitical concern, given that large populations could be exposed to potentially lethal doses of radiation. Because of this, evaluating potential countermeasures against radiation-induced mortality is critical. Gut microflora are the most common source of systemic infection following exposure to lethal doses of whole-body radiation, suggesting that prophylactic antibiotic therapy may reduce mortality after radiation exposure. The chemical stability, easy administration and favorable tolerability profile of the non-systemic antibiotic, rifaximin, make it an ideal potential candidate for use as a countermeasure. This study evaluated the use of rifaximin as a countermeasure against low-to-intermediate-dose whole-body radiation in rodents. Female Wistar rats (8 weeks old) were irradiated with 550 cGy to the whole body and were evaluated for 30 d. Animals received methylcellulose, neomycin (179 mg/kg/d) or variably dosed rifaximin (150-2000 mg/kg/d) one hour after irradiation and daily throughout the study period. Clinical assessments (e.g. body weight) were made daily. On postirradiation day 30, blood samples were collected and a complete blood cell count was performed. Animals receiving high doses of rifaximin (i.e. 1000 or 2000 mg/kg/d) had a greater increase in weight from the day of irradiation to postirradiation day 30 compared with animals that received placebo or neomycin. For animals with an increase in average body weight from irradiation day within 80-110% of the group average, methylcellulose rendered an absolute neutrophil count (ANC) of 211, neomycin rendered an ANC of 334, rifaximin 300 mg/kg/d rendered an ANC of 582 and rifaximin 1000 mg/kg/d rendered an ANC of 854 (P = 0.05 for group comparison). Exposure to rifaximin after near-lethal whole-body radiation resulted in diminished levels of neutropenia.

  17. Ultrasound skin tightening.

    Science.gov (United States)

    Minkis, Kira; Alam, Murad

    2014-01-01

    Ultrasound skin tightening is a noninvasive, nonablative method that allows for energy deposition into the deep dermal and subcutaneous tissue while avoiding epidermal heating. Ultrasound coagulation is confined to arrays of 1-mm(3) zones that include the superficial musculoaponeurotic system and connective tissue. This technology gained approval from the Food and Drug Administration as the first energy-based skin "lifting" device, specifically for lifting lax tissue on the neck, submentum, and eyebrows. Ultrasound has the unique advantage of direct visualization of treated structures during treatment. Ultrasound is a safe and efficacious treatment for mild skin tightening and lifting. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Cell survival curves deduced from non-quantitative reactions of skin, intestinal mucosa and lung

    International Nuclear Information System (INIS)

    Dutreix, J.; Wambersie, A.

    1975-01-01

    The shape of the cell survival curve for the cell population relevant to some biological effects has been derived from the comparison of the total doses which result in the same biological effect for two irradiations delivered with N and 2N fractions in the same overall time. They show an initial slope which is interpreted as related to directly lethal, i.e. 'one-hit' or 'irreparable' events. The ratio of the initial slope and the slope at a dose D gives the contribution of the cell killing by directly lethal events relative to cell killing by accumulation of sublethal events. The bioligical effects which have been studied are: (i) dry desquamation of the skin of C 3 H mice and patients; (ii) intestinal death of BALB/c mice; and (iii) lung death of C 3 H mice. The shape of the cell survival curve has been found to be similar for skin desquamation and for intestinal death with a large contribution of lethal events, at single doses of 1000 rad. For lung death the initial tangent has a smaller slope and the shoulder is broader; this is interpreted as a relatively smaller contribution of lethal events with respect to accumulation of sublethal events. (author)

  19. Low uptake of silica nanoparticles in Caco-2 intestinal epithelial barriers

    NARCIS (Netherlands)

    Ye, Dong; Bramini, Mattia; Hristov, Delyan R.; Wan, Sha; Salvati, Anna; Åberg, Christoffer; Dawson, Kenneth A.

    2017-01-01

    Cellular barriers, such as the skin, the lung epithelium or the intestinal epithelium, constitute one of the first obstacles facing nanomedicines or other nanoparticles entering organisms. It is thus important to assess the capacity of nanoparticles to enter and transport across such barriers. In

  20. Ultraviolet-B lethal damage on Pseudomonas aeruginosa

    International Nuclear Information System (INIS)

    Degiorgi, C.F.; Fernandez, R.O.; Pizarro, R.A.

    1996-01-01

    Pseudomonas aeruginosa has shown an increased sensitivity compared with that of Escherichia coli and Enterobacter cloacae, when they were exposed to 0.4 kJ/m2 of ultraviolet-B radiation. The rapid decay in cell viability observed in Pseudomonas aeruginosa after the irradiation was influenced by factors such as culture media and the presence of pyocyanine during the irradiation. The radioinduced lethal damage could be prevented by photoreactivating treatment, indicating that pyrimidine dimer formation was the mechanism causing bacterial death. The results indicate that several environmental conditions may act as protective agents against ultraviolet-B-induced damage

  1. Metformin is synthetically lethal with glucose withdrawal in cancer cells.

    Science.gov (United States)

    Menendez, Javier A; Oliveras-Ferraros, Cristina; Cufí, Sílvia; Corominas-Faja, Bruna; Joven, Jorge; Martin-Castillo, Begoña; Vazquez-Martin, Alejandro

    2012-08-01

    Glucose deprivation is a distinctive feature of the tumor microecosystem caused by the imbalance between poor supply and an extraordinarily high consumption rate. The metabolic reprogramming from mitochondrial respiration to aerobic glycolysis in cancer cells (the "Warburg effect") is linked to oncogenic transformation in a manner that frequently implies the inactivation of metabolic checkpoints such as the energy rheostat AMP-activated protein kinase (AMPK). Because the concept of synthetic lethality in oncology can be applied not only to genetic and epigenetic intrinsic differences between normal and cancer cells but also to extrinsic ones such as altered microenvironment, we recently hypothesized that stress-energy mimickers such as the AMPK agonist metformin should produce metabolic synthetic lethality in a glucose-starved cell culture milieu imitating the adverse tumor growth conditions in vivo. Under standard high-glucose conditions, metformin supplementation mostly caused cell cycle arrest without signs of apoptotic cell death. Under glucose withdrawal stress, metformin supplementation circumvented the ability of oncogenes (e.g., HER2) to protect breast cancer cells from glucose-deprivation apoptosis. Significantly, representative cell models of breast cancer heterogeneity underwent massive apoptosis (by >90% in some cases) when glucose-starved cell cultures were supplemented with metformin. Our current findings may uncover crucial issues regarding the cell-autonomous metformin's anti-cancer actions: (1) The offently claimed clinically irrelevant, non-physiological concentrations needed to observe the metformin's anti-cancer effects in vitro merely underlie the artifactual interference of erroneous glucose-rich experimental conditions that poorly reflect glucose-starved in vivo conditions; (2) the preferential killing of cancer stem cells (CSC) by metformin may simply expose the best-case scenario for its synthetically lethal activity because an increased

