WorldWideScience

Sample records for lepidium draba brassicaceae

  1. New Lepidium (Brassicaceae) from New Zealand

    Science.gov (United States)

    de Lange, P. J.; Heenan, P. B.; Houliston, G. J.; Rolfe, J. R.; Mitchell, A. D.

    2013-01-01

    Abstract A revision of the New Zealand endemic Lepidium oleraceum and allied species is presented. Sixteen species are recognised, 10 of these are new. The new species are segregated on the basis of morphological characters supported by molecular data obtained from three DNA markers (two rDNA and one cpDNA). One species, Lepidium castellanum sp. nov., is endemic to the Kermadec Islands where it is sympatric with Lepidium oleraceum. The North Island of New Zealand supports four species, with two of them, Lepidium amissum sp. nov. and Lepidium obtusatum, now extinct. The South Island supports six species, that, aside from Lepidium banksii, Lepidium flexicaule and Lepidium oleraceum, are all confined to the south-eastern half of the island (Lepidium aegrum sp. nov., Lepidium crassum sp. nov. and Lepidium juvencum sp. nov.). One of these, Lepidium juvencum sp. nov., extends to Stewart Island. The Chatham Islands support six species (Lepidium flexicaule, Lepidium oblitum sp. nov., Lepidium oleraceum, Lepidium oligodontum sp. nov., Lepidium panniforme sp. nov., and Lepidium rekohuense sp. nov.), one of which, Lepidium oligodontum sp. nov., extends to the Antipodes Islands group. The remote, subantarctic Bounty Islands group supports one endemic, Lepidium seditiosum sp. nov., which is the only vascular plant to be recorded from there. Lepidium limenophylax sp. nov. is known from islands off the south-western side of Stewart Island/Rakiura, The Snares and Auckland islands. Lepidium naufragorum, although not related to Lepidium oleraceum and its allies, is also treated because populations with entire leaves are now known. Typification is undertaken for Lepidium banksii, Lepidium oleraceum, Lepidium oleraceum var. acutidentatum, var. frondosum and var. serrulatum. PMID:23794938

  2. Phenology and temperature-dependent development of Ceutorhynchus assimilis, a potential biological control agent for Lepidium draba

    Science.gov (United States)

    Heart-podded hoary cress (Lepidium draba) is an alien weed that has invaded rangeland in the northwestern USA. A host race (i;e; host-specific biotype) of the weevil, Ceutorhynchus assimilis, is being evaluated as a prospective biological control agent. This biotype is only known from southern Eur...

  3. Kaempferol glycosides and cardenolide glycosides, cytotoxic constituents from the seeds of Draba nemorosa (Brassicaceae).

    Science.gov (United States)

    Moon, Surk-Sik; Rahman, Md Aziz Abdur; Manir, Md Maniruzzaman; Jamal Ahamed, V S

    2010-08-01

    Bioassay-directed fractionation of a methanolic extract from the seeds of Draba nemorosa (Brassicaceae) led to isolation of a new flavonol glycoside, drabanemoroside (5, kaempferol 3-O-alpha-L-rhamnopyranosyl-(1-->2)-alpha-L-arabinopyranose) along with four known flavonoid derivatives (1-4), four cardenolide glycosides (6-9). Kaempferol glycosides 2 and 5 showed strong cytotoxicity against human small lung cancer cell line A549 and melanoma SK-Mel-2 with an IC(50) of 0.5 microg/mL and 1.9 microg/mL, respectively. Cardenolide glycosides 6-9 showed potent cytotoxicity (A549) in the range of 0.01-0.032 microg/mL. Their structures were characterized based on spectroscopic data (2D NMR, HRTOFMS, IR, and UV) and comparison of literature values. The carbohydrate units were also confirmed by comparing the hydrolysate of 5 with authentic monosaccharides.

  4. New Lepidium (Brassicaceae from New Zealand

    Directory of Open Access Journals (Sweden)

    Peter de Lange

    2013-06-01

    Full Text Available A revision of the New Zealand endemic Lepidium oleraceum and allied species is presented. Sixteen species are recognised, 10 of these are new. The new species are segregated on the basis of morphological characters supported by molecular data obtained from three DNA markers (two rDNA and one cpDNA. One species, L. castellanum sp. nov., is endemic to the Kermadec Islands where it is sympatric with L. oleraceum. The North Island of New Zealand supports four species, with two of them, L. amissum sp. nov. and L. obtusatum, now extinct. The South Island supports six species, that, aside from L. banksii, L. flexicaule and L. oleraceum, are all confined to the south-eastern half of the island (L. aegrum sp. nov., L. crassum sp. nov. and L. juvencum sp. nov.. One of these, L. juvencum sp. nov., extends to Stewart Island. The Chatham Islands support six species (L. flexicaule, L. oblitum sp. nov., L. oleraceum, L. oligodontum sp. nov., L. panniforme sp. nov., and L. rekohuense sp. nov., one of which, L. oligodontum sp. nov., extends to the Antipodes Islands group. The remote, subantarctic Bounty Islands group supports one endemic, L. seditiosum sp. nov., which is the only vascular plant to be recorded from there. Lepidium limenophylax sp. nov. is known from islands off the south-western side of Stewart Island/Rakiura, The Snares and Auckland islands. Lepidium naufragorum, although not related to L. oleraceum and its allies, is also treated because populations with entire leaves are now known. Typification is undertaken for L. banksii, L. oleraceum, L. oleraceum var. acutidentatum, var. frondosum and var. serrulatum.

  5. ALLELOPATHIC EFFECT OF PARSLEY (Petroselinum crispum Mill. COGERMINATION, WATER EXTRACTS AND RESIDUES ON HOARY CRESS (Lepidium draba (L. Desv.

    Directory of Open Access Journals (Sweden)

    Marija Ravlić

    2014-06-01

    Full Text Available The aim of the study was to examine allelopathic effect of parsley (Petroselinum crispum Mill. on germination and growth parameters of weed species hoary cress (Lepidium draba (L. Desv.. Cogermination of hoary cress with parsley seeds, water extracts from fresh and dry parsley biomass in concentrations of 5 and 10% (50 and 100 g per litre of distilled water were evaluated in Petri dishes. Effect of water extracts from fresh parsley biomass in aforementioned concentrations as well as effects of fresh and dry parsley residues in two rates (10 and 20 g/kg of soil were examined in pots with soil. Cogermination of seeds stimulated root length, but decreased shoot length and fresh weight of hoary cress seedlings. In the Petri dish assay, extracts from fresh and dry parsley biomass reduced germination of hoary cress, but had both stimulatory as well as inhibitory effect on other parameters. The highest concentration of dry biomass extract completely reduced germination rate of hoary cress (by 100%. In the pot experiment, extracts from fresh parsley biomass had stimulatory effect on weed growth parameters except for root length which was inhibited with higher concentration by 4.2%. Fresh parsley residues reduced germination, root and shoot length of hoary cress, while dry parsley residues promoted measured parameters, with the exception of root length.

  6. Phytotoxical effect of Lepidium draba L. extracts on the germination and growth of monocot (Zea mays L.) and dicot (Amaranthus retroflexus L.) seeds.

    Science.gov (United States)

    Kaya, Yusuf; Aksakal, Ozkan; Sunar, Serap; Erturk, Filiz Aygun; Bozari, Sedat; Agar, Guleray; Erez, Mehmet Emre; Battal, Peyami

    2015-03-01

    Laboratory experiments were performed to determine phytotoxic potentials of white top (Lepidium draba) methanol extracts (root, stem and leaf) on germination and early growth of corn (Zea mays) and redroot pigweed (Amaranthus retroflexus). Furthermore, the effects of different methanol extracts of L. draba on the phytohormone (indole-3-acetic acid (IAA), gibberellic acid (GA), abscisic acid (ABA) and zeatin) levels of corn and redroot pigweed were investigated. It was observed that all concentrations of methanol extracts of root, stem and leaf of L. draba inhibited germination, radicle and plumule elongation when compared with the respective controls. Besides this, the degree of inhibition was increased in concert with increasing concentrations of extracts used. On the other hand, phytohormone levels changed with the application of different extract concentrations. Comparing with the control, the GA levels significantly decreased while the ABA levels increased in all the application groups. Zeatin and IAA levels showed changes depending upon the applied extracts and concentrations. © The Author(s) 2012.

  7. A synopsis of the South American Lepidium (Brassicaceae)

    OpenAIRE

    Ihsan A. Al-Shehbaz

    2010-01-01

    Cincuenta especies nativas y 12 naturalizadas de Lepidium crecen en América del Sur, se presenta una clave para las 62 especies. Se describen e ilustran tres nuevas especies de Argentina (L. hickenii, L. pedersenii y L. santacruzensis) y dos para Perú (L. cuzcoensis y L. werffii), y se discuten sus relaciones con sus especies más afines. Se propone Lepidium crassius comb. nov., se designa lectotipo para 19 binomios (Coronopus didymus var. macrocarpus, C. didymus var. procumbens, L. abrotanifo...

  8. A synopsis of the South American Lepidium (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Ihsan A. Al-Shehbaz

    2010-01-01

    Full Text Available Cincuenta especies nativas y 12 naturalizadas de Lepidium crecen en América del Sur, se presenta una clave para las 62 especies. Se describen e ilustran tres nuevas especies de Argentina (L. hickenii, L. pedersenii y L. santacruzensis y dos para Perú (L. cuzcoensis y L. werffii, y se discuten sus relaciones con sus especies más afines. Se propone Lepidium crassius comb. nov., se designa lectotipo para 19 binomios (Coronopus didymus var. macrocarpus, C. didymus var. procumbens, L. abrotanifolium var. steinmannii, L. affine, L. argentinum, L. auriculatum, L. bonariense var. pseudovirginicum, L. calycinum var. integrifolium, L. costaricense, L. cumingianum var. orbiculatum, L. cumingianum subsp. berteroanum, L. depressum, L. myrianthum, L. neglectum, L. parodii, L. pubescens var. fallax, L. subvaginatum, L. virginicum subsp. centrali-americanum, Thlaspi campestre, y se reducen a sinónimos otros 17 nombres (Coronopus leptocarpus, C. leptocarpus var. microcarpus, L. boelckii, L. bonariense var. gayi, L. bonariense var. pseudovirginicum, L. brevicaule, L. calycinum, L. danielsii, L. demissum, L. kalenbornii, L. morrisonii, L. peruvianum, L. philippianum var. boliviense, L. raimondii, L. scabrifructum, L. spicatum var. caylx-persistente, L. subvaginatum. L. depressum y L. rahmeri son nuevos registros para la Argentina.

  9. Dormancy and germination in short-lived lepidium perfoliatu l. (brassicaceae) seeds

    International Nuclear Information System (INIS)

    Tang, An-Jun; Tian, M.; Long, Chun-Lin

    2010-01-01

    To understand germination timing in an ecological context, the response to environmental events that effect seed dormancy is central and has to be combined with knowledge of germination responses to different ecological factors. In this study, seed dormancy, germination and seedling survival of annual short-lived clasping pepper weed Lepidium perfoliatum L. (Brassicaceae) were investigated. Three types of pre-treatments viz., various temperature dry storage, light and water stress were tested as possible dormancy and survival-affecting environmental events. Fresh mature seeds were greatly dormant. Warm (30 deg. C) dry storage more facilitated breaking dormancy, they germinated well under apt conditions (e.g. 20 deg. C and 10/20 deg. C plus periodic light, 14 h/d). For those seeds which underwent after-ripening, they could germinate at a range of constant temperatures (4, 10, 15, 20, 25, and 30 deg. C) and one alternating temperature (10/20 deg. C). Under alternating temperature regimes, the final percent germination of L. perfoliatum seeds increased from 37 deg. C to 93% when temperature altered from 4/10 deg. C to 10/20 deg. C in light, then decreased with increasing temperature. The germination pattern under constant temperature conditions was similar to that under alternating temperature and significant differences in final percent germinations and rates of germination were observed among different temperatures. Under different light treatments, final germination of showed significant differences, only with 35% of germination percentage in dark, much lower than those in red and white light (i.e. 93% and 91%, respectively). GA3 could promote the germination of non-dormant seeds in dark. When water potentials were reduced, final percent germination decreased dramatically, and few seeds germinated at -0.98 MPa (generated by PEG-8000). The changes of proline content in resultant seedlings were reverse to that of final percent germination with changing water

  10. Polymorphic chloroplast microsatellite markers in the octoploid Lepidium meyenii (Brassicaceae) and cross-species amplification in Lepidium.

    Science.gov (United States)

    Hasan, Nabeeh A; Mummenhoff, Klaus; Quiros, Carlos F; Tay, C David; Bailey, C Donovan

    2010-10-01

    As a crop and medicinal plant, the octoploid Andean endemic Lepidium meyenii suffers from taxonomic uncertainty. Few molecular markers are available to genotype individuals or track gene flow in wild and cultivated material. • Using available sequence data, eight cpSSR primer pairs were developed for L. meyenii. Levels of polymorphism checked in 56 individual L. meyenii, including cultivated and wild material, revealed that the number of alleles per locus ranged from three to five, and intrapopulation allele frequencies ranged from 0.071 to 1.0. Polymerase-chain-reaction screens using our cpSSR primers in 27 other Lepidium species and three Coronopus species suggested a high degree of interspecific amplification. • These polymorphic cpSSR markers should prove useful in characterizing genetic variation among cultivated and wild L. meyenii. Additionally, interspecific amplifications suggest that these markers will be useful for the study of related taxa.

  11. Histología de la Maca, Lepidium meyenii Walpers (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Manuel Marín-Bravo

    2013-06-01

    Full Text Available Se presenta el estudio histológico de Lepidium meyenii Walpers "maca", enfocado principalmente en la caracterización del órgano reservante. El estudio se realizó en macas de color amarillo, procedentes de Junín, y comprendió la caracterización histológica del órgano reservante subterráneo y detalles adicionales de la estructura interna foliar, a partir de muestras fijadas en FAA y empleando la técnica de inclusión en parafina. Los resultados muestran en el órgano reservante las características de una región de transición entre la raíz, de estructura secundaria lignificada, y el tallo primario reducido, con el desarrollo de una amplia zona medular. Presenta además un tipo peculiar de actividad cambial secundaria en la forma de haces conductores corticales. Entre los detalles histológicos adicionales está el desarrollo de una cubierta suberificada de células corticales en el órgano reservante y la presencia de tricomas cónicos unicelulares en las hojas.

  12. Actividad leishmanicida de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae)

    OpenAIRE

    Alzamora, Libertad; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Solís, Hilda; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Rojas, Marisol; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Calderón, Marisela; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Fajardo, Narda; Universidad Nacional Mayor de San Marcos. Facultad de Medicina Humana. Instituto de Medicina Tropical «Daniel Alcides Carrión»; Quispe, Jenny; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Alvarez, Evelyn; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Colona, Erasmo; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología; Torres, Dina; Universidad Nacional Mayor de San Marcos, Facultad de Ciencias Biológicas, Instituto de Investigaciones de Ciencias Biológicas Antonio Raimondi, Laboratorio de Inmunología

    2013-01-01

    The classic treatment of the cutaneous leishmaniosis consists on the injection of 15-20 ampoule of Glucantine what causes serious secondary effects. This fact justifies the search of new medications what motivated the present investigation. The objective was to evaluate the leishmanicidal activity of the methanolic extracts (ME) of the white, red, purple and black ecotypes of Lepidium peruvianum Chacón (at present Lepidium meyenii Walp.) about the growth of Leishmania braziliensis peruviana i...

  13. A bicontinental origin of polyploid Australian/New Zealand Lepidium species (Brassicaceae)? Evidence from genomic in situ hybridization.

    Science.gov (United States)

    Dierschke, Tom; Mandáková, Terezie; Lysak, Martin A; Mummenhoff, Klaus

    2009-09-01

    Incongruence between chloroplast and nuclear DNA phylogenies, and single additive nucleotide positions in internal transcribed spacer (ITS) sequences of polyploid Australian/New Zealand (NZ) Lepidium species have been used to suggest a bicontinental hybrid origin. This pattern was explained by two trans-oceanic dispersals of Lepidium species from California and Africa and subsequent hybridization followed by homogenization of the ribosomal DNA sequence either to the Californian (C-clade) or to the African ITS-type (A-clade) in two different ITS-lineages of Australian/NZ Lepidium polyploids. Genomic in situ hybridization (GISH) was used to unravel the genomic origin of polyploid Australian/NZ Lepidium species. Fluorescence in situ hybridization (FISH) with ribosomal DNA (rDNA) probes was applied to test the purported ITS evolution, and to facilitate chromosome counting in high-numbered polyploids. In Australian/NZ A-clade Lepidium polyploids, GISH identified African and Australian/NZ C-clade species as putative ancestral genomes. Neither the African nor the Californian genome were detected in Australian/NZ C-clade species and the Californian genome was not detected in Australian/NZ A-clade species. Five of the eight polyploid species (from 7x to 11x) displayed a diploid-like set of rDNA loci. Even the undecaploid species Lepidium muelleriferdinandi (2n = 11x = 88) showed only one pair of each rDNA repeat. In A-clade allopolyploids, in situ rDNA localization combined with GISH corroborated the presence of the African ITS-type. The nuclear genomes of African and Australian/NZ C-clade species were detected by GISH in allopolyploid Australian/NZ Lepidium species of the A-clade, supporting their hybrid origin. The presumed hybrid origin of Australian/NZ C-clade taxa could not be confirmed. Hence, it is assumed that Californian ancestral taxa experienced rapid radiation in Australia/NZ into extant C-clade polyploid taxa followed by hybridization with African species. As a

  14. Actividad leishmanicida de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available El tratamiento clásico de la leishmaniosis cutánea consiste en la inyección de 15-20 ampollas de Glucantine lo que ocasiona efectos secundarios, este hecho justifica la búsqueda de nuevos medicamentos motivando la presente investigación. El objetivo fue evaluar in vitro la actividad leishmanicida de los extractos metanólicos (EM de los ecotipos blanco, rojo, morado y negro de Lepidium peruvianum, Chacón (también conocida como Lepidium meyenii Walp., sobre el crecimiento de Leishmania braziliensis peruviana. Los promastigotes alcanzaron la fase de crecimiento exponencial al quinto día de cultivo a 27 ºC en el medio bifásico Columbia, suplementado con 15% de sangre desfibrinada de carnero, en ese momento se enfrentaron, por separado, con los EM a concentraciones de 50, 100, 200 y 400 μg/ml. Los recuentos se hicieron diariamente con cámara Neubauer. La máxima disminución de promastigotes se produjo al segundo día de enfrentamiento para el ecotipo morado (17,41% de viabilidad empleando 400 μg/ml. El efecto leishmanicida estaría relacionado con los alcaloides imidazólicos presentes en el EM. Se concluye que al segundo día de enfrentamiento con el EM, el ecotipo morado presenta la mayor actividad leishmanicida seguido del ecotipo blanco.

  15. Synergistic effect of the hydroalcoholic extract from Lepidium meyenii (Brassicaceae) and Fagara tessmannii (Rutaceae) on male sexual organs and hormone level in rats.

    Science.gov (United States)

    Lembè, Dieudonné Massoma; Gasco, Manuel; Gonzales, G F

    2014-01-01

    Lepidium meyenii is a plant, which has been used in folk medicine to treat infertility and to increase sexual desire. However, few reports have investigated the administration of this plant with other plants having the same properties. The present investigation was designed to evaluate whether the combination of Lepidium meyenii and Fagara tessmannii can improve spermatogenesis and testosterone level in rats. Twenty male rats were treated daily for 2 weeks with the hydroalcoholic extract of Fagara tessmannii and Lepidium meyenii (Fag + MN) as follow: (vehicle), (0.01 g + 0.5 mg), (0.1 g + 5 mg) and (1 g+ 50 mg)/kg BW. At doses Fag 0.01 g/MN 0.5 mg and Fag 0.1 g/MN 5 mg, the weight of seminal vesicle, prostate, and testis significantly decreased (P Lepidium meyenii (Black Maca) with Fagara tessmannii can improve male reproductive organs activities.

  16. From species to trait evolution in Aethionema (Brassicaceae)

    NARCIS (Netherlands)

    Mohammadin, Setareh

    2017-01-01

    The plant family Brassicaceae (or crucifers) is an economically important group that includes many food crops (e.g. cabbages and radishes), horticultural species (e.g. Draba, Iberis, Lunaria), and model plant species (particularly Arabidopsis thaliana). Because of the

  17. Evolution of genome size in Brassicaceae.

    Science.gov (United States)

    Johnston, J Spencer; Pepper, Alan E; Hall, Anne E; Chen, Z Jeffrey; Hodnett, George; Drabek, Janice; Lopez, Rebecca; Price, H James

    2005-01-01

    Brassicaceae, with nearly 340 genera and more than 3350 species, anchors the low range of angiosperm genome sizes. The relatively narrow range of DNA content (0.16 pg Lepidium virginicum and Brassica rapa. Branches in the phylogenetic tree that represent probable evolutionary increases in genome size terminate in Arabidopsis halleri, A. lyrata, Arabis hirsuta, Capsella rubella, Caulanthus heterophyllus, Crucihimalaya, Lepidium sativum, Sisymbrium and Thlaspi arvense. Branches within one clade containing Brassica were identified that represent two ancient ploidy events (2x to 4x and 4x to 6x) that were predicted from published comparative mapping studies.

  18. Characterization of the lignin polymer in Brassicaceae family

    Directory of Open Access Journals (Sweden)

    S. Hemmati

    2017-04-01

    Full Text Available Background and objectives: Residues of medicinal plants after extraction and weeds are suitable candidates for bioethanol production. Significant barriers exist to make the conversion of lignocellulosic feedstock to biofuel cost effective and environmentally friendly; one of which is the lignin polymer. Brassicaceae family is one of the potential targets for biofuel production. The structural characteristics of lignin from Hirschfeldia incana, Sisymbrium altissimum and Cardaria draba were studied in comparison to that of Brassica napus. Methods: Lignin deposition was observed by phloroglucinol and Mäule staining. The total lignin content was determined by Klason method. Maximum UV absorbance and FT-IR spectra were compared. Ratio of syringyl to guaiacyl lignin (S/G ratio as a metric of lignin digestibility was determined by DFRC followed by GC-MS analysis. 1H-NMR spectra of the total lignin was compared with other spectroscopic methods. Results: Staining of thestem cross sections of C. draba showed higher G units in contrast to the higher S units in S. altissimum which was in agreement with 1H-NMR analysis. Total lignin content for H. incana, C. draba and S. altissimum was 27.10%, 23.8% and 24.5%, respectively. The specific maximum UV absorbance appeared between 230-260 nm. FT-IR analysis confirmed the presence of more aromatic structures in the seed maturation stage than the flowering stage. S/G ratio was 0.26, 0.10 and 0.22 for H. incana, C. draba and S. altissimum, respectively.  Conclusion: Except Cardaria draba with the predominance of G subunits in lignin polymer, Hirschfeldia incana and Sisymbrium altissimum are suitable candidates for bioethanol production.

  19. Producción de IFN−γ en cultivos de linfocitos humanos por efecto de los extractos metanólicos de cuatro ecotipos de Lepidium peruvianum, Chacón (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available Se estudió la actividad inmunoduladora sobre cultivos de linfocitos T humanos de sangre periférica. Se evaluó la producción de IFN−γ inducida por los extractos metanólicos (EM de los ecotipos blanco, negro, rojo y morado de Lepidium peruvianum (conocida también como Lepidium meyenii Walp. maca. Luego de cultivar los linfocitos con los respectivos EM de maca durante 14 horas sólo el EM del ecotipo morado indujo la producción significativa de IFN−γ cuantificada mediante Elispot. El extracto metanólico del ecotipo morado de maca posee propiedades inmunoestimuladoras importantes, desencadenando la activación de linfocitos T humanos.

  20. Ameliorative effect of Draba nemorosa extract on chronic heart ...

    African Journals Online (AJOL)

    1Department of Cardiology, The Second People's Hospital of Huai'an, 2Pediatric Surgery, Huai'an Maternity and Children ... treating cardiovascular diseases. This study was aimed at investigating the effect of DNE on CHF in a rat model. EXPERIMENTAL. Materials. Draba nemorosa ... Drug administration began from.

  1. Ameliorative effect of Draba nemorosa extract on chronic heart ...

    African Journals Online (AJOL)

    Purpose: To evaluate the effect of Draba nemorosa extract (DNE) on oxidative stress and hemodynamics in rats with chronic congestive heart failure (CHF). Methods: Adriamycin was used to establish CHF in Sprague Dawley (SD) rat model. Six groups of SD rats were used in this study: control group, CHF group, captopril ...

  2. Distinct cell wall architectures in seed endosperms in representatives of the Brassicaceae and Solanaceae.

    Science.gov (United States)

    Lee, Kieran J D; Dekkers, Bas J W; Steinbrecher, Tina; Walsh, Cherie T; Bacic, Antony; Bentsink, Leónie; Leubner-Metzger, Gerhard; Knox, J Paul

    2012-11-01

    In some species, a crucial role has been demonstrated for the seed endosperm during germination. The endosperm has been shown to integrate environmental cues with hormonal networks that underpin dormancy and seed germination, a process that involves the action of cell wall remodeling enzymes (CWREs). Here, we examine the cell wall architectures of the endosperms of two related Brassicaceae, Arabidopsis (Arabidopsis thaliana) and the close relative Lepidium (Lepidium sativum), and that of the Solanaceous species, tobacco (Nicotiana tabacum). The Brassicaceae species have a similar cell wall architecture that is rich in pectic homogalacturonan, arabinan, and xyloglucan. Distinctive features of the tobacco endosperm that are absent in the Brassicaceae representatives are major tissue asymmetries in cell wall structural components that reflect the future site of radicle emergence and abundant heteromannan. Cell wall architecture of the micropylar endosperm of tobacco seeds has structural components similar to those seen in Arabidopsis and Lepidium endosperms. In situ and biomechanical analyses were used to study changes in endosperms during seed germination and suggest a role for mannan degradation in tobacco. In the case of the Brassicaceae representatives, the structurally homogeneous cell walls of the endosperm can be acted on by spatially regulated CWRE expression. Genetic manipulations of cell wall components present in the Arabidopsis seed endosperm demonstrate the impact of cell wall architectural changes on germination kinetics.

  3. Draba alshehbazii (Brassicaceae), a new species from extreme altitudes of eastern Ladakh (Jammu and Kashmir, India)

    Czech Academy of Sciences Publication Activity Database

    Klimeš, Leoš; German, D.

    2008-01-01

    Roč. 158, č. 4 (2008), s. 749-754 ISSN 0024-4074 R&D Projects: GA ČR GA206/03/1219; GA AV ČR IAA600050802 Institutional research plan: CEZ:AV0Z60050516 Keywords : Cruciferae * Pangong * Rupshu * taxonomy Subject RIV: EF - Botanics Impact factor: 1.189, year: 2008

  4. Intra-individual variation and evolution of modular structure in Draba plants.

    Science.gov (United States)

    Grigorieva, Olga V; Cherdantsev, Vladimir G

    2014-09-01

    We studied the evolution of quantitative traits related to shoot system architecture in a large genus Draba (Brassicaceae) making emphasis on the dynamics of relationship between individual and intra-individual variation. The results suggest that selection leading to origin of different life forms arises mainly from a necessity of moderation of the non-adaptive contest between the egoistic plant modules, taking care of self-reproduction of their own. We separated two evolutionary trends, one leading to the formation of short-lived monocarpic, and the other to long-lived polycarpic forms from the short-lived polycarpic plants. The first trend concerns with transformation of the innovation shoots into the axillary inflorescences by shortening of their vegetative developmental phase, while the second one - with individuation of the plant modules owing to acquisition of the capacity of rooting and separating from the mother plant. In both trends, the turning points of the evolution are those of originating of the negative for individual plants interactions between the plant modules being indirect non-adaptive consequences of the previous adaptive evolution and initiating selection for rebuilding of the plant modular structure. The difference between selection operating on intra-individual and individual variations is that, in the first case, combining of the characters of different individuals is infeasible. This leaves no choice for the evolution but to change the developmental mechanisms. In the case considered in this work, this is a change in shoot architecture using the material afforded by the natural variability of developmental pathways of the plant modules. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Genetics of cryptic speciation within an Arctic mustard, Draba nivalis.

    Directory of Open Access Journals (Sweden)

    A Lovisa S Gustafsson

    Full Text Available Crossing experiments indicate that hybrid sterility barriers frequently have developed within diploid, circumpolar plant species of the genus Draba. To gain insight into the rapid evolution of postzygotic reproductive isolation in this system, we augmented the linkage map of one of these species, D. nivalis, and searched for quantitative trait loci (QTLs associated with reproductive isolation. The map adds 63 new dominant markers to a previously published dataset of 31 co-dominant microsatellites. These markers include 52 amplified fragment length polymorphisms (AFLPs and 11 sequence-specific amplified polymorphisms (SSAPs based on retrotransposon sequence. 22 markers displaying transmission ratio distortion were further included in the map. We resolved eight linkage groups with a total map length of 894 cM. Significant genotype-trait associations, or quantitative trait loci (QTL, were detected for reproductive phenotypes including pollen fertility (4 QTLs, seed set (3 QTLs, flowering time (3 QTLs and number of flowers (4 QTLs. Observed patterns of inheritance were consistent with the influence of both nuclear-nuclear interactions and chromosomal changes on these traits. All seed set QTLs and one pollen fertility QTL displayed underdominant effects suggestive of the involvement of chromosomal rearrangements in hybrid sterility. Interestingly, D. nivalis is predominantly self-fertilizing, which may facilitate the establishment of underdominant loci and contribute to reproductive isolation.

  6. Lepidium sativum Linn.: a current addition to the family of mucilage and its applications.

    Science.gov (United States)

    Prajapati, Vipul D; Maheriya, Pankaj M; Jani, Girish K; Patil, Prasant D; Patel, Bhumit N

    2014-04-01

    Mucilage from the last decades has been found to be very attractive, interesting and useful in development of desired pharmaceutical dosage forms. Various applications of plant based mucilage have a wide potentiality in drug formulations. Lepidium sativum Linn. (family: Brassicaceae) is one of the mucilage containing fast growing, edible annual herb. Its various parts (roots, leaves and seeds) have been used to treat various human ailments. It mainly contains alkaloids, saponins, anthracene glycosides, carbohydrates, proteins, amino acids, flavanoids, and sterols as chief phytochemical constituents. Its seed extracts have been screened for various biological activities like hypotensive, anti-microbial, bronchodilator, hypoglycemic and allelopathic, whereas its seed coat mucilage has been isolated using different methods to make it effective excipient of desired functionality as a part of pharmaceutical applications. Through keen references of reported work on Lepidium sativum Linn., in this review, we have focused on its seed coat mucilage isolation methods, chemical constituents, pharmacological profile and versatile application of Lepidium sativum Linn. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Spatial relationships between seed bank and seedling populations of Hordeum spontaneum and Cardaria draba in saffron (Crocus sativus L. fields

    Directory of Open Access Journals (Sweden)

    hasan makariyan

    2009-06-01

    Full Text Available Geostatistical techniques were used to characterize the spatial relationship between Hordeum spontaneum and Cardaria draba seedling and seed bank over the course of one growing season (2004-2005 in three saffron fields, located in Southern Khorasan, Iran. The density and spatial distribution of weeds varied widely with fields. The emergence percentage was higher for Cardaria draba than for H. spontaneum in all fields. Semivariograms showed spatial autocorrelation in seed bank and seedling populations of H. spontaneum and C. draba in all fields. Cross-semivariograms showed moderate to strong (63.3 to 94.7% and strong spatial continuity (78.4 to 95.4 %. between seed bank and seedling population densities of H. spontaneum and C. draba, respectively. Grey-scale field maps of C. draba seed banks corresponded visually to maps of seedling populations and could have been used to target control efforts, but visual correspondence between H. spontaneum seed bank and seedling maps was poor. Seed bank and seedling mapping may be useful for site-specific management, but additional information is needed to understand variation in the relationships between these two populations over time and space.

  8. Lepidium flavum Torrey var. apterum nob

    NARCIS (Netherlands)

    Henrard, J.Th.; Thellung, A.

    1918-01-01

    Wie bekannt, ist TORREY’S Lepidium flavum sehr ausgezeichnet durch die gelbe Krone mit der zweizähnigen Frucht und dem sehr langen hervorragenden Griffel *). Lepidium flavum gehört also zur Sektion Monoploca (BUNGE 1845 pro gen.) THELLUNG, und zwar speziell zur Grex Alyssoidea THELL. ¹) Bei einer

  9. The in vitro biological activity of Lepidium meyenii extracts.

    Science.gov (United States)

    Valentová, K; Buckiová, D; Kren, V; Peknicová, J; Ulrichová, J; Simánek, V

    2006-03-01

    The biological activity of methanolic and aqueous extracts from dehydrated hypocotyls of Lepidium meyenii (Brassicaceae, vernacular name "maca"), was studied on rat hepatocytes and human breast cancer MCF-7 cells. The extracts did not exhibit cytotoxicity in hepatocyte primary cultures up to 10 mg/ml as measured by the MTT viability test, and lactate dehydrogenase (LDH) and aspartate aminotransferase (AST) leakage. Moreover, after 72 h, extracts inhibited LDH and AST leakage from the hepatocytes. When hepatocytes were intoxicated by t-butyl hydroperoxide, neither extract prevented oxidative damage. Both extracts showed weak antioxidant activity in the DPPH radical scavenging test with IC(50) values of 3.46 +/- 0.16 and 0.71 +/- 0.10 mg/ml, for aqueous and methanolic extracts, respectively. Thus, the observed effect on spontaneous enzyme leakage is probably mediated through mechanisms other than antioxidant activity. Both methanolic and aqueous extracts have shown estrogenic activity comparable with that of silymarin in MCF-7 cell line. Maca estrogenicity was exhibited in the range from 100 to 200 mug of extract per ml. The findings in the present study show that maca does not display in vitro hepatotoxicity. In contrast, a slight cytoprotective effect, probably not mediated by antioxidant capacity, was noted. Maca extracts exhibited estrogenic activity comparably to the effect of silymarin in MCF-7 cells.

  10. Seeds of Brassicaceae weeds have an inherent or inducible response to the germination stimulant karrikinolide.

    Science.gov (United States)

    Long, Rowena L; Stevens, Jason C; Griffiths, Erin M; Adamek, Markus; Gorecki, Marta J; Powles, Stephen B; Merritt, David J

    2011-10-01

    Karrikinolide (KAR(1)) is a smoke-derived chemical that can trigger seeds to germinate. A potential application for KAR(1) is for synchronizing the germination of weed seeds, thereby enhancing the efficiency of weed control efforts. Yet not all species germinate readily with KAR(1), and it is not known whether seemingly non-responsive species can be induced to respond. Here a major agronomic weed family, the Brassicaceae, is used to test the hypothesis that a stimulatory response to KAR(1) may be present in physiologically dormant seeds but may not be expressed under all circumstances. Seeds of eight Brassicaceae weed species (Brassica tournefortii, Raphanus raphanistrum, Sisymbrium orientale, S. erysimoides, Rapistrum rugosum, Lepidium africanum, Heliophila pusilla and Carrichtera annua) were tested for their response to 1 µm KAR(1) when freshly collected and following simulated and natural dormancy alleviation, which included wet-dry cycling, dry after-ripening, cold and warm stratification and a 2 year seed burial trial. Seven of the eight Brassicaceae species tested were stimulated to germinate with KAR(1) when the seeds were fresh, and the remaining species became responsive to KAR(1) following wet-dry cycling and dry after-ripening. Light influenced the germination response of seeds to KAR(1), with the majority of species germinating better in darkness. Germination with and without KAR(1) fluctuated seasonally throughout the seed burial trial. KAR(1) responses are more complex than simply stating whether a species is responsive or non-responsive; light and temperature conditions, dormancy state and seed lot all influence the sensitivity of seeds to KAR(1), and a response to KAR(1) can be induced. Three response types for generalizing KAR(1) responses are proposed, namely inherent, inducible and undetected. Given that responses to KAR(1) were either inherent or inducible in all 15 seed lots included in this study, the Brassicaceae may be an ideal target for

  11. DNA barcoding of western North American taxa: Leymus (Poaceae) and Lepidium (Brassicaceae)

    Science.gov (United States)

    Catherine Mae Culumber

    2007-01-01

    My objective was to determine if polymorphic information from the 18S-5.8S-26S nuclear ribosomal DNA internal transcribed spacer regions and the trnK-psbA, trnK-rps16 chloroplast DNA spacer regions is sufficient 1) to identify a plant specimen to the species level, and 2) to establish the phylogenetic relationship between species. The first study examined the...

  12. [Chemical constituents of Lepidium meyenii].

    Science.gov (United States)

    Liang, Wen-juan; Xu, Hong-bo; Yang, Cai-yan; Geng, Chang-an; Zhang Xue-mei; Chen, Ji-jun

    2015-12-01

    To study the chemical constituents of Lepidium meyenii, the air-dried rhizome of L. meyenii was extracted with 70% EtOH. The extract was condensed to a small amount of volume and extracted with petroleum ether, EtOAc and n-BuOH, successively. The compounds were isolated and purified by column chromatography, and identified based on spectral analyses (1H-NMR, 13C-NMR, HRESIMS). Eighteen compounds were isolated from L. meyenii, including 7 alkaloids and 4 fatty acids and 7 other compounds. They were characterized as (3-hydroxybenzyl) carbamic acid(1), phenylmethanamine(2), N-benzylformamide (3), N-benzylacetamide (4), pyridin-4-ylmethanamine(5), n-(4-methoxybenzyl) aniline(6), uracil(7), succininc acid(8), decanedioic acid(9), n-hexa- decanoic acid methyl ester(10), heptanoic acid(11), solerole(12), pyromucic acid methyl ester(13), 5-hydroxymethyl-2-furancar- boxadehyde(14), 5-(methoxymethyl)-1H-pyrrole-2-carbaldehyde(15), 1,7-dihydroxy-2,3, 4-trimethoxyxanthone (16), 1,7-di- hydroxy-3,4- dimethoxy-xanthone(17), (+)-pinoresinol(18). Meanwhile, compounds 1-18 were obtained from L. neyenii for the first time.

  13. Lepidium latifolium L.: een nieuw pekeladventief?

    NARCIS (Netherlands)

    Graaf, de J.M.

    1993-01-01

    Lepidium latifolium, originally a species of salt steppes, has been found at two localities near Leiden between pavement along road-sides. Its new habitat may have become suitable for it because of the frequent use of road-salt in winter.

  14. Synergistic antiosteoporotic effect of Lepidium Sativum and ...

    African Journals Online (AJOL)

    Alendronate belongs to a class of drugs called bisphosphonates. Bisphosphonates (BP) therapy is a vital option to reduce the risk of bone fracture in people who suffer from osteoporosis. Yet, bisphosphonate have displayed several side effects. Lepidium sativum (LS) seeds have been used in traditional folk medicine to ...

  15. Genome of Plant Maca (Lepidium meyenii) Illuminates Genomic Basis for High-Altitude Adaptation in the Central Andes.

    Science.gov (United States)

    Zhang, Jing; Tian, Yang; Yan, Liang; Zhang, Guanghui; Wang, Xiao; Zeng, Yan; Zhang, Jiajin; Ma, Xiao; Tan, Yuntao; Long, Ni; Wang, Yangzi; Ma, Yujin; He, Yuqi; Xue, Yu; Hao, Shumei; Yang, Shengchao; Wang, Wen; Zhang, Liangsheng; Dong, Yang; Chen, Wei; Sheng, Jun

    2016-07-06

    Maca (Lepidium meyenii Walp, 2n = 8x = 64), belonging to the Brassicaceae family, is an economic plant cultivated in the central Andes sierra in Peru (4000-4500 m). Considering that the rapid uplift of the central Andes occurred 5-10 million years ago (Ma), an evolutionary question arises regarding how plants such as maca acquire high-altitude adaptation within a short geological period. Here, we report the high-quality genome assembly of maca, in which two closely spaced maca-specific whole-genome duplications (WGDs; ∼6.7 Ma) were identified. Comparative genomic analysis between maca and closely related Brassicaceae species revealed expansions of maca genes and gene families involved in abiotic stress response, hormone signaling pathway, and secondary metabolite biosynthesis via WGDs. The retention and subsequent functional divergence of many duplicated genes may account for the morphological and physiological changes (i.e., small leaf shape and self-fertility) in maca in a high-altitude environment. In addition, some duplicated maca genes were identified with functions in morphological adaptation (i.e., LEAF CURLING RESPONSIVENESS) and abiotic stress response (i.e., GLYCINE-RICH RNA-BINDING PROTEINS and DNA-DAMAGE-REPAIR/TOLERATION 2) under positive selection. Collectively, the maca genome provides useful information to understand the important roles of WGDs in the high-altitude adaptation of plants in the Andes. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Inhibitory effect of a defensin gene from the Andean crop maca (Lepidium meyenii) against Phytophthora infestans.

    Science.gov (United States)

    Solis, Julio; Medrano, Giuliana; Ghislain, Marc

    2007-08-01

    In this study, we report the isolation of a defensin gene, lm-def, isolated from the Andean crop 'maca' (Lepidium meyenii) with activity against the pathogen Phytophthora infestans responsible of late blight disease of the potato and tomato crops. The lm-def gene has been isolated by polymerase chain reaction (PCR) using degenerate primers corresponding to conserved regions of 13 plant defensin genes of the Brassicaceae family assuming that defensin genes are highly conserved among cruciferous species. The lm-def gene belongs to a small multigene family of at least 10 members possibly including pseudogenes as assessed by genomic hybridization and nucleotide sequence analyses. The deduced mature Lm-Def peptide is 51 amino acids in length and has 74-94% sequence identity with other plant defensins of the Brassicaceae family. The Lm-Def peptide was produced as a fusion protein using the pET-44a expression vector and purified using an immobilized metal ion affinity chromatography. The recombinant protein (NusA:Lm-Def) exhibited in vitro activity against P. infestans. The NusA:Lm-Def protein caused growth inhibition and hyphal damage at concentration not greater than 0.4 microM. In contrast, the NusA protein alone expressed and purified similarly did not show any activity against P. infestans. Therefore, these results indicate that the lm-def gene isolated from maca belong to the plant defensin family with activity against P. infestans. Its expression in potato, as a transgene, might help to control the late blight disease caused by P. infestans with the advantage of being of plant origin.

  17. Biosystematic studies on Brassicaceae (Cruciferae) in Egypt

    NARCIS (Netherlands)

    Abdel Khalik, K.N.E.

    2002-01-01

    The present work deals with a systematic investigation of 45 taxa belonging to 23 genera of the tribes Arabideae, Euclidieae, Hesperideae, Lunarieae, Matthioleae and Sisymbrieae of the family Brassicaceae from Egypt. This work is largely based on herbarium material

  18. Effect of three different cultivars of Lepidium meyenii (Maca) on learning and depression in ovariectomized mice.

    Science.gov (United States)

    Rubio, Julio; Caldas, Maria; Dávila, Sonia; Gasco, Manuel; Gonzales, Gustavo F

    2006-06-23

    Lepidium meyenii Walp. (Brassicaceae), known as Maca, is a Peruvian hypocotyl growing exclusively between 4000 and 4500 m altitude in the central Peruvian Andes, particularly in Junin plateau and is used traditionally to enhance fertility. Maca is a cultivated plant and different cultivars are described according to the color of the hypocotyls. The study aimed to elucidate the effect of Yellow, Red and Black Maca on cognitive function and depression in ovariectomized (OVX) mice. In all experiments OVX mice were treated during 21 days and divided in four groups: control group, Yellow Maca, Red Maca and Black Maca. Latent learning was assessed using the water finding task and the antidepressant activity of the three varieties of Maca was evaluated using the forced swimming test. Animals were sacrificed at the end of each treatment and the uterus were excised and weighed. Black Maca was the variety that showed the best response in the water finding task, particularly in the trained mice. The three varieties were effective to reduce finding latency in non trained and trained mice (P < 0.05). In the force swimming test, all varieties assessed reduced the time of immobility and increased uterine weight in OVX mice. Black Maca appeared to have more beneficial effects on latent learning in OVX mice; meanwhile, all varieties of Maca showed antidepressant activity.

  19. Ethnobiology and Ethnopharmacology of Lepidium meyenii (Maca), a Plant from the Peruvian Highlands.

    Science.gov (United States)

    Gonzales, Gustavo F

    2012-01-01

    Lepidium meyenii (maca) is a Peruvian plant of the Brassicaceae family cultivated for more than 2000 years, which grows exclusively in the central Andes between 4000 and 4500 m altitude. Maca is used as a food supplement and also for its medicinal properties described traditionally. Since the 90s of the XX century, an increasing interest in products from maca has been observed in many parts of the world. In the last decade, exportation of maca from Peru has increased from 1,415,000 USD in 2001 to USD 6,170,000 USD in 2010. Experimental scientific evidence showed that maca has nutritional, energizer, and fertility-enhancer properties, and it acts on sexual dysfunctions, osteoporosis, benign prostatic hyperplasia, memory and learning, and protects skin against ultraviolet radiation. Clinical trials showed efficacy of maca on sexual dysfunctions as well as increasing sperm count and motility. Maca is a plant with great potential as an adaptogen and appears to be promising as a nutraceutical in the prevention of several diseases.

  20. Effect of three different cultivars of Lepidium meyenii (Maca on learning and depression in ovariectomized mice

    Directory of Open Access Journals (Sweden)

    Gonzales Gustavo F

    2006-06-01

    Full Text Available Abstract Background Lepidium meyenii Walp. (Brassicaceae, known as Maca, is a Peruvian hypocotyl growing exclusively between 4000 and 4500 m altitude in the central Peruvian Andes, particularly in Junin plateau and is used traditionally to enhance fertility. Maca is a cultivated plant and different cultivars are described according to the color of the hypocotyls. Methods The study aimed to elucidate the effect of Yellow, Red and Black Maca on cognitive function and depression in ovariectomized (OVX mice. In all experiments OVX mice were treated during 21 days and divided in four groups: control group, Yellow Maca, Red Maca and Black Maca. Latent learning was assessed using the water finding task and the antidepressant activity of the three varieties of Maca was evaluated using the forced swimming test. Animals were sacrificed at the end of each treatment and the uterus were excised and weighed. Results Black Maca was the variety that showed the best response in the water finding task, particularly in the trained mice. The three varieties were effective to reduce finding latency in non trained and trained mice (P Conclusion Black Maca appeared to have more beneficial effects on latent learning in OVX mice; meanwhile, all varieties of Maca showed antidepressant activity.

  1. Ethnobiology and Ethnopharmacology of Lepidium meyenii (Maca, a Plant from the Peruvian Highlands

    Directory of Open Access Journals (Sweden)

    Gustavo F. Gonzales

    2012-01-01

    Full Text Available Lepidium meyenii (maca is a Peruvian plant of the Brassicaceae family cultivated for more than 2000 years, which grows exclusively in the central Andes between 4000 and 4500 m altitude. Maca is used as a food supplement and also for its medicinal properties described traditionally. Since the 90s of the XX century, an increasing interest in products from maca has been observed in many parts of the world. In the last decade, exportation of maca from Peru has increased from 1,415,000 USD in 2001 to USD 6,170,000 USD in 2010. Experimental scientific evidence showed that maca has nutritional, energizer, and fertility-enhancer properties, and it acts on sexual dysfunctions, osteoporosis, benign prostatic hyperplasia, memory and learning, and protects skin against ultraviolet radiation. Clinical trials showed efficacy of maca on sexual dysfunctions as well as increasing sperm count and motility. Maca is a plant with great potential as an adaptogen and appears to be promising as a nutraceutical in the prevention of several diseases.

  2. Dynamic Subcellular Localization of Iron during Embryo Development in Brassicaceae Seeds

    Directory of Open Access Journals (Sweden)

    Miguel A. Ibeas

    2017-12-01

    Full Text Available Iron is an essential micronutrient for plants. Little is know about how iron is loaded in embryo during seed development. In this article we used Perls/DAB staining in order to reveal iron localization at the cellular and subcellular levels in different Brassicaceae seed species. In dry seeds of Brassica napus, Nasturtium officinale, Lepidium sativum, Camelina sativa, and Brassica oleracea iron localizes in vacuoles of cells surrounding provasculature in cotyledons and hypocotyl. Using B. napus and N. officinale as model plants we determined where iron localizes during seed development. Our results indicate that iron is not detectable by Perls/DAB staining in heart stage embryo cells. Interestingly, at torpedo development stage iron localizes in nuclei of different cells type, including integument, free cell endosperm and almost all embryo cells. Later, iron is detected in cytoplasmic structures in different embryo cell types. Our results indicate that iron accumulates in nuclei in specific stages of embryo maturation before to be localized in vacuoles of cells surrounding provasculature in mature seeds.

