LOCALIZATION OF PERMEABILITY BARRIERS IN THE FROG SKIN EPITHELIUM

Science.gov (United States)

Martinez-Palomo, A.; Erlij, D.; Bracho, H.

1971-01-01

Ruthenium red and colloidal lanthanum were used to determine the site of the structural barriers to diffusion within the intercellular spaces of frog skin epithelium. Electron micrographs show that occluding zonules located at the outer border of the stratum corneum and at the outer layer of the stratum granulosum are true tight junctions since they are impermeable to these tracers. Measurement of 140La uptake by the living skin shows that lanthanum moves across the external surface of the skin readily, into and out of a compartment that has a limited capacity and is bounded on its internal side by a barrier impermeable to lanthanum. Examination of these skins with the electron microscope suggests that the compartment is localized between the external membrane of the cells at the outer layer of the s. granulosum and at the outermost surface of the skin. These observations and other findings described in the literature indicate that the site of the external high resistance barrier of the frog skin is localized at the outer border of the s. granulosum. PMID:4329611

Ceramides and barrier function in healthy skin

DEFF Research Database (Denmark)

Jungerstedt, J; Hellgren, Lars; Drachmann, Tue

2010-01-01

Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...

The outcomes of barrier protection in periwound skin and stoma care.

Science.gov (United States)

Stephen-Haynes, Jackie

This article considers the anatomy and physiology of the skin,wound healing, excoriation, maceration, peristomal skin and the importance of periwound protection. The results of a 54-patient study of the use of barrier film forming skin protection in periwound skin are presented and a 10-patient healthy volunteer experimental evaluation. The results confirm the effectiveness of barrier protection in healthy skin in an experimental evaluation and a 54-patient study requiring periwound protection.

Impaired Skin Barrier Due to Sebaceous Gland Atrophy in the Latent Stage of Radiation-Induced Skin Injury: Application of Non-Invasive Diagnostic Methods

Directory of Open Access Journals (Sweden)

Hyosun Jang

2018-01-01

Full Text Available Radiation-induced skin injury can take the form of serious cutaneous damage and have specific characteristics. Asymptomatic periods are classified as the latent stage. The skin barrier plays a critical role in the modulation of skin permeability and hydration and protects the body against a harsh external environment. However, an analysis on skin barrier dysfunction against radiation exposure in the latent stage has not been conducted. Thus, we investigated whether the skin barrier is impaired by irradiation in the latent stage and aimed to identify the molecules involved in skin barrier dysfunction. We analyzed skin barrier function and its components in SKH1 mice that received 20 and 40 Gy local irradiation. Increased transepidermal water loss and skin pH were observed in the latent stage of the irradiated skin. Skin barrier components, such as structural proteins and lipid synthesis enzymes in keratinocyte, increased in the irradiated group. Interestingly, we noted sebaceous gland atrophy and increased serine protease and inflammatory cytokines in the irradiated skin during the latent period. This finding indicates that the main factor of skin barrier dysfunction in the latent stage of radiation-induced skin injury is sebaceous gland deficiency, which could be an intervention target for skin barrier impairment.

Skin barrier disruption by acetone: observations in a hairless mouse skin model

NARCIS (Netherlands)

Rissmann, R.; Oudshoorn, M.H.M.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

2009-01-01

To disrupt the barrier function of the skin, different in vivo methods have been established, e.g., by acetone wiping or tape-stripping. In this study, the acetone-induced barrier disruption of hairless mice was investigated in order to establish a reliable model to study beneficial, long-term

Trait Positive Affect Buffers the Effects of Acute Stress on Skin Barrier Recovery

Science.gov (United States)

Robles, Theodore F.; Brooks, Kathryn P.; Pressman, Sarah D.

2010-01-01

Objective This study examines the role of self-reported trait positive affect (PA) on skin barrier recovery after skin disruption, and whether the role of trait PA in wound healing is consistent with the direct effects model or the stress-buffering model of PA and health. Design Sixty healthy participants (mean age 22.7 ± 3.9 years) completed a self-report measure of trait positive and negative affect, underwent a “tape-stripping” procedure that disrupts normal skin barrier function, and were randomly assigned to a Stress (Trier Social Stress Test) or No Stress (reading task) condition. Main Outcome Measures Skin barrier recovery was assessed by measuring transepidermal water loss up to 2 hr after skin disruption. Results Multilevel modeling indicated that greater trait PA was related to faster skin barrier recovery (p < .05). The effects of PA on skin barrier recovery were independent of levels of trait NA. Conclusion These findings suggest that trait PA may influence skin barrier recovery following a brief stressor. In addition, these results provide additional evidence that trait PA can positively impact objective health outcomes. PMID:19450044

Multifactorial skin barrier deficiency and atopic dermatitis: Essential topics to prevent the atopic march.

Science.gov (United States)

Egawa, Gyohei; Kabashima, Kenji

2016-08-01

Atopic dermatitis (AD) is the most common inflammatory skin disease in the industrialized world and has multiple causes. Over the past decade, data from both experimental models and patients have highlighted the primary pathogenic role of skin barrier deficiency in patients with AD. Increased access of environmental agents into the skin results in chronic inflammation and contributes to the systemic "atopic (allergic) march." In addition, persistent skin inflammation further attenuates skin barrier function, resulting in a positive feedback loop between the skin epithelium and the immune system that drives pathology. Understanding the mechanisms of skin barrier maintenance is essential for improving management of AD and limiting downstream atopic manifestations. In this article we review the latest developments in our understanding of the pathomechanisms of skin barrier deficiency, with a particular focus on the formation of the stratum corneum, the outermost layer of the skin, which contributes significantly to skin barrier function. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Ceramides and barrier function in healthy skin

DEFF Research Database (Denmark)

Mutanu Jungersted, Jakob; Hellgren, Lars; Høgh, Julie Kaae

2010-01-01

Lipids in the stratum corneum are key components in the barrier function of the skin. Changes in lipid composition related to eczematous diseases are well known, but limited data are available on variations within healthy skin. The objective of the present study was to compare ceramide subgroups...... and ceramide/cholesterol ratios in young, old, male and female healthy skin. A total of 55 participants with healthy skin was included in the study. Lipid profiles were correlated with transepidermal water loss and with information on dry skin from a questionnaire including 16 people. No statistically...... significant differences were found between young and old skin for ceramide subgroups or ceramide/cholesterol ratios, and there was no statistically significant correlation between answers about dry skin and ceramide levels. Interestingly, a statistically significant higher ceramide/cholesterol ratio was found...

Composite of microgels and lipids as biofilm to restore skin barrier function

NARCIS (Netherlands)

Oudshoorn, M.H.M.

2008-01-01

The mature epidermis is an effective barrier which prevents the body from dehydration and protects it against various environmental influences. If the natural barrier is immature or damaged, the skin barrier is impaired and desiccation occurs. Hence, the regeneration of impaired skin is an essential

Defective channels lead to an impaired skin barrier.

Science.gov (United States)

Blaydon, Diana C; Kelsell, David P

2014-10-15

Channels are integral membrane proteins that form a pore, allowing the passive movement of ions or molecules across a membrane (along a gradient), either between compartments within a cell, between intracellular and extracellular environments or between adjacent cells. The ability of cells to communicate with one another and with their environment is a crucial part of the normal physiology of a tissue that allows it to carry out its function. Cell communication is particularly important during keratinocyte differentiation and formation of the skin barrier. Keratinocytes in the skin epidermis undergo a programme of apoptosis-driven terminal differentiation, whereby proliferating keratinocytes in the basal (deepest) layer of the epidermis stop proliferating, exit the basal layer and move up through the spinous and granular layers of the epidermis to form the stratum corneum, the external barrier. Genes encoding different families of channel proteins have been found to harbour mutations linked to a variety of rare inherited monogenic skin diseases. In this Commentary, we discuss how human genetic findings in aquaporin (AQP) and transient receptor potential (TRP) channels reveal different mechanisms by which these channel proteins function to ensure the proper formation and maintenance of the skin barrier. © 2014. Published by The Company of Biologists Ltd.

Cost-effectiveness of a Ceramide-Infused Skin Barrier Versus a Standard Barrier

Science.gov (United States)

Berger, Ariel; Inglese, Gary; Skountrianos, George; Karlsmark, Tonny; Oguz, Mustafa

2018-01-01

PURPOSE: To assess the cost-effectiveness of a ceramide-infused skin barrier (CIB) versus other skin barriers (standard of care) among patients who have undergone ostomy creation. DESIGN: Cost-effectiveness analysis, based on a decision-analytic model that was estimated using data from the ADVOCATE (A Study Determining Variances in Ostomy Skin Conditions And The Economic Impact) trial, which investigated stoma-related healthcare costs over 12 weeks among patients who recently underwent fecal ostomy, and from other sources. SUBJECTS AND SETTING: Analysis was based on a hypothetical cohort of 1000 patients who recently underwent fecal ostomy; over a 1-year period, 500 patients were assumed to use CIB and 500 were assumed to use standard of care. METHODS: We adapted a previous economic model to estimate expected 1-year costs and outcomes among persons with a new ostomy assumed to use CIB versus standard of care. Outcomes of interest included peristomal skin complications (PSCs) (up to 2 during the 1-year period of interest) and quality-adjusted life days (QALDs); QALDs vary from 1, indicating a day of perfect health to 0, indicating a day with the lowest possible health (deceased). Subjects were assigned QALDs on a daily basis, with the value of the QALD on any given day based on whether the patient was experiencing a PSC. Costs included those related to skin barriers, ostomy accessories, and care of PSCs. The incremental cost-effectiveness of CIB versus standard of care was estimated as the incremental cost per PSC averted and QALD gained, respectively; net monetary benefit of CIB was also estimated. All analyses were run using the perspective of an Australian payer. RESULTS: On a per-patient basis, use of CIB was expected over a 1-year period to result in 0.16 fewer PSCs, an additional 0.35 QALDs, and a savings of A$180 (Australian dollars, US $137) in healthcare costs all versus standard of care. Management with CIB provided a net monetary benefit (calculated as

Effect of glove occlusion on the skin barrier

DEFF Research Database (Denmark)

Tiedemann, Daniel; Clausen, Maja Lisa; John, Swen Malthe

2016-01-01

that the negative effect of occlusion in itself is limited, and that only extensive and long-term occlusion will cause barrier impairment. However, studies investigating combined effect of occlusion and exposure to soaps/detergents indicate that occlusion significantly enhances the skin barrier damage caused...... by detergents/soaps in a dose-response fashion....

Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months......Alitretinoin is a new drug for systemic treatment of chronic hand eczema. Previous functional tests of skin topically treated with retinoids have indicated impaired skin barrier function, but no data are available on barrier parameters after systemic alitretinoin treatment. To investigate...

Oral intake of beet extract provides protection against skin barrier impairment in hairless mice.

Science.gov (United States)

Kawano, Ken-Ichi; Umemura, Kazuo

2013-05-01

The epidermis acts as a functional barrier against the external environment. Disturbances in the function of this barrier cause water loss and increase the chances of penetration by various irritable stimuli, leading to skin diseases such as dry skin, atopic dermatitis, and psoriasis. Ceramides are a critical natural element of the protective epidermal barrier. The aim of this study was to evaluate whether the oral intake of beet (Beta vulgaris) extract, a natural product rich in glucosylceramide (GlcCer), may prevent disturbance in skin barrier function. When HR-1 hairless mice were fed a special diet (HR-AD), transepidermal water loss (TEWL) from the dorsal skin increased, with a compensatory increase in water intake after 5 weeks. Mice fed with HR-AD had dry skin with erythema and showed increased scratching behaviour. Histological examinations revealed a remarkable increase in the thickness of the skin at 8 weeks. Supplemental addition of beet extract, which contained GlcCer at a final concentration of 0.1%, significantly prevented an increase TEWL, water intake, cumulative scratching time, and epidermal thickness at 8 weeks. These results indicate that oral intake of beet extract shows potential for preventing skin diseases associated with impaired skin barrier function. Copyright © 2012 John Wiley & Sons, Ltd.

Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

Directory of Open Access Journals (Sweden)

Magdalena Boer

2016-02-01

Full Text Available The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

Disturbed skin barrier in children with chronic kidney disease.

Science.gov (United States)

Wojtowicz-Prus, Elzbieta; Kilis-Pstrusinska, Katarzyna; Reich, Adam; Zachwieja, Katarzyna; Miklaszewska, Monika; Szczepanska, Maria; Szepietowski, Jacek C

2015-02-01

There are limited data on skin lesions in children with end-stage renal failure. The aim of the study was an evaluation of the skin barrier in children with different stages of chronic kidney disease (CKD). The prevalence of xerosis, its severity, as well as its link selected demographic factors, were examined. The study included 103 children: 72 with CKD stages 3-5 (38 on conservative treatment and 34 on dialysis) and 31 patients with primary monosymptomatic nocturnal enuresis as a control group. Initially, the study subjects described the localisation and severity of dry skin by themselves. Next, clinical evaluation of xerosis, non-invasive corneometric assessment of epidermis moisturising and the measurement of transepidermal water loss were performed. Most CKD children reported dry skin. The problem of xerosis was identified more frequently in patients on dialysis (67.6 %) than on conservative treatment (42.1 %) (p = 0.01). CKD patients divided according to skin dryness did not differ with regards to age, sex, initial kidney disease and CKD duration. Disturbed skin barrier is an important concern of children with CKD, intensifying as the disease progresses. This symptom occurs on early stages of CKD and it should be taken into consideration in the CKD management.

The effects of using a moldable skin barrier on peristomal skin condition in persons with an ostomy: results of a prospective, observational, multinational study.

Science.gov (United States)

Szewczyk, Maria Teresa; Majewska, Grazyna; Cabral, Mary V; Hölzel-Piontek, Karin

2014-12-01

Peristomal skin problems are the most commonly experienced physical complication following ostomy surgery and often are caused by leakage or a poorly fitting skin barrier. A prospective, multicenter, observational evaluation of persons with a colostomy, ileostomy, or urostomy was conducted to assess the incidence of peristomal lesions and level of patient satisfaction with moldable skin barriers. Peristomal skin was assessed using the Studio Alterazoni Cutanee Stomale (SACS™) scale, and patients were asked to rate barrier application and usage variables. During a period of 12 months, and using convenience sampling, 561 patients from 90 centers in 3 countries were enrolled: 28 in Germany, 48 in Poland, and 14 in the United States. Participants included 277 new stoma patients (average time since surgery 0.3 months; average age 64.7 ± 12.86 years) who had a colostomy (174), ileostomy (72), or urostomy (10); and 284 patients with an existing stoma (average time since surgery 18.2 months; average age 66 ± 12.62 years) who had a colostomy (174), ileostomy (88), or urostomy (22) who experienced skin complications using a traditional skin barrier (ie, a solid or flexible barrier with precut opening or one requiring cutting an opening to accommodate the stoma). All patients were assessed at baseline and after 1 and 2 months. In the patients with a new stoma, 225 (90.4%) had intact skin at baseline, 239 (95.6%) had intact skin after 2 months, and 98% rated overall satisfaction with the barrier as good or excellent. In the patients with an existing stoma, intact skin was observed in 103 patients (39.5%) at baseline and 225 (86.2%) after 2 months, with 96.5% of patients rating overall satisfaction with the barrier as good or excellent. In this group, the proportion of patients who used accessory products (eg, belt, deodorants, powder) was 73% at baseline and 64.2% at the 2-month follow-up. The moldable skin barriers evaluated were effective in preventing and healing

Hydrogel-forming microneedles increase in volume during swelling in skin, but skin barrier function recovery is unaffected

Science.gov (United States)

Donnelly, Ryan F.; Mooney, Karen; McCrudden, Maelíosa T.C.; Vicente-Pérez, Eva M.; Belaid, Luc; González-Vázquez, Patricia; McElnay, James C.; Woolfson, A. David

2014-01-01

We describe, for the first time, quantification of in-skin swelling and fluid uptake by hydrogel-forming microneedle arrays (MN) and skin barrier recovery in human volunteers. Such MN, prepared from aqueous blends of hydrolysed poly(methylvinylether/maleicanhydride) (15% w/w) and the crosslinker poly(ethyleneglycol) 10,000 daltons (7.5% w/w), were inserted into the skin of human volunteers (n = 15) to depths of approximately 300 μm by gentle hand pressure. The MN swelled in skin, taking up skin interstitial fluid, such that their mass had increased by approximately 30% after 6 hours in skin. Importantly, however, skin barrier function recovered within 24 hours post microneedle removal, regardless of how long the MN had been in skin or how much their volume had increased with swelling. Further research on closure of MN-induced micropores is required, since transepidermal water loss measurements suggested micropore closure, while optical coherence tomography indicated that MN-induced micropores had not closed over, even 24 hours after MN had been removed. There were no complaints of skin reactions, adverse events or strong views against MN use by any of the volunteers. Only some minor erythema was noted after patch removal, although this always resolved within 48 hours and no adverse events were present on follow-up. PMID:24633895

Physiological and Molecular Effects of in vivo and ex vivo Mild Skin Barrier Disruption.

Science.gov (United States)

Pfannes, Eva K B; Weiss, Lina; Hadam, Sabrina; Gonnet, Jessica; Combardière, Béhazine; Blume-Peytavi, Ulrike; Vogt, Annika

2018-01-01

The success of topically applied treatments on skin relies on the efficacy of skin penetration. In order to increase particle or product penetration, mild skin barrier disruption methods can be used. We previously described cyanoacrylate skin surface stripping as an efficient method to open hair follicles, enhance particle penetration, and activate Langerhans cells. We conducted ex vivo and in vivo measurements on human skin to characterize the biological effect and quantify barrier disruption-related inflammation on a molecular level. Despite the known immunostimulatory effects, this barrier disruption and hair follicle opening method was well accepted and did not result in lasting changes of skin physiological parameters, cytokine production, or clinical side effects. Only in ex vivo human skin did we find a discrete increase in IP-10, TGF-β, IL-8, and GM-CSF mRNA. The data underline the safety profile of this method and demonstrate that the procedure per se does not cause substantial inflammation or skin damage, which is also of interest when applied to non-invasive sampling of biomarkers in clinical trials. © 2018 S. Karger AG, Basel.

Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study

Directory of Open Access Journals (Sweden)

Elisabeth Hahnel

2017-11-01

Full Text Available Abstract Background Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. Methods This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Results Mean age (n = 223 was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%. The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%, of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2% and of skin tears 6.3% (95% CI: 3.2% - 9.5%. Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Conclusion Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis

Associations between skin barrier characteristics, skin conditions and health of aged nursing home residents: a multi-center prevalence and correlational study.

Science.gov (United States)

Hahnel, Elisabeth; Blume-Peytavi, Ulrike; Trojahn, Carina; Kottner, Jan

2017-11-13

Geriatric patients are affected by a range of skin conditions and dermatological diseases, functional limitations and chronic diseases. Skin problems are highly prevalent in elderly populations. Aim of this study was to investigate possible associations between health, functional and cutaneous variables in aged long-term care residents. This observational, cross-sectional, descriptive prevalence study was conducted in a random sample of 10 institutional long-term care facilities in Berlin. In total, n = 223 residents were included. Demographic and functional characteristics, xerosis cutis, incontinence associated dermatitis, pressure ulcers and skin tears were assessed. Stratum corneum hydration, transepidermal water loss, skin surface pH and skin temperature were measured. Data analysis was descriptive and explorative. To explore possible bivariate associations, a correlation matrix was created. The correlation matrix was also used to detect possible collinearity in the subsequent regression analyses. Mean age (n = 223) was 83.6 years, 67.7% were female. Most residents were affected by xerosis cutis (99.1%; 95% CI: 97.7% - 100.0%). The prevalence of pressure ulcers was 9.0% (95% CI: 5.0% - 13.0%), of incontinence associated dermatitis 35.4% (95% CI: 29.9% - 42.2%) and of skin tears 6.3% (95% CI: 3.2% - 9.5%). Biophysical skin parameters were not associated with overall care dependency, but with age and skin dryness. In general, skin dryness and measured skin barrier parameters were associated between arms and legs indicating similar overall skin characteristics of the residents. Prevalence of xerosis cutis, pressure ulcers and skin tears were high, indicating the load of these adverse skin conditions in this population. Only few associations of demographic characteristics, skin barrier impairments and the occurrence of dry skin, pressure ulcers, skin tears and incontinence-associated dermatitis have been detected, that might limit the diagnostic value of skin

Natural Oils for Skin-Barrier Repair: Ancient Compounds Now Backed by Modern Science.

Science.gov (United States)

Vaughn, Alexandra R; Clark, Ashley K; Sivamani, Raja K; Shi, Vivian Y

2018-02-01

Natural plant oils are commonly used as topical therapy worldwide. They are usually easily accessible and are relatively inexpensive options for skin care. Many natural oils possess specific compounds with antimicrobial, antioxidant, anti-inflammatory, and anti-itch properties, making them attractive alternative and complementary treatments for xerotic and inflammatory dermatoses associated with skin-barrier disruption. Unique characteristics of various oils are important when considering their use for topical skin care. Differing ratios of essential fatty acids are major determinants of the barrier repair benefits of natural oils. Oils with a higher linoleic acid to oleic acid ratio have better barrier repair potential, whereas oils with higher amounts of irritating oleic acid may be detrimental to skin-barrier function. Various extraction methods for oils exist, including cold pressing to make unrefined oils, heat and chemical distillation to make essential oils, and the addition of various chemicals to simulate a specific scent to make fragranced oils. The method of oil processing and refinement is an important component of selecting oil for skin care, and cold pressing is the preferred method of oil extraction as the heat- and chemical-free process preserves beneficial lipids and limits irritating byproducts. This review summarizes evidence on utility of natural plant-based oils in dermatology, particularly in repairing the natural skin-barrier function, with the focus on natural oils, including Olea europaea (olive oil), Helianthus annus (sunflower seed oil), Cocos nucifera (coconut oil), Simmondsia chinesis (jojoba oil), Avena sativa (oat oil), and Argania spinosa (argan oil).

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...

Effect of saline iontophoresis on skin barrier function and cutaneous irritation in four ethnic groups.

Science.gov (United States)

Singh, J; Gross, M; Sage, B; Davis, H T; Maibach, H I

2000-08-01

The effect of saline iontophoresis on skin barrier function and irritation was investigated in four ethnic groups (Caucasians, Hispanics, Blacks and Asians). Forty healthy human volunteers were recruited according to specific entry criteria. Ten subjects, five males and five females, were assigned to each ethnic group. Skin barrier function was examined after 4 hours of saline iontophoresis at a current density of 0.2 mA/cm(2) on a 6.5 cm(2) area in terms of the measured responses: transepidermal water loss (TEWL), skin capacitance, skin temperature and visual scores. There were significant differences in TEWL among the ethnic groups prior to patch application. TEWL at baseline in ethnic groups was in the rank order: Caucasian>Asian>Hispanic>Black. Iontophoresis was generally well tolerated, and skin barrier function was not irreversibly affected by iontophoresis in any group. There was no significant skin temperature change, compared to baseline, in any ethnic groups at any observation point. Edema was not observed. At patch removal, the erythema score was elevated in comparison to baseline in all ethnic groups; erythema resolved within 24 hours. Thus, saline iontophoresis produced reversible changes in skin barrier function and irritation in healthy human subjects.

Effects of industrial detergents on the barrier function of human skin

DEFF Research Database (Denmark)

Nielsen, G D; Nielsen, Jesper Bo; Andersen, Klaus Ejner

2000-01-01

Detergents are involved in the causation of contact dermatitis and in promoting percutaneous absorption of toxic chemicals, but limited information is available to allow an assessment of their relative effects on the skin barrier function. The effect of detergents on skin permeability to water...

Mechanism for initiation of food allergy: Dependence on skin barrier mutations and environmental allergen costimulation.

Science.gov (United States)

Walker, Matthew T; Green, Jeremy E; Ferrie, Ryan P; Queener, Ashley M; Kaplan, Mark H; Cook-Mills, Joan M

2018-02-15

Mechanisms for the development of food allergy in neonates are unknown but clearly linked in patient populations to a genetic predisposition to skin barrier defects. Whether skin barrier defects contribute functionally to development of food allergy is unknown. The purpose of the study was to determine whether skin barrier mutations, which are primarily heterozygous in patient populations, contribute to the development of food allergy. Mice heterozygous for the filaggrin (Flg) ft and Tmem79 ma mutations were skin sensitized with environmental and food allergens. After sensitization, mice received oral challenge with food allergen, and then inflammation, inflammatory mediators, and anaphylaxis were measured. We define development of inflammation, inflammatory mediators, and food allergen-induced anaphylaxis in neonatal mice with skin barrier mutations after brief concurrent cutaneous exposure to food and environmental allergens. Moreover, neonates of allergic mothers have increased responses to suboptimal sensitization with food allergens. Importantly, responses to food allergens by these neonatal mice were dependent on genetic defects in skin barrier function and on exposure to environmental allergens. ST2 blockade during skin sensitization inhibited the development of anaphylaxis, antigen-specific IgE, and inflammatory mediators. Neonatal anaphylactic responses and antigen-specific IgE were also inhibited by oral pre-exposure to food allergen, but interestingly, this was blunted by concurrent pre-exposure of the skin to environmental allergen. These studies uncover mechanisms for food allergy sensitization and anaphylaxis in neonatal mice that are consistent with features of human early-life exposures and genetics in patients with clinical food allergy and demonstrate that changes in barrier function drive development of anaphylaxis to food allergen. Copyright © 2018 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Female Rats are Less Susceptible during Puberty to Lethal Effects of Percutaneous Exposure to VX

Science.gov (United States)

2015-12-17

lethal dose determination for percutaneous exposure to soman and VX in guinea pigs and the effectiveness of decontamination with M291 SDK or SANDIA...di-isopropylamino) ethyl] methyl phosphonthioate) through pig , human and guinea pig skin in vitro, Toxicol. In Vitro 20 (2006) 1532–1536. [6] R... production and transepidermal water loss [TEWL]) change with age [3,14,15]. As reviewed in Ref. [28], the barrier function of the stratum corneum is

Coal tar induces AHR-dependent skin barrier repair in atopic dermatitis

NARCIS (Netherlands)

Bogaard, E.H. van den; Bergboer, J.G.M.; Vonk-Bergers, M.; Vlijmen-Willems, I.M. van; Hato, S.V.; Valk, P.G. van der; Schroder, J.M.; Joosten, I.; Zeeuwen, P.L.J.M.; Schalkwijk, J.

2013-01-01

Topical application of coal tar is one of the oldest therapies for atopic dermatitis (AD), a T helper 2 (Th2) lymphocyte-mediated skin disease associated with loss-of-function mutations in the skin barrier gene, filaggrin (FLG). Despite its longstanding clinical use and efficacy, the molecular

Assessment of skin barrier function in rosacea patients with a novel 1% metronidazole gel.

Science.gov (United States)

Draelos, Zoe D

2005-01-01

The skin of patients with rosacea is extremely sensitive and hyper-reactive to dietary, environmental, and topical factors. Accordingly, the management of rosacea involves not only choosing appropriate medication and treatment for daily skin care, but also avoiding known trigger factors. Recently, 1% metronidazole, a mainstay of topical rosacea therapy, was reformulated in a gel vehicle that contains hydrosolubilizing agents (HSA) niacinamide, beta cyclodextrin, and a low concentration of propylene glycol. It is designed to solubilize greater concentrations of metronidazole than is possible in water alone while reducing the potential for irritation and barrier disruption. A 2-week study was undertaken by the author to evaluate the effect of the new 1% metronidazole gel on the skin barrier in 25 women with mild to moderate rosacea. Statistically significant improvement in disease severity, erythema, desquamation, and skin irritation was noted by the investigator by the end of week 1, which continued throughout the study. After 2 weeks, subjects noted improvements in skin condition and rosacea. Results of noninvasive assessments showed no disruption of the skin barrier. Furthermore, there was an increasing trend in skin hydration that approached statistical significance.

Damage and recovery of skin barrier function after glycolic acid chemical peeling and crystal microdermabrasion.

Science.gov (United States)

Song, Ji Youn; Kang, Hyun A; Kim, Mi-Yeon; Park, Young Min; Kim, Hyung Ok

2004-03-01

Superficial chemical peeling and microdermabrasion have become increasingly popular methods for producing facial rejuvenation. However, there are few studies reporting the skin barrier function changes after these procedures. To evaluate objectively the degree of damage visually and the time needed for the skin barrier function to recover after glycolic acid peeling and aluminum oxide crystal microdermabrasion using noninvasive bioengineering methods. Superficial chemical peeling using 30%, 50%, and 70% glycolic acid and aluminum oxide crystal microdermabrasion were used on the volar forearm of 13 healthy women. The skin response was measured by a visual observation and using an evaporimeter, corneometer, and colorimeter before and after peeling at set time intervals. Both glycolic acid peeling and aluminum oxide crystal microdermabrasion induced significant damage to the skin barrier function immediately after the procedure, and the degree of damage was less severe after the aluminum oxide crystal microdermabrasion compared with glycolic acid peeling. The damaged skin barrier function had recovered within 24 hours after both procedures. The degree of erythema induction was less severe after the aluminum oxide crystal microdermabrasion compared with the glycolic acid peeling procedure. The degree of erythema induced after the glycolic acid peeling procedure was not proportional to the peeling solution concentration used. The erythema subsided within 1 day after the aluminum oxide crystal microdermabrasion procedure and within 4 days after the glycolic acid peeling procedure. These results suggest that the skin barrier function is damaged after the glycolic acid peeling and aluminum oxide crystal microdermabrasion procedure but recovers within 1 to 4 days. Therefore, repeating the superficial peeling procedure at 2-week intervals will allow sufficient time for the damaged skin to recover its barrier function.

Evaluation of a cyanoacrylate dressing to manage peristomal skin alterations under ostomy skin barrier wafers.

Science.gov (United States)

Milne, Catherine T; Saucier, Darlene; Trevellini, Chenel; Smith, Juliet

2011-01-01

Peristomal skin alterations under ostomy barrier wafers are a commonly reported problem. While a number of interventions to manage this issue have been reported, the use of a topically applied cyanoacrylate has received little attention. This case series describes the use of a topical cyanoacrylate for the management of peristomal skin alterations in persons living with an ostomy. Using a convenience sample, the topical cyanoacrylate dressing was applied to 11 patients with peristomal skin disruption under ostomy wafers in acute care and outpatient settings. The causes of barrier function interruption were also addressed to enhance outcomes. Patients were assessed for wound discomfort using a Likert Scale, time to healing, and number of appliance changes. Patient satisfaction was also examined. Average reported discomfort levels were 9.5 out of 10 at the initial peristomal irritation assessment visit decreased to 3.5 at the first wafer change and were absent by the second wafer change. Wafers had increasing wear time between changes in both settings with acute care patients responding faster. Epidermal resurfacing occurred within 10.2 days in outpatients and within 7 days in acute care patients. Because of the skin sealant action of this dressing, immediate adherence of the wafer was reported at all pouch changes.

A synthetic C16 omega-hydroxyphytoceramide improves skin barrier functions from diversely perturbed epidermal conditions.

Science.gov (United States)

Oh, Myoung Jin; Nam, Jin Ju; Lee, Eun Ok; Kim, Jin Wook; Park, Chang Seo

2016-10-01

Omega-hydroxyceramides (ω-OH-Cer) play a crucial role in maintaining the integrity of skin barrier. ω-OH-Cer are the primary lipid constituents of the corneocyte lipid envelope (CLE) covalently attached to the outer surface of the cornified envelope linked to involucrin to become bound form lipids in stratum corneum (SC). CLE becomes a hydrophobic impermeable layer of matured corneocyte preventing loss of natural moisturizing factor inside the corneocytes. More importantly, CLE may also play an important role in the formation of proper orientation of intercellular lipid lamellar structure by interdigitating with the intercellular lipids in a comb-like fashion. Abnormal barrier conditions associated with atopic dermatitis but also UVB-irradiated skins are known to have lowered level of bound lipids, especially ω-OH-Cer, which indicate that ω-OH-Cer play an important role in maintaining the integrity of skin barrier. In this study, protective effects of a novel synthetic C16 omega-hydroxyphytoceramides (ω-OH-phytoceramide) on skin barrier function were investigated. Epidermal barrier disruption was induced by UVB irradiation, tape-stripping in hairless mouse and human skin. Protective effect of damaged epidermis was evaluated using the measurement of transepidermal water loss and cohesion of SC. Increased keratinocyte differentiation was verified using cultured keratinocyte through western blot. Results clearly demonstrated that a synthetic C16 ω-OH-phytoceramide enhanced the integrity of SC and accelerated the recovery of damaged skin barrier function by stimulating differentiation process. In a conclusion, a synthetic C16 ω-OH-phytoceramide treatment improved epidermal homeostasis in several disrupted conditions.

Examination of the skin barrier repair/wound healing process using a living skin equivalent model and matrix-assisted laser desorption-ionization-mass spectrometry imaging.

Science.gov (United States)

Lewis, E E L; Barrett, M R T; Freeman-Parry, L; Bojar, R A; Clench, M R

2018-04-01

Examination of the skin barrier repair/wound healing process using a living skin equivalent (LSE) model and matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI) to identify lipids directly involved as potential biomarkers. These biomarkers may be used to determine whether an in vivo wound is going to heal for example if infected. An in vitro LSE model was wounded with a scalpel blade and assessed at day 4 post-wounding by histology and MALDI-MSI. Samples were sectioned at wound site and were either formalin-fixed paraffin-embedded (FFPE) for histology or snapped frozen (FF) for MSI analysis. The combination of using an in vitro wounded skin model with MSI allowed the identification of lipids involved in the skin barrier repair/wound healing process. The technique was able to highlight lipids directly in the wound site and distinguish differences in lipid distribution between the epidermis and wound site. This novel method of coupling an in vitro LSE with MSI allowed in-depth molecular analysis of the skin barrier repair/wound healing process. The technique allowed the identification of lipids directly involved in the skin barrier repair/wound healing process, indicating these biomarkers may be potentially be used within the clinic. These biomarkers will help to determine, which stage of the skin barrier repair/wound healing process the wound is in to provide the best treatment. © 2018 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Controlling the hydration of the skin though the application of occluding barrier creams.

Science.gov (United States)

Sparr, Emma; Millecamps, Danielle; Isoir, Muriel; Burnier, Véronique; Larsson, Åsa; Cabane, Bernard

2013-03-06

The skin is a barrier membrane that separates environments with profoundly different water contents. The barrier properties are assured by the outer layer of the skin, the stratum corneum (SC), which controls the transepidermal water loss. The SC acts as a responding membrane, since its hydration and permeability vary with the boundary condition, which is the activity of water at the outer surface of the skin. We show how this boundary condition can be changed by the application of a barrier cream that makes a film with a high resistance to the transport of water. We present a quantitative model that predicts hydration and water transport in SC that is covered by such a film. We also develop an experimental method for measuring the specific resistance to water transport of films made of occluding barrier creams. Finally, we combine the theoretical model with the measured properties of the barrier creams to predict how a film of cream changes the activity of water at the outer surface of the SC. Using the known variations of SC permeability and hydration with the water activity in its environment (i.e. the relative humidity), we can thus predict how a film of barrier cream changes SC hydration.

Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin.

Science.gov (United States)

Oudshoorn, Marion H M; Rissmann, Robert; van der Coelen, Dennis; Hennink, Wim E; Ponec, Maria; Bouwstra, Joke A

2009-08-01

The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which formulation could improve barrier function, as was observed previously for the natural biofilm vernix caseosa (VC). The biofilms [i.e. particles (synthetic corneocytes) embedded in a synthetic lipid matrix] mimic closely the physicochemical properties and structure of VC. Various formulations were prepared using different particle:lipid ratios, particles with different initial water content and uncoated or lipid-coated particles. It was observed that application of all tested formulations improved the skin barrier recovery rate and reduced crust formation and epidermal hyperproliferation. However, only one of the biofilms [i.e. B1; composed of uncoated particles with 50% (w/w) initial water content and particle:lipid ratio of 2:1] mimicked the effects of native VC most closely. This indicates the importance of the presence of individual components, i.e. barrier lipids and water, as well as the ratio of these components. Consequently, these observations suggest the potential use of this biofilm treatment clinically.

Effect of synthetic vernix biofilms on barrier recovery of damaged mouse skin

NARCIS (Netherlands)

Oudshoorn, M.H.M.; Rissmann, R.; van der Coelen, D.; Hennink, W.E.; Ponec, M.; Bouwstra, J.A.

2009-01-01

The aim of this work was to investigate whether topical application of synthetic biofilms supports and accelerates the recovery of the murine skin barrier, disrupted by sequential tape stripping. Therefore, various biofilms were applied topically on disrupted mouse skin to determine which

Skin Barrier Restoration and Moisturization Using Horse Oil-Loaded Dissolving Microneedle Patches.

Science.gov (United States)

Lee, Chisong; Eom, Younghyon Andrew; Yang, Huisuk; Jang, Mingyu; Jung, Sang Uk; Park, Ye Oak; Lee, Si Eun; Jung, Hyungil

2018-01-01

Horse oil (HO) has skin barrier restoration and skin-moisturizing effects. Although cream formulations have been used widely and safely, their limited penetration through the stratum corneum is a major obstacle to maximizing the cosmetic efficacy of HO. Therefore, we aimed to encapsulate HO in a cosmetic dissolving microneedle (DMN) for efficient transdermal delivery. To overcome these limitations of skin permeation, HO-loaded DMN (HO-DMN) patches were developed and evaluated for their efficacy and safety using in vitro and clinical studies. Despite the lipophilic nature of HO, the HO-DMN patches had a sharp shape and uniform array, with an average length and tip diameter of 388.36 ± 16.73 and 38.54 ± 5.29 µm, respectively. The mechanical strength of the HO-DMN patches was sufficient (fracture force of 0.29 ± 0.01 N), and they could successfully penetrate pig skin. During the 4-week clinical evaluation, HO-DMN patches caused significant improvements in skin and dermal density, skin elasticity, and moisturization. Additionally, a brief safety assessment showed that the HO-DMN patches induced negligible adverse events. The HO-DMNs are efficient, safe, and convenient for wide use in cosmetic applications for skin barrier restoration and moisturization. © 2018 S. Karger AG, Basel.

Modulating the skin barrier function by DMSO: molecular dynamics simulations of hydrophilic and hydrophobic transmembrane pores

NARCIS (Netherlands)

den Otter, Wouter K.; Notman, R.; Anwar, J.; Noro, M.G.; Briels, Willem J.

2008-01-01

The dense lipid bilayers at the outer surface of the skin represent the primary barrier to molecules penetrating the human skin. One approach to overcome this barrier, with promising applications in administering medicinal drugs to the body, is to employ chemical permeability enhancers. How these

Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

Directory of Open Access Journals (Sweden)

Reiko J Tanaka

Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

Skin barrier properties in patients with recessive X-linked ichthyosis

DEFF Research Database (Denmark)

Johansen, J D; Ramsing, D; Vejlsgaard, G

1995-01-01

increased in controls compared to ichthyosis patients, when evaluated by TEWL. When evaluated by erythema index a statistically significant increase in redness was found in controls, but not in ichthyosis patients. Electrical capacitance, reflecting skin hydration, was significantly reduced in RXLI patients......Patients with X-linked recessive ichthyosis (RXLI) were studied as a model of the effect of disturbed epidermal lipid composition on skin barrier function. Thirteen patients with RXLI and 15 age- and sex-matched controls were patch-tested with sodium lauryl sulphate (SLS) 0.5% for 24 h. Basal skin...... properties and skin response to SLS were studied by measurement of transepidermal water loss (TEWL), electrical capacitance and erythema index. No statistically significant difference in basal TEWL was found between the two groups. The skin response to SLS was found to be statistically significantly...

Emu oil-based lotion effects on neonatal skin barrier during transition from intrauterine to extrauterine life

Directory of Open Access Journals (Sweden)

Zanardo V

2017-08-01

Full Text Available Vincenzo Zanardo,1 David Giarrizzo,2 Francesca Volpe,1 Lara Giliberti,1 Gianluca Straface1 1Division of Perinatal Medicine, Policlinico Abano Terme, Abano Terme, 2CALANTHA Physiology of Lactation Laboratory, Padua, Italy Abstract: Both appropriate hydration and skin surface pH are fundamental in preventing baby skin barrier damage during transition from intrauterine to extrauterine life. However, effects of topical moisturizers on neonatal stratum corneum temperature, pH, hydration, and elasticity have not been scientifically evaluated in vivo. We checked 31 full-term breastfeeding neonates by non-invasive bioengineering method, which is able to evaluate the basal skin barrier (left heel, and assessed at 6±1 hours after birth, and at 1 and 24 hours after emu oil-based topical treatment. The basal skin barrier of right heel (no oil exposure of each newborn was considered as control. We found that a single application of an emu oil-based lotion was effective in improving heel stratum corneum hydration, which increases both skin pH and elasticity without any effect on temperature. Further studies are needed to confirm long-term beneficial effects of this treatment in a very sensitive patient population. Keywords: skin barrier, neonate, emu oil-based lotion, topical treatment

Loss of corneodesmosin leads to severe skin barrier defect, pruritus, and atopy: unraveling the peeling skin disease.

Science.gov (United States)

Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

2010-08-13

Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disease is characterized by a complete loss of CDSN expression. The skin phenotype is consistent with a recent murine Cdsn knockout model. Using three-dimensional human skin models, we demonstrate that lack of corneodesmosin causes an epidermal barrier defect supposed to account for the predisposition to atopic diseases, and we confirm the role of corneodesmosin as a decisive epidermal adhesion molecule. Therefore, peeling skin disease will represent a new model disorder for atopic diseases, similarly to Netherton syndrome and ichthyosis vulgaris in the recent past.

Influence of sunflower seed oil or baby lotion on the skin barrier function of newborns: A pilot study.

Science.gov (United States)

Kanti, Varvara; Günther, Malise; Stroux, Andrea; Sawatzky, Sabine; Henrich, Wolfgang; Abou-Dakn, Michael; Blume-Peytavi, Ulrike; Garcia Bartels, Natalie

2017-12-01

Skin care influences skin barrier function during the first postnatal weeks. Although the use of natural oils in preterms has been investigated, there are currently no data comparing the effect of sunflower oil to an emollient on barrier development in healthy term newborns. In a prospective, randomized clinical study, 50 healthy full-term newborns aged ≤72 h were randomly assigned to two groups: group baby lotion (L, n=22) and sunflower seed oil (SSO, n=24). The skin barrier function was evaluated in three anatomical areas (front, abdomen, and thigh) by noninvasive assessment of transepidermal water loss (TEWL), stratum corneum hydration (SCH), sebum, and skin pH at inclusion and after five weeks. In both groups, skin pH decreased and SCH increased statistically significantly in all measured areas at W5 compared to baseline. TEWL decreased statistically significantly on the forearm in both groups, on the upper leg in group L, and on the abdomen in group SSO. Both skin care regimes did not harm skin barrier function adaptation in healthy term neonates during the first five weeks of life. © 2017 Wiley Periodicals, Inc.

Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

DEFF Research Database (Denmark)

Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

Acute irritant threshold correlates with barrier function, skin hydration and contact hypersensitivity in atopic dermatitis and rosacea.

Science.gov (United States)

Darlenski, Razvigor; Kazandjieva, Jana; Tsankov, Nikolai; Fluhr, Joachim W

2013-11-01

The aim of the study was to disclose interactions between epidermal barrier, skin irritation and sensitization in healthy and diseased skin. Transepidermal water loss (TEWL) and stratum corneum hydration (SCH) were assessed in adult patients with atopic dermatitis (AD), rosacea and healthy controls. A 4-h patch test with seven concentrations of sodium lauryl sulphate was performed to determine the irritant threshold (IT). Contact sensitization pattern was revealed by patch testing with European baseline series. Subjects with a lower IT had higher TEWL values and lower SCH. Subjects with positive allergic reactions had significantly lower IT. In AD, epidermal barrier deterioration was detected on both volar forearm and nasolabial fold, while in rosacea, impeded skin physiology parameters were observed on the facial skin only, suggesting that barrier impediment is restricted to the face in rosacea, in contrast with AD where the abnormal skin physiology is generalized. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Stratum corneum lipids, skin barrier function and filaggrin mutations in patients with atopic eczema

DEFF Research Database (Denmark)

Høgh, Julie Kaae; Hellgren, Lars; Jungersted, JM

2010-01-01

chromatography. In addition, TEWL, erythema, skin hydration and pH were measured. In 27 of the 49 individuals, a 24-h irritation patch test with sodium lauryl sulphate was performed. For the analysis, both the AD group and the control group were stratified by FLG mutation status (FLGmut/FLGwt). Results......Background: Prior to the discovery of filaggrin (FLG) mutations, evidence for an impaired skin barrier in atopic dermatitis (AD) has been documented, and changes in ceramide profile, altered skin pH and increased trans-epidermal water loss (TEWL) in patients with AD have been reported. Until now......, no studies have analysed stratum corneum (SC) lipids combined with skin barrier parameters in subjects of known FLG genotype. Methods: A cohort of 49 German individuals genotyped for the most common FLG mutations (R501X, 2282del4) had SC samples taken for lipid analysis by high-performance thin layer...

Thiolated silicone oils as adhesive skin protectants for improved barrier function.

Science.gov (United States)

Partenhauser, A; Zupančič, O; Rohrer, J; Bonengel, S; Bernkop-Schnürch, A

2016-06-01

The purpose of this study was the evaluation of thiolated silicone oil as novel skin protectant exhibiting prolonged residence time, enhanced barrier function and reinforced occlusivity. Two silicone conjugates were synthesized with mercaptopropionic acid (MPA) and thioglycolic acid (TGA) as thiol ligands. Adhesion, protection against artificial urine and water vapour permeability with both a Payne cup set-up and transepidermal water loss (TEWL) measurements on porcine skin were assessed. Silicone thiomers showed pronounced substantivity on skin with 22.1 ± 6.3% and 39.2 ± 6.7% remaining silicone after 8 h for silicone-TGA and silicone-MPA, respectively, whereas unmodified silicone oil and dimethicone were no longer detectable. In particular, silicone-MPA provided a protective shield against artificial urine penetration with less than 25% leakage within 6 h. An up to 2.5-fold improved water vapour impermeability for silicone-MPA in comparison with unmodified control was discovered with the Payne cup model. In addition, for silicone-MPA a reduced TEWL by two-thirds corresponding to non-thiolated control was determined for up to 8 h. Thiolation of silicone oil leads to enhanced skin adhesiveness and barrier function, which is a major advantage compared to commonly used silicones and might thus be a promising treatment modality for various topical applications. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Ion microbeam analysis. Application to the study of the skin barrier and its nano-toxicology

International Nuclear Information System (INIS)

Simon, M.

2009-12-01

This work is dedicated to the use of ion microbeam irradiation to the study of a complex biological tissue like skin. Up to now, it has been very difficult to detect and track metallic oxides and manufactured nano-particles in biological tissues, most particularly in skin. Thus, it is essential to precise the mechanisms involved in skin barrier function processes face to exogenous agents like nano-particles and to characterize them in biological models in vitro/in vivo. During my work, I have had the opportunity to combine quantitative methods of analysis with high resolution imagery techniques (confocal microscopy, transmission electron microscopy and ion beam analysis) in order to characterize: (i) the skin barrier function of an ex vivo pig ear skin model understanding the ion homeostasis behavior face to different chemical or physical stresses; (ii) the impact on viability, accumulation and intracellular distribution of nano-particles (Titanium Oxides) naked or functionalized with fluorescent dyes (FITC, Rhodamine)

Improvement of hydration and epidermal barrier function in human skin by a novel compound isosorbide dicaprylate.

Science.gov (United States)

Chaudhuri, R K; Bojanowski, K

2017-10-01

The study involved the synthesis of a novel derivative of caprylic acid - isosorbide dicaprylate (IDC) - and the evaluation of its potential in improving water homoeostasis and epidermal barrier function in human skin. The effect of IDC on gene expression was assayed in skin organotypic cultures by DNA microarrays. The results were then confirmed for a few key genes by quantitative PCR, immuno- and cytochemistry. Final validation of skin hydration properties was obtained by four separate clinical studies. Level of hydration was measured by corneometer either by using 2% IDC lotion alone vs placebo or in combination with 2% glycerol lotion vs 2% glycerol only. A direct comparison in skin hydration between 2% IDC and 2% glycerol lotions was also carried out. The epidermal barrier function improvement was assessed by determining changes in transepidermal water loss (TEWL) on the arms before and after treatment with 2% IDC lotion versus placebo. IDC was found to upregulate the expression of AQP3, CD44 and proteins involved in keratinocyte differentiation as well as the formation and function of stratum corneum. A direct comparison between 2% IDC versus 2% glycerol lotions revealed a three-fold advantage of IDC in providing skin hydration. Severely dry skin treated with 2% IDC in combination with 2% glycerol showed 133% improvement, whereas 35% improvement was observed with moderately dry human skin. Topical isosorbide dicaprylate favourably modulates genes involved in the maintenance of skin structure and function, resulting in superior clinical outcomes. By improving skin hydration and epidermal permeability barrier, it offers therapeutic applications in skin ageing. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Lethal genes surviving by mosaicism: a possible explanation for sporadic birth defects involving the skin.

Science.gov (United States)

Happle, R

1987-04-01

A genetic concept is advanced to explain the origin of several sporadic syndromes characterized by a mosaic distribution of skin defects. It is postulated that these disorders are due to the action of a lethal gene surviving by mosaicism. The presence of the mutation in the zygote will lead to death of the embryo at an early stage of development. Cells bearing the mutation can survive only in a mosaic state, in close proximity with normal cells. The mosaic may arise either from a gametic half chromatid mutation or from an early somatic mutation. This concept of origin is proposed to apply to the Schimmelpenning-Feuerstein-Mims syndrome, the McCune-Albright syndrome, the Klippel-Trenaunay syndrome, the Sturge-Weber syndrome, and neurocutaneous melanosis. Moreover, this etiologic hypothesis may apply to two other birth defects that have recently been delineated, the Proteus syndrome (partial gigantism of hands or feet, hemihypertrophy, macrocephaly, linear papillomatous epidermal nevus, subcutaneous hemangiomas and lipomas, accelerated growth, and visceral anomalies), and the Delleman-Oorthuys syndrome (orbital cyst, porencephaly, periorbital appendages, and focal aplasia of the skin.

Chronic liver injury in mice promotes impairment of skin barrier function via tumor necrosis factor-alpha.

Science.gov (United States)

Yokoyama, Satoshi; Hiramoto, Keiichi; Koyama, Mayu; Ooi, Kazuya

2016-09-01

Alcohol is frequently used to induce chronic liver injury in laboratory animals. Alcohol causes oxidative stress in the liver and increases the expression of inflammatory mediators that cause hepatocellular damage. However, during chronic liver injury, it is unclear if/how these liver-derived factors affect distal tissues, such as the skin. The purpose of this study was to evaluate skin barrier function during chronic liver injury. Hairless mice were administered 5% or 10% ethanol for 8 weeks, and damages to the liver and skin were assessed using histological and protein-analysis methods, as well as by detecting inflammatory mediators in the plasma. After alcohol administration, the plasma concentration of the aspartate and alanine aminotransferases increased, while albumin levels decreased. In mice with alcohol-induced liver injury, transepidermal water loss was significantly increased, and skin hydration decreased concurrent with ceramide and type I collagen degradation. The plasma concentrations of [Formula: see text]/[Formula: see text] and tumor necrosis factor-alpha (TNF-α) were significantly increased in mice with induced liver injury. TNF receptor (TNFR) 2 expression was upregulated in the skin of alcohol-administered mice, while TNFR1 levels remained constant. Interestingly, the impairment of skin barrier function in mice administered with 10% ethanol was ameliorated by administering an anti-TNF-α antibody. We propose a novel mechanism whereby plasma TNF-α, via TNFR2 alone or with TNFR1, plays an important role in skin barrier function during chronic liver disease in these mouse models.