  2. Genotoxicity test of irradiated spice mixture by dominant lethal test

    Energy Technology Data Exchange (ETDEWEB)

    Barna, J

    1986-03-01

    Dominant lethal test (DLT) was performed in Sprague Dawley male rats prefed with 25% irradiated spice mixture which was composed of 55% non-pungent ground paprika, 14% black pepper, 9% allspice, 9% coriander, 7% marjoram, 4% cumin, 2% nutmeg. Microbial count of the spice mixture was reduced with 15 kGy from a sup(60)Co source. Control groups received spice-free or untreated spice diet or were administered to cyclophosphamide i.p., respectively. DTL parameters altered significantly in the latter group but neither untreated nor irradiated spice mixture proved to be germ cell mutagens. 24 refs.; 8 figs.

  3. Lethal subarachnoid bleeding under immunosuppressive therapy due to mycotic arteritis

    International Nuclear Information System (INIS)

    Weigel, S.; Kloska, S.; Freund, M.; Kehl, H.G.

    2003-01-01

    A subarachnoid haemorrhage (SAH) occurred 67 days after cardiac transplantation in 10-year-old girl with consecutive immunocompromising therapy. Neither digital subtraction angiography (DSA) nor computed tomographic angiography showed signs of intracranial vascular malformations. One month before the lethal SAH occurred, she had developed arterial hypertension and attacks of severe headache with cerebrospinal fluid (CSF) pleocytosis while CT scans showed an infarct of the left thalamus. Pathologic findings established the rare diagnosis of SAH due to aspergillosis-related mycotic arteritis. Imaging characteristics are presented. (orig.)

  4. Chromium content in human skin after in vitro application of ordinary cement and ferrous-sulphate-reduced cement

    DEFF Research Database (Denmark)

    Fullerton, A; Gammelgaard, Bente; Avnstorp, C

    1993-01-01

    The amount of chromium found in human skin after in vitro application of cement suspensions on full-thickness human skin in diffusion cells was investigated. Cement suspensions made from ordinary Portland cement or Portland cement with the chromate reduced with added ferrous sulphate were used....... The cement suspensions were either applied on the skin surface under occlusion for 48 h or applied repeatedly every 24 h for 96 h. No statistically significant difference in chromium content of skin layers between skin exposed to ordinary Portland cement, skin exposed to cement with added ferrous sulphate...... and unexposed skin was observed, despite a more permeable skin barrier at the alkaline pH of the cement suspensions, i.e., pH 12.5. Increased chromium levels in epidermis and dermis were seen when ordinary Portland cement was applied as a suspension with added sodium sulphate (20%) on the skin surface for 96 h...

  5. Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

    Science.gov (United States)

    Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

    2013-01-01

    Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

  6. Panamanian frog species host unique skin bacterial communities

    Directory of Open Access Journals (Sweden)

    Lisa K. Belden

    2015-10-01

    Full Text Available Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd, that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26% were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in

  7. Formation of a protection film on the human skin by microparticles

    International Nuclear Information System (INIS)

    Lademann, J; Schanzer, S; Richter, H; Knorr, F; Sterry, W; Patzelt, A; Antoniou, C

    2008-01-01

    Laser scanning microscopy and tape stripping, in combination with optical methods, were used to analyze the distribution and penetration of a barrier cream into the horny layer (stratum corneum) of the human skin under in vivo conditions. The barrier cream contained microparticles of 10 – 100 μm loaded with antioxidant substances. The cream was designed for protection of the skin surface against the destructive action of free radicals, produced by systemically applied chemotherapeutic agents reaching the skin surface via the sweat. Both methods were able to demonstrate that the barrier cream was distributed homogeneously on the skin surface forming a protection film. A penetration into deeper parts of the stratum corneum (SC) was not observed

  8. Electrical measurement of the hydration state of the skin surface in vivo.

    Science.gov (United States)

    Tagami, H

    2014-09-01

    Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.

  9. Spiritual and religious aspects of skin and skin disorders

    Directory of Open Access Journals (Sweden)

    Shenefelt PD

    2014-08-01

    Full Text Available Philip D Shenefelt,1 Debrah A Shenefelt2 1Dermatology and Cutaneous Surgery, University of South Florida, Tampa, 2Congregation Or Ahavah, Lutz, FL, USA Abstract: Skin and skin disorders have had spiritual aspects since ancient times. Skin, hair, and nails are visible to self and others, and touchable by self and others. The skin is a major sensory organ. Skin also expresses emotions detectable by others through pallor, coldness, "goose bumps", redness, warmth, or sweating. Spiritual and religious significances of skin are revealed through how much of the skin has been and continues to be covered with what types of coverings, scalp and beard hair cutting, shaving and styling, skin, nail, and hair coloring and decorating, tattooing, and intentional scarring of skin. Persons with visible skin disorders have often been stigmatized or even treated as outcasts. Shamans and other spiritual and religious healers have brought about healing of skin disorders through spiritual means. Spiritual and religious interactions with various skin disorders such as psoriasis, leprosy, and vitiligo are discussed. Religious aspects of skin and skin diseases are evaluated for several major religions, with a special focus on Judaism, both conventional and kabbalistic. Keywords: skin, skin disorders, spiritual, religious

  10. Skin Diseases: Cross-section of human skin

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

  11. Cure of skin cancer. Surgical cure of skin cancer

    International Nuclear Information System (INIS)

    Zikiryakhodjaev, D.Z.; Sanginov, D.R.