  3. Neuroprotective effects of Lepidium meyenii (Maca).

    Science.gov (United States)

    Pino-Figueroa, Alejandro; Nguyen, Diane; Maher, Timothy J

    2010-06-01

    The neuroprotective activity of the plant Lepidium meyenii (Maca) was studied in two experimental models: in vitro and in vivo. Crayfish neurons were pretreated with vehicle or the pentane extract from Maca, subjected to H(2)O(2), and their viability determined microscopically and chemically. A significant concentration-neuroprotective effect relationship was demonstrated. The pentane extract was then administered intravenously to rats prior to and following middle cerebral artery occlusion. While infarct volumes were decreased for the lower dose, higher doses increased infarct volumes compared to controls. These results suggest a potential application of Maca as a neuroprotectant.

  4. 7 CFR 201.56-3 - Mustard family, Brassicaceae (Cruciferae).

    Science.gov (United States)

    2010-01-01

    ...) FEDERAL SEED ACT FEDERAL SEED ACT REGULATIONS Germination Tests in the Administration of the Act § 201.56-3 Mustard family, Brassicaceae (Cruciferae). Kinds of seed: Broccoli, brussels sprouts, cabbage... 7 Agriculture 3 2010-01-01 2010-01-01 false Mustard family, Brassicaceae (Cruciferae). 201.56-3...

  5. [Quality control of Maca (Lepidium meyenii)].

    Science.gov (United States)

    Shu, Ji-cheng; Cui, Hang-qing; Huang, Ying-zheng; Huang, Xiao-ying; Yang, Ming

    2015-12-01

    To control the quality of Maca, the quality standard was established in this study. According to the methods recorded in the Appendix of Chinese Pharmacopoeia (2010 Edition), the water, extract, total ash, acid insoluble substance, and heavy metals inspections in Lepidium meyenii were carried out. N-benzyl-9Z, 12Z-octadecadienamide in L. meyenii was identified by TLC, and it was determined by HPLC. The results showed that the N-benzyl-9Z, 12Z-octadecadienamide identification of TLC was a strong mark and specificity. In content determination experiment, the linearity of N-benzyl-9Z, 12Z-octadecadienamide was in the range of 0.01-2 microg (r = 0.9998), and the average recovery (n=9) was 99.27% (RSD 2.0%). The methods were simple, accurate, with good reproducibility. It is suitable for quality control L. meyenii.

  6. Chemical constituents from maca (lepidium meyenii)

    International Nuclear Information System (INIS)

    Zang, Z.; Li, M.J.; Ma, L.; Li, L.

    2016-01-01

    Two new natural products, tetrahydro-2-benzyl-1H-pyrrolo-(1,2-C) imidazole-1,3(2H) -dione (1) and (1S,4R,4aR,9aS)-4a-methyl-1,4,4a,9a- tetrahydro-1,4-methano-anthracene-9,10-dione (2), together with eleven known compounds (3-13) were isolated from the petroleum ether fraction of the 95% ethanol extract from the tubers of Lepidium meyenii. Among them, compounds 1 and 2 were new natural products, compounds 3, 4, 7-11, and 13 were isolated from L. meyenii for the first time. In addition, the spectroscopic data of compound 1 were firstly reported. Their structures were elucidated by 1D and 2D NMR spectroscopic analysis along with comparison with literature reports. (author)

  7. Effects of Nigella sativa and Lepidium sativum on Cyclosporine Pharmacokinetics

    Science.gov (United States)

    Al-Jenoobi, F. I.; Al-Suwayeh, S. A.; Muzaffar, Iqbal; Al-Kharfy, Khalid M.; Korashy, Hesham M.; Al-Mohizea, Abdullah M.; Raish, Mohd

    2013-01-01

    The present study was conducted to investigate the effects of Nigella sativa and Lepidium sativum on the pharmacokinetics of cyclosporine in rabbits. Two groups of animals were treated separately with Nigella sativa (200 mg/kg p.o.) or Lepidium sativum (150 mg/kg p.o.) for eight consecutive days. On the 8th day, cyclosporine (30 mg/kg p.o.) was administered to each group one hour after herbal treatment. Blood samples were withdrawn at different time intervals (0.0, 0.5, 1.0, 1.5, 2.0, 3.0, 4.0, 6.0, 8.0, 12, and 24 hrs) from marginal ear vein. Cyclosporine was analyzed using UPLC/MS method. The coadministration of Nigella sativa significantly decreased the C max and AUC0−∞ of cyclosporine; the change was observed by 35.5% and 55.9%, respectively (P ≤ 0.05). Lepidium sativum did not produce any significant change in C max of cyclosporine, although its absorption was significantly delayed compared with control group. A remarkable change was observed in T max and AUC0−t of Lepidium sativum treated group. Our findings suggest that concurrent consumption of Nigella sativa and Lepidium sativum could alter the pharmacokinetics of cyclosporine at various levels. PMID:23957013

  8. Lepidium meyenii (Maca): a plant from the highlands of Peru--from tradition to science.

    Science.gov (United States)

    Gonzales, Gustavo F; Gonzales, Carla; Gonzales-Castañeda, Cynthia

    2009-12-01

    This review summarizes the current state of knowledge on Lepidium meyenii (maca), a cruciferous plant (Brassicaceae family) which is cultivated exclusively at an altitude of 4,000-4,500 m in the Peruvian Central Andes. Maca is traditionally used for its nutritional and presumed medicinal properties. Over the past 20 years, interest in maca has increased in many parts of the world, and since 2005 maca is considered one of the seven Peruvian flag products. Maca is exported as powder, capsules, pills, flour, liquor, and extracts. There are different types of maca with differ-ent colors ranging from white to black. We have studied the pharmacological effects of 3 types; yellow, black, and red maca. Evidence from experimental studies indicates effects of maca on nutrition, fertility, memory, and mood. Black maca has better effects on sperm production than yellow maca which has only moderate effects. Red maca, however, has no effect on sperm production. However, red maca has been shown to reduce prostate size in rats in which prostate hyperplasia had been induced with testosterone enanthate; yellow maca has shown moderate effects here, whereas black maca has not shown any effects. Randomized clinical trials have shown that maca has favorable effects on energy and mood, may decrease anxiety and improve sexual desire. Maca has also been shown to improve sperm production, sperm motility, and semen volume. Serum levels of testosterone, estradiol, LH, FSH, and prolactin were not affected. The exact mechanisms of action are still unclear, but so far research clearly indicates that various bioactive constituents contribute to the clinical effects reported.

  9. Bioactive maca (Lepidium meyenii) alkamides are a result of traditional Andean postharvest drying practices.

    Science.gov (United States)

    Esparza, Eliana; Hadzich, Antonella; Kofer, Waltraud; Mithöfer, Axel; Cosio, Eric G

    2015-08-01

    Maca, Lepidium meyenii Walpers (Brassicaceae), is an annual herbaceous plant native to the high plateaus of the Peruvian central Andes. Its underground storage hypocotyls have been a traditional medicinal agent and dietary staple since pre-Columbian times. Reported properties include energizing and fertility-enhancing effects. Published reports have focused on the benzylalkamides (macamides) present in dry hypocotyls as one of the main bioactive components. Macamides are secondary amides formed by benzylamine and a fatty acid moiety, with varying hydrocarbon chain lengths and degree of unsaturation. Although it has been assumed that they are usually present in fresh undamaged tissues, analyses show them to be essentially absent from them. However, hypocotyls dried by traditional Andean postharvest practices or industrial oven drying contain up to 800μgg(-1) dry wt (2.3μmolg(-1) dry wt) of macamides. In this study, the generation of macamides and their putative precursors were studied during nine-week traditional drying trials at 4200m altitude and in ovens under laboratory conditions. Freeze-thaw cycles in the open field during drying result in tissue maceration and release of free fatty acids from storage and membrane lipids up to levels of 1200μgg(-1) dry wt (4.3μmolg(-1) dry wt). Endogenous metabolism of the isothiocyanates generated from glucosinolate hydrolysis during drying results in maximal benzylamine values of 4300μgg(-1) dry wt (40.2μmolg(-1) dry wt). Pearson correlation coefficients of the accumulation profiles of benzylamine and free fatty acid to that of macamides showed good values of 0.898 and 0.934, respectively, suggesting that both provide sufficient substrate for amide synthesis during the drying process. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Effects of a water extract of Lepidium meyenii root in different models of persistent pain in rats.

    Science.gov (United States)

    Tenci, Barbara; Di Cesare Mannelli, Lorenzo; Maresca, Mario; Micheli, Laura; Pieraccini, Giuseppe; Mulinacci, Nadia; Ghelardini, Carla

    2017-10-26

    Lepidium meyenii (Walp.), commonly called maca, is an Andean crop belonging to the Brassicaceae family. Maca hypocotils are habitually consumed as customary food as well as traditional remedies for pathological conditions such as infertility. Moreover, the characterization of maca extracts revealed the presence of compounds that are able to modulate the nervous system. Aimed to evaluate the efficacy of L. meyenii in persistent pain, the present study analyzed the effects of a commercial root extract from maca in different animal models reproducing the most common causes of chronic painful pathologies. A qualitative characterization of this commercial extract by high performance liquid chromatography-mass spectrometry and tandem mass spectrometry analyses allowed us to confirm the presence of some macamides known as bioactive constituents of this root and the absence of the main aromatic glucosinolates. The acute oral administration of maca extract is able to reduce mechanical hypersensitivity and postural unbalance induced by the intra-articular injection of monoiodoacetate and the chronic-constriction injury of the sciatic nerve. Furthermore, L. meyenii extract reverts pain threshold alterations evoked by oxaliplatin and paclitaxel. A good safety profile in mice and rats was shown. In conclusion, the present maca extract could be considered as a therapeutic opportunity to relieve articular and neuropathic pain.

  11. Flavonolignans and other constituents from Lepidium meyenii with activities in anti-inflammation and human cancer cell lines.

    Science.gov (United States)

    Bai, Naisheng; He, Kan; Roller, Marc; Lai, Ching-Shu; Bai, Lu; Pan, Min-Hsiung

    2015-03-11

    From the roots of Lepidium meyenii Walpers (Brassicaceae) have been isolated and identified 2 flavonolignans, tricin 4'-O-[threo-β-guaiacyl-(7″-O-methyl)-glyceryl] ether (1) and tricin 4'-O-(erythro-β-guaiacyl-glyceryl) ether (2), along with 11 other known compounds, tricin (3), pinoresinol (4), 4-hydroxycinnamic acid (5), guanosine (6), glucotropaeolin (7), desulfoglucotropaeolin (8), 3-hydroxybenzylisothiocyanate (9), malic acid benzoate (10), 5-(hydroxymethyl)-2-furfural (11), d-phenylalanine (12), and vanillic acid 4-O-β-d-glucoside (13). Structures were elucidated on the basis of NMR and MS data. Some isolates and previously isolated lepidiline B (14) were tested for cytotoxicity in a small panel of human cancer cell lines (Hep G2, COLO 205, and HL-60) and for anti-inflammatory activities in LPS-treated RAW 264.7 macrophage. Among them, compounds 1 and 14 were modestly active for inhibiting nitrite production in macrophage. Compounds 1, 14, and 3 were demonstrated to be selectively active against HL-60 cells with IC50 values of 40.4, 52.0, and 52.1 μM, respectively.

  12. Aqueous and hydroalcoholic extracts of Black Maca (Lepidium meyenii) improve scopolamine-induced memory impairment in mice.

    Science.gov (United States)

    Rubio, Julio; Dang, Haixia; Gong, Mengjuan; Liu, Xinmin; Chen, Shi-Lin; Gonzales, Gustavo F

    2007-10-01

    Lepidium meyenii Walp. (Brassicaceae), known as Maca, is a Peruvian hypocotyl growing exclusively between 4,000 and 4,500 m altitude in the central Peruvian Andes, particularly in Junin plateau. Previously, Black variety of Maca showed to be more beneficial than other varieties of Maca on learning and memory in ovariectomized mice on the water finding test. The present study aimed to test two different doses of aqueous (0.50 and 2.00 g/kg) and hydroalcoholic (0.25 and 1.00 g/kg) extracts of Black Maca administered for 35 days on memory impairment induced by scopolamine (1mg/kg body weight i.p.) in male mice. Memory and learning were evaluated using the water Morris maze and the step-down avoidance test. Brain acetylcholinesterase (AChE) and monoamine oxidase (MAO) activities in brain were also determined. Both extracts of Black Maca significantly ameliorated the scopolamine-induced memory impairment as measured in both the water Morris maze and the step-down avoidance tests. Black Maca extracts inhibited AChE activity, whereas MAO activity was not affected. These results indicate that Black Maca improves scopolamine-induced memory deficits.

  13. Differentiation of the seed coat and composition of the mucilage of Lepidium perfoliatum L.: a desert annual with typical myxospermy.

    Science.gov (United States)

    Huang, Daihong; Wang, Cui; Yuan, Junwen; Cao, Jing; Lan, Haiyan

    2015-10-01

    Myxospermy is an important feature in seeds of many plant species grown in desert region. Fertilization can initiate differentiation of the seed coat epidermis into a specialized cell type with mucilage production. In the present study, comprehensive analyses were performed on the seed coat differentiation, mucilage production and composition, and seed germination in Lepidium perfoliatum (Brassicaceae), a desert annual with typical myxospermy in China. First, results indicated that mucilage was secreted uniformly at the outer tangential wall, resulting in compression of the cytoplasm to the bottom of the epidermal cells. Secondly, the inner tangential wall and two radial walls of the subepidermal cells were apparently thickened by production of a secondary cell wall material, which resulted in a 'typical' palisade appearance. Thirdly, immunohistochemical staining combined with the enzymatic digestion and infrared spectrum analysis of the mucilage indicated that, while one important component of the seed coat mucilage in L. perfoliatum was pectin, it also contained β-1,3-d-glucan and xyloglucan. Finally, seed germination showed that seeds with mucilage displayed significantly higher germination percentage than that of demucilaged seeds in abundant or excess water conditions. These results suggest that the possible ecological role of mucilage in L. perfoliatum is in the adaptation to habitats with well-watered and water-logged conditions, rather than water stress. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  14. New alkamides from maca (Lepidium meyenii).

    Science.gov (United States)

    Zhao, Jianping; Muhammad, Ilias; Dunbar, D Chuck; Mustafa, Jamal; Khan, Ikhlas A

    2005-02-09

    Maca (Lepidium meyenii) has been used as a food in Peru for thousands of years. More recently a wide array of commercial maca products have gained popularity as dietary supplements, with claims of anabolic and aphrodisiac effects, although the biologically active principles are not fully known. In an earlier chemical investigation, two new alkamides and a novel fatty acid, as well as the N-hydroxypyridine derivative, macaridine, were isolated from L. meyenii. Further examination has led to the isolation of five additional new alkamides, namely, N-benzyl-9-oxo-12Z-octadecenamide (1), N-benzyl-9-oxo-12Z,15Z-octadecadienamide (2), N-benzyl-13-oxo-9E,11E-octadecadienamide (3), N-benzyl-15Z-tetracosenamide (4), and N-(m-methoxybenzyl)hexadecanamide (5). Their structures were established by spectrometric and spectroscopic methods including ESI-HRMS, EI-MS, (1)H, (13)C, and 2D NMR, as well as (1)H-(15)N 2D HMBC experiments. In addition, the identity of N-benzyl-15Z-tetracosenamide (4) was confirmed by synthesis. These compounds have been found from only L. meyenii and could be used as markers for authentication and standardization.

  15. The in vitro biological activity of Lepidium meyenii extracts

    Czech Academy of Sciences Publication Activity Database

    Valentová, K.; Buckiová, Daniela; Křen, Vladimír; Pěknicová, Jana; Ulrichová, J.; Šimánek, V.

    2006-01-01

    Roč. 22, - (2006), s. 91-99 ISSN 0742-2091 R&D Projects: GA MZd NJ7463 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50200510; CEZ:AV0Z50520514 Keywords : Lepidium meyenii * Maca * DPPH Subject RIV: FH - Neurology Impact factor: 1.400, year: 2006

  16. Molecular Resources from Transcriptomes in the Brassicaceae Family

    Directory of Open Access Journals (Sweden)

    Lua Lopez

    2017-08-01

    Full Text Available The rapidly falling costs and the increasing availability of large DNA sequence data sets facilitate the fast and affordable mining of large molecular markers data sets for comprehensive evolutionary studies. The Brassicaceae (mustards are an important species-rich family in the plant kingdom with taxa distributed worldwide and a complex evolutionary history. We performed Simple Sequence Repeats (SSRs mining using de novo assembled transcriptomes from 19 species across the Brassicaceae in order to study SSR evolution and provide comprehensive sets of molecular markers for genetic studies within the family. Moreover, we selected the genus Cochlearia to test the transferability and polymorphism of these markers among species. Additionally, we annotated Cochlearia pyrenaica transcriptome in order to identify the position of each of the mined SSRs. While we introduce a new set of tools that will further enable evolutionary studies across the Brassicaceae, we also discuss some broader aspects of SSR evolution. Overall, we developed 2012 ready-to-use SSR markers with their respective primers in 19 Brassicaceae species and a high quality annotated transcriptome for C. pyrenaica. As indicated by our transferability test with the genus Cochlearia these SSRs are transferable to species within the genus increasing exponentially the number of targeted species. Also, our polymorphism results showed substantial levels of variability for these markers. Finally, despite its complex evolutionary history, SSR evolution across the Brassicaceae family is highly conserved and we found no deviation from patterns reported in other Angiosperms.

  17. Signaling pathways regulated by Brassicaceae extract inhibit the ...

    African Journals Online (AJOL)

    Background: The goal of this study was identification signaling molecules mediated the formation of AGEs in brain of rats injected with CdCl2 and the role of camel whey proteins and Brassicaceae extract on formation of AGEs in brain. Methods: Ninety male rats were randomly grouped into five groups; Normal control (GpI) ...

  18. Phylogeny and biogeography of Alyssum (Brassicaceae) based on ...

    Indian Academy of Sciences (India)

    areas established in the Pliocene/Pleistocene could have provided favourable conditions for the migration and diversification of Alyssum. [Li Y., Kong Y., Zhang Z., Yin Y., Liu B., Lv G. and Wang X. 2014 Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. J. Genet.

  19. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  20. Peruvian Maca: Two Scientific Names Lepidium Meyenii Walpers and Lepidium Peruvianum Chacon – Are They Phytochemically-Synonymous?

    Science.gov (United States)

    Meissner, Henry O.; Mscisz, Alina; Kedzia, Bogdan; Pisulewski, Pawel; Piatkowska, Ewa

    2015-01-01

    Using Liquid Chromatography-Mass Spectrometry (LCMS) , profiles of the two isotypes labelled under the same common name Maca deposited in the Medicinal Plant Herbarium, in Australia and Poland, but identified under two different scientific names Lepidium meyenii Walpers (L. meyenii) and Lepidium peruvianum Chacon (L. peruvianum) are presented. The two isotypes correspond to two holotypes of Peruvian medicinal herb known under the same common name “Maca”, as originally deposited in the Herbarium of San Marcos University in Lima, Peru dated back to 1843 and 1990 respectively. The results demonstrate distinct differences in taxonomy, visual appearance, phytochemical profiles and DNA sequences of the two researched Maca isotypes, suggesting that the two Maca specimens are dissimilar and formal use of the term “synonymous” to L. meyenii and L. peruvianum may be misleading. On the basis of presented results the scientific name L. meyenii, used since 1843 up-today for cultivated Peruvian Maca by numerous reference sources worldwide, including Regulatory Bodies in the USA, EU, Australia and most lately in China, appears to be used in error and should be formally revised. It is concluded, that the isotype of cultivated Peruvian Maca labelled under its scientific name Lepidium peruvianum Chacon, provides all the characteristics peculiar to this historically-documented herb grown in Andean highlands, which may be linked to its traditional use and accepted functionality, confirmed in recent clinical study to be relevant to its present day use for expected dietary, therapeutic and health benefits.

  1. Presence of oligosaccharides in seed-coat mucilage of Lepidium sativum : role in allelopathy

    OpenAIRE

    Iqbal, Amjad

    2010-01-01

    Lepidimoide is a naturally occurring disaccharide reported to be an oligosaccharin, i.e. to exhibit ‘hormone-like’ biological activity. It was found in cress (Lepidium sativum) root exudates and exerts apparently allelopathic effects on neighbouring Amaranthus seedlings. In the present study the effect of cress root exudates on hypocotyl and root length of Amaranthus caudatus and Lactuca sativa was studied. The seedlings of both species grown with Lepidium sativum seedlings had...

  2. Optimization of the new formulation of ice cream with native Iranian seed gums (Lepidium perfoliatum and Lepidium sativum) using response surface methodology (RSM).

    Science.gov (United States)

    Azari-Anpar, M; Soltani Tehrani, N; Aghajani, N; Khomeiri, M

    2017-01-01

    In this study, effect of Qodume shahri ( Lepidium perfoliatum ) and cress ( Lepidium sativum ) on rheological properties of ice cream were investigated. The gums were added to the ice cream formulation and different quality attributes including pH, acidity, melting characteristics, viscosity, overrun, texture analysis and sensory evaluation were determined. Results showed that ice cream formulations containing both the gums had improved overrun, melting rate, first dripping time, viscosity, hardness and adhesiveness. The gum concentrations beyond 0.2% level led to a negative effect on gumminess and chewiness of ice cream. Both the gums addition to improved quality attributes and textural properties of ice cream.

  3. Antiamoebic activity of benzyl glucosinolate from Lepidium virginicum.

    Science.gov (United States)

    Calzada, Fernando; Barbosa, Elizabeth; Cedillo-Rivera, Roberto

    2003-06-01

    In a continuation of our search for potential antiprotozoal agents from plants, we found that a crude extract from the roots of Lepidium virginicum exhibited antiprotozoal activity against Entamoeba histolytica trophozoites (IC(50) of 100.1 micro g/mL). Bioassay-guided fractionation resulted in the isolation of one known glucosinolate responsible for such activity. This compound was identified as benzyl glucosinolate. It showed in vitro activity against Entamoeba histolytica strain HM1-IMSS (IC(50) of 20.4 micro g/mL). The results support the anecdotal reports for the traditional use of L. virginicum roots in the control of diarrhoea and dysentery in the highlands of Chiapas, Mexico. Copyright 2003 John Wiley & Sons, Ltd.

  4. Effect of short-term and long-term treatments with three ecotypes of Lepidium meyenii (MACA) on spermatogenesis in rats.

    Science.gov (United States)

    Gonzales, Carla; Rubio, Julio; Gasco, Manuel; Nieto, Jessica; Yucra, Sandra; Gonzales, Gustavo F

    2006-02-20

    Lepidium meyenii (Brassicaceae), known as Maca, is a Peruvian hypocotyl that grows exclusively between 4000 and 4500 m above sea level in the central Andes. Maca is traditionally employed in the Andean region for its supposed fertility-enhancing properties. The study aimed to test the hypothesis that different ecotypes of Maca (Red, Yellow and Black) after short-term (7 days) and long-term (42 days) treatment affects differentially spermatogenesis adult rats. After 7 days of treatment with Yellow and Red Maca, the length of stage VIII was increased (P<0.05), whereas with Black Maca stages II-VI and VIII were increased (P<0.05). Daily sperm production (DSP) was increased in the group treated with Black Maca compared with control values (P<0.05). Red or Yellow Maca did not alter DSP and epididymal sperm motility was not affected by treatment with any ecotype of Maca. After 42 days of treatment, Black Maca was the only ecotype that enhanced DSP (P<0.05). Moreover, Black Maca was the only that increased epididymal sperm motility (P<0.05). In relation to the control group, Red Maca did not affect testicular and epididymal weight nor epididymal sperm motility and sperm count; however, prostate weight was reduced (P<0.05). Black or Yellow Maca did not affect prostate weight. In conclusion, there were differences in the biological response of the three ecotypes of Maca (Yellow, Red and Black). Black Maca appeared to have more beneficial effect on sperm counts and epididymal sperm motility.

  5. [Study on Chemical Constituents of Fat-soluble Extraction from Lepidium meyenii].

    Science.gov (United States)

    Fan, Cai-hong; Ge, Fa-huan

    2015-02-01

    To study the chemical constituents of the fat-soluble extraction from Lepidium meyenii root. Different extraction methods were studied, including supercritical carbon dioxide extraction, circumfluence extraction and steam distillation. Chemical constituents of the fat-soluble extraction from Lepidium meyenii were analyzed by GC/MS. The number of compounds isolated by the above four methods were 38, 31, 14, 21 (specific gravity less than 1 in steam distillation) , and 25 (specific gravity greater than 1 in steam distillation), accounting for 85.79%, 81.18%, 62.08%, 98.36% (specific gravity less than 1 in steam distillation) and 81.54% (specific gravity greater than 1 in steam distillation) of each total peak area, respectively. This study lays a certain foundation for further study and development of functional factors in Lepidium meyenii root.

  6. Semi-quantitative analysis of transcript accumulation in response to drought stress by Lepidium latifolium seedlings.

    Science.gov (United States)

    Gupta, Sanjay Mohan; Singh, Sadhana; Pandey, Pankaj; Grover, Atul; Ahmed, Zakwan

    2013-09-01

    Cross-amplification of five Arabidopsis abiotic stress-responsive genes (AtPAP, ZFAN, Vn, LC4 and SNS) in Lepidium has been documented in plants raised out of seeds pre-treated with potassium nitrate (KNO 3) for assessment of enhanced drought stress tolerance. cDNA was synthesized from Lepidium plants pre-treated with KNO 3 (0.1% and 0.3%) and exposed to drought conditions (5% and 15% PEG) at seedling stage for 30 d. Transcript accumulation of all the five genes were found suppressed in set of seedlings, which were pre-treated with 0.1% KNO 3 and were exposed to 15% PEG for 30 d. The present study establishes that different pre-treatments may further enhance the survivability of Lepidium plants under conditions of drought stress to different degrees.

  7. Plant-mediated effects in the Brassicaceae on the performance and behaviour of parasitoids

    NARCIS (Netherlands)

    Gols, R.; Harvey, J.A.

    2009-01-01

    Direct and indirect plant defences are well studied, particularly in the Brassicaceae. Glucosinolates (GS) are secondary plant compounds characteristic in this plant family. They play an important role in defence against herbivores and pathogens. Insect herbivores that are specialists on

  8. Brassicaceae: nutrient analysis and investigation of tolerability in people with Crohn’s disease in a New Zealand study

    OpenAIRE

    Bobbi Campbell; Dug Yeo Han; Christopher M. Triggs; Alan G. Fraser; Lynnette R. Ferguson

    2012-01-01

    Background: Nutrition is an important environmental factor influencing symptoms of Crohn’s disease, one of the two main expressions of inflammatory bowel disease. Varieties of Brassicaceae supply valuable nutrients. They are often avoided by people with Crohn’s disease because of the adverse effects they are perceived to have on symptoms. The purpose of this study was to review the nutritional content of commonly eaten forms of Brassicaceae and identify from selected Brassicaceae those that...

  9. [Maca (Lepidium meyenii Walp), a review of its biological properties].

    Science.gov (United States)

    Gonzales, Gustavo F; Villaorduña, Leonidas; Gasco, Manuel; Rubio, Julio; Gonzales, Carla

    2014-01-01

    Maca (Lepidium meyenii) is a plant that grows above 4000 altitude meters in Peru's Central Andes; it has different varieties according to the color of the hypocotyl. This review summarizes the results of studies about the effects of maca on sexual function, spermatogenesis, female reproductive function, memory, depression and anxiety, and energy as well as effects on benign prostatic hyperplasia, osteoporosis and metabolic syndrome. Its anti-aging effect is also discussed as well as safety in consumption. Differences have been shown between the effects of the black, yellow and red maca varieties. Black maca shows the best results on spermatogenesis, memory and fatigue, while red maca is the variety that reverses the benign prostatic hyperplasia and experimentally induced osteoporosis. In addition, maca reduces the glucose levels, and its consumption is related to the lowering of blood pressure and an improved health score. Experimental studies have proven that short and long term consumption don't show in vivo and in vitro toxicity. Although experimental studies have shown that maca has diverse beneficial effects, more clinical studies are needed to confirm these results.

  10. Composition and Physical Properties of Cress (Lepidium sativum L.) and Field Pennycress (Thlaspi arvense L.) Oils

    Science.gov (United States)

    The fatty acid profile and tocopherol, and phytosterol contents of crude cress (Lepidium sativum L.) and field pennycress (Thlaspi arvense L.) oils are reported, along with yields from the corresponding seeds. The physical properties of these oils were also determined, which included oxidative stab...

  11. Crystallization of water-soluble chlorophyll-proteins from Lepidium virginicum.

    Science.gov (United States)

    Murata, T; Itoh, R; Yakushiji, E

    1980-11-05

    Water-soluble chlorophyll-proteins were prepared from leaves of Lepidium virginicum, by means of ammonium sulfate fractionation followed by column chromatography on DEAE-cellulose and Sephacryl S-200. After intensive purification the chlorophyll-proteins were crystallized by dialysis against an ammonium sulfate solution.

  12. Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Keshavaiah Channa

    2011-02-01

    Full Text Available Abstract Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes and mitochondrial (28 genes genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes. Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely

  13. Evolutionary origins of Brassicaceae specific genes in Arabidopsis thaliana

    Science.gov (United States)

    2011-01-01

    Background All sequenced genomes contain a proportion of lineage-specific genes, which exhibit no sequence similarity to any genes outside the lineage. Despite their prevalence, the origins and functions of most lineage-specific genes remain largely unknown. As more genomes are sequenced opportunities for understanding evolutionary origins and functions of lineage-specific genes are increasing. Results This study provides a comprehensive analysis of the origins of lineage-specific genes (LSGs) in Arabidopsis thaliana that are restricted to the Brassicaceae family. In this study, lineage-specific genes within the nuclear (1761 genes) and mitochondrial (28 genes) genomes are identified. The evolutionary origins of two thirds of the lineage-specific genes within the Arabidopsis thaliana genome are also identified. Almost a quarter of lineage-specific genes originate from non-lineage-specific paralogs, while the origins of ~10% of lineage-specific genes are partly derived from DNA exapted from transposable elements (twice the proportion observed for non-lineage-specific genes). Lineage-specific genes are also enriched in genes that have overlapping CDS, which is consistent with such novel genes arising from overprinting. Over half of the subset of the 958 lineage-specific genes found only in Arabidopsis thaliana have alignments to intergenic regions in Arabidopsis lyrata, consistent with either de novo origination or differential gene loss and retention, with both evolutionary scenarios explaining the lineage-specific status of these genes. A smaller number of lineage-specific genes with an incomplete open reading frame across different Arabidopsis thaliana accessions are further identified as accession-specific genes, most likely of recent origin in Arabidopsis thaliana. Putative de novo origination for two of the Arabidopsis thaliana-only genes is identified via additional sequencing across accessions of Arabidopsis thaliana and closely related sister species

  14. Use of Gelatinized Maca (Lepidium Peruvianum) in Early Postmenopausal Women

    Science.gov (United States)

    Meissner, H. O.; Kapczynski, W.; Mscisz, A.; Lutomski, J.

    2005-01-01

    Objective: This double-blind, placebo-corrected clinical pilot study was aimed at assessing the use of hypocotyls of cruciferous Andean plant Maca (Lepidium peruvianum Chacon), in alleviating symptoms of menopausal discomfort experienced by women in early post menopause as measured by profiles of serum hormones: Luteinizing Hormone (LH), Follicle-stimulating Hormone (FSH), Estrogen (E2) and Progesterone (PG) and as assessed by Greene’s Menopausal Index. Design: Study was conducted on 20 Caucasian healthy early-postmenopausal women volunteers during the three months period (Trial I) and on eight women during nine months period (Trial II). Hormone levels were determined in blood with a simultaneous assessment of menopausal index at the start of study, after one month use of placebo, and after two and eight months administration of 2g gelatinized Maca root powder (Maca-GO) in the form of two 500mg hard gel capsules, twice daily. Results: In comparison to placebo, after both, two and eight months administration of Maca-GO capsules to EPMW, level of FSH significantly (PMaca-GO treatment only. There was a significant (PMaca-GO when used in EPMW, depending on the length of use, was acting as a toner of hormonal processes as reflected by decrease in FSH and increased LH secretion, which stimulated production of both ovarian hormones, E2 and PG and resulted in a substantial reduction of menopausal discomfort felt by women participating in the study, with a distinctive placebo effect, thus, fully justifying further, more complex study on effectiveness of Maca-GO as a reliable alternative to HRT program. PMID:23674952

  15. Predicting the occurrence of alate aphids in Brassicaceae

    Directory of Open Access Journals (Sweden)

    Francisco Jorge Cividanes

    2012-04-01

    Full Text Available The objective of this work was to predict the occurrence of alates of Brevicoryne brassicae, Lipaphis erysimi, and Myzus persicae (Hemiptera, Aphididae in Brassicaceae. The alate aphids were collected in yellow water traps from July 1997 to August 2005. Aphid population peaks were predicted using a degree‑day model. The meteorological factors, temperature, air relative humidity, rainfall, and sunshine hours, were used to provide precision indexes to evaluate the best predictor for the date of the first capture of alate aphids by the traps. The degree‑day model indicated that the peak population of the evaluated aphid species can be predicted using one of the following biofix dates: January 1st, June 1st, and the date of the first capture of the alate aphid species by the yellow water traps. The best predictor of B. brassicae occurrence is the number of days with minimum temperature >15°C, and of L. erysimi and M. persicae, the number of days with rainfall occurrence.

  16. Effect of sulfur fertilization on the sanitary state of plants of the family Brassicaceae

    Directory of Open Access Journals (Sweden)

    Tomasz P. Kurowski

    2012-12-01

    Full Text Available The experiment was carried out in the years 2006-2008 in Bałcyny (N=53°35'49"; E=19°51'20". The aim of this study was to determine the effect of sulfur fertilization on the sanitary state of spring oilseed rape, winter oilseed rape, white mustard and Chinese mustard as well as on the species composition of fungi colonizing their seeds. Sulfur fertilization had a beneficial effect on the health of Brassicaceae plants infested by Alternaria blight, grey mould, Sclerotinia stem rot, Phoma stem canker and Verticillium wilt, but it had a varying effect on the occurrence of powdery mildew. Alternaria alternata and Penicillium spp. were isolated most frequently from Brassicaceae seeds. In general, more fungi (including pathogenic to Brassicaceae were isolated from the seeds of plants grown in non-sulfur fertilized plots. Pathogens occurred primarily on the seed surface, and their number decreased after surface disinfection of seeds.

  17. Silique valves as sails in anemochory of Lunaria (Brassicaceae).

    Science.gov (United States)

    Leins, P; Fligge, K; Erbar, C

    2018-03-01

    The generally held opinion that seeds of Lunaria remain at the replum after detachment of the two valves and then wind causes a shaking or rattling of the replum with its diaphragm, thus launching the seeds, is challenged. In a sparse forest in the Swabian Alb, the first author noticed flying valves of Lunaria rediviva to which the narrow-winged flat seeds are attached. Investigations with SEM and histology have shown that the valves secrete a glue only at those sites where the seeds rest on the valves before valve tissues die. Further analysis has shown (using the periodic acid-Schiff reaction) that the glue consists of polysaccharides. After detachment and dispersal of the valves, the adhesive strength continuously decreases. This is the first report for a sticky valve exudate in the Brassicaceae. Because of the adhesion of Lunaria seeds to their valves for some time, the 1st order diaspore is a mericarp, in a broad sense, and can be interpreted as an adaptation to long-distance dispersal by stronger winds. In this context, the 'flying carpets' of Lunaria are more effective and transport more than one seed. Molecular studies assigned Lunaria to the tribe Biscutelleae, which now contains the angustiseptate genera Biscutella and Megadenia as well as the latiseptate genera Lunaria and Ricotia. The valves in Ricotia can easily be detached (studied in herbarium material and a living plant), but, in contrast to Lunaria, the ripe seeds remain at the replum and its diaphragm, respectively. © 2017 German Society for Plant Sciences and The Royal Botanical Society of the Netherlands.

  18. The C-terminal extension peptide of non-photoconvertible water-soluble chlorophyll-binding proteins (Class II WSCPs) affects their solubility and stability: comparative analyses of the biochemical and chlorophyll-binding properties of recombinant Brassica, Raphanus and Lepidium WSCPs with or without their C-terminal extension peptides.

    Science.gov (United States)

    Takahashi, Shigekazu; Uchida, Akira; Nakayama, Katsumi; Satoh, Hiroyuki

    2014-02-01

    Numerous members of the Brassicaceae possess non-photoconvertible water-soluble chlorophyll (Chl)-binding proteins (Class II WSCPs), which function as Chl scavengers during cell disruption caused by wounding, pest/pathogen attacks, and/or environmental stress. Class II WSCPs have two extension peptides, one at the N-terminus and one at the C-terminus. The N-terminal peptide acts as a signal peptide, targeting the protein to the endoplasmic reticulum body, a unique defensive organelle found only in the Brassicaceae. However, the physiological and biochemical functions of the C-terminal extension peptide had not been characterized previously. To investigate the function of the C-terminal extension peptide, we produced expression constructs of recombinant WSCPs with or without the C-terminal extension peptide. The WSCPs used were of Brussels sprouts (Brassica oleracea), Japanese wild radish (Raphanus sativus) and Virginia pepperweed (Lepidium virginicum). The solubility of all of the WSCPs with the C-terminal extension peptide was drastically lower than that of the recombinant WSCPs without the C-terminal extension peptide. In addition, the stability of the reconstituted WSCPs complexes with the C-terminal extension peptide was altered compared with that of the proteins without the C-terminal extension peptide. These finding indicate that the C-terminal extension peptide affects not only the solubility, but also the stability of Class II WSCP. Furthermore, we characterized the Chl-binding properties of the recombinant WSCP from Japanese wild radish (RshWSCP-His) in a 40 % methanol solution. An electrophoretic mobility shift assay revealed that RshWSCP-His required a half-molar ratio of Chls to form a tetramer.

  19. Extraction, purification and antioxidant activities of the polysaccharides from maca (Lepidium meyenii).

    Science.gov (United States)

    Zha, Shenghua; Zhao, Qingsheng; Chen, Jinjin; Wang, Liwei; Zhang, Guifeng; Zhang, Hong; Zhao, Bing

    2014-10-13

    Water-soluble polysaccharides were separated from maca (Lepidium meyenii) aqueous extract (MAE). The crude polysaccharides were deproteinized by Sevag method. During the preparation process of maca polysaccharides, amylase and glucoamylase effectively removed starch in maca polysaccharides. Four Lepidium meyenii polysaccharides (LMPs) were obtained by changing the concentration of ethanol in the process of polysaccharide precipitation. All of the LMPs were composed of rhamnose, arabinose, glucose and galactose. Antioxidant activity tests revealed that LMP-60 showed good capability of scavenging hydroxyl free radical and superoxide radical at 2.0mg/mL, the scavenging rate was 52.9% and 85.8%, respectively. Therefore, the results showed that maca polysaccharides had a high antioxidant activity and could be explored as the source of bioactive compounds. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Value of reduced / oxidized glutathione (GSH / GSSG) in diabetic rats treated with maca (Lepidium meyenii Walp)

    OpenAIRE

    Cisneros, Ruth; Oré, Raque; Arnao, Inés; Suárez, Silvia

    2013-01-01

    Background: Diabetes mellitus and its complications are public health problems. Hyperglycemia triggers harmful biochemical effects to the body, such as oxidative stress and inflammatory process. The use of medicinal plants with high antioxidant capacity as Lepidium meyenii Walp (maca) is an alternative in treatment of this disease. Objective: To determine whether ingestion of maca flour improves the relation reduced/oxidized glutathione (GSH/GSSG) in diabetic rats. Design: Experimental. Setti...

  1. Peruvian Maca (Lepidium peruvianum): (I) Phytochemical and Genetic Differences in Three Maca Phenotypes

    OpenAIRE

    Meissner, Henry O.; Mscisz, Alina; Mrozikiewicz, Mieczyslaw; Baraniak, Marek; Mielcarek, Sebastian; Kedzia, Bogdan; Piatkowska, Ewa; Jólkowska, Justyna; Pisulewski, Pawel

    2015-01-01

    Glucosinolates were previously reported as physiologically-important constituents present in Peruvian Maca (Lepidium peruvianum Chacon) and linked to various therapeutic functions of differently-colored Peruvian Maca hypocotyls. In two separate Trials, three colours of Maca hypocotyls “Black”, “Red” and “Yellow” (termed “Maca phenotypes”), were selected from mixed crops of Peruvian Maca for laboratory studies as fresh and after being dried. Individual Maca phenotypes were cultivated in the hi...

  2. Alien Species of Lepidium in the Flora of Romania: Invasion History and Habitat Preference

    OpenAIRE

    Culiţă SÎRBU; Adrian OPREA; Cristian Valeriu PATRICHE; Costel SAMUIL; Vasile VÎNTU

    2014-01-01

    The history of spread and habitat preferences during invasion of four alien species of Lepidium in Romania, namely L. densiflorum, L. oblongum, L. sativum, and L. virginicum are presented in this paper. The floristic records of these species, collected between 1816 and 2013, were used in the study. L. sativum was sporadically mentioned by earlier botanic references, as a casual alien plant in ruderal places. L. oblongum was reported from a single locality, but it may be considered a potential...

  3. Dose-response effects of Lepidium meyenii (Maca) aqueous extract on testicular function and weight of different organs in adult rats.

    Science.gov (United States)

    Chung, Francisco; Rubio, Julio; Gonzales, Carla; Gasco, Manuel; Gonzales, Gustavo F

    2005-04-08

    Lepidium meyenii (Brassicaceae) known as Maca grows exclusively between 4000 and 4500 m over the sea level in the Peruvian central Andes. The dried hypocotyls of Maca are traditionally used as food and for its supposed fertility-enhancing properties. A dose-response study was performed to determine the effect of 7 days oral administration of an aqueous lyophilized extract of Maca at 0.01-5 g/kg (corresponding to 0.022-11 g dry hypocotyls of Maca/kg) on body and different organ weights, stages of the seminiferous tubules, epididymal sperm count and motility, and serum testosterone and estradiol levels in rats. In doses up to 5 g extract/kg, no toxicity was observed. Almost all organ weights were similar in controls and in the Maca extract-treated groups. Seminal vesicles weight was significantly reduced at 0.01 and 0.10 g extract/kg. Maca increased in length of stages VII-VIII of the seminiferous tubules in a dose-response fashion, with highest response at 1.0 g/kg, while caput/corpus epididymal sperm count increased at the 1.0 g dose. Cauda epididymal sperm count, sperm motility, and serum estradiol level were not affected at any of the doses studied. Serum testosterone was lower at 0.10 g extract/kg. Low-seminal vesicle weights correlated with low-serum testosterone levels (R2=0.33; P<0.0001) and low-testosterone/estradiol ratio (R2=0.35; P<0.0001). Increase in epididymal sperm count was related to lengths of stages VII-VIII. Highest effect on stages VII-VIII of the seminiferous tubules was observed at 1.0 g Maca aqueous extract/kg. The present study demonstrated that Maca extract in doses up to 5 g/kg (equivalent to the intake of 770 g hypocotyls in a man of 70 kg) was safe and that higher effect on reproductive parameters was elicited with a dose of 1 g extract/kg corresponding to 2.2 g dry Maca hypocotyls/kg.

  4. Molecular Phylogenetics, Temporal Diversification, and Principles of Evolution in the Mustard Family (Brassicaceae)

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Franzke, A.; Al-Shehbaz, I.A.; Bakker, F.T.; Koch, M.A.; Mummenhoff, K.

    2010-01-01

    Brassicaceae is an important family at both the agronomic and scientific level. The family not only inlcudes several model species, but it is also becoming an evolutionary model at the family level. However, resolving the phylogenetic relationships within the family has been problematic, and a

  5. High-Performance Liquid Chromatography–Mass Spectrometry Analysis of Plant Metabolites in Brassicaceae

    NARCIS (Netherlands)

    Vos, de C.H.; Schipper, A.; Hall, R.D.

    2012-01-01

    The Brassicaceae family comprises a variety of plant species that are of high economic importance as -vegetables or industrial crops. This includes crops such as Brassica rapa (turnip, Bok Choi), B. oleracea (cabbages, broccoli, cauliflower, etc.), and B. napus (oil seed rape), and also includes the

  6. Brassica database (BRAD) version 2.0: integrating and mining Brassicaceae species genomic resources.

    Science.gov (United States)

    Wang, Xiaobo; Wu, Jian; Liang, Jianli; Cheng, Feng; Wang, Xiaowu

    2015-01-01

    The Brassica database (BRAD) was built initially to assist users apply Brassica rapa and Arabidopsis thaliana genomic data efficiently to their research. However, many Brassicaceae genomes have been sequenced and released after its construction. These genomes are rich resources for comparative genomics, gene annotation and functional evolutionary studies of Brassica crops. Therefore, we have updated BRAD to version 2.0 (V2.0). In BRAD V2.0, 11 more Brassicaceae genomes have been integrated into the database, namely those of Arabidopsis lyrata, Aethionema arabicum, Brassica oleracea, Brassica napus, Camelina sativa, Capsella rubella, Leavenworthia alabamica, Sisymbrium irio and three extremophiles Schrenkiella parvula, Thellungiella halophila and Thellungiella salsuginea. BRAD V2.0 provides plots of syntenic genomic fragments between pairs of Brassicaceae species, from the level of chromosomes to genomic blocks. The Generic Synteny Browser (GBrowse_syn), a module of the Genome Browser (GBrowse), is used to show syntenic relationships between multiple genomes. Search functions for retrieving syntenic and non-syntenic orthologs, as well as their annotation and sequences are also provided. Furthermore, genome and annotation information have been imported into GBrowse so that all functional elements can be visualized in one frame. We plan to continually update BRAD by integrating more Brassicaceae genomes into the database. Database URL: http://brassicadb.org/brad/. © The Author(s) 2015. Published by Oxford University Press.

  7. Assessing the risk of Glyphosate to native plants and weedy Brassicaceae species of North Dakota

    Science.gov (United States)

    This study was conducted to determine the ecological risk to native plants and weedy Brassicaceae species which may be growing in areas affected by off target movement of glyphosate applied to glyphosate-resistant canola (Brassica napus). Ten native grass and forb species were ...

  8. Brassicaceae: nutrient analysis and investigation of tolerability in people with Crohn’s disease in a New Zealand study

    Directory of Open Access Journals (Sweden)

    Bobbi Campbell

    2012-11-01

    Full Text Available Background: Nutrition is an important environmental factor influencing symptoms of Crohn’s disease, one of the two main expressions of inflammatory bowel disease. Varieties of Brassicaceae supply valuable nutrients. They are often avoided by people with Crohn’s disease because of the adverse effects they are perceived to have on symptoms. The purpose of this study was to review the nutritional content of commonly eaten forms of Brassicaceae and identify from selected Brassicaceae those that exacerbate, ameliorate or make no difference to the symptoms of people with Crohn’s Disease. Methods: In this study commonly eaten Brassicaceae were identified and analysed for major nutrients, vitamins, minerals, phytochemicals and FODMAPs. An investigation on the tolerability of ten forms of Brassicaceae on people with Crohn’s disease was also conducted. This was based on the responses of adult subjects in the ‘Genes and Diet in Inflammatory Bowel Disease Study’ based in Auckland, New Zealand. Results: The nutrient analysis of the Brassicaceae showed their important contribution of fibre, vitamins, minerals, and phytochemicals, especially glucosinolates. Our study revealed that over 70% of respondents found that the consumption of broccoli, Chinese greens and rocket (arugula made no difference to their Crohn’s disease (p=0.0001.Conclusions: Brassicaceae contain key nutrients which contribute significantly to a person’s health through their fibre, vitamin, mineral and phytochemical content. Many people with Crohn’s Disease can tolerate different forms of Brassicaceae. By identifying the particular varieties that can be consumed by people with Crohn’s disease and encouraging them to eat them, their nutrition, immune status and anti-inflammatory and anti-cancer factors will be enhanced.

  9. Utilización de Lepidium peruvianum maca, como medio de cultivo para el crecimiento de Trypanosoma cruzi

    OpenAIRE

    Saldaña C, Charles; Córdova P, Ofelia; Instituto de Investigación en Microbiología y Parasitología Tropical. Universidad Nacional de Trujillo. La Libertad, Perú.; Vargas V, Franklin; Instituto de Investigación en Microbiología y Parasitología Tropical. Universidad Nacional de Trujillo. La Libertad, Perú.

    2006-01-01

    Por sus características nutritivas de alto valor, se ensayó la posible utilidad del Lepidium peruvianum maca, como un medio para cultivar Trypanosoma cruzi. Bajo condiciones experimentales se procedió a incubar epimastigotes de T. cruzi en cuatro medios de cultivo bifásicos diferentes, a base de Lepidium peruvianum maca, los cuales fueron comparados con el medio de cultivo BHI como control. La incorporación de maca como medio de cultivo permitió el crecimiento de Trypanosoma cruzi; se determi...