Evaluation of skin surface hydration state and barrier function of stratum corneum of dorsa of hands and heels treated with PROTECT X2 skin protective cream.

Science.gov (United States)

Kubota, Takahiro

2012-06-01

Skin roughness is a term commonly used in Japan to describe a poor skin condition related to a rough and dry skin surface that develops as a result of various damaging effects from the environment or skin inflammation. Recovery from skin roughness requires skin care for a long period, thus it is important to prevent development of such skin changes. PROTECT X2 contains agents used for a protective covering of the skin from frequent hand washing or use of alcohol-based disinfectants. These unique components are also thought to be effective to treat skin roughness of the dorsa of the hands and heels. In the present study, we evaluated the effectiveness of PROTECT X2 to increase skin surface hydration state, as well as enhance the barrier function of the stratum corneum of the dorsa of the hands and heels in elderly individuals. A total of 8 elderly subjects and their caretakers without any skin diseases participated in the study. They applied PROTECT X2 by themselves to the dorsum area of 1 hand and heel 3 to 5 times daily for 1 month, while the opposite sides were left untreated. We measured stratum corneum (SC) hydration and transepidermal water loss (TEWL) before beginning treatment, then 1 week and 1 month after the start of treatment to compare between the treated and untreated skin. SC hydration state after applications of PROTECT X2 was 1.5- to 3.0-fold higher than that of the untreated skin in the dorsa of both hands and heels, indicating that the moisturizing ingredients accompanied by water were replenished in those areas where the cream was applied. Also, TEWL in the dorsum of the hands was 17.0-27.9% lower on the treated side, indicating improvement in SC barrier function. On the basis of these findings, we concluded that PROTECT X2 enhances water-holding in the SC and aids the barrier function of the skin in the dorsum of the hands. In addition, we consider that this formulation is useful for not only protecting the hands from the effects of such agents

The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

Science.gov (United States)

Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

2017-01-01

Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

Stratum Corneum Lipids: Their Role for the Skin Barrier Function in Healthy Subjects and Atopic Dermatitis Patients.

Science.gov (United States)

van Smeden, Jeroen; Bouwstra, Joke A

2016-01-01

Human skin acts as a primary barrier between the body and its environment. Crucial for this skin barrier function is the lipid matrix in the outermost layer of the skin, the stratum corneum (SC). Two of its functions are (1) to prevent excessive water loss through the epidermis and (2) to avoid that compounds from the environment permeate into the viable epidermal and dermal layers and thereby provoke an immune response. The composition of the SC lipid matrix is dominated by three lipid classes: cholesterol, free fatty acids and ceramides. These lipids adopt a highly ordered, 3-dimensional structure of stacked densely packed lipid layers (lipid lamellae): the lateral and lamellar lipid organization. The way in which these lipids are ordered depends on the composition of the lipids. One very common skin disease in which the SC lipid barrier is affected is atopic dermatitis (AD). This review addresses the SC lipid composition and organization in healthy skin, and elaborates on how these parameters are changed in lesional and nonlesional skin of AD patients. Concerning the lipid composition, the changes in the three main lipid classes and the importance of the carbon chain lengths of the lipids are discussed. In addition, this review addresses how these changes in lipid composition induce changes in lipid organization and subsequently correlate with an impaired skin barrier function in both lesional and nonlesional skin of these patients. Furthermore, the effect of filaggrin and mutations in the filaggrin gene on the SC lipid composition is critically discussed. Also, the breakdown products of filaggrin, the natural moisturizing factor molecules and its relation to SC-pH is described. Finally, the paper discusses some major changes in epidermal lipid biosynthesis in patients with AD and other related skin diseases, and how inflammation has a deteriorating effect on the SC lipids and SC biosynthesis. The review ends with perspectives on future studies in relation to

Clinical spectrum of females with HCCS mutation: from no clinical signs to a neonatal lethal form of the microphthalmia with linear skin defects (MLS) syndrome

NARCIS (Netherlands)

van Rahden, V.A.; Rau, I.; Fuchs, S.; Kosyna, F.K.; de Almeida, H.L.; Fryssira, H.; Isidor, B.; Jauch, A.; Joubert, M.; Lachmeijer, A.M.A.; Zweier, C.; Moog, U.; Kutsche, K.

2014-01-01

Background: Segmental Xp22.2 monosomy or a heterozygous HCCS mutation is associated with the microphthalmia with linear skin defects (MLS) or MIDAS (microphthalmia, dermal aplasia, and sclerocornea) syndrome, an X-linked disorder with male lethality. HCCS encodes the holocytochrome c-type synthase

Elucidation of the Synthetic Mechanism of Acylceramide, an Essential Lipid for Skin Barrier Function.

Science.gov (United States)

Ohno, Yusuke

2017-01-01

The primary function of the skin is to act as a permeability barrier that prevents water loss from inside the body and external invasion such as by pathogens, harmful substances, and allergens. Lipids play a critical role in skin barrier formation by forming multi-lamellar structures in the stratum corneum, the outermost cell layer of the epidermis. Ceramide, the backbone of sphingolipids, accounts for more than 50% of the stratum corneum lipids. Acylceramides are epidermis-specific ceramide species essential for skin barrier formation. Decreases in acylceramide levels and changes in ceramide composition and chain-length are associated with such cutaneous disorders as ichthyosis, atopic dermatitis, and psoriasis. Acylceramide consists of a long-chain base and an amide-linked ultra-long-chain fatty acid (ULCFA, 28-36 carbon chain), which is ω-hydroxylated and esterified with linoleic acid. Although the molecular mechanism by which acylceramide is generated has not been fully understood for decades, we recently identified two genes, CYP4F22 and PNPLA1, involved in acylceramide synthesis and elucidated the entire biosynthetic pathway of acylceramide: the synthesis of ULCFA by ELOVL1 and ELOVL4, ω-hydroxylation of the ULCFA by CYP4F22, amide-bond formation with a long-chain base by CERS3, and transacylation of linoleic acid from triacylglycerol to ω-hydroxyceramide by PNPLA1 to generate acylceramide. CYP4F22 and PNPLA1 are the causative genes of ichthyosis. We demonstrated that mutations of CYP4F22 or PNPLA1 markedly reduced acylceramide production. Our recent findings provide important insights into the molecular mechanisms of skin barrier formation and of ichthyosis pathogenesis.

The effect of a daily facial cleanser for normal to oily skin on the skin barrier of subjects with acne.

Science.gov (United States)

Draelos, Zoe D

2006-07-01

Acne vulgaris is a common skin disorder that affects many people every year, especially the teenaged population. People with acne find the condition especially difficult to manage because of the disease's chronicity and variability in response to treatment. Acne is the result of pores clogged with shed skin cells combined with sebum in the hair follicle. Successful treatment of acne is important because acne has the potential to result in lasting physical and emotional scarring. For many years, physicians have agreed that although cleansing is not effective on its own, effective cleansing is an important part of any acne treatment regimen. However, patients have not been satisfied with the types of cleansers available. In addition to containing dyes and perfumes that can irritate and exacerbate acne, these cleansers often are too harsh and can result in excessive drying of the skin, which leads to overcompensation by the oil glands and ultimately to more oil on the surface of the skin. This study examined the use of a daily facial cleanser formulated for normal to oily skin in subjects with mild facial acne. The cleanser was studied for 2 weeks in the absence of additional treatments to eliminate the confounding effects of various treatments. Subjects were monitored for skin barrier function through transepidermal water loss (TEWL) and corneometry, sebum level, and lesion counts. The results of the study indicate that the facial cleanser is gentle and does not damage the skin barrier or result in sebum overcompensation; additionally, the cleanser is effective at deep-pore cleansing, which may help to manage some acne-associated symptoms.

The Tritiated Water Skin Barrier Integrity Test: Considerations for Acceptance Criteria with and Without 14C-Octanol.

Science.gov (United States)

Lehman, Paul A; Beatch, Kacie; Raney, Sam G; Franz, Thomas J

2017-01-01

A study was designed to assess barrier integrity simultaneously using separate compounds (probes) for polar and non-polar pathways through the skin, 3 H 2 O and 14 C-octanol, respectively; and to determine whether the two probe approach could better define barrier integrity. A 5-min dose of water containing 3 H 2 O and 14 C -octanol was applied to ex vivo human skin mounted in Franz diffusion cells. The receptor solution was sampled at 30 min, analyzed for 3 H and 14 C content, and the correlation between water and octanol absorption was determined by statistical tests suitable for non-normally distributed data. This study was conducted on skin from 37 donors with from 3 to 30 replicate skin sections per donor (a total of 426 sections). The correlation between 3 H 2 O and 14 C-octanol absorption was low (Pearson correlation coefficient = 0.3485). The 3 H 2 O absorption cutoff used in this study to select for a normal skin barrier rejected some sections in which 14 C-octanol absorption was within normal limits and accepted others in which 14 C-octanol absorption was abnormally high. The converse was true for 3 H 2 O absorption when the 14 C-octanol-based cutoff was used. The results of the 3 H 2 O test or of similar tests that primarily assess the permeability of polar pathways through the skin may not necessarily provide information relevant to the absorption of highly lipophilic compounds. Octanol, or another molecule that more closely matches the physicochemical attributes of the test compound, may characterize properties of the skin barrier that are more relevant to compounds of low water solubility.

The role of social closeness during tape stripping to facilitate skin barrier recovery: Preliminary findings.

Science.gov (United States)

Robinson, Hayley; Ravikulan, Abhimati; Nater, Urs M; Skoluda, Nadine; Jarrett, Paul; Broadbent, Elizabeth

2017-07-01

Social support is known to reduce the negative effects of stress on health, but there is mixed evidence for the effects of social support on wound healing. This study aimed to investigate whether undergoing a task designed to promote social closeness with a fellow participant and being paired with that person during a tape-stripping procedure could reduce stress and improve skin barrier recovery compared to going through tape stripping alone. Seventy-two healthy adults were randomized to either a social closeness condition where participants completed a relationship-building task and tape stripping in pairs or a control condition where they completed tape stripping alone. Skin barrier recovery was measured using transepidermal water loss. Salivary cortisol and alpha-amylase were collected at four time points as markers of the endocrine and autonomic stress response. Social closeness had a beneficial effect on skin barrier recovery compared to the control condition, t(54) = 2.86, p = .006, r = .36. Social closeness significantly reduced self-reported stress. The effects of the intervention on skin barrier recovery were moderated by self-reported stress reduction (p = .035). There were no significant differences in cortisol between groups, but alpha-amylase increased significantly more from baseline to after tape stripping in the control group compared to the intervention group. This is the first study to show that social closeness with a person going through a similar unfamiliar procedure can positively influence wound healing. Future research needs to replicate these findings in other wound types and in clinical settings. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

The integration of physiologically-targeted skin care in the management of atopic dermatitis: focus on the use of a cleanser and moisturizer system incorporating a ceramide precursor, filaggrin degradation products, and specific "skin-barrier-friendly" excipients.

Science.gov (United States)

Del Rosso, James Q; Kircik, Leon H

2013-07-01

Atopic dermatitis (AD) may be considered the "poster disease" for exemplifying the significance of abnormalities of the epidermal barrier that occur predominantly within the stratum corneum (SC) and upper epidermis. Specifically, impairments of the SC permeability barrier, antimicrobial barrier, and immunologic barrier contribute markedly to the fundamental pathophysiology of AD. The multiple clinical sequelae associated with epidermal barrier impairments inherent to AD include dry skin, pruritus, increased skin sensitivity to irritants and allergens, eczematous skin changes, staphylococcal skin and anterior nares colonization, and increase in some cutaneous infections (ie, molluscum contagiosum). This article addresses the pathophysiology of AD with clinically relevant correlations, and discusses the scientific basis of a specially designed cleanser and moisturizer system that incorporates ceramide technology and filaggrin degradation products along with other "barrier-friendly" excipients.

Is the Fractional Laser Still Effective in Assisting Cutaneous Macromolecule Delivery in Barrier-Deficient Skin? Psoriasis and Atopic Dermatitis as the Disease Models.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Sung, Calvin T; Liu, Pei-Ying; Fang, Jia-You

2018-04-26

Most of the investigations into laser-assisted skin permeation have used the intact skin as the permeation barrier. Whether the laser is effective in improving cutaneous delivery via barrier-defective skin is still unclear. In this study, ablative (Er:YAG) and non-ablative (Er:glass) lasers were examined for the penetration of peptide and siRNA upon topical application on in vitro skin with a healthy or disrupted barrier. An enhanced peptide flux (6.9 fold) was detected after tape stripping of the pig stratum corneum (SC). A further increase of flux to 11.7 fold was obtained after Er:YAG laser irradiation of the SC-stripped skin. However, the application of Er:glass modality did not further raise the flux via the SC-stripped skin. A similar trend was observed in the case of psoriasiform skin. Conversely, the flux was enhanced 3.7 and 2.6 fold after treatment with the Er:YAG and the Er:glass laser on the atopic dermatitis (AD)-like skin. The 3-D skin structure captured by confocal microscopy proved the distribution of peptide and siRNA through the microchannels and into the surrounding tissue. The fractional laser was valid for ameliorating macromolecule permeation into barrier-disrupted skin although the enhancement level was lower than that of normal skin.

Enhanced barrier functions and anti-inflammatory effect of cultured coconut extract on human skin.

Science.gov (United States)

Kim, Soomin; Jang, Ji Eun; Kim, Jihee; Lee, Young In; Lee, Dong Won; Song, Seung Yong; Lee, Ju Hee

2017-08-01

Natural plant oils have been used as a translational alternative to modern medicine. Particularly, virgin coconut oil (VCO) has gained popularity because of its potential benefits in pharmaceutical, nutritional, and cosmetic applications. Cultured coconut extract (CCE) is an alternative end product of VCO, which undergoes a further bacterial fermentation process. This study aimed to investigate the effects of CCE on human skin. We analyzed the expression of skin barrier molecules and collagens after applying CCE on human explanted skin. To evaluate the anti-inflammatory properties of CCE, the expression of inflammatory markers was analyzed after ultraviolet B (UVB) irradiation. The CCE-treated group showed increased expression of cornified cell envelope components, which contribute to protective barrier functions of the stratum corneum. Further, the expression of inflammatory markers was lower in the CCE-treated group after exposure to UVB radiation. These results suggest an anti-inflammatory effect of CCE against UVB irradiation-induced inflammation. Additionally, the CCE-treated group showed increased collagen and hyaluronan synthase-3 expression. In our study, CCE showed a barrier-enhancing effect and anti-inflammatory properties against ex vivo UVB irradiation-induced inflammation. The promising effect of CCE may be attributed to its high levels of polyphenols and fatty acid components. Copyright © 2017 Elsevier Ltd. All rights reserved.

Human Skin Barrier Structure and Function Analyzed by Cryo-EM and Molecular Dynamics Simulation.

Science.gov (United States)

Lundborg, Magnus; Narangifard, Ali; Wennberg, Christian L; Lindahl, Erik; Daneholt, Bertil; Norlén, Lars

2018-04-24

In the present study we have analyzed the molecular structure and function of the human skin's permeability barrier using molecular dynamics simulation validated against cryo-electron microscopy data from near native skin. The skin's barrier capacity is located to an intercellular lipid structure embedding the cells of the superficial most layer of skin - the stratum corneum. According to the splayed bilayer model (Iwai et al., 2012) the lipid structure is organized as stacked bilayers of ceramides in a splayed chain conformation with cholesterol associated with the ceramide sphingoid moiety and free fatty acids associated with the ceramide fatty acid moiety. However, knowledge about the lipid structure's detailed molecular organization, and the roles of its different lipid constituents, remains circumstantial. Starting from a molecular dynamics model based on the splayed bilayer model, we have, by stepwise structural and compositional modifications, arrived at a thermodynamically stable molecular dynamics model expressing simulated electron microscopy patterns matching original cryo-electron microscopy patterns from skin extremely closely. Strikingly, the closer the individual molecular dynamics models' lipid composition was to that reported in human stratum corneum, the better was the match between the models' simulated electron microscopy patterns and the original cryo-electron microscopy patterns. Moreover, the closest-matching model's calculated water permeability and thermotropic behaviour were found compatible with that of human skin. The new model may facilitate more advanced physics-based skin permeability predictions of drugs and toxicants. The proposed procedure for molecular dynamics based analysis of cellular cryo-electron microscopy data might be applied to other biomolecular systems. Copyright © 2018. Published by Elsevier Inc.

Two Ancient Gene Families Are Critical for Maintenance of the Mammalian Skin Barrier in Postnatal Life.

Science.gov (United States)

Cangkrama, Michael; Darido, Charbel; Georgy, Smitha R; Partridge, Darren; Auden, Alana; Srivastava, Seema; Wilanowski, Tomasz; Jane, Stephen M

2016-07-01

The skin barrier is critical for mammalian survival in the terrestrial environment, affording protection against fluid loss, microbes, toxins, and UV exposure. Many genes indispensable for barrier formation in the embryo have been identified, but loss of these genes in adult mice does not induce barrier regression. We describe a complex regulatory network centered on two ancient gene families, the grainyhead-like (Grhl) transcription factors and the protein cross-linking enzymes (tissue transglutaminases [Tgms]), which are essential for skin permeability barrier maintenance in adult mice. Embryonic deletion of Grhl3 induces loss of Tgm1 expression, which disrupts the cornified envelope, thus preventing permeability barrier formation leading to neonatal death. However, gene deletion of Grhl3 in adult mice does not disrupt the preformed barrier, with cornified envelope integrity maintained by Grhl1 and Tgm5, which are up-regulated in response to postnatal loss of Grhl3. Concomitant deletion of both Grhl factors in adult mice induced loss of Tgm1 and Tgm5 expression, perturbation of the cornified envelope, and complete permeability barrier regression that was incompatible with life. These findings define the molecular safeguards for barrier function that accompany the transition from intrauterine to terrestrial life. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Permeability Barrier and Microstructure of Skin Lipid Membrane Models of Impaired Glucosylceramide Processing

OpenAIRE

Sochorov?, Michaela; Sta?kov?, Kl?ra; Pullmannov?, Petra; Kov??ik, Andrej; Zbytovsk?, Jarmila; V?vrov?, Kate?ina

2017-01-01

Ceramide (Cer) release from glucosylceramides (GlcCer) is critical for the formation of the skin permeability barrier. Changes in ?-glucocerebrosidase (GlcCer?ase) activity lead to diminished Cer, GlcCer accumulation and structural defects in SC lipid lamellae; however, the molecular basis for this impairment is not clear. We investigated impaired GlcCer-to-Cer processing in human Cer membranes to determine the physicochemical properties responsible for the barrier defects. Minor impairment (...

Lipids and skin barrier function - a clinical perspective

DEFF Research Database (Denmark)

Jungersted, J.M.; Hellgren, Lars; Jemec, G.B.E.

2008-01-01

The stratum corneum (SC) protects us from dehydration and external dangers. Much is known about the morphology of the SC and penetration of drugs through it, but the data are mainly derived from in vitro and animal experiments. In contrast, only a few studies have the human SC lipids as their focus...... and in particular, the role of barrier function in the pathogenesis of skin disease and its subsequent treatment protocols. The 3 major lipids in the SC of importance are ceramides, free fatty acids, and cholesterol. Human studies comparing levels of the major SC lipids in patients with atopic dermatitis...

Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

Science.gov (United States)

Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

2005-08-01

The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

Nanocrystal: a novel approach to overcome skin barriers for improved topical drug delivery.

Science.gov (United States)

Patel, Viral; Sharma, Om Prakash; Mehta, Tejal

2018-04-01

Skin is an important route of drug delivery for the treatment of various dermatological conditions. The advent of nanotechnology is paving the roadmaps for topical drug delivery by providing sustained release as well as maintaining a localized effect, outweighing the toxicity concern. Area covered: This review highlighted the morphology of skin, its barrier nature as well as drug penetration pathways after topical application of formulations. The existing methods to improve topical drug delivery, by infringing or permeating the skin barriers, are discussed. This context concretes the foundation to accentuate the need for the development of nanocrystal-based topical formulation. The mechanism of drug release, immediate as well as sustained release, after topical administration of drug nanocrystals is also elaborated. The special emphasis is given on the breakthrough achieved, in topical drug delivery using drug nanocrystals, so far in the plethora of literature, patents, and products, under clinical trial as well as in the market. Expert opinion: The current research on nanocrystals for topical drug delivery is highlighting the breakthroughs achieved so far. The output of these research envisages that topical nanocrystals based formulations can be a novel strategy for the drugs which are facing solubility, bioavailability and toxicity concerns.

Anthrax lethal toxin disrupts intestinal barrier function and causes systemic infections with enteric bacteria.

Directory of Open Access Journals (Sweden)

Chen Sun

Full Text Available A variety of intestinal pathogens have virulence factors that target mitogen activated protein kinase (MAPK signaling pathways, including Bacillus anthracis. Anthrax lethal toxin (LT has specific proteolytic activity against the upstream regulators of MAPKs, the MAPK kinases (MKKs. Using a murine model of intoxication, we show that LT causes the dose-dependent disruption of intestinal epithelial integrity, characterized by mucosal erosion, ulceration, and bleeding. This pathology correlates with an LT-dependent blockade of intestinal crypt cell proliferation, accompanied by marked apoptosis in the villus tips. C57BL/6J mice treated with intravenous LT nearly uniformly develop systemic infections with commensal enteric organisms within 72 hours of administration. LT-dependent intestinal pathology depends upon its proteolytic activity and is partially attenuated by co-administration of broad spectrum antibiotics, indicating that it is both a cause and an effect of infection. These findings indicate that targeting of MAPK signaling pathways by anthrax LT compromises the structural integrity of the mucosal layer, serving to undermine the effectiveness of the intestinal barrier. Combined with the well-described immunosuppressive effects of LT, this disruption of the intestinal barrier provides a potential mechanism for host invasion via the enteric route, a common portal of entry during the natural infection cycle of Bacillus anthracis.

Metabolic and redox barriers in the skin exposed to drugs and xenobiotics.

Science.gov (United States)

Korkina, Liudmila

2016-01-01

Growing exposure of human skin to environmental and occupational hazards, to numerous skin care/beauty products, and to topical drugs led to a biomedical concern regarding sustainability of cutaneous chemical defence that is essential for protection against intoxication. Since skin is the largest extra-hepatic drug/xenobiotic metabolising organ where redox-dependent metabolic pathways prevail, in this review, publications on metabolic processes leading to redox imbalance (oxidative stress) and its autocrine/endocrine impact to cutaneous drug/xenobiotic metabolism were scrutinised. Chemical and photo-chemical skin barriers contain metabolic and redox compartments: their protective and homeostatic functions. The review will examine the striking similarity of adaptive responses to exogenous chemical/photo-chemical stressors and endogenous toxins in cutaneous metabolic and redox system; the role(s) of xenobiotics/drugs and phase II enzymes in the endogenous antioxidant defence and maintenance of redox balance; redox regulation of interactions between metabolic and inflammatory responses in skin cells; skin diseases sharing metabolic and redox problems (contact dermatitis, lupus erythematosus, and vitiligo) Due to exceptional the redox dependence of cutaneous metabolic pathways and interaction of redox active metabolites/exogenous antioxidants with drug/xenobiotic metabolism, metabolic tests of topical xenobiotics/drugs should be combined with appropriate redox analyses and performed on 3D human skin models.

Measurement of transepidermal water loss (TEWL) in cats with experimental skin barrier dysfunction using a closed chamber system.

Science.gov (United States)

Momota, Yutaka; Shimada, Kenichiro; Gin, Azusa; Matsubara, Takako; Azakami, Daigo; Ishioka, Katsumi; Nakamura, Yuka; Sako, Toshinori

2016-10-01

A closed chamber evaporimeter is suitable for measuring transepidermal water loss (TEWL) in cats because of the compact device size, tolerance to sudden movement and short measuring time. TEWL is a representative parameter for skin barrier dysfunction, which is one of the clinical signs of atopic dermatitis in humans and dogs. Measurement of feline TEWL has been reported, but applicability of this parameter has not been validated. The aims of this study were to determine if tape stripping is a valid experimental model in cats for studying TEWL and to determine if a closed chambered system is a suitable measurement tool for cats. Ten clinically normal cats. In order to evaluate variation of the measured values, TEWL was measured at the right and left side of the three clipped regions (axillae, lateral thigh and groin). Subsequently, TEWL was measured using sequential tape stripping of the stratum corneum as a model of acute barrier disruption. The variations between both sides of the three regions showed no significant difference. Sequential tape stripping was associated with increasing values for TEWL. Feline TEWL was shown to reflect changes in the skin barrier in an experimental model using a closed chamber system and has the potential for evaluating skin barrier function in cats with skin diseases. © 2016 ESVD and ACVD.

Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.

Science.gov (United States)

Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T

2012-01-01

Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.

Barrier abnormalities and keratinocyte-derived cytokine cascade after cessation of long-term topical glucocorticosteroid on hairless mouse skin

Directory of Open Access Journals (Sweden)

Tzu-Kai Lin

2015-06-01

Conclusion: An epidermis-derived cytokine cascade was observed following TCS-induced barrier disruption, which is similar to that from permeability barrier insults by acetone or tape stripping. The study suggests that concurrent application of skin care products during TCS treatment improves barrier homeostasis, and should become a standard practice to alleviate TCS-induced WD.

Effect of Fluid Intake on Hydration Status and Skin Barrier Characteristics in Geriatric Patients: An Explorative Study.

Science.gov (United States)

Akdeniz, Merve; Boeing, Heiner; Müller-Werdan, Ursula; Aykac, Volkan; Steffen, Annika; Schell, Mareike; Blume-Peytavi, Ulrike; Kottner, Jan

2018-04-03

Inadequate fluid intake is assumed to be a trigger of water-loss dehydration, which is a major health risk in aged and geriatric populations. Thus, there is a need to search for easy to use diagnostic tests to identify dehydration. Our overall aim was to investigate whether skin barrier parameters could be used for predicting fluid intake and/or hydration status in geriatric patients. An explorative observational comparative study was conducted in a geriatric hospital including patients aged 65 years and older. We measured 3-day fluid intake, skin barrier parameters, Overall Dry Skin Score, serum osmolality, cognitive and functional health, and medications. Forty patients were included (mean age 78.45 years and 65% women) with a mean fluid intake of 1,747 mL/day. 20% of the patients were dehydrated and 22.5% had an impending dehydration according to serum osmolality. Multivariate analysis suggested that skin surface pH and epidermal hydration at the face were associated with fluid intake. Serum osmolality was associated with epidermal hydration at the leg and skin surface pH at the face. Fluid intake was not correlated with serum osmolality. Diuretics were associated with high serum osmolality. Approximately half of the patients were diagnosed as being dehydrated according to osmolality, which is the current reference standard. However, there was no association with fluid intake, questioning the clinical relevance of this measure. Results indicate that single skin barrier parameters are poor markers for fluid intake or osmolality. Epidermal hydration might play a role but most probably in combination with other tests. © 2018 S. Karger AG, Basel.

Hataedock treatment has preventive therapeutic effects for atopic dermatitis through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice.

Science.gov (United States)

Cha, Ho-Yeol; Ahn, Sang-Hyun; Cheon, Jin-Hong; Park, Sun-Young; Kim, Kibong

2017-07-12

Hataedock treatment is traditionally used for the purpose of preventing the future skin disease by feeding herbal extracts to the newborn in traditional Chinese and Korean medicine. This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment for atopic dermatitis (AD) through skin barrier protection in Dermatophagoides farinae-induced NC/Nga mice. To the HTD treatment group, the extract of Coptis japonica Makino and Glycyrrhiza uralensis Fischer, which analyzed with High Performance Liquid Chromatography (HPLC)-fingerprint for quality consistency, was administered orally to the 3-week-old mice before inducing AD. After that, Dermatophagoides farinae was applied except the control group to induce AD-like skin lesions. We confirmed the effects of HTD on morphological changes, protection of skin barrier, regulation of Th2 differentiation, inflammation regulation and induction of apoptosis through histochemistry, immunohistochemistry, and Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay. HTD effectively reduced edema, angiogenesis and skin lesion. HTD also increased the levels of liver X receptor (LXR) and filaggrin but decreased the level of protein kinase C (PKC) (pprotection of skin barrier. Therefore, HTD may have potential applications for alternative and preventive treatment in the management of AD. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

Effect of olive and sunflower seed oil on the adult skin barrier: implications for neonatal skin care.

Science.gov (United States)

Danby, Simon G; AlEnezi, Tareq; Sultan, Amani; Lavender, Tina; Chittock, John; Brown, Kirsty; Cork, Michael J

2013-01-01

Natural oils are advocated and used throughout the world as part of neonatal skin care, but there is an absence of evidence to support this practice. The goal of the current study was to ascertain the effect of olive oil and sunflower seed oil on the biophysical properties of the skin. Nineteen adult volunteers with and without a history of atopic dermatitis were recruited into two randomized forearm-controlled mechanistic studies. The first cohort applied six drops of olive oil to one forearm twice daily for 5 weeks. The second cohort applied six drops of olive oil to one forearm and six drops of sunflower seed oil to the other twice daily for 4 weeks. The effect of the treatments was evaluated by determining stratum corneum integrity and cohesion, intercorneocyte cohesion, moisturization, skin-surface pH, and erythema. Topical application of olive oil for 4 weeks caused a significant reduction in stratum corneum integrity and induced mild erythema in volunteers with and without a history of atopic dermatitis. Sunflower seed oil preserved stratum corneum integrity, did not cause erythema, and improved hydration in the same volunteers. In contrast to sunflower seed oil, topical treatment with olive oil significantly damages the skin barrier, and therefore has the potential to promote the development of, and exacerbate existing, atopic dermatitis. The use of olive oil for the treatment of dry skin and infant massage should therefore be discouraged. These findings challenge the unfounded belief that all natural oils are beneficial for the skin and highlight the need for further research. © 2012 Wiley Periodicals, Inc.

Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils.

Science.gov (United States)

Lin, Tzu-Kai; Zhong, Lily; Santiago, Juan Luis

2017-12-27

Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter). Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro.

Science.gov (United States)

Buist, Harrie E; van de Sandt, Johannes J M; van Burgsteden, Johan A; de Heer, Cees

2005-10-01

The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of repeated exposure. The influence of repeated and single exposure to representative biocidal active substances on the skin barrier was investigated in vitro. The biocidal active substances selected were alkyldimethylbenzylammonium chloride (ADBAC), boric acid, deltamethrin, dimethyldidecylammonium chloride (DDAC), formaldehyde, permethrin, piperonyl butoxide, sodium bromide, and tebuconazole. Of these nine compounds, only the quaternary ammonium chlorides ADBAC and DDAC had a clear and consistent influence on skin permeability of the marker compounds tritiated water and [(14)C]propoxur. For these compounds, repeated exposure increased skin permeability more than single exposure. At high concentrations the difference between single and repeated exposure was quantitatively significant: repeated exposure to 300 mg/L ADBAC increased skin permeability two to threefold in comparison to single exposure. Therefore, single and repeated exposure to specific biocidal products may significantly increase skin permeability, especially when used undiluted.

Enhancement of percutaneous penetration of aniline and o-toluidine in vitro using skin barrier creams.

Science.gov (United States)

Korinth, Gintautas; Lüersen, Lars; Schaller, Karl Heinz; Angerer, Jürgen; Drexler, Hans

2008-04-01

Aniline (ANI) and the human carcinogen o-toluidine (OT) are released at the workplace during the production and processing of rubber. Recently, we showed in rubber industry workers that a frequent use of skin barrier creams (SBC) increased the internal exposure of ANI and OT. In the present study, diffusion cells were used to investigate the effects of two SBC and one skin care cream (SCC) on percutaneous penetration of neat ANI and OT as well as of OT from a mixture with a workplace specific lubricant. The experiments were carried out with untreated and with skin creams treated human skin. A considerable percutaneous penetration enhancement of test compounds was observed for treated skin compared with untreated skin; the highest enhancement (mean factors 6.2-12.3) was found for SBC (based on oil in water emulsion) treated skin. The lowest penetration enhancement showed SCC treated skin (mean factors 4.2-9.7). The in vitro data support our findings in workers that the percutaneous absorption of aromatic amines significantly increases in presence of skin creams. The efficacy of skin creams to protect the percutaneous penetration of aromatic amines is not confirmed by our own experiments.

Recovery Effects of Oral Administration of Glucosylceramide and Beet Extract on Skin Barrier Destruction by UVB in Hairless Mice

Directory of Open Access Journals (Sweden)

Yoshihiro Tokudome

2017-10-01

Full Text Available Purified glucosylceramide from beet extract (beet GlcCer and beet extract containing an equal amount of GlcCer were administered orally to ultra violet B (UVB-irradiated mice, and differences in the protective effects against skin barrier dysfunction caused by UVB irradiation were compared. In the beet GlcCer group, epidermal thickening and the decrease in stratum corneum (SC ceramide content caused by UVB irradiation were reduced. In the group that was orally administered beet extract containing glucosylceramide, effects similar to those in the beet GlcCer group were observed. Oral administration of beet GlcCer had no obvious effects against an increase in TEWL or decrease in SC water content after UVB irradiation, but there was improvement in the beet extract group. Oral administration of beet GlcCer is effective in improving skin barrier function in UVB-irradiated mice. Beet extract contains constituents other than GlcCer that are also effective in improving skin barrier function.

[Basic therapeutics : What are the features of modern personal care products to protect and regenerate the skin barrier?

Science.gov (United States)

Daniels, R

2017-11-01

It is international consensus that the daily use of properly selected products for the maintenance therapy is a must in the adjuvant treatment of most chronic skin diseases. In a first step, the selection of an adequate product can be guided by the classical triangle of the dermal vehicles. However, modern skin care products use diverse excipients, e. g. emulsifiers and viscosity enhancers, to improve the galenical and haptic properties of the formulations. It is thus no longer sufficient to simply have knowledge about the oil and water content of a cream in order to make a proper selection. A very positive effect on the skin barrier can be achieved using biomimetic lipids which can be incorporated into the epidermal lipid barrier. The application of such products as a foam cream is the most convenient way especially favorable when inflamed or hardly accessible skin areas have to be treated.

Anti-Inflammatory and Skin Barrier Repair Effects of Topical Application of Some Plant Oils

Directory of Open Access Journals (Sweden)

Tzu-Kai Lin

2017-12-01

Full Text Available Plant oils have been utilized for a variety of purposes throughout history, with their integration into foods, cosmetics, and pharmaceutical products. They are now being increasingly recognized for their effects on both skin diseases and the restoration of cutaneous homeostasis. This article briefly reviews the available data on biological influences of topical skin applications of some plant oils (olive oil, olive pomace oil, sunflower seed oil, coconut oil, safflower seed oil, argan oil, soybean oil, peanut oil, sesame oil, avocado oil, borage oil, jojoba oil, oat oil, pomegranate seed oil, almond oil, bitter apricot oil, rose hip oil, German chamomile oil, and shea butter. Thus, it focuses on the therapeutic benefits of these plant oils according to their anti-inflammatory and antioxidant effects on the skin, promotion of wound healing and repair of skin barrier.

Two very long chain fatty acid acyl-CoA synthetase genes, acs-20 and acs-22, have roles in the cuticle surface barrier in Caenorhabditis elegans.

Directory of Open Access Journals (Sweden)

Eriko Kage-Nakadai

Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.

Potentially lethal damage repair in cell lines of radioresistant human tumours and normal skin fibroblasts

International Nuclear Information System (INIS)

Marchese, M.J.; Minarik, L.; Hall, E.J.; Zaider, M.

1985-01-01

Radiation cell survival data were obtained in vitro for three cell lines isolated from human tumours traditionally considered to be radioresistant-two melanomas and one osteosarcoma-as well as from a diploid skin fibroblast cell line. One melanoma cell line was much more radioresistant than the other, while the osteosarcoma and fibroblast cell lines were more radiosensitive than either. For cells growing exponentially, little potentially lethal damage repair (PLDR) could be demonstrated by comparing survival data for cells in which subculture was delayed by 6 h with those sub-cultured immediately after treatment. For the malignant cells in plateau phase, which in these cells might be better termed 'slowed growth phase', since an appreciable fraction of the cells are still cycling, a small amount of PLDR was observed, but not as much as reported by other investigators in the literature. The normal fibroblasts, which achieved a truer plateau phase in terms of noncycling cells, showed a significantly larger amount of PLDR than the tumour cells. (author)

Oral administration of Bifidobacterium breve attenuates UV-induced barrier perturbation and oxidative stress in hairless mice skin.

Science.gov (United States)

Ishii, Yuki; Sugimoto, Saho; Izawa, Naoki; Sone, Toshiro; Chiba, Katsuyoshi; Miyazaki, Kouji

2014-07-01

Recent studies have shown that some probiotics affect not only the gut but also the skin. However, the effects of probiotics on ultraviolet (UV)-induced skin damage are poorly understood. In this study, we aim to examine whether oral administration of live Bifidobacterium breve strain Yakult (BBY), a typical probiotic, can attenuate skin barrier perturbation caused by UV and reactive oxygen species (ROS) in hairless mice. The mice were orally supplemented with a vehicle only or BBY once a day for nine successive days. Mouse dorsal skin was irradiated with UV from days 6 to 9. The day after the final irradiation, the transepidermal water loss (TEWL), stratum corneum hydration, and oxidation-related factors of the skin were evaluated. We elucidated that BBY prevented the UV-induced increase in TEWL and decrease in stratum corneum hydration. In addition, BBY significantly suppressed the UV-induced increase in hydrogen peroxide levels, oxidation of proteins and lipids, and xanthine oxidase activity in the skin. Conversely, antioxidant capacity did not change regardless of whether BBY was administered or not. In parameters we evaluated, there was a positive correlation between the increase in TEWL and the oxidation levels of proteins and lipids. Our results suggest that oral administration of BBY attenuates UV-induced barrier perturbation and oxidative stress of the skin, and this antioxidative effect is not attributed to enhancement of antioxidant capacity but to the prevention of ROS generation.

Effects of UVA (320-400 nm) on the barrier characteristics of the skin

International Nuclear Information System (INIS)

McAuliffe, D.J.; Blank, I.H.

1991-01-01

The stratum corneum serves as the major barrier to the entrance of most molecules into the skin. In the studies presented here, the effects of UVA radiation (320-400 nm) on the barrier capacity of human stratum corneum were examined. Penetration of a homologous series of primary alcohols through unirradiated (control) and UVA-irradiated (test) human epidermis was determined in vitro. Permeability constants, kp, were calculated. Mean ratios of permeability constants for UVA-irradiated and unirradiated epidermis (mean kp test)/(mean kp control) ranged from 2.3 to 3.0 for methanol and from 2.2 to 2.5 for ethanol. These mean ratios were determined using different pieces of epidermis from the same piece of skin for test and control samples. When kp control and kp test were determined on the same piece of epidermis on successive days, the ratios (kp test/kp control) were similar to the mean ratios determined on different pieces of epidermis. For other primary alcohols, propanol, butanol, hexanol, and heptanol, UVA radiation did not alter their permeability constants significantly. Partition coefficients, Km, were determined for ethanol and heptanol using UVA-irradiated and unirradiated stratum corneum. For ethanol, irradiation resulted in a 1.5 to 2.6 times increase in Km. For heptanol, irradiation caused no change in Km. These results demonstrate that the barrier capacity of stratum corneum for small, polar, primary alcohols is diminished (permeability increases) and for higher molecular weight less polar alcohols, is unaffected by small doses of UVA radiation. This increased permeability of small polar alcohols through human skin may be due to enhanced partitioning into UVA-irradiated stratum corneum, which was not apparent for a higher molecular weight less polar alcohol

Skin barrier integrity and natural moisturising factor levels after cumulative dermal exposure to alkaline agents in atopic dermatitis

NARCIS (Netherlands)

Angelova-Fischer, Irena; Dapic, Irena; Hoek, Anne-Karin; Jakasa, Ivone; Fischer, Tobias W.; Zillikens, Detlef; Kezic, Sanja

2014-01-01

Dermal exposure to alkaline agents may lead to skin barrier damage and irritant contact dermatitis. The objective of this study was to investigate the effects of cumulative exposure to 0.5% sodium lauryl sulphate (SLS) and 0.15% NaOH on the barrier function and natural moisturising factor (NMF)

Abnormal sensitivity of diploid skin fibroblasts from a family with Gardner's syndrome to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C

International Nuclear Information System (INIS)

Little, J.B.; Nove, J.; Weichselbaum, R.R.

1980-01-01

Skin fibroblasts isolated from two members of the same family with the cancer-prone disease Gardner's Syndrome (intestinal polyposis, colon cancer, bone and soft tissue tumors) showed enhanced sensitivity to the lethal effects of X-irradiation, ultraviolet light and mitomycin-C. These cells showed no liquid-holding type recovery following UV-irradiation of confluent cultures, but were normal in their capacity for UV-induced unscheduled DNA synthesis. UV survival was not influenced by post-irradiation incubation with caffeine. (orig.)

Effects of single and repeated exposure to biocidal active substances on the barrier function of the skin in vitro

NARCIS (Netherlands)

Buist, H.E.; Sandt, J.J.M. van de; Burgsteden, J.A. van; Heer, C. de

2005-01-01

The dermal route of exposure is important in worker exposure to biocidal products. Many biocidal active substances which are used on a daily basis may decrease the barrier function of the skin to a larger extent than current risk assessment practice addresses, due to possible skin effects of

Skin Barrier Development Depends on CGI-58 Protein Expression during Late-Stage Keratinocyte Differentiation

Science.gov (United States)

Grond, Susanne; Radner, Franz P.W.; Eichmann, Thomas O.; Kolb, Dagmar; Grabner, Gernot F.; Wolinski, Heimo; Gruber, Robert; Hofer, Peter; Heier, Christoph; Schauer, Silvia; Rülicke, Thomas; Hoefler, Gerald; Schmuth, Matthias; Elias, Peter M.; Lass, Achim; Zechner, Rudolf; Haemmerle, Guenter

2017-01-01

Adipose triglyceride lipase (ATGL) and its coactivator comparative gene identification-58 (CGI-58) are limiting in cellular triglyceride catabolism. Although ATGL deficiency is compatible with normal skin development, mice globally lacking CGI-58 die postnatally and exhibit a severe epidermal permeability barrier defect, which may originate from epidermal and/or peripheral changes in lipid and energy metabolism. Here, we show that epidermis-specific disruption of CGI-58 is sufficient to provoke a defect in the formation of a functional corneocyte lipid envelope linked to impaired ω-O-acylceramide synthesis. As a result, epidermis-specific CGI-58-deficient mice show severe skin dysfunction, arguing for a tissue autonomous cause of disease development. Defective skin permeability barrier formation in global CGI-58-deficient mice could be reversed via transgenic restoration of CGI-58 expression in differentiated but not basal keratinocytes suggesting that CGI-58 is essential for lipid metabolism in suprabasal epidermal layers. The compatibility of ATGL deficiency with normal epidermal function indicated that CGI-58 may stimulate an epidermal triglyceride lipase beyond ATGL required for the adequate provision of fatty acids as a substrate for ω-O-acylceramide synthesis. Pharmacological inhibition of ATGL enzyme activity similarly reduced triglyceride-hydrolytic activities in wild-type and CGI-58 overexpressing epidermis implicating that CGI-58 participates in ω-O-acylceramide biogenesis independent of its role as a coactivator of epidermal triglyceride catabolism. PMID:27725204

Effective lethal mutagenesis of influenza virus by three nucleoside analogs.

Science.gov (United States)

Pauly, Matthew D; Lauring, Adam S

2015-04-01

Lethal mutagenesis is a broad-spectrum antiviral strategy that exploits the high mutation rate and low mutational tolerance of many RNA viruses. This approach uses mutagenic drugs to increase viral mutation rates and burden viral populations with mutations that reduce the number of infectious progeny. We investigated the effectiveness of lethal mutagenesis as a strategy against influenza virus using three nucleoside analogs, ribavirin, 5-azacytidine, and 5-fluorouracil. All three drugs were active against a panel of seasonal H3N2 and laboratory-adapted H1N1 strains. We found that each drug increased the frequency of mutations in influenza virus populations and decreased the virus' specific infectivity, indicating a mutagenic mode of action. We were able to drive viral populations to extinction by passaging influenza virus in the presence of each drug, indicating that complete lethal mutagenesis of influenza virus populations can be achieved when a sufficient mutational burden is applied. Population-wide resistance to these mutagenic agents did not arise after serial passage of influenza virus populations in sublethal concentrations of drug. Sequencing of these drug-passaged viral populations revealed genome-wide accumulation of mutations at low frequency. The replicative capacity of drug-passaged populations was reduced at higher multiplicities of infection, suggesting the presence of defective interfering particles and a possible barrier to the evolution of resistance. Together, our data suggest that lethal mutagenesis may be a particularly effective therapeutic approach with a high genetic barrier to resistance for influenza virus. Influenza virus is an RNA virus that causes significant morbidity and mortality during annual epidemics. Novel therapies for RNA viruses are needed due to the ease with which these viruses evolve resistance to existing therapeutics. Lethal mutagenesis is a broad-spectrum strategy that exploits the high mutation rate and the low

Atopic dermatitis-like disease and associated lethal myeloproliferative disorder arise from loss of Notch signaling in the murine skin.

Directory of Open Access Journals (Sweden)

Alexis Dumortier

2010-02-01

Full Text Available The Notch pathway is essential for proper epidermal differentiation during embryonic skin development. Moreover, skin specific loss of Notch signaling in the embryo results in skin barrier defects accompanied by a B-lymphoproliferative disease. However, much less is known about the consequences of loss of Notch signaling after birth.To study the function of Notch signaling in the skin of adult mice, we made use of a series of conditional gene targeted mice that allow inactivation of several components of the Notch signaling pathway specifically in the skin. We demonstrate that skin-specific inactivation of Notch1 and Notch2 simultaneously, or RBP-J, induces the development of a severe form of atopic dermatitis (AD, characterized by acanthosis, spongiosis and hyperkeratosis, as well as a massive dermal infiltration of eosinophils and mast cells. Likewise, patients suffering from AD, but not psoriasis or lichen planus, have a marked reduction of Notch receptor expression in the skin. Loss of Notch in keratinocytes induces the production of thymic stromal lymphopoietin (TSLP, a cytokine deeply implicated in the pathogenesis of AD. The AD-like associated inflammation is accompanied by a myeloproliferative disorder (MPD characterized by an increase in immature myeloid populations in the bone marrow and spleen. Transplantation studies revealed that the MPD is cell non-autonomous and caused by dramatic microenvironmental alterations. Genetic studies demontrated that G-CSF mediates the MPD as well as changes in the bone marrow microenvironment leading to osteopenia.Our data demonstrate a critical role for Notch in repressing TSLP production in keratinocytes, thereby maintaining integrity of the skin and the hematopoietic system.

Barreira cutânea na dermatite atópica Skin barrier in atopic dermatitis

Directory of Open Access Journals (Sweden)

Flavia Alvim Sant'Anna Addor

2010-04-01

Full Text Available O estudo da barreira cutânea e de suas propriedades ganhou impulso a partir da década de 60, com estudos que apontaram sua resistência de forma isolada e suas propriedades com relação à permeação cutânea. Paralelamente, a descrição dos corpos de Odland auxiliou a compreensão da manutenção da estabilidade da camada córnea. O modelo brick & mortar, em que os corneócitos são os tijolos e o cimento são os lipídeos intercelulares, é o mais aceito, até o momento. Atualmente, há evidências consistentes de que o estrato córneo é uma estrutura metabolicamente ativa e exerce funções adaptativas. A barreira cutânea também tem um papel na resposta inflamatória, com ativação de melanócitos, angiogênese e fibroplasia, cuja intensidade depende, basicamente, da intensidade da agressão. As anormalidades da barreira cutânea da dermatite atópica são clinicamente observáveis pela presença de pele seca, achado muito frequente e significativo, que constitui parâmetro iagnóstico e de acompanhamento. O grau de hidratação da camada córnea, assim como a perda de água transepidérmica (transepidermal water loss - TEWL, estão relacionados com o grau de dano à barreira, constituindo parâmetros biofísicos que permitem acompanhar os pacientes de maneira não invasiva e com maior grau de sensibilidade.Research about the skin barrier and its properties has increased significantly since the 60s, with studies that indicated its resistance when isolated, as well as its particularities in relation to skin permeability. At the same time, description of Odland bodies helped to understand how stratum corneum stability is maintained. The “brick and mortarâ€� model is the most accepted so far. In this analogy, the corneocytes are the bricks and the intercellular lipids are the mortar. Currently, there is concrete evidence that the stratum corneum is an active metabolic structure that holds adaptive functions, interacting

Diabetic and sympathetic influences on the water permeability barrier function of human skin as measured using transepidermal water loss: A case-control study.

Science.gov (United States)

Han, Seung Hoon; Park, Ji Woong

2017-11-01

The presence of long-standing hyperglycemic conditions has been suggested to lead to many skin problems associated with an impaired skin barrier function. However, the relationship between impaired skin barrier status and altered peripheral nervous system function has not yet been determined. The purpose of this study was to investigate the water evaporation rate as a measure of the permeability barrier function of diabetic skin and its relationship to diabetic sensorimotor polyneuropathy (DSPN) and peripheral autonomic neuropathy (PAN) using well-controlled confounding variables.This case-control study included 42 participants with chronic diabetes and 43 matched healthy controls. The diabetic group underwent a nerve conduction study and sympathetic skin response (SSR) test to confirm the presence of DSPN and PAN, respectively. Different skin regions were analyzed using the noninvasive Tewameter instrument (Courage + Khazaka Electronic GmbH, Cologne, Germany). The impacts of PAN, DSPN, age, and diabetes duration on the values of transepidermal water loss (TEWL) were each analyzed and compared between the groups.Regardless of the presence of DSPN or PAN, the TEWL values as measured on the distal extremities were significantly lower in the diabetic group than in the control group. In the diabetic group, participants with abnormal SSR test results showed decreased TEWL values in the finger, sole, and first toe, as compared with participants with normal SSR test results. In the control group, age showed a negative correlation with the TEWL values with respect to some measured regions. However, in the diabetic group, there was no significant correlation between either patient age or diabetes duration and TEWL values.The presence of a long-term hyperglycemic state can reduce the permeability barrier function of the skin, a phenomenon that might be related to the presence of an impaired peripheral sympathetic nervous system, rather than peripheral sensorimotor

Microspectroscopic Confocal Raman and Macroscopic Biophysical Measurements in the in vivo Assessment of the Skin Barrier: Perspective for Dermatology and Cosmetic Sciences

NARCIS (Netherlands)

Falcone, D.; Uzunbajakava, N.E.; Varghese, B.; Aquino Santos, G.R. de; Richters, R.J.H.; Kerkhof, P.C.M. van de; Erp, P.E.J. van

2015-01-01

Skin barrier function, confined to the stratum corneum, is traditionally evaluated using established, noninvasive biophysical methods like transepidermal water loss, capacitance and conductance. However, these methods neither measure skin molecular composition nor its structure, hindering the actual

Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier.