    2001-01-01

    In this chapter authors studied the cure of skin cancer in particular the surgical cure of skin cancer. They noted that surgical cure of skin cancer is remain one of the primary and most important methods in treatment of skin cancer

  12. Artificial skin and patient simulator comprising the artificial skin

    NARCIS (Netherlands)

    2011-01-01

    The invention relates to an artificial skin (10, 12, 14), and relates to a patient simulator (100) comprising the artificial skin. The artificial skin is a layered structure comprising a translucent cover layer (20) configured for imitating human or animal skin, and comprising a light emitting layer

  13. Multilayer moisture barrier

    Science.gov (United States)

    Pankow, Joel W; Jorgensen, Gary J; Terwilliger, Kent M; Glick, Stephen H; Isomaki, Nora; Harkonen, Kari; Turkulainen, Tommy

    2015-04-21

    A moisture barrier, device or product having a moisture barrier or a method of fabricating a moisture barrier having at least a polymer layer, and interfacial layer, and a barrier layer. The polymer layer may be fabricated from any suitable polymer including, but not limited to, fluoropolymers such as polyethylene terephthalate (PET) or polyethylene naphthalate (PEN), or ethylene-tetrafluoroethylene (ETFE). The interfacial layer may be formed by atomic layer deposition (ALD). In embodiments featuring an ALD interfacial layer, the deposited interfacial substance may be, but is not limited to, Al.sub.2O.sub.3, AlSiO.sub.x, TiO.sub.2, and an Al.sub.2O.sub.3/TiO.sub.2 laminate. The barrier layer associated with the interfacial layer may be deposited by plasma enhanced chemical vapor deposition (PECVD). The barrier layer may be a SiO.sub.xN.sub.y film.

  14. Allergy Skin Tests

    Science.gov (United States)

    ... and symptoms. Medications can interfere with results Before scheduling a skin test, bring your doctor a list ... of Privacy Practices Notice of Nondiscrimination Manage Cookies Advertising Mayo Clinic is a not-for-profit organization ...

  15. Caring for Tattooed Skin

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  16. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Registration General information Housing & travel Education Exhibit hall Mobile app 2019 Annual Meeting Derm Exam Prep Course ... SkinPAC State societies Scope of practice Truth in advertising NP/PA laws Action center Public and patients ...

  17. Impairments in Skin Integrity.

    Science.gov (United States)

    Murphree, Rose W

    2017-09-01

    Altered skin integrity increases the chance of infection, impaired mobility, and decreased function and may result in the loss of limb or, sometimes, life. Skin is affected by both intrinsic and extrinsic factors. Intrinsic factors can include altered nutritional status, vascular disease issues, and diabetes. Extrinsic factors include falls, accidents, pressure, immobility, and surgical procedures. Ensuring skin integrity in the elderly requires a team approach and includes the individual, caregivers, and clinicians. The twenty-first century clinician has several online, evidence-based tools to assist with optimal treatment plans. Understanding best practices in addressing skin integrity issues can promote positive outcomes with the elderly. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test; Allergic rhinitis - allergy testing; Asthma - allergy testing; Eczema - allergy testing; Hayfever - allergy testing; Dermatitis - allergy testing; Allergy testing; ...

  19. Examine Your Skin

    Medline Plus

    Full Text Available ... Store In Memory Melanoma Info Melanoma Facts Melanoma Prevention Sunscreen Suggestions Examine Your Skin Newly Diagnosed? Understanding ... Biopsy: The First Step Sentinel Node Biopsy Melanoma Treatment: Stages I & II Melanoma Treatment: Stage III Melanoma ...

  20. Examine Your Skin

    Medline Plus

    Full Text Available ... We Are Be On Our PAGE MIF Staff Programs & Services Scientific Advisory Board Advisory Board Patrons & Sponsors ... us for One-on-One Support Donate Share Facebook Twitter Newsletter Examine Your Skin Watch the video ...

  1. Occupational skin diseases

    DEFF Research Database (Denmark)

    Mahler, V; Aalto-Korte, K; Alfonso, J H

    2017-01-01

    BACKGROUND: Work-related skin diseases (WSD) are caused or worsened by a professional activity. Occupational skin diseases (OSD) need to fulfil additional legal criteria which differ from country to country. OSD range amongst the five most frequently notified occupational diseases (musculoskeletal...... diseases, neurologic diseases, lung diseases, diseases of the sensory organs, skin diseases) in Europe. OBJECTIVE: To retrieve information and compare the current state of national frameworks and pathways to manage patients with occupational skin disease with regard to prevention, diagnosis, treatment...... in Science and Technology (COST) Action TD 1206 (StanDerm) (www.standerm.eu). RESULTS: Besides a national health service or a statutory health insurance, most European member states implemented a second insurance scheme specifically geared at occupational diseases [insurance against occupational risks...

  2. Skin care and incontinence

    Science.gov (United States)

    ... skin care; Incontinence - pressure sore; Incontinence - pressure ulcer Patient Instructions Preventing pressure ulcers Images Male urinary system References Holroyd S. Incontinence-associated dermatitis: identification, prevention and care. Br J Nurs . 2015;24( ...

  3. Healthy Skin Matters

    Science.gov (United States)

    ... skin. If you’re helping out in the kitchen, make sure you use hot pads or wear ... in humans, plants, and animals, while others are essential for a healthy life. Propionibacterium acnes (P. acnes) ( ...

  4. Tuberculin Skin Testing

    Science.gov (United States)

    ... Appendix 1 Appendix 2 Appendix 3 Interim Laboratory Biosafety Guidance for XDR Mycobacterium tuberculosis strains Data & Statistics ... The Mantoux tuberculin skin test (TST) is the standard method of determining whether a person is infected ...

  5. [Currently available skin substitutes].

    Science.gov (United States)

    Oravcová, Darina; Koller, Ján

    2014-01-01

    The current trend of burn wound care has shifted to more holistic approach of improvement in the long-term form and function of the healed burn wounds and quality of life. Autologous split or full-thickness skin graft are the best definitive burn wound coverage, but it is constrained by the limited available sources, especially in major burns. Donor site morbidities in term of additional wounds and scarring are also of concern of the autograft application. This has demanded the emergence of various skin substitutes in the management of acute burn injury as well as post burn reconstructions. This paper reviews currently available skin substitutes, produced in not for-profit skin banks as well as commercially available. They are divided according to type of material included, as biological, biosynthetic and synthetic and named respectively.

  6. Parasites and the skin

    African Journals Online (AJOL)

    2009-06-11

    Jun 11, 2009 ... those conditions that are encountered in daily practice and to remind you of those ... care conditions. Parasitic infections can be solely confined to the skin, as seen ..... endemic areas or may become chronic and disseminate.

  7. Skin or nail culture

    Science.gov (United States)

    Mucosal culture; Culture - skin; Culture - mucosal; Nail culture; Culture - fingernail; Fingernail culture ... There, it is placed in a special dish (culture). It is then watched to see if bacteria, ...