  10. Thiouracil-Forming Bacteria Identified and Characterized upon Porcine In Vitro Digestion of Brassicaceae Feed

    Science.gov (United States)

    Kiebooms, Julie A. L.; Wauters, Jella; Vanden Bussche, Julie; Houf, Kurt; De Vos, Paul; Van Trappen, Stefanie; Cleenwerck, Ilse

    2014-01-01

    In recent years, the frequent detection of the banned thyreostat thiouracil (TU) in livestock urine has been related to endogenous TU formation following digestion of glucosinolate-rich Brassicaceae crops. Recently, it was demonstrated that, upon in vitro digestion of Brassicaceae, fecal bacteria induce TU detection in livestock (porcine livestock > bovines). Therefore, the present study was intended to isolate and identify bacteria involved in this intestinal TU formation upon Brassicaceae digestion and to gain more insight into the underlying mechanism in porcine livestock. Twenty porcine fecal inocula (gilts and multiparous sows) were assessed through static in vitro colonic-digestion simulations with rapeseed. After derivatization and extraction of the fecal suspensions, TU was analyzed using liquid chromatography-tandem mass spectrometry (LC-MS2). On average, lower TU concentrations were observed in fecal colonic simulations in gilts (8.35 ng g−1 rapeseed ± 3.42 [mean ± standard deviation]) than in multiparous sows (52.63 ng g−1 ± 16.17), which correlates with maturation of the gut microbial population with age. Further exploration of the mechanism showed cell-dependent activity of the microbial conversion and sustained TU-forming activity after subjection of the fecal inoculum to moderate heat over a time span of up to 30 min. Finally, nine TU-producing bacterial species were successfully isolated and identified by a combination of biochemical and molecular techniques as Escherichia coli (n = 5), Lactobacillus reuteri (n = 2), Enterococcus faecium (n = 1), and Salmonella enterica subsp. arizonae (n = 1). This report demonstrates that endogenous formation of TU is Brassicaceae induced and occurs under colonic conditions most likely through myrosinase-like enzyme activity expressed by different common intestinal bacterial species. PMID:25261511

  11. Estudio fitoquímico del "mastuerzo" (Coronopus didymus Sm. Brassicaceae)

    OpenAIRE

    López de Ruiz, Rosa Evelia; Fusco, María del Rosario; Rapisarda, Ana M. P.; Sosa, Ángela; Ruiz, Sohar Osvaldo

    1989-01-01

    Ha sido estudiado el Coronopus didymus Sm. (Brassicaceae), nombre vulgar "mastuerzo", usado en tisanas en medicina popular. A partir del extracto de éter de petróleo se aisla ß-sitosterol, el cual se usa como hipocolesterolémico. En la fracción alcaloídica se encuentra sinapina, como cloruro, base de amonio cuaternaria frecuentemente presente en esta familia botánica.

  12. Efficient Detection of Novel Nuclear Markers for Brassicaceae by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Reinhold Stockenhuber

    Full Text Available The lack of DNA sequence information for most non-model organisms impairs the design of primers that are universally applicable for the study of molecular polymorphisms in nuclear markers. Next-generation sequencing (NGS techniques nowadays provide a powerful approach to overcome this limitation. We present a flexible and inexpensive method to identify large numbers of nuclear primer pairs that amplify in most Brassicaceae species. We first obtained and mapped NGS transcriptome sequencing reads from two of the distantly related Brassicaceae species, Cardamine hirsuta and Arabis alpina, onto the Arabidopsis thaliana reference genome, and then identified short conserved sequence motifs among the three species bioinformatically. From these, primer pairs to amplify coding regions (nuclear protein coding loci, NPCL and exon-primed intron-crossing sequences (EPIC were developed. We identified 2,334 universally applicable primer pairs, targeting 1,164 genes, which provide a large pool of markers as readily usable genomic resource that will help addressing novel questions in the Brassicaceae family. Testing a subset of the newly designed nuclear primer pairs revealed that a great majority yielded a single amplicon in all of the 30 investigated Brassicaceae taxa. Sequence analysis and phylogenetic reconstruction with a subset of these markers on different levels of phylogenetic divergence in the mustard family were compared with previous studies. The results corroborate the usefulness of the newly developed primer pairs, e.g., for phylogenetic analyses or population genetic studies. Thus, our method provides a cost-effective approach for designing nuclear loci across a broad range of taxa and is compatible with current NGS technologies.

  13. Brassicaceae Mustards: Traditional and Agronomic Uses in Australia and New Zealand

    Directory of Open Access Journals (Sweden)

    Mahmudur Rahman

    2018-01-01

    Full Text Available Commonly cultivated Brassicaceae mustards, namely garlic mustard (Alliaria petiolata, white mustard (Brassica alba, Ethiopian mustard (B. carinata, Asian mustard (B. juncea, oilseed rape (B. napus, black mustard (B. nigra, rapeseed (B. rapa, white ball mustard (Calepina irregularis, ball mustard (Neslia paniculata, treacle mustard (Erysimum repandum, hedge mustard (Sisymbrium officinale, Asian hedge mustard (S. orientale, smooth mustard (S. erysimoides and canola are the major economically important oilseed crops in many countries. Mustards were naturalized to Australia and New Zealand and Australia is currently the second largest exporter of Brassicaceae oilseeds to meet the global demand for a healthy plant-derived oil, high in polyunsaturated fats. Apart from providing edible oil, various parts of these plants and many of their phytochemicals have been used traditionally for both agronomic as well as medicinal purposes, with evidence of their use by early Australian and New Zealand settlers and also the indigenous population. This review provides an overview of the current knowledge of traditional and agronomic uses of Brassicaceae oilseeds and mustards with a focus on their importance in Australia and New Zealand.

  14. CrusView: a Java-based visualization platform for comparative genomics analyses in Brassicaceae species.

    Science.gov (United States)

    Chen, Hao; Wang, Xiangfeng

    2013-09-01

    In plants and animals, chromosomal breakage and fusion events based on conserved syntenic genomic blocks lead to conserved patterns of karyotype evolution among species of the same family. However, karyotype information has not been well utilized in genomic comparison studies. We present CrusView, a Java-based bioinformatic application utilizing Standard Widget Toolkit/Swing graphics libraries and a SQLite database for performing visualized analyses of comparative genomics data in Brassicaceae (crucifer) plants. Compared with similar software and databases, one of the unique features of CrusView is its integration of karyotype information when comparing two genomes. This feature allows users to perform karyotype-based genome assembly and karyotype-assisted genome synteny analyses with preset karyotype patterns of the Brassicaceae genomes. Additionally, CrusView is a local program, which gives its users high flexibility when analyzing unpublished genomes and allows users to upload self-defined genomic information so that they can visually study the associations between genome structural variations and genetic elements, including chromosomal rearrangements, genomic macrosynteny, gene families, high-frequency recombination sites, and tandem and segmental duplications between related species. This tool will greatly facilitate karyotype, chromosome, and genome evolution studies using visualized comparative genomics approaches in Brassicaceae species. CrusView is freely available at http://www.cmbb.arizona.edu/CrusView/.

  15. Optimized methodology for the simultaneous extraction of glucosinolates, phenolic compounds and antioxidant activity from maca (Lepidium meyenii)

    NARCIS (Netherlands)

    Campos, D.; Chirinos, R.; Barreto, O.; Noratto, G.; Pedreschi Plasencia, R.P.

    2013-01-01

    Maca is a highly appreciated Andean crop with multiple attributed health claims due to its assortment of bioactive compounds. The extraction parameters of glucosinolates (GLs), total phenolic compounds (TPC) and antioxidant capacity (AC) of maca (Lepidium meyenii) hypocotyls were optimized using

  16. Extraction of Lepidium apetalum Seed Oil Using Supercritical Carbon Dioxide and Anti-Oxidant Activity of the Extracted Oil

    Directory of Open Access Journals (Sweden)

    Xuchong Tang

    2011-12-01

    Full Text Available The supercritical fluid extraction (SFE of Lepidium apetalum seed oil and its anti-oxidant activity were studied. The SFE process was optimized using response surface methodology (RSM with a central composite design (CCD. Independent variables, namely operating pressure, temperature, time and flow rate were evaluated. The maximum extraction of Lepidium apetalum seed oil by SFE-CO2 (about 36.3% was obtained when SFE-CO2 extraction was carried out under the optimal conditions of 30.0 MPa of pressure, 70 °C of temperature, 120 min of extraction time and 25.95 L/h of flow rate. GC-MS analysis showed the presence of four fatty acids in Lepidium apetalum seed oil, with a high content (91.0% of unsaturated fatty acid. The anti-oxidant activity of the oil was assessed by the 2,2-diphenyl-1-picrylhydrazyl (DPPH radical-scavenging assay and 2,2′-azino- bis(3-ethylbenzthiazoline-6-sulphonic acid diammonium salt (ABTS test. Lepidium apetalum seed oil possessed a notable concentration-dependent antioxidant activity, with IC50 values of 1.00 and 3.75 mg/mL, respectively.

  17. Physicochemical and functional properties of dietary fiber from maca (Lepidium meyenii Walp.) liquor residue.

    Science.gov (United States)

    Chen, Jinjin; Zhao, Qingsheng; Wang, Liwei; Zha, Shenghua; Zhang, Lijun; Zhao, Bing

    2015-11-05

    Using maca (Lepidium meyenii) liquor residue as the raw material, dietary fiber (DF) was prepared by chemical (MCDF) and enzymatic (MEDF) methods, respectively, of which the physicochemical and functional properties were comparatively studied. High contents of DF were found in MCDF (55.63%) and MEDF (81.10%). Both fibers showed good functional properties, including swelling capacity, water holding capacity, oil holding capacity, glucose adsorption capacity and glucose retardation index. MEDF showed better functional properties, which could be attributed to its higher content of DF, more irregular surface and more abundant monosaccharide composition. The results herein suggest that maca DF prepared by enzymatic method from liquor residue is a good functional ingredient in food products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. [Assesing the effect of Lepidium meyenii "Maca" on the gastric mucosa in patients with functional dyspepsia].

    Science.gov (United States)

    Benites Goñi, Harold Eduardo; Cok García, Jaime; Bussalleu Cavero, Alejandra; Bustamente Robles, Katherine Yelenia; Zegarra Chang, Arturo; Bravo, Eduar; Bussalleu Rivera, Alejandro

    2014-01-01

    The present study was designed to determine the histological effect of Lepidium meyenii "Maca" on the gastric mucosa in patients with functional dyspepsia. This study consists of a clinical case series, in which the effect of Maca on the gastric histopathology of 29 Peruvian patients diagnosed with functional dyspepsia was examined. The presence of H. pylori, as well as the degree and depth of the gastric mucosa inflammation was evaluated from biopsies obtained before and after the treatment based solely of Maca 3 grams per day for four weeks. Average values of the degree and depth of mucosal inflammation before and after the treatment were compared showing no statistical difference among the samples. Sixteen patients were infected with H. pylori, and they remained infected after the treatment with Maca. A four week long treatment with Maca does not produce significant changes on gastric mucosa of patients with functional dyspepsia, neither on H. pylori eradication.

  19. Effect of ethanol extract of Lepidium meyenii Walp. on osteoporosis in ovariectomized rat.

    Science.gov (United States)

    Zhang, Yongzhong; Yu, Longjiang; Ao, Mingzhang; Jin, Wenwen

    2006-04-21

    Maca (Lepidium meyenii Walp.) is a cruciferous plant from the Andes of Peru. The root of Maca is traditionally employed for its supposed properties in aphrodisiacs and improving fertility, it also has been widely used to help alleviate the symptoms of menopause. The purpose of this study was to evaluate the effect of ethanol extract of Maca on postmenopausal osteoporosis in ovariectomized rats. Female Sprague-Dawley rats were divided into four groups: Sham-operated and ovariectomized groups were fed with equivolume of distilled water, and the remaining ovariectomized groups were orally administrated with ethanol extract of Maca at 0.096 and 0.24 g/kg for 28 weeks. The findings derived from the basis of bone mineral density, biomechanical, biochemical and histopathological parameters indicated that higher dose of ethanol extract of Maca was effective in the prevention of estrogen deficient bone loss.

  20. Analysis of macamides in samples of Maca (Lepidium meyenii) by HPLC-UV-MS/MS.

    Science.gov (United States)

    McCollom, Megan M; Villinski, Jacquelyn R; McPhail, Kerry L; Craker, Lyle E; Gafner, Stefan

    2005-01-01

    The macamides are a distinct class of secondary metabolites that have so far been found only in Lepidium meyenii Walp. (Maca). Using HPLC-UV-MS/MS, the main macamides have been identified as n-benzylhexadecanamide, n-benzyl-(9Z)-octadecenamide, n-benzyl-(9Z, 12Z)-octadecadienamide, n-benzyl-(9Z, 12Z, 15Z)-octadecatrienamide and n-benzyloctadecanamide. The identities of n-benzyl-(9Z)-octadecenamide and n-benzyl-(9Z, 12Z)-octadecadienamide were confirmed by comparison of chromatographic and spectral properties with synthetic analogues. Total macamides have been quantified by HPLC-UV in plant material from different vendors using n-benzylhexadecanamide as an external standard. The amount of macamides in the dried plant material ranged from 0.0016 to 0.0123%.

  1. 2D spectroscopy study of water-soluble chlorophyll-binding protein from Lepidium virginicum.

    Science.gov (United States)

    Alster, Jan; Lokstein, Heiko; Dostál, Jakub; Uchida, Akira; Zigmantas, Donatas

    2014-04-03

    Water-soluble chlorophyll-binding proteins (WSCPs) are interesting model systems for the study of pigment-pigment and pigment-protein interactions. While class IIa WSCP has been extensively studied by spectroscopic and theoretical methods, a comprehensive spectroscopic study of class IIb WSCP was lacking so far despite the fact that its structure was determined by X-ray crystallography. In this paper, results of two-dimensional electronic spectroscopy applied to the class IIb WSCP from Lepidium virginicum are presented. Global analysis of 2D data allowed determination of energy levels and excitation energy transfer pathways in the system. Some additional pathways, not present in class IIa WSCP, were observed. The data were interpreted in terms of a model comprising two interacting chlorophyll dimers. In addition, oscillatory signals were observed and identified as coherent beatings of vibrational origin.

  2. La Maca (Lepidium peruvianum Chacón sp. nov. y su Habitat

    Directory of Open Access Journals (Sweden)

    Gloria Chacon

    2014-06-01

    Full Text Available Este estudio presenta la descripción taxonómica de un ejemplar tipo de la MACA obtenido el 9 de septiembre de 1989 cerca de Huarancaca, ciudad de Cerro de Pasco, del Departamento de Pasco, como Lepidium peruvianum Chacon sp. nov., especie nueva para el género Lepidium (CRUCIFERA, las características que la distinguen de las especies afines especialmente de Lepidium meyenii Walp. y de Lepidium gelidium Wedd. están especificadas en este estudio. Igualmente presenta el estudio fitoquímico de la MACA realizado en 1960-1962, su hábitat y aclimatación a niveles de la costa. Esta especie cuyo nombre es MACA es oriunda de los Andes Centrales del Perú y se la conoce tanto por su valor alimenticio como farmacológico desde antes de la época del incanato. Crece en los Departamentos de Pasco y Junín en altitudes de 4100 y 4300 m sobre el nivel del mar. El clima en esta región es frío y seco durante el año caracterizándose el verano (enero, febrero y marzo como lluvioso con un promedio de 250,8 mm y con una temperatura ambiental promedio de 4.8 °C. En invierno (junio, julio y agosto las lluvias son escasas llegando a 34.4 mm y el promedio de la temperatura ambiental es alrededor de 3.5 °C. Los análisis químicos de la raíz realizados en 1960 y 1961 han demostrado la presencia de glúcidos y cuatro tipos de alcaloides, presentadas en cromatografía de papel Whatman. Estos alcaloides que he denominado "Extracto alcaloideo/marzo 1961", son los principios activos que intervienen en la frecuencia de procreación y dela clara y marcada estimulación de la maduración de los folículos de Graaf realizados en experimentos con ratas y en los machos, un aumento en la cantidad de espermatozoides en los tubos seminíferos y aumento de mitosis y espermatogonia. Estos ensayos los he realizado en el Instituto de Patología de la Facultad de Medicina Humana [de la UNMSM] durante los años 1961 y 1962. Las observaciones histológicas e histoqu

  3. Evaluation of nutritional and antioxidant status of Lepidium latifolium Linn.: a novel phytofood from Ladakh.

    Directory of Open Access Journals (Sweden)

    Tarandeep Kaur

    Full Text Available Lepidium latifolium Linn. (perennial pepperweed is one of the preferred phytofoods among cold arid region of Ladakh, India and its leaves contribute significantly to people's diet. This study was conducted to determine its nutritive value and antioxidant activity. Plant samples from three different locations were selected in the present study. Results showed that this plant is an excellent source of glucosinolates, notably sinigrin that is present in very high amount (∼70-90%. Its value ranged from 149 to 199 µg per g fresh weight. Fatty acid composition analysis showed that its leaves were abundant in unsaturated fatty acids, specifically linolenic acid (18∶3 whose percentage is about 50%. Higher glucose and crude protein along with higher nitrogen to sulfur ratio, supplements the nutritive value of this plant. Based on total phenol, flavanoids, free radical scavenging activity and DNA protective activity showed that this ecotype of perennial pepperweed contains high antioxidant properties. The percentage inhibition for O2(- scavenging activity ranged from 41.3% to 83.9%. Higher content of phenols (26.89 to 50.51 mg gallic acid equivalents per g dry weight and flavanoids (38.66 to 76.00 mg quercetin equivalents per g dry weight in leaves could be responsible for the free radical scavenging activity of this plant. Depending upon the location of the plants, variations were observed in different activities. Based on the systematic evaluation in this study, preparations of Lepidium latifolium from Ladakh can be promoted as substitute to dietary requirements.

  4. Antagonistic effect of Lepidium meyenii (red maca) on prostatic hyperplasia in adult mice.

    Science.gov (United States)

    Gonzales, G F; Gasco, M; Malheiros-Pereira, A; Gonzales-Castañeda, C

    2008-06-01

    The plants from the Lepidium gender have demonstrated to have effect on the size of the prostate. Lepidium meyenii (Maca) is a Peruvian plant that grows exclusively over 4000 m above sea level. The present study was designed to determine the effect of red maca (RM) in the prostate hyperplasia induced with testosterone enanthate (TE) in adult mice. Prostate hyperplasia was induced by administering TE, and then these animals (n = 6, each group) were treated with RM or Finasteride (positive control) for 21 days. There was an additional group without prostate hyperplasia (vehicle). Mice were killed on days 7, 14 and 21 after treatment with RM. Testosterone and oestradiol levels were measured on the last day of treatment. Prostatic stroma, epithelium and acini were measured histologically. RM reduced prostate weight at 21 days of treatment. Weights of seminal vesicles, testis and epididymis were not affected by RM treatment. The reduction in prostate size by RM was 1.59 times. Histological analysis showed that TE increased 2-fold the acinar area, effect prevented in the groups receiving TE + RM for 14 (P < 0.05) and 21 (P < 0.05) days and the group receiving TE + Finasteride for 21 days (P < 0.05). TE increased prostatic stroma area and this effect was prevented by treatment with RM since 7 days of treatment or Finasteride. The reduction in prostatic stroma area by RM was 1.42 times. RM has an anti-hyperplastic effect on the prostate of adult mice when hyperplasia was induced with TE acting first at prostatic stromal level.

  5. Fine-scale predictions of perennial pepperweed (Lepidium latifolium) invasion and herbicide success in a brackish tidal marsh

    OpenAIRE

    Tobias, Vanessa

    2015-01-01

    ABSTRACT Background/Question/Methods Perennial pepperweed (Lepidium latifolium, LELA) is an aggressively invasive crucifer that is a major concern for coastal management. This plant invades a wide variety of habitats including saline wetlands, riparian areas, and upland rangelands. Traditional management actions such as hand removal and mowing are impractical for controlling pepperweed in wetland habitats. Understanding the physical factors that influence invasion and the efficacy of herbi...

  6. UAE-HPLC-UV: New Contribution for Fast Determination of Total Isothiocyanates in Brassicaceae Vegetables

    Directory of Open Access Journals (Sweden)

    Cecilia M. Fusari

    2015-01-01

    Full Text Available Total isothiocyanates content (ITC is considered a good indicator of bioactive compounds responsible for beneficial effects related to Brassicaceae vegetables. Analytical performance is a critical factor for routine analysis in plant tissues. The extraction technique for isolating phytochemicals from Brassicaceae vegetables is currently the bottleneck of the methodology. The aim of this work was to optimize this step in the analytical process. Fast and less expensive alternative, based on ultrasound-assisted extraction technique (UAE for direct extraction of GLS into an aqueous phase and further analysis of the hydrolysis product, was optimized. Full factorial (2k design followed by Central Composite Design (CCD was used to obtain the optimum extraction conditions. Selected conditions were homogenization time (9 min; ultrasound bath time (5 min; and sample-to-solvent ratio (1 : 5 w/v mg mL−1. The proposed analytical methodology exhibits satisfactory analytical performance in terms of linearity, precision (RSD < 2.4%, and limits of detection (26 nmol g−1 w.w.. The new analytical methodology was applied to cauliflower, cabbage, watercress, and broccoli samples with recoveries higher than 86%. The UAE extraction technique was showed to be efficient for real samples analysis leading to sensible, selective, and reproducible methodology for ITC analysis.

  7. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae.

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-09-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Evolution of CONSTANS Regulation and Function after Gene Duplication Produced a Photoperiodic Flowering Switch in the Brassicaceae

    Science.gov (United States)

    Simon, Samson; Rühl, Mark; de Montaigu, Amaury; Wötzel, Stefan; Coupland, George

    2015-01-01

    Environmental control of flowering allows plant reproduction to occur under optimal conditions and facilitates adaptation to different locations. At high latitude, flowering of many plants is controlled by seasonal changes in day length. The photoperiodic flowering pathway confers this response in the Brassicaceae, which colonized temperate latitudes after divergence from the Cleomaceae, their subtropical sister family. The CONSTANS (CO) transcription factor of Arabidopsis thaliana, a member of the Brassicaceae, is central to the photoperiodic flowering response and shows characteristic patterns of transcription required for day-length sensing. CO is believed to be widely conserved among flowering plants; however, we show that it arose after gene duplication at the root of the Brassicaceae followed by divergence of transcriptional regulation and protein function. CO has two close homologs, CONSTANS-LIKE1 (COL1) and COL2, which are related to CO by tandem duplication and whole-genome duplication, respectively. The single CO homolog present in the Cleomaceae shows transcriptional and functional features similar to those of COL1 and COL2, suggesting that these were ancestral. We detect cis-regulatory and codon changes characteristic of CO and use transgenic assays to demonstrate their significance in the day-length-dependent activation of the CO target gene FLOWERING LOCUS T. Thus, the function of CO as a potent photoperiodic flowering switch evolved in the Brassicaceae after gene duplication. The origin of CO may have contributed to the range expansion of the Brassicaceae and suggests that in other families CO genes involved in photoperiodic flowering arose by convergent evolution. PMID:25972346

  9. Lepidium meyenii (Maca) enhances the serum levels of luteinising hormone in female rats.

    Science.gov (United States)

    Uchiyama, Fumiaki; Jikyo, Tamaki; Takeda, Ryosuke; Ogata, Misato

    2014-02-03

    Lepidium meyenii (Maca) is traditionally employed in the Andean region for its supposed fertility benefits. This study investigated the effect of Maca on the serum pituitary hormone levels during the pro-oestrus phase. Maca powder was made from the tubers of Lepidium meyenii Walp collected, dried, and reduced to powder at the plantation in Junín Plateau and was purchased from Yamano del Perú SAC. The Maca powder was identified by chemical profiling and taxonomic methods. Two groups of female Sprague-Dawley rats were provided feed with normal feed containing 5%, 25%, or 50% Maca powder ad libitum for 7 weeks. At 1800h of the proestrus stage, the rats were euthanised, and blood samples were collected for serum isolation. The serum pituitary hormone levels were measured using enzyme-linked immunosorbent assays (ELISAs). No significant differences in feed intake or growth rate were observed among the rats. During the pro-oestrus stage, a 4.5-fold increase (P<0.01) in luteinising hormone (LH) and a 19-fold increase (P<0.01) in follicle-stimulating hormone (FSH) were observed in the sera of rats fed with 50% Maca powder compared with the control rats. No significant differences were observed in the levels of the other pituitary hormones, including growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH), and thyroid-stimulating hormone (TSH). A dose-dependent increase of LH serum levels was observed within the range of 3-30g Maca/kg. Furthermore, the enhancement of the LH serum levels was specific to the pro-oestrus LH surge. The present study demonstrates that Maca uniquely enhances the LH serum levels of pituitary hormones in female rats during the pro-oestrus LH surge and acts in a pharmacological, dose-dependent manner. These findings support the traditional use of Maca to enhance fertility and suggest a potential molecular mechanism responsible for its effects. © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Caracterización de las proteínas totales de tres ecotipos de maca (Lepidium peruvianum G. Chacón), mediante electroforesis unidimensional y bidimensional

    OpenAIRE

    Mario Monteghirfo; Armando Yarleque-Chocas

    2007-01-01

    Objetivo: Caracterizar las proteínas solubles que se encuentran en la raíz del Lepidium peruvianum G. Chacón, maca, mediante electroforesis unidimensional y electroforesis bidimensional. Diseño: Estudio de tipo observacional y transversal. Lugar: Centro de Investigación de Bioquímica y Nutrición Alberto Guzmán Barrón. Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Perú. Materiales: Raíces de Lepidium peruvianum G. Chacón ‘maca’ de los ecotipos blanco, amarillo y morado,...

  11. Mannans and endo-β-mannanase transcripts are located in different seed compartments during Brassicaceae germination.

    Science.gov (United States)

    Carrillo-Barral, Néstor; Matilla, Angel J; Rodríguez-Gacio, María Del Carmen; Iglesias-Fernández, Raquel

    2018-03-01

    Mannans but not endo-β-mannanases are mainly found in the mucilage layer of two Brassicaceae seeds. Nonetheless, mannanase mobilization from inner to outer seed layers cannot be ruled out. The contribution of endo-β-mannanase (MAN) genes to the germination of the wild-type Sisymbrium officinale and cultivated Brassica rapa (Brassicaceae) species has been explored. In both species, mannans have been localized to the imbibed external seed coat layer (mucilage) by fluorescence immunolocalization and MAN enzymatic activity increases in seeds as imbibition progresses, reaching a peak before 100% germination is achieved. The MAN gene families have been annotated and the expression of their members analyzed in vegetative and reproductive organs. In S. officinale and B. rapa, MAN2, MAN5, MAN6, and MAN7 transcripts accumulate upon seed imbibition. SoMAN7 is the most expressed MAN gene in S. officinale germinating seeds, as occurs with its ortholog in Arabidopsis thaliana, but in B. rapa, the most abundant transcripts are BrMAN2 and BrMAN5. These genes (MAN2, MAN5, MAN6, and MAN7) are localized, by mRNA in situ hybridization, to the micropylar at the endosperm layer and to the radicle in S. officinale, but in B. rapa, these mRNAs are faintly found to the micropylar living seed coat layer and are mainly present at the radicle tip and the vascular bundles. If the domestication process undergone by B. rapa is responsible for these different MAN expression patterns, upon germination remains to be elucidated. Since mannans and MAN genes are not spatially distributed in the same seed tissues, a movement of MAN enzymes that are synthesized with typical signal peptides from the embryo tissues to the mucilage layer (via apoplastic space) is necessary for the mannans to be hydrolyzed.

  12. Underexplored biodiversity of Eastern Mediterranean biota: systematics and evolutionary history of the genus Aubrieta (Brassicaceae).

    Science.gov (United States)

    Koch, Marcus A; Karl, Robert; German, Dmitry A

    2017-01-01

    Aubrieta is a taxonomically difficult genus from the Brassicaceae family with approximately 20 species centred in Turkey and Greece. Species boundaries and their evolutionary history are poorly understood. Therefore, we analysed bio- and phylogeographic relationships and evaluated morphological variation to study the evolution of this genus. Phylogenetic analyses of DNA sequence variation of nuclear-encoded loci and plastid DNA were used to unravel phylogeographic patterns. Morphometric analyses were conducted to study species delimitation. DNA sequence-based mismatch distribution and climate-niche analyses were performed to explain various radiations in space and time during the last 2·5 million years. Species groups largely show non-overlapping distribution patterns in the eastern Mediterranean and Asia Minor. We recognized 20 species and provide evidence for overlooked species, thereby highlighting taxonomical difficulties but also demonstrating underexplored species diversity. The centre of origin of Aubrieta is probably Turkey, from which various clades expanded independently towards Asia Minor, south to Lebanon and west to Greece and the Balkans during the Pleistocene. Pleistocene climatic fluctuations had a pronounced effect on Aubrieta speciation and radiation during the last 1·1 million years in the Eastern Mediterranean and Asia Minor. In contrast to many other Brassicaceae, speciation processes did not involve excessive formation of polyploids, but displayed formation of diploids with non-overlapping present-day distribution areas. Expansions from the Aubrieta centre of origin and primary centre of species diversity showed adaptation trends towards higher temperature and drier conditions. However, later expansion and diversification of taxa from within the second centre of species diversity in Greece started ∼0·19 Mya and were associated with a general transition of species adaptation towards milder temperatures and less dry conditions. © The

  13. Structural Characterization and Immunomodulatory Activity of a Novel Polysaccharide from Lepidium meyenii.

    Science.gov (United States)

    Zhang, Mengmeng; Wang, Guang; Lai, Furao; Wu, Hui

    2016-03-09

    A novel polysaccharide named as MC-1 was isolated from the roots of Lepidium meyenii using a water extraction method. Structural characterization revealed that MC-1 had an average molecular weight of 11.3 kDa and consisted of arabinose (26.21%), mannose (11.81%), glucose (53.66%), and galactose (8.32%). The main linkage types of MC-1 were proven to be (1 → 5)-α-L-Ara, (1 → 3)-α-L-Man, (1 → 2,6)-α-L-Man, (1 → )-α-D-Glc, (1 → 4)-α-D-Glc, (1 → 6)-α-D-Glc and (1 → 6)-β-D-Gal by methylation analysis, periodate oxidation-Smith degradation and NMR analysis. The immunostimulating assay indicated that MC-1 could significantly enhance the pinocytic and phagocytic capacity and promote the NO, TNF-α, and IL-6 secretion of RAW 264.7 cells, involving toll-like receptor 2, complement receptor 3, and mannose receptor mainly. These results suggested the potential utilization of MC-1 as an attractive functional food supplement candidate for hypoimmunity population.

  14. Acute and chronic dosing of Lepidium meyenii (Maca) on male rat sexual behavior.

    Science.gov (United States)

    Lentz, Aaron; Gravitt, Karla; Carson, Culley C; Marson, Lesley

    2007-03-01

    The use of natural remedies for the treatment of sexual disorders is under current investigation. For generations people of the rural community in Peru have used Lepidium meyenii Walpers (Maca), because of their belief that it improves fertility and sexual desire. To determine the acute and chronic effects of Maca on male sexual behavior and to examine chronic administration of Maca on anxiety. Ejaculatory and mounting behavior and postejaculatory interval. Anxiety tests using an elevated plus maze, locomotion, and social interaction with another male. Maca (25 and 100 mg/kg) was orally administered to male rats for 30 days. Male sexual behavior was monitored after acute, 7 and 21 days of treatment. Anxiety behavior and locomotion were measured at 28-29 days using the elevated plus maze and social interaction tests. Maca treatment did not produce large changes in male sexual behavior. However, an increase in ejaculation latency and postejaculatory interval was observed after both acute and 7 days of treatment. After 21 days of treatment Maca had no effect on sexual behavior. Chronic administration of Maca did not increase locomotion or anxiety. Acute and short-term administration of Maca produced a small effect of rat male sexual behavior and long-term administration did not increase anxiety.

  15. Purification, characterization and biological activities of a polysaccharide from Lepidium meyenii leaves.

    Science.gov (United States)

    Li, Shufang; Hao, Limin; Kang, Qiaozhen; Cui, Yinxin; Jiang, Hui; Liu, Xin; Lu, Jike

    2017-10-01

    The characteristics and biological activities of a novel polysaccharide from Lepidium meyenii leaves (LMLP) were investigated. LMLP was purified using DEAE-52 cellulose chromatography followed by SephadexG-100 chromatography. The average molecule weight of LMLP was 58.43kDa and it was composed of galactose, arabinose, rhamnose, glucose and mannose with a relative molar ratio of 5.51:4.05:1.15:0.77:0.01. Antioxidant activity results showed that LMLP presented an EC 50 of 3.72mg/mL in scavenging 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical, and it also had reducing power (OD700nm being 0.079 at 1mg/mL). Moreover, LMLP possessed the potential on stimulating immune response of RAW264.7 cells. It could promote proliferation, strengthen phagocytosis function, enhance the expression of CD80, and increase the secretion of nitric oxide (NO) in a dose-dependent manner. All of these results suggested that LMLP could be used as a natural ingredient for functional food. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Lepidium meyenii (Maca) reduces spermatogenic damage induced by a single dose of malathion in mice.

    Science.gov (United States)

    Bustos-Obregon, Eduardo; Yucra, Sandra; Gonzales, Gustavo F

    2005-03-01

    To observe the effect of the aqueous extract of hypocotyls of the plant Lepidium meyenii (Maca) on spermatogenic damage induced by the organophosphate insecticide malathion in mice. Mice were treated with 80 mg/kg of malathion in the presence or absence of an aqueous extract of Maca, which was orally administered 7, 14 or 21 days after injection of the malathion. Stages of the seminiferous epithelium were assessed by transillumination on days 0, 7, 14 and 21. The administration of Maca increased significantly the length of stage VIII on days 7, 14 and 21 of treatment compared with the controls. An increase in the length of stage IX occurred on day 14 of treatment. Malathion affected spermatogenesis by reducing the lengths of stage IX on day 7, stages VII and IX-XI on day 14 and a recovery of stages IX-XII on day 21. The magnitude of alteration in the length of stage IX produced by malathion was significantly reduced by Maca on days 7 and 14. The length of stage VIII was increased when Maca was administered to mice treated with malathion. Assessment of the relative length of stages of the seminiferous epithelium showed that Maca treatment resulted in rapid recovery of the effect of malathion. Maca enhances spermatogenesis following spermatogenic damage caused by the organophosphorous pesticide.

  17. Maca (Lepidium meyenii) for treatment of menopausal symptoms: A systematic review.

    Science.gov (United States)

    Lee, Myeong Soo; Shin, Byung-Cheul; Yang, Eun Jin; Lim, Hyun-Ja; Ernst, Edzard

    2011-11-01

    Maca (Lepidium meyenii), an Andean plant of the brassica (mustard) family has been used for centuries in the Andes as an adaptogenic plant to manage anemia, infertility and female hormone balance. The aim of this review was to assess the evidence for and against the effectiveness of the maca plant as a treatment for menopausal symptoms. We searched 17 databases from their inception up to June 2011 and included all randomized clinical trials (RCTs) that compared any type of maca-based intervention to a placebo for the treatment of menopausal symptoms. All studies were assessed for methodological quality using the Cochrane 'risk of bias' assessment tool. Four RCTs met all inclusion criteria. These RCTs tested the effects of maca on menopausal symptoms in healthy perimenopausal, early postmenopausal, and late postmenopausal women. Using the Kupperman Menopausal Index and the Greene Climacteric Score, all RCTs demonstrated favorable effects of maca. There have been very few rigorous trials of maca for menopausal symptoms. The results of our systematic review provide limited evidence for the effectiveness of maca as a treatment for menopausal symptoms. However, the total number of trials, the total sample size, and the average methodological quality of the primary studies, were too limited to draw firm conclusions. Furthermore, the safety has not been proved yet. Therefore, the efficacy and safety should be tested in larger studies. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  18. Effects of different varieties of Maca (Lepidium meyenii) on bone structure in ovariectomized rats.

    Science.gov (United States)

    Gonzales, Carla; Cárdenas-Valencia, Isaias; Leiva-Revilla, Johanna; Anza-Ramirez, Cecilia; Rubio, Julio; Gonzales, Gustavo F

    2010-01-01

    This study was designed to determine the effect of different varieties of maca (Lepidium meyenii) on bone structure in ovariectomized (OVX) rats. 36 female rats were randomly divided into 6 groups: sham and OVX rats treated with vehicle, estradiol (40 microg/kg), black, yellow or red maca (63 mg/ml) for 4 weeks. At the end of the treatment, uterine weight, femoral bone and lumbar vertebra histomorphology were assessed. Ovariectomy reduced weight, diameter and width of the femoral bone. Estradiol, black and red maca treatment reduced the effect of ovariectomy on these variables. Histological analyses revealed that estradiol, black and red maca treatments reversed the effect of ovariectomy by increasing the trabecular bone area in the second lumbar vertebra. Uterine weight was reduced in OVX rats, and estradiol but neither black nor red maca increased uterine weight. Red and black maca have protective effects on bone architecture in OVX rats without showing estrogenic effects on uterine weight. 2010 S. Karger AG, Basel.

  19. [Determination of benzyl glucosinolate in Lepidium meyenii from different regions by HPLC].

    Science.gov (United States)

    Tang, Lin; Yin, Hong-jun; Si, Cong-cong; Hu, Xiao-yan; Long, Zheng-hai

    2015-12-01

    The content of benzyl isothiocyanate (BITC) which as the enzymatic hydrolysis product of benzyl glucosinolate through thioglucosidase was determined by HPLC. The content of benzyl isothiocyanate (BITC) which as the enzymatic hydrolysis product of benzyl glucosinolate through thioglucosidase was determined by HPLC. The chromatography condition was as follows: Kaseisorb LC ODS 2000 (4.6 mm x 150 mm, 5 min) column with the mobile phase of acetonitrile(A)-water( B) under gradient elution (0-5 min, 3%-8% A; 5-9 min, 8%-48% A; 9-23 min, 48%-62% A; 23-28 min, 62%-99% A); the flow rate was 1.0 mL x min(-1) with 10 microL injection volume; detection wavelength was 246 nm and temperature of column was 40 degrees C. The content of benzyl glucosinolate was in the range of 10.76-17.91 g x L(-1). The method is simple, accurate and good reproducibility which can be used for the determination of benzyl glucosinolate in Lepidium meyenii, effectively.

  20. The use of maca (Lepidium meyenii) to improve semen quality: A systematic review.

    Science.gov (United States)

    Lee, Myeong Soo; Lee, Hye Won; You, Sooseong; Ha, Ki-Tae

    2016-10-01

    The aim of this review was to assess the evidence for the effectiveness of maca (Lepidium meyenii) in improving semen quality. We searched 11 databases from their inception to March 2016 and included all clinical trials on the improvement of semen quality parameters in infertile and healthy men, regardless of the study design or the type of maca. The risk of bias for each study was assessed using the Cochrane criteria. The selection of studies, data extraction, and validation were performed independently by the first two authors. Discrepancies were resolved through discussion by the same two authors. Five studies - 3 randomized clinical trials (RCTs) and 2 uncontrolled observational studies (UOSs) - met all of the inclusion criteria. One RCT found favorable effects of maca on sperm mobility in infertile men. The two other RCTs showed positive effects of maca on several semen quality parameters in healthy men. The two UOSs also suggested favorable effects of maca on semen quality. The results of our systematic review provide suggestive evidence for the effectiveness of maca in improving semen quality. However, the total number of trials, the total sample size, and the risk of bias of the included studies prevent the drawing firm conclusions. More rigorous studies are warranted. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Anti-fatigue activity of polysaccharide fractions from Lepidium meyenii Walp. (maca).

    Science.gov (United States)

    Li, Jing; Sun, Qingrui; Meng, Qingran; Wang, Lei; Xiong, Wentao; Zhang, Lianfu

    2017-02-01

    The two fractions of polysaccharide MPS-1 and MPS-2 were extracted from Lepidium meyenii Walp. (maca) by water, and purified using a DEAE-52 and a Sephadex G-100 column. The molecular weight (M W ) of MPS-1 was 7.6kDa, and the M W of MPS-2 was 6.7kDa. The MPS-1 was composed of xylose, arabinose, galactose and glucose, with the mole ratio 1:1.7:3.3:30.5; the MPS-2 was composed of arabinose, galactose and glucose, with the mole ratio 1:1.3:36.8. The IR spectrum implied that only α-pyranose existed in MPS-1, and both α-pyranose and β-pyranose existed in MPS-2. The anti-fatigue activities of MPS-1 and MPS-2 were measured by the forced swimming test, along with the determination of blood lactate (BLA), urea nitrogen (BUN), lactic dehydrogenase (LDH) activity and liver glycogen (LG). The results indicated that both MPS-1 and MPS-2 presented dose-dependently positive effects on the fatigue related parameters. Additionally, MPS-2 has a better anti-fatigue effect than MPS-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Effects on starch and amylolytic enzymes during Lepidium meyenii Walpers root storage.

    Science.gov (United States)

    Rondán-Sanabria, Gerby Giovanna; Valcarcel-Yamani, Beatriz; Finardi-Filho, Flavio

    2012-10-01

    The high water content in maca (Lepidium meyenii W.) roots combined with the damage produced during or after harvest makes them vulnerable to attack by enzymes and microorganisms. Although starch degradation has been extensively studied, in maca roots there is a paucity of research regarding the starch reserves. In this paper, parameters of starch degradation are shown to be related to the action of amylolytic enzymes during storage at room temperature. Over the course of three weeks, the starch and protein content, soluble sugar, total amylolytic activity, and α- and β-amylase activity were measured. In addition, the integrity of starch granules was observed by scanning electron microscopy. Despite the evidence of dehydration, there were no significant differences (p ≤ 0.5) in the total starch content or in the activities of α- and β-amylase. After the third week the roots remained suitable for consumption. The results indicate a postharvest latency that can lead to sprout or to senescence, depending on the environmental conditions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Effect of ethanolic extract of Lepidium meyenii Walp on serum hormone levels in ovariectomized rats.

    Science.gov (United States)

    Zhang, Yongzhong; Yu, Longjiang; Jin, Wenwen; Ao, Mingzhang

    2014-01-01

    To evaluate the effect of long-term ethanol extract of Lepidium meyenii (Maca) on serum hormone levels in ovariectomized (OVX) rats and compare them with the effect of diethylstilbestrol. Fifty female Sprague-Dawley rats were ovariectomized or sham operated. Both sham and OVX control groups (n = 10, respectively) received the vehicle. The remaining OVX rats were oral administrated with ethanol extract of Maca (0.096, or 0.24g/kg; n = 10, respectively) and diethylstilbestrol (0.05 mg/kg; n = 10). The treatment continued for 28 weeks. At week 12 and week 28, the blood of rats was collected and serum hormone levels, including estradiol (E2), testosterone (T) and follicle-stimulating hormone (FSH) were measured by radioimmunoassay. At week 12, the levels of serum E2 were slightly higher in Maca groups than that in OVX group; T levels were significantly decreased; and FSH levels were advanced slightly in Maca groups than that in sham group. After 28 weeks administration, serum E2 levels in Maca-treated animals did not differ significantly from sham control, the low dose of Maca increased serum E2 levels, and Maca prevented increase in serum FSH levels compared with OVX group. Long-term Maca supply modulates endocrine hormone balance in OVX rats, especially it decreases enhanced FSH levels. It is proposed that Maca may become a potential choice for postmenopausal women.

  4. Structure analysis and anti-fatigue activity of a polysaccharide from Lepidium meyenii Walp.

    Science.gov (United States)

    Tang, Yun; Zhu, Zhen-Yuan; Pan, Li-Chao; Sun, Huiqing; Song, Qiao-Ying; Zhang, Yongmin

    2018-03-16

    A polysaccharide was obtained from Lepidium meyenii Walp by hot water extraction and purification by Millipore (100 kD) and Sephadex G-200. The content of polysaccharide was examined to be 89.9% with phenol-sulfuric acid method. Its average molecular weight was estimated to be 2.213 × 10 6  Da by High Performance Gel Permeation Chromatography (HPGPC). Monosaccharide analysis showed that the polysaccharide was composed of arabinose, mannose, glucose and galactose with the molar ratio of 2.134: 1: 2.78: 2.82. After Smith degradation, methylation, infrared spectroscopy and NMR, the primary structure of the polysaccharide was identified. The backbone of the polysaccharide was composed of →4)-β-D-Galp-(1→ and →4)-α-D-Galp-(1→, while the branches were comprised of →6)-β-D-Glup-(1→, →5)- β-D-Araf-(1→, →3,6)-α-D-Manp-(1→, →3)-α-D-Galp-(1→, and α-D-Glup-(1→. The anti-fatigue effect of the polysaccharide was evaluated using exhaustive swimming test and biochemical indexes. The results indicated the polysaccharide has anti-fatigue effect.

  5. Metabolomic differentiation of maca (Lepidium meyenii) accessions cultivated under different conditions using NMR and chemometric analysis.

    Science.gov (United States)

    Zhao, Jianping; Avula, Bharathi; Chan, Michael; Clément, Céline; Kreuzer, Michael; Khan, Ikhlas A

    2012-01-01

    To gain insights on the effects of color type, cultivation history, and growing site on the composition alterations of maca (Lepidium meyenii Walpers) hypocotyls, NMR profiling combined with chemometric analysis was applied to investigate the metabolite variability in different maca accessions. Maca hypocotyls with different colors (yellow, pink, violet, and lead-colored) cultivated at different geographic sites and different areas were examined for differences in metabolite expression. Differentiations of the maca accessions grown under the different cultivation conditions were determined by principle component analyses (PCAs) which were performed on the datasets derived from their ¹H NMR spectra. A total of 16 metabolites were identified by NMR analysis, and the changes in metabolite levels in relation to the color types and growing conditions of maca hypocotyls were evaluated using univariate statistical analysis. In addition, the changes of the correlation pattern among the metabolites identified in the maca accessions planted at the two different sites were examined. The results from both multivariate and univariate analysis indicated that the planting site was the major determining factor with regards to metabolite variations in maca hypocotyls, while the color of maca accession seems to be of minor importance in this respect. © Georg Thieme Verlag KG Stuttgart · New York.

  6. Isolation, purification, structural characterization and immunostimulatory activity of water-soluble polysaccharides from Lepidium meyenii.

    Science.gov (United States)

    Zha, Zhengqi; Wang, Su-Yan; Chu, Weihua; Lv, Yang; Kan, Hongjin; Chen, Qiuli; Zhong, Lili; Yue, Long; Xiao, Jinna; Wang, Ying; Yin, Hongping

    2018-03-01

    A water-soluble polysaccharide LMP-1 was isolated and purified by ion-exchange chromatography from maca (Lepidium meyenii Walp.). LMP-1 has a molecular weight of 1.01 × 10 4  Da, and is composed of glucose and arabinose with a molar ratio of 7.03:1.08. Methylation and the 1D and 2D NMR spectroscopy of LMP-1 revealed that it is mainly composed of →4)-α-D-Glcp-(1→, →6)-α-D-Glcp-(1→, →3)-α-D-Glcp-(1→, and β-D-Araf-(1→, with branching at O-6 of →4,6)-α-D-Glcp-(1 → . LMP-1 showed up-regulation of Toll-like receptor 4 (TLR4) and Toll-like receptor 2 (TLR2). The upstream proteins of Toll-like receptors (TLRs) (CD14 and MD2) and mRNA level of IL-1β also increased. Increased transcription factor nuclear factor-kappa B (NF-κB) p65 was found in the nuclei and cytoplasm in LMP-1-treated RAW264.7 macrophages. These results indicated that LMP-1 activated RAW264.7 macrophages and elicited immunostimulatory activities via the TLRs/NF-κB signalling pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Production of a new mucilage compound in Lepidium sativum callus by optimizing in vitro growth conditions.

    Science.gov (United States)

    Golkar, Pooran; Hadian, Fatemeh; Koohi Dehkordi, Mehrana

    2018-02-15

    The mucilage in Lepidium sativum L. is considered a biologically active compound with diverse medicinal properties. Different explants (hypocotyls and leaf) were transferred to Murashige and Skoog (MS) medium supplemented with twelve different plant growth regulator combinations under two different incubations (light and dark). The best mucilage production from callus (36.76% g g -1 dry weight) was obtained in the MS medium supplemented with 1 mg L -1 of 2, 4-D and 2 mg L -1 of BAP under the light condition. The mucilage produced by callus culture was nearly three times more than the mucilage yield of the seeds. The glucose, arabinose + mannose and galactose were 43.4 (mg g -1 DW), 195.3 (mg g -1 DW) and 86.2 (mg g -1 DW) in the mucilage originated from seed, callus leaf and callus hypocotyl, respectively. The present study proposes an efficient method for producing large scales of mucilage with a favorable sugar aimed at food or pharmaceutical industries.