Directory of Open Access Journals (Sweden)

Jes Dreier

Full Text Available In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers that transport their cargo directly through the skin barrier, but mainly burst and fuse with the outer lipid layers of the stratum corneum. It was also found that the flexible liposomes showed a greater delivery of the fluorophore into the stratum corneum, indicating that they functioned as chemical permeability enhancers.

Comparison of skin barrier function and sensory nerve electric current perception threshold between IgE-high extrinsic and IgE-normal intrinsic types of atopic dermatitis.

Science.gov (United States)

Mori, T; Ishida, K; Mukumoto, S; Yamada, Y; Imokawa, G; Kabashima, K; Kobayashi, M; Bito, T; Nakamura, M; Ogasawara, K; Tokura, Y

2010-01-01

Background Two types of atopic dermatitis (AD) have been proposed, with different pathophysiological mechanisms underlying this seemingly heterogeneous disorder. The extrinsic type shows high IgE levels presumably as a consequence of skin barrier damage and feasible allergen permeation, whereas the intrinsic type exhibits normal IgE levels and is not mediated by allergen-specific IgE. Objectives To investigate the relationship between pruritus perception threshold and skin barrier function of patients with AD in a comparison between the extrinsic and intrinsic types. Methods Enrolled in this study were 32 patients with extrinsic AD, 17 with intrinsic AD and 24 healthy individuals. The barrier function of the stratum corneum was assessed by skin surface hydration and transepidermal water loss (TEWL), and pruritus perception was evaluated by the electric current perception threshold (CPT) of sensory nerves upon neuroselective transcutaneous electric stimulation. Results Skin surface hydration was significantly lower and TEWL was significantly higher in extrinsic AD than intrinsic AD or normal controls. Although there was no statistically significant difference in CPT among extrinsic AD, intrinsic AD and normal controls, CPT was significantly correlated with skin surface hydration and inversely with TEWL in intrinsic AD and normal controls, but not extrinsic AD. Finally, CPT was correlated with the visual analogue scale of itch in the nonlesional skin of patients with extrinsic but not intrinsic AD. Conclusions Patients with extrinsic AD have an impaired barrier, which increases the pre-existing pruritus but rather decreases sensitivity to external stimuli. In contrast, patients with intrinsic AD retain a normal barrier function and sensory reactivity to external pruritic stimuli.

Effects of Locally Applied Glycerol and Xylitol on the Hydration, Barrier Function and Morphological Parameters of the Skin.

Science.gov (United States)

Korponyai, Csilla; Szél, Edit; Behány, Zoltán; Varga, Erika; Mohos, Gábor; Dura, Ágnes; Dikstein, Shabtay; Kemény, Lajos; Erős, Gábor

2017-02-08

Glycerol and xylitol hydrate the skin and improve its barrier function over a short period. We studied the effects of glycerol and xylitol on the physiological properties and morphology of the skin after longer-term application. Twelve volunteers with dry skin were examined. Three areas on the arms were determined. Area 1 served as untreated control. The vehicle was applied to area 2, while area 3 was treated twice daily with a formulation containing glycerol (5%) and xylitol (5%) for 14 days. Transepidermal water loss (TEWL), hydration and biomechanical properties of the skin were monitored. Biopsies were taken for routine histology and immunohistochemistry for filaggrin and matrix metalloproteinase-1 (MMP-1). The polyols increased the skin hydration and protein quantity of filaggrin, elevated the interdigitation index, decreased the TEWL and improved the biomechanical properties of the skin, but did not change the protein expression of MMP-1. A combination of glycerol and xylitol can be useful additional therapy for dry skin.

Skin allografts in lethally irradiated animals repopulated with syngeneic hemopoietic cells

International Nuclear Information System (INIS)

Schwadron, R.B.

1983-01-01

Total body irradiation and repopulation with syngeneic hemopoietic cells can be used to induce tolerance to major histocompatibility complex (MHC) mismatched heart and kidney grafts in rats and mice. However, this protocol does not work for MHC mismatched skin grafts in rats or mice. Furthermore, LEW rats that accept WF cardiac allografts after irradiation and repopulation reject subsequent WF skin grafts. Treatment of skin allograft donors with methotrexate prior to grafting onto irradiated and reconstituted mice resulted in doubling of the mean survival time. Analysis of which antigens provoked skin graft rejection by irradiation and reconstituted animals revealed the importance of I region antigens. Cardiac allograft acceptance by irradiated and reconstituted animals is mediated by suppressor cells found in the spleen. Adoptively tolerant LEW rats accepted WF skin grafts in 50% of grafted animals. Analysis of this phenomenon revealed that the adoptive transfer procedure itself was important in achieving skin allograft acceptance by these animals. In general, it seems that the lack of ability of irradiated and reconstituted animals to accept fully MHC disparate skin grafts results from the inability of these animals to suppress lymph node effector cells against I region antigen seen on highly immunogenic allogeneic Langerhans cells in the skin

NANODERM. Quality of skin as a barrier to ultra-fine particles

International Nuclear Information System (INIS)

Kiss, A.Z.; Kertesz, Zs.; Szikszai, Z.; Biro, T.; Czifra, G.; Toth, B.I.; Juhasz, I.; Kiss, B.; Hunyadi, J.

2007-01-01

ultra-fine particles on healthy skin. On the other hand, micronised titanium-dioxide particles are internalized by melanocytes and fibroblasts in cell culture. Particles disturb cell viability and proliferation as well as keratinocyte differentiation. Outlook Although this EU project has ended, there are still several questions to be answered. In view of the cellular effects, we are currently investigating the penetration of nanosized particles into skin with impaired barrier function. Long term exposure studies are also required

Structural modification of the skin barrier by OH radicals: a reactive molecular dynamics study for plasma medicine

International Nuclear Information System (INIS)

Van der Paal, J; Verlackt, C C; Yusupov, M; Neyts, E C; Bogaerts, A

2015-01-01

While plasma treatment of skin diseases and wound healing has been proven highly effective, the underlying mechanisms, and more generally the effect of plasma radicals on skin tissue, are not yet completely understood. In this paper, we perform ReaxFF-based reactive molecular dynamics simulations to investigate the interaction of plasma generated OH radicals with a model system composed of free fatty acids, ceramides, and cholesterol molecules. This model system is an approximation of the upper layer of the skin (stratum corneum). All interaction mechanisms observed in our simulations are initiated by H-abstraction from one of the ceramides. This reaction, in turn, often starts a cascade of other reactions, which eventually lead to the formation of aldehydes, the dissociation of ceramides or the elimination of formaldehyde, and thus eventually to the degradation of the skin barrier function. (paper)

A Long-Term Study to Evaluate Acidic Skin Care Treatment in Nursing Home Residents: Impact on Epidermal Barrier Function and Microflora in Aged Skin.

Science.gov (United States)

Blaak, Jürgen; Kaup, Olaf; Hoppe, Willi; Baron-Ruppert, Gabriele; Langheim, Heiko; Staib, Peter; Wohlfart, Rainer; Lüttje, Dieter; Schürer, Nanna

2015-08-01

The pH of the stratum corneum (SC) in the elderly is elevated and linked to impaired SC function. Therefore, this paper addresses the question of whether acidic skin care generates positive clinical, biophysical, and microbiological effects in aged skin. This study was performed to assess skin care effects in nursing home residents (aged 80-97 years). Visual, biophysical, and microbiological methods were used. Subjects were randomly assigned to 1 of 2 groups and treated over 7 weeks with skin care products adjusted to a pH of 4.0 (group A) or a pH of 6.0 (group B). Compared to baseline, SC integrity improved significantly in group A (p = 0.007), whereas there was no change in group B (p = 0.672). SC recovery 24 h after perturbation increased significantly in group A (p = 0.004) compared to baseline. The SC recovery in group B was not significant compared to baseline (p = 0.327). Long-term treatment with pH 4.0 skin care results in a significant improvement in epidermal barrier function compared to identical products with a pH of 6.0. In addition, effects on skin dryness and resident flora were demonstrated, but without significant differences, between the 2 groups. Based on these results, we recommend adjustment of skin care products for the elderly to a pH of 4.0 to maintain the health of aged skin. © 2015 S. Karger AG, Basel.

[Impact of wet work on epidermal barrier (tewl and stratum corneum hydration) and skin viscoelasticity in nurses].

Science.gov (United States)

Kieć-Świcrczyńska, Marta; Chomiczewska-Skóra, Dorota; Świerczyńska-Machura, Dominika; Kręcisz, Beata

2014-01-01

Nurses are prone to develop hand eczema due to occupational exposure to irritants, including wet work. The aim of the study was to evaluate the impact of wet work on selected skin properties, reflecting epidermal barrier function--transepidermal water loss (TEWL) and stratum corneum hydration--and additionally skin viscoelasticity, in nurses. Study subjects included 90 nurses employed in hospital wards. Measurements were carried out within the dorsal aspect of the dominant hand, using a Cutometer MPA 580 equipped with Tewameter TM 300 and Corneometer CM 825 (Courage & Khazaka, Germany) probes. Examina- tions took place on hospital premises. Similar measurements were performed in the control group of females non-exposed to irritants. In the examined group of nurses, mean TEWL was 15.5 g/h/m2 and was higher than in the control group (12.99 g/h/m2). After rejecting the extreme results, the difference between the groups proved to be statistically significant (p hydration was lower in the examined group (37.915) compared with the control group (40.05), but the difference was not sta tistically significant. Also results of viscoelasticity assessment showed no significant differences between studied groups. The results of the assessment of skin biophysical properties show that wet work exerts a moderately adverse impact on skin condition. A higher TEWL value and a lower stratum corneum hydration in workers exposed to irritants reflect an adverse impact of these factors on the epidermal barrier function.

Permeability of skin and oral mucosa to water and horseradish peroxidase as related to the thickness of the permeability barrier

International Nuclear Information System (INIS)

Squier, C.A.; Hall, B.K.

1985-01-01

The permeability of porcine skin and keratinized and nonkeratinized oral mucosa to tritium-labeled water and horseradish peroxidase (HRPO) was determined using perfusion chambers. Small blocks from each tissue were also incubated with HRPO and the extent of penetration visualized microscopically; this enabled measurements to be made of the thickness of the permeability barrier to this water-soluble tracer. Results obtained after inverting the oral mucosa in the chambers or adding metabolic inhibitors indicated that both compounds diffuse across the tissue. The permeability constants derived directly in the study showed that skin was less permeable than oral mucosa and that the floor of the mouth was significantly more permeable than all other regions. When these constants were normalized in terms of a standard permeability barrier thickness and the different tissues compared, the values obtained for skin were again less than those of the oral regions but, of these, the buccal mucosa was significantly higher. The difference in permeability between epidermis and keratinized oral epithelium may be due to differences in the volume density of membrane-coating granules known to exist between the tissues; differences between the oral mucosal regions may reflect differences in the nature of the intercellular barrier material

Ultraviolet A photosensitivity profile of dexchlorpheniramine maleate and promethazine-based creams: Anti-inflammatory, antihistaminic, and skin barrier protection properties.

Science.gov (United States)

Facchini, Gustavo; Eberlin, Samara; Clerici, Stefano Piatto; Alves Pinheiro, Ana Lucia Tabarini; Costa, Adilson

2017-12-01

Unwanted side effects such as dryness, hypersensitivity, and cutaneous photosensitivity are challenge for adherence and therapeutical success for patients using treatments for inflammatory and allergic skin response. In this study, we compared the effects of two dermatological formulations, which are used in inflammatory and/or allergic skin conditions: dexchlorpheniramine maleate (DCP; 10 mg/g) and promethazine (PTZ; 20 mg/g). We evaluated both formulations for phototoxicity potential, skin irritation, anti-inflammatory and antihistaminic abilities, and skin barrier repair in vitro and ex vivo using the standard OECD test guideline n° 432, the ECVAM protocol n° 78, and cultured skin explants from a healthy patient. Ultraviolet A was chosen as exogenous agent to induce allergic and inflammatory response. Both PTZ and DCP promoted increases in interleukin-1 (IL-1) synthesis in response to ultraviolet A (UVA) radiation compared to control. However, the increase observed with PTZ was significantly greater than the DCP, indicating that the latter has a lower irritant potential. DCP also demonstrated a protective effect on UVA-induced leukotriene B4 and nuclear factor kappa B (NF-κB) synthesis. Conversely, PTZ demonstrates more robust UVA antihistaminic activity. Likewise, PTZ promoted a significantly greater increase in the production of involucrin and keratin 14, both associated with protective skin barrier property. In conclusion, these data suggest possible diverging UVA response mechanisms of DCP and PTZ, which gives greater insight into the contrasting photosensitizing potential between DCP and PTZ observed in the patients. © 2017 Wiley Periodicals, Inc.

The structure, function, and importance of ceramides in skin and their use as therapeutic agents in skin-care products.

Science.gov (United States)

Meckfessel, Matthew H; Brandt, Staci

2014-07-01

Ceramides (CERs) are epidermal lipids that are important for skin barrier function. Much research has been devoted to identifying the numerous CERs found in human skin and their function. Alterations in CER content are associated with a number of skin diseases such as atopic dermatitis. Newer formulations of skin-care products have incorporated CERs into their formulations with the goal of exogenously applying CERs to help skin barrier function. CERs are a complex class of molecules and because of their growing ubiquity in skin-care products, a clear understanding of their role in skin and use in skin-care products is essential for clinicians treating patients with skin diseases. This review provides an overview of the structure, function, and importance of skin CERs in diseased skin and how CERs are being used in skin-care products to improve or restore skin barrier function. Copyright © 2014 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

Simulations of skin barrier function: free energies of hydrophobic and hydrophilic transmembrane pores in ceramide bilayers.

Science.gov (United States)

Notman, Rebecca; Anwar, Jamshed; Briels, W J; Noro, Massimo G; den Otter, Wouter K

2008-11-15

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel phase and in the DMSO-induced fluidized state. Our simulations show that the fluid phase bilayers form archetypal water-filled hydrophilic pores similar to those observed in phospholipid bilayers. In contrast, the rigid gel-phase bilayers develop hydrophobic pores. At the relatively small pore diameters studied here, the hydrophobic pores are empty rather than filled with bulk water, suggesting that they do not compromise the barrier function of ceramide membranes. A phenomenological analysis suggests that these vapor pores are stable, below a critical radius, because the penalty of creating water-vapor and tail-vapor interfaces is lower than that of directly exposing the strongly hydrophobic tails to water. The PMCF free energy profile of the vapor pore supports this analysis. The simulations indicate that high DMSO concentrations drastically impair the barrier function of the skin by strongly reducing the free energy required for pore opening.

Stratum corneum integrity as a predictor for peristomal skin problems in ostomates

DEFF Research Database (Denmark)

Nybaek, H; Lophaven, Søren Nymand; Karlsmark, T

2010-01-01

BACKGROUND: Peristomal skin problems are common, most often the result is disruption of the skin barrier and this may account for more than one in three visits to ostomy nurses. Therefore a specific assessment of individual risk factors relating to the skin barrier function would be of great...... interest. METHODS: Skin barrier integrity in ostomy patients with peristomal skin problems (PSP) was compared with that of ostomy patients with normal skin (controls) using transepidermal water loss (TEWL). Mechanical barrier disruption was determined by a tape stripping test and chemical barrier...

Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer

Directory of Open Access Journals (Sweden)

Antoine Berger

2018-01-01

Full Text Available Purpose: As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant for breast cancer. Methods: Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low. Results: Average age was 60 years (range: 34-85. Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031. Positive physician’s opinion on product use was more frequent for high (66.6% versus low (32% users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. Conclusions: These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

Interest of Supportive and Barrier Protective Skin Care Products in the Daily Prevention and Treatment of Cutaneous Toxicity During Radiotherapy for Breast Cancer.

Science.gov (United States)

Berger, Antoine; Regueiro, Carlos; Hijal, Tarek; Pasquier, David; De La Fuente, Cristina; Le Tinier, Florence; Coche-Dequeant, Bernard; Lartigau, Eric; Moyal, Dominique; Seité, Sophie; Bensadoun, René-Jean

2018-01-01

As many as 50% of patients with cancer develop acute skin reactions to some degree with radiotherapy. Proactive skin care is often recommended to minimise these skin reactions and maintain the integrity of the epidermal barrier; nevertheless, no consensual guidelines are systematically used. This multicentre, observational, prospective study evaluated the tolerability and benefit of supportive and barrier protective skin care products in preventing radiotherapy-induced skin reactions in 253 women initiating radiotherapy (exclusive or adjuvant) for breast cancer. Patients received a kit of 5 commercially available skin care products before the first radiotherapy treatment. The following variables were assessed: cutaneous adverse events, investigator-assessed skin reactions (oedema, erythema, dryness, desquamation) before and after radiotherapy course, investigator, and patient opinion on products benefit. Results were analysed by frequency of product use (heavy versus low). Average age was 60 years (range: 34-85). Over 92% of patients reported good to excellent tolerance on irradiated skin for each product. During the 6-week radiotherapy period, we observed that heavy product users had less skin reactions than the low users, particularly within 10 days of radiotherapy initiation (8% versus 18%; p  = .031). Positive physician's opinion on product use was more frequent for high (66.6%) versus low (32%) users. Patient-assessed patient benefit index was generally >1, indicating relevant treatment benefit, with a tendency for better benefit in high versus low users. These results support recommendations to use skin care products to minimise the impact of secondary cutaneous reactions with radiotherapy cancer treatment.

Herbal medicines that benefit epidermal permeability barrier function

Directory of Open Access Journals (Sweden)

Lizhi Hu

2015-06-01

Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

Efficacy of a Hand Regimen in Skin Barrier Protection in Individuals With Occupational Irritant Contact Dermatitis.

Science.gov (United States)

Jordan, Laura

2016-11-01

Occupational irritant contact dermatitis (OICD) is a dif cult and hard to manage condition. It occurs more frequently in certain occupations where contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing heightens the risk. Treatment for OICD includes patient education in addition to physical, topical, and systemic therapies. To review the pathogenesis and treatment options for OICD and evaluate the ef cacy of a selective skin-care regimen involv- ing a hand protectant cream alone as well as combined with a repair cream and speci c cleanser. A single-center open study was performed comprising 42 healthy male and female adult volunteers prone to occupational irritant contact dermatitis due to frequent wet work or contact with detergents. Between day 0 and day 7, subjects applied a hand protectant cream as needed on both hands (at least twice daily). On days 7 to 14, subjects applied a hand protectant cream and cleanser as needed on both hands (at least twice daily) as well as a repair cream each evening. A diary log was given to each volunteer for application control and for a subjective evaluation of daily tolerability. In these subjects prone to occupational irritant contact dermatitis, the hand protectant cream applied during the initial 7-day period was effective in restoring the damaged skin barrier and improving the stratum corneum hydration. A regimen that combined the hand protectant and repair creams with a speci c cleanser during a further 7-day period allowed contin- ued improvement of skin hydration and additional clinical bene ts while respecting the skin barrier function. The results of this study support the use of a 3-step approach for patients who are at risk of repeated exposure to external irritants. J Drugs Dermatol. 2016;15(suppl 11):s81-85..

Xenobiotic metabolism in human skin and 3D human skin reconstructs: A review

NARCIS (Netherlands)

Gibbs, S.; Sandt, J.J.M. van de; Merk, H.F.; Lockley, D.J.; Pendlington, R.U.; Pease, C.K.

2007-01-01

In this review, we discuss and compare studies of xenobiotic metabolism in both human skin and 3D human skin reconstructs. In comparison to the liver, the skin is a less studied organ in terms of characterising metabolic capability. While the skin forms the major protective barrier to environmental

Efficacy of a shower cream and a lotion with skin-identical lipids in healthy subjects with atopic dry skin.

Science.gov (United States)

Berardesca, Enzo; Mortillo, Susan; Cameli, Norma; Ardigo, Marco; Mariano, Maria

2018-05-10

Atopic dermatitis is a chronic, pruritic inflammatory skin disease that adversely affects quality of life. The current study evaluates the efficacy of a shower cream and a lotion, each with skin-identical lipids and emollients, in the treatment of atopic dry skin of subjects with a history of atopic condition. In all, 40 healthy females with clinically dry skin on the lower legs were enrolled in the study and underwent 4 weeks of daily use of the shower cream and 2 additional weeks of both the shower cream and the body lotion. Subjects were evaluated at day 0, week 4, and week 6. Skin barrier function was assessed by Tewameter ® , skin hydration by Corneometer ® , smoothness and desquamation by Visioscan ® , and stratum corneum architecture by reflectance confocal microscopy (RCM). The investigator assessed the degree of dryness, roughness, redness, cracks, tingling and itch, and subjective self-assessment evaluated the perception of skin soothing, smoothness, and softness. Skin barrier function and skin moisture maintenance were significantly improved using the shower cream. The lotion with physiological lipids, together with the shower cream, also improved skin barrier function and moisture. Both the shower cream and the body lotion reduced clinical dryness, roughness, redness, cracks, tingling and itch, according to the dermatologist, and increased soothing, smoothness, and softness, according to the subjects of the study. The combination of a shower cream and a lotion with physiological lipids efficiently restores skin barrier function and increases skin hydration, becoming an effective skin-care option for patients with atopic dry skin. © 2018 Wiley Periodicals, Inc.

Nanoscale alterations of corneocytes indicate skin disease

DEFF Research Database (Denmark)

Franz, J; Beutel, M; Gevers, K

2016-01-01

BACKGROUND: The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here...... dermatitis, a common inflammatory skin condition. CONCLUSION: The presence of these corneocyte-nanostructures might be used as a diagnostic parameter for skin disorders - even in cases below a clinical threshold....

Skin graft - slideshow

Science.gov (United States)

... this page: //medlineplus.gov/ency/presentations/100100.htm Skin graft - series—Normal anatomy To use the sharing features ... entire body, and acts as a protective barrier. Skin grafts may be recommended for: Extensive wounds Burns Specific ...

Skin Basement Membrane: The Foundation of Epidermal Integrity—BM Functions and Diverse Roles of Bridging Molecules Nidogen and Perlecan

Directory of Open Access Journals (Sweden)

Dirk Breitkreutz

2013-01-01

Full Text Available The epidermis functions in skin as first defense line or barrier against environmental impacts, resting on extracellular matrix (ECM of the dermis underneath. Both compartments are connected by the basement membrane (BM, composed of a set of distinct glycoproteins and proteoglycans. Herein we are reviewing molecular aspects of BM structure, composition, and function regarding not only (i the dermoepidermal interface but also (ii the resident microvasculature, primarily focusing on the per se nonscaffold forming components perlecan and nidogen-1 and nidogen-2. Depletion or functional deficiencies of any BM component are lethal at some stage of development or around birth, though BM defects vary between organs and tissues. Lethality problems were overcome by developmental stage- and skin-specific gene targeting or by cell grafting and organotypic (3D cocultures of normal or defective cells, which allows recapitulating BM formation de novo. Thus, evidence is accumulating that BM assembly and turnover rely on mechanical properties and composition of the adjacent ECM and the dynamics of molecular assembly, including further “minor” local components, nidogens largely functioning as catalysts or molecular adaptors and perlecan as bridging stabilizer. Collectively, orchestration of BM assembly, remodeling, and the role of individual players herein are determined by the developmental, tissue-specific, or functional context.

Nanoscale alterations of corneocytes indicate skin disease

NARCIS (Netherlands)

Franz, J.; Beutel, M.; Gevers, K.; Kramer, A.; Thyssen, J. P.; Kezic, S.; Riethmüller, C.

2016-01-01

The skin barrier protects the organism against exogenous stressors and simultaneously prevents excessive water loss. While the delicate regulation of skin barrier is not completely understood, morphological and histological evaluation remain key features of clinical investigations. Here, we extended

Devices for overcoming biological barriers: the use of physical forces to disrupt the barriers.

Science.gov (United States)

Mitragotri, Samir

2013-01-01

Overcoming biological barriers including skin, mucosal membranes, blood brain barrier as well as cell and nuclear membrane constitutes a key hurdle in the field of drug delivery. While these barriers serve the natural protective function in the body, they limit delivery of drugs into the body. A variety of methods have been developed to overcome these barriers including formulations, targeting peptides and device-based technologies. This review focuses on the use of physical methods including acoustic devices, electric devices, high-pressure devices, microneedles and optical devices for disrupting various barriers in the body including skin and other membranes. A summary of the working principles of these devices and their ability to enhance drug delivery is presented. Copyright © 2012. Published by Elsevier B.V.

Percutaneous penetration through slightly damaged skin

DEFF Research Database (Denmark)

Nielsen, Jesper B

2005-01-01

with human skin. A slight damage to the barrier integrity was induced by pre-treatment of the skin with sodium lauryl sulphate (SLS) before pesticide exposure. The experimental model with 3 h pre-treatment with SLS (0.1% or 0.3%) assured a significant but controlled damage to the barrier integrity, a damage...

Cathepsin B as a potential cystatin M/E target in the mouse hair follicle

NARCIS (Netherlands)

Oortveld, M.A.W.; Vlijmen-Willems, I.M.J.J. van; Kersten, F.F.J.; Cheng, T.; Verdoes, M.; Erp, P.E.J. van; Verbeek, S.; Reinheckel, T.; Hendriks, W.J.A.J.; Schalkwijk, J.; Zeeuwen, P.L.J.M.

2017-01-01

Deficiency of the cysteine protease inhibitor cystatin M/E (Cst6) in mice leads to disturbed epidermal cornification, impaired barrier function, and neonatal lethality. We report the rescue of the lethal skin phenotype of ichq (Cst6-deficient; Cst6-/-) mice by transgenic, epidermis-specific,

Impact of chemical peeling combined with negative pressure on human skin.

Science.gov (United States)

Kim, S J; Kang, I J; Shin, M K; Jeong, K H; Baek, J H; Koh, J S; Lee, S J

2016-10-01

In vivo changes in skin barrier function after chemical peeling with alpha hydroxyacids (AHAs) have been previously reported. However, the additional effects of physical treatment with chemical agents on skin barrier function have not been adequately studied. This study measured the degree of acute skin damage and the time required for skin barrier repair using non-invasive bioengineering methods in vivo with human skin to investigate the additional effect of a 4% AHA chemical jet accelerated at supersonic velocities. Thirteen female subjects (average age: 29.54 ± 4.86 years) participated in this study. The faces of the subjects were divided into half according to the block randomization design and were then assigned to receive AHA peeling alone or AHA peeling combined with pneumatic pressure on each side of the face. Transepidermal water loss (TEWL), skin colour and skin blood flow were evaluated at baseline and at 30 min, 2, 5 and 7 days after treatment. The TEWL and skin blood flow were significantly increased after 30 min in chemodermabrasion compared with chemical peeling alone (P peeling alone (P < 0.05). Chemodermabrasion can temporarily impair skin barriers, but it is estimated that it can enhance the skin barrier function after 7 days compared to the use of a chemical agent alone. In addition, chemodermabrasion has a more effective impact in the dermis and relatively preserves the skin barrier. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Chromium-induced skin damage among Taiwanese cement workers.

Science.gov (United States)

Chou, Tzu-Chieh; Wang, Po-Chih; Wu, Jyun-De; Sheu, Shiann-Cherng

2016-10-01

Little research has been done on the relationships between chromium exposure, skin barrier function, and other hygienic habits in cement workers. Our purpose was to investigate chromium-induced skin barrier disruption due to cement exposure among cement workers. One hundred and eight cement workers were recruited in this study. Urinary chromium concentration was used to characterize exposure levels. The biological exposure index was used to separate high and low chromium exposure. Transepidermal water loss (TEWL) was used to assess the skin barrier function. TEWL was significantly increased in workers with high chromium exposure levels than those with low chromium exposure levels (p = 0.048). A positive correlation was also found between urinary chromium concentration and TEWL (R = 0.28, p = 0.004). After adjusting for smoking status and glove use, a significant correlation between urinary chromium concentrations and TEWL remained. Moreover, workers who smoked and had a high chromium exposure had significantly increased TEWL compared to nonsmokers with low chromium exposure (p = 0.01). Skin barrier function of cement workers may have been disrupted by chromium in cement, and smoking might significantly enhance such skin barrier perturbation with chromium exposure. Decreased chromium skin exposure and smoking cessation should be encouraged at work. © The Author(s) 2015.

Commonly Employed African Neonatal Skin Care Products Compromise Epidermal Function in Mice.

Science.gov (United States)

Man, Mao-Qiang; Sun, Richard; Man, George; Lee, Dale; Hill, Zelee; Elias, Peter M

2016-09-01

Neonatal mortality is much higher in the developing world than in developed countries. Infections are a major cause of neonatal death, particularly in preterm infants, in whom defective epidermal permeability barrier function facilitates transcutaneous pathogen invasion. The objective was to determine whether neonatal skin care products commonly used in Africa benefit or compromise epidermal functions in murine skin. After twice-daily treatment of 6- to 8-week-old hairless mice with each skin care product for 3 days, epidermal permeability barrier function, skin surface pH, stratum corneum hydration, and barrier recovery were measured using a multiprobe adapter system physiology monitor. For products showing some benefits in these initial tests, the epidermal permeability barrier homeostasis was assessed 1 and 5 hours after a single application to acutely disrupted skin. All of the skin care products compromised basal permeability barrier function and barrier repair kinetics. Moreover, after 3 days of treatment, most of the products also reduced stratum corneum hydration while elevating skin surface pH to abnormal levels. Some neonatal skin care products that are widely used in Africa perturb important epidermal functions, including permeability barrier homeostasis in mice. Should these products have similar effects on newborn human skin, they could cause a defective epidermal permeability barrier, which can increase body fluid loss, impair thermoregulation, and contribute to the high rates of neonatal morbidity and mortality seen in Africa. Accordingly, alternative products that enhance permeability barrier function should be identified, particularly for use in preterm infants. © 2016 Wiley Periodicals, Inc.

Skin absorption through atopic dermatitis skin

DEFF Research Database (Denmark)

Halling-Overgaard, A-S; Kezic, S; Jakasa, I

2017-01-01

Patients with atopic dermatitis have skin barrier impairment in both lesional and non-lesional skin. They are typically exposed to emollients daily and topical anti-inflammatory medicaments intermittently, hereby increasing the risk of developing contact allergy and systemic exposed to chemicals...... ingredients found in these topical preparations. We systematically searched for studies that investigated skin absorption of various penetrants, including medicaments, in atopic dermatitis patients, but also animals with experimentally induced dermatitis. We identified 40 articles, i.e. 11 human studies...... examining model penetrants, 26 human studies examining atopic dermatitis drugs and 3 animal studies. We conclude that atopic dermatitis patients have nearly two-fold increased skin absorption when compared to healthy controls. There is a need for well-designed epidemiological and dermato...

Water vapour loss measurements on human skin.

NARCIS (Netherlands)

Valk, Petrus Gerardus Maria van der

1984-01-01

In this thesis, the results of a series of investigations into the barrier function of human skin are presented. In these investigations, the barrier function was assessed by water vapour loss measurements of the skin using a method based on gradient estimation.... Zie: Summary and conclusions

Simulations of Skin Barrier Function: Free Energies of Hydrophobic and Hydrophilic Transmembrane Pores in Ceramide Bilayers

OpenAIRE

Notman, Rebecca; Anwar, Jamshed; Briels, W. J.; Noro, Massimo G.; den Otter, Wouter K.

2008-01-01

Transmembrane pore formation is central to many biological processes such as ion transport, cell fusion, and viral infection. Furthermore, pore formation in the ceramide bilayers of the stratum corneum may be an important mechanism by which penetration enhancers such as dimethylsulfoxide (DMSO) weaken the barrier function of the skin. We have used the potential of mean constraint force (PMCF) method to calculate the free energy of pore formation in ceramide bilayers in both the innate gel pha...

Increased skin barrier disruption by sodium lauryl sulfate in mice expressing a constitutively active STAT6 in T cells.

Science.gov (United States)

DaSilva, Sonia C; Sahu, Ravi P; Konger, Raymond L; Perkins, Susan M; Kaplan, Mark H; Travers, Jeffrey B

2012-01-01

Atopic dermatitis (AD) is a pruritic, chronic inflammatory skin disease that affects 10-20% of children and 1-3% of adults worldwide. Recent studies have indicated that the ability of Th2 cytokines, such as interleukin-4 (IL-4) to regulate skin barrier function may be a predisposing factor for AD development. The present studies examined the ability of increased Th2 activity to affect cutaneous barrier function in vivo and epidermal thickening. Mice that express a constitutively active Signal Transducer and Activator of Transcription 6 (STAT6VT) have increased Th2 cells and a predisposition to allergic inflammation were used in these studies, they demonstrate that topical treatment with the irritant sodium lauryl sulfate (SLS) caused increased transepidermal water loss and epidermal thickening in STAT6VT mice over similarly treated wild-type mice. The proliferation marker Ki-67 was increased in the epidermis of STAT6VT compared to the wild-type mice. However, these differences do not appear to be linked to the addition of an irritant as control-treated STAT6VT skin also exhibited elevated Ki-67 levels, suggesting that the increased epidermal thickness in SLS-treated STAT6VT mice is primarily driven by epidermal cell hypertrophy rather than an increase in cellular proliferation. Our results suggest that an environment with increased Th2 cytokines results in abnormal responses to topical irritants.

Effect of lethal and sub-lethal concentrations of tobacco (Nicotiana ...

African Journals Online (AJOL)

Lethal and sub-lethal bioassays on Clarias gariepinus were conducted to evaluate the toxicity of tobacco (Nicotiana tobaccum) leaf dust on weight gain and haematological indices of Clarias gariepinus (mean weight 10.5±0.70g) in glass aquaria with aeration system. The concentrations used during the lethal exposure are: ...

From microscopic to macroscopic dynamics in mean-field theory: effect of neutron skin on fusion barrier and dissipation

Energy Technology Data Exchange (ETDEWEB)

Lacroix, D

2001-07-01

In this work, we introduce a method to reduce the microscopic mean-field theory to a classical macroscopic dynamics at the initial stage of fusion reaction. We show that TDHF (Time-dependent Hartree-Fock) could be a useful tool to infer information on the fusion barrier as well as on one-body dissipation effect. We apply the reduction of information to the case of head-on reaction between a {sup 16}O and {sup 16,22,24,28}O in order to quantify the effect of neutron skin on fusion. We show that the precise determination of fusion barrier requires, in addition to the relative distance between center of mass, the introduction of an additional collective coordinate that explicitly breaks the neutron-proton symmetry. With this additional collective variable, we obtain a rather precise determination of the barrier position, height and diffuseness as well as one-body friction. (author)

Development of a stratum corneum substitute for in vitro percutaneous penetration studies : a skin barrier model comprising synthetic stratum corneum lipids

NARCIS (Netherlands)

Jager, Miranda Wilhelmina de

2006-01-01

The research outlined in this thesis was focused on the development of a skin barrier model, which can substitute for stratum corneum in diffusion studies. This so-called stratum corneum substitute (SCS) was prepared with reconstituted SC lipids (cholesterol, free fatty acids and ceramides) on a

Comparison of the lethal effects of chemical warfare nerve agents across multiple ages.

Science.gov (United States)

Wright, Linnzi K M; Lee, Robyn B; Vincelli, Nicole M; Whalley, Christopher E; Lumley, Lucille A

2016-01-22

Children may be inherently more vulnerable than adults to the lethal effects associated with chemical warfare nerve agent (CWNA) exposure because of their closer proximity to the ground, smaller body mass, higher respiratory rate, increased skin permeability and immature metabolic systems. Unfortunately, there have only been a handful of studies on the effects of CWNA in pediatric animal models, and more research is needed to confirm this hypothesis. Using a stagewise, adaptive dose design, we estimated the 24h median lethal dose for subcutaneous exposure to seven CWNA in both male and female Sprague-Dawley rats at six different developmental times. Perinatal (postnatal day [PND] 7, 14 and 21) and adult (PND 70) rats were more susceptible than pubertal (PND 28 and 42) rats to the lethal effects associated with exposure to tabun, sarin, soman and cyclosarin. Age-related differences in susceptibility were not observed in rats exposed to VM, Russian VX or VX. Published by Elsevier Ireland Ltd.

Lethality Index 2008-2014: Less shootings, same lethality, more opacity

Directory of Open Access Journals (Sweden)

Carlos Silva Forné

2017-11-01

Full Text Available This article evaluates the use of lethal force by Mexican federal security forces during shootings with presumed members of organized crime from 2008-2014. The authors use official data and press reports on deaths and wounded in shootings to construct indicators such as the number of dead civilians over the number of dead officials from the federal security forces and the number of dead civilians over the number of wounded civilians. In a context where certain factors that contribute to an excessive use of force become more common, the results of the study show a growing use of lethal force. This raises questions over the possible excessive use of lethal force as a normal or systematic practice. The study also shows a growing context of opacity in the information available to evaluate the use of lethal force and the general lack of a legal framework to regulate the use of lethal force in Mexico.

A plant oil-containing pH 4 emulsion improves epidermal barrier structure and enhances ceramide levels in aged skin.

Science.gov (United States)

Blaak, J; Dähnhardt, D; Dähnhardt-Pfeiffer, S; Bielfeldt, S; Wilhelm, K-P; Wohlfart, R; Staib, P

2017-06-01

Xerosis is a serious problem among the very old. It is a dermatological challenge caused by significant alterations in stratum corneum (SC) function and structure. Two negative changes in aged skin are (i) the enhanced skin surface pH and (ii) the altered SC lipid content, composition and ordering. Therefore, we investigated the way in which an acidic skin care product with different plant oils affects SC function, structure and lipid profile in older subjects with dry skin. Before and after a 3-week application period, different biophysical measurements were performed: transepidermal water loss, SC hydration and skin surface pH. In addition, the SC lipid matrix was evaluated by analysis of the intercellular lipid lamellae and the SC lipid profile. After treatment, a significant increase in lipid lamellae in the intercellular space of the SC was observed in the area treated with the test product compared to the untreated area. Furthermore, the ceramide level was found to be increased, although ceramides were not provided by the acidic test formulation. In summary, topical application of a pH 4.0 product containing plant oils improves epidermal barrier formation and SC lipid ordering and ratio in aged dry skin. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Sub-Lethal Dose of Shiga toxin 2 from Enterohemorrhagic Escherichia coli Affects Balance and Cerebellar Cythoarquitecture.

Directory of Open Access Journals (Sweden)

Luciana eD’Alessio

2016-02-01

Full Text Available Shiga toxin producing Escherichia coli may damage the central nervous system before or concomitantly to manifested hemolytic uremic syndrome symptoms. The cerebellum is frequently damaged during this syndrome, however the deleterious effects of Shiga toxin 2 has never been integrally reported by ultrastructural, physiological and behavioral means. The aim of this study was to determine the cerebellar compromise after intravenous administration of a sub-lethal dose of Shiga toxin 2 by measuring the cerebellar blood brain barrier permeability, behavioral task of cerebellar functionality (inclined plane test, and ultrastructural analysis (transmission electron microscope. Intravenous administration of vehicle (control group, sub-lethal dose of 0.5 ηg and 1 ηg of Stx2 per mouse were tested for behavioral and ultrastructural studies. A set of three independent experiments were performed for each study (n=6. Blood–Brain Barrier resulted damaged and consequently its permeability was significantly increased. Lower scores obtained in the inclined plane task denoted poor cerebellar functionality in comparison to their controls. The most significant lower score was obtained after 5 days of 1ηg of toxin administration. Transmission electron microscope micrographs from the Stx2-treated groups showed neurons with a progressive neurodegenerative condition in a dose dependent manner. As sub-lethal intravenous Shiga toxin 2 altered the blood brain barrier permeability in the cerebellum the toxin penetrated the cerebellar parenchyma and produced cell damaged with significant functional implications in the test balance.

Stratum corneum damage and ex vivo porcine skin water absorption - a pilot study

DEFF Research Database (Denmark)

Duch Lynggaard, C; Bang Knudsen, D; Jemec, G B E

2009-01-01

A simple ex vivo screening technique would be of interest for mass screening of substances for potential barrier disruptive qualities. Ex vivo water absorption as a marker of skin barrier integrity was studied on pig ear skin. Skin water absorption was quantified by weighing and weight changes were...... found to reflect prehydration barrier damage. It is suggested that this simple model may be elaborated to provide a rapid, economical screening tool for potential skin irritants....

Skin moisturization mechanisms: new data.

Science.gov (United States)

Bonté, F

2011-05-01

The main function of the skin is to protect the body against exogenous substances and excessive water loss. The skin barrier is located in the outermost layer of the skin, called the stratum corneum, which is composed of corneocytes, originating from the keratinocytes differentiation process, embedded in organized complex lipid domains. Moisturizing of the skin is recognized as the first anti-aging skin care. Skin moisturization is essential for its appearance, protection, complexion, softness and the reinforcement of its barrier properties against deleterious and exogenous environmental factors. The intrinsic water binding capacity of skin is not only due to the complex natural moisturizing factor present in corneocytes, but also to hyaluronic acid and a regulated water transport within the skin. Recent data shows that the water movements between the cells at the different levels of the epidermis are due to dedicated water and glycerol transport proteins named aquaporins. Their role in the skin moisturization is completed by corneodesmosomes and tight junctions. Water and pH are now shown to be of prime importance in the regulation of the epidermal enzymes linked to corneocytes desquamation and lipid synthesis. Furthermore, the level of moisturization of the skin is important in its protection against repeated exposure to various irritant agents or phenomena such as very frequent washing with strong tensioactive materials. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Heavy Cigarette Smokers in a Chinese Population Display a Compromised Permeability Barrier

Science.gov (United States)

Xin, Shujun; Ye, Li; Lv, Chengzhi; Elias, Peter M.

2016-01-01

Cigarette smoking is associated with various cutaneous disorders with defective permeability. Yet, whether cigarette smoking influences epidermal permeability barrier function is largely unknown. Here, we measured skin biophysical properties, including permeability barrier homeostasis, stratum corneum (SC) integrity, SC hydration, skin surface pH, and skin melanin/erythema index, in cigarette smokers. A total of 99 male volunteers were enrolled in this study. Smokers were categorized as light-to-moderate (hydration and skin melanin/erythema index on the dorsal hand, forehead, and cheek. Basal transepidermal water loss (TEWL) and barrier recovery rates were assessed on the forearm. A Skin-pH-Meter pH900 was used to measure skin surface pH. Our results showed that heavy cigarette smokers exhibited delayed barrier recovery after acute abrogation (1.02% ± 13.06 versus 16.48% ± 6.07), and barrier recovery rates correlated negatively with the number of daily cigarettes consumption (p = 0.0087). Changes in biophysical parameters in cigarette smokers varied with body sites. In conclusion, heavy cigarette smokers display compromised permeability barrier homeostasis, which could contribute, in part, to the increased prevalence of certain cutaneous disorders characterized by defective permeability. Thus, improving epidermal permeability barrier should be considered for heavy cigarette smokers. PMID:27437403

No Sting Barrier Film to Protect Skin in Adult Patients: Findings From a Scoping Review With Implications for Evidence-Based Practice.

Science.gov (United States)

Micheli, Chiara; Palese, Alvisa; Canzan, Federica; Ambrosi, Elisa

2017-10-01

In the industrialized world, approximately 1-1.5% of the population has received treatments for skin lesions. In the 1990s, a polymeric barrier film called the No Sting Barrier Film (NSBF) was developed as an alternative to petrolatum-based ointments and zinc oxide formulas. To date, few studies have explored the effectiveness of NSBF in protecting skin integrity. To map the methods, fields and outcomes used to produce evidence on NSBF effectiveness. A scoping review was performed in 2015. A search strategy for identifying relevant studies was designed and performed. Systematic reviews, meta-analyses, randomized controlled trials, controlled clinical trials, and comparative studies for all types of interventions were included; research conducted in any clinical context was eligible for inclusion. Studies were selected by two reviewers; data extraction and analysis also was performed by two reviewers and disagreements were discussed. Six studies were included. NSBF's potential as a skin protector was investigated with respect to (a) chronic wounds (pressure ulcers or vascular leg ulcers); (b) urinary or fecal incontinence; and (c) post-mastectomy irradiation. The principal clinical outcomes investigated were, respectively: (a) wound healing, wound exudates and erythema control; (b) incidence of incontinence-associated dermatitis and skin reactions; and (c) intensity of pruritus and skin reactions. Pain and comfort were measured in all clinical applications. The main process outcomes investigated were: (a) ease of application, (b) application and removal time, and (c) costs. Zinc oxide and petroleum formulations were the most common comparison interventions in research on chronic ulcers and incontinence; sorbolene cream and topical corticosteroids were the most frequent comparisons in the context of post-mastectomy irradiation. NBSF may be used for peri-wound skin protection in patients with chronic wounds, with urinary or fecal incontinence and for women undergoing

Oily skin: an overview.

Science.gov (United States)

Sakuma, Thais H; Maibach, Howard I

2012-01-01

Oily skin (seborrhea) is a common cosmetic problem that occurs when oversized sebaceous glands produce excessive amounts of sebum giving the appearance of shiny and greasy skin. This paper overviews the main concepts of sebaceous gland anatomy and physiology, including the biosynthesis, storage and release of sebum, as well as its relationship to skin hydration and water barrier function. We also address how skin oiliness may vary according to diet, age, gender, ethnicity and hot humid climates. The deeper understanding of this skin type provides the opportunity to better guide patients regarding skin care and also assist in the development of sebosuppressive agents. Copyright © 2012 S. Karger AG, Basel.

The important role of stratum corneum lipids for the cutaneous barrier function.

Science.gov (United States)

van Smeden, J; Janssens, M; Gooris, G S; Bouwstra, J A

2014-03-01

The skin protects the body from unwanted influences from the environment as well as excessive water loss. The barrier function of the skin is located in the stratum corneum (SC). The SC consists of corneocytes embedded in a lipid matrix. This lipid matrix is crucial for the lipid skin barrier function. This paper provides an overview of the reported SC lipid composition and organization mainly focusing on healthy and diseased human skin. In addition, an overview is provided on the data describing the relation between lipid modulations and the impaired skin barrier function. Finally, the use of in vitro lipid models for a better understanding of the relation between the lipid composition, lipid organization and skin lipid barrier is discussed. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. This article is part of a Special Issue entitled The Important Role of Lipids in the Epidermis and their Role in the Formation and Maintenance of the Cutaneous Barrier. Guest Editors: Kenneth R. Feingold and Peter Elias. Copyright © 2013 Elsevier B.V. All rights reserved.

The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier.

Science.gov (United States)

Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

2017-01-01

The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier.

The pH of the main Brazilian commercial moisturizers and liquid soaps: considerations on the repair of the skin barrier*

Science.gov (United States)

Gonçalves, Giovana M; Brianezi, Gabrielli; Miot, Hélio Amante

2017-01-01

The pH of the skin is slightly acidic (4.6 to 5.8) which is important for appropriate antibacterial, antifungal, constitution of barrier function, as well as structuring and maturation of the stratum corneum. This study aimed to evaluate the pH of the main commercial moisturizers and liquid soaps in Brazil. Thus, pH of the products was quantified by pH meter in three measurements. A total of 38 moisturizers and six commercial liquid soaps were evaluated. Mean pH of 63% and 50% of the moisturizing and liquid soaps presented results above 5.5, disfavoring repair, function, and synthesis of dermal barrier. PMID:29166523

Structure and Function of Your Skin

Science.gov (United States)

... Name: Category: Share: Yes No, Keep Private Structure & Function of Your Skin Share | What It Looks Like . . . ... in the dermis. What It Does . . . The major function of skin is to provide a barrier between ...

EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to flaxseed oil and vitamin E and maintenance of the skin permeability barrier function pursuant to Article 13(5) of Regulation (EC) No 1924/2006

DEFF Research Database (Denmark)

Tetens, Inge

related to a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function. The food constituent that is the subject of the health claim is a combination of flaxseed oil and vitamin E. The Panel considers that the combination of flaxseed oil and vitamin E...... be drawn from these studies for the scientific substantiation of the claim. The Panel concludes that a cause and effect relationship has not been established between the consumption of a combination of flaxseed oil and vitamin E and maintenance of the skin permeability barrier function...... is sufficiently characterised. The claimed effect is “contributes to maintain skin permeability barrier function”. The target population proposed by the applicant is healthy adults with dry and sensitive skin. Maintenance of the permeability barrier function of the skin is a beneficial physiological effect...

Electrochemical monitoring of native catalase activity in skin using skin covered oxygen electrode.

Science.gov (United States)

Nocchi, Sarah; Björklund, Sebastian; Svensson, Birgitta; Engblom, Johan; Ruzgas, Tautgirdas

2017-07-15

A skin covered oxygen electrode, SCOE, was constructed with the aim to study the enzyme catalase, which is part of the biological antioxidative system present in skin. The electrode was exposed to different concentrations of H 2 O 2 and the amperometric current response was recorded. The observed current is due to H 2 O 2 penetration through the outermost skin barrier (referred to as the stratum corneum, SC) and subsequent catalytic generation of O 2 by catalase present in the underlying viable epidermis and dermis. By tape-stripping the outermost skin layers we demonstrate that SC is a considerable diffusion barrier for H 2 O 2 penetration. Our experiments also indicate that skin contains a substantial amount of catalase, which is sufficient to detoxify H 2 O 2 that reaches the viable epidermis after exposure of skin to high concentrations of peroxide (0.5-1mM H 2 O 2 ). Further, we demonstrate that the catalase activity is reduced at acidic pH, as compared with the activity at pH 7.4. Finally, experiments with often used penetration enhancer thymol shows that this compound interferes with the catalase reaction. Health aspect of this is briefly discussed. Summarizing, the results of this work show that the SCOE can be utilized to study a broad spectrum of issues involving the function of skin catalase in particular, and the native biological antioxidative system in skin in general. Copyright © 2017 Elsevier B.V. All rights reserved.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Gentle cleansing and moisturizing for patients with atopic dermatitis and sensitive skin.

Science.gov (United States)

Cheong, Wai Kwong

2009-01-01

Atopic dermatitis is a common condition characterized by pruritus, inflammation, and dryness of the skin. Inflammation disrupts the barrier function of the stratum corneum, predisposing the skin to be dry, and increases susceptibility to irritants and secondary bacterial infection. Sensitive skin is common, reported by 40-50% of women and 30% of men in the US, Europe, and Japan. Basic requirements in managing eczema and sensitive skin include effective cleansers that do not compromise skin barrier integrity, alleviation of skin dryness, and restoration of skin barrier function through the use of therapeutic moisturizers. The selection of a skin cleanser is therefore an important part of managing these conditions. Studies have reported clinical improvement with the use of soap-free cleansers in combination with topical treatments. While topical corticosteroids and immunosuppressive agents are mainstays of treatment for atopic dermatitis, therapeutic moisturizers are important adjuncts. Moisturizers improve skin hydration, reduce susceptibility to irritation, restore the integrity of the stratum corneum, and enhance the efficacy of topical corticosteroids.

Skin barrier disruption by sodium lauryl sulfate-exposure alters the expressions of involucrin, transglutaminase 1, profilaggrin, and kallikreins during the repair phase in human skin in vivo.