  8. Fungal Skin Infections

    Science.gov (United States)

    ... Abbreviations Weights & Measures ENGLISH View Professional English Deutsch Japanese Espaniol Find information on medical topics, symptoms, drugs, ... touching the infected area. Diagnosis Skin scrapings or cultures Doctors may suspect a fungal infection when they ...

  9. Examine Your Skin

    Medline Plus

    Full Text Available ... Download a Skin Self-Exam Card Download a Patient Navigation Card Events, Webinars & Videos Events, Webinars & Videos Melanoma Patient Video Events Host an Event Past Webinars Upcoming ...

  10. Allergic Skin Conditions

    Science.gov (United States)

    ... most common types are atopic dermatitis (often called eczema) and contact dermatitis. Atopic Dermatitis (Eczema) Eczema is a chronic ... contact with your skin, they may cause a rash called contact dermatitis. There are two kinds of contact dermatitis: ...

  11. Neuromodulators for Aging Skin

    Science.gov (United States)

    ... Light treatment to the skin and Restylane to tear troughs and outer eyebrow. Photo courtesy of Rebecca Fitzagerald, MD - Los Angeles, California Possible risks Soreness Mild bruising Temporary weakness of surrounding muscles Headache Drooping eyelid Why choose neuromodulators for aging ...

  12. Examine Your Skin

    Medline Plus

    Full Text Available ... Doctor Glossary of Terms Resources Resources Global Resources Cancer Centers Online Resources The Melanoma Book Clinical Trials Download a Skin Self-Exam Card Download a Patient Navigation Card ...

  13. Barrier penetration database

    International Nuclear Information System (INIS)

    Fainberg, A.; Bieber, A.M. Jr.

    1978-11-01

    This document is intended to supply the NRC and nuclear power plant licensees with basic data on the times required to penetrate forcibly the types of barriers commonly found in nuclear plants. These times are necessary for design and evaluation of the physical protection system required under 10CFR73.55. Each barrier listed is described in detail. Minor variations in basic barrier construction that result in the same penetration time, are also described

  14. Coffee polyphenols extracted from green coffee beans improve skin properties and microcirculatory function.

    Science.gov (United States)

    Fukagawa, Satoko; Haramizu, Satoshi; Sasaoka, Shun; Yasuda, Yuka; Tsujimura, Hisashi; Murase, Takatoshi

    2017-09-01

    Coffee polyphenols (CPPs), including chlorogenic acid, exert various physiological activities. The purpose of this study was to investigate the effects of CPPs on skin properties and microcirculatory function in humans. In this double-blind, placebo-controlled study, 49 female subjects with mildly xerotic skin received either a test beverage containing CPPs (270 mg/100 mL/day) or a placebo beverage for 8 weeks. The ingestion of CPPs significantly lowered the clinical scores for skin dryness, decreased transepidermal water loss, skin surface pH, and increased stratum corneum hydration and the responsiveness of skin blood flow during local warming. Moreover, the amounts of free fatty acids and lactic acid in the stratum corneum significantly increased after the ingestion of CPPs. These results suggest that an 8-week intake of CPPs improve skin permeability barrier function and hydration, with a concomitant improvement in microcirculatory function, leading to efficacy in the alleviation of mildly xerotic skin.

  15. ReciPlySkin

    DEFF Research Database (Denmark)

    Popovic Larsen, Olga; Andersen, Mikkel; Munk-Andersen, Niklas

    2017-01-01

    The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report.......The report presents process that enbabled the production of the ReciPlySkin structure exhibited at the Circular Economy Exhibition at KADK during the Autumn 2017. The concept, design, detailed design and production are presented in this report....

  16. Adnexal Tumours Of Skin

    Directory of Open Access Journals (Sweden)

    Parate Sanjay N

    1998-01-01

    Full Text Available A total 120 cases of epidermal appendage tumours of skin were analysed and classified according to the classification provided by WHO’. Epidermal appendage tumours accounted for 12.87% of all skin tumours, of which 29.17% were benign and 70.83% were malignant. Most of the tumours (75.83% were in the head and face region. The most common tumour was basal cell epithelioma (55%.

  17. Mantoux Tuberculin Skin Test

    Centers for Disease Control (CDC) Podcasts

    2006-11-22

    Learn how to evaluate people for latent TB infection with the Mantoux tuberculin skin test. This podcast includes sections on administering and reading the Mantoux tuberculin skin test, the standard method for detecting latent TB infection since the 1930s.  Created: 11/22/2006 by National Center for HIV, STD and TB Prevention (NCHHSTP).   Date Released: 12/12/2006.

  18. Stressed skin panels

    Energy Technology Data Exchange (ETDEWEB)

    Anon

    2001-07-01

    Advantages and disadvantages of stressed skin panels, also known as structural insulated panels (SIPs), are discussed as material and labour-saving alternatives to traditional stick framing. Stressed skin panels are manufactured 'sandwich' assemblies with a rigid insulating polystyrene foam core, whose interior and exterior surfaces are bonded into panels. The skins distribute and carry the structural loading while the bonded foam core provides insulation and keeps the two skins aligned. Since there are fewer framing members, there is little thermal bridging and the R-value remains high. SIPs are usually manufactured in four feet by eight feet panels, although some manufacturers can produce panels up to eight feet by forty feet. SIPs are resource efficient as they use less wood than conventional framing (about 25 per cent less); can structurally cover large spans, requiring less supplementary framing. Use of SIPs eliminate the need for headers over small openings; provide the ability to nail anywhere; create less scrap and waste; lessen vulnerability to unfavourable weather and other job-site hazards, can reduce delays, and often can produce significant savings in material and labour costs. Limitations include the more complex approaches to plumbing and electrical systems, although this can be minimized by designers by incorporating much of the plumbing and electrical work on interior (non-panel) walls. Most stressed skin panels require one-half inch interior gypsum drywall. If become wet, stressed skin panels take a long time to dry out and may harbour mold growth. Larger stressed-skin panels used in floors and roofs, may require cranes or other machinery for handling because of their weight. Although not without some environmental impact, overall, stressed skin panels are judged to be a resource-efficient building technology with significant energy-efficiency benefits and distinct advantages over stick framing. 3 photos.