  8. New Insight into the Water-Soluble Chlorophyll-Binding Protein from Lepidium virginicum.

    Science.gov (United States)

    Kell, Adam; Bednarczyk, Dominika; Acharya, Khem; Chen, Jinhai; Noy, Dror; Jankowiak, Ryszard

    2016-05-01

    This study describes new recombinant water-soluble chlorophyll (Chl)-binding proteins (WSCP) from Lepidium virginicum (LvWSCP). This complex binds four Chls (i.e. two dimers of Chls) per protein tetramer. We show that absorption, emission, hole-burned (HB) spectra and the shape of the zero-phonon hole (ZPH) action spectrum are consistent with the presence of uncorrelated excitation energy transfer between two Chl dimers. Thus, there is no need to include slow protein relaxation within the lowest excited state (as suggested in a previous analysis of cauliflower WSCP [Schmitt, F.-J. et al. (2008) J. Phys. Chem. B, 112, 13951; Pieper, J. et al. (2011) J. Phys. Chem. B, 115, 4053]) in order to explain the large shift observed between the maxima of the ZPH action and emission spectra. Experimental evidence is provided which shows that electron exchange between lowest energy Chls and the protein may occur, i.e. electrons can be trapped at low temperature by nearby aromatic amino acids. The latter explains the shape of nonresonant HB spectra (i.e. the absence of antihole), demonstrating that the hole-burning process in LvWSCP is largely photochemical in nature, though a small contribution from nonphotochemical hole burning (in resonant holes) is also observed. © 2016 The American Society of Photobiology.

  9. Chemical, physicochemical and spectrophotometric properties of crystalline chlorophyll-protein complexes from Lepidium virginicum L.

    Science.gov (United States)

    Murata, T; Ishikawa, C

    1981-04-13

    Two kinds of water-soluble chlorophyll-protein complexes were prepared from leaves of Lepidium virginicum L., one (CP661) from the plant cultivated in a green house from seeds collected near Mono Lake, CA, and the other (CP-663) from a plant collected at Narashino, Chiba, Japan, by ammonium sulfate fractionation followed by column chromatography on DEAE-cellulose and Sephacryl S-200. The chlorophyll . proteins were further purified by crystallization. CP661 has absorption peaks at 661, 468, 439, 419, 380, 339 and 272 nm. CP663 had absorption peaks at 663, 469, 438, 419, 379, 338 and 272 nm. Estimated molecular weights were 78 000 for CP661 and 80 000 for CP663 by gel filtration chromatography and 83 000 for CP661 and 107 000 for CP663 by an equilibrium sedimentation method. 1 mol chlorophyll . protein contained 4 mol chlorophyll a and b with ratios of 1.0 in CP661 and 1.6 to 1.9 in CP663, but no carotenoids. These characters are different from those of chlorophyll-protein complexes which are prepared from the thylakoid membranes of chloroplasts with detergents.

  10. Effect of salinity and ascorbic acid on growth, water and osmotic relations of Lepidium sativum

    Directory of Open Access Journals (Sweden)

    Azadeh Najjar-Khodabakhsh

    2015-06-01

    Full Text Available Soil salinity is a serious environmental problem in arid and semi-arid regions that have negative impacts on crop production. In this research, because of medicinal and nutritional importance of the garden cress (Lepidium sativum plant, the interactive effects of salinity (225 mM NaCl and ascorbic acid (1 mM were evaluated on growth and its water relations. A completely randomized design with four replications was conducted under controlled conditions. The results showed that salinity decreased growth, relative water content, osmotic potential and soluble proteins and increased soluble sugars, amino acids and proline contents. Many of salinity damaged characteristic were improved by adding exogenous ascorbic acid to salty environment. Exogenous ascorbic acid alone, in comparison with control, enhanced the growth of garden cress by increasing relative water content, soluble sugars and soluble proteins contents. The results indicated that usage of ascorbic acid, as an antioxidant, reduced harmful effects of salinity stress and led to growth improvement in garden cress plants.

  11. Isolation, purification and antioxidant activity of polysaccharides from the leaves of maca (Lepidium Meyenii).

    Science.gov (United States)

    Caicai, Kang; Limin, Hao; Liming, Zhang; Zhiqiang, Zheng; Yongwu, Yang

    2018-02-01

    Two fractions of polysaccharides (MLP-1 and MLP-2) were extracted from the leaves of maca (Lepidium Meyenii Walp.) by water, and purified using DEAE-52 ion exchange resin and sephadex G-200 clumns chromatography. An investigation was carried out for their structural characterization and antioxidant activity in vitro. The results indicated that MLP-1 was mainly composed of ribose, rhamnose, arabinose, xylose, mannose, glucose and galactose, with the molar ratio of 0.12:0.32:1.50:0.32:1.03:1.00:0.93; the MLP-2 was a homopolysaccharide composed of glucose. The molecular weight (Mw) of MLP-1 was 42756Da, and the Mw of MLP-2 was 93541Da. The FT-IR spectra showed the general characteristic absorption peak of maca leaf polysaccharides (MLPs). The evaluation of antioxidant activity revealed that MLP-1 had strong scavenging effects in vitro on hydroxyl, superoxide anion and DPPH radicals, whose EC 50 (mg/mL) was 0.44, 0.21, and 0.82, respectively. Both MLP-1 and MLP-2 presented dose-dependently positive effects on the antioxidant-related parameters. The results suggested that the purified MLP-1 displayed better antioxidant capacities than that of MLP-1, which could be explored as potential antioxidant agents for the complementary medicine or functional foods. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Protein changes in Lepidium sativum L. exposed to Hg during soil phytoremediation.

    Science.gov (United States)

    Smolinska, Beata; Szczodrowska, Agnieszka; Leszczynska, Joanna

    2017-08-03

    Some investigations have been carried out in this study to find the best technique of soil reclamation in mercurypolluted soil. In this study, we examined Lepidium sativum L. as a plant useful for Hg phytoextraction. The simultaneous application of compost and thiosulfate was explored as a possible method of enhancing the process of phytoextraction. The results of the investigations of plant protein changes during assisted Hg phytoextraction were also provided. The results of the study show that combined use of compost and thiosulfate significantly increased both the total Hg accumulation and its translocation to aerial plant tissues. Plant protein analysis showed that L. sativum L. has the ability to respond to environmental stress condition by the activation of additional proteins. The additional proteins, like homocysteine methyltransferase, ribulose bisphosphate carboxylases (long and short chains), 14-3-3-like protein, and biosynthesis-related 40S ribosomal protein S15, were activated in plant shoots only in experiments carried out in Hg-polluted soil. There were no protein changes observed in plants exposed to compost and thiosulfate. It suggests that the combined use of compost and thiosulfate decreased Hg toxicity.

  13. Antioxidative response of Lepidium sativum L. during assisted phytoremediation of Hg contaminated soil.

    Science.gov (United States)

    Smolinska, Beata; Szczodrowska, Agnieszka

    2017-09-25

    In this study, Lepidium sativum L. was used in repeated phytoextraction processes to remove Hg from contaminated soil, assisted by combined use of compost and iodide (KI). L. sativum L. is sensitive to changes in environmental conditions and has been used in environmental tests. Its short vegetation period and ability to accumulate heavy metals make it suitable for use in repeated phytoextraction. The antioxidant enzymatic system of the plant (catalase (CAT), ascorbate peroxidase (APX), superoxide dismutase (SOD) and glutathione S-transferase (GST)) was analysed, to understand the effects of increasing Hg accumulation and translocation. Phytoextraction was repeated six times to decrease Hg contamination in soil, and the efficiency of each step was assessed. The results indicate that L. sativum L. is able to take up and accumulate Hg from contaminated soil. A corresponding increase in enzymatic antioxidants shows that the plant defence system is activated in response to Hg stress. Using compost and KI increases total Hg accumulation and translocation to the above-ground parts of L. sativum L. Repeating the process decreases Hg contamination in pot experiments in all variants of the process. The combined use of compost and KI during repeated phytoextraction increases the efficiency of Hg removal from contaminated soil. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Photosynthetic pigments and peroxidase activity of Lepidium sativum L. during assisted Hg phytoextraction.

    Science.gov (United States)

    Smolinska, Beata; Leszczynska, Joanna

    2017-05-01

    The study was conducted to evaluate metabolic answer of Lepidium sativum L. on Hg, compost, and citric acid during assisted phytoextraction. The chlorophyll a and b contents, total carotenoids, and activity of peroxidase were determined in plants exposed to Hg and soil amendments. Hg accumulation in plant shoots was also investigated. The pot experiments were provided in soil artificially contaminated by Hg and/or supplemented with compost and citric acid. Hg concentration in plant shoots and soil substrates was determined by cold vapor atomic absorption spectroscopy (CV-AAS) method after acid mineralization. The plant photosynthetic pigments and peroxidase activity were measured by standard spectrophotometric methods. The study shows that L. sativum L. accumulated Hg in its aerial tissues. An increase in Hg accumulation was noticed when soil was supplemented with compost and citric acid. Increasing Hg concentration in plant shoots was correlated with enhanced activation of peroxidase activity and changes in total carotenoid concentration. Combined use of compost and citric acid also decreased the chlorophyll a and b contents in plant leaves. Presented study reveals that L. sativum L. is capable of tolerating Hg and its use during phytoextraction assisted by combined use of compost and citric acid lead to decreasing soil contamination by Hg.

  15. Preliminary approach to detect amylolytic and pectinolytic activities from maca (Lepidium meyenii Walp.) Ensaios preliminares de detecção de atividades amilolítica e pectinolítica em maca (Lepidium meyenii Walp.)

    OpenAIRE

    Gerby Giovanna Rondan-Sanabria; Tatiana da Costa Raposo Pires; Flavio Finardi Filho

    2006-01-01

    Amylase (AM), pectinesterase (PE) and polygalacturonase (PG) were extracted from maca roots (Lepidium meyenii Walp). The response surface model was used to determine the optimum conditions of pH and temperature activity of each enzyme on the crude extract. The highest values of AM activity occurred at pH 6.1 and 33.6 °C, very close to the experimental central point. The PE activity had a maximum activity at pH 6.6 and 49.4 and PG activity showed optimum activity at pH 5.4 and 46 °C.O ...

  16. Isolation and sequence analysis of a chalcone synthase cDNA of Matthiola incana R. Br. (Brassicaceae).

    Science.gov (United States)

    Epping, B; Kittel, M; Ruhnau, B; Hemleben, V

    1990-06-01

    A cDNA clone (pcM12) of the chalcone synthase (CHS) of Matthiola incana R. Br. (Brassicaceae) was isolated from a cDNA library, sequenced and analysed. It comprises the complete coding sequence for the CHS and 5' and 3' untranslated regions. The deduced amino acid sequence shows that the Matthiola incana CHS consists of 394 amino acid residues. Comparison with CHS amino acid sequences of other plants indicates more than 82% homology.

  17. Divergence of annual and perennial species in the Brassicaceae and the contribution of cis-acting variation at FLC orthologues.

    Science.gov (United States)

    Kiefer, C; Severing, E; Karl, R; Bergonzi, S; Koch, M; Tresch, A; Coupland, G

    2017-07-01

    Variation in life history contributes to reproductive success in different environments. Divergence of annual and perennial angiosperm species is an extreme example that has occurred frequently. Perennials survive for several years and restrict the duration of reproduction by cycling between vegetative growth and flowering, whereas annuals live for 1 year and flower once. We used the tribe Arabideae (Brassicaceae) to study the divergence of seasonal flowering behaviour among annual and perennial species. In perennial Brassicaceae, orthologues of FLOWERING LOCUS C (FLC), a floral inhibitor in Arabidopsis thaliana, are repressed by winter cold and reactivated in spring conferring seasonal flowering patterns, whereas in annuals, they are stably repressed by cold. We isolated FLC orthologues from three annual and two perennial Arabis species and found that the duplicated structure of the A. alpina locus is not required for perenniality. The expression patterns of the genes differed between annuals and perennials, as observed among Arabidopsis species, suggesting a broad relevance of these patterns within the Brassicaceae. Also analysis of plants derived from an interspecies cross of A. alpina and annual A. montbretiana demonstrated that cis-regulatory changes in FLC orthologues contribute to their different transcriptional patterns. Sequence comparisons of FLC orthologues from annuals and perennials in the tribes Arabideae and Camelineae identified two regulatory regions in the first intron whose sequence variation correlates with divergence of the annual and perennial expression patterns. Thus, we propose that related cis-acting changes in FLC orthologues occur independently in different tribes of the Brassicaceae during life history evolution. © 2017 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  18. Inheritance and expression patterns of BN28, a low temperature induced gene in Brassica napus, throughout the Brassicaceae.

    Science.gov (United States)

    Hawkins, G P; Nykiforuk, C L; Johnson-Flanagan, A M; Boothe, J G

    1996-08-01

    Molecular genetics is becoming an important tool in the breeding and selection of agronomically important traits. BN28 is a low temperature induced gene in Brassicaceae species. PCR and Southern blot analysis indicate that BN28 is polymorphic in the three diploid genomes: Brassica rapa (AA), Brassica nigra (BB), and Brassica oleracea (CC). Of the allotetraploids, Brassica napus (AACC) is the only species to have inherited homologous genes from both parental genomes. Brassica juncea (AABB) and Brassica carinata (BBCC) have inherited homologues from the AA and CC genomes, respectively, while Sinapsis arvensis (SS) contains a single homologue from the BB genome and Sinapsis alba (dd) appears to be different from all the diploid parents. All species show message induction when exposed to low temperature. However, differences in expression were noticed at the protein level, with silencing occurring in the BB genome at the level of translation. Results suggest that silencing is occurring in diploid species where duplication may not have occurred. Molecular characterization and inheritance of BN28 homologues in the Brassicaceae may play an important role in determining their quantitative function during exposure to low temperature. Key words : Brassicaceae, BN28, inheritance, polymorphism.

  19. CrusView: A Java-Based Visualization Platform for Comparative Genomics Analyses in Brassicaceae Species[OPEN

    Science.gov (United States)

    Chen, Hao; Wang, Xiangfeng

    2013-01-01

    In plants and animals, chromosomal breakage and fusion events based on conserved syntenic genomic blocks lead to conserved patterns of karyotype evolution among species of the same family. However, karyotype information has not been well utilized in genomic comparison studies. We present CrusView, a Java-based bioinformatic application utilizing Standard Widget Toolkit/Swing graphics libraries and a SQLite database for performing visualized analyses of comparative genomics data in Brassicaceae (crucifer) plants. Compared with similar software and databases, one of the unique features of CrusView is its integration of karyotype information when comparing two genomes. This feature allows users to perform karyotype-based genome assembly and karyotype-assisted genome synteny analyses with preset karyotype patterns of the Brassicaceae genomes. Additionally, CrusView is a local program, which gives its users high flexibility when analyzing unpublished genomes and allows users to upload self-defined genomic information so that they can visually study the associations between genome structural variations and genetic elements, including chromosomal rearrangements, genomic macrosynteny, gene families, high-frequency recombination sites, and tandem and segmental duplications between related species. This tool will greatly facilitate karyotype, chromosome, and genome evolution studies using visualized comparative genomics approaches in Brassicaceae species. CrusView is freely available at http://www.cmbb.arizona.edu/CrusView/. PMID:23898041

  20. Evaulation of perennial pepperweed (Lepidium latifolium) management in a seasonal wetland in San Francisco Estuary prior to restoration of tidal hydrology

    Science.gov (United States)

    Herbicide applications have shown potential for control and management of invasive perennial pepperweed (Lepidium latifolium) in rangelands and tidal wetlands. However, reported efficacy of management methods varies widely, and the effects of more recently labeled aquatic herbicides on non-target ve...

  1. Preliminary approach to detect amylolytic and pectinolytic activities from maca (Lepidium meyenii Walp. Ensaios preliminares de detecção de atividades amilolítica e pectinolítica em maca (Lepidium meyenii Walp.

    Directory of Open Access Journals (Sweden)

    Gerby Giovanna Rondan-Sanabria

    2006-03-01

    Full Text Available Amylase (AM, pectinesterase (PE and polygalacturonase (PG were extracted from maca roots (Lepidium meyenii Walp. The response surface model was used to determine the optimum conditions of pH and temperature activity of each enzyme on the crude extract. The highest values of AM activity occurred at pH 6.1 and 33.6 °C, very close to the experimental central point. The PE activity had a maximum activity at pH 6.6 and 49.4 and PG activity showed optimum activity at pH 5.4 and 46 °C.O objetivo do presente estudo foi determinar valores ideais de pH e temperatura para avaliar as atividades amilolítica (AM, pectinesterásica (PE e poligalacturonásica (PG em raízes de maca (Lepidium meyenii Walp.. Foi utilizado o modelo de superfície de resposta para atingir valores confiáveis de atividades enzimáticas em extratos brutos. Os valores máximos de atividade AM ocorreram em pH 6,1 a 33,6 °C, muito próximos do ponto central dos experimentos. Para as atividades de PE e PG, o valores ótimos foram atingidos em pHs 6,6 e 5,4, a 49,4 e 46 °C, respectivamente.

  2. Is the hype around the reproductive health claims of maca (Lepidium meyenii Walp.) justified?

    Science.gov (United States)

    Beharry, Shruti; Heinrich, Michael

    2018-01-30

    Maca - Lepidium meyenii Walp. has been cultivated and used by Andean people for over 1300-2000 years in Peru as food and medicine. Starting in the late 1990's it has developed into an important herbal medicine in China and is now cultivated there widely, too AIM OF STUDY: This study aims to provide an insight into the emergence of maca on the global market as an alternative remedy to treat reproductive health related problems in both men and women and to critically assess these health claims. A search of electronic databases such as EMBASE and a hand-search was done to acquire peer-reviewed articles and reports about maca. Lepidium meyenii is used traditionally as a tonic, fertility enhancer for both humans and cattle, and to treat a variety of ailments such as rheumatism, respiratory disorders and anaemia among others. Maca root is cooked, baked, fermented as a drink and made into porridge. In the last twenty years, maca was introduced onto the global market and demand has dramatically grown over this time with its promotion on the internet, as the 'Peruvian Ginseng' for libido and fertility enhancement. It has also been said to treat menopausal symptoms, erectile dysfunction and benign prostatic hyperplasia. The sky-rocketing demand for the plant has seen a shift from traditional cultivation methods to mass production practices with the use of fertilisers and also pesticides; as maca is now grown in areas other than the Andes such as in the Yunnan province in China. This can potentially affect the phytochemistry and composition of the plant and thus, the quality, safety and efficacy of maca products. Meanwhile, research into maca's medicinal properties has followed the spike in popularity of maca and has been focused mainly on maca's aphrodisiac and fertility enhancing properties. So far, the in vivo studies and clinical trials conducted have yielded inconclusive results. Some of the key limitations reside in methodology and sample size. Chemical profiling, led

  3. Lepidium meyenii (Maca increases litter size in normal adult female mice

    Directory of Open Access Journals (Sweden)

    Gasco Manuel

    2005-05-01

    Full Text Available Abstract Background Lepidium meyenii, known as Maca, grows exclusively in the Peruvian Andes over 4000 m altitude. It has been used traditionally to increase fertility. Previous scientific studies have demonstrated that Maca increases spermatogenesis and epididymal sperm count. The present study was aimed to investigate the effects of Maca on several fertility parameters of female mice at reproductive age. Methods Adult female Balb/C mice were divided at random into three main groups: i Reproductive indexes group, ii Implantation sites group and iii Assessment of uterine weight in ovariectomized mice. Animals received an aqueous extract of lyophilized Yellow Maca (1 g/Kg BW or vehicle orally as treatment. In the fertility indexes study, animals received the treatment before, during and after gestation. The fertility index, gestation index, post-natal viability index, weaning viability index and sex ratio were calculated. Sexual maturation was evaluated in the female pups by the vaginal opening (VO day. In the implantation study, females were checked for implantation sites at gestation day 7 and the embryos were counted. In ovariectomized mice, the uterine weight was recorded at the end of treatment. Results Implantation sites were similar in mice treated with Maca and in controls. All reproductive indexes were similar in both groups of treatment. The number of pups per dam at birth and at postnatal day 4 was significantly higher in the group treated with Maca. VO day occurred earlier as litter size was smaller. Maca did not affect VO day. In ovariectomized mice, the treatment with Maca increased significantly the uterine weights in comparison to their respective control group. Conclusion Administration of aqueous extract of Yellow Maca to adult female mice increases the litter size. Moreover, this treatment increases the uterine weight in ovariectomized animals. Our study confirms for the first time some of the traditional uses of Maca to

  4. Structural Characterization and Antifatigue Effect In Vivo of Maca (Lepidium meyenii Walp) Polysaccharide.

    Science.gov (United States)

    Tang, Weimin; Jin, Lu; Xie, Lianghua; Huang, Juqing; Wang, Nan; Chu, Bingquan; Dai, Xulin; Liu, Yu; Wang, Rui; Zhang, Ying

    2017-03-01

    Maca (Lepidium meyenii Walp) polysaccharides (MP) with purity of 99.2% were obtained to investigate their structural characteristics and antifatigue effect in vivo. The physicochemical properties of MP were analyzed through high-performance gel filtration chromatography, IR, monosaccharide composition, methylation, GC-MS, and NMR analyses. The antifatigue effect of MP was evaluated by using a mouse weight-loaded swimming model. MP is an acidic heteropolysaccharide with an average molecular weight (M w ) of 793.5 kDa. It is composed of D-GalA: D-Glc: L-Ara: D-Man: D-Gal: L-Rha = 35.07:29.98:16.98:13.01:4.21:0.75 (mol, %). The findings revealed that MP contained β-1,3-Galp(A), β-1,3-Glcp, and α-1, 3-Manp linked alternatingly to form a backbone (5:4:1). MP (above mid-dosage 50 mg/kg bw/d) could effectively elongate swimming durations and accelerate average swimming speeds (within the 1st 5 min) of mice (P < 0.05) and improve the serous biochemical parameters of mice. Compared with the control model, high-dosage (100 mg/kg bw/d) MP treatment could significantly enhance glutathione peroxidase and creatine kinase activities (P < 0.05) and decreased lactate dehydrogenase activity (P < 0.01). High-dosage MP could significantly reduce the levels of blood urea nitrogen, lactic acid, and malondialdehyde (P < 0.05). MP is an acidic polysaccharide with a high D-GalA content, which could be responsible for the antifatigue effect of maca. © 2017 Institute of Food Technologists®.

  5. Effect of Black maca (Lepidium meyenii) on one spermatogenic cycle in rats.

    Science.gov (United States)

    Gonzales, G F; Nieto, J; Rubio, J; Gasco, M

    2006-10-01

    Lepidium meyenii (Maca) grows exclusively between 4000 and 4500 m above sea level in the Peruvian central Andes. The hypocotyls of this plant are traditionally used in the Andean region for their supposed fertility-enhancing properties. The hypocotyls have different colours. Of these, Black maca has better effects on spermatogenesis. The present study aimed to test the hypothesis that Black maca has early effects during a spermatogenic cycle (12 days) of male rats. For this, testicular spermatid, epididymal sperm and vas deferens sperm counts were measured after 1, 3, 5, 7 and 12 days of treatment with Black maca. Aqueous extract of Black maca was given orally by daily gavage at a dose of 2 g kg(-1). In a spermatogenic cycle, compared with day 1, daily sperm production (DSP) was lower at day 7 (control), whereas with Black maca, the difference was observed at day 12. Epididymal sperm count was higher in rats treated with Black maca at days 1, 3 and 7, but similar to controls at days 5 and 12; similarly sperm counts in vas deferens was higher in rats treated with Black maca in days 3, 5 and 7, but similar to controls at days 1 and 12. From this, it is suggested that first action of Black maca was at epididymal level increasing sperm count after 1 day of treatment, whereas an increase in sperm count was observed in vas deferens at day 3 of treatment. Finally, an increase in DSP was observed after 7 days of treatment with Black maca. Testicular testosterone was not affected after 7 days treatment with Black maca. In conclusion, Black maca affects sperm count as early as 1 day after beginning of treatment.

  6. Lepidium meyenii (Maca) increases litter size in normal adult female mice.

    Science.gov (United States)

    Ruiz-Luna, Ana C; Salazar, Stephanie; Aspajo, Norma J; Rubio, Julio; Gasco, Manuel; Gonzales, Gustavo F

    2005-05-03

    Lepidium meyenii, known as Maca, grows exclusively in the Peruvian Andes over 4000 m altitude. It has been used traditionally to increase fertility. Previous scientific studies have demonstrated that Maca increases spermatogenesis and epididymal sperm count. The present study was aimed to investigate the effects of Maca on several fertility parameters of female mice at reproductive age. Adult female Balb/C mice were divided at random into three main groups: i) Reproductive indexes group, ii) Implantation sites group and iii) Assessment of uterine weight in ovariectomized mice. Animals received an aqueous extract of lyophilized Yellow Maca (1 g/Kg BW) or vehicle orally as treatment. In the fertility indexes study, animals received the treatment before, during and after gestation. The fertility index, gestation index, post-natal viability index, weaning viability index and sex ratio were calculated. Sexual maturation was evaluated in the female pups by the vaginal opening (VO) day. In the implantation study, females were checked for implantation sites at gestation day 7 and the embryos were counted. In ovariectomized mice, the uterine weight was recorded at the end of treatment. Implantation sites were similar in mice treated with Maca and in controls. All reproductive indexes were similar in both groups of treatment. The number of pups per dam at birth and at postnatal day 4 was significantly higher in the group treated with Maca. VO day occurred earlier as litter size was smaller. Maca did not affect VO day. In ovariectomized mice, the treatment with Maca increased significantly the uterine weights in comparison to their respective control group. Administration of aqueous extract of Yellow Maca to adult female mice increases the litter size. Moreover, this treatment increases the uterine weight in ovariectomized animals. Our study confirms for the first time some of the traditional uses of Maca to enhance female fertility.

  7. Peruvian Maca (Lepidium peruvianum): (I) Phytochemical and Genetic Differences in Three Maca Phenotypes.

    Science.gov (United States)

    Meissner, Henry O; Mscisz, Alina; Mrozikiewicz, Mieczyslaw; Baraniak, Marek; Mielcarek, Sebastian; Kedzia, Bogdan; Piatkowska, Ewa; Jólkowska, Justyna; Pisulewski, Pawel

    2015-09-01

    Glucosinolates were previously reported as physiologically-important constituents present in Peruvian Maca (Lepidium peruvianum Chacon) and linked to various therapeutic functions of differently-colored Peruvian Maca hypocotyls. In two separate Trials, three colours of Maca hypocotyls "Black", "Red" and "Yellow" (termed "Maca phenotypes"), were selected from mixed crops of Peruvian Maca for laboratory studies as fresh and after being dried. Individual Maca phenotypes were cultivated in the highlands of the Peruvian Andes at 4,200m a.s.l. (Junin and Ninacaca). Glucosinolate levels, chromatographic HPLC profiles and DNA variability in the investigated Maca phenotypes are presented. Genotypic profiles were determined by the ISSR-PCR and RAPD techniques. Compared to the Black and Red phenotypes, the Yellow phenotype contained much lower Glucosinolate levels measured against Glucotropaeolin and m-methoxy-glucotropaeolin standards, and exhibited different RAPD and ISSR-PCR reactions. The Red Maca phenotype showed the highest concentrations of Glucosinolates as compared to the Black and Yellow Maca. It appears that the traditional system used by natives of the Peruvian Andean highlands in preparing Maca as a vegetable dish (boiling dried Maca after soaking in water), to supplement their daily meals, is as effective as laboratory methods - for extracting Glucosinolates, which are considered to be one of the key bioactive constituents responsible for therapeutic functions of Peruvian Maca phenotypes. It is reasonable to assume that the HPLC and DNA techniques combined, or separately, may assist in determining ID and "Fingerprints" identifying individual Peruvian Maca phenotypes, hence confirming the authenticity of marketable Maca products. The above assumptions warrant further laboratory testing.

  8. Lepidium meyenii (Maca) increases litter size in normal adult female mice

    Science.gov (United States)

    Ruiz-Luna, Ana C; Salazar, Stephanie; Aspajo, Norma J; Rubio, Julio; Gasco, Manuel; Gonzales, Gustavo F

    2005-01-01

    Background Lepidium meyenii, known as Maca, grows exclusively in the Peruvian Andes over 4000 m altitude. It has been used traditionally to increase fertility. Previous scientific studies have demonstrated that Maca increases spermatogenesis and epididymal sperm count. The present study was aimed to investigate the effects of Maca on several fertility parameters of female mice at reproductive age. Methods Adult female Balb/C mice were divided at random into three main groups: i) Reproductive indexes group, ii) Implantation sites group and iii) Assessment of uterine weight in ovariectomized mice. Animals received an aqueous extract of lyophilized Yellow Maca (1 g/Kg BW) or vehicle orally as treatment. In the fertility indexes study, animals received the treatment before, during and after gestation. The fertility index, gestation index, post-natal viability index, weaning viability index and sex ratio were calculated. Sexual maturation was evaluated in the female pups by the vaginal opening (VO) day. In the implantation study, females were checked for implantation sites at gestation day 7 and the embryos were counted. In ovariectomized mice, the uterine weight was recorded at the end of treatment. Results Implantation sites were similar in mice treated with Maca and in controls. All reproductive indexes were similar in both groups of treatment. The number of pups per dam at birth and at postnatal day 4 was significantly higher in the group treated with Maca. VO day occurred earlier as litter size was smaller. Maca did not affect VO day. In ovariectomized mice, the treatment with Maca increased significantly the uterine weights in comparison to their respective control group. Conclusion Administration of aqueous extract of Yellow Maca to adult female mice increases the litter size. Moreover, this treatment increases the uterine weight in ovariectomized animals. Our study confirms for the first time some of the traditional uses of Maca to enhance female fertility. PMID

  9. Uptake and phytotoxic effect of benzalkonium chlorides in Lepidium sativum and Lactuca sativa.

    Science.gov (United States)

    Khan, Adnan Hossain; Libby, Mark; Winnick, Daniel; Palmer, John; Sumarah, Mark; Ray, Madhumita B; Macfie, Sheila M

    2018-01-15

    Cationic surfactants such as benzalkonium chlorides (BACs) are used extensively as biocides in hospitals, food processing industries, and personal care products. BACs have the potential to reach the rooting zone of crop plants and BACs might thereby enter the food chain. The two most commonly used BACs, benzyl dimethyl dodecyl ammonium chloride (BDDA) and benzyl dimethyl tetradecyl ammonium chloride (BDTA), were tested in a hydroponic system to assess the uptake by and phytotoxicity to lettuce (Lactuca sativa L.) and garden cress (Lepidium sativum L.). Individually and in mixture, BACs at concentrations up to 100 mg L -1 did not affect germination; however, emergent seedlings were sensitive at 1 mg L -1 for lettuce and 5 mg L -1 for garden cress. After 12 d exposure to 0.25 mg L -1 BACs, plant dry weight was reduced by 68% for lettuce and 75% for garden cress, and symptoms of toxicity (necrosis, chlorosis, wilting, etc.) were visible. High performance liquid chromatography-mass spectroscopy analysis showed the presence of BACs in the roots and shoots of both plant species. Although no conclusive relationship was established between the concentrations of six macro- or six micro-nutrients, growth inhibition or BAC uptake, N and Mg concentrations in BAC-treated lettuce were 50% lower than that of control, indicating that BACs might induce nutrient deficiency. Although bioavailability of a compound in hydroponics is significantly higher than that in soil, these results confirm the potential of BACs to harm vascular plants. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Maca (Lepidium meyenii Walp, una revisión sobre sus propiedades biológicas

    Directory of Open Access Journals (Sweden)

    Gustavo F Gonzales

    Full Text Available La maca (Lepidium meyenii es una planta que crece sobre los 4000 metros de altitud en los Andes Centrales del Perú, presenta diferentes variedades de acuerdo al color de su hipocótilo. La presente revisión resume los resultados de estudios sobre los efectos de la maca en la función sexual, la espermatogénesis, la función reproductiva femenina, la memoria, la depresión y la ansiedad, como energizante y contra la hiperplasia benigna de próstata, osteoporosis y síndrome metabólico. Se discute también su efecto antienvejecimiento y la seguridad en su consumo. Se han demostrado diferencias en el efecto de las variedades negra, amarilla y roja de maca. La maca negra es la que mejores resultados presenta sobre la espermatogénesis, la memoria y contra la fatiga, mientras que la maca roja es la variedad que mejor revierte la hiperplasia benigna de próstata y la osteoporosis inducida experimentalmente. Además, la maca reduce los niveles de glucosa, y su consumo se relaciona con la reducción de la presión arterial y un mejor puntaje de salud. Estudios experimentales han demostrado que el consumo a corto como a largo plazo no muestra toxicidad tanto in vivo como in vitro. A pesar que los estudios experimentales han demostrado que la maca presenta diversos efectos benéficos, son necesarios más estudios clínicos para confirmar estos resultados

  11. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

    Directory of Open Access Journals (Sweden)

    Fauteux François

    2009-10-01

    Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

  12. Utilización de Lepidium Peruvianum Maca, como medio de cultivo para el crecimiento de Trypanosoma Cruzi

    Directory of Open Access Journals (Sweden)

    Charles Saldaña C

    2006-04-01

    Full Text Available Por sus características nutritivas de alto valor, se ensayó la posible utilidad del Lepidium peruvianum maca, como un medio para cultivar Trypanosoma cruzi. Bajo condiciones experimentales se procedió a incubar epimastigotes de T. cruzi en cuatro medios de cultivo bifásicos diferentes, a base de Lepidium peruvianum maca, los cuales fueron comparados con el medio de cultivo BHI como control. La incorporación de maca como medio de cultivo permitió el crecimiento de Trypanosoma cruzi; se determinó que el medio que contenía maca enriquecida con sangre entre los componentes sólidos y la infusión de maca en la fase líquida, presentó un mayor crecimiento (3,41 x 105 parásitos/mL con respecto a los otros medios de cultivo al quinto día (p<0,05.

  13. POT1-independent single-strand telomeric DNA binding activities in Brassicaceae.

    Science.gov (United States)

    Shakirov, Eugene V; McKnight, Thomas D; Shippen, Dorothy E

    2009-06-01

    Telomeres define the ends of linear eukaryotic chromosomes and are required for genome maintenance and continued cell proliferation. The extreme ends of telomeres terminate in a single-strand protrusion, termed the G-overhang, which, in vertebrates and fission yeast, is bound by evolutionarily conserved members of the POT1 (protection of telomeres) protein family. Unlike most other model organisms, the flowering plant Arabidopsis thaliana encodes two divergent POT1-like proteins. Here we show that the single-strand telomeric DNA binding activity present in A. thaliana nuclear extracts is not dependent on POT1a or POT1b proteins. Furthermore, in contrast to POT1 proteins from yeast and vertebrates, recombinant POT1a and POT1b proteins from A. thaliana, and from two additional Brassicaceae species, Arabidopsis lyrata and Brassica oleracea (cauliflower), fail to bind single-strand telomeric DNA in vitro under the conditions tested. Finally, although we detected four single-strand telomeric DNA binding activities in nuclear extracts from B. oleracea, partial purification and DNA cross-linking analysis of these complexes identified proteins that are smaller than the predicted sizes of BoPOT1a or BoPOT1b. Taken together, these data suggest that POT1 proteins are not the major single-strand telomeric DNA binding activities in A. thaliana and its close relatives, underscoring the remarkable functional divergence of POT1 proteins from plants and other eukaryotes.

  14. Essential Oil Composition of Endemic Arabis purpurea Sm. & Arabis cypria Holmboe (Brassicaceae) from Cyprus.

    Science.gov (United States)

    Polatoğlu, Kaan; Servi, Hüseyin; Özçınar, Özge; Nalbantsoy, Ayşe; Gücel, Salih

    2017-01-01

    There are very few reports on the phytochemistry of the Arabis L. (Brassicaceae) species in the literature. Here we present essential oil composition of aerial parts of two endemic Arabis species from Cyprus. The essential oils of Arabis purpurea Sm. and Arabis cypria Holmboe afforded very low oil yields (essential oil of A. purpurea that represent 82.75 ± 0.21 % (n = 3) of the oil. The major components of the oil were nonacosane 16.18 ± 0.13 %, heptacosane 14.91 ± 0.17 %, hexahydrofarnesyl acetone 12.44 ± 0.10 % and phytol 7.36 ± 0.10 % (n = 3). Forty three compounds were identified in the essential oil of A. cypria which represent 81.28 ± 1.55 % (n = 3) of the oil. The major components of the oil were nonacosane 20.25 ± 0.47 %, heptacosane 9.13 ± 1.88 %, hexahydrofarnesyl acetone 9.03 ± 0.44 % and 1-tetradecanol 4.38 ± 2.60 % (n = 3). To the best of our knowledge this is the first report on the essential oil compositions of these species.

  15. Convergent evolution of a complex fruit structure in the tribe Brassiceae (Brassicaceae).

    Science.gov (United States)

    Hall, Jocelyn C; Tisdale, Tracy E; Donohue, Kathleen; Wheeler, Andrew; Al-Yahya, Mohammed A; Kramer, Elena M

    2011-12-01

    Many angiosperms have fruit morphologies that result in seeds from the same plant having different dispersal capabilities. A prime example is found in the Brassiceae (Brassicaceae), which has many members with segmented or heteroarthrocarpic fruits. Since only 40% of the genera are heteroarthrocarpic, this tribe provides an opportunity to study the evolution of an ecologically significant novelty and its variants. We analyzed nuclear (PHYA) and plastid (matK) sequences from 66 accessions using maximum parsimony, maximum likelihood, and Bayesian inference approaches. The evolution of heteroarthrocarpy and its variants was evaluated using maximum parsimony and maximum likelihood ancestral state reconstructions. Although nuclear and plastid phylogenies are incongruent with each other, the following findings are consistent: (1) Cakile, Crambe, Vella, and Zilla lineages are monophyletic; (2) the Nigra lineage is not monophyletic; and (3) within the Cakile clade, Cakile, Didesmus, and Erucaria are paraphyletic. Despite differences in the matK and PHYA topologies at both deep and shallow nodes, similar patterns of morphological evolution emerge. Heteroarthrocarpy, a complex morphological trait, has evolved multiple times across the tribe. Moreover, there are convergent transitions in dehiscence capabilities and fruit disarticulation across the tribe. We present the first explicit analysis of fruit evolution within the Brassiceae, which exemplifies evolutionary lability. The repeated loss and gain of segment dehiscence and disarticulation suggests conservation in the genetic pathway controlling abscission with differential expression across taxa. This study provides a strong foundation for future studies of mechanisms underlying variation in dispersal capabilities of Brassiceae.

  16. Numerical taxonomy of the genus Matthiola (Brassicaceae in Northeast of Iran based on morphological traits

    Directory of Open Access Journals (Sweden)

    Mozhgan Rashid Taranloo

    2014-01-01

    Full Text Available The genus Matthiola R. BR. (Brassicaceae consists of 48 species in the Iranian plateau, of which only seven species are distributed in northeast of Iran. Six species erre collected from the region under study including M. afghanica, M. alyssifolia, M. chenopodiifolia, M. chorassanica, M. dumulosa and M. farinose. Two species, M. flavida and M. revoluta were recorded for the first time in this study. Some specimens of an unknown taxon entitled Matthiola sp. are also collected in the region and included in the present study. In this study, we tried to use a set of morphologically informative characters which could determine species boundaries and also provide appropriate identification key to the genus in the northeast of Iran. 71 morphological features including quantitative and qualitative were examined on 68 herbarium and field-collected accessions followed by statistical analyses. The results of the univariate analysis indicated that "presence/absence of trichome on the stem and leaf" and "presence/absence of glandular trichomes on the sepal and pedicel" did not significantly differentiate the species and they were excluded from the subsequent analysis. The results of multivariate analysis showed that the species under study were grouped within three groups. First group included specimens of the species M. alyssifolia, the species M. afghanica, M. chenopodiifolia, M. dumulosa, M. farinosa, M. flavida and Matthiola sp. were placed in second group and third group included specimens of the two species M. chorassanica and M. revoluta.

  17. Lead Tolerance and Accumulation in Hirschfeldia incana, a Mediterranean Brassicaceae from Metalliferous Mine Spoils

    Science.gov (United States)

    Auguy, Florence; Fahr, Mouna; Moulin, Patricia; Brugel, Anaïs; Laplaze, Laurent; Mzibri, Mohamed El; Filali-Maltouf, Abdelkarim; Doumas, Patrick; Smouni, Abdelaziz

    2013-01-01

    Lead is a heavy metal of particular concern with respect to environmental quality and health. The lack of plant species that accumulate and tolerate Pb is a limiting factor to understand the molecular mechanisms involved in Pb tolerance. In this study we identified Hirschfeldia incana, a Brassicaceae collected from metalliferous mine spoils in Morocco, as a Pb accumulator plant. H. incana exhibited high Pb accumulation in mine soils and in hydroponic cultures. Major Pb accumulation occurred in the roots and a part of Pb translocated from the roots to the shoots, even to the siliques. These findings demonstrated that H. incana is a Pb accumulator species. The expression of several candidate genes after Pb-exposure was measured by quantitative PCR and two of them, HiHMA4 and HiMT2a, coding respectively for a P1B-type ATPase and a metallothionein, were particularly induced by Pb-exposure in both roots and leaves. The functional characterization of HiHMA4 and HiMT2a was achieved using Arabidopsis T-DNA insertional mutants. Pb content and primary root growth analysis confirmed the role of these two genes in Pb tolerance and accumulation. H. incana could be considered as a good experimental model to identify genes involved in lead tolerance and accumulation in plants. PMID:23667449

  18. Effect of Lepidium meyenii (maca) on testicular function of mice with chemically and physically induced subfertility.

    Science.gov (United States)

    Valdivia Cuya, M; Yarasca De La Vega, K; Lévano Sánchez, G; Vásquez Cavero, J; Temoche García, H; Torres Torres, L; Cruz Ornetta, V

    2016-10-01

    The aim of this study was to evaluate the effect of Lepidium meyenii (maca) in chemically and physically subfertile mice. After 35 days, the following groups of mice were evaluated: control, sham, chemical subfertility, chemical subfertility-maca-supplemented, physical subfertility, physical subfertility-maca-supplemented and maca-supplemented only. Motility (32.36% ± 5.34%) and sperm count (44.4 ± 5.37 × 10(6) /ml) in the chemically and physically subfertile mice (11.81% ± 4.06%, 17.34 ± 13.07 × 10(6) /ml) decreased compared to the control (75.53% ± 2.97% and 57.4 ± 19.6 10(6) /ml) and sham (53.5% ± 7.86% and 58.4 ± 14.10 10(6) /ml). Maca was able to reverse the deleterious effect of motility (76.36 ± 1.97) as well as sperm count (53.5 ± 9.18 × 10(6) /ml) on chemical subfertility. In contrast, maca did not reverse the effects of induced physical subfertility nor motility (18.78% ± 14.41%) or sperm count (20.17 ± 11.20 × 10(6) /ml). The percentage of sperm DNA fragmentation in the physically subfertile mice increased (11.1% ± 19.29%) compared to the control (0.84% ± 0.85%). However, in the physically subfertile group, maca decreased sperm DNA fragmentation (2.29% ± 2.30%) closer to the sham (1.04% ± 0.62%) and the control (0.84% ± 0.85%). The group supplemented only with maca showed 0.54% ± 0.50% of spermatozoa with DNA fragmentation. Yet, the differences observed were statistically not significant. In conclusion, it appears that maca activates the cytochrome P450 system after chemically induced subfertility. However, it does not reverse the low mitochondrial membrane potential in spermatozoa compromised in the physical subfertility group. © 2016 Blackwell Verlag GmbH.

  19. The Nutritional Composition of Maca in Hypocotyls (Lepidium meyenii Walp. Cultivated in Different Regions of China

    Directory of Open Access Journals (Sweden)

    Longfei Chen

    2017-01-01

    Full Text Available Maca (Lepidium meyenii Walp. was introduced to China in the recent two decades. Proximate compositions and secondary metabolites in dried maca tuber powders of different cultivation areas and colour types were analyzed and compared in order to provide the scientific guideline for its application. Cultivation region significantly affects the compositions of maca. The protein content of maca ranged from 9.31% to 21.02% by dry basis of maca powders and Xiaopingba-Y, Yulong-Y, and Pamirs-Y have the higher protein contents. The essential amino acids (EAA contents ranged from 189.19 to 312.90 mg/g protein. The crude lipid content of different maca ranged from 0.59% to 1.00% and has no significant difference (P>0.05. The total dietary fiber (TDF contents ranged from 17.82% to 26.00% and soluble dietary fiber (SDF ranged from 2.46% to 7.88%, respectively. Maca samples were rich in Na, Mg, Ca, and K elements which ranged 138.3–187.8, 625.2–837.2, 3838.9–4502.7, and 5394.8–8063.3 mg/kg dry matter (DM. Xiaopingba-Y has the highest benzyl glucosinolate content which was 2.31 mg/g DM. Peru-Y and Xiaopingba have the higher contents of total alkaloids contents which was 2.61 and 2.56 mg/kg DM. Yongsheng-Y, Yulong-Y, and Pamirs-Y were rich in N-benzyl hexadecanamide contents, which were 0.164, 0.174, and 0.173 mg/g DM, respectively. Significant higher protein, total dietary fiber, insoluble dietary fiber, total alkaloids, and benzyl glucosinolate contents were found in purple and black maca compared to yellow maca in Pamirs, while there was no significant difference in N-benzyl hexadecanamide content.

  20. Divergence of regulatory networks governed by the orthologous transcription factors FLC and PEP1 in Brassicaceae species.

    Science.gov (United States)

    Mateos, Julieta L; Tilmes, Vicky; Madrigal, Pedro; Severing, Edouard; Richter, René; Rijkenberg, Colin W M; Krajewski, Paweł; Coupland, George

    2017-12-19

    Genome-wide landscapes of transcription factor (TF) binding sites (BSs) diverge during evolution, conferring species-specific transcriptional patterns. The rate of divergence varies in different metazoan lineages but has not been widely studied in plants. We identified the BSs and assessed the effects on transcription of FLOWERING LOCUS C (FLC) and PERPETUAL FLOWERING 1 (PEP1), two orthologous MADS-box TFs that repress flowering and confer vernalization requirement in the Brassicaceae species Arabidopsis thaliana and Arabis alpina , respectively. We found that only 14% of their BSs were conserved in both species and that these contained a CArG-box that is recognized by MADS-box TFs. The CArG-box consensus at conserved BSs was extended compared with the core motif. By contrast, species-specific BSs usually lacked the CArG-box in the other species. Flowering-time genes were highly overrepresented among conserved targets, and their CArG-boxes were widely conserved among Brassicaceae species. Cold-regulated (COR) genes were also overrepresented among targets, but the cognate BSs and the identity of the regulated genes were usually different in each species. In cold, COR gene transcript levels were increased in flc and pep1-1 mutants compared with WT, and this correlated with reduced growth in pep1-1 Therefore, FLC orthologs regulate a set of conserved target genes mainly involved in reproductive development and were later independently recruited to modulate stress responses in different Brassicaceae lineages. Analysis of TF BSs in these lineages thus distinguishes widely conserved targets representing the core function of the TF from those that were recruited later in evolution. Copyright © 2017 the Author(s). Published by PNAS.

  1. The seed dispersal catapult of Cardamine parviflora (Brassicaceae) is efficient but unreliable.

    Science.gov (United States)

    Hayashi, Marika; Gerry, Shannon P; Ellerby, David J

    2010-10-01

    Seed dispersal performance is an essential component of plant fitness. Despite their significance in shaping performance, the mechanical processes that drive dispersal are poorly understood. We have quantified seed dispersal mechanics in Cardamine parviflora (Brassicaceae), a ballistic disperser that launches seeds with specialized catapult-like structures. To determine which aspects of catapult function dictate interspecific dispersal differences, we compared this disperser with other ballistic dispersers. Comparison with brassicas that lack ballistic dispersal may also provide insight into the evolution of this mechanism. • Catapult performance was quantified using high-speed video analysis of dehiscence, ballistic modeling of seed trajectories, and measuring the mechanical energy storage capacity of the spring-like siliqua valve tissue that launched the seeds. • The siliquae valves coiled rapidly outward, launching the seeds in 4.7 ± 1.3 ms (mean ± SD, N = 11). Coiling was likely driven by the bilayered valve structure. The catapult was 21.3 ± 10.3% efficient (mean ± SD, N = 11) at transferring stored elastic energy to the seeds as kinetic energy. The majority of seeds (71.4%) were not launched effectively. • The efficiency of the C. parviflora catapult was high in comparison to that of a ballistic diplochore, a dispersal mode associated with poor ballistic performance, although the unreliability of the launch mechanism limited dispersal distance. Effective launching requires temporary seed-valve adhesion. The adhesion mechanism may be the source of the unreliability. Valve curvature is likely driven by the bilayered valve structure, a feature absent in nonballistic brassicas.