Science.gov (United States)

Törmä, Hans; Lindberg, Magnus; Berne, Berit

2008-05-01

Detergents are skin irritants affecting keratinocytes. In this study, healthy volunteers were exposed to water (vehicle) and 1% sodium lauryl sulfate (SLS) under occlusive patch tests for 24 hours. The messenger RNA (mRNA) expression of keratinocyte differentiation markers and of enzymes involved in corneodesmosome degradation was examined in skin biopsies (n=8) during the repair phase (6 hours to 7 days postexposure) using real-time reverse-transcription PCR. It was found that the expression of involucrin was increased at 6 hours, but then rapidly normalized. The expression of transglutaminase 1 exhibited a twofold increase after 24 hours in the SLS-exposed skin. Profilaggrin was decreased after 6 hours. Later (4-7 days), the expression in SLS-exposed areas was >50% above than in control areas. An increased and altered immunofluorescence pattern of involucrin, transglutaminase 1, and filaggrin was also found (n=4). At 6 hours post-SLS exposure, the mRNA expression of kallikrein-7 (KLK-7) and kallikrein-5 (KLK-5) was decreased by 50 and 75%, respectively, as compared with control and water-exposed areas. Thereafter, the expression pattern of KLK-7 and KLK-5 was normalized. Changes in protein expression of KLK-5 were also found. In conclusion, SLS-induced skin barrier defects induce altered mRNA expression of keratinocyte differentiation markers and enzymes degrading corneodesmosomes.

Histopathological effects of lethal and sub-lethal concentrations of ...

African Journals Online (AJOL)

The histopathological effects of lethal and sub-lethal concentrations of glyphosate on African catfish Clarias gariepinus were investigated. C. gariepinus juveniles were assessed in a static renewal bioassay for 96 hours (acute toxicity) and 28 days (chronic toxicity) using varying concentrations (0.0 mg/l 20.0 mg/l, 30.0 mg/l, ...

Supplementation with Eskimo Skin Care improves skin elasticity in women. A pilot study.

Science.gov (United States)

Segger, Dörte; Matthies, Andreas; Saldeen, Tom

2008-01-01

To investigate the question of whether supplementation with an oral oil formulation rich in natural stable fish oil can alter skin elasticity, transepidermal water loss (TEWL), and skin roughness in healthy women. Twenty-four healthy women aged 40-60 years participated in a single-blind randomized trial for testing the effect of a proprietary oral supplement for skin nutrition (Eskimo Skin Care) on skin elasticity, TEWL, and skin roughness. Skin elasticity was measured by an optical cutometer, TEWL by a water-loss module based upon the vapour gradient principle, and skin roughness with a three-dimensional microtopography imaging system. Skin elasticity increased by 10% after 3 months of treatment with the supplement, a statistically significant increase in comparison with the control group (p=0.0298). There was a trend, though not statistically significant, towards a positive influence on the skin's barrier function. No effect on the skin roughness was observed. Eskimo Skin Care, an oral preparation rich in natural stable fish oil, can improve skin elasticity.

Personnel decontamination and preventive skin care

International Nuclear Information System (INIS)

Henning, Klaus; Gojowczyk, Peter

2010-01-01

Skin contamination arises from contact with contaminated aqueous solutions and from transmission of radioactively contaminated dirt particles. As long as the surface of the skin is neither inflamed nor showing any lesions, normally only a limited part of the top layer (epidermis), i.e. the upper layers of the stratum corneum, is contaminated. The intact horny layer has a barrier function protecting against the penetration of chemicals and dirt particles. The horny layer can be damaged by water, solvents, alkaline substances, and acids. In general, it is safe to say that the horny layer acts as a natural barrier to the penetration of liquid and particulate impurities into lower layers of the skin. As long as the horny layer is intact and free from lesions, the risk of incorporation can be considered low. When decontaminating and cleansing the skin, also in daily skin cleansing, care must be taken to prevent the acid protective layer and the horny layer from being compromised. Daily cleansing and cleansing for decontamination must be carried out with a mild, weakly acidic detergent. In addition, prevention should be achieved daily by applying a non-greasy skin lotion to protect the skin. Following a systematic regular regimen in skin cleansing and preventive skin care as well as a specific approach in skin decontamination and cleansing will avoid damage to the skin and remove any contamination incurred. This approach comprises a three-pronged concept, namely skin protection, cleansing and care. (orig.)

Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin.

Science.gov (United States)

Rojo de la Vega, Montserrat; Krajisnik, Andrea; Zhang, Donna D; Wondrak, Georg T

2017-12-18

The transcription factor NRF2 (nuclear factor-E2-related factor 2) orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet) radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA)-approved natural food colorant (referred to as 'annatto') originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i) bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii) systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii) bixin-induced suppression of photodamage is observable in Nrf2 +/+ but not in Nrf2 -/- SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor) α/γ agonist, and TLR (Toll-like receptor) 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells) antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

Targeting NRF2 for Improved Skin Barrier Function and Photoprotection: Focus on the Achiote-Derived Apocarotenoid Bixin

Directory of Open Access Journals (Sweden)

Montserrat Rojo de la Vega

2017-12-01

Full Text Available The transcription factor NRF2 (nuclear factor-E2-related factor 2 orchestrates major cellular defense mechanisms including phase-II detoxification, inflammatory signaling, DNA repair, and antioxidant response. Recent studies strongly suggest a protective role of NRF2-mediated gene expression in the suppression of cutaneous photodamage induced by solar UV (ultraviolet radiation. The apocarotenoid bixin, a Food and Drug Administration (FDA-approved natural food colorant (referred to as ‘annatto’ originates from the seeds of the achiote tree native to tropical America, consumed by humans since ancient times. Use of achiote preparations for skin protection against environmental insult and for enhanced wound healing has long been documented. We have recently reported that (i bixin is a potent canonical activator of the NRF2-dependent cytoprotective response in human skin keratinocytes; that (ii systemic administration of bixin activates NRF2 with protective effects against solar UV-induced skin damage; and that (iii bixin-induced suppression of photodamage is observable in Nrf2+/+ but not in Nrf2−/− SKH-1 mice confirming the NRF2-dependence of bixin-induced antioxidant and anti-inflammatory effects. In addition, bixin displays molecular activities as sacrificial antioxidant, excited state quencher, PPAR (peroxisome proliferator-activated receptor α/γ agonist, and TLR (Toll-like receptor 4/NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells antagonist, all of which might be relevant to the enhancement of skin barrier function and environmental stress protection. Potential skin photoprotection and photochemoprevention benefits provided by topical application or dietary consumption of this ethno-pharmacologically validated phytochemical originating from the Americas deserves further preclinical and clinical examination.

Protecting the radiation-damaged skin from friction: a mini review

International Nuclear Information System (INIS)

Herst, Patries M

2014-01-01

Radiation-induced skin reactions are an unavoidable side effect of external beam radiation therapy, particularly in areas prone to friction and excess moisture such as the axilla, head and neck region, perineum and skin folds. Clinical studies investigating interventions for preventing or managing these reactions have largely focussed on formulations with moisturising, anti-inflammatory, anti-microbial and wound healing properties. However, none of these interventions has emerged as a consistent candidate for best practice. Much less emphasis has been placed on evaluating ways to protect the radiation-damaged skin from friction and excess moisture. This mini review analyses the clinical evidence for barrier products that form a protective layer by adhering very closely to the skin folds and do not cause further trauma to the radiation-damaged skin upon removal. A database search identified only two types of barrier products that fitted these criteria and these were tested in two case series and six controlled clinical trials. Friction protection was most effective when the interventions were used from the start of treatment and continued for several weeks after completion of treatment. Soft silicone dressings (Mepilex Lite and Mepitel Film) and Cavilon No Sting Barrier Film, but not Cavilon Moisturizing Barrier Cream, decreased skin reaction severity, most likely due to differences in formulation and skin build-up properties. It seems that prophylactic use of friction protection of areas at risk could be a worthwhile addition to routine care of radiation-damaged skin

Efficacy of IPL device combined with intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with regards to the recovery of skin barrier function: A pilot study.

Science.gov (United States)

Kim, Dong Young; Park, Hyun Sun; Yoon, Hyun-Sun; Cho, Soyun

2015-10-01

Keloids and hypertrophic scars are prevalent and psychologically distressful dermatologic conditions. Various treatment modalities have been tried but without complete success by any one method. We evaluated the efficacy of a combination of intense pulsed light (IPL) device and intralesional corticosteroid injection for the treatment of keloids and hypertrophic scars with respect to the recovery of skin barrier function. Totally 52 Korean patients were treated by the combined treatment at 4-8-week intervals. Using digital photographs, changes in scar appearance were assessed with modified Vancouver Scar Scale (MVSS), physicians' global assessment (PGA) and patient's satisfaction score. In 12 patients, the stratum corneum (SC) barrier function was assessed by measuring transepidermal water loss (TEWL) and SC capacitance. Most scars demonstrated significant clinical improvement in MVSS, PGA and patient's satisfaction score after the combined therapy. A significant decrease of TEWL and elevation of SC capacitance were also documented after the treatment. The combination therapy (IPL + corticosteroid injection) not only improves the appearance of keloids and hypertrophic scars but also increases the recovery level of skin hydration status in terms of the skin barrier function.

Formation of a protection film on the human skin by microparticles

International Nuclear Information System (INIS)

Lademann, J; Schanzer, S; Richter, H; Knorr, F; Sterry, W; Patzelt, A; Antoniou, C

2008-01-01

Laser scanning microscopy and tape stripping, in combination with optical methods, were used to analyze the distribution and penetration of a barrier cream into the horny layer (stratum corneum) of the human skin under in vivo conditions. The barrier cream contained microparticles of 10 – 100 μm loaded with antioxidant substances. The cream was designed for protection of the skin surface against the destructive action of free radicals, produced by systemically applied chemotherapeutic agents reaching the skin surface via the sweat. Both methods were able to demonstrate that the barrier cream was distributed homogeneously on the skin surface forming a protection film. A penetration into deeper parts of the stratum corneum (SC) was not observed

Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes.

Science.gov (United States)

Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan

2015-03-01

The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing.

Comparison of structure and organization of cutaneous lipids in a reconstructed skin model and human skin: spectroscopic imaging and chromatographic profiling.

Science.gov (United States)

Tfayli, Ali; Bonnier, Franck; Farhane, Zeineb; Libong, Danielle; Byrne, Hugh J; Baillet-Guffroy, Arlette

2014-06-01

The use of animals for scientific research is increasingly restricted by legislation, increasing the demand for human skin models. These constructs present comparable bulk lipid content to human skin. However, their permeability is significantly higher, limiting their applicability as models of barrier function, although the molecular origins of this reduced barrier function remain unclear. This study analyses the stratum corneum (SC) of one such commercially available reconstructed skin model (RSM) compared with human SC by spectroscopic imaging and chromatographic profiling. Total lipid composition was compared by chromatographic analysis (HPLC). Raman spectroscopy was used to evaluate the conformational order, lateral packing and distribution of lipids in the surface and skin/RSM sections. Although HPLC indicates that all SC lipid classes are present, significant differences are observed in ceramide profiles. Raman imaging demonstrated that the RSM lipids are distributed in a non-continuous matrix, providing a better understanding of the limited barrier function. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rheological and sensory properties of hydrophilic skin protection gels based on polyacrylates.

Science.gov (United States)

Kulawik-Pióro, Agnieszka; Kurpiewska, Joanna; Kułaszka, Agnieszka

2018-03-01

With the current increases in occupational skin diseases, literature data attesting the decreasing efficiency of barrier creams with respect to the manufacturer's declarations and legal regulations granting skin protection gels for employees, research is required to analyse and evaluate the recipes used for hydrophilic skin protection gels based on polyacrylates. This study investigated the rheological properties, pH and sensory perception of hydrophilic barrier gels based on polyacrylates. The acrylic acid derivatives used were good thickeners, and helped to form transparent gels of adequate durability. They could be used to create hydrophilic films on the surface of the skin to protect it against hydrophobic substances. A correlation was shown between the results of the rheological properties and the barrier properties of the gels. This confirms the possibility of monitoring the quality of the gels at the stage of recipe development. Polyacrylates are viable for use in industry to produce hydrophilic barrier creams suitable for skin protection.

Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

Energy Technology Data Exchange (ETDEWEB)

Xia, Xiaojun [The Methodist Hospital Research Institute, Houston, TX 77030 (United States); Park, Eunmi [Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Fischer, Susan M. [Department of Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Smithville, TX 78967 (United States); Hu, Yinling, E-mail: huy2@mail.nih.gov [Cancer and Inflammation Program, Center for Cancer Research, Frederick National Laboratory for Cancer Research, Frederick, MD 21701 (United States)

2013-02-15

Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside.

Mouse Genetic Models Reveal Surprising Functions of IκB Kinase Alpha in Skin Development and Skin Carcinogenesis

International Nuclear Information System (INIS)

Xia, Xiaojun; Park, Eunmi; Fischer, Susan M.; Hu, Yinling

2013-01-01

Gene knockout studies unexpectedly reveal a pivotal role for IκB kinase alpha (IKKα) in mouse embryonic skin development. Skin carcinogenesis experiments show that Ikkα heterozygous mice are highly susceptible to chemical carcinogen or ultraviolet B light (UVB) induced benign and malignant skin tumors in comparison to wild-type mice. IKKα deletion mediated by keratin 5 (K5).Cre or K15.Cre in keratinocytes induces epidermal hyperplasia and spontaneous skin squamous cell carcinomas (SCCs) in Ikkα floxed mice. On the other hand, transgenic mice overexpressing IKKα in the epidermis, under the control of a truncated loricrin promoter or K5 promoter, develop normal skin and show no defects in the formation of the epidermis and other epithelial organs, and the transgenic IKKα represses chemical carcinogen or UVB induced skin carcinogenesis. Moreover, IKKα deletion mediated by a mutation, which generates a stop codon in the Ikkα gene, has been reported in a human autosomal recessive lethal syndrome. Downregulated IKKα and Ikkα mutations and deletions are found in human skin SCCs. The collective evidence not only highlights the importance of IKKα in skin development, maintaining skin homeostasis, and preventing skin carcinogenesis, but also demonstrates that mouse models are extremely valuable tools for revealing the mechanisms underlying these biological events, leading our studies from bench side to bedside

Theories of Lethal Mutagenesis: From Error Catastrophe to Lethal Defection.

Science.gov (United States)

Tejero, Héctor; Montero, Francisco; Nuño, Juan Carlos

2016-01-01

RNA viruses get extinct in a process called lethal mutagenesis when subjected to an increase in their mutation rate, for instance, by the action of mutagenic drugs. Several approaches have been proposed to understand this phenomenon. The extinction of RNA viruses by increased mutational pressure was inspired by the concept of the error threshold. The now classic quasispecies model predicts the existence of a limit to the mutation rate beyond which the genetic information of the wild type could not be efficiently transmitted to the next generation. This limit was called the error threshold, and for mutation rates larger than this threshold, the quasispecies was said to enter into error catastrophe. This transition has been assumed to foster the extinction of the whole population. Alternative explanations of lethal mutagenesis have been proposed recently. In the first place, a distinction is made between the error threshold and the extinction threshold, the mutation rate beyond which a population gets extinct. Extinction is explained from the effect the mutation rate has, throughout the mutational load, on the reproductive ability of the whole population. Secondly, lethal defection takes also into account the effect of interactions within mutant spectra, which have been shown to be determinant for the understanding the extinction of RNA virus due to an augmented mutational pressure. Nonetheless, some relevant issues concerning lethal mutagenesis are not completely understood yet, as so survival of the flattest, i.e. the development of resistance to lethal mutagenesis by evolving towards mutationally more robust regions of sequence space, or sublethal mutagenesis, i.e., the increase of the mutation rate below the extinction threshold which may boost the adaptability of RNA virus, increasing their ability to develop resistance to drugs (including mutagens). A better design of antiviral therapies will still require an improvement of our knowledge about lethal

Facial skin care products and cosmetics.

Science.gov (United States)

Draelos, Zoe Diana

2014-01-01

Facial skin care products and cosmetics can both aid or incite facial dermatoses. Properly selected skin care can create an environment for barrier repair aiding in the re-establishment of a healing biofilm and diminution of facial redness; however, skin care products that aggressively remove intercellular lipids or cause irritation must be eliminated before the red face will resolve. Cosmetics are an additive variable either aiding or challenging facial skin health. Copyright © 2014 Elsevier Inc. All rights reserved.

Loss of Corneodesmosin Leads to Severe Skin Barrier Defect, Pruritus, and Atopy: Unraveling the Peeling Skin Disease

OpenAIRE

Oji, Vinzenz; Eckl, Katja-Martina; Aufenvenne, Karin; Nätebus, Marc; Tarinski, Tatjana; Ackermann, Katharina; Seller, Natalia; Metze, Dieter; Nürnberg, Gudrun; Fölster-Holst, Regina; Schäfer-Korting, Monika; Hausser, Ingrid; Traupe, Heiko; Hennies, Hans Christian

2010-01-01

Generalized peeling skin disease is an autosomal-recessive ichthyosiform erythroderma characterized by lifelong patchy peeling of the skin. After genome-wide linkage analysis, we have identified a homozygous nonsense mutation in CDSN in a large consanguineous family with generalized peeling skin, pruritus, and food allergies, which leads to a complete loss of corneodesmosin. In contrast to hypotrichosis simplex, which can be associated with specific dominant CDSN mutations, peeling skin disea...

Managing Occupational Irritant Contact Dermatitis Using a Two-Step Skincare Regimen Designed to Prevent Skin Damage and Support Skin Recovery.

Science.gov (United States)

von Grote, Erika C; Palaniswarmy, Kiruthi; Meckfessel, Matthew H

2016-12-01

Occupational irritant contact dermatitis (ICD) affecting the hands is a common and difficult-to-manage condition. Occupations that necessitate contact with harsh chemicals, use of alcohol-based disinfectants, and frequent hand washing elevate the risk of ICD. Management strategies that do not adequately prevent accumulated damage and repair skin, can develop into chronic dermatoses which negatively impact work productivity and quality of life. A 2-step skin-care regimen (Excipial Daily Protection Hand Cream (EP) and Excipial Rapid Repair Hand Cream (ER), Galderma Laboratories, L.P.) has been developed as a daily-use management strategy to protect and repair vulnerable hands. The protective barrier cream is formulated with aluminum chlorohydrate and designed for pre-exposure application to enhance the skin's natural protective barrier and minimize excessive moisture while wearing protective gloves. The repair cream, a lipid-rich formulation, is intended for post-exposure application to rehydrate and facilitate the skin's natural healing process. The results of 3 clinical studies highlighted in this review demonstrate how the use of a 2-step skin-care regimen offers a greater protective effect against ICD than the use of barrier cream alone, and also how the formulation of the barrier cream used in these studies helps minimize the occlusion effect caused by gloves and does not interfere with the antibacterial efficacy of an alcohol-based hand sanitizer. This 2-step skin-care regimen is effectively designed to manage and minimize the risk of ICD development in a variety of patients and provides clinicians an additional tool for helping patients manage ICD. J Drugs Dermatol. 2016;15(12):1504-1510.

SKIN CARE IN INFANTS

Directory of Open Access Journals (Sweden)

I. N. Zakharova

2014-01-01

Full Text Available Human skin is a complex organ in its structure. Numerous functions of the skin may be impaired in its pathology. Anatomical and physiological characteristics of the skin in children predispose to common diseases of the skin. Diaper dermatitis is one of the most common skin diseases during infancy and childhood. Diapered skin is exposed to friction and excessive hydration, has a higher pH than nondiapered skin, and is repeatedly soiled with feces that contains enzymes with high irritation potential for the skin. Diaper dermatitis may vary in clinical severity and course. Therapeutically, frequent diaper changes and adequate skin care are most important. Appropriate skin care can help to prevent the occurrence of diaper dermatitis and to speed up the healing of affected skin. This includes frequent diaper changes and aeration, gentle cleansing, and the use of a barrier cream. For the treatment of diaper dermatitis agents selected depending on the presence and severity of complications. For prevention and treatment of uncomplicated diaper dermatitis effective means of containing dexpantenol.

Cell survival curves deduced from non-quantitative reactions of skin, intestinal mucosa and lung

International Nuclear Information System (INIS)

Dutreix, J.; Wambersie, A.

1975-01-01

The shape of the cell survival curve for the cell population relevant to some biological effects has been derived from the comparison of the total doses which result in the same biological effect for two irradiations delivered with N and 2N fractions in the same overall time. They show an initial slope which is interpreted as related to directly lethal, i.e. 'one-hit' or 'irreparable' events. The ratio of the initial slope and the slope at a dose D gives the contribution of the cell killing by directly lethal events relative to cell killing by accumulation of sublethal events. The bioligical effects which have been studied are: (i) dry desquamation of the skin of C 3 H mice and patients; (ii) intestinal death of BALB/c mice; and (iii) lung death of C 3 H mice. The shape of the cell survival curve has been found to be similar for skin desquamation and for intestinal death with a large contribution of lethal events, at single doses of 1000 rad. For lung death the initial tangent has a smaller slope and the shoulder is broader; this is interpreted as a relatively smaller contribution of lethal events with respect to accumulation of sublethal events. (author)

Role of epidermis-type lipoxygenases for skin barrier function and adipocyte differentiation

DEFF Research Database (Denmark)

Fürstenberger, Gerhard; Epp, Nikolas; Eckl, Katja-Martina

2007-01-01

12R-lipoxygenase (12R-LOX) and epidermis-type LOX-3 (eLOX-3) are novel members of the multigene family of mammalian LOX. A considerable gap exists between the identification of these enzymes and their biologic function. Here, we present evidence that 12R-LOX and eLOX-3, acting in sequence, and eL...... evidence indicates that this ligand is an eLOX-3-derived product. In accordance with this data is the observation that forced expression of eLOX-3 enhances adipocyte differentiation.......LOX-3 in combination with another, not yet identified LOX are critically involved in terminal differentiation of keratinocytes and adipocytes, respectively. Mutational inactivation of 12R-LOX and/or eLOX-3 has been found to be associated with development of an inherited ichthyosiform skin disorder...... in humans and genetic ablation of 12R-LOX causes a severe impairment of the epidermal lipid barrier in mice leading to post-natal death of the animals. In preadipocytes, a LOX-dependent PPARgamma activating ligand is released into the cell supernatant early upon induction of differentiation and available...

Suicide Lethality: A Concept Analysis.

Science.gov (United States)

DeBastiani, Summer; De Santis, Joseph P

2018-02-01

Suicide is a significant health problem internationally. Those who complete suicide may have different behaviors and risk factors than those who attempt a non-fatal suicide. The purpose of this article is to analyze the concept of suicide lethality and propose a clear definition of the concept through the identification of antecedents, attributes, and consequences. A literature search for articles published in the English language between 1970 and 2016 was conducted using MEDLINE, the Cochrane Library, Pubmed, Psychlit, Ovid, PsycINFO, and Proquest. The bibliographies of all included studies were also reviewed to identify additional relevant citations. A concept analysis was conducted on the literature findings using six stages of Walker and Avant's method. The concept analysis differentiated between suicide, lethality, suicidal behavior, and suicide lethality. Presence of a suicide plan or a written suicide note was not found to be associated with the majority of completed suicides included in the definition of suicide lethality. There are a few scales that measure the lethality of a suicide attempt, but none that attempt to measure the concept of suicide lethality as described in this analysis. Clarifying the concept of suicide lethality encourages awareness of the possibility of different suicidal behaviors associated with different suicide outcomes and will inform the development of future nursing interventions. A clearer definition of the concept of suicide lethality will guide clinical practice, research, and policy development aimed at suicide prevention.

Effect of seasonal and geographical differences on skin and effect of treatment with an osmoprotectant: Sorbitol.

Science.gov (United States)

Muizzuddin, Neelam; Ingrassia, Michael; Marenus, Kenneth D; Maes, Daniel H; Mammone, Thomas

2013-01-01

Human skin maintains an optimal permeability barrier function in a terrestrial environment that varies considerably in humidity. Cells cultured under hyperosmotic stress accumulate osmolytes including sorbitol. Epidermal keratinocytes experience similar high osmolality under dry environmental conditions because of increased transepidermal water loss (TEWL) and concomitant drying of the skin. This study was designed to determine if epidermal keratinocytes, in vitro, could be protected from high osmotic stress, with the exogenous addition of sorbitol. In addition, we evaluated the effect of a formulation containing topical sorbitol on skin barrier and moisturization of subjects living in arid and humid regions in summer as well as in winter. Results from in vitro experiments showed that 50 mM sorbitol protected epidermal keratinocytes from osmotic toxicity induced by sodium chloride. Clinical studies indicated that skin chronically exposed to hot, dry environment appeared to exhibit stronger skin barrier and a lower baseline TEWL. In addition, skin barrier was stronger in summer than in winter. Sorbitol exhibited significant improvement in both barrier repair and moisturization, especially in individuals subjected to arid environmental conditions.

The role of innate lymphoid cells in healthy and inflamed skin

DEFF Research Database (Denmark)

Bonefeld, Charlotte M.; Geisler, Carsten

2016-01-01

system. During the last years, it has become clear that innate lymphoid cells play a role in homeostasis and inflammation of the skin in humans and mice. In this review, we will discuss the role of innate lymphoid cells in healthy and inflamed skin with special focus on their role in atopic dermatitis.......The skin constitutes the interface between the organism and the environment, and it protects the body from harmful substances in the environment via physical, chemical and immunological barriers. The immunological barrier of the skin comprises both cells from the innate and the adaptive immune...

Xanes and SR-XRF Study of Skin as a Barrier to Ultra-Fine Nanocrystals of TiO2

International Nuclear Information System (INIS)

Kwiatek, W.M.; Lekki, J.; Stachura, Z.; Hanson, A.; Ablett, J.

2007-01-01

Nanocrystalline TiO 2 is commonly used in cosmetic industry as a photoprotective agent. With recent advances in nanomaterial processing, the size of TiO 2 crystals decreased into the nanometre regime. There is no satisfactory evidence that crystals of such small size are harmless to the human population. An EU project NANODERM has been launched where several techniques have been applied to investigate the possibility of particle penetration through the protective horny layer into vital skin regions. Skin biopsies of the animal and human skin have been collected after exposition to formulations containing TiO 2 nanocrystals. The Ti depth distributions were measured by electron and ion microscopy. The microscopy studies did not detect penetration into vital tissue of healthy skin what does not exclude a possibility that TiO 2 could penetrate pathological skin with lowered barrier efficiency. Due to literature the physical effect of the UV irradiation of the TiO 2 nanoparticle is the shift from 4 th to 3 rd oxidation state of the Ti. Titanium at 3 rd oxidation state interact with environment producing free radicals and Reactive Oxygen Species. In order to quantify the oxidation state shift, XANES experiments were carried out with commercially available TiO 2 nanocrystals (6 - 100 nm size), both in anatase and rutile phase. The samples were irradiated with X-rays with, and without accompanying UV illumination at the NSLS X27A beam line. The corresponding XANES spectra were registered and the absorption edge was compared in UV - illuminated and not illuminated spectra. A shift of about 1 eV in the absorption edge position of the rutile sample exposed to UVA light (365 nm, 20 mW/cm 2 ) has been measured and attributed to the changed electron configuration. However, the direction of the shift detected in measured samples was opposite to the expected. (author)

Presence of virus neutralizing antibodies in cerebral spinal fluid correlates with non-lethal rabies in dogs.

Directory of Open Access Journals (Sweden)

Clement W Gnanadurai

Full Text Available Rabies is traditionally considered a uniformly fatal disease after onset of clinical manifestations. However, increasing evidence indicates that non-lethal infection as well as recovery from flaccid paralysis and encephalitis occurs in laboratory animals as well as humans.Non-lethal rabies infection in dogs experimentally infected with wild type dog rabies virus (RABV, wt DRV-Mexico correlates with the presence of high level of virus neutralizing antibodies (VNA in the cerebral spinal fluid (CSF and mild immune cell accumulation in the central nervous system (CNS. By contrast, dogs that succumbed to rabies showed only little or no VNA in the serum or in the CSF and severe inflammation in the CNS. Dogs vaccinated with a rabies vaccine showed no clinical signs of rabies and survived challenge with a lethal dose of wild-type DRV. VNA was detected in the serum, but not in the CSF of immunized dogs. Thus the presence of VNA is critical for inhibiting virus spread within the CNS and eventually clearing the virus from the CNS.Non-lethal infection with wt RABV correlates with the presence of VNA in the CNS. Therefore production of VNA within the CNS or invasion of VNA from the periphery into the CNS via compromised blood-brain barrier is important for clearing the virus infection from CNS, thereby preventing an otherwise lethal rabies virus infection.

Confocal laser scanning microscopy to estimate nanoparticles' human skin penetration in vitro.

Science.gov (United States)

Zou, Ying; Celli, Anna; Zhu, Hanjiang; Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

2017-01-01

With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human "viable" epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested.

Stratum corneum hydration and skin surface pH in patients with atopic dermatitis.

Science.gov (United States)

Knor, Tanja; Meholjić-Fetahović, Ajša; Mehmedagić, Aida

2011-01-01

Atopic dermatitis (AD) is a chronically relapsing skin disease with genetic predisposition, which occurs most frequently in preschool children. It is considered that dryness and pruritus, which are always present in AD, are in correlation with degradation of the skin barrier function. Measurement of hydration and pH value of the stratum corneum is one of the noninvasive methods for evaluation of skin barrier function. The aim of the study was to assess skin barrier function by measuring stratum corneum hydration and skin surface pH of the skin with lesions, perilesional skin and uninvolved skin in AD patients, and skin in a healthy control group. Forty-two patients were included in the study: 21 young and adult AD patients and 21 age-matched healthy controls. Capacitance, which is correlated with hydration of stratum corneum and skin surface pH were measured on the forearm in the above areas by SM810/CM820/pH900 combined units (Courage AND Khazaka, Germany). The mean value of water capacitance measured in AD patients was 44.1 ± 11.6 AU (arbitrary units) on the lesions, 60.2 ± 12.4 AU on perilesional skin and 67.2 ± 8.8 AU on uninvolved skin. In healthy controls, the mean value was 74.1 ± 9.2 AU. The mean pH value measured in AD patients was 6.13 ± 0.52 on the lesions, 5.80 ± 0.41 on perilesional skin, and 5.54 ± 0.49 on uninvolved skin. In control group, the mean pH of the skin surface was 5.24 ± 0.40. The values of both parameters measured on lesional skin were significantly different (capacitance decreased and pH increased) from the values recorded on perilesional skin and uninvolved skin. The same held for the relation between perilesional and uninvolved skin. According to study results, the uninvolved skin of AD patients had significantly worse values of the measured parameters as compared with control group. The results of this study suggested the skin barrier function to be degraded in AD patients, which is specifically expressed in lesional skin.

The biological basis for dose limitation to the skin

International Nuclear Information System (INIS)

Fry, R.J.M.

1992-01-01

Ionizing radiation may cause deterministic effects and cancer. It has been the policy to base dose limits for radiation protection of the skin on the prevention of deterministic effects (1). In the case of cancer in general, dose limitation for radiation protection is based on limiting excess cancer mortality to low levels of radiation. Since skin cancers are seldom lethal, the general radiation protection standards will protect against an increase in excess mortality from skin cancer. However, with the dose limits selected to prevent deterministic effects, there is a significant probability of an excess incidence of skin cancer occurring as a result of exposure during a working lifetime. The induction of skin cancer by radiation is influenced significantly by subsequent exposure to ultraviolet radiation (UVR) from sunlight. This finding raises not only interesting questions about the mechanisms involved, but also about the differences in risk of skin cancer in different populations. The amount and distribution of melanin in the skin determines the degree of the effect of UVR. This paper discusses the mechanisms of the induction of both deterministic and stochastic effects in skin exposed to radiation in relation to radiation protection. (author)

Formation of thymine containing dimers in skin exposed to ultraviolet radiation

Energy Technology Data Exchange (ETDEWEB)

Johnson, B E [Dundee Univ. (UK)

1978-01-01

Nuclear DNA appears to be the major molecular target for the inhibitory, mutagenic and lethal effects of ultraviolet radiation on cells in culture. Cyclobutyl dimers between adjacent pyrimidine bases, the major photochemical lesions for these effects in prokaryotes, also play a part in UVR effects on eukaryotes cells. Pyrimidine dimers have been isolated from in vivo UV-irradiated guinea pig and mouse skin. The wavelength dependence for dimer induction is similar to that for acute skin reactions but no direct causal relationship has been established. Sunlight UVR may induce dimers in skin DNA. Excision of dimers from mouse skin in vivo is deficient as it is for most rodent cells in culture; human cell excision is efficient and the difficulties in interpretation of UV-carcinogenesis results with mice in terms of human skin cancer are therefore increased.

The cutaneous citadel: a holistic view of skin and immunity.

Science.gov (United States)

Spellberg, B

2000-06-23

Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.

The Roles of Vitamin C in Skin Health.

Science.gov (United States)

Pullar, Juliet M; Carr, Anitra C; Vissers, Margreet C M

2017-08-12

The primary function of the skin is to act as a barrier against insults from the environment, and its unique structure reflects this. The skin is composed of two layers: the epidermal outer layer is highly cellular and provides the barrier function, and the inner dermal layer ensures strength and elasticity and gives nutritional support to the epidermis. Normal skin contains high concentrations of vitamin C, which supports important and well-known functions, stimulating collagen synthesis and assisting in antioxidant protection against UV-induced photodamage. This knowledge is often used as a rationale for the addition of vitamin C to topical applications, but the efficacy of such treatment, as opposed to optimising dietary vitamin C intake, is poorly understood. This review discusses the potential roles for vitamin C in skin health and summarises the in vitro and in vivo research to date. We compare the efficacy of nutritional intake of vitamin C versus topical application, identify the areas where lack of evidence limits our understanding of the potential benefits of vitamin C on skin health, and suggest which skin properties are most likely to benefit from improved nutritional vitamin C intake.

Human age and skin physiology shape diversity and abundance of Archaea on skin.

Science.gov (United States)

Moissl-Eichinger, Christine; Probst, Alexander J; Birarda, Giovanni; Auerbach, Anna; Koskinen, Kaisa; Wolf, Peter; Holman, Hoi-Ying N

2017-06-22

The human skin microbiome acts as an important barrier protecting our body from pathogens and other environmental influences. Recent investigations have provided evidence that Archaea are a constant but highly variable component of the human skin microbiome, yet factors that determine their abundance changes are unknown. Here, we tested the hypothesis that the abundance of archaea on human skin is influenced by human age and skin physiology by quantitative PCR of 51 different skin samples taken from human subjects of various age. Our results reveal that archaea are more abundant in human subjects either older than 60 years or younger than 12 years as compared to middle-aged human subjects. These results, together with results obtained from spectroscopy analysis, allowed us gain first insights into a potential link of lower sebum levels and lipid content and thus reduced skin moisture with an increase in archaeal signatures. Amplicon sequencing of selected samples revealed the prevalence of specific eury- and mainly thaumarchaeal taxa, represented by a core archaeome of the human skin.

Alteration of skin hydration and its barrier function by vehicle and permeation enhancers: a study using TGA, FTIR, TEWL and drug permeation as markers.

Science.gov (United States)

Shah, D K; Khandavilli, S; Panchagnula, R

2008-09-01

Vehicles and permeation enhancers (PEs) used in transdermal drug delivery (TDD) of a drug can affect skin hydration, integrity and permeation of the solute administered. This investigation was designed to study the effect of the most commonly used vehicles and PEs on rat skin hydration, barrier function and permeation of an amphiphilic drug, imipramine hydrochloride (IMH). An array of well-established techniques were used to confirm the findings of the study. Thermogravimetric analysis (TGA) and Fourier transform infrared (FTIR) spectroscopy were used to determine changes in skin hydration. Alteration of the stratum corneum (SC) structure was investigated using FTIR studies. To monitor the barrier function alteration, transepidermal water loss (TEWL) measurement and permeation studies were performed. Our findings indicate that with hydration, there was an increase in the bound water content of the skin, and pseudoequilibrium of hydration (a drastic decrease in hydration rate) was achieved at around 12 h. Hydration increased the ratio between amide-I and amide-II peaks in FTIR and reduced the C-H stretching peak area. Both propylene glycol (PG) and ethanol (EtOH) dehydrated skin, with the latter showing a predominant effect. Furthermore, it was confirmed that PG and EtOH decreased the bound water content due to alteration in the protein domains and extraction of SC lipids, respectively. The effect of hydration on the SC was found to be similar to that reported for temperature. Permeation studies revealed that the dehydration caused by vehicles decreased IMH flux, whereas the flux was enhanced by PEs. The role of partition was predominant for the permeation of IMH through dehydrated skin. A synergistic effect was observed for PG and menthol in the enhancement of IMH. Further findings provided strong evidence that PG affects protein domains and EtOH extracts lipids from the bilayer. Both PG and EtOH, with or without PEs, increased TEWL. Initial TEWL was well

Contribution to the penetration of radionuclides across the skin

International Nuclear Information System (INIS)

Koprda, V.; Harangozo, M.; Kassai, Z.

2000-01-01

The human skin as well as the skin of animal species represent a strong barrier against the permeation of ionic forms of substances into an organism. Radionuclides of cesium, cobalt and actinides belong to frequent potential contaminants of human body at an accidental radioactive contamination. Regarding the actual composition of contaminating mixture of radionuclides the damage of an organism after internal contamination is proportional to the extent of penetrated amounts of radionuclides across the skin. In this paper: the time dependence of permeation of 137 Cs + , 60 Co 2+ , and 147 Pm 3+ from aqueous solution through animal skin model was studied, the biologic structure mostly responsible for the barrier effect was selected and proved, the relative importance of the main diffusion pathways for 137 Cs + , 60 Co 2+ and 147 Pm 3+ , the diffusion across the intact skin and the diffusion through the hair channels was assessed, the effect of isotopic carrier on the penetration process was studied, and the retarding capacities of different substances were researched. In all experiments the radioactive tracers were used. The experimental arrangement consisted of Franz-type vertical permeation cells. The well standardized animal skin models were chosen: fresh skin from abdominal region of 5 day old rats (5DR) of Wistar strain (Breeding Farm Dobra Voda, SK) and 9 day old rats (9DR), resp.. The skins of 5DR are still hairless, and 9DR are just short haired. The 5DR skin was used intact, and also with decreasing thickness of horny layer after it had been stripped with Scotch type (3M) 5-20 times respectively, or the skin had been splitted in 60degC hot water, whereby the whole epidermis was removed. Ions penetrated in vitro through the skin from donor solution (vehicle water) to receptor solution (phosphate buffered saline), were determined in aliquots sampled in 1,3,5,7 a 24 hours. The penetrated amounts of ions were found proportional to the time at least in the first 7

Wound-Healing Studies in Cornea and Skin: Parallels, Differences and Opportunities.

Science.gov (United States)

Bukowiecki, Anne; Hos, Deniz; Cursiefen, Claus; Eming, Sabine A

2017-06-12

The cornea and the skin are both organs that provide the outer barrier of the body. Both tissues have developed intrinsic mechanisms that protect the organism from a wide range of external threats, but at the same time also enable rapid restoration of tissue integrity and organ-specific function. The easy accessibility makes the skin an attractive model system to study tissue damage and repair. Findings from skin research have contributed to unravelling novel fundamental principles in regenerative biology and the repair of other epithelial-mesenchymal tissues, such as the cornea. Following barrier disruption, the influx of inflammatory cells, myofibroblast differentiation, extracellular matrix synthesis and scar formation present parallel repair mechanisms in cornea and skin wound healing. Yet, capillary sprouting, while pivotal in proper skin wound healing, is a process that is rather associated with pathological repair of the cornea. Understanding the parallels and differences of the cellular and molecular networks that coordinate the wound healing response in skin and cornea are likely of mutual importance for both organs with regard to the development of regenerative therapies and understanding of the disease pathologies that affect epithelial-mesenchymal interactions. Here, we review the principal events in corneal wound healing and the mechanisms to restore corneal transparency and barrier function. We also refer to skin repair mechanisms and their potential implications for regenerative processes in the cornea.

Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

Science.gov (United States)

Elmahdy, Akram; Cao, Yachao; Hui, Xiaoying; Maibach, Howard

2017-01-01

Objective With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP) application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration. Methods Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO) and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy. Results NPs were localized in the stratum corneum (SC) and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not. Conclusion Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. PMID:29184403

The menstrual cycle and the skin.

Science.gov (United States)

Raghunath, R S; Venables, Z C; Millington, G W M

2015-03-01

Perimenstrual exacerbations of dermatoses are commonly recognized, yet our knowledge of the underlying pathophysiological mechanisms remains imperfect. Research into the effects of oestrogen on the skin has provided evidence to suggest that oestrogen is associated with increases in skin thickness and dermal water content, improved barrier function, and enhanced wound healing. Research into the effects of progesterone suggests that the presence of various dermatoses correlates with peak levels of progesterone. Dermatoses that are exacerbated perimenstrually include acne, psoriasis, atopic eczema and irritant dermatitis, and possibly also erythema multiforme. Exacerbations occur at the peak levels of progesterone in the menstrual cycle. Underlying mechanisms include reduced immune and barrier functions as a result of cyclical fluctuations in oestrogen and/or progesterone. Autoimmune progesterone and oestrogen dermatitis are the best-characterized examples of perimenstrual cutaneous reactions to hormones produced during the menstrual cycle. In this review, we describe the current understanding of the menstrual cycle, and its effect on the skin and cutaneous disorders. © 2015 British Association of Dermatologists.

A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

Energy Technology Data Exchange (ETDEWEB)

Graham, Peter H., E-mail: peter.graham@sesiahs.health.nsw.gov.au [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Plant, Natalie; Graham, Jennifer L.; Browne, Lois [Cancer Care Centre, St. George Hospital, Kogarah, New South Wales (Australia); Borg, Martin [Department of Radiation Oncology, Royal Adelaide Hospital (Australia); Capp, Anne [Department of Radiation Oncology, Mater Hospital, Newcastle, New South Wales (Australia); Delaney, Geoff P. [Cancer Care Centre, Liverpool Hospital, Liverpool, New South Wales (Australia); Harvey, Jennifer [Mater Hospital, South Brisbane, Queensland (Australia); Kenny, Lisbeth [Royal Brisbane Hospital, Herston, Queensland (Australia); Francis, Michael [Andrew Love Cancer Centre, Geelong (Australia); Zissiadis, Yvonne [Department of Radiation Oncology, Royal Perth Hospital, Perth (Australia)

2013-05-01

Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies.

A Paired, Double-Blind, Randomized Comparison of a Moisturizing Durable Barrier Cream to 10% Glycerine Cream in the Prophylactic Management of Postmastectomy Irradiation Skin Care: Trans Tasman Radiation Oncology Group (TROG) 04.01

International Nuclear Information System (INIS)

Graham, Peter H.; Plant, Natalie; Graham, Jennifer L.; Browne, Lois; Borg, Martin; Capp, Anne; Delaney, Geoff P.; Harvey, Jennifer; Kenny, Lisbeth; Francis, Michael; Zissiadis, Yvonne

2013-01-01

Purpose: A previous, unblinded study demonstrated that an alcohol-free barrier film containing an acrylate terpolymer (ATP) was effective in reducing skin reactions compared with a 10% glycerine cream (sorbolene). The different appearances of these products precluded a blinded comparison. To test the acrylate terpolymer principle in a double-blinded manner required the use of an alternative cream formulation, a moisturizing durable barrier cream (MDBC); the study was conducted by the Trans Tasman Radiation Oncology Group (TROG) as protocol 04.01. Methods and Materials: A total of 333 patients were randomized; 1 patient was ineligible and 14 patients withdrew or had less than 7 weeks' observations, leaving 318 for analysis. The chest wall was divided into medial and lateral compartments, and patients were randomized to have MDBC applied daily to the medial or lateral compartment and sorbolene to the other compartment. Weekly observations, photographs, and symptom scores (pain and pruritus) were collected to week 12 or resolution of skin reactions if earlier. Skin dose was confirmed by centrally calibrated thermoluminescent dosimeters. Results: Rates of medial and lateral compartment Common Toxicity Criteria (CTC), version 3, greater than or equal to grade 3 skin reactions were 23% and 41%, but rates by skin care product were identical at 32%. There was no significant difference between MDBC and sorbolene in the primary endpoint of peak skin reactions or secondary endpoints of area-under-the-curve skin reaction scores. Conclusions: The MDBC did not reduce the peak skin reaction compared to sorbolene. It is possible that this is related to the difference in the formulation of the cream compared with the film formulation. Skin dosimetry verification and double blinding are essential for radiation skin care comparative studies

Ceramide 1 and ceramide 3 act synergistically on skin hydration and the transepidermal water loss of sodium lauryl sulfate-irritated skin.

Science.gov (United States)

Huang, Huey-Chun; Chang, Tsong-Min

2008-08-01

Stratum corneum intercellular lipids, such as ceramides, play an important role in the regulation of skin water barrier homeostasis and water-holding capacity. Aim To evaluate the potential water retention capacity of control emulsion and three oil-in-water (o/w) emulsions containing ceramide 1, ceramide 3, or both. Fifteen healthy Asian women (age, 20-30 years) with healthy skin, pretreated with sodium lauryl sulfate (SLS), applied the tested emulsions twice daily over a period of 28 days. Skin hydration and transepidermal water loss (TEWL) values were measured on the indicated days with a Corneometer(R)825 and a TEWAMETER TM210, respectively. The maximum increase in skin humidity was reached after 4 weeks, with values of 21.9 +/- 1.8% and 8.9 +/- 0.9% for emulsion C and control emulsion, respectively. The maximum decrease in TEWL was also reached after 4 weeks, with values of 36.7 +/- 4.7% and 5.1 +/- 0.8% for the same emulsions. It can be concluded that all the tested ceramide-containing emulsions improved skin barrier function when compared with untreated skin. There was some indication that ceramides 1 and 3 contained in emulsion C might exert a beneficial synergistic effect on skin biochemical properties, such as skin hydration and TEWL, and play a key role in the protection mechanism against SLS irritation.

Screening for skin cancer.

Science.gov (United States)

Helfand, M; Mahon, S M; Eden, K B; Frame, P S; Orleans, C T

2001-04-01

Malignant melanoma is often lethal, and its incidence in the United States has increased rapidly over the past 2 decades. Nonmelanoma skin cancer is seldom lethal, but, if advanced, can cause severe disfigurement and morbidity. Early detection and treatment of melanoma might reduce mortality, while early detection and treatment of nonmelanoma skin cancer might prevent major disfigurement and to a lesser extent prevent mortality. Current recommendations from professional societies regarding screening for skin cancer vary. To examine published data on the effectiveness of routine screening for skin cancer by a primary care provider, as part of an assessment for the U.S. Preventive Services Task Force. We searched the MEDLINE database for papers published between 1994 and June 1999, using search terms for screening, physical examination, morbidity, and skin neoplasms. For information on accuracy of screening tests, we used the search terms sensitivity and specificity. We identified the most important studies from before 1994 from the Guide to Clinical Preventive Services, second edition, and from high-quality reviews. We used reference lists and expert recommendations to locate additional articles. Two reviewers independently reviewed a subset of 500 abstracts. Once consistency was established, the remainder were reviewed by one reviewer. We included studies if they contained data on yield of screening, screening tests, risk factors, risk assessment, effectiveness of early detection, or cost effectiveness. We abstracted the following descriptive information from full-text published studies of screening and recorded it in an electronic database: type of screening study, study design, setting, population, patient recruitment, screening test description, examiner, advertising targeted at high-risk groups or not targeted, reported risk factors of participants, and procedure for referrals. We also abstracted the yield of screening data including probabilities and numbers

Action spectra for inactivation of normal and xeroderma pigmentosum human skin fibroblasts by ultraviolet radiations

International Nuclear Information System (INIS)

Keyse, S.M.; Moss, S.H.; Davies, D.J.G.

1983-01-01

Action spectra for UV-induced lethality as measured by colony forming ability were determined both for a normal human skin fibroblast strain (1BR) and for an excision deficient xeroderma pigmentosum strain (XP4LO) assigned to complementation group A using 7 monochromatic wavelengths in the range 254-365 nm. The relative sensitivity of the XP strain compared to the normal skin fibroblasts shows a marked decrease at wavelengths longer than 313 nm, changing from a ratio of about 20 at the shorter wavelengths to just greater than 1.0 at the longer wavelengths. The action spectra thus indicate that the influence on cell inactivation of the DNA repair defect associated with XP cells is decreased and almost reaches zero at longer UV wavelengths. This would occur, for example, if the importance of pyrimidine dimers as the lethal lesion decreased with increasing wavelength. These results are consistent with pyrimidine dimers induced in DNA being the major lethal lesion in both cell strains over the wavelength range 254-313 nm. However, it is indicated that different mechanisms of inactivation operate at wavelengths longer than 313 nm. (author)

The skin barrier function gene SPINK5 is associated with challenge-proven IgE-mediated food allergy in infants.

Science.gov (United States)

Ashley, S E; Tan, H-T T; Vuillermin, P; Dharmage, S C; Tang, M L K; Koplin, J; Gurrin, L C; Lowe, A; Lodge, C; Ponsonby, A-L; Molloy, J; Martin, P; Matheson, M C; Saffery, R; Allen, K J; Ellis, J A; Martino, D

2017-09-01

A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery sample) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these individuals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent sample group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery sample (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy. © 2017 EAACI and John Wiley and Sons A

Electrical measurement of the hydration state of the skin surface in vivo.

Science.gov (United States)

Tagami, H

2014-09-01

Healthy skin surface is smooth and soft, because it is covered by the properly hydrated stratum corneum (SC), an extremely thin and soft barrier membrane produced by the underlying normal epidermis. By contrast, the skin surfaces covering pathological lesions exhibit dry and scaly changes and the SC shows poor barrier function. The SC barrier function has been assessed in vivo by instrumentally measuring transepidermal water loss (TEWL). However, there was a lack of any appropriate method for evaluating the hydration state of the skin surface in vivo until 1980 when we reported the feasibility of employing high-frequency conductance or capacitance to evaluate it quickly and accurately. With such measurements, we can assess easily the moisturizing efficacy of various topical agents in vivo as well as the distribution pattern of water in the SC by combining it with a serial tape-stripping procedure of the skin surface. © 2014 The Author BJD © 2014 British Association of Dermatologists.

DFD-01 Reduces Transepidermal Water Loss and Improves Skin Hydration and Flexibility.

Science.gov (United States)

Jackson, J Mark; Grove, Gary L; Allenby, Kent; Houser, Tim

2017-12-01

In plaque psoriasis, the benefit of topical steroids is well established. The vehicle formulation of topical steroids may also provide benefit in addition to the effects of the steroid itself. DFD-01 (betamethasone dipropionate spray, 0.05%) is a formulation composed of a topical steroid in an emollient-like vehicle that enhances penetration to the target site of inflammation in the skin. The aim of this study was to assess the effect of DFD-01 and its vehicle on skin hydration and barrier function in compromised skin and to evaluate its effect on flexibility in healthy skin. Eighteen healthy white volunteers were enrolled in each of two studies. In Study 1, dry shaving of volar forearms created a compromised skin barrier, through which transepidermal water loss (TEWL) was measured using an evaporimeter. Capacitance, a measure of epidermal hydration, was also measured at baseline and at 1, 2 and 4 h after application of DFD-01 or its vehicle formulation. In Study 2, intact skin flexibility was tested with a cutometer before and at 1, 2 and 4 h after application of DFD-01 or vehicle. In Study 1, both DFD-01 and its vehicle were effective at reducing TEWL through the compromised stratum corneum. Capacitance measurements confirmed this finding; razor-chafed skin treated with either DFD-01 or vehicle exhibited levels of skin hydration similar to unshaved control skin. Study 2 found softening and greater flexibility of normal skin treated with either DFD-01 or vehicle compared with nontreated control skin samples. These tests suggest that the DFD-01 formulation and its vehicle are each effective at retaining moisture within a damaged skin barrier and for softening and increasing the flexibility of intact skin. Dr. Reddy's Laboratories.