  19. Fur skin and fur garment trade between Europe and Asia

    DEFF Research Database (Denmark)

    Hansen, Henning Otte

    2016-01-01

    International trade and specialization with agricultural raw materials and processed products is often rather limited due to trade barriers, logistic problems and food security. This production of raw fur skin - which is also considered an agricultural product - mostly takes place in the Western...... hemisphere, and to a high degree in Europe, while processing and production of fur garments now more and more takes place in Asia. The objective of this paper is to analyze, quantify and explain trade patterns and international specialization within fur skin and fur garments focusing on Europa and Asia...... trade with fur skin products between Asia and Europe has increased remarkably during the recent decades. Europe accounts for a major share of world production and export of raw fur skin, and Asia accounts for the major part of the subsequent processing. This means that there is a significant export...

  20. Transport barriers in plasmas

    International Nuclear Information System (INIS)

    Caldas, I L; Szezech, J D Jr; Kroetz, T; Marcus, F A; Roberto, M; Viana, R L; Lopes, S R

    2012-01-01

    We discuss the creation of transport barriers in magnetically confined plasmas with non monotonic equilibrium radial profiles. These barriers reduce the transport in the shearless region (i.e., where the twist condition does not hold). For the chaotic motion of particles in an equilibrium electric field with a nonmonotonic radial profile, perturbed by electrostatic waves, we show that a nontwist transport barrier can be created in the plasma by modifying the electric field radial profile. We also show non twist barriers in chaotic magnetic field line transport in the plasma near to the tokamak wall with resonant modes due to electric currents in external coils.

  1. Was skin cancer a selective force for black pigmentation in early hominin evolution?

    Science.gov (United States)

    Greaves, Mel

    2014-01-01

    Melanin provides a crucial filter for solar UV radiation and its genetically determined variation influences both skin pigmentation and risk of cancer. Genetic evidence suggests that the acquisition of a highly stable melanocortin 1 receptor allele promoting black pigmentation arose around the time of savannah colonization by hominins at some 1–2 Ma. The adaptive significance of dark skin is generally believed to be protection from UV damage but the pathologies that might have had a deleterious impact on survival and/or reproductive fitness, though much debated, are uncertain. Here, I suggest that data on age-associated cancer incidence and lethality in albinos living at low latitudes in both Africa and Central America support the contention that skin cancer could have provided a potent selective force for the emergence of black skin in early hominins. PMID:24573849

  2. Experimental evaluation of the relationship between lethal or non-lethal virulence and transmission success in malaria parasite infections

    Directory of Open Access Journals (Sweden)

    Nithiuthai S

    2004-09-01

    Full Text Available Abstract Background Evolutionary theory suggests that the selection pressure on parasites to maximize their transmission determines their optimal host exploitation strategies and thus their virulence. Establishing the adaptive basis to parasite life history traits has important consequences for predicting parasite responses to public health interventions. In this study we examine the extent to which malaria parasites conform to the predicted adaptive trade-off between transmission and virulence, as defined by mortality. The majority of natural infections, however, result in sub-lethal virulent effects (e.g. anaemia and are often composed of many strains. Both sub-lethal effects and pathogen population structure have been theoretically shown to have important consequences for virulence evolution. Thus, we additionally examine the relationship between anaemia and transmission in single and mixed clone infections. Results Whereas there was a trade-off between transmission success and virulence as defined by host mortality, contradictory clone-specific patterns occurred when defining virulence by anaemia. A negative relationship between anaemia and transmission success was found for one of the parasite clones, whereas there was no relationship for the other. Notably the two parasite clones also differed in a transmission phenotype (gametocyte sex ratio that has previously been shown to respond adaptively to a changing blood environment. In addition, as predicted by evolutionary theory, mixed infections resulted in increased anaemia. The increased anaemia was, however, not correlated with any discernable parasite trait (e.g. parasite density or with increased transmission. Conclusions We found some evidence supporting the hypothesis that there is an adaptive basis correlating virulence (as defined by host mortality and transmission success in malaria parasites. This confirms the validity of applying evolutionary virulence theory to biomedical

  3. Lethal Nipah virus infection induces rapid overexpression of CXCL10.

    Directory of Open Access Journals (Sweden)

    Cyrille Mathieu

    Full Text Available Nipah virus (NiV is a recently emerged zoonotic Paramyxovirus that causes regular outbreaks in East Asia with mortality rate exceeding 75%. Major cellular targets of NiV infection are endothelial cells and neurons. To better understand virus-host interaction, we analyzed the transcriptome profile of NiV infection in primary human umbilical vein endothelial cells. We further assessed some of the obtained results by in vitro and in vivo methods in a hamster model and in brain samples from NiV-infected patients. We found that NiV infection strongly induces genes involved in interferon response in endothelial cells. Among the top ten upregulated genes, we identified the chemokine CXCL10 (interferon-induced protein 10, IP-10, an important chemoattractant involved in the generation of inflammatory immune response and neurotoxicity. In NiV-infected hamsters, which develop pathology similar to what is seen in humans, expression of CXCL10 mRNA was induced in different organs with kinetics that followed NiV replication. Finally, we showed intense staining for CXCL10 in the brain of patients who succumbed to lethal NiV infection during the outbreak in Malaysia, confirming induction of this chemokine in fatal human infections. This study sheds new light on NiV pathogenesis, indicating the role of CXCL10 during the course of infection and suggests that this chemokine may serve as a potential new marker for lethal NiV encephalitis.

  4. Parental response to severe or lethal prenatal diagnosis

    DEFF Research Database (Denmark)

    Lou, Stina; Jensen, Lotte Groth; Petersen, Olav Bjørn

    2017-01-01

    Objective A severe or lethal prenatal diagnosis places great demands on prospective parents, who face choices of far-reaching consequences, such as continuing or terminating the pregnancy. How best to support these parents is a clinical challenge. This systematic review aimed to identify and synt......Objective A severe or lethal prenatal diagnosis places great demands on prospective parents, who face choices of far-reaching consequences, such as continuing or terminating the pregnancy. How best to support these parents is a clinical challenge. This systematic review aimed to identify...... and synthesize the qualitative evidence regarding prospective parents’ responses to such prenatal diagnoses. Methods Following PRISMA guidelines, four databases were systematically searched and 28 studies met the inclusion criteria. Thematic analysis guided data extraction and synthesis of findings. The CERQual....... Prospective parents who continued the pregnancy wished to be acknowledged as parents, and engaged in planning to obtain a sense of meaning and control. Selective disclosure and concerns about negative responses were issues both for the parents who terminated and those who continued a pregnancy. Conclusion...