  2. Diversification and the evolution of dispersal ability in the tribe Brassiceae (Brassicaceae).

    Science.gov (United States)

    Willis, C G; Hall, J C; Rubio de Casas, R; Wang, T Y; Donohue, K

    2014-12-01

    Dispersal and establishment ability can influence evolutionary processes such as geographic isolation, adaptive divergence and extinction probability. Through these population-level dynamics, dispersal ability may also influence macro-evolutionary processes such as species distributions and diversification. This study examined patterns of evolution of dispersal-related fruit traits, and how the evolution of these traits is correlated with shifts in geographic range size, habitat and diversification rates in the tribe Brassiceae (Brassicaceae). The phylogenetic analysis included 72 taxa sampled from across the Brassiceae and included both nuclear and chloroplast markers. Dispersal-related fruit characters were scored and climate information for each taxon was retrieved from a database. Correlations between fruit traits, seed characters, habitat, range and climate were determined, together with trait-dependent diversification rates. It was found that the evolution of traits associated with limited dispersal evolved only in association with compensatory traits that increase dispersal ability. The evolution of increased dispersal ability occurred in multiple ways through the correlated evolution of different combinations of fruit traits. The evolution of traits that increase dispersal ability was in turn associated with larger seed size, increased geographic range size and higher diversification rates. This study provides evidence that the evolution of increased dispersal ability and larger seed size, which may increase establishment ability, can also influence macro-evolutionary processes, possibly by increasing the propensity for long-distance dispersal. In particular, it may increase speciation and consequent diversification rates by increasing the likelihood of geographic and thereby reproductive isolation. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    Science.gov (United States)

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  4. Review on Cardamine diphylla (Michx.) A. wood (Brassicaceae): ethnobotany and glucosinolate chemistry.

    Science.gov (United States)

    Montaut, Sabine; Bleeker, René S

    2013-09-16

    Cardamine diphylla (Michx.) A. Wood, commonly called toothwort, is a spring perennial herb belonging to the Brassicaceae family. This endemic plant of Eastern North America has been widely used by multiple American First Nations (i.e. indigenous people of North America) for food and medicine for centuries. The aim of the review is to describe the botany, ethnopharmacology, phytochemistry, and bioactivity of Cardamine diphylla. The review covers literature on Cardamine diphylla, and the alternative name Dentaria diphylla, from English and French language sources. Multiple traditional uses of Cardamine diphylla by American First Nations are well documented. Initial health studies showed that the tested concentrations of the extract were not toxic against brine shrimp larvae and the same extract had a weak free-radical scavenging activity. However, bioactive compounds in the form of aliphatic and indole glucosinolates and some indole alkaloids have been isolated from this plant. Ecological research regarding Cardamine diphylla-insect interactions (such as feeding and oviposition) is also available in the literature. The wide range of traditional uses by multiple American First Nations suggests that the antibacterial, antiviral, immunostimulant, analgesic, antipyretic, and anti-inflammatory activities of this plant should be explored in in vitro and in vivo tests. Traditional modes of preparation of the plant suggest that some of the medicinal properties could certainly be attributed to glucosinolate degradation products (i.e. isothiocyanates), but a clear assignment of active molecules and mechanisms of action remain to be elucidated. The presence of glucosinolates indicates that the plant could be probed for cancer chemopreventive properties. Overall, the review shows that more investigation is necessary to determine the possible benefits of Cardamine diphylla extracts to pharmaceutical companies as a nutraceutic specialty phytotherapeutic agent against respiratory

  5. Identification of maca (Lepidium meyenii Walp.) and its adulterants by a DNA-barcoding approach based on the ITS sequence.

    Science.gov (United States)

    Chen, Jin-Jin; Zhao, Qing-Sheng; Liu, Yi-Lan; Zha, Sheng-Hua; Zhao, Bing

    2015-09-01

    Maca (Lepidium meyenii) is an herbaceous plant that grows in high plateaus and has been used as both food and folk medicine for centuries because of its benefits to human health. In the present study, ITS (internal transcribed spacer) sequences of forty-three maca samples, collected from different regions or vendors, were amplified and analyzed. The ITS sequences of nineteen potential adulterants of maca were also collected and analyzed. The results indicated that the ITS sequence of maca was consistent in all samples and unique when compared with its adulterants. Therefore, this DNA-barcoding approach based on the ITS sequence can be used for the molecular identification of maca and its adulterants. Copyright © 2015 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  6. Myrigalone A Inhibits Lepidium sativum Seed Germination by Interference with Gibberellin Metabolism and Apoplastic Superoxide Production Required for Embryo Extension Growth and Endosperm Rupture

    Czech Academy of Sciences Publication Activity Database

    Oracz, K.; Voegele, A.; Tarkowská, Danuše; Jacquemoud, D.; Turečková, Veronika; Urbanová, Terezie; Strnad, Miroslav; Sliwinska, E.; Leubner-Metzger, G.

    2012-01-01

    Roč. 53, č. 1 (2012), s. 81-95 ISSN 0032-0781 R&D Projects: GA AV ČR KAN200380801; GA MŠk ED0007/01/01; GA ČR GD522/08/H003 Keywords : Embryo cell extension growth * Endoreduplication * Endosperm rupture * Gibberellin metabolism * Lepidium sativum * Myrica gale * Phytotoxicity * Reactive oxygen species Subject RIV: EF - Botanics Impact factor: 4.134, year: 2012

  7. Effects of Lepidium meyenii Walp and Jatropha macrantha on blood levels of estradiol-17 beta, progesterone, testosterone and the rate of embryo implantation in mice.

    Science.gov (United States)

    Oshima, Masami; Gu, Yeunhwa; Tsukada, Sekihito

    2003-10-01

    The effects of two Peruvian folk medicines, Lepidium meyenii Walp and Jatropha macrantha, on mouse sex steroid hormones and embryo implantation were investigated. Progesterone levels increased significantly in mice that received L. meyenii Walp, while testosterone levels increased significantly in mice that received L. meyenii Walp as well as in those that received both L. meyenii Walp and J. macrantha. However, there were no marked changes in blood levels of estradiol-17beta or the rate of embryo implantation.

  8. Isolation of Crystalline Water-soluble Chlorophyll Proteins with Different Chlorophyll a and b Contents from Stems and Leaves of Lepidium virginicum

    OpenAIRE

    Reiko, Itoh; Shigeru, Itoh; Masaharu, Sugawa; Osamu, Oishi; Kenichi, Tabata; Mitsumasa, Okada; Mitsuo, Nishimura; Eijiro, Yakushiji; Department of Biology, Faculty of Science, Toho University; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Toho University; Department of Biology, Faculty of Science, Kyushu University

    1982-01-01

    Two types of water-soluble chlorophyll proteins were isolated from Lepidium virginicum L. grown in Japan. The protein isolated from the leaves (CP663L) had a low chlorophyll a/b ratio (1.5-1.7), and that from the stems (CP663S) had a high ratio (3.4-3.5). CP663S showed the same crystal forms and almost the same molecular weight and subunit composition as CP663L.

  9. Therapeutic Effects of Pre-Gelatinized Maca (Lepidium Peruvianum Chacon) used as a Non-Hormonal Alternative to HRT in Perimenopausal Women - Clinical Pilot Study

    OpenAIRE

    Meissner, H. O.; Reich-Bilinska, H.; Mscisz, A.; Kedzia, B.

    2006-01-01

    Background: Roots of cruciferous plant Lepidium peruvianum Chacon cultivated in high plateaus of Andes and known under its common name Maca, have been traditionally-used as an energizing vegetable with therapeutic properties for both men and women. Maca has been recognized by natives of Peru as herbal remedy helping to treat conditions affecting menopausal women. Objective: The effects of Pre-Gelatinized Organic Maca (Maca-GO) on quantitative physiological responses and alleviation of symptom...

  10. Two hAT transposon genes were transferred from Brassicaceae to broomrapes and are actively expressed in some recipients

    Science.gov (United States)

    Sun, Ting; Renner, Susanne S.; Xu, Yuxing; Qin, Yan; Wu, Jianqiang; Sun, Guiling

    2016-01-01

    A growing body of evidence is pointing to an important role of horizontal gene transfer (HGT) in the evolution of higher plants. However, reports of HGTs of transposable elements (TEs) in plants are still scarce, and only one case is known of a class II transposon horizontally transferred between grasses. To investigate possible TE transfers in dicots, we performed transcriptome screening in the obligate root parasite Phelipanche aegyptiaca (Orobanchaceae), data-mining in the draft genome assemblies of four other Orobanchaceae, gene cloning, gene annotation in species with genomic information, and a molecular phylogenetic analysis. We discovered that the broomrape genera Phelipanche and Orobanche acquired two related nuclear genes (christened BO transposase genes), a new group of the hAT superfamily of class II transposons, from Asian Sisymbrieae or a closely related tribe of Brassicaceae, by HGT. The collinearity of the flanking genes, lack of a classic border structure, and low expression levels suggest that BO transposase genes cannot transpose in Brassicaceae, whereas they are highly expressed in P. aegyptiaca. PMID:27452947

  11. Clade-specific positive selection on a developmental gene: BRANCHLESS TRICHOME and the evolution of stellate trichomes in Physaria (Brassicaceae).

    Science.gov (United States)

    Mazie, Abigail R; Baum, David A

    2016-07-01

    Positive selection is known to drive the evolution of genes involved in evolutionary arms races, but what role does it play in the evolution of genes involved in developmental processes? We used the single-celled epidermal trichomes of Brassicaceae as a model to uncover the molecular evolutionary processes that contributed to the transition from dendritic trichomes, as seen in most species of Brassicaceae, to the distinctive stellate trichomes of the genus Physaria. We explored the role of positive selection on the evolution of BRANCHLESS TRICHOME (BLT), a candidate gene for changes in trichome branching pattern. Maximum likelihood models of codon evolution point to a shift in selective pressure affecting the evolution of BLT across the entire Physaria clade, and we found strong evidence that positive selection has acted on a subset of Physaria BLT codons. Almost all of the 10 codon sites with the highest probability of having evolved under positive selection are clustered in a predicted coiled-coil domain, pointing to changes in protein-protein interactions. Thus, our findings suggest that selection acted on BLT to modify its interactions with other proteins. The fact that positive selection occurred throughout the radiation of Physaria could reflect selection to stabilize development in response to an abrupt switch from the dendritic form to the stellate form, divergent selection for diversification of the stellate form, or both. These results point to the need for evolutionary developmental studies of BLT and its interacting proteins in Physaria. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. One-step Multiplex RT-PCR Method for Simultaneous Detection of Seed Transmissible Bacterium and Virus Occurring on Brassicaceae Crop Seeds

    Directory of Open Access Journals (Sweden)

    Kyusik Jeong

    2011-04-01

    Full Text Available The aim of this research was to develop specific and sensitive PCR-based procedures for simultaneous detection of economically important plant pathogenic bacteria and seed borne virus in commercial Brassicaceae crop seeds, Xanthomonns campestris pv. campestris (Xcc and Lettuce Mosaic Virus (LMV. Bacterial and virus diseases of Brassicaceae leaves are responsible for heavy losses. PCR with arbitral primers: selection of specific primers, performance of PCR with specific primers and determination of the threshold level for pathogens detection. To detect simultaneously the Xcc and LMV in commercial Brassicaceae crop seeds (lettuce, kohlrabi, radish, chinese cabbage and cabbage, two pairs of specific primer (LMV-F/R, Xcc-F/R were synthesized by using primer-blast program (http://www.ncbi.nlm.nih.gov/tools/ primer-blast/. The multiplex PCR for the two pathogens in Brassicaceae crop seeds could detect specifically without interference among primers and/or cDNA of other plant pathogens. The pathogen detection limit was determined at 1 ng of RNA extracted from pathogens. In the total PCR results for pathogen detection using commercial kohlrabi (10 varieties, lettuce (50 varieties, radish (20 varieties, chinese cabbage (20 varieties and cabbage (20 varieties, LMV and Xcc were detected from 39 and 2 varieties, respectively. In the PCR result of lettuce, LMV and Xcc were simultaneously detected in 8 varieties.

  13. Species delimitation and interspecific relationships of the genus Orychophragmus (Brassicaceae inferred from whole chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Huan Hu

    2016-12-01

    Full Text Available IntroductionIt is rather difficult to delimit recently diverged species and construct their interspecific relationships because of insufficient informative variations of sampled DNA fragments (Schluter, 2000; Arnold, 2006. The genome-scale sequence variations were found to increase the phylogenetic resolutions of both high- and low-taxonomic groups (e.g., Yoder et al., 2013; Lamichhaney et al., 2015. It is still expensive to collect nuclear genome variations between species for most none-model genera without the reference genome. However, chloroplast genomes (plastome are relatively easy to be assembled to examine interspecific relationships for phylogenetic analyses, especially in addressing unresolved relationship at low taxonomic levels (Wu et al., 2010; Nock et al., 2011; Yang et al., 2013; Huang et al., 2014; Carbonell-Caballero et al., 2015. Plastomes are haploid with maternal inheritance in most angiosperms (Corriveau and Coleman, 1988; Zhang and Liu, 2003; Hagemann, 2004 and are highly conservative in gene order and genome structure with rare recombinations (Jansen et al., 2007; Moore et al., 2010. In this study, we aimed to examine species delimitation and interspecific relationships in Orychophragmus through assembling chloroplast genomes of multiple individuals of tentatively delimited species (Hu et al., 2015a. Orychophragmus is a small genus in the mustard family (Brassicaceae, Cruciferae distributed in northern, central, and southeastern China (Zhou et al., 2001. Its plants have been widely cultivated as ornamentals, vegetables, or source of seed oil (Sun et al., 2011. Despite controversial species delimitations in the genus (Zhou et al., 1987; Tan et al., 1998; Wu and Zhao, 2003; Al-Shehbaz and Yang, 2000; Zhou et al., 2001; Sun et al., 2012, our recent study based on nuclear (nr ITS sequence variations suggested the recognition of seven species (Hu et al., 2015a. Orychophragmus is sister to Sinalliaria, which is a genus endemic

  14. Arsenic absorption by members of the Brassicacea family, analysed by neutron activation, k0-method - preliminary results

    International Nuclear Information System (INIS)

    Uemura, George; Matos, Ludmila Vieira da Silva; Silva, Maria Aparecida da; Ferreira, Alexandre Santos Martorano; Menezes, Maria Angela de Barros Correia

    2009-01-01

    Natural arsenic contamination is a cause for concern in many countries of the world including Argentina, Bangladesh, Chile, China, India, Mexico, Thailand and the United States of America and also in Brazil, specially in the Iron Quadrangle area, where mining activities has been contributing to aggravate natural contamination. Brassicacea is a plant family with edible species (arugula, cabbage, cauliflower, cress, kale, mustard, radish), ornamental ones (alysssum, field pennycress, ornamental cabbages and kales) and some species are known as metal and metalloid accumulators (Indian mustard, field pennycress), like chromium, nickel, and arsenic. The present work aimed at studying other taxa of the Brassicaceae family to verify their capability in absorbing arsenic, under controlled conditions, for possible utilisation in remediation activities. The analytical method chosen was neutron activation analysis, k 0 method, a routine technique at CDTN, and also very appropriate for arsenic studies. To avoid possible interference from solid substrates, like sand or vermiculite, attempts were carried out to keep the specimens in 1/4 Murashige and Skoog basal salt solution (M and S). Growth was stumped, plants withered and perished, showing that modifications in M and S had to be done. The addition of nickel and silicon allowed normal growth of the plant specimens, for periods longer than usually achieved (more than two months); yielding samples large enough for further studies with other techniques, like ICP-MS, and other targets, like speciation studies. The results of arsenic absorption are presented here and the need of nickel and silicon in the composition of M and S is discussed. (author)

  15. Arsenic absorption by members of the Brassicacea family, analysed by neutron activation, k{sub 0}-method - preliminary results

    Energy Technology Data Exchange (ETDEWEB)

    Uemura, George; Matos, Ludmila Vieira da Silva; Silva, Maria Aparecida da; Ferreira, Alexandre Santos Martorano; Menezes, Maria Angela de Barros Correia [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: george@cdtn.br, e-mail: menezes@cdtn.br

    2009-07-01

    Natural arsenic contamination is a cause for concern in many countries of the world including Argentina, Bangladesh, Chile, China, India, Mexico, Thailand and the United States of America and also in Brazil, specially in the Iron Quadrangle area, where mining activities has been contributing to aggravate natural contamination. Brassicacea is a plant family with edible species (arugula, cabbage, cauliflower, cress, kale, mustard, radish), ornamental ones (alysssum, field pennycress, ornamental cabbages and kales) and some species are known as metal and metalloid accumulators (Indian mustard, field pennycress), like chromium, nickel, and arsenic. The present work aimed at studying other taxa of the Brassicaceae family to verify their capability in absorbing arsenic, under controlled conditions, for possible utilisation in remediation activities. The analytical method chosen was neutron activation analysis, k{sub 0} method, a routine technique at CDTN, and also very appropriate for arsenic studies. To avoid possible interference from solid substrates, like sand or vermiculite, attempts were carried out to keep the specimens in 1/4 Murashige and Skoog basal salt solution (M and S). Growth was stumped, plants withered and perished, showing that modifications in M and S had to be done. The addition of nickel and silicon allowed normal growth of the plant specimens, for periods longer than usually achieved (more than two months); yielding samples large enough for further studies with other techniques, like ICP-MS, and other targets, like speciation studies. The results of arsenic absorption are presented here and the need of nickel and silicon in the composition of M and S is discussed. (author)

  16. Improving the physical and moisture barrier properties of Lepidium perfoliatum seed gum biodegradable film with stearic and palmitic acids.

    Science.gov (United States)

    Seyedi, Samira; Koocheki, Arash; Mohebbi, Mohebbat; Zahedi, Younes

    2015-01-01

    Stearic and palmitic fatty acids (10%, 20% and 30%, W/W gum) were used to improve the barrier properties of Lepidium perfoliatum seed gum (LPSG) film. The impact of the incorporation of fatty acids into the film matrix was studied by investigating the physical, mechanical, and barrier properties of the films. Addition of stearic and palmitic fatty acids to LPSG films reduced their water vapor permeability (WVP), moisture content, water solubility and water adsorption. Increasing fatty acid concentration from 10% to 30%, reduced the elongation at break (EB). Lower values of tensile strength (TS) and elastic modulus (EM) were obtained in the presence of higher fatty acids concentrations. Incorporation of fatty acids led to production of opaque films and the opacity increased as function of fatty acids concentration. Results showed that moisture content, water solubility and WVP decreased as the chain length of fatty acid increased. Therefore, LPSG-fatty acids composite film could be used for packaging in which a low affinity toward water is needed. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. In silico profiling for secondary metabolites from Lepidium meyenii (maca) by the pharmacophore and ligand-shape-based joint approach.

    Science.gov (United States)

    Yi, Fan; Tan, Xiao-Lei; Yan, Xin; Liu, Hai-Bo

    2016-01-01

    Lepidium meyenii Walpers (maca) is an herb known as a traditional nutritional supplement and widely used in Peru, North America, and Europe to enhance human fertility and treat osteoporosis. The secondary metabolites of maca, namely, maca alkaloids, macaenes, and macamides, are bioactive compounds, but their targets are undefined. The pharmacophore-based PharmaDB targets database screening joint the ligand shape similarity-based WEGA validation approach is proposed to predict the targets of these unique constituents and was performed using Discovery Studio 4.5 and PharmaDB. A compounds-targets-diseases network was established using Cytoscape 3.2. These suitable targets and their genes were calculated and analyzed using ingenuity pathway analysis and GeneMANIA. Certain targets were identified in osteoporosis (8 targets), prostate cancer (9 targets), and kidney diseases (11 targets). This was the first study to identify the targets of these bioactive compounds in maca for cardiovascular diseases (29 targets). The compound with the most targets (46) was an amide alkaloid (MA-24). In silico target fishing identified maca's traditional effects on treatment and prevention of osteoporosis, prostate cancer, and kidney diseases, and its potential function of treating cardiovascular diseases, as the most important of this herb's possible activities.

  18. Feeding hydroalcoholic extract powder of Lepidium meyenii (maca) enhances testicular gene expression of 3β-hydroxysteroid dehydrogenase in rats.

    Science.gov (United States)

    Ohta, Y; Kawate, N; Inaba, T; Morii, H; Takahashi, K; Tamada, H

    2017-12-01

    Although feeding diets containing the extract powder of Lepidium meyenii (maca), a plant growing in Peru's Central Andes, increases serum testosterone concentration associated with enhanced ability of testosterone production by Leydig cells in male rats, changes in testicular steroidogenesis-related factors by the maca treatment are not known. This study examined the effects of maca on testicular gene expressions for luteinizing hormone receptor, steroidogenic acute regulatory protein and steroidogenic enzymes. Eight-week-old male rats were given the diets with or without (control) the maca extract powder (2%) for 6 weeks, and mRNA levels were determined by reverse transcription quantitative real-time PCR. The results showed that the testicular mRNA level of HSD3B1 (3β-hydroxysteroid dehydrogenase; 3β-HSD) increased by the treatment, whereas the levels of the other factors examined did not change. These results suggest that increased expression of 3β-HSD gene may be involved in the enhanced steroidogenic ability by the maca treatment in rat testes. © 2017 Blackwell Verlag GmbH.

  19. Comparison of Mineral Element Content in a Functional Food Maca (Lepidium meyenii Walp.) from Asia and South America.

    Science.gov (United States)

    Zhang, Ji; Wang, Han-Mo; Zhao, Yan-Li; Zuo, Zhi-Tian; Wang, Yuan-Zhong; Jin, Hang

    2015-01-01

    Contents of eight mineral elements in maca (Lepidium meyenii Walp.) from China and Peru were determined by inductively coupled plasma optical emission spectroscopy. Cu contents in maca samples from China (2.5-31 mg kg(-1) dry weight, dw) were higher than the samples from Peru (<2.1 mg kg(-1) dw). Na in two samples from China was found to be significantly of high content (2400 and 2600 mg kg(-1) dw). The contents (mg kg(-1) dw) of B, Co, Cr, Li, Ni, and Zn were, respectively, 8.1-21, <0.023, <1.1~3.5, 0.020-0.17, 0.085-4.5, and 10-39 for the samples from China, while being 6.6-12, <0.023, <1.1~2.3, 0.035-0.063, 0.68-1.7, and 27-39 for the samples from Peru.

  20. Effect of butanolic fraction of yellow and black maca (Lepidium meyenii) on the sperm count of adult mice.

    Science.gov (United States)

    Inoue, N; Farfan, C; Gonzales, G F

    2016-10-01

    Lepidium meyenii, known as maca, is a popular nutraceutical food which is grown over 4,000 m above sea level in the Peruvian central highlands. Maca contains alkaloids, but there are no studies on their biological effects. The butanol fraction obtained from methanol extract of maca hypocotyls contains alkaloids. The effects of butanol/aqueous fractions partitioned from methanol extract of yellow and black maca were examined. Total phenolic content (TPC) and antioxidant capacity by 2,2'-diphenyl-1-picrylhydrazyl were used to evaluate maca fractions in vitro. Daily sperm production and sperm count in epididymis and vas deferens in mice were determined as biological effect of maca extracts in vivo. Yellow maca (21.7%±0.69) had better antioxidant capacity than black maca (18.2% ± 0.12; p < .01). Antioxidant activity was better in the methanolic fraction than in the aqueous fraction of yellow or black maca. TPC is higher in the aqueous fraction than in the methanolic extract of yellow or black maca. Black maca administration resulted in higher concentration of sperm count in epididymis and vas deferens compared to yellow maca. A higher biological effect was observed in methanolic extract and in aqueous extract than in the butanol fraction of maca. In conclusion, better biological effect was observed in the methanolic extract of maca than in its partitioned fractions. © 2016 Blackwell Verlag GmbH.

  1. Effect of red maca (Lepidium meyenii) on prostate zinc levels in rats with testosterone-induced prostatic hyperplasia.

    Science.gov (United States)

    Gonzales, C; Leiva-Revilla, J; Rubio, J; Gasco, M; Gonzales, G F

    2012-05-01

    Lepidium meyenii (maca) is a plant that grows exclusively above 4000 m in the Peruvian central Andes. Red maca (RM) extract significantly reduced prostate size in rats with benign prostatic hyperplasia (BPH) induced by testosterone enanthate (TE). Zinc is an important regulator of prostate function. This study aimed to determine the effect of RM on prostate zinc levels in rats with BPH induced by TE. Also, the study attempted to determine the best marker for the effect of RM on sex accessory glands. Rats treated with RM extract from day 1 to day 14 reversed the effect of TE administration on prostate weight and zinc levels. However, RM administered from day 7 to day 14 did not reduce the effect of TE on all studied variables. Finasteride (FN) reduced prostate, seminal vesicle and preputial gland weights in rats treated with TE. Although RM and FN reduced prostate zinc levels, the greatest effect was observed in TE-treated rats with RM from day 1 to day 14. In addition, prostate weight and zinc levels showed the higher diagnosis values than preputial and seminal vesicle weights. In conclusion, RM administered from day 1 to day 14 reduced prostate size and zinc levels in rats where prostatic hyperplasia was induced with TE. Also, this experimental model could be used as accurately assay to determine the effect of maca obtained under different conditions and/or the effect of different products based on maca. © 2011 Blackwell Verlag GmbH.

  2. Characteristic fingerprinting based on macamides for discrimination of maca (Lepidium meyenii) by LC/MS/MS and multivariate statistical analysis.

    Science.gov (United States)

    Pan, Yu; Zhang, Ji; Li, Hong; Wang, Yuan-Zhong; Li, Wan-Yi

    2016-10-01

    Macamides with a benzylalkylamide nucleus are characteristic and major bioactive compounds in the functional food maca (Lepidium meyenii Walp). The aim of this study was to explore variations in macamide content among maca from China and Peru. Twenty-seven batches of maca hypocotyls with different phenotypes, sampled from different geographical origins, were extracted and profiled by liquid chromatography with ultraviolet detection/tandem mass spectrometry (LC-UV/MS/MS). Twelve macamides were identified by MS operated in multiple scanning modes. Similarity analysis showed that maca samples differed significantly in their macamide fingerprinting. Partial least squares discriminant analysis (PLS-DA) was used to differentiate samples according to their geographical origin and to identify the most relevant variables in the classification model. The prediction accuracy for raw maca was 91% and five macamides were selected and considered as chemical markers for sample classification. When combined with a PLS-DA model, characteristic fingerprinting based on macamides could be recommended for labelling for the authentication of maca from different geographical origins. The results provided potential evidence for the relationships between environmental or other factors and distribution of macamides. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  3. Dose-response effect of Red Maca (Lepidium meyenii) on benign prostatic hyperplasia induced by testosterone enanthate.

    Science.gov (United States)

    Gasco, M; Villegas, L; Yucra, S; Rubio, J; Gonzales, G F

    2007-08-01

    The main goal of this study was to determine the effect of a freeze-dried aqueous extract of the red variety of Lepidium meyenii (Red Maca) on testosterone-induced benign prostatic hyperplasia (BPH) in adult rats of the Holtzman strain. Rats were treated with freeze-dried aqueous extract of Red Maca at doses of 0, 0.01, 0.05, 0.1, and 0.5 g/kg body wt. A positive control group received Finasteride (0.6 mg/kg body wt.). After treatment, the animals were sacrificed, and the ventral prostate was extracted, and weighed. HPLC was used to determine the presence of glucosinolates in Red Maca. The prostate weight diminished in a dose-dependent fashion in rats treated with Red Maca. The effect of Red Maca was better than that observed with Finasteride. Finasteride, but not Red Maca, reduced seminal vesicles weight. Analysis of the HPLC indicated the presence of benzyl glucosinolate (Glucotropaeolin) with a content of 0.639%. Serum testosterone levels were not affected by Red Maca. Moreover, serum testosterone levels were not related to prostate or seminal vesicles weight in rats treated with vehicle and Red Maca. In conclusion, Red Maca administered orally in rats seems to exert an inhibitory effect at a level post DHT conversion, on the BPH-induced experimentally, although a direct measure of reductase action would still be required.

  4. マカ(Lepidium meyenii WALP)の成分分析法について

    OpenAIRE

    治京, 玉記

    2013-01-01

    (要旨)近年、原因療法を目的とした手法として、生理機能を調節する薬用植物が注目されている。アブラナ科植物マカLepidium meyenii WALPは、ペルーでは機能性の低下、更年期の諸症状や不妊などに用いられている伝統的な薬用植物である。しかしながら、マカは自然環境下で栽培されているため産地、栽培条件、収穫方法など環境変化により2次代謝産物への影響が懸念されている。本稿では、マカの2次代謝産物の成分分析法について報告する。...

  5. Peruvian Maca (Lepidium peruvianum): (II) Phytochemical Profiles of Four Prime Maca Phenotypes Grown in Two Geographically-Distant Locations.

    Science.gov (United States)

    O Meissner, Henry; Mscisz, Alina; Piatkowska, Ewa; Baraniak, Marek; Mielcarek, Sebastian; Kedzia, Bogdan; Holderna-Kedzia, Elzbieta; Pisulewski, Pawel

    2016-03-01

    Peruvian Maca crops (Lepidium peruvianum), grown in two geographically-distant cultivation sites located at similar altitudes in the highlands of the Peruvian Andes (Junin at 4,200 m a.s.l. and Ancash 4,150 m a.s.l.), were used in the study. Four prime Maca phenotypes, distinguished by hypocotyl colours labelled as "Yellow", "Purple", "Red" and "Black" were selected to determine distribution in levels and corresponding ratios between individual Glucosinolates (Glucotropaeolin and m-methylglucotropaeolin) in an attempt to identify four Peruvian Maca phenotypes from analyses of powdered hypocotyls. There were highly significant differences (PMaca phenotypes harvested in two locations. The Junin crop represented a mostly "large" class (13.3 g) with "small" size hypocotyls (7.2 g), while a "small" class was predominant in Ancash (3.5 g). Powdered Yellow Maca showed significantly higher (PMaca being the least infected. Only minor, statistically-confirmed differences were detected in nutritive characteristics between the four Maca phenotypes grown in Junin, however highly significant differences (PMaca grown in Junin and Ancash. Irrespective of the cultivation location, Red phenotypes showed the highest content of Total Glucosinolates, followed by Black and Purple, with the Yellow phenotype showing consistently lower levels. Highly significant PMaca phenotypes grown in two locations, confirms an earlier assumption that sums of individual Glucosinolates, their ratios and profiles, may be feasible to explore in analytically identifying individual Maca phenotypes in pulverised marketed Maca products.

  6. Evaluación preliminar del efecto de Lepidium meyenii Walp en el desarrollo embrionario de ratón

    Directory of Open Access Journals (Sweden)

    Guadalupe D´Arrigo

    2013-06-01

    Full Text Available La "maca", Lepidium meyenii Walp, especie vegetal nativa del Perú, es un recurso de gran valor nutricional. Además son varias las investigaciones realizadas en la última década en las cuales se ha comprobado sus efectos sobre la fertilidad de mamíferos. En este trabajo, evaluamos el posible efecto del extracto liofilizado del hipocótilo de L. meyenii Walp en el desarrollo de los embriones preimplantacionales de Mus musculus. Se suministró el liofilizado intra-peritonealmente, en una concentración de 0 g/Kg (grupo control y 1 g/Kg de peso corporal a dos grupos de ratonas preñadas respectivamente, desde el día 1 hasta el día 4 de preñez. Se evaluaron el estadío de desarrollo, condición y morfología embrionarias, no encontrándose efectos tóxicos del extracto acuoso liofilizado de "maca" en el desarrollo normal de los embriones pre-implantacionales de ratón.

  7. Comparison of Mineral Element Content in a Functional Food Maca (Lepidium meyenii Walp. from Asia and South America

    Directory of Open Access Journals (Sweden)

    Ji Zhang

    2015-01-01

    Full Text Available Contents of eight mineral elements in maca (Lepidium meyenii Walp. from China and Peru were determined by inductively coupled plasma optical emission spectroscopy. Cu contents in maca samples from China (2.5–31 mg kg−1 dry weight, dw were higher than the samples from Peru (<2.1 mg kg−1 dw. Na in two samples from China was found to be significantly of high content (2400 and 2600 mg kg−1 dw. The contents (mg kg−1 dw of B, Co, Cr, Li, Ni, and Zn were, respectively, 8.1–21, <0.023, <1.1~3.5, 0.020–0.17, 0.085–4.5, and 10–39 for the samples from China, while being 6.6–12, <0.023, <1.1~2.3, 0.035–0.063, 0.68–1.7, and 27–39 for the samples from Peru.

  8. Targeting Colorectal Cancer Proliferation, Stemness and Metastatic Potential Using Brassicaceae Extracts Enriched in Isothiocyanates: A 3D Cell Model-Based Study

    Directory of Open Access Journals (Sweden)

    Lucília P. Pereira

    2017-04-01

    Full Text Available Colorectal cancer (CRC recurrence is often attributable to circulating tumor cells and/or cancer stem cells (CSCs that resist to conventional therapies and foster tumor progression. Isothiocyanates (ITCs derived from Brassicaceae vegetables have demonstrated anticancer effects in CRC, however little is known about their effect in CSCs and tumor initiation properties. Here we examined the effect of ITCs-enriched Brassicaceae extracts derived from watercress and broccoli in cell proliferation, CSC phenotype and metastasis using a previously developed three-dimensional HT29 cell model with CSC-like traits. Both extracts were phytochemically characterized and their antiproliferative effect in HT29 monolayers was explored. Next, we performed cell proliferation assays and flow cytometry analysis in HT29 spheroids treated with watercress and broccoli extracts and respective main ITCs, phenethyl isothiocyanate (PEITC and sulforaphane (SFN. Soft agar assays and relative quantitative expression analysis of stemness markers and Wnt/β-catenin signaling players were performed to evaluate the effect of these phytochemicals in stemness and metastasis. Our results showed that both Brassicaceae extracts and ITCs exert antiproliferative effects in HT29 spheroids, arresting cell cycle at G2/M, possibly due to ITC-induced DNA damage. Colony formation and expression of LGR5 and CD133 cancer stemness markers were significantly reduced. Only watercress extract and PEITC decreased ALDH1 activity in a dose-dependent manner, as well as β-catenin expression. Our research provides new insights on CRC therapy using ITC-enriched Brassicaceae extracts, specially watercress extract, to target CSCs and circulating tumor cells by impairing cell proliferation, ALDH1-mediated chemo-resistance, anoikis evasion, self-renewal and metastatic potential.

  9. Disminución del daño oxidativo y efecto hipoglicemiante de la maca (Lepidium meyenii Walp) en ratas con diabetes inducida por streptozotocina

    OpenAIRE

    María Elena Rodrigo; Rubén Valdivieso; Silvia Suárez; Rosa Oriondo; Raquel Oré

    2011-01-01

    Introducción: La maca es consumida desde tiempos ancestrales como parte de la dieta. Se le ha atribuido propiedades medicinales y se encuentra incluida en la medicina tradicional peruana. Estudios recientes describen que la admistración de maca reduce la glicemia en animales normoglicémicos, pero los mecanismos involucrados no están muy claros. Objetivos: Determinar el efecto hipoglicemiante y antioxidante de la harina de maca (Lepidium meyenii Walp) del ecotipo amarillo, en ratas con diabete...

  10. Disminucion del daño oxidativo y efecto hipoglicemiante de la maca (Lepidium meyenii Walp) en ratas con diabetes inducida por streptozotocina

    OpenAIRE

    Rodrigo, María Elena; Valdivieso, Rubén; Suárez, Silvia; Oriondo, Rosa; Oré, Raquel

    2013-01-01

    Introducción: La maca es consumida desde tiempos ancestrales como parte de la dieta. Se le ha atribuido propiedades medicinales y se encuentra incluida en la medicina tradicional peruana. Estudios recientes describen que la admistración de maca reduce la glicemia en animales normoglicémicos, pero los mecanismos involucrados no están muy claros. Objetivos: Determinar el efecto hipoglicemiante y antioxidante de la harina de maca (Lepidium meyenii Walp) del ecotipo amarillo, en ratas con diabete...

  11. Effect of Sodium Dodecyl Sulfate on Structure and Spectroscopic Characteristics of Water-Soluble Chlorophyll Protein Complex Isolated from Stems of Lepidium virginicum

    OpenAIRE

    Kenichi, Tabata; Shigeru, Itoh; Masaharu, Sugawa; Mitsuo, Nishimura; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Kyushu University:(Present)National Institute for Basic Biology; Department of Biology, Faculty of Science, Kyushu University; Department of Biology, Faculty of Science, Kyushu University

    1983-01-01

    The relationship between structure and spectroscopic characteristics of the water-soluble chlorophyll protein complex isolated from stems of Lepidium virginicum (CP663S) was studied. Addition of 0.08% SDS induced a red shift of the 663 nm absorption maximum. At the same time, under excitation at 435 nm, the maximum of fluorescence emission shifted from 672 nm to 675 nm and the fluorescence yield increased. When CP663S was excited at 480 nm, the 660 nm emission band of chlorophyll b became mor...

  12. Effect of SO/sub 2/ on sexual reproduction in Lepidium virginicum L. originating from regions with different SO/sub 2/ concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Murdy, W.H.

    1979-09-01

    Tolerance of SO/sub 2/ with respect to sexual reproduction is reported for populations of Lepidium virginicum from the Copper Basin of Tennessee, a region subjected to SO/sub 2/ pollution for the past 75 yr. The offspring of plants from inside and outside the Copper Basin were fumigated with 2130 ..mu..g/m/sup 2/ SO/sub 2/ for 9 h at high relative humidity in replicated experiments. As a result of SO/sub 2/ stress, plants from outside the Copper Basin were less fertile than plants from inside the Copper Basin.

  13. BIOAKUMULASI DAN DISTRIBUSI CD PADA AKAR DAN PUCUK 3 JENIS TANAMAN FAMILI BRASSICACEAE: IMPLEMENTASINYA UNTUK FITOREMEDIASI (Cadmium Bioaccumulation and Distribution in Root and Shoot of 3 Crops of Brassicaceae: Implication For Phytoremediation

    Directory of Open Access Journals (Sweden)

    Rini Susana

    2013-07-01

    Full Text Available ABSTRAK Effisiensi tanaman untuk fitoremediasi salah satunya ditentukan oleh besarnya akumulasi logam dalam biomassa tanaman yang dipanen. Akumulasi kadmium pada organ berbagai jenis tanaman menunjukkan respon yang beragam, Sebuah percobaan pot telah dilakukan pada 3 jenis tanaman famili Brassicaceae yaitu sawi hijau (Brassica rapa var. parachinensis , sawi putih (Brassica rapa var. Pekinensis dan kailan (Brassica oleracea var. Alboglabra pada tanah gambut yang dikontaminasi kadmium (Cd dengan tujuan mempelajari bioakumulasi Cd pada akar dan pucuk dari ketiga jenis tanaman tersebut dan menentukan jenis yang lebih potensial untuk fitoremediasi. Kontaminan Cd dicampurkan pada tanah dengan tingkatan dosis yang berbeda yaitu tanpa kontaminan, 2 mgkg-1 Cd, 4 mgkg-1 Cd, 8 mgkg-1 Cd, 16 mgkg-1 Cd dan 32 mgkg-1 Cd, dan tanah tersebut digunakan sebagai media tumbuh tanaman (5kg/polibag. Hasil penelitian menunjukkan kandungan Cd pada organ akar sawi hijau, sawi putih dan kailan lebih besar dari pucuk. Ketiga tanaman termasuk tanaman akumulator Cd. Kailan mempunyai kemampuan akumulasi Cd (BCF yang lebih besar dari sawi hijau dan sawi putih, tetapi mempunyai kemampuan transfer Cd ke pucuk (TF paling kecil. Sawi hijau dan sawi putih dengan biomassa yang besar dan mempunyai kemampuan transfer Cd ke pucuk yang jauh lebih besar dari kailan, lebih potensial digunakan untuk fitoremediasi tanah yang tercemar Cd. ABSTRACT Plant efficiency for phytoremediation depend on total amount of metal content in the harvestable tissues of plant biomass. Cadmium accumulation in the organs of various plant species showed varying responses. Field experiment was carried out with 3 crops of family Brassicaceae, i.e. Brassica rapa var. parachinensis, Brassica rapa var. Pekinensis and Brassica oleracea var. Alboglabra on Cd-contaminated peat soil. Contaminant Cd and soil were mixed in different dosages i.e. 2 mgkg-1 Cd, 4 mgkg-1 Cd, 8 mgkg-1 Cd, 16 mgkg-1 Cd and 32 mgkg-1 Cd and

  14. Influence of colour type and previous cultivation on secondary metabolites in hypocotyls and leaves of maca (Lepidium meyenii Walpers).

    Science.gov (United States)

    Clément, Céline; Diaz Grados, Diego A; Avula, Bharathi; Khan, Ihklas A; Mayer, Andrea C; Ponce Aguirre, Dante D; Manrique, Ivan; Kreuzer, Michael

    2010-04-15

    Maca is an Andean crop of the Brassicaceae family which is mainly known for its fertility-enhancing properties following consumption. The hypocotyls display various colours ranging from white to black. Each colour has different biological effects. The aim of this study was to analyse the concentrations of major secondary metabolites in hypocotyls and leaves of maca in a controlled planting experiment in the Peruvian Andes at 4130 m above sea level. The effects of colour type and of previous cultivation of the field were examined. In the hypocotyls, the colour type effect was significant for most secondary metabolites; exceptions were beta-sitosterol and campesterol. The lead-coloured, yellow and violet maca hypocotyls were rich in glucosinolates, macaene and macamides, respectively. Previous cultivation affected macaene, campesterol and indole glucosinolate concentrations. Effects on metabolite concentrations in the leaves were minor. Hypocotyls were richer in macaene, macamides and glucosinolates than were leaves, and were poorer in beta-sitosterol and total phenols. Colour type has to be considered in maca production, as colour associates with variations in concentrations of distinct bioactive metabolites. Leaves may be interesting for animal nutrition purposes as they contain essentially the same secondary metabolites as the hypocotyls but in clearly lower concentrations. (c) 2010 Society of Chemical Industry.

  15. Effect of different levels of Lepidium sativum L. on growth performance, carcass characteristics, hematology and serum biochemical parameters of broilers.

    Science.gov (United States)

    Shawle, Kassa; Urge, Mengistu; Animut, Getachew

    2016-01-01

    Frequent use of antibiotics to stimulate growth and health of animals leads to the development of antibiotic-resistant populations of microorganisms. In this context, alternatives like herbs and spices to antibiotics are of importance, as they are natural products. Therefore, the present experiment was designed to evaluate the performance, carcass traits, hematology and serum biochemical parameters of broilers fed ration containing varying levels of Lepidium satvium (Garden cress) seed powder as feed additive up to the age of 42 days. A total of 204 Cobb-500 day-old broiler chicks were randomly distributed into four treatments with three replicates of 17 chicks each. Garden cress (GC) was included in the ration at 0 (0GC), 0.75 (0.75GC), 1.50 (1.5GC) and 2.25 % (2.25GC) in each treatments. Growth performance, carcass characteristics, heamatology, serum biochemical and economic efficiency parameters were observed. The crude protein, ether extract and crude fiber content of GC were 22.4, 25.7 and 10.5 %, respectively. Daily dry matter intake and average daily gain during the entire experimental period were affected (p  0.05). Sex differences were significant for eviscerated, carcass and kidney percentages with greater values for females than males. All hematological parameters were within the normal range. However, inclusion of GC improved (p health of broilers. Based on the production parameters used in the study, GC can be included as feed additive at a level of 0.75 % in the total ration for better and positive results on biological performance and health status of broilers.

  16. Effect of different fractions from hydroalcoholic extract of Black Maca (Lepidium meyenii) on testicular function in adult male rats.

    Science.gov (United States)

    Yucra, Sandra; Gasco, Manuel; Rubio, Julio; Nieto, Jessica; Gonzales, Gustavo F

    2008-05-01

    To evaluate the effect of different fractions of Black Maca (Lepidium meyenii), obtained from the hydroalcoholic extract, on spermatogenesis. Animal study. Animal and laboratory facilities at a university. Forty two adult male rats from the Holtzman strain (3 months old). Hydroalcoholic extract of Black Maca was partitioned with the following solvents: petroleum ether, chloroform, ethyl acetate, n-butanol, and water to obtain each fraction. Forty-two rats were divided in different groups according the fraction administered and vehicle. The hydroalcoholic extract of Black Maca and its fractions and vehicle were given orally by gavage for 7 days. Daily sperm production, epididymal sperm count, and sperm count in the vas deferens. Daily sperm production was higher in the ethyl acetate group compared with all other groups. The epididymal sperm count was higher in rats treated with ethyl acetate fraction compared with rats treated with vehicle (control), petroleum ether, n-butanol, or water fractions. The sperm count in vas deferens was lower in rats treated with ethyl acetate, petroleum ether, or water fractions compared with the control group; thus, the sperm count in vas deferens in rats treated with chloroform and n-butanol fractions was higher than in the petroleum ether group. The greatest effect on spermatogenesis was observed in the ethyl acetate fraction from the hydroalcoholic extract of Black Maca, suggesting that the compounds related to the beneficial effect on sperm production of Black Maca are presented in this fraction. Antioxidant components could play a role in the effect of increased epididymal sperm concentration observed in the model.

  17. Potent endogenous allelopathic compounds in Lepidium sativum seed exudate: effects on epidermal cell growth in Amaranthus caudatus seedlings

    Science.gov (United States)

    Iqbal, Amjad; Fry, Stephen C.

    2012-01-01

    Many plants exude allelochemicals – compounds that affect the growth of neighbouring plants. This study reports further studies of the reported effect of cress (Lepidium sativum) seed(ling) exudates on seedling growth in Amaranthus caudatus and Lactuca sativa. In the presence of live cress seedlings, both species grew longer hypocotyls and shorter roots than cress-free controls. The effects of cress seedlings were allelopathic and not due to competition for resources. Amaranthus seedlings grown in the presence of cress allelochemical(s) had longer, thinner hypocotyls and shorter, thicker roots – effects previously attributed to lepidimoide. The active principle was more abundant in cress seed exudate than in seedling (root) exudates. It was present in non-imbibed seeds and releasable from heat-killed seeds. Release from live seeds was biphasic, starting rapidly but then continuing gradually for 24 h. The active principle was generated by aseptic cress tissue and was not a microbial digestion product or seed-treatment chemical. Crude seed exudate affected hypocotyl and root growth at ∼25 and ∼450 μg ml−1 respectively. The exudate slightly (28%) increased epidermal cell number along the length of the Amaranthus hypocotyl but increased total hypocotyl elongation by 129%; it resulted in a 26% smaller hypocotyl circumference but a 55% greater epidermal cell number counted round the circumference. Therefore, the effect of the allelochemical(s) on organ morphology was imposed primarily by regulation of cell expansion, not cell division. It is concluded that cress seeds exude endogenous substances, probably including lepidimoide, that principally regulate cell expansion in receiver plants. PMID:22268144

  18. Evaluation of plant growth promoting activity and heavy metal tolerance of psychrotrophic bacteria associated with maca (Lepidium meyenii Walp. rhizosphere

    Directory of Open Access Journals (Sweden)

    Paola Ortiz-Ojeda

    2017-05-01

    Full Text Available The high Andean plateau of Peru is known to suffer harsh environmental conditions. Acidic soils containing high amount of heavy metals due to mining activities and withstanding very low temperatures affect agricultural activities by diminishing crop quality and yield. In this context, plant growth promoting rhizobacteria (PGPR adapted to low temperatures and tolerant to heavy metals can be considered as an environment-friendly biological alternative for andean crop management. The aim of this work was to select and characterize psychrotrophic PGPR isolated from the rhizosphere of maca (Lepidium meyenii Walp. a traditional andean food crop. A total of 44 psychrotrophic strains isolated from 3 areas located in the Bombon plateu of Junin-Peru were tested for their PGPR characteristics like indole acetic acid (IAA production, phosphate solubilization and for their ability to improve seed germination. In addition, their capacity to grow in the presence of heavy metals like cadmium (Cd, lead (Pb, cobalt (Co and mercury (Hg was tested. Of the total number of strains tested, 12 were positive for IAA production at 22 °C, 8 at 12 °C and 16 at 6 °C. Phosphate solubilization activities were higher at 12 °C and 6 °C than at 22 °C. Red clover plant assays showed that 16 strains were capable to improve seed germination at 22 °C and 4 at 12 °C. Moreover, 11 strains showed tolerance to Cd and Pb at varying concentrations. This study highlight the importance of obtaining PGPRs to be used in high andean plateu crops that are exposed to low temperatures and presence of heavy metals on soil.

  19. Beneficial effects of Lepidium meyenii (Maca) on psychological symptoms and measures of sexual dysfunction in postmenopausal women are not related to estrogen or androgen content.