Homozygous ALOXE3 Nonsense Variant Identified in a Patient with Non-Bullous Congenital Ichthyosiform Erythroderma Complicated by Superimposed Bullous Majocchi’s Granuloma: The Consequences of Skin Barrier Dysfunction

Directory of Open Access Journals (Sweden)

Tao Wang

2015-09-01

Full Text Available Non-bullous congenital ichthyosiform erythroderma (NBCIE is a hereditary disorder of keratinization caused by pathogenic variants in genes encoding enzymes important to lipid processing and terminal keratinocyte differentiation. Impaired function of these enzymes can cause pathologic epidermal scaling, significantly reduced skin barrier function. In this study, we have performed a focused, genetic analysis of a probrand affected by NBCIE and extended this to his consanguineous parents. Targeted capture and next-generation sequencing was performed on NBCIE associated genes in the proband and his unaffected consanguineous parents. We identified a homozygous nonsense variant c.814C>T (p.Arg272* in ALOXE3 (NM_001165960.1 in the proband and discovered that his parents are both heterozygous carriers of the variant. The clinical manifestations of the proband’s skin were consistent with NBCIE, and detailed histopathological assessment revealed epidermal bulla formation and Majocchi’s granuloma. Infection with Trichophyton rubrum was confirmed by culture. The patient responded to oral terbinafine antifungal treatment. Decreased skin barrier function, such as that caused by hereditary disorders of keratinization, can increase the risk of severe cutaneous fungal infections and the formation of Majocchi’s granuloma and associated alopecia. Patients with NBCIE should be alerted to the possible predisposition for developing dermatophytoses and warrant close clinical follow-up.

Skin innate immune system

Directory of Open Access Journals (Sweden)

Berna Aksoy

2013-06-01

Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies

Directory of Open Access Journals (Sweden)

Masutaka Furue

2017-07-01

Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.

[Skin hydration and hydrating products].

Science.gov (United States)

Duplan, H; Nocera, T

2018-05-01

One of the skin's principal functions is to protect the body against its environment by maintaining an effective epidermal barrier, not only against external factors, but also to prevent water loss from the body. Indeed, water homeostasis is vital for the normal physiological functioning of skin. Hydration levels affect not only visible microscopic parameters such as the suppleness and softness of skin, but also molecular parameters, enzyme activities and cellular signalling within the epidermis. The body is continually losing some of its water, but this phenomenon is limited and the optimal hydration gradient in skin is ensured via a set of sophisticated regulatory processes that rely on the functional and dynamic properties of the uppermost level of the skin consisting of the stratum corneum. The present article brings together data recently acquired in the fields of skin hydration and the characterisation of dehydrated or dry skin, whether through study of the regulatory processes involved or as a result of changes in the techniques used for in situ measurement, and thus in optimisation of management. Copyright © 2018. Published by Elsevier Masson SAS.

Lipidomic analysis of epidermal lipids: a tool to predict progression of inflammatory skin disease in humans.

Science.gov (United States)

Li, Shan; Ganguli-Indra, Gitali; Indra, Arup K

2016-05-01

Lipidomics is the large-scale profiling and characterization of lipid species in a biological system using mass spectrometry. The skin barrier is mainly comprised of corneocytes and a lipid-enriched extracellular matrix. The major skin lipids are ceramides, cholesterol and free fatty acids (FFA). Lipid compositions are altered in inflammatory skin disorders with disrupted skin barrier such as atopic dermatitis (AD). Here we discuss some of the recent applications of lipidomics in human skin biology and in inflammatory skin diseases such as AD, psoriasis and Netherton syndrome. We also review applications of lipidomics in human skin equivalent and in pre-clinical animal models of skin diseases to gain insight into the pathogenesis of the skin disease. Expert commentary: Skin lipidomics analysis could be a fast, reliable and noninvasive tool to characterize the skin lipid profile and to monitor the progression of inflammatory skin diseases such as AD.

Innate lymphoid cells and the skin

OpenAIRE

Salimi, Maryam; Ogg, Graham

2014-01-01

Innate lymphoid cells are an emerging family of effector cells that contribute to lymphoid organogenesis, metabolism, tissue remodelling and protection against infections. They maintain homeostatic immunity at barrier surfaces such as lung, skin and gut (Nature 464:1367?1371, 2010, Nat Rev Immunol 13: 145?149, 2013). Several human and mouse studies suggest a role for innate lymphoid cells in inflammatory skin conditions including atopic eczema and psoriasis. Here we review the innate lymphoid...

Evaluation of out-in skin transparency using a colorimeter and food dye in patients with atopic dermatitis.

Science.gov (United States)

Mochizuki, H; Tadaki, H; Takami, S; Muramatsu, R; Hagiwara, S; Mizuno, T; Arakawa, H

2009-05-01

Atopic dermatitis is a disease of skin barrier dysfunction and outside stimuli can cross the skin barrier. To examine a new method for evaluating the outside to inside skin transparency with a colorimeter and yellow dyes. In study 1, a total of 28 volunteer subjects (24 normal and four with atopic dermatitis) participated. After provocation with yellow dye, the skin colour of all the subjects was measured using a colorimeter. The skin transparency index was calculated by the changes of the skin colour to yellow. Other variables of skin function, including transepidermal water loss (TEWL) and stratum corneum hydration, were also measured. In study 2, the skin transparency index was evaluated for a cohort of 38 patients with atopic dermatitis, 27 subjects with dry skin and 29 healthy controls. In study 1, the measurement of skin colour (b*) using tartrazine showed good results. There was a significant relationship between the skin transparency index with tartrazine and the atopic dermatitis score (P = 0.014). No other measurements of skin function, including the TEWL, were correlated. In study 2, the skin transparency index score obtained with tartrazine in the patients with atopic dermatitis was significantly higher than that of the controls and those with dry skin (P colorimeter and food dye, is noninvasive, safe and reliable for the evaluation of out-in skin transparency and can demonstrate the characteristic dysfunction in the skin barrier in patients with atopic dermatitis.

Quantification of changes in skin hydration and sebum after tape stripping using infrared spectroscopy

Science.gov (United States)

Ezerskaia, A.; Pereira, S. F.; Urbach, H. P.; Varghese, B.

2017-02-01

Skin barrier function relies on well balanced water and lipid system of stratum corneum. Optimal hydration and oiliness levels are indicators of skin health and integrity. We demonstrate an accurate and sensitive depth profiling of stratum corneum sebum and hydration levels using short wave infrared spectroscopy in the spectral range around 1720 nm. We demonstrate that short wave infrared spectroscopic technique combined with tape stripping can provide morequantitative and more reliable skin barrier function information in the low hydration regime, compared to conventional biophysical methods.

Epidemiology of "fragile skin": results from a survey of different skin types

Directory of Open Access Journals (Sweden)

Haftek M

2013-12-01

findings need to be confirmed through objective evaluation, the current survey demonstrated that "fragile skin" is perceived to occur in a substantial proportion of individuals from any given country, particularly in the age range of 15–34 years, regardless of skin type. Keywords: fragile skin, prevalence, skin barrier, skin type, survey

Confocal laser scanning microscopy to estimate nanoparticles’ human skin penetration in vitro

Directory of Open Access Journals (Sweden)

Zou Y

2017-10-01

Full Text Available Ying Zou,1,2,* Anna Celli,2,3,* Hanjiang Zhu,2,* Akram Elmahdy,2 Yachao Cao,2 Xiaoying Hui,2 Howard Maibach2 1Skin & Cosmetic Research Department, Shanghai Skin Disease Hospital, Shanghai, People’s Republic of China; 2Department of Dermatology, School of Medicine, University of California San Francisco, San Francisco, CA, USA; 3San Francisco Veterans Medical Center, San Francisco, CA, USA *These authors contributed equally to this work Objective: With rapid development of nanotechnology, there is increasing interest in nanoparticle (NP application and its safety and efficacy on human skin. In this study, we utilized confocal laser scanning microscopy to estimate NP skin penetration.Methods: Three different-sized polystyrene NPs marked with red fluorescence were applied to human skin, and Calcium Green 5N was used as a counterstain. Dimethyl sulfoxide (DMSO and ethanol were used as alternative vehicles for NPs. Tape stripping was utilized as a barrier-damaged skin model. Skin biopsies dosed with NPs were incubated at 4°C or 37°C for 24 hours and imaged using confocal laser scanning microscopy.Results: NPs were localized in the stratum corneum (SC and hair follicles without penetrating the epidermis/dermis. Barrier alteration with tape stripping and change in incubation temperature did not induce deeper penetration. DMSO enhanced NP SC penetration but ethanol did not.Conclusion: Except with DMSO vehicle, these hydrolyzed polystyrene NPs did not penetrate intact or barrier-damaged human “viable” epidermis. For further clinical relevance, in vivo human skin studies and more sensitive analytic chemical methodology are suggested. Keywords: nanoparticles, skin penetration, stratum corneum, confocal laser scanning microscopy, tape stripping

Factors influencing circadian rhythms in acetaminophen lethality.

Science.gov (United States)

Schnell, R C; Bozigian, H P; Davies, M H; Merrick, B A; Park, K S; McMillan, D A

1984-01-01

Experiments were conducted to examine the effects of changes in lighting schedules and food consumption on circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice. Under a normal lighting schedule (light: 06.00-18.00 h), male mice exhibited a circadian rhythm in acetaminophen lethality (peak: 18.00 h; nadir: 06.00, 10.00 h) and an inverse rhythm in hepatic glutathione concentrations (peak: 06.00, 10.00 h; nadir: 18.00 h). Under a reversed lighting schedule (light: 18.00-06.00 h) the glutathione rhythm was reversed and the rhythm in acetaminophen lethality was altered showing greater sensitivity to the drug. Under continuous light, there was a shift in the acetaminophen lethality and the hepatic glutathione rhythms. Under continuous dark, both rhythms were abolished. Under a normal lighting regimen, hepatic glutathione levels were closely correlated with food consumption; i.e., both were increased during the dark phase and decreased during the light phase. Fasting the mice for 12 h abolished the rhythms in acetaminophen lethality and hepatic glutathione levels; moreover, the lethality was increased and the hepatic glutathione levels were decreased. These experiments show that both lighting schedules and feeding can alter the circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice.

Deadly hairs, lethal feathers--convergent evolution of poisonous integument in mammals and birds.

Science.gov (United States)

Plikus, Maksim V; Astrowski, Aliaksandr A

2014-07-01

Hairs and feathers are textbook examples of the convergent evolution of the follicular appendage structure between mammals and birds. While broadly recognized for their convergent thermoregulatory, camouflage and sexual display functions, hairs and feathers are rarely thought of as deadly defence tools. Several recent studies, however, show that in some species of mammals and birds, the integument can, in fact, be a de facto lethal weapon. One mammalian example is provided by African crested rats, which seek for and chew on the bark of plants containing the highly potent toxin, ouabain. These rats then coat their fur with ouabain-containing saliva. For efficient toxin retention, the rodents have evolved highly specialized fenestrated and mostly hollow hair shafts that soak up liquids, which essentially function as wicks. On the avian side of the vertebrate integumental variety spectrum, several species of birds of New Guinea have evolved resistance to highly potent batrachotoxins, which they acquire from their insect diet. While the mechanism of bird toxicity remains obscure, in a recently published issue of the journal, Dumbacher and Menon explore the intriguing idea that to achieve efficient storage of batrachotoxins in their skin, some birds exploit the basic permeability barrier function of their epidermis. Batrachotoxins become preferentially sequestered in their epidermis and are then transferred to feathers, likely through the exploitation of specialized avian lipid-storing multigranular body organelles. Here, we discuss wider implications of this intriguing concept. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Natural considerations for skin of color.

Science.gov (United States)

Baumann, Leslie; Rodriguez, David; Taylor, Susan C; Wu, Jessica

2006-12-01

Changing US demographics indicate that dermatologists will treat an increasing number of individuals of color. Early research on cutaneous anatomy and physiology was performed mostly in white populations. However, new research is elucidating similarities and differences in skin of color and white skin with regard to skin barrier, pigmentation, and sensitivity. Two of the most important issues are skin lightening and brightening. Products for use on skin of color typically should be gentle because of the proclivity of more deeply pigmented skin to develop pigmentary abnormalities in response to skin irritation or trauma. Increasing patient interest in natural remedies has been matched by research on the use of natural ingredients in dermatology. The relative gentleness of many of these products, coupled with excellent efficacy, makes natural ingredients such as soy and licorice excellent choices in the treatment of disorders such as postinflammatory hyperpigmentation (PIH) and melasma. For daily skin care, ingredients such as oatmeal and feverfew are good choices for gentle cleansing and moisturizing of dry, sensitive, or ashy skin. Sun protection is an increasing concern due to rising rates of melanoma. Several botanical products are useful in augmenting photoprotection with conventional sunscreens.

Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

[Considerations on photoprotection and skin disorders].

Science.gov (United States)

Cestari, T Ferreira; de Oliveira, F Bazanella; Boza, J Catucci

2012-11-01

Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Considerations on photoprotection and skin disorders.

Science.gov (United States)

Cestari, T Ferreira; Oliveira, F Bazanella de; Boza, J Catucci

2012-12-01

Excessive exposure to solar or artificial sources of UV radiation is deleterious to the skin and can cause or worsen several diseases. Detrimental effects of UV radiation exert an important role in the development of skin cancers, cause alterations on the immune response, and act as a trigger or aggravating factor for pigmentary disorders. A group of measures, including education, change of habits, use of physical barriers and sunscreens constitutes a significant part of the treatment of many skin disorders and are valuable preventive tools. This article summarizes the relevant studies addressing these issues, emphasizing the many aspects of photoprotection. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Effects of various vehicles on skin hydration in vivo.

Science.gov (United States)

Wiedersberg, S; Leopold, C S; Guy, R H

2009-01-01

The stratum corneum, the outermost layer of the skin, regulates the passive loss of water to the environment. Furthermore, it is well accepted that drug penetration is influenced by skin hydration, which may be manipulated by the application of moisturizing or oleaginous vehicles. Measurements of transepidermal water loss (TEWL), and of skin hydration using a corneometer, were used to assess the effect of different vehicles on stratum corneum barrier function in vivo in human volunteers. A microemulsion significantly increased skin hydration relative to a reference vehicle based on medium chain triglycerides; in contrast, Transcutol(R) lowered skin hydration. TEWL measurements confirmed these observations. Copyright 2009 S. Karger AG, Basel.

Cream or foam in pedal skin care: towards the ideal vehicle for urea used against dry skin.

Science.gov (United States)

Borelli, C; Bielfeldt, S; Borelli, S; Schaller, M; Korting, H C

2011-02-01

The aim of this study was to evaluate different urea-containing cosmetic preparations designed for foot care regarding skin occlusion. The primary aim was therefore to screen the short-term transepidermal water loss (TEWL) as a parameter for skin barrier function and skin occlusion and to characterize the relative role of the vehicle, i.e. cream or foam in the context of cosmetics containing urea in the 2-10% range addressing the cosmetic products urea 2% cream (GEHWOL FUSSKRAFT blau), petrolatum containing cream (GEHWOL med Schrundensalbe), urea 10% cream (GEHWOL med Lipidro-Crème), urea 10% foam (Allpresan Fuss Schaum) and vaseline (positive control) compared with an untreated area on the volar forearms of volunteers. Moreover, the short time (24 h) kinetics regarding the moisturizing effect of cream and foam formulations in diabetic patients were compared. The efficacy of a cream on reduction of skin thickness of hyperkeratotic skin in the heel region before and after a period of product application was also evaluated. In some of the trials, healthy individuals and in others, diabetic patients (type I and II) were enrolled. TEWL was determined before product application, as well as at given points of time thereafter. In this study, no excessive occlusion effects comparable with a blockage of the skin's natural water evaporation could be observed for any of the test products. To the extent to be expected, this was found neither for the cream products nor for the foam product. Slightly lowered TEWL values after application of the 10% urea cream can be interpreted as a beneficial effect in terms of an improved barrier function. Regarding skin moisture, the urea-containing cream formulation appeared equal or slightly superior to the foam formulation. The thickness of the horny layer was found reduced after application of 10 % urea-containing cream. At present it looks as if cream vehicles would still be vehicles of choice in general, when it comes to the

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus).

Science.gov (United States)

Alves, Ricardo N; Sundell, Kristina S; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M

2018-06-01

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na + , K + -ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier's functional properties mature earlier and are independent of metamorphosis.

Was skin cancer a selective force for black pigmentation in early hominin evolution?

Science.gov (United States)

Greaves, Mel

2014-01-01

Melanin provides a crucial filter for solar UV radiation and its genetically determined variation influences both skin pigmentation and risk of cancer. Genetic evidence suggests that the acquisition of a highly stable melanocortin 1 receptor allele promoting black pigmentation arose around the time of savannah colonization by hominins at some 1–2 Ma. The adaptive significance of dark skin is generally believed to be protection from UV damage but the pathologies that might have had a deleterious impact on survival and/or reproductive fitness, though much debated, are uncertain. Here, I suggest that data on age-associated cancer incidence and lethality in albinos living at low latitudes in both Africa and Central America support the contention that skin cancer could have provided a potent selective force for the emergence of black skin in early hominins. PMID:24573849

Topical Nano and Microemulsions for Skin Delivery

Directory of Open Access Journals (Sweden)

Christofori M. R. R. Nastiti

2017-09-01

Full Text Available Nanosystems such as microemulsions (ME and nanoemulsions (NE offer considerable opportunities for targeted drug delivery to and via the skin. ME and NE are stable colloidal systems composed of oil and water, stabilised by a mixture of surfactants and cosurfactants, that have received particular interest as topical skin delivery systems. There is considerable scope to manipulate the formulation components and characteristics to achieve optimal bioavailability and minimal skin irritancy. This includes the incorporation of established chemical penetration enhancers to fluidize the stratum corneum lipid bilayers, thus reducing the primary skin barrier and increasing permeation. This review discusses nanosystems with utility in skin delivery and focuses on the composition and characterization of ME and NE for topical and transdermal delivery. The mechanism of skin delivery across the stratum corneum and via hair follicles is reviewed with particular focus on the influence of formulation.

Comfort and microbial barrier properties of garments worn next to the skin

Science.gov (United States)

Kopitar, D.; Rogina-Car, B.; Skenderi, Z.

2017-10-01

Compared with viscose fibre, modal fibre is characterized by some advantageous properties such as higher dry and wet tenacities, higher wet modulus, lower water retention capacity and lower level of swelling. Impact of different knitted fabric structure made of cotton and 97 % CMD/3 % EL fibres on thermo-physiological comfort and microbial barrier properties were investigated. All knitted fabrics have very good physiological properties. The microbial barrier permeability of knitted fabric after extreme contamination with bacterial spores in dry state showed that double jersey offered more effective microbial barrier than the single jersey knitted fabrics respectively the greater thickness of double jersey knitted fabric provide more difficult barrier to bacterial spores to pass. In wet state all knitted fabrics have more effective microbial barrier which could be explained by cellulose fibres swelling. In wet state 97 % CMD/3 % EL single jersey knitted fabric have more effective microbial barrier then cotton double and single jersey knitted fabrics.

The 24-hour skin hydration and barrier function effects of a hyaluronic 1%, glycerin 5%, and Centella asiatica stem cells extract moisturizing fluid: an intra-subject, randomized, assessor-blinded study.

Science.gov (United States)

Milani, Massimo; Sparavigna, Adele

2017-01-01

Moisturizing products are commonly used to improve hydration in skin dryness conditions. However, some topical hydrating products could have negative effects on skin barrier function. In addition, hydrating effects of moisturizers are not commonly evaluated up to 24 hours after a single application. Hyaluronic acid (HA) and glycerin are very well-known substances able to improve skin hydration. Centella asiatica extract (CAE) could exert lenitive, anti-inflammatory and reepithelialization actions. Furthermore, CAE could inhibit hyaluronidase enzyme activity, therefore prolonging the effect of HA. A fluid containing HA 1%, glycerin 5% and stem cells CAE has been recently developed (Jaluronius CS [JCS] fluid). To evaluate and compare the 24-hour effects of JCS fluid on skin hydration and on transepidermal water loss (TEWL) in healthy subjects in comparison with the control site. Twenty healthy women, mean age 40 years, were enrolled in an intra-subject (right vs left), randomized, assessor-blinded, controlled, 1-day trial. The primary end points were the skin hydration and TEWL, evaluated at the volar surface of the forearm and in standardized conditions (temperature- and humidity-controlled room: 23°C and 30% of humidity) using a corneometer and a vapometer device at baseline, 1, 8 and 24 hours after JCS fluid application. Measurements were performed by an operator blinded for the treatments. Skin hydration after 24 hours was significantly higher ( P =0.001; Mann-Whitney U test) in the JCS-treated area in comparison with the control site. JCS induced a significant ( P =0.0001) increase in skin hydration at each evaluation time (+59% after 1 hour, +48% after 8 hours and +29% after 24 hours) in comparison with both baseline ( P =0.0001) and non-treated control site ( P =0.001). TEWL after 24 hours was significantly lower ( P =0.049; Mann-Whitney U test) in the JCS-treated area in comparison with the control site (13±4 arbitrary units [AU] vs 16±6 AU). JCS fluid

Lethal and sub-lethal effects of five pesticides used in rice farming on the earthworm Eisenia fetida

NARCIS (Netherlands)

Rico, Andreu; Sabater, Consuelo; Castillo, María Ángeles

2016-01-01

The toxicity of five pesticides typically used in rice farming (trichlorfon, dimethoate, carbendazim, tebuconazole and prochloraz) was evaluated on different lethal and sub-lethal endpoints of the earthworm Eisenia fetida. The evaluated endpoints included: avoidance behaviour after an exposure

Lethal Epistaxis.

Science.gov (United States)

Byard, Roger W

2016-09-01

Epistaxis or nosebleed refers to bleeding from the nostrils, nasal cavity, or nasopharynx. Occasional cases may present with torrential lethal hemorrhage. Three cases are reported to demonstrate particular features: Case 1: A 51-year-old woman with lethal epistaxis with no obvious bleeding source; Case 2: A 77-year-old man with treated nasopharyngeal carcinoma who died from epistaxis arising from a markedly neovascularized tumor bed; Case 3: A 2-year-old boy with hemophilia B who died from epistaxis with airway obstruction in addition to gastrointestinal bleeding. Epistaxis may be associated with trauma, tumors, vascular malformations, bleeding diatheses, infections, pregnancy, endometriosis, and a variety of different drugs. Careful dissection of the nasal cavity is required to locate the site of hemorrhage and to identify any predisposing conditions. This may be guided by postmortem computerized tomographic angiography (PCTA). Despite careful dissection, however, a source of bleeding may never be identified. © 2016 American Academy of Forensic Sciences.

Diffusion of [2-14C]diazepam across hairless mouse skin and human skin

International Nuclear Information System (INIS)

Koch, R.L.; Palicharla, P.; Groves, M.J.

1987-01-01

The objectives of this study were to investigate the absorption of diazepam applied topically to the hairless mouse in vivo and to determine the diffusion of diazepam across isolated hairless mouse skin and human skin. [ 14 C]Diazepam was readily absorbed after topical administration to the intact hairless mouse, a total of 75.8% of the 14 C-label applied being recovered in urine and feces. Diazepam was found to diffuse across human and hairless mouse skin unchanged in experiments with twin-chambered diffusion cells. The variation in diffusion rate or the flux for both human and mouse tissues was greater among specimens than between duplicate or triplicate trials for a single specimen. Fluxes for mouse skin (stratum corneum, epidermis, and dermis) were greater than for human skin (stratum corneum and epidermis): 0.35-0.61 microgram/cm2/h for mouse skin vs 0.24-0.42 microgram/cm2/h for human skin. The permeability coefficients for mouse skin ranged from 1.4-2.4 X 10(-2)cm/h compared with 0.8-1.4 X 10(-2)cm/h for human skin. Although human stratum corneum is almost twice the thickness of that of the hairless mouse, the diffusion coefficients for human skin were 3-12 times greater (0.76-3.31 X 10(-6) cm2/h for human skin vs 0.12-0.27 X 10(-6) cm2/h for hairless mouse) because of a shorter lag time for diffusion across human skin. These differences between the diffusion coefficients and diffusion rates (or permeability coefficients) suggest that the presence of the dermis may present some barrier properties. In vitro the dermis may require complete saturation before the diazepam can be detected in the receiving chamber

Prevalence and lethality among patients with histoplasmosis and AIDS in the Midwest Region of Brazil.

Science.gov (United States)

Silva, Thaísa C; Treméa, Carolina M; Zara, Ana Laura S A; Mendonça, Ana Flávia; Godoy, Cássia S M; Costa, Carolina R; Souza, Lúcia K H; Silva, Maria R R

2017-01-01

Histoplasmosis is a systemic mycosis that is considered an important public health problem. In this work, we performed a descriptive, observational, cross-sectional and retrospective study with a secondary data analysis of medical records from 2000 to 2012 at a tertiary hospital. The study sample consisted of 275 patients with laboratory-confirmed Disseminated Histoplasmosis (DH)/AIDS. The results showed that the prevalence of DH associated with AIDS was 4.4%. The majority of patients were young adult men with fever in 84.2%, cough in 63.4%, weight loss in 63.1%, diarrhoea in 44.8% and skin manifestations in 27.6% of patients. In the overall cohort, the CD4 counts were low, but not significantly different in survivors and non-survivors. Higher levels of urea and lower levels of haemoglobin and platelets were observed in non-survivor patients (<.05). The global lethality was 71.3% (196/275). The results with high prevalence and lethality highlight the need to adopt measures to facilitate early diagnosis, proper treatment and improved prognosis. © 2016 Blackwell Verlag GmbH.

Defects of filaggrin-like proteins in both lesional and nonlesional atopic skin.

Science.gov (United States)

Pellerin, Laurence; Henry, Julie; Hsu, Chiung-Yueh; Balica, Stéfana; Jean-Decoster, Catherine; Méchin, Marie-Claire; Hansmann, Britta; Rodriguez, Elke; Weindinger, Stefan; Schmitt, Anne-Marie; Serre, Guy; Paul, Carle; Simon, Michel

2013-04-01

Atopic dermatitis (AD) is a chronic inflammatory skin disease characterized by a disturbed epidermal barrier. In a subset of patients, this is explained by nonsense mutations in the gene encoding filaggrin (FLG). We sought to evaluate the respective role of FLG mutations and proinflammatory cytokines and to assess the expression of FLG, hornerin (HRNR), and FLG2, 2 FLG-like proteins, which are involved in epidermal barrier functions, in normal skin and both lesional and nonlesional skin of patients with AD. An FLG-genotyped cohort of 73 adults with AD and 73 aged-matched control subjects was analyzed by using immunohistochemistry and immunoblotting. Normal primary human keratinocytes were differentiated in either the absence or presence of IL-4, IL-13, and IL-25. Compared with control subjects, FLG, HRNR, and FLG2 were detected at significantly lower levels in the skin of patients with AD, irrespective of their FLG genotype. The reduction was greater in lesional compared with nonlesional skin. In addition, the proFLG/FLG ratio was found to be higher in the skin of wild-type patients than in control subjects. Cytokine treatment of keratinocytes induced a dramatic reduction in FLG, FLG2, and HRNR expression both at the mRNA and protein levels. The stratum corneum of lesional but also clinically unaffected skin of adults with AD is abnormal, with reduced expression of FLG and FLG-like proteins. In addition to nonsense mutations, proinflammatory cytokines and some defects in the proFLG processing can contribute to the FLG downregulation. Our study suggests that skin inflammation reduces the expression of FLG-like proteins, contributing to the AD-related epidermal barrier dysfunction. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

Effects of water activity and low molecular weight humectants on skin permeability and hydration dynamics - a double-blind, randomized and controlled study.

Science.gov (United States)

Albèr, C; Buraczewska-Norin, I; Kocherbitov, V; Saleem, S; Lodén, M; Engblom, J

2014-10-01

The mammalian skin is a barrier that effectively separates the water-rich interior of the body from the normally dryer exterior. Changes in the external conditions, for example ambient humidity, have been shown to affect the skin barrier properties. The prime objective of this study was to evaluate the effect of water activity of a topical formulation on skin hydration and permeability. A second objective was to gain more understanding on how two commonly used humectants, urea and glycerol, affect skin barrier function in vivo. Simple aqueous formulations were applied under occlusion to the volar forearm of healthy volunteers. Following 4-h exposure, skin water loss (by transepidermal water loss measurements), skin hydration (by Corneometry) and skin permeability (by time to vasodilation due to benzyl nicotinate exposure) were monitored. The results demonstrate that a relatively small change in the water activity of a topical formulation is sufficient to induce considerable effects on stratum corneum hydration and permeability to exogenous substances. Exposing the skin to high water activity leads to increased skin hydration and also increased permeability. Furthermore, urea and glycerol promote skin hydration and permeability even at reduced water activity of the applied formulation. These results highlight the importance of considering the water activity in topically applied formulations and the potential benefit of using humectants. The results may impact formulation optimization in how to facilitate skin hydration and to modify skin permeability by temporarily open and close the skin barrier. © 2014 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Lethal congenital contracture syndrome (LCCS) and other lethal arthrogryposes in Finland--an epidemiological study.

Science.gov (United States)

Pakkasjärvi, Niklas; Ritvanen, Annukka; Herva, Riitta; Peltonen, Leena; Kestilä, Marjo; Ignatius, Jaakko

2006-09-01

Arthrogryposis multiplex congenita is a heterogeneous group of disorders characterized by multiple contractures with an estimated frequency of 1 in 3,000 births. With improving diagnostic methods, increasing numbers of fetuses with arthrogryposis are found. The pathogenetic mechanisms are relatively well known but the epidemiology and genetics of the prenatally lethal forms of arthrogryposis are less well known. In this study we collected all cases of a multiple contractures diagnosed in Finland during 1987-2002 including live born infants, stillbirths, and terminated pregnancies. Ninety-two cases of 214 suffered intrauterine demise (68 selective pregnancy terminations and 24 stillbirths) and 58 died in infancy. In 141 out of these cases the diagnosis could be included within lethal arthrogryposes, with a prevalence of 1 in 6,985 (1.43/10,000) births. Of these, 59 had spinal cord pathology at autopsy and thus were of neurogenic origin. Thirty-nine cases had lethal congenital contracture syndrome (LCCS) clinically characterized by total immobility of the fetus at all ultrasound examinations (12 weeks or later), multiple joint contractures in both upper and lower limbs, hydrops, and fetal death before the 32nd week of pregnancy. LCCS is noted as a unique Finnish disorder with a prevalence of 1 in 25,250 (0.40/10,000) births and is a major cause of lethal arthrogryposis in Finland.

Low uptake of silica nanoparticles in Caco-2 intestinal epithelial barriers

NARCIS (Netherlands)

Ye, Dong; Bramini, Mattia; Hristov, Delyan R.; Wan, Sha; Salvati, Anna; Åberg, Christoffer; Dawson, Kenneth A.

2017-01-01

Cellular barriers, such as the skin, the lung epithelium or the intestinal epithelium, constitute one of the first obstacles facing nanomedicines or other nanoparticles entering organisms. It is thus important to assess the capacity of nanoparticles to enter and transport across such barriers. In

Erbium-yttrium-aluminum-garnet laser irradiation ameliorates skin permeation and follicular delivery of antialopecia drugs.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Aljuffali, Ibrahim A; Li, Yi-Ching; Fang, Jia-You

2014-11-01

Alopecia usually cannot be cured because of the available drug therapy being unsatisfactory. To improve the efficiency of treatment, erbium-yttrium-aluminum-garnet (Er-YAG) laser treatment was conducted to facilitate skin permeation of antialopecia drugs such as minoxidil (MXD), diphencyprone (DPCP), and peptide. In vitro and in vivo percutaneous absorption experiments were carried out by using nude mouse skin and porcine skin as permeation barriers. Fluorescence and confocal microscopies were used to visualize distribution of permeants within the skin. Laser ablation at a depth of 6 and 10 μm enhanced MXD skin accumulation twofold to ninefold depending on the skin barriers selected. DPCP absorption showed less enhancement by laser irradiation as compared with MXD. An ablation depth of 10 μm could increase the peptide flux from zero to 4.99 and 0.33 μg cm(-2) h(-1) for nude mouse skin and porcine skin, respectively. The laser treatment also promoted drug uptake in the hair follicles, with DPCP demonstrating the greatest enhancement (sixfold compared with the control). The imaging of skin examined by microscopies provided evidence of follicular and intercellular delivery assisted by the Er-YAG laser. Besides the ablative effect of removing the stratum corneum, the laser may interact with sebum to break up the barrier function, increasing the skin delivery of antialopecia drugs. The minimally invasive, well-controlled approach of laser-mediated drug permeation offers a potential way to treat alopecia. This study's findings provide the basis for the first report on laser-assisted delivery of antialopecia drugs. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Age-related percutaneous penetration part 1: skin factors.

Science.gov (United States)

Konda, S; Meier-Davis, S R; Cayme, B; Shudo, J; Maibach, H I

2012-05-01

Changes in the skin that occur in the elderly may put them at increased risk for altered percutaneous penetration from pharmacotherapy along with potential adverse effects. Skin factors that may have a role in age-related percutaneous penetration include blood flow, pH, skin thickness, hair and pore density, and the content and structure of proteins, glycosaminoglycans (GAGs), water, and lipids. Each factor is examined as a function of increasing age along with its potential impact on percutaneous penetration. Additionally, topical drugs that successfully overcome the barrier function of the skin can still fall victim to cutaneous metabolism, thereby producing metabolites that may have increased or decreased activity. This overview discusses the current data and highlights the importance of further studies to evaluate the impact of skin factors in age-related percutaneous penetration.

Effects of topical application of aqueous solutions of hexoses on epidermal permeability barrier recovery rate after barrier disruption.

Science.gov (United States)

Denda, Mitsuhiro

2011-11-01

Previous studies have suggested that hexose molecules influence the stability of phospholipid bilayers. Therefore, the effects of topical application of all 12 stereoisomers of dextro-hexose on the epidermal barrier recovery rate after barrier disruption were evaluated. Immediately after tape stripping, 0.1 m aqueous solution of each hexose was applied on hairless mouse skin. Among the eight dextro-aldohexoses, topical application of altose, idose, mannose and talose accelerated the barrier recovery, while allose, galactose, glucose and gulose had no effect. Among the four dextro-ketohexoses, psicose, fructose, sorbose and tagatose all accelerated the barrier recovery. As the effects of hexoses on the barrier recovery rate appeared within 1 h, the mechanism is unlikely to be genomic. Instead, these hexoses may influence phase transition of the lipid bilayers of lamellar bodies and cell membrane, a crucial step in epidermal permeability barrier homeostasis. © 2011 John Wiley & Sons A/S.

Effects of air pollution on the skin: A review.

Science.gov (United States)

Puri, Poonam; Nandar, Shashi Kumar; Kathuria, Sushruta; Ramesh, V

2017-01-01

The increase in air pollution over the years has had major effects on the human skin. Various air pollutants such as ultraviolet radiation, polycyclic aromatic hydrocarbons, volatile organic compounds, oxides, particulate matter, ozone and cigarette smoke affect the skin as it is the outermost barrier. Air pollutants damage the skin by inducing oxidative stress. Although human skin acts as a biological shield against pro-oxidative chemicals and physical air pollutants, prolonged or repetitive exposure to high levels of these pollutants may have profound negative effects on the skin. Exposure to ultraviolet radiation has been associated with extrinsic skin aging and skin cancers. Cigarette smoke contributes to premature aging and an increase in the incidence of psoriasis, acne and skin cancers. It is also implicated in allergic skin conditions such as atopic dermatitis and eczema. Polyaromatic hydrocarbons are associated with extrinsic skin aging, pigmentation, cancers and acneiform eruptions. Volatile organic compounds have been associated with atopic dermatitis. Given the increasing levels of air pollution and its detrimental effects on the skin, it is advisable to use strategies to decrease air pollution.

A Randomized Controlled Trial Determining Variances in Ostomy Skin Conditions and the Economic Impact (ADVOCATE Trial).

Science.gov (United States)

Colwell, Janice C; Pittman, Joyce; Raizman, Rose; Salvadalena, Ginger

To compare ostomy-related costs and incidence of peristomal skin complications (PSCs) for ceramide-infused ostomy skin barriers and control skin barriers. The ADVOCATE trial is a multi-centered randomized controlled trial, and double-blinded international study with an adaptive design. The sample comprised 153 adults from 25 sites from the United States, Canada, and Europe. Participants were seen in hospital and outpatient care settings. Data were collected by investigators at each site during face-to-face visits and during telephone check-in calls between visits. Cost of care data were collected using a questionnaire developed specifically for the study. The peristomal skin was assessed using the Ostomy Skin Tool. Health-related quality of life was measured using the SF-12v2. Patient-reported outcomes were collected using a patient-centered study-specific questionnaire. Cost of care was analyzed via analysis of covariance comparing total cost of care for 12 weeks between the 2 groups. The incidence of PSC was analyzed via Barnard's exact test comparing the incidence of PSCs between the control and treatment groups. Tertiary outcomes were exploratory in nature and not statistically powered. Use of the ceramide-infused barrier significantly reduced stoma-related cost of care over a 12-week period, resulting in a $36.46 decrease in cost (14% relative decrease). The adjusted average costs were $223.73 in the treatment group and $260.19 in the control group (P = .017). The overall incidence of PSCs in the study was 47.7%; PSC incidence was 40.5% for the treatment group versus 55.4% for controls (P = .069, 95% confidence interval of the difference: -1.2 to 30.4). Significantly more participants using the ceramide-infused skin barrier were "very satisfied" with barrier performance (75% vs 55%; P = .033), prevention of leakage (63% vs 38%; P < .01), and prevention of itching (53% vs 31%; P = .016). General postoperative improvement in health-related quality of life was

Skin acceptability of a cosmetic moisturizer formulation in female subjects with sensitive skin

Directory of Open Access Journals (Sweden)

Nisbet SJ

2018-04-01

the exposed areas.Conclusion: This cosmetic moisturizer appears generally well tolerated and suitable for topical use in subjects with sensitive skin. Keywords: skin barrier, safety testing, sensitive skin, skin acceptability, irritation

Optimal barrier zones for stopping the invasion of Aedes aegypti mosquitoes via transgenic or sterile insect techniques

KAUST Repository

Lee, S. Seirin; Baker, Ruth E.; Gaffney, Eamonn A.; White, Steven M.

2013-01-01

(Release of Insects carrying a Dominant Lethal), for controlling invasion of the mosquito Aedes aegypti using a spatial stage-structured mathematical model. In particular, we explore the use of a barrier zone of sterile/transgenic insects to prevent

Successful Treatment of Acute Lethal Dose of Acrylamide Poisoning

Directory of Open Access Journals (Sweden)

Ali Banagozar Mohammadi

2015-03-01

Full Text Available Background: Acrylamide (C3H5NO is a vinyl monomer. This water-soluble crystalline solid is a colorless, odorless agent which is used in scientific laboratories and some industries. Acrylamide has cellular oxidative effects. Acute or chronic poisoning with this agent happens as a result of skin, respiratory, or oral contacts. Clinical manifestations depend on the dose, duration, and frequency of contact. Management of these patients consists of conservative and palliative therapies to reduce the oxidative effects. Case: The case was a 29-year-old girl with a Master of Sciences degree in genetics who worked in a university research center with previous history of depression. She had ingested 100cc of 30% Acrylamide solution for intentional suicide attempt. The patient was successfully managed using N-acetyl cysteine, vitamin C, and melatonin. Conclusion: Early diagnosis and appropriate treatment with recommended agents together with supportive therapies can save the life of patients exposed to potentially lethal doses of acrylamide, although intentional or accidental.

Chronic Exposure of Corals to Fine Sediments: Lethal and Sub-Lethal Impacts

Science.gov (United States)

Flores, Florita; Hoogenboom, Mia O.; Smith, Luke D.; Cooper, Timothy F.; Abrego, David; Negri, Andrew P.

2012-01-01

Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS) for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata) more than the upright branching species (Acropora millepora). The lowest sediment treatments that caused full colony mortality were 30 mg l−1 TSS (25 mg cm−2 day−1) for M. aequituberculata and 100 mg l−1 TSS (83 mg cm−2 day−1) for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue. PMID:22662225

Chronic exposure of corals to fine sediments: lethal and sub-lethal impacts.

Directory of Open Access Journals (Sweden)

Florita Flores

Full Text Available Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata more than the upright branching species (Acropora millepora. The lowest sediment treatments that caused full colony mortality were 30 mg l(-1 TSS (25 mg cm(-2 day(-1 for M. aequituberculata and 100 mg l(-1 TSS (83 mg cm(-2 day(-1 for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue.

New lethal disease involving type I and III collagen defect resembling geroderma osteodysplastica, De Barsy syndrome, and Ehlers-Danlos syndrome IV.

OpenAIRE

Jukkola, A; Kauppila, S; Risteli, L; Vuopala, K; Risteli, J; Leisti, J; Pajunen, L

1998-01-01

We describe the clinical findings and biochemical features of a male child suffering from a so far undescribed lethal connective tissue disorder characterised by extreme hypermobility of the joints, lax skin, cataracts, severe growth retardation, and insufficient production of type I and type III procollagens. His features are compared with Ehlers-Danlos type IV, De Barsy syndrome, and geroderma osteodysplastica, as these disorders show some symptoms and signs shared with our patient. The chi...

A Perspective on the Interplay of Ultraviolet-Radiation, Skin Microbiome and Skin Resident Memory TCRαβ+ Cells

Directory of Open Access Journals (Sweden)

VijayKumar Patra

2018-05-01

Full Text Available The human skin is known to be inhabited by diverse microbes, including bacteria, fungi, viruses, archaea, and mites. This microbiome exerts a protective role against infections by promoting immune development and inhibiting pathogenic microbes to colonize skin. One of the factors having an intense effect on the skin and its resident microbes is ultraviolet-radiation (UV-R. UV-R can promote or inhibit the growth of microbes on the skin and modulate the immune system which can be either favorable or harmful. Among potential UV-R targets, skin resident memory T cells (TRM stand as well positioned immune cells at the forefront within the skin. Both CD4+ or CD8+ αβ TRM cells residing permanently in peripheral tissues have been shown to play prominent roles in providing accelerated and long-lived specific immunity, tissue homeostasis, wound repair. Nevertheless, their response upon UV-R exposure or signals from microbiome are poorly understood compared to resident TCRγδ cells. Skin TRM survive for long periods of time and are exposed to innumerable antigens during lifetime. The interplay of TRM with skin residing microbes may be crucial in pathophysiology of various diseases including psoriasis, atopic dermatitis and polymorphic light eruption. In this article, we share our perspective about how UV-R may directly shape the persistence, phenotype, specificity, and function of skin TRM; and moreover, whether UV-R alters barrier function, leading to microbial-specific skin TRM, disrupting the healthy balance between skin microbiome and skin immune cells, and resulting in chronic inflammation and diseased skin.

Barrier function test: Laboratory evaluation of the protective function of some barrier creams against cashewnut shell oil

Directory of Open Access Journals (Sweden)

Pasricha J

1991-01-01

Full Text Available A barrier function test has been designed to screen the protective capacity of a cream against the cauterizing effect of cashew nut shell oil (CNSO on the skin. The test consists of applying the barrier cream on a 5 cm circular area of skin on the back of a human volunteer and then at its centre applying a 1 cm sq Whatman no. 3 paper disc soaked in the CNSO for 15 minutes and looking for the evidence of cauterization reaction after 48 hours. Of the various creams containing a variety of paraffins, bees wax, polyethylene glycols, methyl cellulose gel, and petrolatum, only polyethylene glycol (PEG cream was found to afford adequate protection against cashew nut shell oil. Addition of 10% zinc oxide or 10% kaolin to the PEG cream did not seem to afford any additional protection. Castor oil already being used by the workers was found to be inferior to the PEG cream.

Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival.

Science.gov (United States)

Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen

2015-12-22

Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

In vivo quantification of quantum dot systemic transport in C57BL/6 hairless mice following skin application post-ultraviolet radiation.

Science.gov (United States)

Jatana, Samreen; Palmer, Brian C; Phelan, Sarah J; Gelein, Robert; DeLouise, Lisa A

2017-04-14

Previous work has demonstrated size, surface charge and skin barrier dependent penetration of nanoparticles into the viable layers of mouse skin. The goal of this work was to characterize the tissue distribution and mechanism of transport of nanoparticles beyond skin, with and without Ultraviolet Radiation (UVR) induced skin barrier disruption. Atomic absorption spectroscopy (AAS), flow cytometry and confocal microscopy were used to examine the effect of UVR dose (180 and 360 mJ/cm 2 UVB) on the skin penetration and systemic distribution of quantum dot (QD) nanoparticles topically applied at different time-points post UVR using a hairless C57BL/6 mouse model. Results indicate that QDs can penetrate mouse skin, regardless of UVR exposure, as evidenced by the increased cadmium in the local lymph nodes of all QD treated mice. The average % recovery for all treatment groups was 69.68% with ~66.84% of the applied dose recovered from the skin (both epicutaneous and intracutaneous). An average of 0.024% of the applied dose was recovered from the lymph nodes across various treatment groups. When QDs are applied 4 days post UV irradiation, at the peak of the skin barrier defect and LC migration to the local lymph node, there is an increased cellular presence of QD in the lymph node; however, AAS analysis of local lymph nodes display no difference in cadmium levels due to UVR treatment. Our data suggests that Langerhans cells (LCs) can engulf QDs in skin, but transport to the lymph node may occur by both cellular (dendritic and macrophage) and non-cellular mechanisms. It is interesting that these specific nanoparticles were retained in skin similarly regardless of UVR barrier disruption, but the observed skin immune cell interaction with nanoparticles suggest a potential for immunomodulation, which we are currently examining in a murine model of skin allergy.

Skin Cancer Knowledge, Beliefs, Self-Efficacy, and Preventative Behaviors among North Mississippi Landscapers

Directory of Open Access Journals (Sweden)

Vinayak K. Nahar

2013-01-01

Full Text Available There are slightly over one million workers in the landscape service industry in the US. These workers have potential for high levels of solar ultraviolet radiation exposure, increasing their risk of skin cancer. A cross-sectional sample of 109 landscapers completed a self-administered questionnaire based on Health Belief Model (HBM. The participants correctly answered 67.1% of the knowledge questions, 69.7% believed they were more likely than the average person to get skin cancer, and 87.2% perceived skin cancer as a severe disease. Participants believed that the use of wide-brimmed hats, long sleeved shirts/long pants, and sunscreen was beneficial but reported low usage of these and other sun protective strategies. The primary barriers to using sun protection were “I forget to wear it” and “it is too hot to wear.” Of the HBM variables, perceived benefits outweighing perceived barrier (, and self-efficacy (, were correlated with sun protection behaviors. The reasons for absence of the relationship between perceived skin cancer threat and sun protection behaviors could be lack of skin cancer knowledge and low rate of personal skin cancer history.

Optimization of PIXE-sensitivity for detection of Ti in thin human skin sections

International Nuclear Information System (INIS)

Pallon, Jan; Garmer, Mats; Auzelyte, Vaida; Elfman, Mikael; Kristiansson, Per; Malmqvist, Klas; Nilsson, Christer; Shariff, Asad; Wegden, Marie

2005-01-01

Modern sunscreens contain particles like TiO 2 having sizes of 25-70 nm and acting as a reflecting substance. For cosmetic reasons the particle size is minimized. Questions have been raised to what degree these nano particles penetrate the skin barrier, and how they do affect the human. The EU funded project 'Quality of skin as a barrier to ultra-fine particles' - NANODERM has started with the purpose to evaluate the possible risks of TiO 2 penetration into vital skin layers. The purpose of the work presented here was to find the optimal conditions for micro-PIXE analysis of Ti in thin skin sections. In the skin region where Ti is expected to be found, the naturally occurring major elements phosphorus, chlorine, sulphur and potassium have steep gradients and thus influence the X-ray background in a non-predictable manner. Based on experimental studies of Ti-exposed human skin sections using proton energies ranging from 1.8-2.55 MeV, the corresponding PIXE detection limits for Ti were calculated. The energy that was found to be the most favourable, 1.9 MeV, was then selected for future studies

Skin Fungi from Colonization to Infection.

Science.gov (United States)

de Hoog, Sybren; Monod, Michel; Dawson, Tom; Boekhout, Teun; Mayser, Peter; Gräser, Yvonne

2017-07-01

Humans are exceptional among vertebrates in that their living tissue is directly exposed to the outside world. In the absence of protective scales, feathers, or fur, the skin has to be highly effective in defending the organism against the gamut of opportunistic fungi surrounding us. Most (sub)cutaneous infections enter the body by implantation through the skin barrier. On intact skin, two types of fungal expansion are noted: (A) colonization by commensals, i.e., growth enabled by conditions prevailing on the skin surface without degradation of tissue, and (B) infection by superficial pathogens that assimilate epidermal keratin and interact with the cellular immune system. In a response-damage framework, all fungi are potentially able to cause disease, as a balance between their natural predilection and the immune status of the host. For this reason, we will not attribute a fixed ecological term to each species, but rather describe them as growing in a commensal state (A) or in a pathogenic state (B).

Erbium:YAG laser resurfacing increases skin permeability and the risk of excessive absorption of antibiotics and sunscreens: the influence of skin recovery on drug absorption.