  5. Cell lethality after selective irradiation of the DNA replication fork

    International Nuclear Information System (INIS)

    Hofer, K.G.; Warters, R.L.

    1985-01-01

    It has been suggested that nascent DNA located at the DNA replication fork may exhibit enhanced sensitivity to radiation damage. To evaluate this hypothesis, Chinese hamster ovary cells (CHO) were labeled with 125 I-iododeoxyuridine ( 125 IUdR) either in the presence or absence of aphidicolin. Aphidicolin (5 μg/ml) reduced cellular 125 IUdR incorporation to 3-5% of the control value. The residual 125 I incorporation appeared to be restricted to low molecular weight (sub-replicon sized) fragments of DNA which were more sensitive to micrococcal nuclease attack and less sensitive to high salt DNase I digestion than randomly labeled DNA. These findings suggest that DNA replicated in the presence of aphidicolin remains localized at the replication fork adjacent to the nuclear matrix. Based on these observations an attempt was made to compare the lethal consequences of 125 I decays at the replication fork to that of 125 I decays randomly distributed over the entire genome. Regardless of the distribution of decay events, all treatment groups exhibited identical dose-response curves (D 0 : 101 125 I decays/cell). Since differential irradiation of the replication complex did not result in enhanced cell lethality, it can be concluded that neither the nascent DNA nor the protein components (replicative enzymes, nuclear protein matrix) associated with the DNA replication site constitute key radiosensitive targets within the cellular genome. (orig.)

  6. Lethal mutation of internal irradiation brown planthopper (Nilaparvita lugens Stal)

    International Nuclear Information System (INIS)

    Wahid, R.A.

    1988-01-01

    The moulting IVth of BPH nympha were irradiated internally with radiophosphorous 32-P 1 uCi/ml, 10 uCi/ml, 50 uCi/ml, 100 uCi/ml, and 500 uCi/ml concentrations respectivelly. An observation was carried out to determines heredity of hopper sterilities from the mating groups of R male x N female, R male x R female, and N male x R female. The 32-P concentration below of 50 uCi/ml seemed to be the substerile dose, however, the dominant lethal mutation has been visually shown by R male x R female F1 mating group. The hereditary lines of F1, F2, F3, and F4 of the hopper sterilities wich were indicated by the nympha hatch ability have some significant correlations (r1= -0.77, r2= -0.92, r3= -0.93 and r4= -0.85). Thus, the resesif lethal mutations visually showed by F3 and F4 from all of the 100 uCi/ml and 50 uCi/ml treated groups. (author). 10 refs, 2 figs, 2 tabs

  7. Effects of Helicobacter pylori infection on common lethal factors for hepatitis B virus-related cirrhosis

    Directory of Open Access Journals (Sweden)

    LI Yuling

    2015-09-01

    Full Text Available ObjectiveTo study the relationship between Helicobacter pylori (H. pylori infection and common lethal factors for hepatitis B virus-related cirrhosis (HBC. MethodsA total of 235 patients with HBC who were admitted to our hospitals from October 2008 to October 2014 were retrospectively analyzed. The infection rate of H. pylori in those patients was calculated. In the 155 patients with esophagogastric varices and 97 patients with portal hypertensive gastropathy (PHG, the infection rate of H. pylori was compared between those with different degrees of esophagogastric varices or PHG. In the 32 patients whose blood ammonia was determined, the level of blood ammonia was compared between H. pylori-positive and -negative groups. Between-group comparison of continuous data was performed by t test and analysis of variance, and between-group comparison of categorical data was performed by χ2 test. ResultsThe infection rate of H. pylori in the 235 patients with HBC was 80.85% (190/235. In the 155 patients with esophagogastric varices, who had tortuous serpentine uplift or bead-like changes of esophageal varices and tumor-like changes (with or without gastric erosion of gastric varices visible under endoscopy, there was significant difference in infection rate of H. pylori between patients with mild, moderate, and severe varices (50.55% (46/91 vs 43.59% (17/39 vs 76% (19/25, χ2=6.913, P<0.05. In the 97 patients with PHG, who had snake skin-like changes, cherry red spots, scarlet rash, and erosion bleeding of gastric mucosa visible under endoscopy, there was significant difference in infection rate of H. pylori between patients with mild and severe PHG (43.33% (26/60 vs 67.57% (25/37, χ2=5.391, P<005.In patients whose blood ammonia was determined, patients in H. pylori-positive group had a significantly higher average concentration of blood ammonia than those in H. pylori-negative group (62.76±13.43 vs 47.20±12.51 μmol/L, t= 3.39, P<0

  8. Potentiation of radiation lethality by Topotecan, a Topoisomerase I inhibitor

    International Nuclear Information System (INIS)

    Lamond, J.P.; Kinsella, T.J.; Boothman, D.A.

    1995-01-01

    Purpose/Objective: Topotecan is a water soluble Topoisomerase I (Topo I) inhibitor that has demonstrated antineoplastic activity in phase I/II trials of solid tumors (such as non-small cell lung, small cell lung, ovarian, esophageal and head and neck primaries) and leukemias. We sought to determine (1) if Topotecan potentiated the lethal effects of ionizing radiation, and (2) the characteristics of the synergistic effect. Materials and Methods: Human radioresistant melanoma (U1-Mel) and glioma (D54) cells were grown in Dulbecco's modified Eagle's medium (DME) with 10% fetal calf serum (FCS) until confluence-arrest. Cells were x-irradiated (0-700 cGy) and exposed to various Topotecan concentrations (2-100μM), either before (for 4 hours), during, or after (for 4 hours) irradiation. Appropriate controls were also performed. Survival was determined via colony forming assays. Survival curves were normalized to correct for drug cytotoxicities and variations in initial viable cells plated. In another set of experiments, U1-Mel cells were exposed to 10 μM Topotecan either before, during or after 400 cGy, as described above. A modification of the SDS and KCl assay was used to quantify Topo I-DNA complexes via glass fiber filter binding. All experiments were performed at least 7 times in duplicate. Results: Potentiation of radiation lethality was seen in the U1-Mel and D54 cell lines. The synergistic effects were (1) dependent on drug concentration, with lethality enhancement and minimal drug lethality alone in the 2-10 μM range (2) dependent on timing, with synergy present only when the drug was present at the time of, or shortly after irradiation, and (3) irreversible, with inhibition of potential lethal damage repair (PLDR). The dose enhancement ratios (DER) for 4 μM Topotecan in the U1-Mel cells was 1.7 - 2.4, depending on the survival endpoints that were used. The DER for 2 μM Topotecan in D54 cells was 3.0 - 4.0. The U1-Mel cells that were exposed to Topotecan

  9. Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus).