    Science.gov (United States)

    Brooks, Nicole A; Wilcox, Gisela; Walker, Karen Z; Ashton, John F; Cox, Marc B; Stojanovska, Lily

    2008-01-01

    To examine the estrogenic and androgenic activity of Lepidium meyenii (Maca) and its effect on the hormonal profile and symptoms in postmenopausal women. Fourteen postmenopausal women completed a randomized, double-blind, placebo-controlled, crossover trial. They received 3.5 g/day of powered Maca for 6 weeks and matching placebo for 6 weeks, in either order, over a total of 12 weeks. At baseline and weeks 6 and 12 blood samples were collected for the measurement of estradiol, follicle-stimulating hormone, luteinizing hormone, and sex hormone-binding globulin, and the women completed the Greene Climacteric Scale to assess the severity of menopausal symptoms. In addition, aqueous and methanolic Maca extracts were tested for androgenic and estrogenic activity using a yeast-based hormone-dependent reporter assay. No differences were seen in serum concentrations of estradiol, follicle-stimulating hormone, luteinizing hormone, and sex hormone-binding globulin between baseline, Maca treatment, and placebo (P > 0.05). The Greene Climacteric Scale revealed a significant reduction in scores in the areas of psychological symptoms, including the subscales for anxiety and depression and sexual dysfunction after Maca consumption compared with both baseline and placebo (P Lepidium meyenii (Maca) (3.5 g/d) reduces psychological symptoms, including anxiety and depression, and lowers measures of sexual dysfunction in postmenopausal women independent of estrogenic and androgenic activity.

  20. Host plant suitability and feeding preferences of the grapevine pest Abagrotis orbis (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Mostafa, A M; Lowery, D T; Jensen, L B M; Deglow, E K

    2011-12-01

    Thirteen plant species were tested for their suitability as hosts for Abagrotis orbis (Grote), a climbing cutworm pest of grapevines in British Columbia. Choice tests were also conducted to investigate larval feeding preferences for the Brassicaceae species joi choi, Brassica rapa variety. Chinensis L., spring draba; Draba verna L.; and shepherd's purse, Capsella bursa-pastoris (L.) Medik; compared with postdormant buds of grape, Vitis vinifera L. (Vitaceae), and leaves of nine other plant species from several families. Results showed that tah tsai, Brassica rapa L. variety rosularis (M. Tsen & S. H. Lee) Hanelt (Brassicaceae), is a superior host for A. orbis based on shorter time to adult eclosion, heavier pupae, and higher rates of survival. Later-instar larvae died when fed draba, whereas those reared on shepherd's purse did not survive beyond the third instar. White clover, Trifolium repens L. (Fabaceae), and grape leaves were unsuitable hosts throughout development. Fifth-instar A. orbis preferred plants of the Brassicaceae family, dandelion, Taraxacum officinale Weber (Asteraceae), and strawberry, Fragaria sp. L. (Rosaceae), compared with postdormant grape buds. The results of this study suggest that the winter annual mustards draba and shepherd's purse that often grow abundantly in vine rows might help reduce climbing cutworm damage to the buds of grapevines.

  1. Evolutionary Migration of the Disjunct Salt Cress Eutrema salsugineum (= Thellungiella salsuginea, Brassicaceae) between Asia and North America.

    Science.gov (United States)

    Wang, Xiao-Juan; Shi, Da-Chuan; Wang, Xin-Yu; Wang, Juan; Sun, Yong-Shuai; Liu, Jian-Quan

    2015-01-01

    Eutrema salsugineum (= Thellungiella salsuginea Brassicaceae), a species growing in highly saline habitats, is a good model for use in salt-stress research. However, its evolutionary migrations and genetic variations within and between disjunct regions from central Asia to northern China and North America remain largely unknown. We examined genetic variations and phylogeographic patterns of this species by sequencing ITS, 9 chloroplast (cp) DNA fragments (4379 bp) and 10 unlinked nuclear loci (6510 bp) of 24 populations across its distributional range. All markers suggested the high genetic poverty of this species and the limited number of genetic variations recovered was congruently partitioned between central Asia, northern China and North America. Further modelling of nuclear population-genetic data based on approximate bayesian computation (ABC) analyses indicated that the long-distance dispersals after the recent origin of E. salsugineum may have occurred from central Asia to the other two regions respectively within 20000 years. The fast demographic expansions should have occurred in northern China in a more recent past. Our study highlights the importance of using ABC analyses and nuclear population genetic data to trace evolutionary migrations of the disjunct distributions of the plants in the recent past.

  2. The molecular phylogeny of Matthiola R. Br. (Brassicaceae) inferred from ITS sequences, with special emphasis on the Macaronesian endemics.

    Science.gov (United States)

    Jaén-Molina, Ruth; Caujapé-Castells, Juli; Reyes-Betancort, Jorge Alfredo; Akhani, Hossein; Fernández-Palacios, Olga; de Paz, Julia Pérez; Febles-Hernández, Rosa; Marrero-Rodríguez, Aguedo

    2009-12-01

    Matthiola (Brassicaceae) is a genus that is widespread in the Mediterranean and Irano-Turanian regions and includes two species that are endemic to the archipelagos of Madeira and the Canaries in Macaronesia, which is an insular oceanic hotspot of biodiversity harboring many radiating endemic plant lineages. Sequence analyses of the nuclear ITS-1 and ITS-2 regions in a comprehensive geographical sample of Matthiola, encompassing all the endemic Macaronesian populations known to date, suggest independent Mediterranean and NW African origins of the taxa in Madeira and the Canaries, respectively. These molecular data reveal a complex evolutionary landscape that converges with morphological analyses in the recognition of two new Madeiran species. The data also suggest that the Canarian infra-specific endemic taxa described thus far have high (but non-diagnostic) levels of morphological and genetic diversity, and should be included in the single endemic Matthiola bolleana. In agreement with earlier investigations that revealed a high genetic differentiation between the populations of Matthiola in Fuerteventura and Lanzarote, our phylogeny supports independent founder events from the same mainland congener to either island. The consistently derived position of the Moroccan populations within a mostly Canarian clade suggests a further back-colonization of the continent. Notably, the ITS sequence resolution offered by Matthiola is higher than that found in many of the radiating Canarian endemic lineages for which molecular phylogenetic studies abound. Hence, our research discovers largely unexplored pathways to understand plant diversification in this oceanic insular hotspot through the investigation of non-speciose endemics.

  3. Auftreten von Falschem Mehltau bei Gartenkresse (Lepidium sativum L. in der Saatgutvermehrung – Evaluierung von Saatgutbehandlung und Wachstumsbedingungen in einem Gefäßversuch

    Directory of Open Access Journals (Sweden)

    Zeller, Stefanie

    2014-09-01

    Full Text Available Die zur Familie der Brassicaceae gehörende Gartenkresse wird in Deutschland überwiegend im biologischen Anbau vermehrt. Seit einigen Jahren werden diese Gartenkressebestände von Erregern des Falschen Mehltaus (Hyaloperonospora parasitica, Perofascia lepidii befallen, was zu einem Totalausfall des Pflanzenbestandes führen kann. Daher ist die biologische Saatgutproduktion von Gartenkresse gefährdet, was eine Beeinträchtigung der Saatgutversorgung für die Keimsprossenerzeugung zur Folge hat. In den laufenden Untersuchungen wird der Einfluss von nicht chemischen Saatgutbehandlungsmaßnahmen (Wasserdampf, Elektronen, sowie Wachstumsbedingungen (Feuchte, Boden auf die Infektion mit Falschem Mehltau untersucht.

  4. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  5. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    Science.gov (United States)

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  6. Identification of endocannabinoid system-modulating N-alkylamides from Heliopsis helianthoides var. scabra and Lepidium meyenii.

    Science.gov (United States)

    Hajdu, Zsanett; Nicolussi, Simon; Rau, Mark; Lorántfy, László; Forgo, Peter; Hohmann, Judit; Csupor, Dezső; Gertsch, Jürg

    2014-07-25

    The discovery of the interaction of plant-derived N-alkylamides (NAAs) and the mammalian endocannabinoid system (ECS) and the existence of a plant endogenous N-acylethanolamine signaling system have led to the re-evaluation of this group of compounds. Herein, the isolation of seven NAAs and the assessment of their effects on major protein targets in the ECS network are reported. Four NAAs, octadeca-2E,4E,8E,10Z,14Z-pentaene-12-ynoic acid isobutylamide (1), octadeca-2E,4E,8E,10Z,14Z-pentaene-12-ynoic acid 2'-methylbutylamide (2), hexadeca-2E,4E,9Z-triene-12,14-diynoic acid isobutylamide (3), and hexadeca-2E,4E,9,12-tetraenoic acid 2'-methylbutylamide (4), were identified from Heliopsis helianthoides var. scabra. Compounds 2-4 are new natural products, while 1 was isolated for the first time from this species. The previously described macamides, N-(3-methoxybenzyl)-(9Z,12Z,15Z)-octadecatrienamide (5), N-benzyl-(9Z,12Z,15Z)-octadecatrienamide (6), and N-benzyl-(9Z,12Z)-octadecadienamide (7), were isolated from Lepidium meyenii (Maca). N-Methylbutylamide 4 and N-benzylamide 7 showed submicromolar and selective binding affinities for the cannabinoid CB1 receptor (Ki values of 0.31 and 0.48 μM, respectively). Notably, compound 7 also exhibited weak fatty acid amide hydrolase (FAAH) inhibition (IC50 = 4 μM) and a potent inhibition of anandamide cellular uptake (IC50 = 0.67 μM) that was stronger than the inhibition obtained with the controls OMDM-2 and UCM707. The pronounced ECS polypharmacology of compound 7 highlights the potential involvement of the arachidonoyl-mimicking 9Z,12Z double-bond system in the linoleoyl group for the overall cannabimimetic action of NAAs. This study provides additional strong evidence of the endocannabinoid substrate mimicking of plant-derived NAAs and uncovers a direct and indirect cannabimimetic action of the Peruvian Maca root.

  7. SEM observations of pollen grains, fruits and seeds of the Pieniny Mountains (South Poland endemic species Erysimum pieninicum (Zapał. Pawł. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Irmina Maciejewska

    2011-01-01

    Full Text Available Erysimum pieninicum (Zapał. Pawł. (Brassicaceae is an endemic species, growing only in Pieniny Mts. The aim of the presented work was to investigate its pollen morphology as well as its ultrastructural traits of pericarp and seed-coat. Pollen grains of this species were of small size, 3-zonocolpate with reticulate ornamentation. The external siliqua surface was of rugose sculpture, covered by numerous, stellate hairs. The internal surface of the fruit was naked and characterized by striate sculpture. The seed-coat ornamentation of E. pieninicum was of blister type.

  8. Effect of Cadmium Contaminants Against Absorption of Cadmium and the Results of 3 Types of Families Brassicaceae Vegetables on Peat Soil

    OpenAIRE

    Panthera Boy, Godefridus Delanova; Suswati, Denah; Susana, Rini

    2014-01-01

    Cadmium (Cd) is a heavy metal that is often the pollutants on agricultural land. This research aimed to study the absorption of cadmium (Cd) and yield of the three kinds family brassicaceae grown in peat media contaminated with cadmium (Cd). The method used in this research was Split Plot Design. As the main plot are 3 types of vegetables consist of 3 types of mustards: mustard greens, Chinese cabbage, and Chinese broccoli. Sub plot the dose cadmium treatment consisting of c0 (no contaminant)...

  9. Dendrochronological study of the endangered shrub Vella pseudocytisus subsp. paui (Brassicaceae: implications for its recovery and conservation

    Directory of Open Access Journals (Sweden)

    Génova, Mar

    2013-12-01

    Full Text Available Dendrochronology is useful to determine plant longevity, to provide insights into the structure and dynamics of plant populations and to study the relationships between growth and environmental determinants. The dendrochronology of endangered shrubs is unexplored, although their use represents an opportunity to produce better conservation guidelines. We collected for this study 63 samples from already dead specimens of Vella pseudocytisus subsp. paui (Brassicaceae, an endangered Spanish endemism from three localities. We analyzed the relationship between ring data and plant size to determine the accuracy of using size as a proxy for plant age. We also explored the relationships between ring data and environmental variables to detect growth determinants. This shrub showed a high longevity as older individuals presented nearly 50 growth rings. The relationship between age and size is weak although it could be established based on the logarithmic function of plant biovolume. Significant relationships were found between rainfall and ring widths, showing that water limited annual growth. Finally, age structure characterized differences among populations, highlighting the effects of disturbance and land use. These results provided new opportunities for management within the ongoing recovery plan for the species.La dendrocronología es útil para determinar la longevidad de la planta, proporcionar información sobre la estructura y dinámica de las poblaciones vegetales y estudiar las relaciones entre el crecimiento y las variables ambientales. Hasta ahora no se había hecho uso de la dendrocronología en arbustos en peligro de extinción, aunque su empleo puede mejorar las directrices de conservación. En este estudio se han recolectado 63 especímenes ya muertos de tres localidades de Vella pseudocytisus subsp. paui (Brassicaceae, un endemismo español en peligro de extinción. Se han analizado las relaciones entre los grosores del anillo de

  10. Flowering Locus C (FLC Is a Potential Major Regulator of Glucosinolate Content across Developmental Stages of Aethionema arabicum (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Setareh Mohammadin

    2017-05-01

    Full Text Available The biochemical defense of plants can change during their life-cycle and impact herbivore feeding and plant fitness. The annual species Aethionema arabicum is part of the sister clade to all other Brassicaceae. Hence, it holds a phylogenetically important position for studying crucifer trait evolution. Glucosinolates (GS are essentially Brassicales-specific metabolites involved in plant defense. Using two Ae. arabicum accessions (TUR and CYP we identify substantial differences in glucosinolate profiles and quantities between lines, tissues and developmental stages. We find tissue specific side-chain modifications in aliphatic GS: methylthioalkyl in leaves, methylsulfinylalkyl in fruits, and methylsulfonylalkyl in seeds. We also find large differences in absolute glucosinolate content between the two accessions (up to 10-fold in fruits that suggest a regulatory factor is involved that is not part of the quintessential glucosinolate biosynthetic pathway. Consistent with this hypothesis, we identified a single major multi-trait quantitative trait locus controlling total GS concentration across tissues in a recombinant inbred line population derived from TUR and CYP. With fine-mapping, we narrowed the interval to a 58 kb region containing 15 genes, but lacking any known GS biosynthetic genes. The interval contains homologs of both the sulfate transporter SULTR2;1 and FLOWERING LOCUS C. Both loci have diverse functions controlling plant physiological and developmental processes and thus are potential candidates regulating glucosinolate variation across the life-cycle of Aethionema. Future work will investigate changes in gene expression of the candidates genes, the effects of GS variation on insect herbivores and the trade-offs between defense and reproduction.

  11. Effect of water content and temperature on seed longevity of seven Brassicaceae species after 5 years of storage.

    Science.gov (United States)

    Mira, S; Estrelles, E; González-Benito, M E

    2015-01-01

    Maximising seed longevity is crucial for genetic resource preservation and longevity of orthodox seeds is determined by environmental conditions (water content and temperature). The effect of water content (down to 0.01 g·H₂O·g(-1) ) on seed viability was studied at different temperatures for a 5-year storage period in taxonomically related species. Seeds of seven Brassicaceae species (Brassica repanda, Eruca vesicaria, Malcolmia littorea, Moricandia arvensis, Rorippa nasturtium-aquaticum, Sinapis alba, Sisymbrium runcinatum) were stored at 48 environments comprising a combination of eight water contents, from 0.21 to 0.01 g·H₂O·g(-1) DW and six temperatures (45, 35, 20, 5, -25, -170 °C). Survival curves were modelled and P50 calculated for those conditions where germination was reduced over the 5-year assay period. Critical water content for storage of seeds of six species at 45 °C ranged from 0.02 to 0.03 g·H₂O·g(-1) . The effect of extreme desiccation at 45 °C showed variability among species: three species showed damaging effects of drying below the critical water content, while for three species it was neither detrimental nor beneficial to seed longevity. Lipid content could be related to longevity, depending on the storage conditions. A variable seed longevity response to water content among taxonomically related species was found. The relative position of some of the species as long- or short-lived at 45 °C varied depending on the humidity at which storage behaviour was evaluated. Therefore, predictions of survival under desiccated conditions based on results obtained at high humidity might be problematic for some species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  12. Plasticity in functional traits in the context of climate change: a case study of the subalpine forb Boechera stricta (Brassicaceae).

    Science.gov (United States)

    Anderson, Jill T; Gezon, Zachariah J

    2015-04-01

    Environmental variation often induces shifts in functional traits, yet we know little about whether plasticity will reduce extinction risks under climate change. As climate change proceeds, phenotypic plasticity could enable species with limited dispersal capacity to persist in situ, and migrating populations of other species to establish in new sites at higher elevations or latitudes. Alternatively, climate change could induce maladaptive plasticity, reducing fitness, and potentially stalling adaptation and migration. Here, we quantified plasticity in life history, foliar morphology, and ecophysiology in Boechera stricta (Brassicaceae), a perennial forb native to the Rocky Mountains. In this region, warming winters are reducing snowpack and warming springs are advancing the timing of snow melt. We hypothesized that traits that were historically advantageous in hot and dry, low-elevation locations will be favored at higher elevation sites due to climate change. To test this hypothesis, we quantified trait variation in natural populations across an elevational gradient. We then estimated plasticity and genetic variation in common gardens at two elevations. Finally, we tested whether climatic manipulations induce plasticity, with the prediction that plants exposed to early snow removal would resemble individuals from lower elevation populations. In natural populations, foliar morphology and ecophysiology varied with elevation in the predicted directions. In the common gardens, trait plasticity was generally concordant with phenotypic clines from the natural populations. Experimental snow removal advanced flowering phenology by 7 days, which is similar in magnitude to flowering time shifts over 2-3 decades of climate change. Therefore, snow manipulations in this system can be used to predict eco-evolutionary responses to global change. Snow removal also altered foliar morphology, but in unexpected ways. Extensive plasticity could buffer against immediate fitness

  13. Antioxidant and neuroprotector effect of Lepidium meyenii (maca) methanol leaf extract against 6-hydroxy dopamine (6-OHDA)-induced toxicity in PC12 cells.

    Science.gov (United States)

    Rodríguez-Huamán, Ángel; Casimiro-Gonzales, Sandra; Chávez-Pérez, Jorge Antonio; Gonzales-Arimborgo, Carla; Cisneros-Fernández, Richard; Aguilar-Mendoza, Luis Ángel; Gonzales, Gustavo F

    2017-05-01

    Reactive oxygen species (ROS) are normally produced during cell metabolism, there is strong evidence to suggest that ROS produced in excess impair the cell and may be etiologically related to various neurodegenerative diseases. This study was undertaken to examine the effects of Lepidium meyenii (MACA) methanol leaf extract on neurotoxicity in PC12 cell exposed to 6-hydroxydopamine (6-OHDA). Fresh samples of "maca" leaves were processed in order to obtain foliar extracts and to evaluate the neurobiological activity on PC12 cells, subjected to the cytotoxic effect of 6-OHDA through the determination of the capacity antioxidant, cell viability and cytotoxicity assays on PC12 cells. The results of the tests of antioxidant activity, showed maximum values of 2262.37 and 1305.36 expressed in Trolox equivalents (TEAC), for the methanolic and aqueous fractions respectively. Cell viability assays at a dose of 10 μg extract showed an increase of 31% and 60% at 6 and 12 h of pretreatment, respectively. Cytotoxicity assays at the same dose and exposure time showed a 31.4% and 47.8% reduction in lactate dehydrogenase (LDH) activity and an increase in superoxide dismutase (SOD) activity. The results allow us to affirm that the methanolic foliar extract of "maca" presents in vitro neurobiological activity of antioxidant protection, increase in cell viability and reduction of cytotoxicity against oxidative stress generated by 6-OHDA. In conclusion, the present study shows a protective role for Lepidium meyenii leaf extract on 6-OHDA-induced toxicity by an antioxidant effect.

  14. Red Maca (Lepidium meyenii), a Plant from the Peruvian Highlands, Promotes Skin Wound Healing at Sea Level and at High Altitude in Adult Male Mice.

    Science.gov (United States)

    Nuñez, Denisse; Olavegoya, Paola; Gonzales, Gustavo F; Gonzales-Castañeda, Cynthia

    2017-12-01

    Nuñez, Denisse, Paola Olavegoya, Gustavo F. Gonzales, and Cynthia Gonzales-Castañeda. Red maca (Lepidium meyenii), a plant from the Peruvian highlands, promotes skin wound healing at sea level and at high altitude in adult male mice. High Alt Med Biol 18:373-383, 2017.-Wound healing consists of three simultaneous phases: inflammation, proliferation, and remodeling. Previous studies suggest that there is a delay in the healing process in high altitude, mainly due to alterations in the inflammatory phase. Maca (Lepidium meyenii) is a Peruvian plant with diverse biological properties, such as the ability to protect the skin from inflammatory lesions caused by ultraviolet radiation, as well as its antioxidant and immunomodulatory properties. The aim of this study was to determine the effect of high altitude on tissue repair and the effect of the topical administration of the spray-dried extract of red maca (RM) in tissue repair. Studies were conducted in male Balb/c mice at sea level and high altitude. Lesions were inflicted through a 10 mm-diameter excisional wound in the skin dorsal surface. Treatments consisted of either (1) spray-dried RM extract or (2) vehicle (VH). Animals wounded at high altitude had a delayed healing rate and an increased wound width compared with those at sea level. Moreover, wounding at high altitude was associated with an increase in inflammatory cells. Treatment with RM accelerated wound closure, decreased the level of epidermal hyperplasia, and decreased the number of inflammatory cells at the wound site. In conclusion, RM at high altitude generate a positive effect on wound healing, decreasing the number of neutrophils and increasing the number of macrophages in the wound healing at day 7 postwounding. This phenomenon is not observed at sea level.

  15. Efecto de cuatro ecotipos de Lepidium peruvianum Chacón sobre la producción de óxido nítrico in vitro

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available Los macrófagos desempeñan un rol importante en la respuesta innata y adaptativa, durante su activación producen mediadores citotóxicos como Óxido Nítrico (NO. El objetivo fue evaluar la producción de NO por macrófagos peritoneales de ratón cultivados con extractos metanólicos (EM de los ecotipos rojo, negro, morado y blanco de Lepidium peruvianum Chacón (también conocida como Lepidium meyenii Walp. Los EM se prepararon empleando maca pulverizada macerada en metanol (1:2 durante 10 días. Los macrófagos peritoneales se obtuvieron de ratones 3 días después de haberles inyectado 1 ml de Caldo Tioglicolato por vía intraperitoneal; se cultivaron por triplicado durante 18 h a 37 °C en medio RPMI 1640 suplementado con 10% de suero de bovino fetal. La dosis de EM fue de 800 μg/ml por ecotipo, se consideraron controles sin EM. La producción de NO se determinó por acumulación de nitrito en el medio y se evidenció con el reactivo de Peter Griess, las concentraciones de nitrito se calcularon en base a la curva estándar elaborada con NaNO2. Las concentraciones producidas de nitrito fueron de 7,45; 6,79; 5,76; 5,61 y 6,81 mM para los EM de los ecotipos morado, negro, blanco, rojo y control respectivamente. Los cuatro ecotipos indujeron la producción de NO, aunque con el ecotipo morado fue superior (p>0,05.

  16. Effect of organic fertilizers on quality and quantity characteristics of blond psyllium (Plantago ovata Forssk.) clasping peperweed (Lepidium perfoilatum L.), qodumeh Shirazi (Alyssum homolocarpum L.) and dragon's head (Lalementia iberica L.)

    OpenAIRE

    A. Koocheki; S. Amirmoradi; J. Shabahng; S. Kalantari Khandani

    2016-01-01

    This experiment was carried out in experimental farm of Agricultural Faculty of Ferdowsi University of Mashhad, Iran during 2010. The design was split plot with three replications. Main plots were the medicinal plant species consist of: blond psyllium (Plantago ovate Forssk.), clasping peperweed (Lepidium perfoilatum L.), qodumeh Shirazi (Alyssum homolocarpum L.) dragon's head (Lalementia iberica L.) and subplots were various organic fertilizer consist of cow manure, vermicompost (based on c...

  17. Four plant defensins from an indigenous South African Brassicaceae species display divergent activities against two test pathogens despite high sequence similarity in the encoding genes

    Directory of Open Access Journals (Sweden)

    de Beer Abré

    2011-10-01

    Full Text Available Abstract Background Plant defensins are an important component of the innate defence system of plants where they form protective antimicrobial barriers between tissue types of plant organs as well as around seeds. These peptides also have other activities that are important for agricultural applications as well as the medical sector. Amongst the numerous plant peptides isolated from a variety of plant species, a significant number of promising defensins have been isolated from Brassicaceae species. Here we report on the isolation and characterization of four defensins from Heliophila coronopifolia, a native South African Brassicaceae species. Results Four defensin genes (Hc-AFP1-4 were isolated with a homology based PCR strategy. Analysis of the deduced amino acid sequences showed that the peptides were 72% similar and grouped closest to defensins isolated from other Brassicaceae species. The Hc-AFP1 and 3 peptides shared high homology (94% and formed a unique grouping in the Brassicaceae defensins, whereas Hc-AFP2 and 4 formed a second homology grouping with defensins from Arabidopsis and Raphanus. Homology modelling showed that the few amino acids that differed between the four peptides had an effect on the surface properties of the defensins, specifically in the alpha-helix and the loop connecting the second and third beta-strands. These areas are implicated in determining differential activities of defensins. Comparing the activities after recombinant production of the peptides, Hc-AFP2 and 4 had IC50 values of 5-20 μg ml-1 against two test pathogens, whereas Hc-AFP1 and 3 were less active. The activity against Botrytis cinerea was associated with membrane permeabilization, hyper-branching, biomass reduction and even lytic activity. In contrast, only Hc-AFP2 and 4 caused membrane permeabilization and severe hyper-branching against the wilting pathogen Fusarium solani, while Hc-AFP1 and 3 had a mild morphogenetic effect on the fungus

  18. Toxicological aspects of the South American herbs cat's claw (Uncaria tomentosa) and Maca (Lepidium meyenii) : a critical synopsis.

    Science.gov (United States)

    Valerio, Luis G; Gonzales, Gustavo F

    2005-01-01

    Recent exceptional growth in human exposure to natural products known to originate from traditional medicine has lead to a resurgence of scientific interest in their biological effects. As a strategy for improvement of the assessment of their pharmacological and toxicological profile, scientific evidence-based approaches are being employed to appropriately evaluate composition, quality, potential medicinal activity and safety of these natural products. Using this approach, we comprehensively reviewed existing scientific evidence for known composition, medicinal uses (past and present), and documented biological effects with emphasis on clinical pharmacology and toxicology of two commonly used medicinal plants from South America with substantial human exposure from historical and current global use: Uncaria tomentosa (common name: cat's claw, and Spanish: uña de gato), and Lepidium meyenii (common name: maca). Despite the geographic sourcing from remote regions of the tropical Amazon and high altitude Andean mountains, cat's claw and maca are widely available commercially in industrialised countries. Analytical characterisations of their active constituents have identified a variety of classes of compounds of toxicological, pharmacological and even nutritional interest including oxindole and indole alkaloids, flavonoids, glucosinolates, sterols, polyunsaturated fatty acids, carbolines and other compounds. The oxindole alkaloids from the root bark of cat's claw are thought to invoke its most widely sought-after medicinal effects as a herbal remedy against inflammation. We find the scientific evidence supporting this claim is not conclusive and although there exists a base of information addressing this medicinal use, it is limited in scope with some evidence accumulated from in vitro studies towards understanding possible mechanisms of action by specific oxindole alkaloids through inhibition of nuclear factor (NF)-kappaB activation. Although controlled clinical

  19. Ameliorative effect of Draba nemorosa extract on chronic heart ...

    African Journals Online (AJOL)

    that TCM effectively treats symptoms, reduce side effects and reverse resistance via targeting multiple pathways. TCMs such as Shengmai [9],. Sini decoction [10], Shuanglong formula [11], and. Huangqi injection have been reported to exhibit potential pharmacological activities against cardiovascular diseases [12].

  20. The Impact of the Brassicaceae Plant Materials Added to the Soil on the Population of FUSARIUM SOLANI (Mart. SACC. and FUSARIUM OXYSPORUM Schlecht

    Directory of Open Access Journals (Sweden)

    Smolińska Urszula

    2014-09-01

    Full Text Available Soil with the spores of fungi in dormant stage from previous years infections belonging to the genus Fusarium caused significant loss of onion yield in Poland. The most important form of Fusarium inoculum in the field are chlamydospores, which may survive in soil for many years. There are no available methods to eradicate chlamydospores from soil environment. Inspired by data from the literature and own prelimi–nary observation, we evaluated the effect of application of Brassicaceae plant material to the soil infested with F. oxysporum and F. solani isolates, which are pathogenic to onion. Obtained results showed that addition of fresh plant material from B. juncea and B. alba had no effect on amount of Fusarium propagules in the soil. Moreover amendment of infested soil with dry plants or milled seeds of B. juncea or B. nigra significantly stimulated the population of Fusarium in the soil.

  1. A continental-wide perspective: the genepool of nuclear encoded ribosomal DNA and single-copy gene sequences in North American Boechera (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Christiane Kiefer

    Full Text Available 74 of the currently accepted 111 taxa of the North American genus Boechera (Brassicaceae were subject to pyhlogenetic reconstruction and network analysis. The dataset comprised 911 accessions for which ITS sequences were analyzed. Phylogenetic analyses yielded largely unresolved trees. Together with the network analysis confirming this result this can be interpreted as an indication for multiple, independent, and rapid diversification events. Network analyses were superimposed with datasets describing i geographical distribution, ii taxonomy, iii reproductive mode, and iv distribution history based on phylogeographic evidence. Our results provide first direct evidence for enormous reticulate evolution in the entire genus and give further insights into the evolutionary history of this complex genus on a continental scale. In addition two novel single-copy gene markers, orthologues of the Arabidopsis thaliana genes At2g25920 and At3g18900, were analyzed for subsets of taxa and confirmed the findings obtained through the ITS data.

  2. Efecto neuroprotector del Lepidium meyenii, ecotipo negro (maca negra) en ratas crías frente al daño cerebral inducido por la ingesta de sulfato ferroso y vitamina C durante la gestación de las ratas madre

    OpenAIRE

    Troncoso, Luzmila; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Guija, Emilio; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Palomino, Felio; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Soberón, Mercedes; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Oliveira, Gisela; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Núñez, Marco; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Flores, Juana; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Acuña, Sheresnarda; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú; Terrazas, Carmen; Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM. Lima, Perú

    2013-01-01

    Objetivo: Evaluar el efecto neuroprotector del Lepidium meyenii, ecotipo negro en ratas crías por ingesta de sulfato ferroso y vitamina C (SFC) durante la gestación de ratas madre. Diseño: Experimental, analítico. Institución: Centro de Investigación de Bioquímica y Nutrición. Material biológico: Lepidium meyenii, ecotipo negro (maca negra: MN), ratas. Intervenciones: Se distribuyeron 30 ratas albinas de dos meses de edad, en tres grupos. Tratamiento en los últimos 7 días de gestación: grupo ...

  3. Effect of chronic treatment with three varieties of Lepidium meyenii (Maca) on reproductive parameters and DNA quantification in adult male rats.

    Science.gov (United States)

    Gasco, M; Aguilar, J; Gonzales, G F

    2007-08-01

    The aim of this study was to evaluate the chronic effect of different varieties of Lepidium meyenii (Red Maca, Yellow Maca and Black Maca). Male rats were treated by gavage with aqueous extract of each variety of maca equivalent to 1 g hypocotyl kg(-1) body weight (BW) for 84 days. At the end of the treatment, daily sperm production (DSP), epididymal sperm count (ESC) and sperm count in vas deferens (SCVD) were assessed. In addition, testis DNA quantification was also determined. Any toxic effect was assessed in liver and spleen by histological studies. The results indicate that Yellow Maca and Black Maca improved ESC and that three varieties of maca increased the SCVD without affecting DSP. Moreover, testis DNA levels were not affected by treatment with any of the three varieties of maca. Histological picture of the liver in animals treated with the three varieties of maca was similar to that observed in controls. In conclusion, Yellow and Black Maca increased epididymal sperm count after 84 days of treatment without affecting DSP. Maca seems to act as a modulator of sperm count at the reproductive tract level.

  4. Hypocotyls of Lepidium meyenii (maca), a plant of the Peruvian highlands, prevent ultraviolet A-, B-, and C-induced skin damage in rats.

    Science.gov (United States)

    Gonzales-Castañeda, Cynthia; Gonzales, Gustavo F

    2008-02-01

    Lepidium meyenii (maca) is a plant that grows exclusively in the Peruvian Central Andes, where ultraviolet radiation (UVR) is predominant. Determine if two extracts of maca can provide dermal protection against UVR. We have administered two maca extracts (0.13 mg/ml), one obtained after boiling and the other without boiling, on the dorsal surface of male Holtzman rats exposed to UVC radiation once a week during 3 consecutive weeks. A dose-response effect of an aqueous extract of maca after a boiling process under exposure of rats to UVA, UVB, or UVC was also studied. A commercial sunscreen was used as a positive control. UVR caused significant increase in skin epidermal thickness. The epidermal height in animals treated with maca was similar to those who did not receive UVR. The aqueous extract of maca after a boiling process had better effect than maca extract without a boiling process. A dose-response effect was observed with increasing doses of aqueous extract of maca after a boiling process. Maca extract had benzyl glucosinolates and polyphenols. Maca extracts protect the skin of rats against UV irradiations and can be suggested as an alternative means of solar protection.

  5. Protective effect of polysaccharide from maca (Lepidium meyenii) on Hep-G2 cells and alcoholic liver oxidative injury in mice.

    Science.gov (United States)

    Zhang, Lijun; Zhao, Qingsheng; Wang, Liwei; Zhao, Mingxia; Zhao, Bing

    2017-06-01

    To study the characterization and hepatoprotective activity of polysaccharide from maca (Lepidium meyenii), the main polysaccharide from maca (MP-1) was obtained by DEAE-52 cellulose column. The average molecular weight of MP-1 was 1067.3kDa and the polysaccharide purity was 91.63%. In order to assess the antioxidant activities of MP-1, four kinds of methods were used, including scavenging hydroxyl radical, DPPH, superoxide anion radical, and FRAP, and the results indicated high antioxidant activities. Furthermore, hepatoprotective activity of MP-1 was studied both in vitro and vivo. In vitro, the alcohol induced Hep-G2 cells model was established to evaluate the protective effect of MP-1, which demonstrated MP-1 can alleviate alcohol damage in Hep-G2 cells. In vivo, the Institute of Cancer Researcch (ICR) mice were used to evaluate hepatoprotecive effects of MP-1 on alcoholic liver disease (ALD). Supplement with MP-1 supressed the triglyceride level both in serum and in hepatic tissue. In addition, MP-1 ameliorated serous transaminases increase induced by alcohol, including aspartate transaminase, alanine aminotransferase, and γ-glutamyl transpeptidase. Moreover, MP-1 also dramatically increased the superoxide dismutase, glutathione peroxidase, and glutathione s-transferase levels in alcoholic mice. Meantime, histopathologic results MP-1 lighten inflammation induced by alcohol. These results indicate that MP-1 possesses hepatoprotective activity against hepatic injury induced by alcohol. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Identification and characterization of microRNAs and their targets in high-altitude stress-adaptive plant maca (Lepidium meyenii Walp).

    Science.gov (United States)

    Paul, Sujay

    2017-06-01

    MicroRNAs (miRNAs) are endogenous, short (~21-nucleotide), non-coding RNA molecules that play pivotal roles in plant growth, development, and stress response signaling. In this study using recently published draft genome sequence of a high-altitude plant maca (Lepidium meyenii Walp) and applying genome-wide computational-based approaches, a total of 62 potentially conserved miRNAs belonging to 28 families were identified and four (lme-miR160a, lme-miR164c, lme-miR 166a, and lme-miR 319a) of them further validated by RT-PCR. Deploying psRNATarget tool a total of 99 potential miRNA target transcripts were also identified in maca. Targets include a number of transcription factors like Squamosa promoter-binding, NAC, MYB, auxin response factor, APETALA, WRKY, and F-box protein. To the best of my knowledge, this is the first genome-based miRNA profiling of a high-altitude plant.

  7. Long-term feeding of hydroalcoholic extract powder of Lepidium meyenii (maca) enhances the steroidogenic ability of Leydig cells to alleviate its decline with ageing in male rats.

    Science.gov (United States)

    Yoshida, K; Ohta, Y; Kawate, N; Takahashi, M; Inaba, T; Hatoya, S; Morii, H; Takahashi, K; Ito, M; Tamada, H

    2018-02-01

    This study examined whether feeding hydroalcoholic extract of Lepidium meyenii (maca) to 8-week-old (sexually maturing) or 18-week-old (mature) male rats for more than a half year affects serum testosterone concentration and testosterone production by Leydig cells cultured with hCG, 22R-hydroxycholesterol or pregnenolone. Testosterone concentration was determined in the serum samples obtained before and 6, 12, 18 and 24 weeks after the feeding, and it was significantly increased only at the 6 weeks in the group fed with the maca extract to maturing rats when it was compared with controls. Testosterone production by Leydig cells significantly increased when cultured with hCG by feeding the maca extract to maturing rats for 27 weeks (35 weeks of age) and when cultured with 22R-hydroxycholesterol by feeding it to mature rats for 30 weeks (48 weeks of age). Overall testosterone production by cultured Leydig cells decreased to about a half from 35 to 48 weeks of age. These results suggest that feeding the maca extract for a long time to male rats may enhance the steroidogenic ability of Leydig cells to alleviate its decline with ageing, whereas it may cause only a transient increase in blood testosterone concentration in sexually maturing male rats. © 2017 Blackwell Verlag GmbH.

  8. (+)-Meyeniins A-C, Novel Hexahydroimidazo[1,5-c]thiazole Derivatives from the Tubers of Lepidium meyenii: Complete Structural Elucidation by Biomimetic Synthesis and Racemic Crystallization.

    Science.gov (United States)

    Zhou, Min; Ma, Hang-Ying; Liu, Zhi-Hua; Yang, Guang-Yu; Du, Gang; Ye, Yan-Qing; Li, Gan-Peng; Hu, Qiu-Fen

    2017-03-08

    (+)-Meyeniins A-C (1-3), a novel class of sulfur-containing hexahydroimidazo[1,5-c]thiazole derivatives, were isolated from the tubers of Lepidium meyenii (maca) cultivated in Lijiang, Yunnan province, China. Guided by their biosynthetic hypothesis, a stereocontrolled biomimetic synthesis of meyeniins A-C and their individual enantiomers was efficiently accomplished by a combination of a condensation reaction and Edman degradation. The formation of high-quality crystals for X-ray crystallography occurred much more readily from a racemic mixture of (±)-meyeniin A than with the single enantiomer alone in this case. These extensive strategies, combined with circular dichroism (CD) spectra, allowed the complete structural assignments of (+)-meyeniins A-C. Among them, (+)-meyeniin A showed moderate selective cytotoxicities against the HL-60, A549 and MCF-7 human cell lines with IC 50 values of 14.41, 32.22, and 33.14 μM, respectively. To some extent, these findings support traditional applications of maca as healthy nutritional supplements or functional foods for cancer prevention.

  9. Aqueous extract of yellow maca (Lepidium meyenii) improves sperm count in experimental animals but response depends on hypocotyl size, pH and routes of administration.

    Science.gov (United States)

    Sanchez-Salazar, L; Gonzales, G F

    2018-04-01

    Lepidium meyenii, a Peruvian plant growing over 4000 m.a.s.l., has effects on nutrition and fertility. The purpose of this study was to evaluate the sperm count in 105 male mice receiving boiled aqueous extract of yellow maca hypocotyls from different sizes, under different pH conditions and using two different routes of administration. Five mice per group were treated daily for 3 days with vehicle (oral and intraperitoneal) or maca aqueous extracts (5 mg/0.5 ml/day) belonging to the first, second, third and fourth categories, according to their hypocotyl size. On day four, sperm count was evaluated at testis, epididymis and vas deferens. Sperm count was higher in mice receiving maca from the larger sizes (first and second categories). Reduction in maca extract pH increased sperm count, whereas an increase in the pH resulted in a reduction in sperm count. The effect of pH reduction is observed only in maca from the first and second categories. Aqueous extract of maca was effective only after oral administration. In conclusion, the larger size of hypocotyls presented the best biological effect, and the low pH in the extract and the transformation after gastrointestinal passage are both important for its biological action. © 2017 Blackwell Verlag GmbH.

  10. Subjective effects of Lepidium meyenii (Maca) extract on well-being and sexual performances in patients with mild erectile dysfunction: a randomised, double-blind clinical trial.

    Science.gov (United States)

    Zenico, T; Cicero, A F G; Valmorri, L; Mercuriali, M; Bercovich, E

    2009-04-01

    Lepidium meyenii (Maca) is a cultivated root belonging to the brassica family used in the Andean region for its supposed aphrodisiac properties. We carried out a double-blind clinical trial on 50 Caucasian men affected by mild erectile dysfunction (ED), randomised to treatment with Maca dry extract, 2400 mg, or placebo. The treatment effect on ED and subjective well-being was tested administrating before and after 12 weeks the International Index of Erectile Function (IIEF-5) and the Satisfaction Profile (SAT-P). After 12 weeks of treatment, both Maca- and placebo-treated patients experienced a significant increase in IIEF-5 score (P < 0.05 for both). However, patients taking Maca experienced a more significant increase than those taking placebo (1.6 +/- 1.1 versus 0.5 +/- 0.6, P < 0.001). Both Maca- and placebo-treated subjects experienced a significant improvement in psychological performance-related SAT-P score, but the Maca group higher than that of placebo group (+9 +/- 6 versus +6 +/- 5, P < 0.05). However, only Maca-treated patients experienced a significant improvement in physical and social performance-related SAT-P score compared with the baseline (+7 +/- 6 and +7 +/- 6, both P < 0.05). In conclusion, our data support a small but significant effect of Maca supplementation on subjective perception of general and sexual well-being in adult patients with mild ED.

  11. Effect of Lepidium meyenii Walp. on Semen Parameters and Serum Hormone Levels in Healthy Adult Men: A Double-Blind, Randomized, Placebo-Controlled Pilot Study.

    Science.gov (United States)

    Melnikovova, Ingrid; Fait, Tomas; Kolarova, Michaela; Fernandez, Eloy C; Milella, Luigi

    2015-01-01

    Background/Aims. Products of Lepidium meyenii Walp. (maca) are touted worldwide as an alimentary supplement to enhance fertility and restore hormonal balance. Enhancing properties of maca on semen parameters in animals were previously reported by various authors, but we present to the best of our knowledge the first double-blind, randomized, placebo-controlled pilot trial in men. The aim of this study was to evaluate the effects of maca on semen parameters and serum hormone levels in healthy adult men. Methods. A group of 20 volunteers aged 20-40 years was supplied by milled hypocotyl of maca or placebo (1.75 g/day) for 12 weeks. Negative controls of semen were compared to the samples after 6 and 12 weeks of maca administration; negative blood controls were compared to the samples after 12 weeks of treatment. Results. Sperm concentration and motility showed rising trends compared to placebo even though levels of hormones did not change significantly after 12 weeks of trial. Conclusion. Our results indicate that maca possesses fertility enhancing properties in men. As long as men prefer to use alimentary supplement to enhance fertility rather than prescribed medication or any medical intervention, it is worth continuing to assess its possible benefits.

  12. Feeding hydroalcoholic extract powder of Lepidium meyenii (maca) increases serum testosterone concentration and enhances steroidogenic ability of Leydig cells in male rats.

    Science.gov (United States)

    Ohta, Y; Yoshida, K; Kamiya, S; Kawate, N; Takahashi, M; Inaba, T; Hatoya, S; Morii, H; Takahashi, K; Ito, M; Ogawa, H; Tamada, H

    2016-04-01

    Although Lepidium meyenii (maca), a plant growing in Peru's central Andes, has been traditionally used for enhancing fertility and reproductive performance in domestic animals and human beings, effects of maca on reproductive organs are still unclear. This study examined whether feeding the hydroalcoholic extract powder of maca for 6 weeks affects weight of the reproductive organs, serum concentrations of testosterone and luteinising hormone (LH), number and cytoplasmic area of immunohistochemically stained Leydig cells, and steroidogenesis of cultured Leydig cells in 8-week-old male rats. Feeding the extract powder increased weight of seminal vesicles, serum testosterone level and cytoplasmic area of Leydig cells when compared with controls. Weight of prostate gland, serum LH concentration and number of Leydig cells were not affected by the maca treatment. The testosterone production by Leydig cells significantly increased when cultured with 22R-hydroxycholesterol or pregnenolone and tended to increase when cultured with hCG by feeding the extract powder. The results show that feeding the hydroalcoholic extract powder of maca for 6 weeks increases serum testosterone concentration associated with seminal vesicle stimulation in male rats, and this increase in testosterone level may be related to the enhanced ability of testosterone production by Leydig cells especially in the metabolic process following cholesterol. © 2015 Blackwell Verlag GmbH.

  13. Structural, electronic, topological and vibrational properties of a series of N-benzylamides derived from Maca (Lepidium meyenii) combining spectroscopic studies with ONION calculations

    Science.gov (United States)

    Chain, Fernando E.; Ladetto, María Florencia; Grau, Alfredo; Catalán, César A. N.; Brandán, Silvia Antonia

    2016-02-01

    In the present work, the structural, topological and vibrational properties of four members of the N-benzylamides series derived from Maca (Lepidium meyenii) whose names are, N-benzylpentadecanamide, N-benzylhexadecanamide, N-benzylheptadecanamide and N-benzyloctadecanamide, were studied combining the FTIR, FT-Raman and 1H and 13C-NMR spectroscopies with density functional theory (DFT) and ONION calculations. Furthermore, the N-benzylacetamide, N-benzylpropilamide and N-benzyl hexanamide derivatives were also studied in order to compare their properties with those computed for the four macamides. These seven N-benzylamides series have a common structure, C8H8NO-R, being R the side chain [-(CH2)n-CH3] with a variable n number of CH2 groups. Here, the atomic charges, molecular electrostatic potentials, stabilization energies, topological properties of those macamides were analyzed as a function of the number of C atoms of the side chain while the frontier orbitals were used to compute the gap energies and some descriptors in order to predict their reactivities and behaviors in function of the longitude of the side chain. Here, the force fields, the complete vibrational assignments and the corresponding force constants were only reported for N-benzylacetamide, N-benzyl hexanamide and N-benzylpentadecanamide due to the high number of vibration normal modes that present the remains macamides.

  14. Structural Characterization of a Novel Polysaccharide from Lepidium meyenii (Maca) and Analysis of Its Regulatory Function in Macrophage Polarization in Vitro.

    Science.gov (United States)

    Zhang, Mengmeng; Wu, Wenjia; Ren, Yao; Li, Xiaofeng; Tang, Yuqian; Min, Tian; Lai, Furao; Wu, Hui

    2017-02-15

    In our previous study, three novel polysaccharides, named MC-1, MC-2, and MC-3, were separated from the roots of maca (Lepidium meyenii), which is a food source from the Andes region. The structural information and immunomodulatory activity of MC-1 were then investigated. The structure and activity of MC-2 are still unknown. In this study, structural characterization revealed that MC-2 has an average molecular weight of 9.83 kDa and is composed of arabinose (20.9%), mannose (4.5%), glucose (71.9%), and galactose (2.7%). The main linkage types of MC-2 were proven to be (1→5)-α-l-Ara, (1→3)-α-l-Man, (1→)-α-d-Glc, (1→4)-α-d-Glc, (1→6)-α-d-Glc, and (1→6)-β-d-Gal by methylation and NMR analyses. Congo red assay showed that MC-2 possesses a triple-helix conformation. Immunostimulating assays indicated that MC-2 could induce M1 polarization of original macrophages and convert M2 macrophages into M1 phenotype. Although MC-2 could not shift M1 macrophages into M2, it could still inhibit inflammatory reactions induced by lipopolysaccharide. Furthermore, Toll-like receptor 2, tTll-like receptor 4, complement receptor 3, and mannose receptor were confirmed as the membrane receptors for MC-2 on macrophages. These results indicate that MC-2 could potentially be used toward hypoimmunity and tumor therapies.

  15. Photoprotection against the UVB-induced oxidative stress and epidermal damage in mice using leaves of three different varieties of Lepidium meyenii (maca).

    Science.gov (United States)

    Gonzales-Castañeda, Cynthia; Rivera, Valery; Chirinos, Ana Lucía; Evelson, Pablo; Gonzales, Gustavo Francisco

    2011-08-01

    Skin exposure to ultraviolet (UV) B radiation leads to epidermal damage and generation of reactive oxygen species. The photoprotective effect of extracts of three varieties of leaves (red, yellow, and black) from maca (Lepidium meyenii), a plant from the Peruvian highlands, was assessed in mouse skin exposed to UVB radiation. The hydroalcoholic extracts of three varieties of maca leaves were applied topically to the dorsal skin of young-adult male mice prior to exposition to UVB radiation. The three varieties had UVA/UVB absorptive properties and presented antioxidant activity, being highest with red maca, followed by black and yellow maca. The three varieties of maca leaves prevented the development of sunburn cells, epidermal hyperplasia, leukocytic infiltration, and other alterations produced by UVB radiation. Mice treated with black maca showed the highest superoxide dismutase levels, and mice treated with black and yellow maca showed higher catalase levels in skin, whereas red maca protected the skin and liver against significant increases in the lipid peroxidation activity observed in the unprotected animals. The presence of significant antioxidant activity and the inhibition of lipid peroxidation suggest that the observed protection could be partly attributable to this mechanism. © 2011 The International Society of Dermatology.