Science.gov (United States)

Lee, Woan-Ruoh; Shen, Shing-Chuan; Al-Suwayeh, Saleh A; Li, Yi-Ching; Fang, Jia-You

2012-06-01

While laser skin resurfacing is expected to result in reduced barrier function and increased risk of drug absorption, the extent of the increment has not yet been systematically investigated. We aimed to establish the skin permeation profiles of tetracycline and sunscreens after exposure to the erbium:yttrium-aluminum-garnet (Er:YAG) laser during postoperative periods. Physiological and histopathological examinations were carried out for 5 days after laser treatment on nude mice. Percutaneous absorption of the permeants was determined by an in vitro Franz cell. Ablation depths varied in reaching the stratum corneum (10 μm, 2.5 J/cm²) to approach the epidermis (25 μm, 6.25 J/cm²) and upper dermis (40 μm, 10 J/cm²). Reepithelialization evaluated by transepidermal water loss was complete within 2-4 days and depended on the ablation depth. Epidermal hyperplasia was observed in the 40-μm-treated group. The laser was sufficient to disrupt the skin barrier and allow the transport of the permeants into and across the skin. The laser fluence was found to play an important role in modulating skin absorption. A 25-μm ablation depth increased tetracycline flux 84-fold. A much smaller enhancement (3.3-fold) was detected for tetracycline accumulation within the skin. The laser with different fluences produced enhancement of oxybenzone skin deposition of 3.4-6.4-fold relative to the untreated group. No penetration across the skin was shown regardless of whether titanium dioxide was applied to intact or laser-treated skin. However, laser resurfacing increased the skin deposition of titanium dioxide from 46 to 109-188 ng/g. Tetracycline absorption had recovered to the level of intact skin after 5 days, while more time was required for oxybenzone absorption. The in vivo skin accumulation and plasma concentration revealed that the laser could increase tetracycline absorption 2-3-fold. The experimental results indicated that clinicians should be cautious when determining the

Permeation of platinum and rhodium nanoparticles through intact and damaged human skin

International Nuclear Information System (INIS)

Mauro, Marcella; Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo; Jaganjac, Morana; Bovenzi, Massimo; Filon, Francesca Larese

2015-01-01

The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na 2 PtC l6 and RhCl 3 ·3H 2 O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm −2  h −1 and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration

Permeation of platinum and rhodium nanoparticles through intact and damaged human skin

Energy Technology Data Exchange (ETDEWEB)

Mauro, Marcella [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy); Crosera, Matteo; Bianco, Carlotta; Adami, Gianpiero; Montini, Tiziano; Fornasiero, Paolo [University of Trieste, Department of Chemical and Pharmaceutical Sciences (Italy); Jaganjac, Morana [Rudjer Boskovic Institute, Laboratory for Oxidative Stress, Department of Molecular Medicine (Croatia); Bovenzi, Massimo; Filon, Francesca Larese, E-mail: larese@units.it [University of Trieste, Clinical Unit of Occupational Medicine, Department of Medical Sciences (Italy)

2015-06-15

The aim of the study was to evaluate percutaneous penetration of platinum and rhodium nanoparticles (PtNPs: 5.8 ± 0.9 nm, RhNPs: 5.3 ± 1.9 nm) through human skin. Salts compounds of these metals are sensitizers and some also carcinogenic agents. In vitro permeation experiments were performed using Franz diffusion cells with intact and damaged skin. PtNPs and RhNPs, stabilized with polyvinylpyrrolidone, were synthesized by reduction of Na{sub 2}PtC{sub l6} and RhCl{sub 3}·3H{sub 2}O respectively. Suspensions with a concentration of 2.0 g/L of PtNPs and RhNPs were dispersed separately in synthetic sweat at pH 4.5 and applied as donor phases to the outer surface of the skin for 24 h. Measurements of the content of the metals in the receiving solution and in the skin were performed subsequently. Rhodium skin permeation was demonstrated through damaged skin, with a permeation flux of 0.04 ± 0.04 μg cm{sup −2} h{sup −1} and a lag time of 7.9 ± 1.1 h, while no traces of platinum were found in receiving solutions. Platinum and rhodium skin-analysis showed significantly higher concentrations of the metals in damaged skin. Rh and Pt applied as NPs can penetrate the skin barrier and Rh can be found in receiving solutions. These experiments pointed out the need for skin contamination prevention, since even a minor injury to the skin barrier can significantly increase penetration.

Commensal–dendritic-cell interaction specifies a unique protective skin immune signature

Science.gov (United States)

Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine

2015-01-01

The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086

A novel continuous colour mapping approach for visualization of facial skin hydration and transepidermal water loss for four ethnic groups.

Science.gov (United States)

Voegeli, R; Rawlings, A V; Seroul, P; Summers, B

2015-12-01

The aim of this exploratory study was to develop a novel colour mapping approach to visualize and interpret the complexity of facial skin hydration and barrier properties of four ethnic groups (Caucasians, Indians, Chinese and Black Africans) living in Pretoria, South Africa. We measured transepidermal water loss (TEWL) and skin capacitance on 30 pre-defined sites on the forehead, cheek, jaw and eye areas of sixteen women (four per ethnic group) and took digital images of their faces. Continuous colour maps were generated by interpolating between each measured value and superimposing the values on the digital images. The complexity of facial skin hydration and skin barrier properties is revealed by these measurements and visualized by the continuous colour maps of the digital images. Overall, the Caucasian subjects had the better barrier properties followed by the Black African subjects, Chinese subjects and Indian subjects. Nevertheless, the two more darkly pigmented ethnic groups had superior skin hydration properties. Subtle differences were seen when examining the different facial sites. There exists remarkable skin capacitance and TEWL gradients within short distances on selected areas of the face. These gradients are distinctive in the different ethnic groups. In contrast to other reports, we found that darkly pigmented skin does not always have a superior barrier function and differences in skin hydration values are complex on the different parts of the face among the different ethnic groups. © 2015 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Influence of the thymus on the capacity of female mice to reject male skin grafts

International Nuclear Information System (INIS)

De Pirro, E.S.; Goldberg, E.H.

1989-01-01

The ability of female mice to reject H-Y-incompatible, but otherwise histocompatible, male skin grafts differs greatly from strain to strain, as is illustrated particularly by the C57BL strain (B6 and other sublines), termed ''H-Y rejector,'' because females invariably and promptly reject C57BL male skin, in comparison with the C3H strain, termed ''H-Y nonrejector,'' because females characteristically accept male C3H skin. To assess the extent to which the thymus governs this rejector vs. nonrejector status, two studies were made. In the first, lethally irradiated B6 (C57BL) and C3H females were restored with (B6 X C3H)F1 female cells, providing a graft-vs.-host-free milieu for differentiation of the same immunopoietic cell population in B6 vs. C3H hosts. With respect to (B6 X C3H)F1 male skin grafts, B6 hosts responded as rejectors and C3H hosts as nonrejectors, signifying that rejector vs. nonrejector status was determined by the host during immunopoiesis. That the main organ responsible for rejector vs. nonrejector determination is the thymus was shown in a second study. Previously thymectomized (B6 X C3H)F1 females received a histocompatible graft of thymus from either B6 or C3H neonatal females and were restored with donor-marked (B6-Ly-5a X C3H)F1 female cells after lethal irradiation. With respect to (B6 X C3H)F1 male skin grafts, the recipients of B6 thymus grafts responded generally as rejectors and the recipients of C3H thymus grafts responded uniformly as nonrejectors

MicroRNAs in skin tissue engineering.

Science.gov (United States)

Miller, Kyle J; Brown, David A; Ibrahim, Mohamed M; Ramchal, Talisha D; Levinson, Howard

2015-07-01

35.2 million annual cases in the U.S. require clinical intervention for major skin loss. To meet this demand, the field of skin tissue engineering has grown rapidly over the past 40 years. Traditionally, skin tissue engineering relies on the "cell-scaffold-signal" approach, whereby isolated cells are formulated into a three-dimensional substrate matrix, or scaffold, and exposed to the proper molecular, physical, and/or electrical signals to encourage growth and differentiation. However, clinically available bioengineered skin equivalents (BSEs) suffer from a number of drawbacks, including time required to generate autologous BSEs, poor allogeneic BSE survival, and physical limitations such as mass transfer issues. Additionally, different types of skin wounds require different BSE designs. MicroRNA has recently emerged as a new and exciting field of RNA interference that can overcome the barriers of BSE design. MicroRNA can regulate cellular behavior, change the bioactive milieu of the skin, and be delivered to skin tissue in a number of ways. While it is still in its infancy, the use of microRNAs in skin tissue engineering offers the opportunity to both enhance and expand a field for which there is still a vast unmet clinical need. Here we give a review of skin tissue engineering, focusing on the important cellular processes, bioactive mediators, and scaffolds. We further discuss potential microRNA targets for each individual component, and we conclude with possible future applications. Copyright © 2015 Elsevier B.V. All rights reserved.

The effect of ceramide-containing skin care products on eczema resolution duration.

Science.gov (United States)

Draelos, Zoe Diana

2008-01-01

Eczema is a common dermatologic condition that affects children as well as adults and is related to a defective skin barrier, which is most commonly caused by damage to the intercellular lipids from improper selection of skin cleansers and moisturizers. A new concept in skin care is the incorporation of ceramides into therapeutic cleansers and moisturizers. Ceramides are important components of the intercellular lipids that are necessary to link the protein-rich corneocytes into a waterproof barrier that is capable of protecting the underlying skin tissues and regulating body homeostasis. This study evaluated the effect of both a multilamellar vesicular emulsion (MVE) ceramide-containing liquid cleanser and moisturizing cream plus fluocinonide cream 0.05% compared with a bar cleanser plus fluocinonide cream 0.05% in the treatment of mild to moderate eczema. The addition of an MVE ceramide-containing liquid cleanser and moisturizing cream to a high-potency corticosteroid enhanced the treatment outcome of mild to moderate eczema compared with the use of a bar cleanser and high-potency corticosteroid in reducing disease duration, time to disease clearance, and symptoms. Thus, skin care product selection can have an important clinical effect on the clearance of mild to moderate eczema.

Acute skin reaction after fractionated irradiation

International Nuclear Information System (INIS)

Kozubek, S.

1983-01-01

Experimental data on acute mouse and pig skin reaction after fractionated γ or X irradiation have been analysed in terms of a new cell tissue kinetic model. The exponential-quadratic and generalized Huggett formulae have been used for cell lethality description. Fairly better results could be demonstrated with generalized Huggett formula. The speed of repopulation has been determined for fractionated regimes as well as for some irregular schedules. The repopulation is slower in the case of fractionated treatment. On considering the normal cell loss factor in the tissue, minimum cell cycle time has been calculated. Its value differs for various strains (Tsub(d)=28.8 hours for SAS/TO mice and Tsub(d) < or approximately 17 hours for WHT/Ht mice) and does not differ for plucked skin. The repopulation has been shown to follow exponential dependence after some latent period. Other factors influencing the effectiveness of radiation treatment (the length of the latent period or the changes of the survival curve during fractionated irradiation) have been considered, too

Quality of skin as a barrier to ultra-fine particles. Contribution of the IBA group to the NANODERM EU-5 project in 2003-2004

International Nuclear Information System (INIS)

Kertesz, Zs.; Szikszai, Z.; Kiss, A.Z.

2004-01-01

Complete text of publication follows. Micronised titanium-, zinc- or silicon-oxide is a widely used physical photoprotective agent as a component of various cosmetic products. Due to the small particle size (down to 15 nm) it is supposed, that the particles may pass through the uppermost horny skin layer, and penetrate into deeper vital skin layers. However, only a few experiments have been carried out on its penetration through the human epidermal barrier and its possible biological effects in vivo and in vitro, using the tape stripping method which has no lateral and limited depth resolution. A consortium consisting of 12 European universities and scientific institutes has been established under the leadership of the Fakultat fuer Physik und Geowissenchaft Universitat Leipzig, whose goal is to get quantitative information on the penetration of ultrafine particles in all strata of skin, on their penetration pathways as well as on their impact on human health [1]. The IBA group of the Atomki takes part in this project as a subcontractor of the Department of Dermatology, University of Debrecen, Hungary. Ion microscopy, electron microscopy and autoradiography are used to trace the penetration of the nanoparticles into the skin layers, molecular and cell-biological methods are applied to assess the skin response and activation of dermal cells. The IBA group of the Atomki takes part in WP3: Ion Microscopy Work Package together with five other nuclear microprobe laboratories. The participants provide quantitative elemental composition in all strata of skin with detection limits of about 1 μg/g and lateral resolution of 1-2 μm by applying various ion beam analytical techniques. Samples investigated by ion microscopy are 14-16 μm thick cryo-fixed freeze-dried sections of porcine and human skin. Since the sample preparation requires completely different treatment for ion microscopy than for conventional microscopy, the members of the IBA group, who already have

Mining of lethal recessive genetic variation in Danish cattle

DEFF Research Database (Denmark)

Das, Ashutosh

2015-01-01

in fertility. The primary objective of this PhD projekt was to identify recessive lethal gentic variants in the main Danish dairy cattle breed. Holstein-Friesian utilzing next generation sequencing (NGS) data. This study shows a potential for the use of the NGS-based reverse genetic approach in identifying...... lethal or semi-lethal recessive gentic variation...

The Use of Matriderm and Autologous Skin Graft in the Treatment of Full Thickness Skin Defects

Directory of Open Access Journals (Sweden)

Jang Hwan Min

2014-07-01

Full Text Available Background For patients with full thickness skin defects, autologous Split-thickness skin grafts (STSG are generally regarded as the mainstay of treatment. However, skin grafts have some limitations, including undesirable outcomes resulting from scars, poor elasticity, and limitations in joint movement due to contractures. In this study, we present outcomes of Matriderm grafts used for various skin tissue defects whether it improves on these drawbacks. Methods From January 2010 to March 2012, a retrospective review of patients who had undergone autologous STSG with Matriderm was performed. We assessed graft survival to evaluate the effectiveness of Matriderm. We also evaluated skin quality using a Cutometer, Corneometer, Tewameter, or Mexameter, approximately 12 months after surgery. Results A total of 31 patients underwent STSG with Matriderm during the study period. The success rate of skin grafting was 96.7%. The elasticity value of the portion on which Matriderm was applied was 0.765 (range, 0.635-0.800, the value of the trans-epidermal water loss (TEWL was 10.0 (range, 8.15-11.00 g/hr/m2, and the humidification value was 24.0 (range, 15.5-30.0. The levels of erythema and melanin were 352.0 arbitrary unit (AU (range, 299.25-402.75 AU and 211.0 AU (range, 158.25-297.00 AU, respectively. When comparing the values of elasticity and TEWL of the skin treated with Matriderm to the values of the surrounding skin, there was no statistically significant difference between the groups. Conclusions The results of this study demonstrate that a dermal substitute (Matriderm with STSG was adopted stably and with minimal complications. Furthermore, comparing Matriderm grafted skin to normal skin using Cutometer, Matriderm proved valuable in restoring skin elasticity and the skin barrier.

Lipid functions in skin: Differential effects of n-3 polyunsaturated fatty acids on cutaneous ceramides, in a human skin organ culture model.

Science.gov (United States)

Kendall, Alexandra C; Kiezel-Tsugunova, Magdalena; Brownbridge, Luke C; Harwood, John L; Nicolaou, Anna

2017-09-01

Ceramides are important for skin health, with a multitude of species found in both dermis and epidermis. The epidermis contains linoleic acid-Ester-linked Omega-hydroxylated ceramides of 6-Hydroxy-sphingosine, Sphingosine and Phytosphingosine bases (CER[EOH], CER[EOS] and CER[EOP], respectively), that are crucial for the formation of the epidermal barrier, conferring protection from environmental factors and preventing trans-epidermal water loss. Furthermore, a large number of ceramides, derivatives of the same sphingoid bases and various fatty acids, are produced by dermal and epidermal cells and perform signalling roles in cell functions ranging from differentiation to apoptosis. Supplementation with the n-3 polyunsaturated fatty acids (PUFA) eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have shown promise as therapeutic agents in a number of inflammatory skin conditions, altering the lipid profile of the skin and production of bioactive lipids such as the eicosanoids, docosanoids and endocannabinoids. In this study we wished to investigate whether EPA and DHA could also affect the ceramide profile in epidermis and dermis, and, in this way, contribute to formation of a robust lipid barrier and ceramide-mediated regulation of skin functions. Ex vivo skin explants were cultured for 6days, and supplemented with EPA or DHA (50μM). Liquid chromatography coupled to tandem mass spectrometry with electrospray ionisation was used to assess the prevalence of 321 individual ceramide species, and a number of sphingoid bases, phosphorylated sphingoid bases, and phosphorylated ceramides, within the dermis and epidermis. EPA augmented dermal production of members of the ceramide families containing Non-hydroxy fatty acids and Sphingosine or Dihydrosphingosine bases (CER[NS] and CER[NDS], respectively), while epidermal CER[EOH], CER[EOS] and CER[EOP] ceramides were not affected. DHA did not significantly affect ceramide production. Ceramide-1-phosphate levels in

Melatonin, mitochondria, and the skin.

Science.gov (United States)

Slominski, Andrzej T; Zmijewski, Michal A; Semak, Igor; Kim, Tae-Kang; Janjetovic, Zorica; Slominski, Radomir M; Zmijewski, Jaroslaw W

2017-11-01

The skin being a protective barrier between external and internal (body) environments has the sensory and adaptive capacity to maintain local and global body homeostasis in response to noxious factors. An important part of the skin response to stress is its ability for melatonin synthesis and subsequent metabolism through the indolic and kynuric pathways. Indeed, melatonin and its metabolites have emerged as indispensable for physiological skin functions and for effective protection of a cutaneous homeostasis from hostile environmental factors. Moreover, they attenuate the pathological processes including carcinogenesis and other hyperproliferative/inflammatory conditions. Interestingly, mitochondria appear to be a central hub of melatonin metabolism in the skin cells. Furthermore, substantial evidence has accumulated on the protective role of the melatonin against ultraviolet radiation and the attendant mitochondrial dysfunction. Melatonin and its metabolites appear to have a modulatory impact on mitochondrion redox and bioenergetic homeostasis, as well as the anti-apoptotic effects. Of note, some metabolites exhibit even greater impact than melatonin alone. Herein, we emphasize that melatonin-mitochondria axis would control integumental functions designed to protect local and perhaps global homeostasis. Given the phylogenetic origin and primordial actions of melatonin, we propose that the melatonin-related mitochondrial functions represent an evolutionary conserved mechanism involved in cellular adaptive response to skin injury and repair.

The effect of postirradiation holding at 22 degrees C on the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in gamma-irradiated HeLa x skin fibroblast human hybrid cells

International Nuclear Information System (INIS)

Redpath, J.L.; Antoniono, R.J.; Mendonca, M.S.; Sun, C.

1994-01-01

The effect of postirradiation holding at 22 degrees C on cell growth, progression of cells through the cell cycle, and the repair of sublethal, potentially lethal and potentially neoplastic transforming damage in γ-irradiated HeLa x skin fibroblast human hybrid cells has been examined. Cell growth and cell cycle progression were essentially stopped at this reduced temperature. Cell survival was dramatically reduced by holding confluent cultures for 6 h at 22 degrees C, as opposed to 37 degrees C, after 7.5 Gy γ radiation delivered at a rate of 2 Gy/min. Return of the cells to 37 degrees C for 6 h after holding at 22 degrees C did not result in increased survival. A similar effect was obtained when the cells were held at 22 degrees C between split-dose irradiation of log-phase cultures where no increase in survival was observed over a split-dose interval of 4 h. In this case a partial increase in survival was observed upon returning the cells to 37 degrees C for 3 h after holding at 22 degrees C for the first 3 h of the split-dose interval. Neoplastic transformation frequency was not enhanced by holding confluent cultures for 6 h at 22 degrees C after 7.5 Gy γ radiation. This is consistent with previous observations that misrepair of potentially neoplastic transforming damage already occurs at 37 degrees C. The overall results are interpreted in terms of the reduced temperature favoring misrepair, rather than inhibition of repair, of sublethal, potentially lethal and potentially transforming radiation damage. 24 refs., 5 figs., 3 tabs

Intravital multiphoton tomography as an appropriate tool for non-invasive in vivo analysis of human skin affected with atopic dermatitis

Science.gov (United States)

Huck, Volker; Gorzelanny, Christian; Thomas, Kai; Mess, Christian; Dimitrova, Valentina; Schwarz, Martin; Riemann, Iris; Niemeyer, Verena; Luger, Thomas A.; König, Karsten; Schneider, Stefan W.

2011-03-01

Increasing incidence of inflammatory skin diseases such as Atopic Dermatitis (AD) has been noted in the past years. According to recent estimations around 15% of newborn subjects are affected with a disease severity that requires medical treatment. Although its pathogenesis is multifactorial, recent reports indicate that an impaired physical skin barrier predispose for the development of AD. The major part of this barrier is formed by the stratum corneum (SC) wherein corneocytes are embedded in a complex matrix of proteins and lipids. Its components were synthesized in the stratum granulosum (SG) and secreted via lamellar bodies at the SC/SG interface. Within a clinical in vivo study we focused on the skin metabolism at the SC/SG interface in AD affected patients in comparison to healthy subjects. Measurement of fluorescence life-time of NADH provides access to the metabolic state of skin. Due to the application of a 5D intravital tomographic skin analysis we facilitate the non-invasive investigation of human epidermis in the longitudinal course of AD therapy. We could ascertain by blinded analysis of 40 skin areas of 20 patients in a three month follow-up that the metabolic status at the SC/SG interface was altered in AD compromised skin even in non-lesional, apparent healthy skin regions. This illustrates an impaired skin barrier formation even at non-affected skin of AD subjects appearing promotive for the development of acute skin inflammation. Therefore, our findings allow a deeper understanding of the individual disease development and the improved management of the therapeutic intervention in clinical application.

The effectiveness of using a bath oil to reduce signs of dry skin: A randomized controlled pragmatic study.

Science.gov (United States)

Kottner, Jan; Kanti, Varvara; Dobos, Gabor; Hahnel, Elisabeth; Lichterfeld-Kottner, Andrea; Richter, Claudia; Hillmann, Kathrin; Vogt, Annika; Blume-Peytavi, Ulrike

2017-01-01

Dry skin (xerosis cutis) is increasingly recognized as a relevant health problem in daily life and in health and nursing care. The use of bath additives such as oils is common to reduce dry skin, but empirical evidence supporting this practice is limited. The aim of this study was to investigate the effectiveness of using a bath oil additive in improving skin barrier function and ameliorating dry skin in comparison to non-oil containing skin cleansers for bathing or showering. Single centre randomized observer blind pragmatic parallel group trial. Outpatient/community care. Volunteers showing clinically mild to moderate dry skin recruited from the city of Berlin. Healthy children and adults were randomly assigned to use either a commercially available bath oil or to continue using their regular non-oil containing skin cleansers every other day over a study period of 28days. Skin barrier parameters and the severity of dry skin were assessed at baseline and at two follow-up visits at the study centre. Transepidermal water loss was the primary outcome. All sixty participants randomized completed the trial. Median age was 32.5 (IQR 8.3 to 69) years. At the end of study the mean transepidermal water loss in the intervention group was statistically significant lower compared to the control group (mean difference -1.9 (95% CI -3.1 to -0.8) g/m 2 /h). Stratum corneum hydration was statistically significantly higher in the intervention group at the end of the study. Skin surface pH and roughness were comparable in both groups and remained unchanged, while both groups showed a trend to improvement in dry skin symptoms CONCLUSIONS: This pragmatic trial provides empirical evidence that the regular use of the investigated bath oil is effective in improving the skin barrier function in children and adults with mild dry skin when used in routine skin care and supports its use as a basic element for the management of a broad spectrum of dry skin conditions. Clinical

Active agents in common skin care products.

Science.gov (United States)

Draelos, Zoe Diana

2010-02-01

Skin care products are numerous and perplexing, yet the majority fall into the moisturizer category. Moisturizers are substances designed to improve and maintain the skin barrier. They serve as a vehicle for the delivery of active ingredients that minimize facial lines of dehydration, deliver photoprotection, and provide antioxidant properties. Moisturizers are based on occlusive substances, such as petrolatum and dimethicone, and humectant substances, such as glycerin, with a variety of sunscreens and botanicals for added functionality and marketing impact. This article reviews these common active agents. The plethora of over-the-counter skin care products available for patient purchase is overwhelming, yet there is certain commonality among 80 percent of the formulations. The majority of the products are moisturizers with added ingredients to support marketing claims. Whether the product is a facial foundation, an antiaging night cream, a sunscreen, a topical antioxidant, or a skin-lightening serum, the formulation is basically a moisturizer. Sunscreen is the most biologically active antiaging ingredient in skin care products, but the antiinflammatory and antioxidant effects of botanicals possess tremendous marketing appeal.

Protective properties of plasma of burnt and irradiated rats against lethal effect of endotoxins in vivo

Energy Technology Data Exchange (ETDEWEB)

Budagov, R S; Chureyeva, L N

1984-10-01

The purpose of this work was to estimate protective properties of plasma in disease with increased endotoxemia. Burns and acute radiation sickness were used as models of suppression of physiological mechanisms of detoxication. Experiments were performed on male Wistar rats and mice, which received 3rd degree burns over 15% of the body surface, whole body gamma irradiation at 7.5 Gr or both. At 3 hours, 3, 7 and 12 days after the exposure the animals were decapitated and blood collected. The irradiated mice received 0.2 ml endotoxin intraperitoneally, 1.0 ml freshly prepared rat plasma, then the lethality of the mice in 24 hours was observed. It was found that the plasma of intact rats was capable of decreasing the lethal effects of S. typhimurium and E. coli endotoxins in vivo in mice. Deep skin burns, acute radiation sickness and the combined effects of radiation and thermal injury did not change this phenomenon. The plasma of the experimental rats retained the protective properties at various periods of time after the thermal, radiation and combined exposures. The functioning of the humoral detoxication mechanism is radioresistant, indirectly indicating the nonimmunoglobulin nature of endotoxin inactivators. 19 references.

MKLN1 splicing defect in dogs with lethal acrodermatitis.

Directory of Open Access Journals (Sweden)

Anina Bauer

2018-03-01

Full Text Available Lethal acrodermatitis (LAD is a genodermatosis with monogenic autosomal recessive inheritance in Bull Terriers and Miniature Bull Terriers. The LAD phenotype is characterized by poor growth, immune deficiency, and skin lesions, especially at the paws. Utilizing a combination of genome wide association study and haplotype analysis, we mapped the LAD locus to a critical interval of ~1.11 Mb on chromosome 14. Whole genome sequencing of an LAD affected dog revealed a splice region variant in the MKLN1 gene that was not present in 191 control genomes (chr14:5,731,405T>G or MKLN1:c.400+3A>C. This variant showed perfect association in a larger combined Bull Terrier/Miniature Bull Terrier cohort of 46 cases and 294 controls. The variant was absent from 462 genetically diverse control dogs of 62 other dog breeds. RT-PCR analysis of skin RNA from an affected and a control dog demonstrated skipping of exon 4 in the MKLN1 transcripts of the LAD affected dog, which leads to a shift in the MKLN1 reading frame. MKLN1 encodes the widely expressed intracellular protein muskelin 1, for which diverse functions in cell adhesion, morphology, spreading, and intracellular transport processes are discussed. While the pathogenesis of LAD remains unclear, our data facilitate genetic testing of Bull Terriers and Miniature Bull Terriers to prevent the unintentional production of LAD affected dogs. This study may provide a starting point to further clarify the elusive physiological role of muskelin 1 in vivo.

Superresolution and Fluorescence Dynamics Evidence Reveal That Intact Liposomes Do Not Cross the Human Skin Barrier

DEFF Research Database (Denmark)

Dreier, Jes; Sørensen, Jens A; Brewer, Jonathan R

2016-01-01

In this study we use the combination of super resolution optical microscopy and raster image correlation spectroscopy (RICS) to study the mechanism of action of liposomes as transdermal drug delivery systems in human skin. Two different compositions of liposomes were applied to newly excised human...... skin, a POPC liposome and a more flexible liposome containing the surfactant sodium cholate. Stimulated emission depletion microscopy (STED) images of intact skin and cryo-sections of skin treated with labeled liposomes were recorded displaying an optical resolution low enough to resolve the 100 nm...... liposomes in the skin. The images revealed that virtually none of the liposomes remained intact beneath the skin surface. RICS two color cross correlation diffusion measurements of double labeled liposomes confirmed these observations. Our results suggest that the liposomes do not act as carriers...

Lethality of Rendang packaged in multilayer retortable pouch with sterilization process

Science.gov (United States)

Praharasti, A. S.; Kusumaningrum, A.; Frediansyah, A.; Nurhikmat, A.; Khasanah, Y.; Suprapedi

2017-01-01

Retort Pouch had become a choice to preserve foods nowadays, besides the used of the can. Both had their own advantages, and Retort Pouch became more popular for the reason of cheaper and easier to recycle. General Method usually used to estimate the lethality of commercial heat sterilization process. Lethality value wa s used for evaluating the efficacy of the thermal process. This study aimed to find whether different layers of pouch materials affect the lethality value and to find differences lethality in two types of multilayer retort pouch, PET/Aluminum Foil/Nylon/RCPP and PET/Nylon/Modified Aluminum/CPP. The result showed that the different layer arrangement was resulted different Sterilization Value (SV). PET/Nylon/Modified Aluminum/CPP had better heat penetration, implied by the higher value of lethality. PET/Nylon/Modified Aluminum/CPP had the lethality value of 6,24 minutes, whereas the lethality value of PET/Aluminum Foil/Nylon/RCPP was 3,54 minutes.

Next generation human skin constructs as advanced tools for drug development.

Science.gov (United States)

Abaci, H E; Guo, Zongyou; Doucet, Yanne; Jacków, Joanna; Christiano, Angela

2017-11-01

Many diseases, as well as side effects of drugs, manifest themselves through skin symptoms. Skin is a complex tissue that hosts various specialized cell types and performs many roles including physical barrier, immune and sensory functions. Therefore, modeling skin in vitro presents technical challenges for tissue engineering. Since the first attempts at engineering human epidermis in 1970s, there has been a growing interest in generating full-thickness skin constructs mimicking physiological functions by incorporating various skin components, such as vasculature and melanocytes for pigmentation. Development of biomimetic in vitro human skin models with these physiological functions provides a new tool for drug discovery, disease modeling, regenerative medicine and basic research for skin biology. This goal, however, has long been delayed by the limited availability of different cell types, the challenges in establishing co-culture conditions, and the ability to recapitulate the 3D anatomy of the skin. Recent breakthroughs in induced pluripotent stem cell (iPSC) technology and microfabrication techniques such as 3D-printing have allowed for building more reliable and complex in vitro skin models for pharmaceutical screening. In this review, we focus on the current developments and prevailing challenges in generating skin constructs with vasculature, skin appendages such as hair follicles, pigmentation, immune response, innervation, and hypodermis. Furthermore, we discuss the promising advances that iPSC technology offers in order to generate in vitro models of genetic skin diseases, such as epidermolysis bullosa and psoriasis. We also discuss how future integration of the next generation human skin constructs onto microfluidic platforms along with other tissues could revolutionize the early stages of drug development by creating reliable evaluation of patient-specific effects of pharmaceutical agents. Impact statement Skin is a complex tissue that hosts various

Intravital multiphoton tomography as a novel tool for non-invasive in vivo analysis of human skin affected with atopic dermatitis

Science.gov (United States)

Huck, Volker; Gorzelanny, Christian; Thomas, Kai; Niemeyer, Verena; Luger, Thomas A.; König, Karsten; Schneider, Stefan W.

2010-02-01

Atopic Dermatitis (AD) is an inflammatory disease of human skin. Its pathogenesis is still unknown; however, dysfunctions of the epidermal barrier and the immune response are regarded as key factors for the development of AD. In our study we applied intravital multiphoton tomography (5D-IVT), equipped with a spectral-FLIM module for in-vivo and ex-vivo analysis of human skin affected with AD. In addition to the morphologic skin analysis, FLIM technology gain access to the metabolic status of the epidermal cells referring to the NADH specific fluorescence lifetime. We evaluated a characteristic 5D-IVT skin pattern of AD in comparison to histological sections and detected a correlation with the disease activity measured by SCORAD. FLIM analysis revealed a shift of the mean fluorescence lifetime (taum) of NADH, indicating an altered metabolic activity. Within an ex-vivo approach we have investigated cryo-sections of human skin with or without barrier defects. Spectral-FLIM allows the detection of autofluorescent signals that reflect the pathophysiological conditions of the defect skin barrier. In our study the taum value was shown to be different between healthy and affected skin. Application of the 5D-IVT allows non-invasive in-vivo imaging of human skin with a penetration depth of 150 μm. We could show that affected skin could be distinguished from healthy skin by morphological criteria, by FLIM and by spectral-FLIM. Further studies will evaluate the application of the 5D-IVT technology as a diagnostic tool and to monitor the therapeutic efficacy.

Antenatal Corticosteroids and Postnatal Fluid Restriction Produce Differential Effects on AQP3 Expression, Water Handling, and Barrier Function in Perinatal Rat Epidermis

Directory of Open Access Journals (Sweden)

Johan Agren

2010-01-01

Full Text Available Loss of water through the immature skin can lead to hypothermia and dehydration in preterm infants. The water and glycerol channel aquaglyceroporin-3 (AQP3 is abundant in fetal epidermis and might influence epidermal water handling and transepidermal water flux around birth. To investigate the role of AQP3 in immature skin, we measured in vivo transepidermal water transport and AQP3 expression in rat pups exposed to clinically relevant fluid homeostasis perturbations. Preterm (E18 rat pups were studied after antenatal corticosteroid exposure (ANS, and neonatal (P1 rat pups after an 18 h fast. Transepidermal water loss (TEWL and skin hydration were determined, AQP3 mRNA was quantified by RT-PCR, and in-situ hybridization and immunocytochemistry were applied to map AQP3 expression. ANS resulted in an improved skin barrier (lower TEWL and skin hydration, while AQP3 mRNA and protein increased. Fasting led to loss of barrier integrity along with an increase in skin hydration. These alterations were not paralleled by any changes in AQP3. To conclude, antenatal corticosteroids and early postnatal fluid restriction produce differential effects on skin barrier function and epidermal AQP3 expression in the rat. In perinatal rats, AQP3 does not directly determine net water transport through the skin.

Studies on the relationship between epidermal cell turnover kinetics and permeability of hairless mouse skin

International Nuclear Information System (INIS)

Han, S.R.

1988-01-01

The primary aim of this study was to develop non-invasive, physical means to quantitatively assess the epidermal turnover kinetics and barrier properties of the skin and relate these to the cutaneous irritation which results from ultraviolet light irradiation and mold thermal burns. After systematically injecting radiolabeled glycine, the appearance of radioactivity at the skin's surface indicated the transit time of radiolabeled cells through the skin. By plotting the data as the cumulative specific activity against time and then fitting them with a third order polynomial equation, it is possible to estimate the turnover time of the stratum corneum. The skin turnover was coordinated with non-invasive transepidermal water loss (TEWL) studies determined with an evaporimeter. In vitro diffusion studies of the permeability of hydrocortisone through UVB irradiated and thermally burned skin were also performed. The studies indicated that irritated skin offers a relatively low diffusional resistance to hydrocortisone. Depending on the severity of the trauma, the increases in hydrocortisone's permeability coefficient through irritated skin ranged from a low of about 2 times normal to a high of about 210 times normal. Trauma-induced changes in hydrocortisone permeability parallel changes in TEWL, proving that the barrier deficient state resulting from rapid epidermal turnover is a general phenomenon

Measurement of skin permeation/penetration of nanoparticles for their safety evaluation.

Science.gov (United States)

Kimura, Eriko; Kawano, Yuichiro; Todo, Hiroaki; Ikarashi, Yoshiaki; Sugibayashi, Kenji

2012-01-01

The aim of the present study was to quantitatively evaluate the skin permeation/penetration of nanomaterials and to consider their penetration pathway through skin. Firstly, penetration/permeation of a model fluorescent nanoparticle, Fluoresbrite®, was determined through intact rat skin and several damaged skins. Fluoresbrite® permeated through only needle-punctured skin. The permeation profiles of soluble high molecular compounds, fluorescein isothiocyanate-dextrans (FITC-dextrans, FDs), with different molecular weights were also measured for comparison. The effects of molecular sizes and different skin pretreatments on the skin barrier were determined on the skin penetration/permeation of Fluoresbrite® and FDs. Fluoresbrite® was not permeated the intact skin, but FDs were permeated the skin. The skin distribution of titanium dioxide and zinc oxide nanoparticles was also observed after topical application of commercial cosmetics. Nanoparticles in sunscreen cosmetics were easily distributed into the groove and hair follicles after their topical application, but seldom migrated from the groove or follicles to viable epidermis and dermis. The obtained results suggested that nanoparticles did not permeate intact skin, but permeated pore-created skin. No or little permeation was observed for these nanomaterials through the stratum corneum.

[Bladder tumor lethality. Results in the autonomous community of Rioja between 1975-1991].

Science.gov (United States)

Fernández Fernández, A; Gil Fabra, J; Fernández Ruíz, M; Angulo Castellanos, M G; Blanco Martín, E; Otero Mauricio, G

1998-01-01

Between 1975-1991, a total of 557 cases of bladder carcinoma were identified in the Autonomous Community of La Rioja (CAR) which were followed up to December 1994. The overall lethality was 21.9%. 492 cases with 22.35% lethality were identified in males. In females, however, there was 65 cases with 18.46% lethality. The comparison of males and females lethality resulted in p = 0.525. Lethality between cases diagnosed within each 5-year period analyzed is: 1975-1981: 177 cases, lethality 23.72%. 1982-1986: 168 cases, lethality 30.95%. 1987-1991: 212 cases, lethality 13.20%. Between the first and the second 5-year periods, p = 0.132; between the first and third 5-year periods p = 0.007 and between the second and third 5-year periods p CAR for a 22.35% lethality. Lethality is higher in males that in females but the difference is not statistically significant. In the last 5-year period assessed, 1987-1991, a reduction of lethality from bladder neoplasms has been documented.

Mathematical models to describe iontophoretic transport in vitro and in vivo and the effect of current application on the skin barrier.

Science.gov (United States)

Gratieri, Taís; Kalia, Yogeshvar N

2013-02-01

The architecture and composition of the stratum corneum make it a particularly effective barrier against the topical and transdermal delivery of hydrophilic molecules and ions. As a result, different strategies have been explored in order to expand the range of therapeutic agents that can be administered by this route. Iontophoresis involves the application of a small electric potential to increase transport into and across the skin. Since current flow is preferentially via transport pathways with at least some aqueous character, it is ideal for hydrosoluble molecules containing ionisable groups. Hence, the physicochemical properties that limit partitioning and passive diffusion through the intercellular lipid matrix are beneficial for electrically-assisted delivery. The presence of fixed ionisable groups in the skin (pI 4-4.5) means that application of the electric field results in a convective solvent flow (i.e., electroosmosis) in the direction of ion motion so as to neutralise membrane charge. Hence, under physiological conditions, cation electrotransport is due to both electromigration and electroosmosis-their relative contribution depends on the formulation conditions and the physicochemical properties of the permeant. Different mathematical models have been developed to provide a theoretical framework in order to explain iontophoretic transport kinetics. They usually involve solutions of the Nernst-Planck equation - using either the constant field (Goldman) or electroneutrality (Nernst) approximations - with or without terms for the convective solvent flow component. Investigations have also attempted to elucidate the nature of ion transport pathways and to explain the effect of current application on the electrical properties of the skin-more specifically, the stratum corneum. These studies have led to the development of different equivalent circuit models. These range from simple parallel arrangements of a resistor and a capacitor to the inclusion of the

BP180 dysfunction triggers spontaneous skin inflammation in mice.

Science.gov (United States)

Zhang, Yang; Hwang, Bin-Jin; Liu, Zhen; Li, Ning; Lough, Kendall; Williams, Scott E; Chen, Jinbo; Burette, Susan W; Diaz, Luis A; Su, Maureen A; Xiao, Shengxiang; Liu, Zhi

2018-06-04

BP180, also known as collagen XVII, is a hemidesmosomal component and plays a key role in maintaining skin dermal/epidermal adhesion. Dysfunction of BP180, either through genetic mutations in junctional epidermolysis bullosa (JEB) or autoantibody insult in bullous pemphigoid (BP), leads to subepidermal blistering accompanied by skin inflammation. However, whether BP180 is involved in skin inflammation remains unknown. To address this question, we generated a BP180-dysfunctional mouse strain and found that mice lacking functional BP180 (termed Δ NC16A ) developed spontaneous skin inflammatory disease, characterized by severe itch, defective skin barrier, infiltrating immune cells, elevated serum IgE levels, and increased expression of thymic stromal lymphopoietin (TSLP). Severe itch is independent of adaptive immunity and histamine, but dependent on increased expression of TSLP by keratinocytes. In addition, a high TSLP expression is detected in BP patients. Our data provide direct evidence showing that BP180 regulates skin inflammation independently of adaptive immunity, and BP180 dysfunction leads to a TSLP-mediated itch. The newly developed mouse strain could be a model for elucidation of disease mechanisms and development of novel therapeutic strategies for skin inflammation and BP180-related skin conditions.

Identification of multi-drug resistant Pseudomonas aeruginosa clinical isolates that are highly disruptive to the intestinal epithelial barrier

Directory of Open Access Journals (Sweden)

Shevchenko Olga

2006-06-01

Full Text Available Abstract Background Multi-drug resistant Pseudomonas aeruginosa nosocomial infections are increasingly recognized worldwide. In this study, we focused on the virulence of multi-drug resistant clinical strains P. aeruginosa against the intestinal epithelial barrier, since P. aeruginosa can cause lethal sepsis from within the intestinal tract of critically ill and immuno-compromised patients via mechanisms involving disruption of epithelial barrier function. Methods We screened consecutively isolated multi-drug resistant P. aeruginosa clinical strains for their ability to disrupt the integrity of human cultured intestinal epithelial cells (Caco-2 and correlated these finding to related virulence phenotypes such as adhesiveness, motility, biofilm formation, and cytotoxicity. Results Results demonstrated that the majority of the multi-drug resistant P. aeruginosa clinical strains were attenuated in their ability to disrupt the barrier function of cultured intestinal epithelial cells. Three distinct genotypes were found that displayed an extreme epithelial barrier-disrupting phenotype. These strains were characterized and found to harbor the exoU gene and to display high swimming motility and adhesiveness. Conclusion These data suggest that detailed phenotypic analysis of the behavior of multi-drug resistant P. aeruginosa against the intestinal epithelium has the potential to identify strains most likely to place patients at risk for lethal gut-derived sepsis. Surveillance of colonizing strains of P. aeruginosa in critically ill patients beyond antibiotic sensitivity is warranted.

Hydration effects on the barrier function of stratum corneum lipids: Raman analysis of ceramides 2, III and 5.

Science.gov (United States)

Tfayli, Ali; Jamal, Dima; Vyumvuhore, Raoul; Manfait, Michel; Baillet-Guffroy, Arlette

2013-11-07

The stratum corneum is the outermost layer of the skin; its barrier function is highly dependent on the composition and the structure as well as the organization of lipids in its extracellular matrix. Ceramides, free fatty acids and cholesterol represent the major lipid classes present in this matrix. They play an important role in maintaining the normal hydration levels required for the normal physiological function. Despite the advancement in the understanding of the structure, composition and the function of the stratum corneum (SC), the concern of "dry skin" remains important in dermatology and care research. Most studies focus on the quantification of water in the skin using different techniques including Raman spectroscopy, while the studies that investigate the effect of hydration on the quality of the barrier function of the skin are limited. Raman spectroscopy provides structural, conformational and organizational information that could help elucidate the effect of hydration on the barrier function of the skin. In order to assess the effect of relative humidity on the lipid barrier function; we used Raman spectroscopy to follow-up the evolution of the conformation and the organization of three synthetic ceramides (CER) differing from each other by the nature of their polar heads (sphingosine, phytosphingosine and α hydroxyl sphingosine), CER 2, III and 5 respectively. CER III and 5 showed a more compact and ordered organization with stronger polar interactions at intermediate relative humidity values, while CER 2 showed opposite tendencies to those observed with CER III and 5.

Infant Skin Care Products: What Are the Issues?

Science.gov (United States)

Kuller, Joanne McManus

2016-10-01

Infant skin is susceptible to dryness and irritation from external factors, including topical skin care products not formulated for the infant's skin. This may increase the risk of contact dermatitis. Parents frequently express concern regarding potential harm from ingredients in skin care products and seek information. This is complicated by several skin care myths. The purpose of this literature review was to provide evidence-based information to educate parents on the use of products for preterm and term infants. Multiple searches using PubMed were conducted including the search terms "infant skin care," "infant products," "infant bath," "emollients," "diaper skin care," and "diaper wipes." Reference lists of comprehensive reviews were also scanned. Google searches were used to assess consumer information, product information, and regulatory guidelines. There is little scientific evidence to support safety of natural/organic products on infant skin. Raw materials originate from different sources, complicating testing and comparisons of ingredients. Research shows that cleansers formulated for infant skin do not weaken the skin barrier the way harsher soaps and detergents can. Oils with the lowest oleic acid content provide a lower risk of irritant contact dermatitis. Nurses must be informed about natural and organic products, preservatives, and fragrances and know the definition of commonly used marketing terms. Decisions regarding the use of infant products in preterm and term infants should be evidence based. More research is needed to support claims regarding the safety of products used on infant skin.

Functional and morphological studies of photodamaged skin on the hands of middle-aged Japanese golfers.

Science.gov (United States)

Kikuchi-Numagami, K; Suetake, T; Yanai, M; Takahashi, M; Tanaka, M; Tagami, H

2000-06-01

The skin of golfers' hands provides a suitable model to study the effect of chronic sun exposure, because one of their hands is exposed to the outer environment, especially sunlight, while the other one is always protected by a glove during play. Our purpose was to find out the influence of photodamage on the properties of the skin surface of middle-aged Japanese by using non-invasive methods. We measured hydration state, and water barrier function of the stratum corneum (SC) and the color of the skin of the dorsum of the hands. In a separate study, we evaluated the skin surface contour by using replicas taken from the skin in a slightly stretched or relaxed position. We found a significant decrease in hydration of the skin surface of the exposed skin as compared to that of the protected skin, whereas no such difference was found with transepidermal water loss, a parameter for water barrier function of the SC. Luminance of skin color was also reduced in the sun-exposed skin. Replica analysis revealed that large wrinkles developing in a relaxed position were more prominent on the exposed than on the protected skin, while fine furrows noted in a slightly stretched position were shallower on the former than the latter. The data obtained indicate that the chronically exposed skin of golfers' hands shows morphological and functional changes resulting from long time exposure to the outer environment especially sunlight. Furthermore, bioengineering non-invasive methods are found to be useful to detect early photodamage of the skin in a more quantitative fashion which is rather difficult to demonstrate clinically.

Humanitarian Algorithms : A Codified Key Safety Switch Protocol for Lethal Autonomy

OpenAIRE

Nyagudi, Nyagudi Musandu

2014-01-01

With the deployment of lethal autonomous weapons, there is the requirement that any such platform complies with the precepts of International Humanitarian Law. Humanitarian Algorithms[9: p. 9] ensure that lethal autonomous weapon systems perform military/security operations, within the confines of International Humanitarian Law. Unlike other existing techniques of regulating lethal autonomy this scheme advocates for an approach that enables Machine Learning. Lethal autonomous weapons must be ...

A new body moisturizer increases skin hydration and improves atopic dermatitis symptoms among children and adults.

Science.gov (United States)

Simpson, Eric; Dutronc, Yves

2011-07-01

Moisturizers result in an increase of skin hydration and restoration of the skin barrier function and play a prominent role in the longterm management of atopic dermatitis (AD). Cetaphil RestoradermTM Moisturizer (CRM) contains novel ingredients specifically designed for AD, and its effects on skin hydration, skin barrier function and signs of AD were assessed in four studies, three of which were evaluator-blinded, randomized and intra-individual comparison trials. A single application of CRM induced significantly greater hydration than the untreated control for at least 24 hours (P is less than 0.001). After the skin was disrupted with 0.5% sodium dodecyl sulfate (SDS), applications of CRM led to a more rapid restoration of skin barrier function and maintained significantly greater skin hydration compared to the untreated control (both P is less than 0.05). After four weeks of twice-daily CRM application among subjects with a history of AD, a significant decrease of itching/stinging scores compared to baseline was reported, as well as an improvement in the quality-of- life and a high level of satisfaction regarding the product. When CRM was used as an adjunctive treatment with topical steroid for four weeks among subjects with mild-to-moderate AD, a more rapid decrease of overall disease severity was observed on days 7, 14 and 21 by the blinded investigator (P is less than 0.05), compared to steroid treatment alone. In summary, CRM is suitable for the specific needs of patients with AD and can be used either alone for long-term management or in adjunction with traditional treatment for both short and long-term disease control.

Comparison of atmospheric microplasma and plasma jet irradiation for increasing of skin permeability

International Nuclear Information System (INIS)

Shimizu, K; Tran, N A; Hayashida, K; Blajan, M

2016-01-01

Atmospheric plasma is attracting interest for medical applications such as sterilization, treatment of cancer cells and blood coagulation. Application of atmospheric plasma in dermatology has potential as a novel tool for wound healing, skin rejuvenation and treatment of wrinkles. In this study, we investigated the enhancement of percutaneous absorption of dye as alternative agents of transdermal drugs. Hypodermic needles are often the only way to deliver large-molecule drugs into the dermis, although a safe transdermal drug delivery method that does not require needles would be desirable. We therefore explored the feasibility of using atmospheric microplasma irradiation to enhance percutaneous absorption of drugs, as an alternative delivery method to conventional hypodermic needles. Pig skin was used as a biological sample, exposed to atmospheric microplasma, and analyzed by attenuated total reflection-Fourier transform infrared spectroscopy. A tape stripping test, a representative method for evaluating skin barrier performance, was also conducted for comparison. Transepidermal water loss (TEWL) was measured and compared with and without atmospheric microplasma irradiation, to quantify water evaporation from the inner body through the skin barrier. The results show that the stratum corneum, the outermost skin layer, could be chemically and physically modified by atmospheric microplasma irradiation. Physical damage to the skin by microplasma irradiation and an atmospheric plasma jet was also assessed by observing the skin surface. The results suggest that atmospheric microplasma has the potential to enhance percutaneous absorption. (paper)

Dirt-binding particles consisting of hydrogenated castor oil beads constitute a nonirritating alternative for abrasive cleaning of recalcitrant oily skin contamination in a three-step programme of occupational skin protection.

Science.gov (United States)

Mahler, V; Erfurt-Berge, C; Schiemann, S; Michael, S; Egloffstein, A; Kuss, O

2010-04-01

In occupational fields with exposure to grease, oil, metal particles, coal, black lead or soot, cleansing formulations containing abrasive bodies (e.g. refined walnut shell, corn, wood, plastic or pumice) are used. These may constitute an irritant per se. As an alternative, hydrogenated castor oil (also known as castor wax) beads have been developed as dirt-binding particles. A polar surface contributes to their mechanical cleaning effects in removal of oily grime. Standardized examination of the in vivo effects upon the skin barrier of castor wax beads in comparison with abrasive bodies and pure detergent. Three cleansing preparations - (i) detergent, (ii) detergent containing castor wax beads, (iii) detergent containing walnut shell powder - were each repetitively applied in vivo (four times daily for 3 weeks), mimicking workplace conditions, in 30 healthy volunteers (15 with and 15 without an atopic skin diathesis) and compared vs. (iv) no treatment. The treatment effects upon the skin barrier were monitored by repeated measurements of functional parameters [transepidermal water loss (TEWL), redness] and surface topography. After a 3-week treatment, a significant global treatment effect (P dirt and use of skin protection and skin care measures under real workplace conditions, this component may now be used and examined further in different occupations.

Non-Lethal Weapons Program

Science.gov (United States)

Sheets Frequently Asked Questions Non-Lethal Weapons FAQs Active Denial System FAQs Human Electro -Muscular Incapacitation FAQs Related Links Business Opportunities Contact JNLWD Congressional Engagement , Wednesday, Sept 20, 2017. The Active Denial System, blunt-impact munitions, dazzling lasers, LRAD 100X

International guidelines for the in vivo assessment of skin properties in non-clinical settings

DEFF Research Database (Denmark)

du Plessis, Johan; Stefaniak, Aleksandr; Eloff, Fritz

2013-01-01

There is an emerging perspective that it is not sufficient to just assess skin exposure to physical and chemical stressors in workplaces, but that it is also important to assess the condition, i.e. skin barrier function of the exposed skin at the time of exposure. The workplace environment, repre......, representing a non-clinical environment, can be highly variable and difficult to control, thereby presenting unique measurement challenges not typically encountered in clinical settings....

Dietary Cerebroside from Sea Cucumber (Stichopus japonicus): Absorption and Effects on Skin Barrier and Cecal Short-Chain Fatty Acids.