    Science.gov (United States)

    Alves, Ricardo N; Sundell, Kristina S; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M

    2018-06-01

    To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na + , K + -ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier's functional properties mature earlier and are independent of metamorphosis.

  10. Skin care practice in German nursing homes: a German-wide cross-sectional study.

    Science.gov (United States)

    Kottner, Jan; Rahn, Yasmin; Blume-Peytavi, Ulrike; Lahmann, Nils

    2013-04-01

    Due to anatomical and physiological changes in the course of aging and due to increased vulnerability, there are special skin care needs in elderly and care-dependent persons. Little is known about skin care practice in German long-term care facilities. The aim of the study was to gather epidemiological data about skin care practice in German nursing homes. In spring 2012 a German-wide cross sectional study was conducted in 47 nursing homes. Based on standardized data collection sheets. demographics and variables about methods and frequencies of skin cleansing and application of skin care products for 3 552 nursing home residents were collected and analyzed. The variables age, gender and level of care dependency was representative for the group of all German nursing home residents. More than 90% of investigated nursing home residents required skin care assistance. Washing body parts or the whole body were conducted most frequently (89.1%, 95% CI 88.0- 90.1). Skin care leave-on products were used in 91.7% (95% CI 90.7-92.6), whereas there were large variations between individuals. In total, more than 100 brands were used. Skin care practice in multimorbid care dependent persons shows large variations. How skin care products meet the special requirements of aged skin and whether they enhance the skin barrier function and prevent cuteneous skin damage is unknown. © The Authors • Journal compilation © Blackwell Verlag GmbH, Berlin.

  11. Fire barrier problems-part 3

    International Nuclear Information System (INIS)

    Verna, B.J.

    1993-01-01

    This article deals with problems associated with a thermal barrier material called Thermo-Lag 330. Typically in nuclear applications this material is used to provide either 1 hour (1/2 inch thick) or 3 hour (1 inch thick) barriers to prevent the spread of fires between redundant safety systems, and to protect cable trays and conduit. The article reviews concerns within the nuclear industry as to the proper handling of the material, how to interpret the data available on the material, the apparant conflicting assessments of the material when tested by different groups, etc. Research is ongoing on the suitability of the material, but the article points out that the manufacturer feels it should be installed by properly trained installers, the joints sealed with a grouting material, properly bundled to maintain its integrity, have a complete stress skin, and not be walked on after installation in order to function properly

  12. Converse Barrier Certificate Theorems

    DEFF Research Database (Denmark)

    Wisniewski, Rafael; Sloth, Christoffer

    2016-01-01

    This paper shows that a barrier certificate exists for any safe dynamical system. Specifically, we prove converse barrier certificate theorems for a class of structurally stable dynamical systems. Other authors have developed a related result by assuming that the dynamical system has neither...

  13. Chimeric autologous/allogeneic constructs for skin regeneration.

    Science.gov (United States)

    Rasmussen, Cathy Ann; Tam, Joshua; Steiglitz, Barry M; Bauer, Rebecca L; Peters, Noel R; Wang, Ying; Anderson, R Rox; Allen-Hoffmann, B Lynn

    2014-08-01

    The ideal treatment for severe cutaneous injuries would eliminate the need for autografts and promote fully functional, aesthetically pleasing autologous skin regeneration. NIKS progenitor cell-based skin tissues have been developed to promote healing by providing barrier function and delivering wound healing factors. Independently, a device has recently been created to "copy" skin by harvesting full-thickness microscopic tissue columns (MTCs) in lieu of autografts traditionally harvested as sheets. We evaluated the feasibility of combining these two technologies by embedding MTCs in NIKS-based skin tissues to generate chimeric autologous/allogeneic constructs. Chimeric constructs have the potential to provide immediate wound coverage, eliminate painful donor site wounds, and promote restoration of a pigmented skin tissue possessing hair follicles, sweat glands, and sebaceous glands. After MTC insertion, chimeric constructs and controls were reintroduced into air-interface culture and maintained in vitro for several weeks. Tissue viability, proliferative capacity, and morphology were evaluated after long-term culture. Our results confirmed successful MTC insertion and integration, and demonstrated the feasibility of generating chimeric autologous/allogeneic constructs that preserved the viability, proliferative capacity, and structure of autologous pigmented skin. These feasibility studies established the proof-of-principle necessary to further develop chimeric autologous/allogeneic constructs for the treatment of complex skin defects. Reprint & Copyright © 2014 Association of Military Surgeons of the U.S.

  14. Impulsivity, aggression and brain structure in high and low lethality suicide attempters with borderline personality disorder.

    Science.gov (United States)

    Soloff, Paul; White, Richard; Diwadkar, Vaibhav A

    2014-06-30

    Impulsivity and aggressiveness are trait dispositions associated with the vulnerability to suicidal behavior across diagnoses. They are associated with structural and functional abnormalities in brain networks involved in regulation of mood, impulse and behavior. They are also core characteristics of borderline personality disorder (BPD), a disorder defined, in part, by recurrent suicidal behavior. We assessed the relationships between personality traits, brain structure and lethality of suicide attempts in 51 BPD attempters using multiple regression analyses on structural MRI data. BPD was diagnosed by the Diagnostic Interview for Borderline Patients-revised, impulsivity by the Barratt Impulsiveness Scale (BIS), aggression by the Brown-Goodwin Lifetime History of Aggression (LHA), and high lethality by a score of 4 or more on the Lethality Rating Scale (LRS). Sixteen High Lethality attempters were compared to 35 Low Lethality attempters, with no significant differences noted in gender, co-morbidity, childhood abuse, BIS or LHA scores. Degree of medical lethality (LRS) was negatively related to gray matter volumes across multiple fronto-temporal-limbic regions. Effects of impulsivity and aggression on gray matter volumes discriminated High from Low Lethality attempters and differed markedly within lethality groups. Lethality of suicide attempts in BPD may be related to the mediation of these personality traits by specific neural networks. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Heterochromatin position effects on circularized sex chromosomes cause filicidal embryonic lethality in Drosophila melanogaster.