  16. Effect of Lepidium meyenii Walp. on Semen Parameters and Serum Hormone Levels in Healthy Adult Men: A Double-Blind, Randomized, Placebo-Controlled Pilot Study

    Science.gov (United States)

    Melnikovova, Ingrid; Fait, Tomas; Kolarova, Michaela; Fernandez, Eloy C.

    2015-01-01

    Background/Aims. Products of Lepidium meyenii Walp. (maca) are touted worldwide as an alimentary supplement to enhance fertility and restore hormonal balance. Enhancing properties of maca on semen parameters in animals were previously reported by various authors, but we present to the best of our knowledge the first double-blind, randomized, placebo-controlled pilot trial in men. The aim of this study was to evaluate the effects of maca on semen parameters and serum hormone levels in healthy adult men. Methods. A group of 20 volunteers aged 20–40 years was supplied by milled hypocotyl of maca or placebo (1.75 g/day) for 12 weeks. Negative controls of semen were compared to the samples after 6 and 12 weeks of maca administration; negative blood controls were compared to the samples after 12 weeks of treatment. Results. Sperm concentration and motility showed rising trends compared to placebo even though levels of hormones did not change significantly after 12 weeks of trial. Conclusion. Our results indicate that maca possesses fertility enhancing properties in men. As long as men prefer to use alimentary supplement to enhance fertility rather than prescribed medication or any medical intervention, it is worth continuing to assess its possible benefits. PMID:26421049

  17. Prevalencia de hongos en harina de Lepidium peruvianum «Maca» en mercados de Andahuaylas, Ica y Cañete - Perú

    Directory of Open Access Journals (Sweden)

    Alfonso Orellana

    2013-05-01

    Full Text Available Se determinó la prevalencia de hongos en la harina de Lepidium peruvianum «maca» en un total de 60 muestras procedentes de los mercados de Andahuaylas (20, Ica (20 y Cañete (20. Las muestras fueron procesadas mediante el método de diluciones sucesivas y sembradas en superficie en Agar Papa Dextrosa (APD. El 96,7% del total de muestras estaban contaminadas; identificándose 9 géneros y un total de 14 especies de mohos filamentosos, incluyendo uno clasificado como Mycelia sterilia. El recuento general de colonias va desde 33x104 a 61x104 UFC/g., no existiendo diferencia significativa entre los centros de expendio. Los géneros con mayor incidencia fueron Penicillium y Fusarium. La alta prevalencia de hongos contaminantes en la harina de maca sugieren continuar estudios destinados a evaluar el efecto y riesgo sanitario que representa su consumo para la salud humana.

  18. Effect of Lepidium meyenii Walp. on Semen Parameters and Serum Hormone Levels in Healthy Adult Men: A Double-Blind, Randomized, Placebo-Controlled Pilot Study

    Directory of Open Access Journals (Sweden)

    Ingrid Melnikovova

    2015-01-01

    Full Text Available Background/Aims. Products of Lepidium meyenii Walp. (maca are touted worldwide as an alimentary supplement to enhance fertility and restore hormonal balance. Enhancing properties of maca on semen parameters in animals were previously reported by various authors, but we present to the best of our knowledge the first double-blind, randomized, placebo-controlled pilot trial in men. The aim of this study was to evaluate the effects of maca on semen parameters and serum hormone levels in healthy adult men. Methods. A group of 20 volunteers aged 20–40 years was supplied by milled hypocotyl of maca or placebo (1.75 g/day for 12 weeks. Negative controls of semen were compared to the samples after 6 and 12 weeks of maca administration; negative blood controls were compared to the samples after 12 weeks of treatment. Results. Sperm concentration and motility showed rising trends compared to placebo even though levels of hormones did not change significantly after 12 weeks of trial. Conclusion. Our results indicate that maca possesses fertility enhancing properties in men. As long as men prefer to use alimentary supplement to enhance fertility rather than prescribed medication or any medical intervention, it is worth continuing to assess its possible benefits.

  19. Bioactivity of Dianthus caryophyllus, Lepidium sativum, Pimpinella anisum, and Illicium verum essential oils and their major components against the West Nile vector Culex pipiens.

    Science.gov (United States)

    Kimbaris, Athanasios C; Koliopoulos, George; Michaelakis, Antonios; Konstantopoulou, Maria A

    2012-12-01

    Mosquitoes constitute a severe health problem in many areas all over the world. There are many regions of the tropics and subtropics where mosquitoes are one of the main reasons for inhibiting the economic upgrade. Except nuisance, their medical importance is another matter of attention since mosquitoes are vectors for a wide variety of vector-borne diseases. Due to disadvantages of currently used chemical control methods, it is unavoidable to search for eco-friendly new molecules. We report herein the evaluation of the larvicidal effect exhibited by essential oils of Dianthus caryophyllus, Lepidium sativum, Pimpinella anisum, and Illicium verum against late third to early fourth instar mosquito larvae of Culex pipiens. Furthermore, phytochemical analysis of plant samples revealed their major compounds to be β-caryophyllene, eugenol, eucalyptol, α-terpinyl acetate, and (E)-anethole which were also tested for their potential larvicidal activity. For D. caryophyllus and L. sativum, this was the first report on the chemical composition of their essential oils. The essential oils of I. verum and P. anisum demonstrated high larvicidal activity with a LC(50) <18 mg L(-1). The other two essential oils of D. caryophyllus and L. sativum revealed moderate larvicidal activity, displaying a LC(50) value above 50 mg L(-1). Among the pure components, the most toxic were eugenol, (E)-anethole, and α-terpinyl acetate, with LC(50) values 18.28, 16.56, and 23.03 mg L(-1), respectively. Eucalyptol (1,8 cineole) and β-caryophyllene were inactive at concentrations even as high as 100 mg L(-1), showing the least significant activity against mosquito larvae. Results allow some rationalization on the relative importance of the major compounds regarding the larvicidal activity of selected essential oils and their potential use as vector control agents.

  20. The Influence of pH of Extracting Water on the Composition of Seaweed Extracts and Their Beneficial Properties onLepidium sativum.

    Science.gov (United States)

    Godlewska, Katarzyna; Michalak, Izabela; Tuhy, Łukasz; Chojnacka, Katarzyna

    2017-01-01

    Baltic seaweeds were used to obtain aqueous extracts (E) through changing initial pH of deionised water added to algal biomass (EpH3·H 2 O, EpH7·H 2 O, and EpH10·H 2 O) and through changing pH of the mixture of algae and deionised water (EpH3, EpH7, and EpH10). Algal extracts were characterized in terms of the concentration of polyphenols and micro- and macroelements. The highest concentration of polyphenols was determined in extract EpH3 and the lowest in extract EpH10·H 2 O. It was found that the obtained extracts had similar concentrations of elements (except EpH3). The phytotoxicity of algal extracts (0.5, 2.5, and 10%) was examined in the germination tests on Lepidium sativum . No phytotoxic effects were observed. It was found that they had beneficial effects on the cultivated plants (length and weight). The best biostimulant effect was observed in the groups treated with EpH3 (2.5%), EpH7 (2.5%), and EpH7 (10%). The dry weight of plants was similar in all the groups. Algal extract also improved the multielemental composition of plant. The greatest concentration of total chlorophyll in plants was obtained by using extract EpH10·H 2 O, 0.5%. These results proved that algal extracts have high potential to be applied in cultivation of plants.

  1. Efecto bifidogénico de jalea de Lepidium meyenii Walp. “maca” en el recuento de Bifidobacterium bifidum en yogurt probiótico

    Directory of Open Access Journals (Sweden)

    María Elena León Marroú

    2011-01-01

    Full Text Available Los recuentos de Bifidobacterium bifidum en yogures probióticos tienden a disminuir de manera significativa por diferentes factores: pH, oxígeno disuelto, composición antagónica entre las especies, la composición química del medio, temperatura de almacenamiento, entre otros. Para asegurar que la eficacia de los productos que contienen B. bifidum sea máxima a menudo se incluyen factores bifidogénicos, los cuales tienen la propiedad de promover no solo el crecimiento adecuado, sino también su viabilidad durante el almacenamiento del producto final. El presente estudio investigó sobre el recuento de B. bifidum en yogurt probiótico elaborado en condiciones de laboratorio en relación a dos variables: adición de tres concentraciones diferentes de jalea de Lepidium meyenii “maca” (10 %, 20 % y 30 % y tiempo de almacenamiento. Se realizó el recuento de B. bifidum cada tres días, durante un mes. Se utilizó el método de recuento en placa por siembra en profundidad. Los resultados indicaron que todas las muestras a las que se añadieron jalea de L. meyenii “maca” en diferentes concentraciones mantuvieron recuentos de B. bifidum por encima de los valores establecidos por las normas internacionales. Se concluye que L. meyenii “maca”, en razón de algunos de sus componentes, ejerció un efecto bifidogénico y en concentración de 30 % de jalea fue mayor.

  2. Efecto bifidogénico de jalea de Lepidium meyenii Walp. “maca” en el recuento de Bifidobacterium bifidum en yogurt probiótico

    Directory of Open Access Journals (Sweden)

    María Elena León Marroú

    2011-06-01

    Full Text Available Los recuentos de Bifidobacterium bifidum en yogures probióticos tienden a disminuir de manera significativa por diferentes factores: pH, oxígeno disuelto, composición antagónica entre las especies, la composición química del medio, temperatura de almacenamiento, entre otros. Para asegurar que la eficacia de los productos que contienen B. bifidum sea máxima a menudo se incluyen factores bifidogénicos, los cuales tienen la propiedad de promover no solo el crecimiento adecuado, sino también su viabilidad durante el almacenamiento del producto final. El presente estudio investigó sobre el recuento de B. bifidum en yogurt probiótico elaborado en condiciones de laboratorio en relación a dos variables: adición de tres concentraciones diferentes de jalea de Lepidium meyenii “maca” (10 %, 20 % y 30 % y tiempo de almacenamiento. Se realizó el recuento de B. bifidum cada tres días, durante un mes. Se utilizó el método de recuento en placa por siembra en profundidad. Los resultados indicaron que todas las muestras a las que se añadieron jalea de L. meyenii “maca” en diferentes concentraciones mantuvieron recuentos de B. bifidum por encima de los valores establecidos por las normas internacionales. Se concluye que L. meyenii “maca”, en razón de algunos de sus componentes, ejerció un efecto bifidogénico y en concentración de 30 % de jalea fue mayor.

  3. Role of maca (Lepidium meyenii) consumption on serum interleukin-6 levels and health status in populations living in the Peruvian Central Andes over 4000 m of altitude.

    Science.gov (United States)

    Gonzales, Gustavo F; Gasco, Manuel; Lozada-Requena, Ivan

    2013-12-01

    Lepidium meyenii (Maca) is a plant that grows at over 4,000 m above sea level in the central Peruvian Andes. The hypocotyls of this plant are traditionally consumed for their nutritional and medicinal properties. The aim of this study was to determine the health status based on a health related quality of life (HRQL) questionnaire (SF-20) and serum levels of interleukin 6 (IL-6) in subjects that are maca consumers. For this, a cross-sectional study was designed to be performed in 50 subjects from Junin (4,100 m): 27 subjects were maca consumers and 23 were non-consumers. The SF-20 survey is used to obtain a summary measure of health status. The stand up from a chair and sit down (SUCSD) test (to assess lower-extremity function), hemoglobin measurement, blood pressure, sexual hormone levels, serum IL-6 levels and the score of chronic mountain sickness (CMS) were evaluated. Testosterone/estradiol ratio (P <0.05), IL-6 (P < 0.05) and CMS score were lower, whereas the health status score was higher, in maca consumers when compared to non-consumers (P < 0.01). A greater proportion of maca consumers successfully completed the SUCSD test compared to non-consumers (P < 0.01), showing a significant association with lower values of serum IL-6 (P < 0.05). In conclusion, consumption of maca was associated with low serum IL-6 levels and in turn with better health status scores in the SF-20 survey and low chronic mountain sickness scores.

  4. Effect of gamma irradiation on phenol content, antioxidant activity and biological activity of black maca and red maca extracts (Lepidium meyenii walp).

    Science.gov (United States)

    Zevallos-Concha, A; Nuñez, D; Gasco, M; Vasquez, C; Quispe, M; Gonzales, G F

    2016-01-01

    This study was performed to determine the effects of gamma irradiation on UV spectrum on maca, total content of polyphenols, 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical-scavenging activities and in vivo biological activities of red and black maca extracts (Lepidium meyenii). Adult mice of the strain Swiss aged 3 months and weighing 30-35 g in average were used to determine biological activities. Daily sperm production, effect on testosterone-induced prostate hyperplasia and forced swimming test were used to determine the effect of irradiation on biological activities of maca extracts. Irradiation did not show differences in UV spectrum but improves the amount of total polyphenols in red maca as well as in black maca extracts. In both cases, black maca extract has more content of polyphenols than red maca extract (p  0.05). Black maca extract but not red maca extract has more swimming endurance capacity in the forced swimming test. Irradiation of black maca extract increased the swimming time to exhaustion (p  0.05). Testosterone enanthate (TE) increased significantly the ventral prostate weight. Administration of red maca extract in animals treated with TE prevented the increase in prostate weight. Irradiation did not modify effect of red maca extract on prostate weight (p > 0.05). In conclusion, irradiation does not alter the biological activities of both black maca and red maca extracts. It prevents the presence of microorganisms in the extracts of black or red maca, but the biological activities were maintained.

  5. Peruvian Maca (Lepidium peruvianum) - III: The Effects of Cultivation Altitude on Phytochemical and Genetic Differences in the Four Prime Maca Phenotypes.

    Science.gov (United States)

    Meissner, Henry O; Mscisz, Alina; Baraniak, Marek; Piatkowska, Ewa; Pisulewski, Pawel; Mrozikiewicz, Mieczyslaw; Bobkiewicz-Kozlowska, Teresa

    2017-06-01

    In two trials, dietary and Glucosinolates' characteristics in four Maca phenotypes have been examined with an extension into the determination of DNA sequences. Hypocotyls of the four prime phenotypes of Peruvian Maca - Lepidium peruvianum Chacon, labelled as "Yellow", "Black", "Red" and "Purple" were separated from mixed Maca crops cultivated in four geographically-distant locations in the Peruvian Andes at altitudes between 2,800m and 4,300 m a.s.l. It was found that at higher altitudes where Red and Purple Maca phenotypes were grown, the significantly higher ( P Maca physiological activity, were observed with the Purple phenotype showing the highest Glucosinolates' content at 4,300m a.s.l., followed by the Red-coloured hypocotyls. Black Maca showed a reversal, but also a significant ( P 0.05) and has consistently the lowest Glucosinolates content. Thus, it is reasonable to assume that the altitude at which Red, Purple and Black phenotypes of L. peruvianum are grown, may be responsible for the variation in physiologic functionalities, leading to different than expected specific therapeutic and health benefits induced by Maca phenotypes grown at diverse altitudes. Although promising, insufficiently precise differences in DNA sequences failed to distinguish, without any reasonable doubt, four Maca phenotypes cultivated either in the same or geographically-distant locations, and harvested at different altitudes a.s.l. Further research on DNA sequences is needed, with more primers and larger number of Maca phenotypes, considering biosynthesis of secondary metabolites and adaptation pathways induced by harsh environment at altitudes where Maca is cultivated.

  6. Hormone-Balancing Effect of Pre-Gelatinized Organic Maca (Lepidium peruvianum Chacon): (I) Biochemical and Pharmacodynamic Study on Maca using Clinical Laboratory Model on Ovariectomized Rats.

    Science.gov (United States)

    Meissner, H O; Mrozikiewicz, P; Bobkiewicz-Kozlowska, T; Mscisz, A; Kedzia, B; Lowicka, A; Reich-Bilinska, H; Kapczynski, W; Barchia, I

    2006-09-01

    Ovariectomized rats were used in a model laboratory study to examine biochemical and pharmacodynamic effects of pre-gelatinized organic preparation of Lepidium peruvianum Chacon (Maca-GO). Biochemical and Pharmacodynamic effects of Maca-GO (250 mg Maca-GO per kg body weight (bw) administered by intubation twice daily) were assessed in a 28 day model laboratory study on ovariectomized (by laparoscopy) Wistar rats with pharmacodynamic tests performed at the conclusion of the trial followed by blood collection for morphology and biochemical tests. Toxicity of Maca-GO used in the study was determined in bioassay on mice and rats. Anti-depressive function (Porsolt's test) and anxiolytic sedative and cognitive effects (using elevated-plus maze, locomotor activity and passive avoidance tests) were assessed against control (laparotomized female rats with intact ovaries). In addition to blood morphology, the following blood serum constituents were analyzed: Estrogen (E2), Progesterone (PGS), Cortisol (CT), Adrenocorticotropic Hormone (ACTH), Thyroid Hormones (TSH, T3, and T4), Iron (Fe) and lipid profile (Triglycerides, Total Cholesterol, LDL, HDL). Analytically-determined non-toxic status of Maca-GO was confirmed in bioassays when applied to mice and rats at levels of 0.5 and up to 15mg/kg bw which shows it safe use in humans with the LD50>15 mg/kg bw. Maca-GO showed a distinctive, (PMaca-GO on sex hormone levels show its potential as a safe preparation for use in correcting physiological symptoms characteristic in postmenopausal stage with an indication of potentially even more value for its use in pre-menopausal women.

  7. Peruvian Maca (Lepidium peruvianum) – III: The Effects of Cultivation Altitude on Phytochemical and Genetic Differences in the Four Prime Maca Phenotypes

    Science.gov (United States)

    Meissner, Henry O.; Mscisz, Alina; Baraniak, Marek; Piatkowska, Ewa; Pisulewski, Pawel; Mrozikiewicz, Mieczyslaw; Bobkiewicz-Kozlowska, Teresa

    2017-01-01

    In two trials, dietary and Glucosinolates’ characteristics in four Maca phenotypes have been examined with an extension into the determination of DNA sequences. Hypocotyls of the four prime phenotypes of Peruvian Maca - Lepidium peruvianum Chacon, labelled as “Yellow”, “Black”, “Red” and “Purple” were separated from mixed Maca crops cultivated in four geographically-distant locations in the Peruvian Andes at altitudes between 2,800m and 4,300 m a.s.l. It was found that at higher altitudes where Red and Purple Maca phenotypes were grown, the significantly higher (PMaca physiological activity, were observed with the Purple phenotype showing the highest Glucosinolates’ content at 4,300m a.s.l., followed by the Red-coloured hypocotyls. Black Maca showed a reversal, but also a significant (P0.05) and has consistently the lowest Glucosinolates content. Thus, it is reasonable to assume that the altitude at which Red, Purple and Black phenotypes of L. peruvianum are grown, may be responsible for the variation in physiologic functionalities, leading to different than expected specific therapeutic and health benefits induced by Maca phenotypes grown at diverse altitudes. Although promising, insufficiently precise differences in DNA sequences failed to distinguish, without any reasonable doubt, four Maca phenotypes cultivated either in the same or geographically-distant locations, and harvested at different altitudes a.s.l. Further research on DNA sequences is needed, with more primers and larger number of Maca phenotypes, considering biosynthesis of secondary metabolites and adaptation pathways induced by harsh environment at altitudes where Maca is cultivated. PMID:28824342

  8. The Influence of pH of Extracting Water on the Composition of Seaweed Extracts and Their Beneficial Properties on Lepidium sativum

    Directory of Open Access Journals (Sweden)

    Katarzyna Godlewska

    2017-01-01

    Full Text Available Baltic seaweeds were used to obtain aqueous extracts (E through changing initial pH of deionised water added to algal biomass (EpH3·H2O, EpH7·H2O, and EpH10·H2O and through changing pH of the mixture of algae and deionised water (EpH3, EpH7, and EpH10. Algal extracts were characterized in terms of the concentration of polyphenols and micro- and macroelements. The highest concentration of polyphenols was determined in extract EpH3 and the lowest in extract EpH10·H2O. It was found that the obtained extracts had similar concentrations of elements (except EpH3. The phytotoxicity of algal extracts (0.5, 2.5, and 10% was examined in the germination tests on Lepidium sativum. No phytotoxic effects were observed. It was found that they had beneficial effects on the cultivated plants (length and weight. The best biostimulant effect was observed in the groups treated with EpH3 (2.5%, EpH7 (2.5%, and EpH7 (10%. The dry weight of plants was similar in all the groups. Algal extract also improved the multielemental composition of plant. The greatest concentration of total chlorophyll in plants was obtained by using extract EpH10·H2O, 0.5%. These results proved that algal extracts have high potential to be applied in cultivation of plants.

  9. Zn, Cd and Pb accumulation and arbuscular mycorrhizal colonisation of pennycress Thlaspi praecox Wulf. (Brassicaceae) from the vicinity of a lead mine and smelter in Slovenia

    International Nuclear Information System (INIS)

    Vogel-Mikus, Katarina; Drobne, Damjana; Regvar, Marjana

    2005-01-01

    Significant hyperaccumulation of Zn, Cd and Pb in field samples of Thlaspi praecox Wulf. collected from a heavy metal polluted area in Slovenia was found, with maximal shoot concentrations of 14590 mg kg -1 Zn, 5960 mg kg -1 Cd and 3500 mg kg -1 Pb. Shoot/root ratios of 9.6 for Zn and 5.6 for Cd show that the metals were preferentially transported to the shoots. Shoot bioaccumulation factors exceeded total soil Cd levels 75-fold and total soil Zn levels 20-fold, further supporting the hyperaccumulation of Cd and Zn. Eighty percent of Pb was retained in roots, thus indicating exclusion as a tolerance strategy for Pb. Low level colonisation with arbuscular mycorrhizal fungi (AMF) of a Paris type was observed at the polluted site, whereas at the non-polluted site Arum type colonisation was more common. To our knowledge this is the first report of Cd hyperaccumulation and AMF colonisation in metal hyperaccumulating T. praecox. - Thlaspi praecox Wulf. (Brassicaceae) is a newly discovered Cd, Zn and Pb hyperaccumulator able to form symbiosis with arbuscular mycorrhizal fungi

  10. A Pollen Coat–Inducible Autoinhibited Ca2+-ATPase Expressed in Stigmatic Papilla Cells Is Required for Compatible Pollination in the Brassicaceae[W

    Science.gov (United States)

    Iwano, Megumi; Igarashi, Motoko; Tarutani, Yoshiaki; Kaothien-Nakayama, Pulla; Nakayama, Hideki; Moriyama, Hideki; Yakabe, Ryo; Entani, Tetsuyuki; Shimosato-Asano, Hiroko; Ueki, Masao; Tamiya, Gen; Takayama, Seiji

    2014-01-01

    In the Brassicaceae, intraspecific non-self pollen (compatible pollen) can germinate and grow into stigmatic papilla cells, while self-pollen or interspecific pollen is rejected at this stage. However, the mechanisms underlying this selective acceptance of compatible pollen remain unclear. Here, using a cell-impermeant calcium indicator, we showed that the compatible pollen coat contains signaling molecules that stimulate Ca2+ export from the papilla cells. Transcriptome analyses of stigmas suggested that autoinhibited Ca2+-ATPase13 (ACA13) was induced after both compatible pollination and compatible pollen coat treatment. A complementation test using a yeast Saccharomyces cerevisiae strain lacking major Ca2+ transport systems suggested that ACA13 indeed functions as an autoinhibited Ca2+ transporter. ACA13 transcription increased in papilla cells and in transmitting tracts after pollination. ACA13 protein localized to the plasma membrane and to vesicles near the Golgi body and accumulated at the pollen tube penetration site after pollination. The stigma of a T-DNA insertion line of ACA13 exhibited reduced Ca2+ export, as well as defects in compatible pollen germination and seed production. These findings suggest that stigmatic ACA13 functions in the export of Ca2+ to the compatible pollen tube, which promotes successful fertilization. PMID:24569769

  11. Characterization and structural features of a chalcone synthase mutation in a white-flowering line of Matthiola incana R. Br. (Brassicaceae).

    Science.gov (United States)

    Hemleben, Vera; Dressel, Angela; Epping, Bernhard; Lukacin, Richard; Martens, Stefan; Austin, Michael

    2004-05-01

    For Matthiola incana (Brassicaceae), used as a model system to study biochemical and genetical aspects of anthocyanin biosynthesis, several nearly isogenic colored wild type lines and white-flowering mutant lines are available, each with a specific defect in the genes responsible for anthocyanin production (genes e, f, and g). For gene f supposed to code for chalcone synthase (CHS; EC 2.3.1.74), the key enzyme of the flavonoid/anthocyanin biosynthesis pathway belonging to the group of type III polyketide synthases (PKS), the wild type genomic sequence of M. incana line 04 was determined in comparison to the white-flowering CHS mutant line 18. The type of mutation in the chs gene was characterized as a single nucleotide substitution in a triplet AGG coding for an evolutionary conserved arginine into AGT coding for serine (R72S). Northern blots and RT-PCR demonstrated that the mutated gene is expressed in flower petals. Heterologous expression of the wild type and mutated CHS cDNA in E. Scherichia coli, verified by Western blotting and enzyme assays with various starter molecules, revealed that the mutant protein had no detectable activity, indicating that the strictly conserved arginine residue is essential for the enzymatic reaction. This mutation, which previously was not detected by mutagenic screening, is discussed in the light of structural and functional information on alfalfa CHS and related type III PKS enzymes.

  12. Extracto acuoso de Lepidium meyenii Walp (maca y su papel como adaptógeno, en un modelo animal de resistencia física

    Directory of Open Access Journals (Sweden)

    Silvia Suárez

    2009-09-01

    Full Text Available Introducción: El Lepidium meyenii Walp (maca es una raíz andina del Perú, utilizada como alimento por su valor nutricional y propiedades etnomedicinales; es parte de la medicina tradicional. Objetivos: Evaluar el papel de adaptógeno del extracto acuoso de maca amarilla sobre las enzimas del tejido muscular en un modelo animal de resistencia física y estrés oxidativo. Diseño: Experimental. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM, Lima, Perú. Material biológico: Extracto acuoso de la maca amarilla y ratas macho recién destetados. Intervenciones: Administración del extracto acuoso de la maca amarilla en ratas macho recién destetados, distribuidos en cuatro grupos: (I, de control, (II 0,4 mg de maca/g de peso (III 0,8 mg de maca/g de peso y (IV, 1,2 mg de maca/g de peso. El extracto acuoso fue administrado por cánula orogástrica. Se realizó un control de los pesos. Se aplicó la prueba de nado forzado después de 30 días de tratamiento. Los animales fueron sacrificados y se preparó homogenizado de músculo al 10%. Principales medidas de resultados: Actividad de las enzimas superóxido dismutasa (SOD, catalasa (CAT y lactato deshidrogenasa (LDH; y, como indicador de proceso oxidativo, se midió la peroxidación lipídica (TBARS. Resultados: El rendimiento en la prueba de resistencia fue la siguiente: (I 7,09 min; (II 11,25 min; (III 11,27 min; (IV 12,71 min, respectivamente. Las actividades enzimáticas de los grupos I, II, III y IV fueron: SOD (U/mL 36,6, 18,2, 17,2 y 18,2; CAT (U/L 18,6, 16,5, 13,4 y 10,3; y LDH (U/mL 11,6, 6,5, 6,0 y 5,8. TBARS (umol/g tejido: 5,82, 7,15, 4,11 y 4,06. Conclusiones: La administración del extracto acuoso de maca amarilla favorece la respuesta del organismo a una situación estresante y físicamente extenuante, lo que correspondería al papel de un adaptógeno.

  13. Influences of dietary supplementation with Lepidium meyenii (Maca) on stallion sperm production and on preservation of sperm quality during storage at 5 °C.

    Science.gov (United States)

    Del Prete, C; Tafuri, S; Ciani, F; Pasolini, M P; Ciotola, F; Albarella, S; Carotenuto, D; Peretti, V; Cocchia, N

    2018-03-01

    Stallion semen is damaged by oxidative stress during cooling and transport. Semen processing and extenders have been tested to improve the fertilizing capacity of semen and to preserve semen during transport. Dietary supplementation with natural antioxidants has been proposed to prevent oxidative damages. In this study, for the first time, the effect of dietary supplementation with Lepidium meyenii (Maca) on the characteristics of fresh and chilled stallion semen was evaluated. Maca is a traditional Andean crop used as a nutraceutical for the fertility-enhancing properties that are linked with antioxidant activity. The diet of five stallions was supplemented with 20 g of Maca powder daily for a total of 60 days. A control group of five stallions received the same diet without Maca. Semen was collected once before the administration of Maca (D0), twice during the administration at 30 and 60 days (D30 and D60), and finally twice at 30 and 60 days after the end of the administration (D90 and D120). Ejaculates were processed for cooled shipping at 5 °C and evaluated in the laboratory for total and progressive motility, acrosome integrity, and lipid peroxidation after collection and after 24, 48, and 72 h of storage. Dietary supplementation with Maca improved sperm concentration (from 213 ± 80.4 to 447 ± 73.1 × 10 6 spz/mL) and total sperm count (from 10,880 ± 4377 to 24,783 ± 4419 × 10 6 spz). The beneficial effects of Maca supplementation on motility and acrosome integrity in the raw semen were detected from the end of treatment with Maca (D60) until the end of the study (D120). Furthermore, during cooling storage, total motility, progressive motility, and acrosome integrity declined more slowly in the Maca-treated group than in the control group. Lipid peroxidation did not change during cooling storage in either group and did not show a significant difference between the two groups. In this study, the dietary supplementation with Maca

  14. Short and long-term physiological responses of male and female rats to two dietary levels of pre-gelatinized maca (lepidium peruvianum chacon).

    Science.gov (United States)

    Meissner, H O; Kedzia, B; Mrozikiewicz, P M; Mscisz, A

    2006-02-01

    The aim of this study is to identify physiological responses of male and female rats to either a short- or long-term administration of two doses of Maca (Lepidium peruvianum) and observe relationships which may exist between groups of hormones and effects mediated by them. The effect of pre-gelatinized (extruded) organic Maca powder (Maca-GO) was studied on Sprague-Dowley male and female rats (1:1 ratio) receiving two dietary levels of Maca-GO (0.75 g/kg and 7.5 g/kg body weight) and assessed against control during 28 and 90 day laboratory trials on 30 and 60 rats respectively. Blood morphology, biochemistry (hormones, lipids and minerals) and histology of internal organs were determined. Homogenates of skeletal muscles and bones of rats were also analyzed. Maca-GO has low toxicity (LD=7.5 g/kg) and appears to be safe for short-term and extended use as dietary supplement or as a component of functional dietary and therapeutic preparations. There were different responses of male and female rats to different levels of Maca-GO administered during a short- and a longer-term periodl. When administered at higher dose for extended period of time (90 days), Maca-GO acted as a toner of hormonal processes in adult female rats at increased progesterone and a steady estradiol level, without affecting levels of blood FSH, LH and TSH. Obtained results justify further clinical research on use of Maca-GO in sportsmen, physically-active people of both sexes and peri-menopausal women to clarify mechanisms underlaying physiological mode of action of Maca-GO validaet in clinical study on humans. Substantial decrease in blood cortisol levels in a short- and longer-term trial and simultaneous tendency to lower blood ACTH, may indicate antidepressive effect of Maca-GO, which together with reduction in body weight, lowering triglycerides in blood plasma and increasing calcium and phosphorus deposition in bone and muscle tissues is worthy consideration in potential application to women at

  15. Disminución del daño oxidativo y efecto hipoglicemiante de la maca (Lepidium meyenii Walp en ratas con diabetes inducida por streptozotocina

    Directory of Open Access Journals (Sweden)

    María Elena Rodrigo

    2011-01-01

    Full Text Available Introducción: La maca es consumida desde tiempos ancestrales como parte de la dieta. Se le ha atribuido propiedades medicinales y se encuentra incluida en la medicina tradicional peruana. Estudios recientes describen que la admistración de maca reduce la glicemia en animales normoglicémicos, pero los mecanismos involucrados no están muy claros. Objetivos: Determinar el efecto hipoglicemiante y antioxidante de la harina de maca (Lepidium meyenii Walp del ecotipo amarillo, en ratas con diabetes inducida por estreptozotocina. Diseño: Experimental. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, Universidad Nacional Mayor de San Marcos, Lima, Perú. Material biológico: Harina de maca amarilla y ratas albinas Holtzmann machos con diabetes inducida. Intervenciones: Se administró la harina de maca amarilla a las ratas distribuidas en 4 grupos: grupo I control (solo dieta; II, harina de maca 4 g/día; III, harina de maca 6 g/día; y IV, dieta + glibenclamida 10 mg/kg de peso; el experimento duró 46 días. Se evaluó diariamente la glicemia y el peso; al final del experimento se determinó en sangre los niveles de insulina, parámetros de daño oxidativo (vitamina C y se midió la peroxidación lipídica (TBARS, como indicador del proceso oxidativo. Principales medidas de los resultados: Modificación de los niveles de glicemia, insulina, vitamina C y formación del complejo MDA-TBARS. Resultados: La administración de harina de maca en la dieta (4 a 6 g/día de animales diabéticos redujo la glicemia en 50%, incrementó los niveles de insulina 22% y mejoró los niveles de vitamina C respecto al grupo control. La administración de maca 4 g/día disminuyó el daño oxidativo, pues redujo la formación del complejo MDA-TBARS en 54% con respecto al grupo control. Conclusiones: La administración de harina de maca amarilla a animales diabéticos mejoró el metabolismo de la glucosa, regulando la glicemia y

  16. Relación de glutatión reducido/oxidado (GSH/GSSG en ratas diabéticas tratadas con maca (Lepidium meyenii walp

    Directory of Open Access Journals (Sweden)

    Ruth Cisneros

    2011-04-01

    Full Text Available Introducción: La diabetes mellitus y sus complicaciones representan un problema de salud pública. La hiperglucemia desencadena efectos bioquímicos dañinos para el organismo, como el estrés oxidativo y el proceso inflamatorio crónico, por lo que el uso de plantas medicinales con elevada capacidad antioxidante, como Lepidium meyenii Walp (maca, es una alternativa en el tratamiento de esta patología. Objetivo: Determinar si la ingestión de harina de maca mejora la relación glutatión reducido/oxidado (GSH/GSSG en ratas diabéticas. Diseño: Experimental. Institución: Centro de Investigación de Bioquímica y Nutrición, Facultad de Medicina, UNMSM, Lima, Perú. Material biológico: Harina de maca amarilla y ratas albinas Holtzman machos adultas. Intervenciones: Se utilizó 24 ratas, a los cuales se les indujo la diabetes con estreptozotocina (STZ 40 mg/kg de masa corporal y que fueron distribuidas aleatoriamente en cuatro grupos, de seis animales cada uno: control (CO, glibenclamida (GL 10 mg/kg de masa corporal, maca 4 g/día (M4 y maca 6 g/día (M6; el experimento duró 40 días. Se evaluó la glicemia, masa corporal y, al final del experimento, se determinó los niveles de GSH y GSSG en plasma y homogenizado de hígado. Principales medidas de resultados: Masa corporal, glicemia, GSH y GSSG en plasma y homogenizado de hígado. Resultados: A nivel plasmático, el glutatión circulante estuvo favorecido para la forma reducida. Los valores de la relación GSH/GSSG en los grupos tratados con maca estuvieron alrededor de 190, significativamente mayor al grupo CO. Conclusiones: La administración de harina de maca amarilla a ratas diabéticas incrementó la relación GSH/GSSG a nivel plasmático, contribuyendo a mejorar su estado redox.

  17. Role of cadmium and ultraviolet-B radiation in plants. Influence on photosynthesis and element content in two species of Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Larsson Joensson, Helene

    2001-02-01

    Plants are exposed to many different stress factors during their lifetime. often more than one factor at a time. which highlights the importance of research regarding interaction among stress factors. Cadmium and ultraviolet-B radiation (MB, 280-315 mm) are two potential stress factors in the environment, which have gained increased interest due to atmospheric pollution. In this work the interaction between Cd and UV-B radiation was investigated in two species of Brassicaceae; Brassica napus and Arabidopsis thaliana, the latter including the wild type and phytochelatin-deficient cad1-3. In both species photosynthetic parameters and element content were studied after the plants were exposed to Cd and supplemental UV-B radiation for 14 days. A separate Cd uptake study was carried out on Arabidopsis thaliana to investigate the effect of different Cd pretreatments on Cd uptake. The experiments showed that Cd was the dominant factor, but in Brassica napus, Cd+UV-B showed some interaction effects on energy dissipation and chlorophyll ratios. Generally, Cd decreased the chlorophyll content and influenced photosynthesis by altering oxygen evolution, non-photochemical quenching and the quantum yield. Cadmium had large effects on the content of essential elements, particularly in roots, that may be due to competition during uptake. The Cd uptake study showed that the wild type contained much higher amounts of Cd than the phytochelatin-deficient cad1-3, although Cd uptake is expected to be independent of phytochelatin content. Phytochelatins chelate and transport Cd to the vacuole, thus removing Cd from the cytosol. This compartmentation may disrupt a possible feedback mechanism in the cytosol.

  18. Biomimetic Synthesis of Macahydantoins A and B from Lepidium meyenii, and Structure Revision of Macahydantoin B as a Class of Thiohydantoin with a 4-Methyl-hexahydropyrrolo[1,2-c]imidazole Skeleton.

    Science.gov (United States)

    Zhou, Min; Ma, Hang-Ying; Xing, Huan-Huan; Li, Ping; Li, Gan-Peng; Geng, Hui-Chun; Hu, Qiu-Fen; Yang, Guang-Yu

    2017-09-15

    Phytochemical investigation on Lepidium meyenii led to the discovery of macahydantoin C (3), a new thiohydantoin with a 1,3-diazabicyclo[3.3.1]nonane core, the spectral properties of which indicate a potential structural misassignment of its previously reported analogue, macahydantoin B (2a). To probe this hypothesis, a concise, scalable, and biomimetic synthesis of the originally proposed 2a and its revised structure (2b) was efficiently accomplished using the modified Edman degradation as the key step from commercially available materials in 65% (three steps) and 52% (three steps) overall yields, respectively. These synthetic endeavors undoubtedly reassigned the structure of macahydantoin B as an unreported type of thiohydantoin featuring a 4-methyl-hexahydropyrrolo[1,2-c]imidazole scaffold.

  19. Efecto citotóxico del extracto metanólico de tres ecotipos de Lepidium peruvianum Chacón sobre líneas celulares HeLa y HT-29

    Directory of Open Access Journals (Sweden)

    Libertad Alzamora

    2013-05-01

    Full Text Available La búsqueda de compuestos naturales con actividad citotóxica y antitumoral es una de las prioridades actuales de la lucha contra el cáncer; motivo por el cual el objetivo del presente trabajo fue evaluar la actividad citotóxica de los extractos metanólicos (EM de los ecotipos negro, morado y amarillo de Lepidium peruvianum, Chacón (conocida también como Lepidium meyenii Walp. (maca sobre las líneas celulares HeLa (Human Epithelial Carcinoma y HT-29 (Human Colon Adenocarcinoma. Se determinó que la concentración inhibitoria del 50% del crecimiento celular (IC50 para la línea celular HT-29, con los ecotipos negro, morado y amarillo fue de 8,32 mg/ml, 9,28 mg/ml y 0,487 mg/ml respectivamente, mientras que para la línea celular HeLa fue de 2,4 mg/ml, 1,93 mg/ml y 0,66 mg/ml respectivamente. Adicionalmente, se evaluó un EM del ecotipo amarillo con dos años de almacenamiento (10 ºC determinándose como IC50 4,29 mg/ml para HT-29 y 4,17 mg/ml para HeLa. Se concluye que el efecto citotóxico del ecotipo amarillo sobre HT-29 y HeLa fue superior al mostrado por los ecotipos negro y morado; que la línea celular más sensible a los ecotipos amarillo, negro y morado es HeLa, y que el EM del ecotipo amarillo conservó sus propiedades citotóxicas pese al tiempo de almacenamiento, aunque éstas disminuyeron.

  20. Developmental Control and Plasticity of Fruit and Seed Dimorphism in Aethionema arabicum

    Czech Academy of Sciences Publication Activity Database

    Lenser, T.; Graeber, K.; Cevik, O.S.; Adiguzel, N.; Donmez, A. A.; Grosche, C.; Kettermann, M.; Mayland-Quellhorst, S.; Merai, Z.; Mohammadin, S.; Nguyen, T.P.; Rumpler, H.; Schulze, C.; Sperber, K.; Steinbrecher, T.; Wiegand, M.; Strnad, Miroslav; Scheid, O. M.; Rensing, S. A.; Schranz, M. E.; Theissen, G.; Mummenhoff, K.; Leubner-Metzger, Gerhard

    2016-01-01

    Roč. 172, č. 3 (2016), s. 1691-1707 ISSN 0032-0889 R&D Projects: GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : diptychocarpus-strictus brassicaceae * phenotypic plasticity * arabidopsis-thaliana * lepidium brassicaceae * atriplex-sagittata * dispersal ability * desert annuals * coat mucilage * crepis-sancta * pod shatter Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.456, year: 2016

  1. Therapeutic Effects of Pre-Gelatinized Maca (Lepidium Peruvianum Chacon) used as a Non-Hormonal Alternative to HRT in Perimenopausal Women - Clinical Pilot Study.

    Science.gov (United States)

    Meissner, H O; Reich-Bilinska, H; Mscisz, A; Kedzia, B

    2006-06-01

    Roots of cruciferous plant Lepidium peruvianum Chacon cultivated in high plateaus of Andes and known under its common name Maca, have been traditionally-used as an energizing vegetable with therapeutic properties for both men and women. Maca has been recognized by natives of Peru as herbal remedy helping to treat conditions affecting menopausal women. The effects of Pre-Gelatinized Organic Maca (Maca-GO) on quantitative physiological responses and alleviation of symptoms contributing to menopausal discomfort in perimenopausal women was examined. IN THIS, FOUR MONTHS, DOUBLE BLIND, CROSSOVER, RANDOMIZED PILOT TRIAL, MONTHLY MEASUREMENTS OF THE FOLLOWING BLOOD SERUM CONSTITUENTS WERE TAKEN: Estrogen (E2), Follicle Stimulating Hormone (FSH), Luteinizing Hormone (LH) and Progesterone (PGS), Cortisol (CT), Adrenocorticotropic Hormone (ACTH), Thyroid Hormones (TSH, T3, T4), minerals (Ca, K, Fe) and lipid profile (Triglicerides, Total Cholesterol, LDL, HDL). In monthly interviews conducted by gynecologist, body weight and blood pressure were registered and Menopausal Index according to Kupperman's was determined. Toxicity of Maca -GO determined on rats showed its safe use at the level of 7.5mg/kg body weight. A group of 20 women (aged 41-50 years), who fulfilled criteria of being in perimenopausal stage (E2 above 40pg/ml and FSH below 30IU/ml), were randomly allocated to two even groups, one receiving for two months Maca-GO and the other Placebo capsules followed by a crossover with treatment change for another two months period. All participants signed informed consent to participate. Two 500mg hard capsules with Maca-GO or Placebo were self-administered by participants twice daily with meals (total 2g/day). Two months administration of Maca-GO significantly alleviated symptoms of discomfort observed in majority of women involved in the study (74%-87%) as assessed by Kupperman's Menopausal index. This was associated with significant increase in E2 and FSH, Progesterone

  2. Nectar-carbohydrate production and composition vary in relation to nectary anatomy and location within individual flowers of several species of Brassicaceae.

    Science.gov (United States)

    Davis, A R; Pylatuik, J D; Paradis, J C; Low, N H

    1998-06-01

    Nectar-carbohydrate production and composition were investigated by high-performance liquid chromatography and enzymology in nine species from five tribes of the Brassicaceae. In six species (Arabidopsis thaliana (L.) Heynh., Brassica napus L., B. rapa L., Lobularia maritima (L.) Desv., Raphanus sativus L., Sinapis arvensis L.) that produced nectar from both lateral nectaries (associated with the short stamens) and median nectaries (outside the long stamens), on average 95% of the total nectar carbohydrate was collected from the lateral ones. Nectar from these glands possessed a higher glucose/fructose ratio (usually 1.0-1.2) than that from the median nectaries (0.2-0.9) within the same flower. Comparatively little sucrose was detected in any nectar samples except from Matthiola bicornus (Sibth. et Sm.) DC., which possessed lateral nectaries only and produced a sucrose-dominant exudate. The anatomy of the nectarial tissue in nectar-secreting flowers of six species, Hesperis matronalis L., L. maritima, M. bicornus, R. sativus, S. arvensis, and Sisymbrium loeselii L., was studied by light and scanning-electron microscopy. Phloem alone supplied the nectaries. However, in accordance with their overall nectar-carbohydrate production, the lateral glands received relatively rich quantities of phloem that penetrated far into the glandular tissue, whereas median glands were supplied with phloem that often barely innervated them. All nectarial tissue possessed modified stomata (with the exception of the median glands of S. loeselii, which did not produce nectar); further evidence was gathered to indicate that these structures do not regulate nectar flow by guard-cell movements. The numbers of modified stomata per gland showed no relation to nectar-carbohydrate production. Taken together, the data on nectar biochemistry and nectary anatomy indicate the existence of two distinct nectary types in those Brassicacean species that possess both lateral and median nectaries

  3. The transillumination technique as a method for the assessment of spermatogenesis using medicinal plants: the effect of extracts of black maca (Lepidium meyenii) and camu camu (Myrciaria dubia) on stages of the spermatogenic cycle in male rats.

    Science.gov (United States)

    Gonzales, Gustavo F; Vasquez, Vanessa Bertha; Gasco, Manuel

    2013-10-01

    Transillumination technique for assessment of stages of spermatogenic cycle is a useful tool for toxicological studies. This study was designed to determine the effect of two medicinal plants on spermatogenesis in male rats using the transillumination technique. For this, the effect of the combination of a fruit with highest content of ascorbic acid (Myrciaria dubia, camu camu) and extract of black maca (Lepidium meyenii) on seminiferous tubule stages scored by transillumination on intact tubules in adult male rats was assessed. Animals were treated during seven days with vehicle, black maca, camu camu or a mixture of black maca + camu camu and assessed for daily sperm production (DSP), stages of spermatogenic cycle as well as antioxidant activity and levels of flavonoids and polyphenols. Black maca increased stages of spermiation (VII-VIII) and mitosis of germ cells (IX-XI), whereas camu camu increased stages of mitosis (IX-XI) and meiosis (XII). Mixture of maca + camu camu increased stages of spermiation, mitosis and meiosis. All treatments increased DSP (p<0.05) and epididymal sperm count (p<0.05). Total polyphenols, flavonoids levels and antioxidant activity were higher in camu camu (p<0.001) than in black maca. In conclusion, M. dubia (camu camu) has potential effects improving spermatogenesis and co-administered with maca increase stages of mitosis, meiosis and spermiation of the spermatogenic cycle as assessed by the transillumination technique. This technique is becoming increasingly a useful tool for assessment spermatogenesis.

  4. Effect of organic fertilizers on quality and quantity characteristics of blond psyllium (Plantago ovata Forssk. clasping peperweed (Lepidium perfoilatum L., qodumeh Shirazi (Alyssum homolocarpum L. and dragon's head (Lalementia iberica L.

    Directory of Open Access Journals (Sweden)

    A. Koocheki

    2016-05-01

    Full Text Available This experiment was carried out in experimental farm of Agricultural Faculty of Ferdowsi University of Mashhad, Iran during 2010. The design was split plot with three replications. Main plots were the medicinal plant species consist of: blond psyllium (Plantago ovate Forssk., clasping peperweed (Lepidium perfoilatum L., qodumeh Shirazi (Alyssum homolocarpum L. dragon's head (Lalementia iberica L. and subplots were various organic fertilizer consist of cow manure, vermicompost (based on cow manure, coffee compost and spent mushroom compost. Results showed that medicinal plants had significant difference for number of seeds per plant, shoot dry matter, seed yield, plant height and mucilage percentage. Effect of various organic matter on all traits except for 1000-seed weight was significant. Interaction of organic fertilizers and plant was significant for dry matter. Lalementia had the most mucilage percentage (27.75% and cow manure was the best fertilizer because it had the highest amounts of dry matter (1816 kg.ha-1, seed yield (467.5 kg.ha-1, number seed per plant (550 seeds.plant-1, plant height (23.17 cm and mucilage percentage (20.75%.