Science.gov (United States)

Duan, Jingjing; Ishida, Marina; Aida, Kazuhiko; Tsuduki, Tsuyoshi; Zhang, Jin; Manabe, Yuki; Hirata, Takashi; Sugawara, Tatsuya

2016-09-21

Sphingolipids from marine sources have attracted more attention recently because of their distinctive structures and expected functions. In this study, the content and components of cerebroside from sea cucumber Stichopus japonicus were analyzed. The absorption of cerebroside from S. japonicus was investigated with an in vivo lipid absorption assay. The result revealed that S. japonicus is a rich source of cerebroside that contained considerable amounts of odd carbon chain sphingoid bases. The cumulative recoveries of d17:1- and d19:2-containing cerebrosides were 0.31 ± 0.16 and 0.32 ± 0.10%, respectively, for 24 h after administration. To the best of the authors' knowledge, this is the first work that shows sphingolipids from a marine source could be absorbed in vivo and incorporated into ceramides. In addition, dietary supplementation with sea cucumber cerebroside to hairless mouse improved the skin barrier function and increased short-chain fatty acids in cecal contents, which have shown beneficial effects on the host.

Differential susceptibility of primary cultured human skin cells to hypericin PDT in an in vitro model.

Science.gov (United States)

Popovic, A; Wiggins, T; Davids, L M

2015-08-01

Skin cancer is the most common cancer worldwide, and its incidence rate in South Africa is increasing. Photodynamic therapy (PDT) has been shown to be an effective treatment modality, through topical administration, for treatment of non-melanoma skin cancers. Our group investigates hypericin-induced PDT (HYP-PDT) for the treatment of both non-melanoma and melanoma skin cancers. However, a prerequisite for effective cancer treatments is efficient and selective targeting of the tumoral cells with minimal collateral damage to the surrounding normal cells, as it is well established that cancer therapies have bystander effects on normal cells in the body, often causing undesirable side effects. The aim of this study was to investigate the cellular and molecular effects of HYP-PDT on normal primary human keratinocytes (Kc), melanocytes (Mc) and fibroblasts (Fb) in an in vitro tissue culture model which represented both the epidermal and dermal cellular compartments of human skin. Cell viability analysis revealed a differential cytotoxic response to a range of HYP-PDT doses in all the human skin cell types, showing that Fb (LD50=1.75μM) were the most susceptible to HYP-PDT, followed by Mc (LD50=3.5μM) and Kc (LD50>4μM HYP-PDT) These results correlated with the morphological analysis which displayed distinct morphological changes in Fb and Mc, 24h post treatment with non-lethal (1μM) and lethal (3μM) doses of HYP-PDT, but the highest HYP-PDT doses had no effect on Kc morphology. Fluorescent microscopy displayed cytoplasmic localization of HYP in all the 3 skin cell types and additionally, HYP was excluded from the nuclei in all the cell types. Intracellular ROS levels measured in Fb at 3μM HYP-PDT, displayed a significant 3.8 fold (phuman skin cells thus highlighting the efficacy and indeed, the potential bystander effect of if administered in vivo. This study contributes toward our knowledge of the cellular response of the epidermis to photodynamic therapies and

Establishment and function of tissue-resident innate lymphoid cells in the skin

Directory of Open Access Journals (Sweden)

Jie Yang

2017-03-01

Full Text Available ABSTRACT Innate lymphoid cells (ILCs are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

Establishment and function of tissue-resident innate lymphoid cells in the skin.

Science.gov (United States)

Yang, Jie; Zhao, Luming; Xu, Ming; Xiong, Na

2017-07-01

Innate lymphoid cells (ILCs) are a newly classified family of immune cells of the lymphoid lineage. While they could be found in both lymphoid organs and non-lymphoid tissues, ILCs are preferentially enriched in barrier tissues such as the skin, intestine, and lung where they could play important roles in maintenance of tissue integrity and function and protection against assaults of foreign agents. On the other hand, dysregulated activation of ILCs could contribute to tissue inflammatory diseases. In spite of recent progress towards understanding roles of ILCs in the health and disease, mechanisms regulating specific establishment, activation, and function of ILCs in barrier tissues are still poorly understood. We herein review the up-to-date understanding of tissue-specific relevance of ILCs. Particularly we will focus on resident ILCs of the skin, the outmost barrier tissue critical in protection against various foreign hazardous agents and maintenance of thermal and water balance. In addition, we will discuss remaining outstanding questions yet to be addressed.

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

KAUST Repository

Alves, Ricardo N.; Sundell, Kristina S.; Anjos, Liliana; Sundh, Henrik; Harboe, Torstein; Norberg, Birgitta; Power, Deborah M.

2018-01-01

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

Structural and functional maturation of skin during metamorphosis in the Atlantic halibut (Hippoglossus hippoglossus)

KAUST Repository

Alves, Ricardo N.

2018-02-20

To establish if the developmental changes in the primary barrier and osmoregulatory capacity of Atlantic halibut skin are modified during metamorphosis, histological, histochemical, gene expression and electrophysiological measurements were made. The morphology of the ocular and abocular skin started to diverge during the metamorphic climax and ocular skin appeared thicker and more stratified. Neutral mucins were the main glycoproteins produced by the goblet cells in skin during metamorphosis. Moreover, the number of goblet cells producing neutral mucins increased during metamorphosis and asymmetry in their abundance was observed between ocular and abocular skin. The increase in goblet cell number and their asymmetric abundance in skin was concomitant with the period that thyroid hormones (THs) increase and suggests that they may be under the control of these hormones. Several mucin transcripts were identified in metamorphosing halibut transcriptomes and Muc18 and Muc5AC were characteristic of the body skin. Na+, K+-ATPase positive (NKA) cells were observed in skin of all metamorphic stages but their number significantly decreased with the onset of metamorphosis. No asymmetry was observed between ocular and abocular skin in NKA cells. The morphological changes observed were linked to modified skin barrier function as revealed by modifications in its electrophysiological properties. However, the maturation of the skin functional characteristics preceded structural maturation and occurred at stage 8 prior to the metamorphic climax. Treatment of Atlantic halibut with the THs disrupter methimazole (MMI) affected the number of goblet cells producing neutral mucins and the NKA cells. The present study reveals that the asymmetric development of the skin in Atlantic halibut is TH sensitive and is associated with metamorphosis and that this barrier’s functional properties mature earlier and are independent of metamorphosis.

Chimeric autologous/allogeneic constructs for skin regeneration.

Science.gov (United States)

Rasmussen, Cathy Ann; Tam, Joshua; Steiglitz, Barry M; Bauer, Rebecca L; Peters, Noel R; Wang, Ying; Anderson, R Rox; Allen-Hoffmann, B Lynn

2014-08-01

The ideal treatment for severe cutaneous injuries would eliminate the need for autografts and promote fully functional, aesthetically pleasing autologous skin regeneration. NIKS progenitor cell-based skin tissues have been developed to promote healing by providing barrier function and delivering wound healing factors. Independently, a device has recently been created to "copy" skin by harvesting full-thickness microscopic tissue columns (MTCs) in lieu of autografts traditionally harvested as sheets. We evaluated the feasibility of combining these two technologies by embedding MTCs in NIKS-based skin tissues to generate chimeric autologous/allogeneic constructs. Chimeric constructs have the potential to provide immediate wound coverage, eliminate painful donor site wounds, and promote restoration of a pigmented skin tissue possessing hair follicles, sweat glands, and sebaceous glands. After MTC insertion, chimeric constructs and controls were reintroduced into air-interface culture and maintained in vitro for several weeks. Tissue viability, proliferative capacity, and morphology were evaluated after long-term culture. Our results confirmed successful MTC insertion and integration, and demonstrated the feasibility of generating chimeric autologous/allogeneic constructs that preserved the viability, proliferative capacity, and structure of autologous pigmented skin. These feasibility studies established the proof-of-principle necessary to further develop chimeric autologous/allogeneic constructs for the treatment of complex skin defects. Reprint & Copyright © 2014 Association of Military Surgeons of the U.S.

Heterogeneous response to X-ray and ultraviolet light irradiations of cultured skin fibroblasts in two families with Gardner's Syndrome

International Nuclear Information System (INIS)

Kinsella, T.J.; Little, J.B.; Nove, J.; Weichselbaum, R.R.; Li, F.P.; Meyer, R.J.; Marchetto, D.J.; Patterson, W.B.

1982-01-01

A heterogeneous response to X-ray and far UV (254 nm) light irradiations was found in cultured skin fibroblast lines from 2 separate families with Gardner's syndrome. When compared to 2 normal control cultures and cultures from 2 patients with nonfamilial colon cancer, cultures from 4 clinically affected members of family 1 showed increased sensitivity to the lethal effects of both X-ray and UV light irradiations. These cells also showed a delayed pattern of X-ray potentially lethal damage repair (PLDR) and absent UV PLDR. In contrast, cultures from 3 members of family 2 (2 of whom were clinically affected) showed a normal response of survival and PLDR to both X-ray and UV light irradiations. Thus increased sensitivity of cultured skin fibroblasts to X-ray and UV light irradiations was not a consistent in vitro finding in patients with Gardner's syndrome. However, in families with Gardner's syndrome who demonstrate in vitro radiosensitivity, additional studies are needed to assess the usefulness of these techniques in detecting affected individuals prior to the development of colon carcinoma and other manifestations

Non-Lethal Weapons: Opportunities for R&D

Science.gov (United States)

2004-12-01

during the Vietnam War. US; emulsifying agents are used in food processing, drilling fluids, cosmetics , pharmaceuticals, heavy- duty cleaners, textile...conducted in a professional manner, with no threat to public safety or the environment. 11 References [1] Fenton , G., (2001). NLW Technology Taxonomy...W.A., Mason, R.L., Collins, K.R., (2000). Non-Lethal Applicants of Slippery Substances. NDIA Non-Lethal Defense IV. [24] Fenton , G., (2000). Overview

Drug Delivery Through the Skin: Molecular Simulations of Barrier Lipids to Design more Effective Noninvasive Dermal and Transdermal Delivery Systems for Small Molecules Biologics and Cosmetics

Energy Technology Data Exchange (ETDEWEB)

J Torin Huzil; S Sivaloganathan; M Kohandel; M Foldvari

2011-12-31

The delivery of drugs through the skin provides a convenient route of administration that is often preferable to injection because it is noninvasive and can typically be self-administered. These two factors alone result in a significant reduction of medical complications and improvement in patient compliance. Unfortunately, a significant obstacle to dermal and transdermal drug delivery alike is the resilient barrier that the epidermal layers of the skin, primarily the stratum corneum, presents for the diffusion of exogenous chemical agents. Further advancement of transdermal drug delivery requires the development of novel delivery systems that are suitable for modern, macromolecular protein and nucleotide therapeutic agents. Significant effort has already been devoted to obtain a functional understanding of the physical barrier properties imparted by the epidermis, specifically the membrane structures of the stratum corneum. However, structural observations of membrane systems are often hindered by low resolutions, making it difficult to resolve the molecular mechanisms related to interactions between lipids found within the stratum corneum. Several models describing the molecular diffusion of drug molecules through the stratum corneum have now been postulated, where chemical permeation enhancers are thought to disrupt the underlying lipid structure, resulting in enhanced permeability. Recent investigations using biphasic vesicles also suggested a possibility for novel mechanisms involving the formation of complex polymorphic lipid phases. In this review, we discuss the advantages and limitations of permeation-enhancing strategies and how computational simulations, at the atomic scale, coupled with physical observations can provide insight into the mechanisms of diffusion through the stratum corneum.

Changes in skin barrier during treatment with systemic alitretinoin: focus on skin susceptibility and stratum corneum ceramides

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2010-01-01

) was performed on the volar forearm and evaluated by trans-epidermal water loss (TEWL), erythema, and a cyanoacrylate skin sample was obtained for lipid analysis. We found no significant changes in response to SLS irritation as evaluated by TEWL and erythema, after treatment with alitretinoin for 2 months...

Lethal synergy involving bicyclomycin: an approach for reviving old antibiotics.

Science.gov (United States)

Malik, Muhammad; Li, Liping; Zhao, Xilin; Kerns, Robert J; Berger, James M; Drlica, Karl

2014-12-01

One way to address the growing problem of antimicrobial resistance is to revive old compounds that may have intrinsic lethal activity that is obscured by protective factors. Bicyclomycin is an old inhibitor of the Rho transcription terminator that by itself shows little rapid lethal activity. However, bicyclomycin participates in bacteriostatic synergy, which raises the possibility that conditions for lethal synergy may exist, perhaps through a suppression of protective factors. Bicyclomycin was combined with bacteriostatic inhibitors of gene expression, and bactericidal activity was measured with several cultured Gram-negative pathogens. When used alone, bicyclomycin failed to rapidly kill growing cultures of Escherichia coli; however, the additional presence of bacteriostatic concentrations of tetracycline, chloramphenicol or rifampicin led to rapid killing. Four other pathogen species, Acinetobacter baumannii, Klebsiella pneumoniae, Salmonella enterica serotype Typhimurium and Shigella dysenteriae, also exhibited enhanced killing when bicyclomycin was combined with tetracycline or rifampicin. This lethal synergy was achieved at low concentrations (slightly above the MIC) for all agents tested in combinations. Follow-up work with E. coli indicated that lethal synergy arose from a blockage of transcription elongation. Moreover, lethal synergy was reduced when bicyclomycin was added 60 min before tetracycline, suggesting that bicyclomycin induces a protective factor. The action of bicyclomycin illustrates the potential present in a largely abandoned antibacterial agent; it exhibits lethal synergy when coadministered with known, bacteriostatic inhibitors of gene expression. The identification of protective factors, which are currently uncharacterized, may reveal new ways to promote the lethal action of some old antibiotics. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved

Validation of Cyanoacrylate Method for Collection of Stratum Corneum in Human Skin for Lipid Analysis

DEFF Research Database (Denmark)

Jungersted, JM; Hellgren, Lars; Drachmann, Tue

2010-01-01

Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method for the col......Background and Objective: Lipids in the stratum corneum (SC) are of major importance for the skin barrier function. Many different methods have been used for the collection of SC for the analysis of SC lipids. The objective of the present study was to validate the cyanoacrylate method...

Nuclear microprobe investigation of the penetration of ultrafine zinc oxide into human skin affected by atopic dermatitis

Science.gov (United States)

Szikszai, Z.; Kertész, Zs.; Bodnár, E.; Borbíró, I.; Angyal, A.; Csedreki, L.; Furu, E.; Szoboszlai, Z.; Kiss, Á. Z.; Hunyadi, J.

2011-10-01

Skin penetration is one of the potential routes for nanoparticles to gain access into the human body. Ultrafine metal oxides, such as titanium dioxide and zinc oxide are widely used in cosmetic and health products like sunscreens. These oxides are potent UV filters and the particle size smaller than 200 nm makes the product more transparent compared to formulations containing coarser particles. The present study continues the work carried out in the frame of the NANODERM: “Quality of skin as a barrier to ultrafine particles” European project and complements our previous investigations on human skin with compromised barrier function. Atopic dermatitis (a type of eczema) is an inflammatory, chronically relapsing, non-contagious skin disease. It is very common in children but may occur at any age. The exact cause of atopic dermatitis is unknown, but is likely due to a combination of impaired barrier function together with a malfunction in the body's immune system. In this study, skin samples were obtained from two patients suffering from atopic dermatitis. Our results indicate that the ultrafine zinc oxide particles, in a hydrophobic basis gel with an application time of 2 days or 2 weeks, have penetrated deeply into the stratum corneum in these patients. On the other hand, penetration into the stratum spinosum was not observed even in the case of the longer application time.

In vitro permeation of platinum through African and Caucasian skin.

Science.gov (United States)

Franken, A; Eloff, F C; du Plessis, J; Badenhorst, C J; Du Plessis, J L

2015-02-03

The majority of the South African workforce are Africans, therefore potential racial differences should be considered in risk and exposure assessments in the workplace. Literature suggests African skin to be a superior barrier against permeation and irritants. Previous in vitro studies on metals only included skin from Caucasian donors, whereas this study compared the permeation of platinum through African and Caucasian skin. A donor solution of 0.3 mg/ml of potassium tetrachloroplatinate (K₂PtCl₄) dissolved in synthetic sweat was applied to the vertical Franz diffusion cells with full thickness abdominal skin. Skin from three female African and three female Caucasian donors were included (n=21). The receptor solution was removed at various intervals during the 24 h experiment, and analysed with high resolution inductively coupled plasma-mass spectrometry (ICP-MS). Skin was digested and analysed by inductively coupled plasma-optical emission spectrometry (ICP-OES). Significantly higher permeation of platinum through intact African skin (p=0.044), as well as a significantly higher mass of platinum retention in African skin in comparison with Caucasian skin (p=0.002) occurred. Significant inter-donor variation was found in both racial groups (pskin and further investigation is necessary to explain the higher permeation through African skin. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

DEFF Research Database (Denmark)

Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

2015-01-01

are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

Prevalence and correlates of sun protection and skin self-examination practices among cutaneous malignant melanoma survivors.

Science.gov (United States)

Manne, Sharon; Lessin, Stuart

2006-10-01

Little is known about the level of engagement and correlates of sun protection and skin self-exam among individuals diagnosed with melanoma. Participants (N = 229) completed measures of skin self-exam and sun protection practice and knowledge and attitudes. Approximately eighty-four percent of patients reported engaging in skin self-examination at least once in the past year. Engagement in sun protection practices was moderate. Self-exam practice was associated with gender, physician recommendation about self-exam, and perceived benefits and barriers of self-exam. Sun protection was associated with gender, age, medical status and health care access, physician recommendation, knowledge, and a number of psychological factors. Behavioral interventions to improve skin surveillance and sun protection may benefit from an emphasis on physician education regarding self-exam and sun protection, education regarding the efficacy of sunscreen and the risks associated with sunbathing, reducing perceived barriers to self-exam and sun protection, and reducing reliance on social influences on sun protection practices.

Experimental skin carcinoma by UVB application

Directory of Open Access Journals (Sweden)

Andrada Iftode

2016-12-01

Full Text Available OBJECTIVES AND BACKGROUND The aim of this research study was to evaluate the harmful effects at skin level induced by concomitant and repeated exposure to three toxic agents: UVB radiation, DMBA and TPA. MATERIALS AND METHODS Experimental mice were divided in thw following groups (n=5 mice/group: group 1 – healthy mice, group 2 – mice exposed to UVB – radiation and topical administration of acetone and group 3 – mice exposed to UVB – radiation and topical application of DMBA and TPA solutions (phase I - double tumor initiation and phase II - tumor promotion. RESULTS Application of these compounds led to the development of skin papilloma and to significant changes in skin parameters. CONCLUSIONS The barrier function of the skin was degraded in UVB exposed mice. DMBA and TPA depended on carcinogens schedule and corelated with skin carcinoma. Graphical abstract: Schematic protocol of experimental skin carcinoma REFERENCES 1. Lee Ja, Ko Jh, Jung Bg, Kim Th, Hong Ji, Park Ys, Lee Bj. Fermented Prunus mume with Probiotics Inhibits 7,12- Dimethylbenz[a]anthracene and 12-OTetradecanoyl phorbol-13-acetate Induced Skin Carcinogenesis through Alleviation of Oxidative Stress. Asian Pac J Cancer Prev. 2013;14:2973-2978. 2. Firooz A, Sadr B, Babakoohi S, Sarraf-Yazdy M, Fanian F, Kazerouni-Timsar A, NassiriKashani M, Naghizadeh MM, Dowlati Y. Variation of Biophysical Parameters of the Skin with Age, Gender, and Body Region. Scientific World Journal. 2012; doi.org/10.1100/2012/386936 3. Gheorgheosu (Coricovac D, Borcan F, Balasz NI, Soica C, Simu G, Kemeny L, Dehelean CA. Evaluation of skin parameters in C57BL/6J mice exposed to chemical and environmental factors using non-invasive methods. J Agroalim Proc Technol. 2014;20:14-20.

p120-catenin mediates inflammatory responses in the skin

DEFF Research Database (Denmark)

Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

2006-01-01

but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series

OpenAIRE

R. W. Knackstedt; J. A. Dixon; P. J. O’Neill; F. A. Herrera

2015-01-01

Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-ad...

Skin friction related behaviour of artificial turf systems.

Science.gov (United States)

Tay, Sock Peng; Fleming, Paul; Hu, Xiao; Forrester, Steph

2017-08-01

The occurrence of skin friction related injuries is an issue for artificial turf sports pitches and remains a barrier to their acceptance. The purpose of this study was to evaluate the current industry standard Securisport® Sports Surface Tester that measures skin surface related frictional behaviour of artificial turf. Little research has been published about the device and its efficacy, despite its widespread use as a standard FIFA test instrument. To achieve a range of frictional behaviours, several "third generation" (3G) carpet and infill combinations were investigated; friction time profiles throughout the Securisport rotations were assessed in combination with independent measurements of skin roughness before and after friction testing via 3D surface scanning. The results indicated that carpets without infill had greatest friction (coefficients of friction 0.97-1.20) while those completely filled with sand or rubber had similar and lower values independent of carpet type (coefficient of friction (COF) ≈0.57). Surface roughness of a silicone skin (s-skin) decreased after friction testing, with the largest change on sand infilled surfaces, indicating an "abrasive" polishing effect. The combined data show that the s-skin is damaged in a surface-specific manner, thus the Securisport COF values appear to be a poor measure of the potential for skin abrasion. It is proposed that the change in s-skin roughness improves assessment of the potential for skin damage when players slide on artificial turf.

Mini outbreak of Kaposi′s varicelliform eruption in skin ward: A study of five cases

Directory of Open Access Journals (Sweden)

Rao GRR

2007-01-01

Full Text Available Background: Kaposi`s varicelliform eruption (KVE represents widespread cutaneous herpes simplex virus (HSV infection in patients with preexisting dermatoses. Occasionally, this infection can present as a nosocomial infection in skin wards, if adequate bed-spacing and barrier nursing methods are not followed. We are reporting five cases of KVE; four cases acquired the infection in a makeshift ward after admission of the first case in May 2005, due to the renovation work of the regular skin ward. Aim: The purpose of this study is to create clinical awareness about this uncommon dermatologic entity and to stress upon the importance of bed-spacing and barrier nursing in skin wards. Methods: Five cases of KVE, three females and two males with different primary dermatoses (pemphigus foliaceus - one, pemphigus vulgaris - two, paraneoplastic pemphigus - one and toxic epidemal necrolysis - one were included in this study. Diagnosis was made clinically and supported with Tzanck smear and HSV serology. All the cases were treated with oral acyclovir. Results: Four out of five cases of KVE recovered with treatment, one case of extensive pemphigus vulgaris with KVE succumbed to death. Conclusion: Mini outbreaks of KVE can occur in skin wards with inadequate bed-spacing and overcrowding of patients. Therefore adequate bed-spacing, barrier nursing and isolation of suspected cases are mandatory to prevent such life-threatening infections.

An antivector vaccine protects against a lethal vector-borne pathogen.

Directory of Open Access Journals (Sweden)

Milan Labuda

2006-04-01

Full Text Available Vaccines that target blood-feeding disease vectors, such as mosquitoes and ticks, have the potential to protect against the many diseases caused by vector-borne pathogens. We tested the ability of an anti-tick vaccine derived from a tick cement protein (64TRP of Rhipicephalus appendiculatus to protect mice against tick-borne encephalitis virus (TBEV transmitted by infected Ixodes ricinus ticks. The vaccine has a "dual action" in immunized animals: when infested with ticks, the inflammatory and immune responses first disrupt the skin feeding site, resulting in impaired blood feeding, and then specific anti-64TRP antibodies cross-react with midgut antigenic epitopes, causing rupture of the tick midgut and death of engorged ticks. Three parameters were measured: "transmission," number of uninfected nymphal ticks that became infected when cofeeding with an infected adult female tick; "support," number of mice supporting virus transmission from the infected tick to cofeeding uninfected nymphs; and "survival," number of mice that survived infection by tick bite and subsequent challenge by intraperitoneal inoculation of a lethal dose of TBEV. We show that one dose of the 64TRP vaccine protects mice against lethal challenge by infected ticks; control animals developed a fatal viral encephalitis. The protective effect of the 64TRP vaccine was comparable to that of a single dose of a commercial TBEV vaccine, while the transmission-blocking effect of 64TRP was better than that of the antiviral vaccine in reducing the number of animals supporting virus transmission. By contrast, the commercial antitick vaccine (TickGARD that targets only the tick's midgut showed transmission-blocking activity but was not protective. The 64TRP vaccine demonstrates the potential to control vector-borne disease by interfering with pathogen transmission, apparently by mediating a local cutaneous inflammatory immune response at the tick-feeding site.

Panamanian frog species host unique skin bacterial communities

Directory of Open Access Journals (Sweden)

Lisa K. Belden

2015-10-01

Full Text Available Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd, that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26% were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in

Effects of topical corticosteroid and tacrolimus on ceramides and irritancy to sodium lauryl sulphate in healthy skin

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellegren, Lars I

2011-01-01

twice daily for one week with betamethasone, tacrolimus, emollient, or left untreated, respectively. After one week each area was challenged with a 24 h sodium lauryl sulphate patch test. The lipids were collected using the cyanoacrylate method and evaluated by high performance thin layer chromatography......The skin barrier, located in the stratum corneum, is influenced mainly by the lipid and protein composition of this layer. In eczematous diseases impairment of the skin barrier is thought to be of prime importance. Topical anti-inflammatory drugs and emollients are the most widely used eczema...

Influence Analysis of Shell Material and Charge on Shrapnel Lethal Power

Directory of Open Access Journals (Sweden)

Wang Lin

2015-01-01

Full Text Available To compare the shrapnel lethal power with different shell material and charge, LS-DYNA was used to numerically simulate four kinds of shrapnel lethal power. The shell material was 58SiMn, 50SiMnVB or 40Cr, whereas the charge was RL-F. And the shell material was 58SiMn, whereas the charge was TNT. The shell rupture process and lethal power test were analyzed. The results show that, the lethal power of RL-F charge increase by 25%, 45%, 14% compared with the TNT charge, whereas the shell material was 58SiMn, 50SiMnVB, 40Cr. And then the guarantee range and lethal power can be improved by using the high explosive and changing shell material, whereas the projectile shape coefficient is invariable.

A survey of knowledge, attitudes, and practices towards skin and soft tissue infections in rural Alaska

Directory of Open Access Journals (Sweden)

Gregory A. Raczniak

2016-02-01

Full Text Available Background: Community-acquired methicillin-resistant Staphylococcus aureus and methicillin-sensitive S. aureus infections are common to south-western Alaska and have been associated with traditional steambaths. More than a decade ago, recommendations were made to affected communities that included preventive skin care, cleaning methods for steambath surfaces, and the use of protective barriers while in steambaths to reduce the risk of S. aureus infection. Objective: A review of community medical data suggested that the number of skin infection clinical encounters has increased steadily over the last 3 years and we designed a public health investigation to seek root causes. Study design: Using a mixed methods approach with in-person surveys, a convenience sample (n=492 from 3 rural communities assessed the range of knowledge, attitudes and practices concerning skin infections, skin infection education messaging, prevention activities and home self-care of skin infections. Results: We described barriers to implementing previous recommendations and evaluated the acceptability of potential interventions. Prior public health messages appear to have been effective in reaching community members and appear to have been understood and accepted. We found no major misconceptions regarding what a boil was or how someone got one. Overall, respondents seemed concerned about boils as a health problem and reported that they were motivated to prevent boils. We identified current practices used to avoid skin infections, such as the disinfection of steambaths. We also identified barriers to engaging in protective behaviours, such as lack of access to laundry facilities. Conclusions: These findings can be used to help guide public health strategic planning and identify appropriate evidence-based interventions tailored to the specific needs of the region.

Microautoradiography of 14C-salicylic acid in the skin of guinea-pig

International Nuclear Information System (INIS)

Washitake, Mitsunori; Ozawa, Yasuo; Anmo, Toshio; Tanaka, Ichiro

1974-01-01

The concentration of salicylic acid in guinea-pig skin was examined by microautoradiography. The retention of salicylic acid in the stratum corneum was observed. It was considered that the rate of transfer of the drug into the stratum corneum was small and that the stratum corneum became the barrier for permeability of the skin. The distribution of salicylic acid in other parts of the skin was uniform and no retention of the drug in any special parts was observed. The plasma level showed less percutaneous absorption of the drug when it was applied as liquid paraffin solution than when it was applied as an aqueous solution. The amount of salicylic acid absorbed from damaged skin was extremely large and, in this case, disappearance of the drug from the skin was fast. (author)

Helminth Infection and Commensal Microbiota Drive Early IL-10 Production in the Skin by CD4+ T Cells That Are Functionally Suppressive.

Directory of Open Access Journals (Sweden)

David E Sanin

2015-05-01

Full Text Available The skin provides an important first line of defence and immunological barrier to invasive pathogens, but immune responses must also be regulated to maintain barrier function and ensure tolerance of skin surface commensal organisms. In schistosomiasis-endemic regions, populations can experience repeated percutaneous exposure to schistosome larvae, however little is known about how repeated exposure to pathogens affects immune regulation in the skin. Here, using a murine model of repeated infection with Schistosoma mansoni larvae, we show that the skin infection site becomes rich in regulatory IL-10, whilst in its absence, inflammation, neutrophil recruitment, and local lymphocyte proliferation is increased. Whilst CD4+ T cells are the primary cellular source of regulatory IL-10, they expressed none of the markers conventionally associated with T regulatory (Treg cells (i.e. FoxP3, Helios, Nrp1, CD223, or CD49b. Nevertheless, these IL-10+ CD4+ T cells in the skin from repeatedly infected mice are functionally suppressive as they reduced proliferation of responsive CD4+ T cells from the skin draining lymph node. Moreover, the skin of infected Rag-/- mice had impaired IL-10 production and increased neutrophil recruitment. Finally, we show that the mechanism behind IL-10 production by CD4+ T cells in the skin is due to a combination of an initial (day 1 response specific to skin commensal bacteria, and then over the following days schistosome-specific CD4+ T cell responses, which together contribute towards limiting inflammation and tissue damage following schistosome infection. We propose CD4+ T cells in the skin that do not express markers of conventional T regulatory cell populations have a significant role in immune regulation after repeated pathogen exposure and speculate that these cells may also help to maintain skin barrier function in the context of repeated percutaneous insult by other skin pathogens.

Inhibitory action of chlorophyllin of autosome recessive lethals induced by irradiation

International Nuclear Information System (INIS)

Salceda, V.M.; Pimentel, P.A.E.; Cruces, M.P.

2006-01-01

The chlorophyllin is a sodium salt of the chlorophyll that has a strong protective action of the damage induced by different agents so much physical as chemical. In Drosophila there is reported this effect in somatic cells. In contrast, in germinal cells using tests with the sexual chromosomes has not been found such inhibitory action. For this reason, in this occasion we will refer to the effect of the lethality induced in autosome chromosomes, in particular to the chromosome II of this species. For such effect groups of males of the line Canton-S its were pre-treated for 24h with or without 69 mm of CCS and later on treaties with or without 40 Gy of gamma irradiation. The males were then subjected to the technical Cy L / Pm for the detection of recessive lethals. In the third generation the respective counts of the descendant of each one of them to determine the corresponding categories for each extracted chromosome were made. To be mendelian crosses it is expected for a normal chromosome a proportion 2:1 of individuals with genotype Cy L / +: +/+. The absence of individuals +/+ it is indicative of a lethal gene, until 10% of these individuals of each male's total descendant, it is considered that is carrying of a semi lethal gene. The sum of lethal and semi lethals constitutes the category detrimental. The obtained results indicated that the pre-treatment with CCS reduces in a significant way the frequency of induced lethals by 40 Gy of gamma rays. The fact that an effect inhibitor has not been observed in the test of recessive lethal bound to the sex obtained previously, it contrasts with the effect observed in the chromosome II, results of this study and with the one observed in the chromosome III in somatic cells. The above-mentioned shows a differential action of the CCS between sexual chromosomes and autosomal before the effect of the gamma radiation. At the moment we don't have an explanation to these evidences. To evaluate the action of the chlorophyllin

Lethal and Sub-lethal Effects of Four Insecticides on the Aphidophagous Coccinellid Adalia bipunctata (Coleoptera: Coccinellidae).

Science.gov (United States)

Depalo, Laura; Lanzoni, Alberto; Masetti, Antonio; Pasqualini, Edison; Burgio, Giovanni

2017-12-05

Conventional insecticide assays, which measure the effects of insecticide exposure on short-term mortality, overlook important traits, including persistence of toxicity or sub-lethal effects. Therefore, such approaches are especially inadequate for prediction of the overall impact of insecticides on beneficial arthropods. In this study, the side effects of four modern insecticides (chlorantraniliprole, emamectin benzoate, spinosad, and spirotetramat) on Adalia bipunctata (L.) (Coleoptera: Coccinellidae) were evaluated under laboratory conditions by exposition on treated potted plants. In addition to investigation of acute toxicity and persistence of harmful activity in both larvae and adults of A. bipunctata, demographic parameters were evaluated, to provide a comprehensive picture of the nontarget effects of these products. Field doses of the four insecticides caused detrimental effects to A. bipunctata; but in different ways. Overall, spinosad showed the best toxicological profile among the products tested. Emamectin benzoate could be considered a low-risk insecticide, but had high persistence. Chlorantraniliprole exhibited lethal effects on early instar larvae and adults, along with a long-lasting activity, instead spirotetramat showed a low impact on larval and adult mortality and can be considered a short-lived insecticide. However, demographic analysis demonstrated that chlorantraniliprole and spirotetramat caused sub-lethal effects. Our findings highlight that sole assessment of mortality can lead to underestimation of the full impact of pesticides on nontarget insects. Demographic analysis was demonstrated to be a sensitive method for detection of the sub-lethal effects of insecticides on A. bipunctata, and this approach should be considered for evaluation of insecticide selectivity. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Experiences in therapy for lethal midline granuloma

International Nuclear Information System (INIS)

Tosaka, Kaoru; Ishikawa, Takeru

1982-01-01

Four cases of the lethal midline granuloma or malignant granuloma of the nose were treated by irradiation and chemotherapy, which are generally prescribed for malignant lymphomas. Clinical, histological and laboratory examination indicated that they were the lethal midline granuloma and clearly differentiated from Wegener's granulomatosis or malignant lymphoma. All of the cases exhibited primary remission. The four cases were observed up to 38, 22, 14, and 10 months since the beginning of the therapy, showing no local or general recurrence. (author)

Ethyl cellulose nanocarriers and nanocrystals differentially deliver dexamethasone into intact, tape-stripped or sodium lauryl sulfate-exposed ex vivo human skin - assessment by intradermal microdialysis and extraction from the different skin layers.

Science.gov (United States)

Döge, Nadine; Hönzke, Stefan; Schumacher, Fabian; Balzus, Benjamin; Colombo, Miriam; Hadam, Sabrina; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Schäfer-Korting, Monika; Schindler, Anke; Rühl, Eckart; Skov, Per Stahl; Church, Martin K; Hedtrich, Sarah; Kleuser, Burkhard; Bodmeier, Roland; Vogt, Annika

2016-11-28

Understanding penetration not only in intact, but also in lesional skin with impaired skin barrier function is important, in order to explore the surplus value of nanoparticle-based drug delivery for anti-inflammatory dermatotherapy. Herein, short-term ex vivo cultures of (i) intact human skin, (ii) skin pretreated with tape-strippings and (iii) skin pre-exposed to sodium lauryl sulfate (SLS) were used to assess the penetration of dexamethasone (Dex). Intradermal microdialysis was utilized for up to 24h after drug application as commercial cream, nanocrystals or ethyl cellulose nanocarriers applied at the therapeutic concentration of 0.05%, respectively. In addition, Dex was assessed in culture media and extracts from stratum corneum, epidermis and dermis after 24h, and the results were compared to those in heat-separated split skin from studies in Franz diffusion cells. Providing fast drug release, nanocrystals significantly accelerated the penetration of Dex. In contrast to the application of cream and ethyl cellulose nanocarriers, Dex was already detectable in eluates after 6h when applying nanocrystals on intact skin. Disruption of the skin barrier further accelerated and enhanced the penetration. Encapsulation in ethyl cellulose nanocarriers delayed Dex penetration. Interestingly, for all formulations highly increased concentrations in the dialysate were observed in tape-stripped skin, whereas the extent of enhancement was less in SLS-exposed skin. The results were confirmed in tissue extracts and were in line with the predictions made by in vitro release studies and ex vivo Franz diffusion cell experiments. The use of 45kDa probes further enabled the collection of inflammatory cytokines. However, the estimation of glucocorticoid efficacy by Interleukin (IL)-6 and IL-8 analysis was limited due to the trauma induced by the probe insertion. Ex vivo intradermal microdialysis combined with culture media analysis provides an effective, skin-sparing method for

Occlusive gloves and skin conditions: is there a problem? Results of a cross-sectional study in a semiconductor company.

Science.gov (United States)

Weistenhöfer, W; Wacker, M; Bernet, F; Uter, W; Drexler, H

2015-04-01

Although there is poor scientific evidence that working with occlusive gloves is as damaging as wet work, prolonged glove occlusion is considered to be a risk factor for developing hand eczema similar to wet work. To assess the effects of wearing occlusive gloves during the whole working day, without exposure to any additional hazardous substances, on skin condition and skin barrier function. We investigated 323 employees of a semiconductor production company in Germany: 177 clean-room workers wearing occlusive gloves during the whole shift (exposed group) and 146 employees working in administration (control group). A standardized interview was performed, the skin condition of both hands was studied using the quantitative skin score HEROS, and transepidermal water loss (TEWL) and stratum corneum hydration were measured. There was no significant difference in skin condition between the two subgroups. Values for TEWL and corneometry were significantly higher in exposed participants (P gloves at least 30 min before the measurement. Hence, the effect of occlusion on skin barrier function seems to be transient. Prolonged wearing of occlusive gloves with clean hands and without exposure to additional hazardous substances does not seem to affect the skin negatively. © 2014 British Association of Dermatologists.

Liquid Crystal Gel Reduces Age Spots by Promoting Skin Turnover

Directory of Open Access Journals (Sweden)

Mina Musashi

2014-07-01

Full Text Available Studies have shown that liquid crystals structurally resembling the intercellular lipids in the stratum corneum can beneficially affect the skin when applied topically by stimulating the skin’s natural regenerative functions and accelerating epidermal turnover. In the present study, the effects of applying low concentrations of a liquid crystal gel of our own creation were evaluated using epidermal thickening in mouse skin as an assay for effective stimulation of epidermal turnover. A liquid crystal gel was also applied topically to human facial skin, and analysis was conducted using before-and-after photographs of age spots, measurements of L* values that reflect degree of skin pigmentation, single-layer samples of the stratum corneum obtained via tape-stripping, and measurements of trans-epidermal water loss that reflect the status of the skin’s barrier function. The results suggested that cost-effective creams containing as low as 5% liquid crystal gel might be effective and safely sold as skin care products targeting age spots and other problems relating to uneven skin pigmentation.

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function.We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified.The aim of this study was to examine the effect of UV...

The impact of ultraviolet therapy on stratum corneum ceramides and barrier function

DEFF Research Database (Denmark)

Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

2011-01-01

therapy in dermatological patients on ceramides and skin barrier function. We found that UV light treatment does not change the ratio of important stratum corneum lipids, but we confirm earlier findings of decreased susceptibility to irritants after UV- therapy.......The ceramide profile as well as the barrier function is known to be deteriorated in atopic eczema and psoriasis, and ultraviolet (UV) light is known to improve the barrier function. The impact of UV light on ceramides, however, is not clarified. The aim of this study was to examine the effect of UV...

Fur skin and fur garment trade between Europe and Asia

DEFF Research Database (Denmark)

Hansen, Henning Otte

2016-01-01

International trade and specialization with agricultural raw materials and processed products is often rather limited due to trade barriers, logistic problems and food security. This production of raw fur skin - which is also considered an agricultural product - mostly takes place in the Western...... hemisphere, and to a high degree in Europe, while processing and production of fur garments now more and more takes place in Asia. The objective of this paper is to analyze, quantify and explain trade patterns and international specialization within fur skin and fur garments focusing on Europa and Asia...... trade with fur skin products between Asia and Europe has increased remarkably during the recent decades. Europe accounts for a major share of world production and export of raw fur skin, and Asia accounts for the major part of the subsequent processing. This means that there is a significant export...

A fermented barley and soybean formula enhances skin hydration.

Science.gov (United States)

Lee, Sein; Kim, Jong-Eun; Suk, Sujin; Kwon, Oh Wook; Park, Gaeun; Lim, Tae-Gyu; Seo, Sang Gwon; Kim, Jong Rhan; Kim, Dae Eung; Lee, Miyeong; Chung, Dae Kyun; Jeon, Jong Eun; Cho, Dong Woon; Hurh, Byung Serk; Kim, Sun Yeou; Lee, Ki Won

2015-09-01

Skin hydration is one of the primary aims of beauty and anti-aging treatments. Barley (Hordeum vulgare) and soybean (Glycine max) are major food crops, but can also be used as ingredients for the maintenance of skin health. We developed a natural product-based skin treatment using a barley and soybean formula (BS) incorporating yeast fermentation, and evaluated its skin hydration effects as a dietary supplement in a clinical study. Participants ingested a placebo- (n = 33) or BS- (3 g/day) containing drink (n = 32) for 8 weeks. A significant increase in hydration in the BS group as compared to the placebo group was observed on the faces of subjects after 4 and 8 weeks, and on the forearm after 4 weeks. Decreases in stratum corneum (SC) thickness were also observed on the face and forearm. BS enhanced hyaluronan (HA) and skin barrier function in vitro and reduced Hyal2 expression in human dermal fibroblasts (HDF). BS also recovered ultraviolet (UV) B-induced downregulation of HA in HaCaT cells. These results suggest that BS has promising potential for development as a health functional food to enhance skin health.

Back to the future: revisiting HIV-1 lethal mutagenesis

Science.gov (United States)

Dapp, Michael J.; Patterson, Steven E.; Mansky, Louis M.

2012-01-01

The concept of eliminating HIV-1 infectivity by elevating the viral mutation rate was first proposed over a decade ago, even though the general concept had been conceived earlier for RNA viruses. Lethal mutagenesis was originally viewed as a novel chemotherapeutic approach for treating HIV-1 infection in which use of a viral mutagen would over multiple rounds of replication lead to the lethal accumulation of mutations, rendering the virus population non infectious – known as the slow mutation accumulation model. There have been limitations in obtaining good efficacy data with drug leads, leaving some doubt into clinical translation. More recent studies of the APOBEC3 proteins as well as new progress in the use of nucleoside analogs for inducing lethal mutagenesis have helped to refocus attention on rapid induction of HIV-1 lethal mutagenesis in a single or limited number of replication cycles leading to a rapid mutation accumulation model. PMID:23195922

Perinatal-lethal Gaucher disease presenting as hydrops fetalis.

Science.gov (United States)

BenHamida, Emira; Ayadi, Imene; Ouertani, Ines; Chammem, Maroua; Bezzine, Ahlem; BenTmime, Riadh; Attia, Leila; Mrad, Ridha; Marrakchi, Zahra

2015-01-01

Perinatal-lethal Gaucher disease is very rare and is considered a variant of type 2 Gaucher disease that occurs in the neonatal period. The most distinct features of perinatal-lethal Gaucher disease are non-immune hydrops fetalis. Less common signs of the disease are hepatosplenomegaly, ichthyosis and arthrogryposis. We report a case of Gaucher's disease (type 2) diagnosed in a newborn who presented with Hydrops Fetalis.

Optimal barrier zones for stopping the invasion of Aedes aegypti mosquitoes via transgenic or sterile insect techniques

KAUST Repository

Lee, S. Seirin

2013-03-27

Biological invasions have dramatically altered the natural world by threatening native species and their communities. Moreover, when the invading species is a vector for human disease, there are further substantive public health and economic impacts. The development of transgenic technologies is being explored in relation to new approaches for the biological control of insect pests. We investigate the use of two control strategies, classical sterile insect techniques and transgenic late-acting bisex lethality (Release of Insects carrying a Dominant Lethal), for controlling invasion of the mosquito Aedes aegypti using a spatial stage-structured mathematical model. In particular, we explore the use of a barrier zone of sterile/transgenic insects to prevent or impede the invasion of mosquitoes. We show that the level of control required is not only highly sensitive to the rate at which the sterile/transgenic males are released in the barrier zone but also to the spatial range of release. Our models characterise how the distribution of sterile/transgenic mosquitoes in the barrier zone can be controlled so as to minimise the number of mass-produced insects required for the arrest of species invasion. We predict that, given unknown rates of mosquito dispersal, management strategies should concentrate on larger release areas rather than more intense release rates for optimal control. © 2013 Springer Science+Business Media Dordrecht.

Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

Science.gov (United States)

Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

2018-01-01

The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

[Improvement of rosacea treatment based on the morphological and functional features of the skin].

Science.gov (United States)

Tsiskarishvili, N V; Katsitadze, A G; Tsiskarishvili, Ts I

2013-10-01

Rosacea - a widespread disease sometimes aleak with severe complications, mainly affecting the skin. Irrational and inadequate treatment leads to chronicity of diseases and psychosocial disadaptation of patients. Lately, a clear upward trend in the number of patients in whom in the process of complex treatment manifestations (with the varying degrees of severity) of impaired barrier function of the skin are observed and they need the protection and restoration of the damaged stratum corneum. In patients with rosacea in order to study the function of the facial skin's horny layer we used the skin analyzer BIA (bioimpedance analysis, which in duration of 6 seconds determines the moisture content, oiliness and the softness of the skin) and significant deviations from the norm (decrease in moisture content, fatness and increased roughness) was revealed. These changes were most clearly pronounced in patients with steroid rosacea. To restore the skin barrier the drug "Episofit A" (Laboratory of Evolutionary Dermatology, France) has been used (1-2 times a day for 6 weeks). Evaluation of treatment efficacy was conducted every 2 weeks by means of a scale from 0 to 5 for parameters of dryness, erythema, peeling and expression of subjective feelings. In accordance with received results, using of Episofit A emulsion, especially on the baсkground of long-term treatment with topical steroids, had a pronounced therapeutic effect. Thus, treatment of patients with consideration of morphological and functional features of facial skin, helps to improve the results traditional therapy, and the drug is highly effective means of the new direction in skin care - corneotherapy aimed to reconstruct and protect damaged stratum corneum.

Skin Diseases: Skin Health and Skin Diseases

Science.gov (United States)

Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

Lethal neonatal short-limbed dwarfism

International Nuclear Information System (INIS)

Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee

1986-01-01

We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

Lethal neonatal short-limbed dwarfism

Energy Technology Data Exchange (ETDEWEB)

Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee [Catholic Medical College, Seoul (Korea, Republic of)

1986-02-15

We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

Sensitive skin at menopause; dew point and electrometric properties of the stratum corneum.

Science.gov (United States)

Paquet, F; Piérard-Franchimont, C; Fumal, I; Goffin, V; Paye, M; Piérard, G E

1998-01-12

A number of menopausal women experience skin sensitive to various environmental threats. Two panels of 15 menopausal women on or without HRT were compared. We studied the response of their stratum corneum to variations in environmental humidity, either in air or in response to an emollient. Environment dew point and electrometric measurements on the skin were recorded to search for correlations. Data show that the baseline stratum corneum hydration is influenced by the dew point. HRT improves the barrier function of the skin. The use of emollient further extends the improvement in the functional properties of skin in menopausal women. Both HRT and an emollient can counteract in part some of the deleterious effects of cold and dry weather.

Skin examination behavior: the role of melanoma history, skin type, psychosocial factors, and region of residence in determining clinical and self-conducted skin examination.

Science.gov (United States)

Kasparian, Nadine A; Bränström, Richard; Chang, Yu-mei; Affleck, Paul; Aspinwall, Lisa G; Tibben, Aad; Azizi, Esther; Baron-Epel, Orna; Battistuzzi, Linda; Bruno, William; Chan, May; Cuellar, Francisco; Debniak, Tadeusz; Pjanova, Dace; Ertmanski, Slawomir; Figl, Adina; Gonzalez, Melinda; Hayward, Nicholas K; Hocevar, Marko; Kanetsky, Peter A; Leachman, Sancy; Bergman, Wilma; Heisele, Olita; Palmer, Jane; Peric, Barbara; Puig, Susana; Schadendorf, Dirk; Gruis, Nelleke A; Newton-Bishop, Julia; Brandberg, Yvonne

2012-10-01

To examine the frequency and correlates of skin examination behaviors in an international sample of individuals at varying risk of developing melanoma. A cross-sectional, web-based survey. Data were collected from the general population over a 20-month period on behalf of the Melanoma Genetics Consortium (GenoMEL). A total of 8178 adults from Northern (32%), Central (33%), and Southern (14%) Europe, Australia (13%), and the United States (8%). Self-reported frequency of skin self-examination (SSE) and clinical skin examination (CSE). After adjustment for age and sex, frequency of skin examination was higher in both Australia (odds ratio [OR]SSE=1.80 [99% CI, 1.49-2.18]; ORCSE=2.68 [99% CI, 2.23-3.23]) and the United States (ORSSE=2.28 [99% CI, 1.76-2.94]; ORCSE=3.39 [99% CI, 2.60-4.18]) than in the 3 European regions combined. Within Europe, participants from Southern Europe reported higher rates of SSE than those in Northern Europe (ORSSE=1.61 [99% CI, 1.31-1.97]), and frequency of CSE was higher in both Central (ORCSE=1.47 [99% CI, 1.22-1.78]) and Southern Europe (ORCSE=3.46 [99% CI, 2.78, 4.31]) than in Northern Europe. Skin examination behavior also varied according to melanoma history: participants with no history of melanoma reported the lowest levels of skin examination, while participants with a previous melanoma diagnosis reported the highest levels. After adjustment for region, and taking into account the role of age, sex, skin type, and mole count, engagement in SSE and CSE was associated with a range of psychosocial factors, including perceived risk of developing melanoma; perceived benefits of, and barriers to, skin examination; perceived confidence in one's ability to engage in screening; and social norms. In addition, among those with no history of melanoma, higher cancer-related worry was associated with greater frequency of SSE. Given the strong association between psychosocial factors and skin examination behaviors, particularly among people with

Biophysical evaluation of fractional laser skin resurfacing with an Er:YSGG laser device in Japanese skin.

Science.gov (United States)

Kimura, Utako; Kinoshita, Ayako; Osawa, Aki; Negi, Osamu; Haruna, Kunitaka; Mizuno, Yuki; Suga, Yasushi

2012-05-01

Ablative fractional laser skin resurfacing (FLSR) has recently been used for the amelioration of acne scars, and previous studies have shown clinical effectiveness. Despite its extensive use, few studies have focused on the associated changes in biophysical properties of the epidermis. Herein, we evaluate transepidermal water loss, sebum levels, skin hydration, and skin elasticity, following FLSR treatments with an Er:YSGG laser device (Pearl FractionalTM, Cutera Inc., Brisbane, CA), employing non-invasive measurements. Five Japanese patients with facial acne scars underwent one FLSR session. Some acne scars appeared to become less obvious as a consequence of the treatment. All patients were aware of a feeling of skin tightness in treated areas. Objective measurements on the lower lateral angle of the eye and on the inner cheeks were evaluated at baseline and at 3 days, 1 week, and 4 weeks after FLSR. Transepidermal water loss showed a significant two-fold (100%) increase at day 3, but had returned to almost the baseline level at week 4 in both areas. Sebum secretion showed a 50% increase at day 3, but had returned to the baseline level after day 7. Skin hydration showed a significant decrease at day 3, but had returned to the baseline level by day 7, and showed significant improvement at the end of the study. Skin elasticity (R2) was still at baseline on day 3, but showed some improvement--an increase of at least 30%--at the end of the study. Based on our findings, we believe that FLSR should be performed no more than once a month to allow sufficient time for the damaged skin to recover its barrier function in most areas of the face.

Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series.

Science.gov (United States)

Knackstedt, R W; Dixon, J A; O'Neill, P J; Herrera, F A

2015-01-01

Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-adhering polyester-based mesh. Proposed benefits of wound closure with DERMABOND PRINEO Skin Closure System, used with or without sutures, include its watertight seal, easy removal, microbial barrier, even distribution of tension, and reduction in wound closure time. Although allergic reactions to 2-octyl cyanoacrylate have been reported, few allergic reactions to DERMABOND PRINEO Skin Closure System have been noted in the literature. This case series describes three patients who experienced an allergic reaction to DERMABOND PRINEO Skin Closure System after undergoing elective bilateral reduction mammoplasties at our institution to further explore this topic. Methods. Retrospective chart review of bilateral reduction mammoplasty patients who received DERMABOND PRINEO Skin Closure System dressing at our institution was performed. Results. Three patients were identified as having a rash in reaction to DERMABOND PRINEO Skin Closure System after bilateral reduction mammoplasty. All three patients required systemic steroid treatment to resolve the rash. One patient was identified as having a prior adhesive reaction. Conclusions. DERMABOND PRINEO Skin Closure System has demonstrated its efficacy in optimizing scar healing and appearance. However, as we demonstrate these three allergic reactions to DERMABOND PRINEO Skin Closure System, caution must be utilized in its usage, namely, in patients with a prior adhesive allergy and in sites where moisture or friction may be apparent.

Rash with DERMABOND PRINEO Skin Closure System Use in Bilateral Reduction Mammoplasty: A Case Series

Directory of Open Access Journals (Sweden)

R. W. Knackstedt

2015-01-01

Full Text Available Background. Bilateral reduction mammoplasty is a common plastic surgery procedure that can be complicated by unfavorable scar formation along incision sites. Surgical adhesives can be utilized as an alternative or as an adjunct to conventional suture closures to help achieve good wound tension and provide an adequate barrier with excellent cosmesis. The recently introduced DERMABOND PRINEO Skin Closure System Skin Closure System combines the skin adhesive 2-octyl cyanoacrylate with a self-adhering polyester-based mesh. Proposed benefits of wound closure with DERMABOND PRINEO Skin Closure System, used with or without sutures, include its watertight seal, easy removal, microbial barrier, even distribution of tension, and reduction in wound closure time. Although allergic reactions to 2-octyl cyanoacrylate have been reported, few allergic reactions to DERMABOND PRINEO Skin Closure System have been noted in the literature. This case series describes three patients who experienced an allergic reaction to DERMABOND PRINEO Skin Closure System after undergoing elective bilateral reduction mammoplasties at our institution to further explore this topic. Methods. Retrospective chart review of bilateral reduction mammoplasty patients who received DERMABOND PRINEO Skin Closure System dressing at our institution was performed. Results. Three patients were identified as having a rash in reaction to DERMABOND PRINEO Skin Closure System after bilateral reduction mammoplasty. All three patients required systemic steroid treatment to resolve the rash. One patient was identified as having a prior adhesive reaction. Conclusions. DERMABOND PRINEO Skin Closure System has demonstrated its efficacy in optimizing scar healing and appearance. However, as we demonstrate these three allergic reactions to DERMABOND PRINEO Skin Closure System, caution must be utilized in its usage, namely, in patients with a prior adhesive allergy and in sites where moisture or friction may

Microbial ecology of the skin in the era of metagenomics and molecular microbiology.

Science.gov (United States)

Hannigan, Geoffrey D; Grice, Elizabeth A

2013-12-01

The skin is the primary physical barrier between the body and the external environment and is also a substrate for the colonization of numerous microbes. Previously, dermatological microbiology research was dominated by culture-based techniques, but significant advances in genomic technologies have enabled the development of less-biased, culture-independent approaches to characterize skin microbial communities. These molecular microbiology approaches illustrate the great diversity of microbiota colonizing the skin and highlight unique features such as site specificity, temporal dynamics, and interpersonal variation. Disruptions in skin commensal microbiota are associated with the progression of many dermatological diseases. A greater understanding of how skin microbes interact with each other and with their host, and how we can therapeutically manipulate those interactions, will provide powerful tools for treating and preventing dermatological disease.

Microautoradiography of /sup 14/C-salicylic acid in the skin of guinea-pig

Energy Technology Data Exchange (ETDEWEB)

Washitake, M; Ozawa, Y; Anmo, T; Tanaka, I [Taisho Pharmaceutical Co. Ltd., Tokyo (Japan). Research Lab.

1974-07-01

The concentration of salicylic acid in guinea-pig skin was examined by microautoradiography. The retention of salicylic acid in the stratum corneum was observed. It was considered that the rate of transfer of the drug into the stratum corneum was small and that the stratum corneum became the barrier for permeability of the skin. The distribution of salicylic acid in other parts of the skin was uniform and no retention of the drug in any special parts was observed. The plasma level showed less percutaneous absorption of the drug when it was applied as liquid paraffin solution than when it was applied as an aqueous solution. The amount of salicylic acid absorbed from damaged skin was extremely large and, in this case, disappearance of the drug from the skin was fast.

Q-switched ruby laser irradiation of normal human skin. Histologic and ultrastructural findings.

Science.gov (United States)

Hruza, G J; Dover, J S; Flotte, T J; Goetschkes, M; Watanabe, S; Anderson, R R

1991-12-01

The Q-switched ruby laser is used for treatment of tatoos. The effects of Q-switched ruby laser pulses on sun-exposed and sun-protected human skin, as well as senile lentigines, were investigated with clinical observation, light microscopy, and transmission electron microscopy. A pinpricklike sensation occurred at radiant exposures as low as 0.2 J/cm2. Immediate erythema, delayed edema, and immediate whitening occurred with increasing radiant exposure. The threshold for immediate whitening varied inversely with skin pigmentation, ranging from a mean of 1.4 J/cm2 in lentigines to 3.1 J/cm2 in sun-protected skin. Transmission electron microscopy showed immediate alteration of mature melanosomes and nuclei within keratinocytes and melanocytes, but stage I and II melanosomes were unaffected. Histologically, immediate injury was confined to the epidermis. There was minimal inflammatory response 1 day after exposure. After 1 week, subthreshold exposures induced hyperpigmentation, with epidermal hyperplasia and increased melanin staining noted histologically. At higher radiant exposures, hypopigmentation occurred with desquamation of a pigmented scale/crust. All sites returned to normal skin color and texture without scarring within 3 to 6 months. These observations suggest that the human skin response to selective photothermolysis of pigmented cells is similar to that reported in animal models, including low radiant exposure stimulation of melanogenesis and high radiant exposure lethal injury to pigmented epidermal cells.

In vitro techniques to assess the proficiency of skin care cosmetic formulations.

Science.gov (United States)

Roy, Amit; Sahu, Ram Kumar; Matlam, Munglu; Deshmukh, Vinay Kumar; Dwivedi, Jaya; Jha, Arvind Kumar

2013-07-01

Cosmetics comprising either natural or synthetic components are used almost regularly and universally in different forms to enhance the beauty. The utmost disclosure of human membrane to sunlight and environmental pollution results in the exhibition of free radical, that react with deoxyribonucleic acid, proteins and fatty acids, causation oxidative destruction dysfunction of the antioxidant system. In skin, the formation of reactive oxygen species leads to skin diseases, predominantly cutaneous malignancies, immunosuppression, wrinkles, aging, etc., The human organism fosters a barrier practice against the destructive action of free radicals, comprising mostly of vitamins, carotenoids and enzymes. Cosmetic products are the best option to reduce skin disorders such as hyper pigmentation, skin aging, skin wrinkling and rough skin texture, etc., Hence in this review, we conferred various in vitro methods that are used for the development of novel cosmetic formulation. There is an expanding fascinate employing in vitro techniques because they are less time consuming, more cost-effective and lessen the participation of human volunteers.

Coffee polyphenols extracted from green coffee beans improve skin properties and microcirculatory function.

Science.gov (United States)

Fukagawa, Satoko; Haramizu, Satoshi; Sasaoka, Shun; Yasuda, Yuka; Tsujimura, Hisashi; Murase, Takatoshi

2017-09-01

Coffee polyphenols (CPPs), including chlorogenic acid, exert various physiological activities. The purpose of this study was to investigate the effects of CPPs on skin properties and microcirculatory function in humans. In this double-blind, placebo-controlled study, 49 female subjects with mildly xerotic skin received either a test beverage containing CPPs (270 mg/100 mL/day) or a placebo beverage for 8 weeks. The ingestion of CPPs significantly lowered the clinical scores for skin dryness, decreased transepidermal water loss, skin surface pH, and increased stratum corneum hydration and the responsiveness of skin blood flow during local warming. Moreover, the amounts of free fatty acids and lactic acid in the stratum corneum significantly increased after the ingestion of CPPs. These results suggest that an 8-week intake of CPPs improve skin permeability barrier function and hydration, with a concomitant improvement in microcirculatory function, leading to efficacy in the alleviation of mildly xerotic skin.

Skinware 2.0: A real-time middleware for robot skin

Directory of Open Access Journals (Sweden)

S. Youssefi

2015-12-01

Full Text Available Robot skins have emerged recently as products of research from various institutes worldwide. Each robot skin is designed with different applications in mind. As a result, they differ in many aspects from transduction technology and structure to communication protocols and timing requirements. These differences create a barrier for researchers interested in developing tactile processing algorithms for robots using the sense of touch; supporting multiple robot skin technologies is non-trivial and committing to a single technology is not as useful, especially as the field is still in its infancy. The Skinware middleware has been created to mitigate these issues by providing abstractions and real-time acquisition mechanisms. This article describes the second revision of Skinware, discussing the differences with respect to the first version.

Laser Scanning Microscopic Investigations of the Decontamination of Soot Nanoparticles from the Skin.

Science.gov (United States)

Lademann, Jürgen; Knorr, Fanny; Patzelt, Alexa; Meinke, Martina C; Richter, Heike; Krutmann, Jean; Rühl, Eckart; Doucet, Olivier

2018-01-01

Airborne pollutants, such as nano-sized soot particles, are increasingly being released into the environment as a result of growing population densities and industrialization. They can absorb organic and metal compounds with potential biological activity, such as polycyclic aromatic hydrocarbons and airborne pollen allergens. Local and systemic toxicities may be induced in the skin if the particulates release their harmful components upon dermal contact. In the present study, skin pretreatments with serum and/or shield as barrier formulations prior to exposure and washing with a cleanser subsequent to exposure were evaluated as a protection and decontamination strategy using laser scanning microscopy. The results indicate that while the application of serum and a cleanser was insufficient for decontamination, the pretreatment with shield prior to nanoparticle exposure followed by washing led to the removal of a considerable amount of the carbon black particles. The combined application of serum and shield before the administration of carbon black particles and subsequent washing led to their elimination from the skin samples. The application of barrier-enhancing formulations in combination with a cleanser may reduce the penetration of harmful airborne particulates by preventing their adhesion to the skin and facilitating their removal by subsequent washing with the cleanser. © 2018 S. Karger AG, Basel.

Silica- and perfluoro-based nanoparticular polymeric network for the skin protection against organophosphates

Science.gov (United States)

Bignon, Cécile; Amigoni, Sonia; Guittard, Frédéric

2016-06-01

Due to their small size, nanoparticles possess unique properties such as high absorption or pollutant degradation, making them useful for skin protection against chemicals. By covalently grafting to a hydrophobically modified alkali-soluble emulsion (HASE), a thickening polymer, nanoparticles can be dispersed as gels in water at neutral pH. With this modification the potential aggregation and toxicity typical of nanoparticles are avoided. Once integrated into a cosmetic formula, these gels can be spread onto skin to afford protective barriers. This paper reports (1) the benefit of SiO2 nanoparticles grafted to a perfluorocarbon HASE polymer (HASE-F/SiO2) which is then integrated into a new formula and it is influence on the efficacy against the penetration of paraoxone, as well as (2) the stability of the barrier cream (BC) and (3) how the homogenous dispersion of nanoparticles maintains a high active surface area of SiO2 nanoparticles. The efficiency of the new active topical skin protectant was proved at different doses (5-27 mg cm-2), under occlusive conditions and validated on human skin. Therefore, the combination of the HASE-F polymer, nanoparticle grafting, and polyvinylpyrrolidone and glycerol formulation led to a very effective active BC.

Development and psychometric testing of the 'Motivation and Self-Efficacy in Early Detection of Skin Lesions' index.

Science.gov (United States)

Dyson, Judith; Cowdell, Fiona

2014-12-01

To develop and psychometrically test the Motivation and Self-Efficacy in Early Detection of Skin Lesions Index. Skin cancer is the most frequently diagnosed cancer worldwide. The primary strategy used to prevent skin cancer is promotion of sun avoidance and the use of sun protection. However, despite costly and extensive campaigns, cases of skin cancer continue to increase. If found and treated early, skin cancer is curable. Early detection is, therefore, very important. The study was conducted in 2013. Instrument Development. A literature review and a survey identified barriers (factors that hinder) and levers (factors that help) to skin self-examination. These were categorized according to a the Theoretical Domains Framework and this formed the basis of an instrument, which was tested for validity and reliability using confirmatory factor analysis and Cronbach's alpha respectively. A five-factor 20-item instrument was used that tested well for reliability and construct validity. Test-retest reliability was good for all items and domains. The five factors were: (i) Outcome expectancies; (ii) Intention; (iii) Self-efficacy; (iv) Social influences; (v) Memory. The Motivation and Self-Efficacy in Early Detection of Skin Lesions Index provides a reliable and valid method of assessing barriers and levers to skin self-examination. The next step is to design a theory-based intervention that can be tailored according to individual determinants to behaviour change identified by this instrument. © 2014 John Wiley & Sons Ltd.

Lethal interpersonal violence in the Middle Pleistocene.

Directory of Open Access Journals (Sweden)

Nohemi Sala

Full Text Available Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

Lethal interpersonal violence in the Middle Pleistocene.

Science.gov (United States)

Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-Pérez, Ana; Pablos, Adrián; Martínez, Ignacio; Quam, Rolf M; Gómez-Olivencia, Asier; Bermúdez de Castro, José María; Carbonell, Eudald

2015-01-01

Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

Modern child skin care products as a basic treatment in atopic dermatitis

Directory of Open Access Journals (Sweden)

Shchegelskaya T.Yu.

2016-09-01

Full Text Available The aim of the proposed study is to demonstrate the benefits of using specialized cosmetic products as part of basic skin care for children with Atopic Dermatitis (AD. The epidermal barrier dysfunction is known to be the leading factor in pathogenesis of atopic dermatitis and it manifests as dry skin, imbalance in the composition of lipids of the stratum corneum and water-lipid mantle and alterations in the activity of proteases. Due to xerosis, the skin gets easily affected by allergens, irritants and pathogenic microorganisms, which triggers the "itch-scratch" cycle and can lead to AD exacerbation and significantly deteriorate the quality of life of the patient. The basic skin care using the moisturizing and soothing cosmetic products (emollients is acknowledged by all major Guidelines for treatment of AD as an important part of therapy. Significant improvements in skin status as well as the child's well-being can be achieved with use of this simple to understand skin care algorithm that includes proper skin cleansing, moisturizing and itch prevention.

Exocellular extract of Fusarium oxysporum, fungus free, is able to permeate and act selectively in skin.

Science.gov (United States)

Sibin Melo, Katia C; Correia, Marcelo H; Svidzinski, Terezinha I E; Hernandes, Luzmarina

2018-05-01

The skin is an important gateway for Fusarium infection in humans. Our hypothesis is that metabolites produced by Fusarium oxysporum should change the barrier structure to permeate the skin. Male Wistar rats received a topical application of a solution (0.05 mg/mL) of Fusarium metabolites. The animals were euthanized 3, 6, 12, 24 h after and the skin was processed for immunostaining by laminin and E-cadherin to investigate whether the Fusarium metabolites can break the barrier of healthy skin. Other techniques were employed: H&E to study the morphology; metalloproteinase-9 (MMP-9), TUNEL, and PCNA immunostaining to evaluate the inflammation, cell death, and proliferation, respectively. There was an inflammatory response mainly centered in the dermis. Qualitatively, the skin of the experimental group showed reduced E-cadherin and laminin immunostaining at 3, 12, and 24 h. Higher intensity staining by TUNEL at 3 h, and PCNA at 6, 12, and 24 h. There was intense MMP-9 activity at 6, 12, and 24 h. None of analyses revealed any changes in the epidermis. It was concluded that the fraction was able to permeate the skin and act selectively in dermis, inducing inflammatory response, increasing MMP-9 immunostaining, inducing apoptosis, and reducing E-cadherin and laminin immunostaining. © 2018 APMIS. Published by John Wiley & Sons Ltd.

3D cell printing of in vitro stabilized skin model and in vivo pre-vascularized skin patch using tissue-specific extracellular matrix bioink: A step towards advanced skin tissue engineering.

Science.gov (United States)

Kim, Byoung Soo; Kwon, Yang Woo; Kong, Jeong-Sik; Park, Gyu Tae; Gao, Ge; Han, Wonil; Kim, Moon-Bum; Lee, Hyungseok; Kim, Jae Ho; Cho, Dong-Woo

2018-06-01

3D cell-printing technique has been under spotlight as an appealing biofabrication platform due to its ability to precisely pattern living cells in pre-defined spatial locations. In skin tissue engineering, a major remaining challenge is to seek for a suitable source of bioink capable of supporting and stimulating printed cells for tissue development. However, current bioinks for skin printing rely on homogeneous biomaterials, which has several shortcomings such as insufficient mechanical properties and recapitulation of microenvironment. In this study, we investigated the capability of skin-derived extracellular matrix (S-dECM) bioink for 3D cell printing-based skin tissue engineering. S-dECM was for the first time formulated as a printable material and retained the major ECM compositions of skin as well as favorable growth factors and cytokines. This bioink was used to print a full thickness 3D human skin model. The matured 3D cell-printed skin tissue using S-dECM bioink was stabilized with minimal shrinkage, whereas the collagen-based skin tissue was significantly contracted during in vitro tissue culture. This physical stabilization and the tissue-specific microenvironment from our bioink improved epidermal organization, dermal ECM secretion, and barrier function. We further used this bioink to print 3D pre-vascularized skin patch able to promote in vivo wound healing. In vivo results revealed that endothelial progenitor cells (EPCs)-laden 3D-printed skin patch together with adipose-derived stem cells (ASCs) accelerates wound closure, re-epithelization, and neovascularization as well as blood flow. We envision that the results of this paper can provide an insightful step towards the next generation source for bioink manufacturing. Copyright © 2018 Elsevier Ltd. All rights reserved.

Ambient humidity and the skin: the impact of air humidity in healthy and diseased states.

Science.gov (United States)

Goad, N; Gawkrodger, D J

2016-08-01

Humidity, along with other climatic factors such as temperature and ultraviolet radiation, can have an important impact on the skin. Limited data suggest that external humidity influences the water content of the stratum corneum. An online literature search was conducted through Pub-Med using combinations of the following keywords: skin, skin disease, humidity, dermatoses, dermatitis, eczema, and mist. Publications included in this review were limited to (i) studies in humans or animals, (ii) publications showing relevance to the field of dermatology, (iii) studies published in English and (iv) publications discussing humidity as an independent influence on skin function. Studies examining environmental factors as composite influences on skin health are only included where the impact of humidity on the skin is also explored in isolation of other environmental factors. A formal systematic review was not feasible for this topic due to the heterogeneity of the available research. Epidemiological studies indicated an increase in eczema with low internal (indoors) humidity and an increase in eczema with external high humidity. Other studies suggest that symptoms of dry skin appear with low humidity internal air-conditioned environments. Murine studies determined that low humidity caused a number of changes in the skin, including the impairment of the desquamation process. Studies in humans demonstrated a reduction in transepidermal water loss (TEWL) (a measure of the integrity of the skin's barrier function) with low humidity, alterations in the water content in the stratum corneum, decreased skin elasticity and increased roughness. Intervention with a humidifying mist increased the water content of the stratum corneum. Conversely, there is some evidence that low humidity conditions can actually improve the barrier function of the skin. Ambient relative humidity has an impact on a range of parameters involved in skin health but the literature is inconclusive. Further

In vivo skin penetration of macromolecules in irritant contact dermatitis.

Science.gov (United States)

Abdel-Mottaleb, Mona M A; Lamprecht, Alf

2016-12-30

Recently, a selective preferential accumulation of polymeric nanoparticles (in the size range around 100nm) has been observed in the follicular system of dermatitis skin. The present investigation aimed at clearly investigating the effect of irritant contact dermatitis on the barrier permeability for colloidal systems below this size range, namely quantum dots and hydrophilic macromolecules. Irritant dermatitis was induced in mice and the penetrability of quantum dots (5nm) and hydrophilic dextran molecules has been tracked in both healthy and inflamed skin using confocal laser scanning microscopy. The selective accumulation of the quantum dots was clearly observed in inflamed skin while hydrophilic dextran behaved similarly in both healthy and inflamed skin. The therapeutic potential for the transdermal delivery of peptide drugs through inflamed skin has been also tested in rats. Results revealed that the transdermal permeation of insulin and calcitonin was not significantly enhanced in dermatitis compared to healthy skin. On the other side, permeation through stripped skin was significantly higher. However, the effect was limited and shorter compared to the SC injection where t min was 0.5h and 2h with a 70% and 46% reduction in blood glucose levels for the stripped skin and the SC injection respectively. Similarly, t min was 4h and 8h with area under the curve of 161±65% and 350±97% for the stripped skin and the SC injection respectively. In conclusion, the changes in skin permeability accompanied with skin inflammation did not affect its permeability to peptide drugs. Our findings also underline that experiments with the tape stripped skin model as a surrogate for inflamed skin can risk misleading conclusions due to significant difference of skin permeability between the tape stripped skin and inflamed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

Transporting Patients with Lethal Contagious Infections

National Research Council Canada - National Science Library

Swartz, Colleen

2002-01-01

.... The AIT is a unique military medical team capable of worldwide air evacuation and management of a limited number of patients who are potentially exposed to known and unknown lethal communicable...

Assessing the Impact of Mechanical Damage on Full-Thickness Porcine and Human Skin Using an In Vitro Approach

Directory of Open Access Journals (Sweden)

Hinda Dabboue

2015-01-01

Full Text Available For most xenobiotics, the rates of percutaneous absorption are limited by diffusion through the horny layer of skin. However, percutaneous absorption of chemicals may seriously increase when the skin is damaged. The aim of this work was to develop an in vitro representative model of mechanically damaged skins. The epidermal barrier was examined following exposure to a razor, a rotating brush, and a microneedle system in comparison to tape-stripping which acted as a reference. Excised full-thickness skins were mounted on a diffusion chamber in order to evaluate the effect of injuries and to mimic physiological conditions. The transepidermal water loss (TEWL was greatly increased when the barrier function was compromised. Measurements were made for all the damaged biopsies and observed histologically by microscopy. On human and porcine skins, the tape-stripping application (0 to 40 times showed a proportional increase in TEWL which highlights the destruction of the stratum corneum. Similar results were obtained for all cosmetic instruments. This is reflected in our study by the nonsignificant difference of the mean TEWL scores between 30 strips and mechanical damage. For a specific appreciation, damaged skins were then selected to qualitatively evaluate the absorption of a chlorogenic acid solution using fluorescence microscopy.

A bacterial cocaine esterase protects against cocaine-induced epileptogenic activity and lethality.

Science.gov (United States)

Jutkiewicz, Emily M; Baladi, Michelle G; Cooper, Ziva D; Narasimhan, Diwahar; Sunahara, Roger K; Woods, James H

2009-09-01

Cocaine toxicity results in cardiovascular complications, seizures, and death and accounts for approximately 20% of drug-related emergency department visits every year. Presently, there are no treatments to eliminate the toxic effects of cocaine. The present study hypothesizes that a bacterial cocaine esterase with high catalytic efficiency would provide rapid and robust protection from cocaine-induced convulsions, epileptogenic activity, and lethality. Cocaine-induced paroxysmal activity and convulsions were evaluated in rats surgically implanted with radiotelemetry devices (N=6 per treatment group). Cocaine esterase was administered 1 minute after a lethal dose of cocaine or after cocaine-induced convulsions to determine the ability of the enzyme to prevent or reverse, respectively, the effects of cocaine. The cocaine esterase prevented all cocaine-induced electroencephalographic changes and lethality. This effect was specific for cocaine because the esterase did not prevent convulsions and death induced by a cocaine analog, (-)-2beta-carbomethoxy-3beta-phenyltropane. The esterase prevented lethality even after cocaine-induced convulsions occurred. In contrast, the short-acting benzodiazepine, midazolam, prevented cocaine-induced convulsions but not the lethal effects of cocaine. The data showed that cocaine esterase successfully degraded circulating cocaine to prevent lethality and that cocaine-induced convulsions alone are not responsible for the lethal effects of cocaine in this model. Therefore, further investigation into the use of cocaine esterase for treating cocaine overdose and its toxic effects is warranted.

Dominant-lethal mutations and heritable translocations in mice

Energy Technology Data Exchange (ETDEWEB)

Generoso, W.M.

1983-01-01

Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed.

Dominant-lethal mutations and heritable translocations in mice

International Nuclear Information System (INIS)

Generoso, W.M.

1983-01-01

Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed

Stable isotope discrimination factors and between-tissue isotope comparisons for bone and skin from captive and wild green sea turtles (Chelonia mydas).

Science.gov (United States)

Turner Tomaszewicz, Calandra N; Seminoff, Jeffrey A; Price, Mike; Kurle, Carolyn M

2017-11-30

The ecological application of stable isotope analysis (SIA) relies on taxa- and tissue-specific stable carbon (Δ 13 C) and nitrogen (Δ 15 N) isotope discrimination factors, determined with captive animals reared on known diets for sufficient time to reflect dietary isotope ratios. However, captive studies often prohibit lethal sampling, are difficult with endangered species, and reflect conditions not experienced in the wild. We overcame these constraints and determined the Δ 13 C and Δ 15 N values for skin and cortical bone from green sea turtles (Chelonia mydas) that died in captivity and evaluated the utility of a mathematical approach to predict discrimination factors. Using stable carbon (δ 13 C values) and nitrogen (δ 15 N values) isotope ratios from captive and wild turtles, we established relationships between bone stable isotope (SI) ratios and those from skin, a non-lethally sampled tissue, to facilitate comparisons of SI ratios among studies using multiple tissues. The mean (±SD) Δ 13 C and Δ 15 N values (‰) between skin and bone from captive turtles and their diet (non-lipid-extracted) were 2.3 ± 0.3 and 4.1 ± 0.4 and 2.1 ± 0.6 and 5.1 ± 1.1, respectively. The mathematically predicted Δ 13 C and Δ 15 N values were similar (to within 1‰) to the experimentally derived values. The mean δ 15 N values from bone were higher than those from skin for captive (+1.0 ± 0.9‰) and wild (+0.8 ± 1.0‰) turtles; the mean δ 13 C values from bone were lower than those from skin for wild turtles (-0.6 ± 0.9‰), but the same as for captive turtles. We used linear regression equations to describe bone vs skin relationships and create bone-to-skin isotope conversion equations. For sea turtles, we provide the first (a) bone-diet SI discrimination factors, (b) comparison of SI ratios from individual-specific bone and skin, and (c) evaluation of the application of a mathematical approach to predict stable isotope discrimination factors. Our approach

A lethal ovitrap-based mass trapping scheme for dengue control in Australia: I. Public acceptability and performance of lethal ovitraps.

Science.gov (United States)

Ritchie, S A; Rapley, L P; Williams, C; Johnson, P H; Larkman, M; Silcock, R M; Long, S A; Russell, R C

2009-12-01

We report on the first field evaluation of the public acceptability and performance of two types of lethal ovitrap (LO) in three separate trials in Cairns, Australia. Health workers were able to set standard lethal ovitraps (SLOs) in 75 and 71% of premise yards in the wet and dry season, respectively, and biodegradable lethal ovitraps (BLOs) in 93% of yards. Public acceptance, measured as retention of traps by residents, was high for both trap types, with porous (grass, soil and mulch) versus solid (tiles, concrete, wood and stone) substrates. The SLOs and the BLOs were readily acceptable to ovipositing Aedes aegypti L. (Diptera: Culicidae); the mean number of eggs/trap was 6 and 15, for the dry season and wet season SLO trial, respectively, and 15 for the BLO wet season trial. Indeed, 84-94% of premise yards had egg positive SLOs or BLOs. A high percentage of both wet and dry season SLOs (29 and 70%, respectively) and BLOs (62%) that were dry after 4 weeks were egg positive, indicating the traps had functioned. Lethal strips from SLOs and BLOs that had been exposed for 4 weeks killed 83 and 74%, respectively, of gravid Ae. aegypti in laboratory assays. These results indicate that mass trapping schemes using SLOs and BLOs are not rejected by the public and effectively target gravid Ae. aegypti. The impact of the interventions on mosquito populations is described in a companion paper.

Impacts of chemical enhancers on skin permeation and deposition of terbinafine.

Science.gov (United States)

Erdal, Meryem Sedef; Peköz, Ayca Yıldız; Aksu, Buket; Araman, Ahmet

2014-08-01

The addition of chemical enhancers into formulations is the most commonly employed approach to overcome the skin barrier. The objective of this work was to evaluate the effect of vehicle and chemical enhancers on the skin permeation and accumulation of terbinafine, an allylamine antifungal drug. Terbinafine (1% w/w) was formulated as a Carbopol 934 P gel formulation in presence and absence of three chemical enhancers, nerolidol, dl-limonene and urea. Terbinafine distribution and deposition in stratum corneum (SC) and skin following 8-h ex vivo permeation study was determined using a sequential tape stripping procedure. The conformational order of SC lipids was investigated by ATR-FTIR spectroscopy. Nerolidol containing gel formulation produced significantly higher enhancement in terbinafine permeation through skin and its skin accumulation was increased. ATR-FTIR results showed enhancer induced lipid bilayer disruption in SC. Urea resulted in enhanced permeation of terbinafine across the skin and a balanced distribution to the SC was achieved. But, dl-limonene could not minimize the accumulation of terbinafine in the upper SC. Nerolidol dramatically improved the skin permeation and deposition of terbinafine in the skin that might help to optimize targeting of the drug to the epidermal sites as required for both of superficial and deep cutaneous fungal infections.

Skin Cancer Concerns in People of Color: Risk Factors and Prevention

Science.gov (United States)

Gupta, Alpana K; Bharadwaj, Mausumi; Mehrotra, Ravi

2016-01-01

Background: Though people of color (POC) are less likely to become afflicted with skin cancer, they are much more likely to die from it due to delay in detection or presentation. Very often, skin cancer is diagnosed at a more advanced stage in POC, making treatment difficult. The purpose of this research was to improve awareness regarding skin cancers in people of color by providing recommendations to clinicians and the general public for early detection and photo protection preventive measures. Methods: Data on different types of skin cancers were presented to POC. Due to limited research, there are few resources providing insights for evaluating darkly pigmented lesions in POC. Diagnostic features for different types of skin cancers were recorded and various possible risk factors were considered. Results: This study provided directions for the prevention and early detection of skin cancer in POC based on a comprehensive review of available data. Conclusions: The increased morbidity and mortality rate associated with skin cancer in POC is due to lack of awareness, diagnosis at a more advanced stage and socioeconomic barriers hindering access to care. Raising public health concerns for skin cancer prevention strategies for all people, regardless of ethnic background and socioeconomic status, is the key to timely diagnosis and treatment. PMID:28125871

A first vascularized skin equivalent as an alternative to animal experimentation.

Science.gov (United States)

Groeber, Florian; Engelhardt, Lisa; Lange, Julia; Kurdyn, Szymon; Schmid, Freia F; Rücker, Christoph; Mielke, Stephan; Walles, Heike; Hansmann, Jan

2016-01-01

Tissue-engineered skin equivalents mimic key aspects of the human skin, and can thus be employed as wound coverage for large skin defects or as in vitro test systems as an alternative to animal models. However, current skin equivalents lack a functional vasculature limiting clinical and research applications. This study demonstrates the generation of a vascularized skin equivalent with a perfused vascular network by combining a biological vascularized scaffold (BioVaSc) based on a decellularized segment of a porcine jejunum and a tailored bioreactor system. Briefly, the BioVaSc was seeded with human fibroblasts, keratinocytes, and human microvascular endothelial cells. After 14 days at the air-liquid interface, hematoxylin & eosin and immunohistological staining revealed a specific histological architecture representative of the human dermis and epidermis including a papillary-like architecture at the dermal-epidermal-junction. The formation of the skin barrier was measured non-destructively using impedance spectroscopy. Additionally, endothelial cells lined the walls of the formed vessels that could be perfused with a physiological volume flow. Due to the presence of a complex in-vivo-like vasculature, the here shown skin equivalent has the potential for skin grafting and represents a sophisticated in vitro model for dermatological research.

Creation of Nepal's First Skin Bank: Challenges and Outcomes.

Science.gov (United States)

Cai, Lawrence; Long, Chao; Karki, Bishal; Nakarmi, Kiran; Iqbal, Adnan; Casertano, Michele; Anderson, Sara; Patell, James; Chang, James; Rai, Shankar Man

2017-11-01

In Nepal, burn trauma causes more than 55,000 injuries each year. Burn-related mortality is high in Nepal, in part due to lack of allograft, leading to high infection rates. To address this challenge, our collaboration between Kirtipur Hospital, America Nepal Medical Foundation, Stanford University, and ReSurge International established Nepal's first skin bank. We identified 3 major tasks to create a sustainable skin banking program: 1) identify and acquire the equipment and personnel needed to collect, process, store, and graft cadaveric skin for burn injuries; 2) develop safe donation protocols and documentation tools that remain feasible for low-resource settings; and 3) develop a long-term awareness program to educate the Nepali people on skin donation, a previously foreign concept. Kirtipur Hospital acquired the necessary equipment and materials for the skin bank through a combination of local and international fundraising efforts. Existing U.S. skin banking protocols were adapted for the Nepali setting and piloted on potential patients, donors, and physicians. For the first time in the hospital's history, patients with > 40% total body surface area burns were successfully treated with extensive allografts. It is feasible to create a skin bank in a country with no tradition of allograft skin use. Long-term sustainability now depends on spreading awareness and education in the Kathmandu Valley to overcome religious and cultural barriers that have hindered donor recruitment. Our low-cost and high-impact skin bank provides a model to expand this system to other hospitals both within Nepal and beyond.

Skin healing and scale regeneration in fed and unfed sea bream, Sparus auratus

Directory of Open Access Journals (Sweden)

Canario Adelino VM

2011-10-01

Full Text Available Abstract Background Fish scales are an important reservoir of calcium and phosphorus and together with the skin function as an integrated barrier against environmental changes and external aggressors. Histological studies have revealed that the skin and scales regenerate rapidly in fish when they are lost or damaged. In the present manuscript the histological and molecular changes underlying skin and scale regeneration in fed and fasted sea bream (Sparus auratus were studied using a microarray 3 and 7 days after scale removal to provide a comprehensive molecular understanding of the early stages of these processes. Results Histological analysis of skin/scales revealed 3 days after scale removal re-epithelisation and formation of the scale pocket had occurred and 53 and 109 genes showed significant up or down-regulation, respectively. Genes significantly up-regulated were involved in cell cycle regulation, cell proliferation and adhesion, immune response and antioxidant activities. 7 days after scale removal a thin regenerated scale was visible and only minor changes in gene expression occurred. In animals that were fasted to deplete mineral availability the expression profiles centred on maintaining energy homeostasis. The utilisation of fasting as a treatment emphasised the competing whole animal physiological requirements with regard to barrier repair, infection control and energy homeostasis. Conclusions The identification of numerous genes involved in the mitotic checkpoint and cell proliferation indicate that the experimental procedure may be useful for understanding cell proliferation and control in vertebrates within the context of the whole animal physiology. In response to skin damage genes of immune surveillance were up-regulated along with others involved in tissue regeneration required to rapidly re-establish barrier function. Additionally, candidate fish genes were identified that may be involved in cytoskeletal re

Lethal mechanisms in gastric volvulus.

Science.gov (United States)

Omond, Kimberley J; Byard, Roger W

2017-01-01

A 55-year-old wheelchair-bound woman with severe cerebral palsy was found at autopsy to have marked distention of the stomach due to a volvulus. The stomach was viable, and filled with air and fluid and had pushed the left dome of the diaphragm upwards causing marked compression of the left lung with a mediastinal shift to the right (including the heart). There was no evidence of gastric perforation, ischaemic necrosis or peritonitis. Removal of the organ block revealed marked kyphoscoliosis. Histology confirmed the viability of the stomach and biochemistry showed no dehydration. Death in cases of acute gastric volvulus usually occurs because of compromise of the gastric blood supply resulting in ischaemic necrosis with distention from swallowed air and fluid resulting in perforation with lethal peritonitis. Hypovolaemic shock may also occur. However, the current case demonstrates an alternative lethal mechanism, that of respiratory compromise due to marked thoracic organ compression.

A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin

Directory of Open Access Journals (Sweden)

Nisma Mujahid

2017-06-01

Full Text Available The presence of dark melanin (eumelanin within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in “redhaired” Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk.

A UV-Independent Topical Small-Molecule Approach for Melanin Production in Human Skin.

Science.gov (United States)

Mujahid, Nisma; Liang, Yanke; Murakami, Ryo; Choi, Hwan Geun; Dobry, Allison S; Wang, Jinhua; Suita, Yusuke; Weng, Qing Yu; Allouche, Jennifer; Kemeny, Lajos V; Hermann, Andrea L; Roider, Elisabeth M; Gray, Nathanael S; Fisher, David E

2017-06-13

The presence of dark melanin (eumelanin) within human epidermis represents one of the strongest predictors of low skin cancer risk. Topical rescue of eumelanin synthesis, previously achieved in "redhaired" Mc1r-deficient mice, demonstrated significant protection against UV damage. However, application of a topical strategy for human skin pigmentation has not been achieved, largely due to the greater barrier function of human epidermis. Salt-inducible kinase (SIK) has been demonstrated to regulate MITF, the master regulator of pigment gene expression, through its effects on CRTC and CREB activity. Here, we describe the development of small-molecule SIK inhibitors that were optimized for human skin penetration, resulting in MITF upregulation and induction of melanogenesis. When topically applied, pigment production was induced in Mc1r-deficient mice and normal human skin. These findings demonstrate a realistic pathway toward UV-independent topical modulation of human skin pigmentation, potentially impacting UV protection and skin cancer risk. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Evaluation of the correlation between Scoring Feline Allergic Dermatitis and Feline Extent and Severity Index and skin hydration in atopic cats.

Science.gov (United States)

Szczepanik, Marcin P; Wilkołek, Piotr M; Adamek, Łukasz R; Zając, Marcin; Gołyński, Marcin; Sitkowski, Wiesław; Taszkun, Iwona

2018-02-01

Evaluation of the severity of clinical signs of cats with allergic skin diseases has used two scoring systems: Scoring Feline Allergic Dermatitis (SCORFAD) and the Feline Extent and Severity Index (FeDESI). The integrity of the cutaneous barrier can also be evaluated by measuring skin hydration. A correlation between the clinical score and skin hydration has been observed in humans and dogs with atopic dermatitis (AD). To demonstrate a correlation between the clinical score and skin hydration of cats affected with presumed AD. European short hair cats (n = 18): 11 females and seven males with a confirmed diagnosis of AD. SCORFAD and FeDESI scores were calculated and the measurements of skin hydration were assessed from seven body sites using corneometry. The correlation between the SCORFAD and FeDESI systems and skin hydration of each site, and the average skin hydration was calculated. There was a positive correlation between the SCORFAD score and skin hydration for the axilla, thorax and forelimb; for FeDESI and axilla and lumbar sites. There was a negative correlation between the FeDESI and skin hydration for the pinna (r = -0.47). Measurements of skin hydration could be a useful tool for the evaluation of allergic cats. There is limited evidence of any useful correlation between clinical scoring systems and measurements of hydration. The pinna may be a suitable region for the assessment of skin barrier function in normal and allergic cats. © 2017 ESVD and ACVD.

The lethal injection quandary: how medicine has dismantled the death penalty.

Science.gov (United States)

Denno, Deborah W

2007-10-01

On February 20, 2006, Michael Morales was hours away from execution in California when two anesthesiologists declined to participate in his lethal injection procedure, thereby halting all state executions. The events brought to the surface the long-running schism between law and medicine, raising the question of whether any beneficial connection between the professions ever existed in the execution context. History shows it seldom did. Decades of botched executions prove it. This Article examines how states ended up with such constitutionally vulnerable lethal injection procedures, suggesting that physician participation in executions, though looked upon with disdain, is more prevalent--and perhaps more necessary--than many would like to believe. The Article also reports the results of this author's unique nationwide study of lethal injection protocols and medical participation. The study demonstrates that states have continued to produce grossly inadequate protocols that severely restrict sufficient understanding of how executions are performed and heighten the likelihood of unconstitutionality. The analysis emphasizes in particular the utter lack of medical or scientific testing of lethal injection despite the early and continuous involvement of doctors but ongoing detachment of medical societies. Lastly, the Article discusses the legal developments that led up to the current rush of lethal injection lawsuits as well as the strong and rapid reverberations that followed, particularly with respect to medical involvement. This Article concludes with two recommendations. First, much like what occurred in this country when the first state switched to electrocution, there should be a nationwide study of proper lethal injection protocols. An independent commission consisting of a diverse group of qualified individuals, including medical personnel, should conduct a thorough assessment of lethal injection, especially the extent of physician participation. Second, this

Empirical complexities in the genetic foundations of lethal mutagenesis.

Science.gov (United States)

Bull, James J; Joyce, Paul; Gladstone, Eric; Molineux, Ian J

2013-10-01

From population genetics theory, elevating the mutation rate of a large population should progressively reduce average fitness. If the fitness decline is large enough, the population will go extinct in a process known as lethal mutagenesis. Lethal mutagenesis has been endorsed in the virology literature as a promising approach to viral treatment, and several in vitro studies have forced viral extinction with high doses of mutagenic drugs. Yet only one empirical study has tested the genetic models underlying lethal mutagenesis, and the theory failed on even a qualitative level. Here we provide a new level of analysis of lethal mutagenesis by developing and evaluating models specifically tailored to empirical systems that may be used to test the theory. We first quantify a bias in the estimation of a critical parameter and consider whether that bias underlies the previously observed lack of concordance between theory and experiment. We then consider a seemingly ideal protocol that avoids this bias-mutagenesis of virions-but find that it is hampered by other problems. Finally, results that reveal difficulties in the mere interpretation of mutations assayed from double-strand genomes are derived. Our analyses expose unanticipated complexities in testing the theory. Nevertheless, the previous failure of the theory to predict experimental outcomes appears to reside in evolutionary mechanisms neglected by the theory (e.g., beneficial mutations) rather than from a mismatch between the empirical setup and model assumptions. This interpretation raises the specter that naive attempts at lethal mutagenesis may augment adaptation rather than retard it.

Tissue-specific mosaicism for a lethal osteogenesis imperfecta COL1A1 mutation causes mild OI/EDS overlap syndrome.

Science.gov (United States)

Symoens, Sofie; Steyaert, Wouter; Demuynck, Lynn; De Paepe, Anne; Diderich, Karin E M; Malfait, Fransiska; Coucke, Paul J

2017-04-01

Type I collagen is the predominant protein of connective tissues such as skin and bone. Mutations in the type I collagen genes (COL1A1 and COL1A2) mainly cause osteogenesis imperfecta (OI). We describe a patient with clinical signs of Ehlers-Danlos syndrome (EDS), including fragile skin, easy bruising, recurrent luxations, and fractures resembling mild OI. Biochemical collagen analysis of the patients' dermal fibroblasts showed faint overmodification of the type I collagen bands, a finding specific for structural defects in type I collagen. Bidirectional Sanger sequencing detected an in-frame deletion in exon 44 of COL1A1 (c.3150_3158del), resulting in the deletion of three amino acids (p.Ala1053_Gly1055del) in the collagen triple helix. This COL1A1 mutation was hitherto identified in four probands with lethal OI, and never in EDS patients. As the peaks on the electropherogram corresponding to the mutant allele were decreased in intensity, we performed next generation sequencing of COL1A1 to study mosaicism in skin and blood. While approximately 9% of the reads originating from fibroblast gDNA harbored the COL1A1 deletion, the deletion was not detected in gDNA from blood. Most likely, the mild clinical symptoms observed in our patient can be explained by the mosaic state of the mutation. © 2017 Wiley Periodicals, Inc.

Less skin irritation from alcohol-based disinfectant than from detergent used for hand disinfection

DEFF Research Database (Denmark)

Pedersen, L K; Held, E; Johansen, J D

2005-01-01

and forearms of 17 healthy volunteers. A control area was included. After 4 weeks an SLS patch was applied to each area. Irritant reactions were quantified with a visual score recording and measurements of transepidermal water loss (TEWL) and skin colour were performed on days 1, 5, 11, 38 and 40. RESULTS...... was found on the disinfectant-treated area compared with the control area and detergent area, and a similar trend was found for TEWL, although it was not statistically significant. CONCLUSION: Alcohol-based disinfectant caused less visible skin irritation and less skin barrier disruption than the use...

Calcium-Sensing Receptor Tumor Expression and Lethal Prostate Cancer Progression.

Science.gov (United States)

Ahearn, Thomas U; Tchrakian, Nairi; Wilson, Kathryn M; Lis, Rosina; Nuttall, Elizabeth; Sesso, Howard D; Loda, Massimo; Giovannucci, Edward; Mucci, Lorelei A; Finn, Stephen; Shui, Irene M

2016-06-01

Prostate cancer metastases preferentially target bone, and the calcium-sensing receptor (CaSR) may play a role in promoting this metastatic progression. We evaluated the association of prostate tumor CaSR expression with lethal prostate cancer. A validated CaSR immunohistochemistry assay was performed on tumor tissue microarrays. Vitamin D receptor (VDR) expression and phosphatase and tensin homolog tumor status were previously assessed in a subset of cases by immunohistochemistry. Cox proportional hazards models adjusting for age and body mass index at diagnosis, Gleason grade, and pathological tumor node metastasis stage were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association of CaSR expression with lethal prostate cancer. The investigation was conducted in the Health Professionals Follow-up Study and Physicians' Health Study. We studied 1241 incident prostate cancer cases diagnosed between 1983 and 2009. Participants were followed up or cancer-specific mortality or development of metastatic disease. On average, men were followed up 13.6 years, during which there were 83 lethal events. High CaSR expression was associated with lethal prostate cancer independent of clinical and pathological variables (HR 2.0; 95% CI 1.2-3.3). Additionally, there was evidence of effect modification by VDR expression; CaSR was associated with lethal progression among men with low tumor VDR expression (HR 3.2; 95% CI 1.4-7.3) but not in cases with high tumor VDR expression (HR 0.8; 95% CI 0.2-3.0). Tumor CaSR expression is associated with an increased risk of lethal prostate cancer, particularly in tumors with low VDR expression. These results support further investigating the mechanism linking CaSR with metastases.

Market trends in baby skin care products and implications for clinical practice.

Science.gov (United States)

Gao, Xiang; Simpson, Eric L

2014-01-01

Although the U.S. pediatric skin care market is a $1.7 billion industry, little is known regarding the usage pattern of skin care products in very young children. We have begun to recognize that common over-the-counter skin care products may have positive or negative effects on skin barrier function. Thus, knowing what and how skin care products are used early in life is important. The goal of the current study was to better understand skin care product use in the United States using market research data. We found that the prevalence of use was greater than 50% for all skin care product categories and age groups. Premoistened cleansing wipes and cloths were the most frequently used product, followed by baby oil and lotion and body and baby powder. Baby bath and shampoo products were used at least five times per week per household, and caregivers generally preferred products that were fragrance-free and made for sensitive skin. Lower-income households reported a higher frequency of product use and were less likely to purchase fragrance-free products or ones that were made for sensitive skin. Our findings suggest that the prevalence of pediatric skin care product use is high and conflicts with current recommended skin care guidelines. Product use and preferences may also vary according to race and ethnicity and household income level. © 2014 Wiley Periodicals, Inc.

Influential Factors of Mother-Infant Skin-to-Skin Contact Based on the Precede-Proceed Model from the Perspective of Midwives in Torbat Heydariyeh Hospitals

Directory of Open Access Journals (Sweden)

Mohadeseh Adeli

2016-07-01

structures and barriers associated with skin-to-skin contact.

Fire barrier problems-part 3

International Nuclear Information System (INIS)

Verna, B.J.

1993-01-01

This article deals with problems associated with a thermal barrier material called Thermo-Lag 330. Typically in nuclear applications this material is used to provide either 1 hour (1/2 inch thick) or 3 hour (1 inch thick) barriers to prevent the spread of fires between redundant safety systems, and to protect cable trays and conduit. The article reviews concerns within the nuclear industry as to the proper handling of the material, how to interpret the data available on the material, the apparant conflicting assessments of the material when tested by different groups, etc. Research is ongoing on the suitability of the material, but the article points out that the manufacturer feels it should be installed by properly trained installers, the joints sealed with a grouting material, properly bundled to maintain its integrity, have a complete stress skin, and not be walked on after installation in order to function properly

Alkylglycerol Derivatives, a New Class of Skin Penetration Modulators

Directory of Open Access Journals (Sweden)

Sergio Alberto Bernal-Chávez

2017-01-01

Full Text Available The absorption modulating activity of two alkylglycerol derivatives (batyl and chimyl alcohol on skin barrier properties was evaluated. Biophysical tests such as transepidermal water loss (TEWL and attenuated total reflectance–Fourier transform infrared (ATR-FTIR spectroscopy, as well as in vitro skin permeation studies, were performed in order to determine the effect of these compounds as chemical absorption modulators. Four drugs were used as models: three NSAIDS (diclofenac, naproxen, and piroxicam and glycyrrhizic acid. The results showed that treatment of the skin with alkylglycerols caused (i a reduction on the amount of drug permeated; (ii a reduction in TEWL; and (iii changes in the ATR-FTIR peaks of stratum corneum lipids, indicative of a more ordered structure. All of these findings confirm that alkyl glycerols have an absorption retarding effect on the drugs tested. Such effects are expected to give rise to important applications in the pharmaceutical and cosmetic sectors, in cases where it is desirable for the drug to remain in the superficial layers of the skin to achieve a local effect.

Effect of lethality on the extinction and on the error threshold of quasispecies.

Science.gov (United States)

Tejero, Hector; Marín, Arturo; Montero, Francisco

2010-02-21

In this paper the effect of lethality on error threshold and extinction has been studied in a population of error-prone self-replicating molecules. For given lethality and a simple fitness landscape, three dynamic regimes can be obtained: quasispecies, error catastrophe, and extinction. Using a simple model in which molecules are classified as master, lethal and non-lethal mutants, it is possible to obtain the mutation rates of the transitions between the three regimes analytically. The numerical resolution of the extended model, in which molecules are classified depending on their Hamming distance to the master sequence, confirms the results obtained in the simple model and shows how an error catastrophe regime changes when lethality is taken in account. (c) 2009 Elsevier Ltd. All rights reserved.

Efficacy and Tolerability of a Facial Serum for Fine Lines, Wrinkles, and Photodamaged Skin