    Science.gov (United States)

    Ferree, Patrick M; Gomez, Karina; Rominger, Peter; Howard, Dagnie; Kornfeld, Hannah; Barbash, Daniel A

    2014-04-01

    Some circularized X-Y chromosomes in Drosophila melanogaster are mitotically unstable and induce early embryonic lethality, but the genetic basis is unknown. Our experiments suggest that a large region of X-linked satellite DNA causes anaphase bridges and lethality when placed into a new heterochromatic environment within certain circularized X-Y chromosomes. These results reveal that repetitive sequences can be incompatible with one another in cis. The lethal phenotype also bears a remarkable resemblance to a case of interspecific hybrid lethality.

  16. Late radiation effects in animals surviving lethal irradiation

    International Nuclear Information System (INIS)

    Dimitrov, L.A.

    1974-01-01

    Animals (rats, mice, dogs) survived lethal irradiation by means of prophylactic-therapeutic treatments or previously irradiated, were studied for late radiation effects: life span, cachexia and fat growing of hypophysical type, tissue or organ hypoplasia manifested by disturbed hemopoiesis, suppressed function of adrenal gland, etc., suppressed immune reactivity of the irradiated organism, atypical biochemical changes in DNA and protein metabolism, epilation, chronic dermatitis, ulcerations, reduced reproductivity or full sterility, damage of kidneys leading to nephrosclerosis, dishormonal states, cataracts, diffuse sclerotic processes, various kinds of malignant and non-malignant tumors. In these cases hemopoiesis compensated for a definite time peripheral blood composition, but during the late period it showed features of incompleteness: shorter life survival of erythrocytes and thrombocytes manifested by a decreased binding of labelled methionine in these blood elements, anemia and relative thrombocytopenia sometimes with an increased number of polychromatic erythrocytes in peripheral blood and a decreased number of reticulocytes at the same time; lymphopenia and relative leucopenia with an increased number of hypersegmented neutrophils. Decreased reproductivity and atypical biochemical changes available in the first generation of the irradiated animals showed the probable role of mutagenic factors in the emergence of some late radiation effects. A significant part of late radiation sequences were due to neuro-endocrine desintegrations which lead to a disturbed supply of the vessels and afterwards to their sclerosis. Some of the described late radiation effects were also observed in biological controls as festures of ageing while in irradiated animals they were manifested in an earlier period. After application of optimal amounts radioprotectors (AET, cysteamine, serotonin) a more marked protective effect is demonstrated in the early reactions (time survival

  17. Barriers to the future

    Energy Technology Data Exchange (ETDEWEB)

    Massey, C T

    1986-09-01

    Opportunities for the British coal industry seem vast yet there are still barriers to progress. Seven areas are identified and discussed: mining mobility (for example, longwall mining systems are rigid and inflexible compared with American stall and pillar working); mine structure (many mines are more suitable to pit ponies than to large pieces of equipment); financial barriers (Government requires the industry to break even in 1987/88); personnel barriers (less specialization, better use of skills); safety barriers (increased use of remote control, ergonomics and robotics to protect workers); microelectronic management (nationalization has cushioned management from the market place; there is a need for a more multidisciplinary approach to the industry); and legal barriers (most legislation in the past has been in response to accidents; legislation external to the industry but affecting it is more fundamental).

  18. Advances in understanding the genetic basis of inherited single gene skin barrier disorders: new clues to key genes that may be involved in the pathogenesis of atopic dermatitis Avanços no entendimento da base genética de doenças hereditárias monogênicas da barreira epidérmica: novas pistas para os principais genes que podem estar envolvidos na patogênese da dermatite atópica

    Directory of Open Access Journals (Sweden)

    Joey E Lai-Cheong

    2006-12-01

    Full Text Available Increasing knowledge of genomic DNA sequences and genetic databases has led to the characterization of the molecular basis of several inherited skin disorders. In this review we summarize some of the major recent discoveries that have been made in defining the pathogenic mutations that cause inherited disorders of the skin barrier leading to skin scaling or increased transepidermal water loss in either rare disorders (Netherton’s syndrome or harlequin ichthyosis or more common genodermatoses (ichthyosis vulgaris. These molecular breakthroughs have led to more accurate diagnoses, better genetic counselling and, where appropriate, the feasibility of DNA-based prenatal diagnosis, as well as the possibility of developing newer forms of treatment, including gene or protein therapy. Identifying the molecular basis of these conditions, especially ichthyosis vulgaris, has also provided dramatic new insight into the genetic abnormalities in the common disorder, atopic dermatitis. Thus research on the relatively rare single gene inherited skin disorders not only has benefits for patients and their families with these uncommon conditions but also has the potential to yield fresh and significant new information about very common skin diseases.O maior conhecimento sobre as de sequências genômicas de DNA e as bases de dados genéticas levou à caracterização da base molecular de várias doenças hereditárias de pele. Nesta revisão resumimos algumas das descobertas recentes mais importantes quanto à definição das mutações patogênicas que causam as doenças hereditárias da barreira cutânea, levando a descamação ou aumento da perda hídrica transepidérmica, seja em doenças raras, (síndrome de Netherton ou ictiose em Arlequim ou genodermatoses mais comuns (ictiose vulgar. Estas descobertas moleculares têm conduzido a diagnósticos mais acurados, melhor aconselhamento genético e, quando apropriado, à possibilidade de diagnóstico pr

  19. Ceramide 1 and ceramide 3 act synergistically on skin hydration and the transepidermal water loss of sodium lauryl sulfate-irritated skin.

    Science.gov (United States)

    Huang, Huey-Chun; Chang, Tsong-Min

    2008-08-01

    Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.

  20. Gastrointestinal decontamination in healthy and lethally irradiated monkeys

    International Nuclear Information System (INIS)

    Hendriks, W.D.H.

    1980-01-01

    In periods of extreme immunosuppression, infections which are often life-threatening, frequently occur. In an attempt to prevent such infections in lethally irradiated rhesus monkeys, the animals were subjected to strict reverse isolation prior to irradiation and administrated orally with nonabsorbable antibiotics in order to eliminate their microflora. The antibiotic combination was selected on the basis of a sensitivity test and was added to the liquid food supply. To rapidly achieve a high bactericidal concentration in the intestine, the same antibiotics were additionally given orally for 5 days. The microflora was reduced rapidly; within a few days sterile cultures were obtained. Particularly after discontinuation of the administration of the additional antibiotics were colonizations found. In contrast to colonizations persisting from the first day of treatment on, the first were rather easy to suppress. (Auth.)