  5. Shared and host-specific microbiome diversity and functioning of grapevine and accompanying weed plants.

    Science.gov (United States)

    Samad, Abdul; Trognitz, Friederike; Compant, Stéphane; Antonielli, Livio; Sessitsch, Angela

    2017-04-01

    Weeds and crop plants select their microbiota from the same pool of soil microorganisms, however, the ecology of weed microbiomes is poorly understood. We analysed the microbiomes associated with roots and rhizospheres of grapevine and four weed species (Lamium amplexicaule L., Veronica arvensis L., Lepidium draba L. and Stellaria media L.) growing in proximity in the same vineyard using 16S rRNA gene sequencing. We also isolated and characterized 500 rhizobacteria and root endophytes from L. draba and grapevine. Microbiome data analysis revealed that all plants hosted significantly different microbiomes in the rhizosphere as well as in root compartment, however, differences were more pronounced in the root compartment. The shared microbiome of grapevine and the four weed species contained 145 OTUs (54.2%) in the rhizosphere, but only nine OTUs (13.2%) in the root compartment. Seven OTUs (12.3%) were shared in all plants and compartments. Approximately 56% of the major OTUs (>1%) showed more than 98% identity to bacteria isolated in this study. Moreover, weed-associated bacteria generally showed a higher species richness in the rhizosphere, whereas the root-associated bacteria were more diverse in the perennial plants grapevine and L. draba. Overall, weed isolates showed more plant growth-promoting characteristics compared with grapevine isolates. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Cruciferous weeds in oil seed rape – appearance and control

    Directory of Open Access Journals (Sweden)

    Klingenhagen, Günter

    2014-02-01

    Full Text Available Different cruciferous weeds were drilled in autumn 2011 and 2012 in a field near Münster. Beside common species like hedge mustard (Sisymbrium officinale Scop., shepherd`s purse (Capsella bursa-pastoris, pennycress (Thlaspiarvense, tall hedge mustard (Sisymbrium loeselii and flixweed (Descurainia sophia, we tried to establish weeds that are not common on arable land in Germany until now. These were: Yellow rocket (Barbarea vulgaris, hoary cress (Lepidium draba and Turkish rocket (Bunias orientalis. In autumn 2011 emergence of the sown weeds was poor. In the second year of experiment we got good emergence of the named weeds excluding hoary cress (Lepidium draba. In autumn 2011 and 2012 different herbicidecombinations were applied across the stripes. The best results were achieved with Colzor Trio (clomazone + dimethachlor + napropamid which was applied in pre-emergence state, a spray sequence Butisan Gold (metazachlor + quinmerac + dimethenamid-P applied in pre-emergence followed by Salsa (ethametsulfuronmethyl + Trend (adjuvant in post-emergence and Clearfield-Vantiga (metazachlor + quinmerac + imazamox + Dash (adjuvant, also applied in post-emergence state of the weeds.

  7. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    Science.gov (United States)

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells. © 2016 Blackwell Verlag GmbH.

  8. Molecular cloning, characterization and analysis of the intracellular localization of a water-soluble chlorophyll-binding protein (WSCP) from Virginia pepperweed (Lepidium virginicum), a unique WSCP that preferentially binds chlorophyll b in vitro.

    Science.gov (United States)

    Takahashi, Shigekazu; Yanai, Haruna; Oka-Takayama, Yuko; Zanma-Sohtome, Aya; Fujiyama, Kosaku; Uchida, Akira; Nakayama, Katsumi; Satoh, Hiroyuki

    2013-12-01

    Various plants possess non-photosynthetic, hydrophilic chlorophyll (Chl) proteins called water-soluble Chl-binding proteins (WSCPs). WSCPs are categorized into two classes; Class I (photoconvertible type) and Class II (non-photoconvertible type). Among Class II WSCPs, only Lepidium virginicum WSCP (LvWSCP) exhibits a low Chl a/b ratio compared with that found in the leaf. Although the physicochemical properties of LvWSCP have been characterized, its molecular properties have not yet been documented. Here, we report the characteristics of the LvWSCP gene, the biochemical properties of a recombinant LvWSCP, and the intracellular localization of LvWSCP. The cloned LvWSCP gene possesses a 669-bp open reading frame. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry analysis revealed that the precursor of LvWSCP contains both N- and C-terminal extension peptides. RT-PCR analysis revealed that LvWSCP was transcribed in various tissues, with the levels being higher in developing tissues. A recombinant LvWSCP and hexa-histidine fusion protein (LvWSCP-His) could remove Chls from the thylakoid in aqueous solution and showed an absorption spectrum identical to that of native LvWSCP. Although LvWSCP-His could bind both Chl a and Chl b, it bound almost exclusively to Chl b when reconstituted in 40 % methanol. To clarify the intracellular targeting functions of the N- and C-terminal extension peptides, we constructed transgenic Arabidopsis thaliana lines expressing the Venus protein fused with the LvWSCP N- and/or C-terminal peptides, as well as Venus fused at the C-terminus of LvWSCP. The results showed that the N-terminal peptide functioned in ER body targeting, while the C-terminal sequence did not act as a trailer peptide.

  9. Acceptability, Safety, and Efficacy of Oral Administration of Extracts of Black or Red Maca (Lepidium meyenii) in Adult Human Subjects: A Randomized, Double-Blind, Placebo-Controlled Study.

    Science.gov (United States)

    Gonzales-Arimborgo, Carla; Yupanqui, Irma; Montero, Elsa; Alarcón-Yaquetto, Dulce E; Zevallos-Concha, Alisson; Caballero, Lidia; Gasco, Manuel; Zhao, Jianping; Khan, Ikhlas A; Gonzales, Gustavo F

    2016-08-18

    The plant maca, grown at 4000 m altitude in the Peruvian Central Andes, contains hypocotyls that have been used as food and in traditional medicine for centuries. The aim of this research was to provide results on some health effects of oral administration of spray-dried extracts of black or red maca (Lepidium meyenii) in adult human subjects living at low (LA) and high altitude (HA). A total of 175 participants were given 3 g of either placebo, black, or red maca extract daily for 12 weeks. Primary outcomes were changes in sexual desire, mood, energy, health-related quality of life score (HRQL), and chronic mountain sickness (CMS) score, or in glycaemia, blood pressure, and hemoglobin levels. Secondary outcomes were acceptability and safety, assessed using the Likert test and side effect self-recording, respectively, and the effect of altitude. At low altitude, 32, 30, and 32 participants started the study receiving placebo, red maca, or black maca, respectively. At high altitudes, 33, 35, and 31 participants started the study receiving placebo, red maca, and black maca, respectively. Consumption of spray-dried extracts of red and black maca resulted in improvement in mood, energy, and health status, and reduced CMS score. Fatty acids and macamides were higher in spray-dried extracts of black maca than in red maca. GABA predominated in spray-dried extracts of red maca. Effects on mood, energy, and CMS score were better with red maca. Black maca and, in smaller proportions, red maca reduced hemoglobin levels only in highlanders with abnormally high hemoglobin levels; neither variety of maca reduced hemoglobin levels in lowlanders. Black maca reduced blood glucose levels. Both varieties produced similar responses in mood, and HRQL score. Maca extracts consumed at LA or HA had good acceptability and did not show serious adverse effects. In conclusion, maca extract consumption relative to the placebo improved quality of life parameters. Differences in the level of

  10. Acceptability, Safety, and Efficacy of Oral Administration of Extracts of Black or Red Maca (Lepidium meyenii in Adult Human Subjects: A Randomized, Double-Blind, Placebo-Controlled Study

    Directory of Open Access Journals (Sweden)

    Carla Gonzales-Arimborgo

    2016-08-01

    Full Text Available The plant maca, grown at 4000 m altitude in the Peruvian Central Andes, contains hypocotyls that have been used as food and in traditional medicine for centuries. The aim of this research was to provide results on some health effects of oral administration of spray-dried extracts of black or red maca (Lepidium meyenii in adult human subjects living at low (LA and high altitude (HA. A total of 175 participants were given 3 g of either placebo, black, or red maca extract daily for 12 weeks. Primary outcomes were changes in sexual desire, mood, energy, health-related quality of life score (HRQL, and chronic mountain sickness (CMS score, or in glycaemia, blood pressure, and hemoglobin levels. Secondary outcomes were acceptability and safety, assessed using the Likert test and side effect self-recording, respectively, and the effect of altitude. At low altitude, 32, 30, and 32 participants started the study receiving placebo, red maca, or black maca, respectively. At high altitudes, 33, 35, and 31 participants started the study receiving placebo, red maca, and black maca, respectively. Consumption of spray-dried extracts of red and black maca resulted in improvement in mood, energy, and health status, and reduced CMS score. Fatty acids and macamides were higher in spray-dried extracts of black maca than in red maca. GABA predominated in spray-dried extracts of red maca. Effects on mood, energy, and CMS score were better with red maca. Black maca and, in smaller proportions, red maca reduced hemoglobin levels only in highlanders with abnormally high hemoglobin levels; neither variety of maca reduced hemoglobin levels in lowlanders. Black maca reduced blood glucose levels. Both varieties produced similar responses in mood, and HRQL score. Maca extracts consumed at LA or HA had good acceptability and did not show serious adverse effects. In conclusion, maca extract consumption relative to the placebo improved quality of life parameters. Differences in

  11. A new case of late-acting self-incompatibility in Capparis L. (Brassicaceae: C. jacobinae Moric. ex Eichler, an endemic andromonoecious species of the Caatinga, Pernambuco State, Brazil Novo registro de auto-incompatibilidade de ação tardia em Capparis (Brassicaceae: C. jacobinae Moric. ex Eichler, uma espécie andromonóica endêmica da Caatinga, PE, Brasil

    Directory of Open Access Journals (Sweden)

    Luis Miguel Primo

    2009-09-01

    Full Text Available We studied the reproductive system of Capparis jacobinae Moric ex Eichler (Brassicaceae, based on controlled hand-pollination and observation of pollen tube growth made in a fluorescence microscope. Of 105 self-pollinated flowers only one produced fruits (success = 0.95%, all the other flowers abscised at the same time, between the eighth and tenth day after anthesis. Nevertheless, self- and cross-pollinated pollen tubes reached the micropyle. The rate of penetrated ovules in self-pollinated flowers was lower during the first 24 h after pollination; thereafter this rate was similar between self- and cross-pollinated flowers for treatments of 48 h, 72 h and 96 h after pollination. In addition, we carried out two indirect estimates of the reproductive system, based on pollen/ovule and seed/ovule ratios, which resulted in typical features of xenogamous species. We concluded that C. jacobinae has a late-acting self-incompatibility system. This is the third record of this mechanism for the genus and the first for a species of Capparis endemic to the Caatinga. We suggest that this self-incompatibility system may occur in other species of the same genus and family.O sistema reprodutivo de Capparis jacobinae Moric. ex Eichler (Brassicaceae, uma espécie endêmica da Caatinga no Brasil, foi analisado através de polinizações controladas e observações do desenvolvimento dos tubos polínicos por meio de microscopia de fluorescência. De 105 flores autopolinizadas, apenas uma formou fruto (sucesso= 0,95%, ocorrendo a abscisão das demais em um intervalo de tempo uniforme, entre o oitavo e o décimo dia após a antese. Entretanto, tanto tubos polínicos procedentes de autopolinização quanto de polinização cruzada penetraram na micrópila, sendo a taxa de óvulos penetrados menor em flores autopolinizadas durante as 24 horas posteriores à polinização, igualando-se entre os dois tratamentos para 48, 72 e 96 horas posteriores à polinização. Al

  12. PROXIMATE ANALYSIS OF LEPIDIUM SATIVUM LEAVES

    African Journals Online (AJOL)

    HANIF BELLO

    fats and fiber. Therefore, this plant is recommended for consumers as vegetable in their diet so as to meet up the body nutrients demand. Keywords: Proximate .... they are useless as foods (Oliver, 2002). The crude fiber result showed L. sativum to contain 8.69±0.01% fiber content. As an important part of any diet, fiber.

  13. [Recent researching progress of Lepidium meyenii (Maca)].

    Science.gov (United States)

    Zhou, Yan-yan; Zhao, Hai-yu; Si, Nan; Wang, Hong-jie; Gian, Bao-lin

    2015-12-01

    Maca as one of the star products in the international health care market in recent years, had a wide range of application value and promoted to all over the world. However, the basic research of Maca was not deep, lack of systematic and clear efficacy studies. Market products hype its aphrodisiac effect, which greatly impact more systematic in-depth research and exploration. Therefore, this paper briefly summarizes advance research in recent years including the status quo of the resources, growth cultivation, phytochemical, pharmacological effect and other aspects, which can provide reference for rational development and utilization of Maca.

  14. Genetic relationships among some Hesperis L. (Brassicaceae ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-07-20

    Jul 20, 2009 ... based on H. breviscapa and H. kotschyi samples. The 2 species formed a dual group within the dendogram so the results suggest that their morphological similarities are in accord with the findings obtained from molecular data. H. breviscapa clearly differs from other Hesperis species in its habitus, leaf, ...

  15. Molecular genetic diversity study of Lepidium sativum population ...

    African Journals Online (AJOL)

    Vostro 2520

    Generally, Tigray and Amhara regions showed moderate to high diversity in ISSR analysis. ... other crops. The main purpose of its cultivation in. Ethiopia is to use it as a medicinal plant. It is used for human abdominal ache and diarrhea. Moreover, L. ... of 10 primers were obtained from the Genetic Research Laboratory.

  16. Red maca (Lepidium meyenii) reduced prostate size in rats

    Science.gov (United States)

    Gonzales, Gustavo F; Miranda, Sara; Nieto, Jessica; Fernández, Gilma; Yucra, Sandra; Rubio, Julio; Yi, Pedro; Gasco, Manuel

    2005-01-01

    Background Epidemiological studies have found that consumption of cruciferous vegetables is associated with a reduced risk of prostate cancer. This effect seems to be due to aromatic glucosinolate content. Glucosinolates are known for have both antiproliferative and proapoptotic actions. Maca is a cruciferous cultivated in the highlands of Peru. The absolute content of glucosinolates in Maca hypocotyls is relatively higher than that reported in other cruciferous crops. Therefore, Maca may have proapoptotic and anti-proliferative effects in the prostate. Methods Male rats treated with or without aqueous extracts of three ecotypes of Maca (Yellow, Black and Red) were analyzed to determine the effect on ventral prostate weight, epithelial height and duct luminal area. Effects on serum testosterone (T) and estradiol (E2) levels were also assessed. Besides, the effect of Red Maca on prostate was analyzed in rats treated with testosterone enanthate (TE). Results Red Maca but neither Yellow nor Black Maca reduced significantly ventral prostate size in rats. Serum T or E2 levels were not affected by any of the ecotypes of Maca assessed. Red Maca also prevented the prostate weight increase induced by TE treatment. Red Maca administered for 42 days reduced ventral prostatic epithelial height. TE increased ventral prostatic epithelial height and duct luminal area. These increases by TE were reduced after treatment with Red Maca for 42 days. Histology pictures in rats treated with Red Maca plus TE were similar to controls. Phytochemical screening showed that aqueous extract of Red Maca has alkaloids, steroids, tannins, saponins, and cardiotonic glycosides. The IR spectra of the three ecotypes of Maca in 3800-650 cm (-1) region had 7 peaks representing 7 functional chemical groups. Highest peak values were observed for Red Maca, intermediate values for Yellow Maca and low values for Black Maca. These functional groups correspond among others to benzyl glucosinolate. Conclusions Red Maca, a cruciferous plant from the highland of Peru, reduced ventral prostate size in normal and TE treated rats. PMID:15661081

  17. Lepidium meyenii (Maca) does not exert direct androgenic activities.

    Science.gov (United States)

    Bogani, P; Simonini, F; Iriti, M; Rossoni, M; Faoro, F; Poletti, A; Visioli, F

    2006-04-06

    Maca is the edible root of the Peruvian plant Lepidum meyenii, traditionally employed for its purported aphrodisiac and fertility-enhancing properties. This study aimed at testing the hypothesis that Maca contains testosterone-like compounds, able to bind the human androgen receptor and promote transcription pathways regulated by steroid hormone signaling. Maca extracts (obtained with different solvents: methanol, ethanol, hexane and chloroform) are not able to regulate GRE (glucocorticoid response element) activation. Further experiments are needed to assess which compound, of the several Maca's components, is responsible of the observed in vivo effects.

  18. Antiviral activity of maca (Lepidium meyenii) against human influenza virus.

    Science.gov (United States)

    Del Valle Mendoza, Juana; Pumarola, Tomàs; Gonzales, Libertad Alzamora; Del Valle, Luis J

    2014-09-01

    To investigate antiviral activity of maca to reduce viral load in Madin-Darby canine kidney (MDCK) cells infected with influenza type A and B viruses (Flu-A and Flu-B, respectively). Maca were extracted with methanol (1:2, v/v). The cell viability and toxicity of the extracts were evaluated on MDCK cells using method MTT assay. Antiviral activity of compounds against Flu-A and Flu-B viruses was assayed using a test for determining the inhibition of the cytopathic effect on cell culture and multiplex RT-PCR. The methanol extract of maca showed low cytotoxicity and inhibited influenza-induced cytopathic effect significantly, while viral load was reduced via inhibition of viral growth in MDCK infected cells. Maca contains potent inhibitors of Flu-A and Flu-B with a selectivity index [cytotoxic concentration 50%/IC50] of 157.4 and 110.5, respectively. In vitro assays demonstrated that maca has antiviral activity not only against Flu-A (like most antiviral agents) but also Flu-B viruses, providing remarkable therapeutic benefits. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  19. The Methyltetrahydro-β-Carbolines in Maca (Lepidium meyenii)

    Science.gov (United States)

    Gonzales-Castañeda, Cynthia

    2009-01-01

    Maca, a plant native to the Peruvian highlands, contains (1R,3S)-1-methyl-1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid (MTCA). The family of the tetrahydro-β-carbolines has been associated with both biologically helpful and harmful compounds. We present evidence that MTCA is a natural constituent of Maca, and on consumption no toxicity is found. This suggests that, when consumed as multi-component, MTCA may loose its adversity as drug action. PMID:18955346

  20. Determination of Nutritive Values of Garden Cress ( Lepidium ...

    African Journals Online (AJOL)

    1850.00 mg/100g), calcium (829.13 mg/100g), magnesium (160.60 mg/100g), sodium (141.13 mg/100g) and iron (63.47 mg/100g) with low level of phosphorus (4.10 mg/100g), manganese (5.74 mg/100g), copper (0.39 mg/100g) and chromium ...

  1. The Methyltetrahydro-β-Carbolines in Maca (Lepidium meyenii

    Directory of Open Access Journals (Sweden)

    Gustavo F. Gonzales

    2009-01-01

    Full Text Available Maca, a plant native to the Peruvian highlands, contains (1R,3S-1-methyl-1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid (MTCA. The family of the tetrahydro-β-carbolines has been associated with both biologically helpful and harmful compounds. We present evidence that MTCA is a natural constituent of Maca, and on consumption no toxicity is found. This suggests that, when consumed as multi-component, MTCA may loose its adversity as drug action.

  2. Red maca (Lepidium meyenii reduced prostate size in rats

    Directory of Open Access Journals (Sweden)

    Rubio Julio

    2005-01-01

    Full Text Available Abstract Background Epidemiological studies have found that consumption of cruciferous vegetables is associated with a reduced risk of prostate cancer. This effect seems to be due to aromatic glucosinolate content. Glucosinolates are known for have both antiproliferative and proapoptotic actions. Maca is a cruciferous cultivated in the highlands of Peru. The absolute content of glucosinolates in Maca hypocotyls is relatively higher than that reported in other cruciferous crops. Therefore, Maca may have proapoptotic and anti-proliferative effects in the prostate. Methods Male rats treated with or without aqueous extracts of three ecotypes of Maca (Yellow, Black and Red were analyzed to determine the effect on ventral prostate weight, epithelial height and duct luminal area. Effects on serum testosterone (T and estradiol (E2 levels were also assessed. Besides, the effect of Red Maca on prostate was analyzed in rats treated with testosterone enanthate (TE. Results Red Maca but neither Yellow nor Black Maca reduced significantly ventral prostate size in rats. Serum T or E2 levels were not affected by any of the ecotypes of Maca assessed. Red Maca also prevented the prostate weight increase induced by TE treatment. Red Maca administered for 42 days reduced ventral prostatic epithelial height. TE increased ventral prostatic epithelial height and duct luminal area. These increases by TE were reduced after treatment with Red Maca for 42 days. Histology pictures in rats treated with Red Maca plus TE were similar to controls. Phytochemical screening showed that aqueous extract of Red Maca has alkaloids, steroids, tannins, saponins, and cardiotonic glycosides. The IR spectra of the three ecotypes of Maca in 3800-650 cm (-1 region had 7 peaks representing 7 functional chemical groups. Highest peak values were observed for Red Maca, intermediate values for Yellow Maca and low values for Black Maca. These functional groups correspond among others to benzyl glucosinolate. Conclusions Red Maca, a cruciferous plant from the highland of Peru, reduced ventral prostate size in normal and TE treated rats.

  3. Pinpointing genes underlying annual/perennial transitions with comparative genomics.

    Science.gov (United States)

    Heidel, Andrew J; Kiefer, Christiane; Coupland, George; Rose, Laura E

    2016-11-15

    Transitions between perennial and an annual life history occur often in plant lineages, but the genes that control whether a plant is an annual or perennial are largely unknown. To identify genes that confer differences between annuals and perennials we compared the gene content of four pairs of sister lineages (Arabidopsis thaliana/Arabidopsis lyrata, Arabis montbretiana/Arabis alpina, Arabis verna/Aubrieta parviflora and Draba nemorosa/Draba hispanica) in the Brassicaceae in which each pair contains one annual and one perennial, plus one extra annual species (Capsella rubella). After sorting all genes in all nine species into gene families, we identified five families in which well-annotated genes are present in the perennials A. lyrata and A. alpina, but are not present in any of the annual species. For the eleven genes in perennials in these families, an orthologous pseudogene or otherwise highly diverged gene was found in the syntenic region of the annual species in six cases. The five candidate families identified encode: a kinase, an oxidoreductase, a lactoylglutathione lyase, a F-box protein and a zinc finger protein. By comparing the active gene in the perennial to the pseudogene or heavily altered gene in the annual, dN and dS were calculated. The low dN/dS values in one kinase suggest that it became pseudogenized more recently, while the other kinase, F-box, oxidoreductase and zinc-finger became pseudogenized closer to the divergence between the annual-perennial pair. We identified five gene families that may be involved in the life history switch from perennial to annual. Considering the dN and dS data and whether syntenic pseudogenes were found and the potential functions of the genes, the F-box family is considered the most promising candidate for future functional studies to determine if it affects life history.

  4. The significance of glucosinolates for sulfur storage in Brassicaceae seedlings

    Directory of Open Access Journals (Sweden)

    Luit J. eDe Kok

    2014-12-01

    Full Text Available Brassica juncea seedlings contained a two-fold higher glucosinolate content than Brassica rapa and these secondary sulfur compounds accounted for up to 30 % of the organic sulfur fraction. The glucosinolate content was not affected by H2S and SO2 exposure, demonstrating that these sulfur compounds did not form a sink for excessive atmospheric supplied sulfur. Upon sulfate deprivation, the foliarly absorbed H2S and SO2 replaced sulfate as the sulfur source for growth of B. juncea and B. rapa seedlings. The glucosinolate content was decreased in sulfate-deprived plants, though its proportion of organic sulfur fraction was higher than that of sulfate-sufficient plants, both in absence and presence of H2S and SO2. The significance of myrosinase in the in situ turnover in these secondary sulfur compounds needs to be questioned, since there was no direct co-regulation between the content of glucosinolates and the transcript level and activity of myrosinase. Evidently, glucosinolates cannot be considered as sulfur storage compounds upon exposure to excessive atmospheric sulfur and are unlikely to be involved in the re-distribution of sulfur in B. juncea and B. rapa seedlings upon sulfate deprivation.

  5. The Role of ER Bodies in Brassicaceae Resistance under Clinorotation

    Science.gov (United States)

    Romanchuk, S. M.; Kordyum, E. L.

    2013-02-01

    Results of the electron-microscopic investigation of root apices of Arabidopsis thaliana 3- and 7-day old seedlings grown in the stationary conditions and under clinorotation are presented. It was shown the similarity in the root apex cell ultrastructure in control and under clinorotation. In the same time there were some differences in the ultrustructure of statocytes and the distal elongation zone under clinorotation. For the first time, the sensitivity of ER-bodies, which are derivative of granular endoplasmic reticulum and contain a β-glucosidase enzyme, to the influence of simulated microgravity that was demonstrated by increasing quantity and area of ER-bodies per cell section, as well as by higher variability of their shape under clinorotation. A degree of these changes correlated with the duration of clinorotation. On the basis of obtained data, a protective role of ER-bodies in adaptation of plants to microgravity is discussed.

  6. Phylogeny and biogeography of Alyssum (Brassicaceae) based on ...

    Indian Academy of Sciences (India)

    fined to the Mediterranean and Turkey, and only a few species are distributed in North Africa, Central Asia, Siberia and North America (Dudley 1964a, b). The genus comprises annual and perennial herbaceous plants and (rarely) small shrubs, with oblong–oval leaves and yellow or white flowers. (pink and purple in a few ...

  7. Stress response and health affecting compounds in Brassicaceae

    NARCIS (Netherlands)

    Jahangir, Muhammad

    2010-01-01

    Summary of the Thesis: Vegetables have always been considered as healthy food. So also Brassica vegetables are well known all over the world as a common food due to the presence of health affecting compounds (Chapter 2). A vast amount of data is available for health promoting compounds in

  8. Phylogeny and biogeography of Alyssum (Brassicaceae) based on ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... The genus Alyssum consists of about 195 species native to Europe, Asia and northern Africa. All species were assigned to six sections. Previous molecular phylogeny studies indicate that Alyssum is polyphyletic. However, the divergence time and dispersal of the genus are not well studied. In this study, the ...

  9. The genusGuenthera Andr. in Bess. (Brassicaceae, Brassiceae

    Directory of Open Access Journals (Sweden)

    Gómez-Campo, César

    2003-12-01

    Full Text Available A group of nine species -now included in Brassica— differ from all the other species in several characters, mainly in the stylar portion of their pistils always without seed primordia. Also in their branched subterranean stem (caudex with several leaf rosettes, their leaves entire to deeply pinnatifid but never pinnatisect, their shallowly notched cotyledons and their flattened, elliptic or ovoid seed contour. It is suggested to include these species under the generic denomination Guenthera Andr, in Bess. New ñames for the species and subspecies are provided, as well as a determination key for the species.Un grupo de nueve especies actualmente incluidas en Brassica difiere de todas las demás por varios caracteres, sobre todo por la porción estilar de sus pistilos, que siempre carece de primordios seminales. Además, por su tallo subterráneo ramificado, que forma un cáudex con varias rosetas; sus hojas de enteras hasta profundamente pinnatífidas, pero nunca pinnatisectas; sus cotiledones solo muy ligeramente escotados, y sus semillas, que tienden a ser elipsoidales o aplanadas. Se propone agruparlas todas bajo la denominación genérica Guenthera Andr, in Bess. Se detallan los nuevos nombres para las especies y Subespecies y se añade una clave para diferenciar las especies.

  10. Quantitative variation for apomictic reproduction in the genus Boechera (Brassicaceae)

    NARCIS (Netherlands)

    Aliyu, O.M.; Schranz, M.E.; Sharbel, T.F.

    2010-01-01

    • Premise of the study: The evolution of asexual seed production (apomixis) from sexual relatives is a great enigma of plant biology. The genus Boechera is ideal for studying apomixis because of its close relation to Arabidopsis and the occurrence of sexual and apomictic species at low ploidy levels

  11. Interspecific and interploidal gene flow in Central European Arabidopsis (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Jørgensen Marte H

    2011-11-01

    Full Text Available Abstract Background Effects of polyploidisation on gene flow between natural populations are little known. Central European diploid and tetraploid populations of Arabidopsis arenosa and A. lyrata are here used to study interspecific and interploidal gene flow, using a combination of nuclear and plastid markers. Results Ploidal levels were confirmed by flow cytometry. Network analyses clearly separated diploids according to species. Tetraploids and diploids were highly intermingled within species, and some tetraploids intermingled with the other species, as well. Isolation with migration analyses suggested interspecific introgression from tetraploid A. arenosa to tetraploid A. lyrata and vice versa, and some interploidal gene flow, which was unidirectional from diploid to tetraploid in A. arenosa and bidirectional in A. lyrata. Conclusions Interspecific genetic isolation at diploid level combined with introgression at tetraploid level indicates that polyploidy may buffer against negative consequences of interspecific hybridisation. The role of introgression in polyploid systems may, however, differ between plant species, and even within the small genus Arabidopsis, we find very different evolutionary fates when it comes to introgression.

  12. Ethnomedicinal utilization of wild edible vegetables in district harnai of balochistan province-pakistan

    International Nuclear Information System (INIS)

    Tareen, N.M.; Ahmad, M.

    2016-01-01

    Wild edible plants have a tremendous influence on human being even before civilization. These plants contain considerably high nutritional value. Present survey was conducted to explore edible wild vegetables species and their ethnomedicinal uses by the inhabitants of district Harnai, Balochistan, Pakistan. Information was obtained through informed free listing interviews with randomly selected informants and field interviews with key informants selected after free listing. A total of 59 wild edible vegetables belonging to 41 genera, 59 species and 20 plant families are used not only as vegetables and salads but treatment of various diseases The most common plant families in terms of the number of species are the Brassicaceae (10 species), Apiaceae (9 species) and Asteraceae (6 species). The most common parts of the plants used as vegetables and medicine are their leaves (44.45%) and whole plant (22.22%). Plants are often used as decoction (34%), powder (26%). Highest plants species are used for gastrointestinal diseases (45 species). Highest ICF value (0.4) was recorded for dermatological disorders category. 100% fidelity level was found for two plant species i.e., Descurainia sophia, and Caralluma tuberculata. The highest use value was reported for the Lepidium sativum (0.63). Highest RFC value was calculated for Caralluma tuberculata (0.14). Highest use report was calculated for three species Apium graveolens Lepidium sativum and Mentha longifolia, (7 UR for each). The highest FIV was calculated for family Brassicaceae (14 FIV).Our study reveals that plants are still used as a major source of food like vegetables as well as medicine for the local people. Too little or no information is available on their uses, cooking methods and nutritional and physiotherapeutic values. Necessary steps should be taken to perform phytochemical and pharmacological studies to explore the potential nutritional values and herbal drug discovery of such plants. (author)

  13. Cruciferae (Brassicaceae: альтернативная обработка для «Конспекта сосудистых растений Монголии» (2014

    Directory of Open Access Journals (Sweden)

    D. A. German

    2015-07-01

    Full Text Available Представлен конспект крестоцветных (Cruciferae, или Brassicaceae Монголии, основанный на критической ревизии гербарных сборов, интернет-ресурсов и литературы, в том числе новейших работ по систематике семейства. Для всех 141 видов и 7 подвидов из 59 родов, отмеченных на данный момент во флоре страны, приведена краткая синонимика и данные по распространению (наличию или отсутствию в каждом из 16-ти ботанико-географических регионов в Монголии. Впервые для страны указан род левкой – Matthiola W. T. Aiton, представленный естественно произрастающим здесь M. superba Conti; некоторые виды отмечены в качестве новинок для отдельных районов. В то же время, перечислены и прокомментированы ошибочные указания представителей семейства для Монголии или определенных ее районов, обнародованные в основном после выхода «Конспекта …» И.А. Губанова (1996. Валидизированы новые комбинации в родах Guenthera Andrz. и Stevenia Fisch. Сообщение может считатья альтернативной обработкой крестоцветных для недавно вышедшего «Конспекта сосудистых растений Монголии» (2014.

  14. 76 FR 39807 - Endangered and Threatened Wildlife and Plants; Designation of Critical Habitat for Lepidium...

    Science.gov (United States)

    2011-07-07

    ... decision on this action. ADDRESSES: You may submit comments by one of the following methods: Federal e... designate that specific area as critical habitat will result in the extinction of the species. We are... rationale; and Whether any specific exclusions may result in the extinction of the species and why. (6) The...

  15. First case report of testosterone assay-interference in a female taking maca (Lepidium meyenii).

    Science.gov (United States)

    Srikugan, L; Sankaralingam, A; McGowan, B

    2011-03-25

    A young female with prolonged intermenstrual bleeding was found to have raised total plasma testosterone of 25.8 nmol/l (NR<2.9 nmol/l) using the Roche Elecsys Testosterone I immunoassay without clinical features of virulisation. Few months ago investigations for lethargy and low libido had shown normal total testosterone of 0.8 nmol/l. Further history revealed that she was using maca extract to improve her lethargy and low libido. Maca is traditionally used for its aphrodisiac and fertility-enhancing properties. Maca use has not been shown to affect serum testosterone in mice and human studies. Immunoassay interference with maca was suspected. Testosterone immunoassays use monoclonal antibodies specifically directed against testosterone. They are prone to interference from androgenic compounds. Reanalysis of the original serum sample using Elecsys Testosterone II assay, a higher affinity assay, revealed a total testosterone level of 2.9 nmol/l. It is important to exclude assay interference when testosterone level is greater than 5 nmol/l without supportive clinical signs.

  16. Unintentional and Sequential Lead Exposure from a Ceramic Mug and Maca (Lepidium meyenii).

    Science.gov (United States)

    Johnson-Arbor, Kelly; Vo, Kathy; Wong, Flavia; Gajek, Ryszard

    2018-01-08

    Although the incidence of lead poisoning has decreased in the USA over the last 30 years, human exposures to lead-containing products are still reported. We present a case of unintentional lead exposure from a store-bought ceramic mug and a nutritional supplement. A 32-year-old female was found to have a whole blood lead concentration of 44 μg/dL. Evaluation of her home, occupation, and hobbies initially did not identify a source of lead exposure. Further investigation revealed that the likely etiology of the exposure was lead leaching from a ceramic mug used by the patient to drink hot lemon water while she was pregnant. She stopped drinking from the mug and her blood lead levels decreased, but increased a year later after she began to ingest a maca root powder supplement. Upon discontinuation of maca root powder ingestion, her blood lead levels decreased further. Over time, the acidity and heat of the hot lemon water used in the ceramic mug enhanced the breakdown of its leaded glaze. Maca powder, which is available as a nutritional supplement and is used to treat fatigue and enhance fertility, may contain lead and other minerals. Consumers, particularly women of childbearing age, and their physicians should be aware that imported products available from commercial retailers and internet vendors may contain significant amounts of lead.

  17. Aqueous Extract of Black Maca (Lepidium meyenii) on Memory Impairment Induced by Ovariectomy in Mice

    Science.gov (United States)

    Rubio, Julio; Qiong, Wang; Liu, Xinmin; Jiang, Zhen; Dang, Haixia; Chen, Shi-Lin; Gonzales, Gustavo F.

    2011-01-01

    The present study aims to test two different doses of aqueous extract of black maca on learning and memory in ovariectomized (OVX) mice and their relation with malonalehyde (MDA), acetylcholinesterase (Ache) and monoamine oxidase (MAO) brain levels. Female mice were divided into five groups: (i) naive (control), (ii) sham, (iii) OVX mice and OVX mice treated with (iv) 0.50 g kg−1 and (v) 2.00 g kg−1 black maca. Mice were orally treated with distilled water or black maca during 35 days starting 7 days after surgery. Memory and learning were assessed using the water Morris maze (from day 23–27) and the step-down avoidance test (days 34 and 35). At the end of each treatment, mice were sacrificed by decapitation and brains were dissected out for MDA, Ache and MAO determinations. Black maca (0.5 and 2.0 g/kg) increased step-down latency when compared to OVX control mice. Black maca decreased MDA and Ache levels in OVX mice; whereas, no differences were observed in MAO levels. Finally, black maca improved experimental memory impairment induced by ovariectomy, due in part, by its antioxidant and Ache inhibitory activities. PMID:18955369

  18. Lepidium meyenii (Maca) reversed the lead acetate induced -- damage on reproductive function in male rats.

    Science.gov (United States)

    Rubio, Julio; Riqueros, Marissa I; Gasco, Manuel; Yucra, Sandra; Miranda, Sara; Gonzales, Gustavo F

    2006-07-01

    Rats were treated with 0, 8, 16 and 24 mg/kg of lead acetate (LA) (i.p.) for 35 days with or without Maca. Maca was co-administrated orally from day 18 to day 35. The lengths of stages of the seminiferous epithelium were assessed by transillumination. Also, sex organ weights, testicular and epididymal sperm count, sperm motility, daily sperm production, sperm transit rate and serum testosterone levels were measured. Lead acetate treatment resulted in a dose-response reduction of lengths of stages VIII and IX-XI, and serum testosterone levels. However, rats treated with 8 and 16 mg/kg but not 24 mg/kg of lead acetate showed a low number of testicular spermatids, low daily sperm production (DSP) and low epididymal sperm count. Administration of Maca to rats treated with lead acetate resulted in higher lengths of stages VIII and IX-XI with respect to lead acetate-treated rats. Moreover, treatment with Maca to lead acetate-treated rats resulted in lengths of stages VIII and IX-XI similar to the control group. Maca administration also reduced the deleterious effect on DSP caused by lead acetate treatment. Maca prevented LA-induced spermatogenic disruption in rats and it may become in a potential treatment of male infertility associated with lead exposure.

  19. [Effect of red maca (Lepidium meyenii) on INF-γ levels in ovariectomized rats].

    Science.gov (United States)

    Leiva-Revilla, Johanna; Guerra-Castañon, Félix; Olcese-Mori, Paola; Lozada, Iván; Rubio, Julio; Gonzales, Carla; Gonzales, Gustavo F

    2014-01-01

    Compare the effect of different doses of red maca on gamma interferon (IFN-γ) levels in ovariectomized rats (OVX). Adult female rats were randomly divided into the following six groups: Group 1: pseudo-ovariectomized rats (PO); Group 2: OVX rats; Group 3: OVX rats treated with 4 ug/kg estradiol; and Group 4, 5 and 6: OVX rats treated with red maca extracts with 2.15, 4.3 and 8.6 mg polyphenols/body weight kilogram, respectively. OVX rats showed low levels of IFN-γ compared to PO rats. Estradiol and red maca reversed the effect of ovariectomy on the IFN-γ levels. A positive dose-response effect of red maca on IFN-γ levels was shown (r = 0.57, p <0.05). Red maca administration increases levels of IFN-γ in ovariectomized rats.

  20. The influence of maca (Lepidium meyenii) on antioxidant status, lipid and glucose metabolism in rat.

    Science.gov (United States)

    Vecera, Rostislav; Orolin, Jan; Skottová, Nina; Kazdová, Ludmila; Oliyarnik, Olena; Ulrichová, Jitka; Simánek, Vilím

    2007-06-01

    This work focused on the effect of Maca on lipid, anti-oxidative, and glucose parameters in hereditary hypertriglyceridemic (HHTg) rat. Maca (1%) was administred to rats as a part of a high-sucrose diet (HSD) for 2 weeks. Rosiglitazone (0.02%) was used as a positive control. Maca significantly decreased the levels of VLDL (very low density lipoproteins), LDL (low density lipoproteins), and total cholesterol, and also the level of TAG (triacylglycerols) in the plasma, VLDL, and liver. Maca, as well as rosiglitazone, significantly improved glucose tolerance, as the decrease of AUC (area under the curve) of glucose showed, and lowered levels of glucose in blood. The activity of SOD (superoxide dismutase) in the liver, the GPX (glutathione peroxidase) in the blood, and the level of GSH (glutathione) in liver increased in all cases significantly. Results demonstrate that maca seems to be promising for a positive influence on chronic human diseases (characterized by atherogenous lipoprotein profile, aggravated antioxidative status, and impaired glucose tolerance), and their prevention.

  1. Aqueous Extract of Black Maca (Lepidium meyenii) on Memory Impairment Induced by Ovariectomy in Mice.

    Science.gov (United States)

    Rubio, Julio; Qiong, Wang; Liu, Xinmin; Jiang, Zhen; Dang, Haixia; Chen, Shi-Lin; Gonzales, Gustavo F

    2011-01-01

    The present study aims to test two different doses of aqueous extract of black maca on learning and memory in ovariectomized (OVX) mice and their relation with malonalehyde (MDA), acetylcholinesterase (Ache) and monoamine oxidase (MAO) brain levels. Female mice were divided into five groups: (i) naive (control), (ii) sham, (iii) OVX mice and OVX mice treated with (iv) 0.50 g kg(-1) and (v) 2.00 g kg(-1) black maca. Mice were orally treated with distilled water or black maca during 35 days starting 7 days after surgery. Memory and learning were assessed using the water Morris maze (from day 23-27) and the step-down avoidance test (days 34 and 35). At the end of each treatment, mice were sacrificed by decapitation and brains were dissected out for MDA, Ache and MAO determinations. Black maca (0.5 and 2.0 g/kg) increased step-down latency when compared to OVX control mice. Black maca decreased MDA and Ache levels in OVX mice; whereas, no differences were observed in MAO levels. Finally, black maca improved experimental memory impairment induced by ovariectomy, due in part, by its antioxidant and Ache inhibitory activities.

  2. The Composition Analysis of Maca (Lepidium meyenii Walp.) from Xinjiang and Its Antifatigue Activity

    OpenAIRE

    Li, Jieying; Chen, Longfei; Li, Jinwei; Duan, Zhenhua; Zhu, Song; Fan, Liuping

    2017-01-01

    Environment would affect the nutritional composition of maca, especially its secondary metabolite. The chemical compositions and function of Xinjiang maca were not very clear. The chemical compositions and bioactivity of Xinjiang maca were determined. A mouse model was also used to evaluate the antifatigue activity of Xinjiang maca as a forced swimming test was performed and certain biochemical parameters related were estimated. The results show that the Xinjiang maca is rich in protein conte...

  3. Stepwise extraction of Lepidium sativum seed gum: Physicochemical characterization and functional properties

    DEFF Research Database (Denmark)

    Razmkhah, Somayeh; Razavi, Seyed Mohammad Ali; Mohammadifar, Mohammad Amin

    2016-01-01

    Cress seed gum (CSG) was fractionated using stepwise extraction with water, yielding three fractions (F1, F2, F3) whose average molecular weights ranged from 863 to 1080 kDa. The chemical composition (monosaccharide, ash, moisture, CHN and uronic acid contents) and molecular weight of the fractio...

  4. Protein-free cress seed (Lepidium sativum) gum: Physicochemical characterization and rheological properties

    DEFF Research Database (Denmark)

    Razmkhah, Somayeh; Razavi, Seyed Mohammad Ali; Mohammadifar, Mohammad Amin

    2016-01-01

    Protein-free cress seed gum (PFCSG) was obtained by precipitation of crude cress seed gum (CSG) withethanol followed by treatment with protease. Molecular weight, moisture, ash and uronic acids contentdecreased after elimination of protein. Elimination of protein improved significantly rheologica...

  5. Spread dynamics of perennial pepperweed (Lepidium latifolium) in two seasonal wetland areas

    Science.gov (United States)

    Renz, Mark J.; Steinmaus, Scott J.; Gilmer, David S.; DiTomaso, Joseph M.

    2012-01-01

    Perennial pepperweed is an invasive plant that is expanding rapidly in several plant communities in the western United States. In California, perennial pepperweed has aggressively invaded seasonal wetlands, resulting in degradation of habitat quality. We evaluated the rate and dynamics of population spread, assessed the effect of disturbance on spread, and determined the biotic and abiotic factors influencing the likelihood of invasion. The study was conducted at eight sites within two wetland regions of California. Results indicate that in undisturbed sites, spread was almost exclusively through vegetative expansion, and the average rate of spread was 0.85 m yr−1 from the leading edge. Spread in sites that were disked was more than three times greater than in undisturbed sites. While smaller infestations increased at a faster rate compared with larger populations, larger infestations accumulated more newly infested areas than smaller infestations from year to year. Stem density was consistently higher in the center of the infestations, with about 2.4 times more stems per square meter compared with the leading edge at the perimeter of the population. The invasion by perennial pepperweed was positively correlated with increased water availability but was negatively correlated with the cover of perennial and annual species. Thus, high cover of resident vegetation can have a suppressive effect on the rate of invasion, even in wetland ecosystems. On the basis of these results, we recommend that resident plant cover not be disturbed, especially in wet areas adjacent to areas currently infested with perennial pepperweed. For infested areas, management efforts should be prioritized to focus on controlling satellite populations as well as the leading edge of larger infestations first. This strategy could reduce the need for costly active restoration efforts by maximizing the probability of successful re-establishment of resident vegetation from the adjacent seedbank.

  6. Allevation of Oxidative Damages Induced by Salinity in Cress (Lepidium sativum by Pretreating with Arginine

    Directory of Open Access Journals (Sweden)

    E Asadi karam

    2015-05-01

    Full Text Available Salinity is one of the main stresses that have negative effectcs on seedling growth, and plant production. It inhibits growth of plants through disturbance of the balance between production of ROS and antioxidant defense mechanism which results in oxidative stress. Because, arginine is a vital regulator of physiological and developmental processes the effect of different concentrations of arginine pretreatment of the plant on alleviation of oxidative stress induced by salt 50 and 100Mm NaCl was investigated. Arginine pretreatment increased chlorophyll a, b, carotenoid and seedling growth under salinity condition. Results also showed that salt stress increased proline, protein, H2O2, soluble sugar and the activity of ascorbate peroxidase, guaiacol peroxidase and catalase. Pretreatment of plants with Arg reduced proline, soluble sugar, H2O2 and antioxidant enzymes activity content significantly. The conclusion is that in garden cress plants, pretreatment with concentration of 5 µM and 10 μM arginine may protect cress under salinity stress, probably through the contracting with ROS and or induction of anti-oxidative enzymes

  7. Purification of cress seed (Lepidium sativum) gum: Physicochemical characterization and functional properties

    DEFF Research Database (Denmark)

    Razmkhah, Somayeh; Mohammadifar, Mohammad Amin; Razavi, Seyed Mohammad Ali

    2016-01-01

    The aim of the present study was to investigate the effects of different purification methods (ethanol, isopropanol and ethanol-isopropanol) on the physicochemical and functional characteristics of cress seed gum. Sugar composition and molecular weight of the samples varied significantly. All...... the purification methods reduced ash and protein content and molecular weight of cress seed gum. The main decomposition of the purified samples started above 200º C and initial decomposition temperature of the crude gum was 190.21º C. DSC thermograms of the purified gums showed two exothermic events at 257.......81-261.95 ºC and 302.46-311.57 ºC. Crude gum displayed an exothermic peak at 259.42º C. Sample I (purified using isopropanol) imparted the best surface activity among the purified samples as it had the highest protein and uronic acid contents and the lowest Mw. All the purification methods could improve...

  8. 76 FR 27183 - Endangered and Threatened Wildlife and Plants; Designation of Critical Habitat for Lepidium...

    Science.gov (United States)

    2011-05-10

    ... pollinators for more successful fruit production and to maintain genetic variability by genetic exchange with... organic matter and nutrients due to lower biomass production (Meyer and Quinney 1993, pp. 3, 6; Fisher et... organisms, primarily bryophytes, lichens, algae, and cyanobacteria, that bind together surface soil...

  9. Purification of cress seed (Lepidium sativum) gum: A comprehensive rheological study

    DEFF Research Database (Denmark)

    Razmkhah, Somayeh; Razavi, Seyed Mohammad Ali; Mohammadifar, Mohammad Amin

    2016-01-01

    In this paper, the effects of different purification methods (ethanol (sample E), isopropanol (sample I) and ethanol-isopropanol (sample EI)) on intrinsic viscosity, steady and dynamic rheological properties of cress seed gum were investigated. The gum dispersions exhibited viscoelastic properties......, the storage modulus (G′) was higher than the loss modulus (G″), and mechanical spectra of the crude and purified cress seed gums were classified as weak gels. The purified samples had stronger and more elastic network structure than the crude gum (CSG) and the gel network got stronger along the series of I......, EI and E. All the gum dispersions indicated shear-thinning behavior and the viscosity of the samples followed the order of E > EI > I > CSG. Herschel-Bulkley model was the best model to describe steady shear flow behavior and Arrhenius-type model was also applied to describe the effect of temperature...

  10. Dilute solution, flow behavior, thixotropy and viscoelastic characterization of cress seed (Lepidium sativum) gum fractions

    DEFF Research Database (Denmark)

    Razmkhah, Somayeh; Razavi, Seyed Mohammad Ali; Mohammadifar, Mohammad Amin

    2017-01-01

    In this study, rheological properties of cress seed gum (CSG) and its fractions (F1, F2, F3; fractionated using stepwise extraction with water) were investigated. Cress seed gum and its fractions revealed random coil conformation in dilute regimes; chain flexibility and intrinsic viscosity...... increased from F1 to F2 to F3. The mechanical spectra derived from strain sweep and frequency sweep measurements indicated that the gum dispersions had viscoelastic behavior; all of them were classified as weak gels and the gel network got stronger along the series of F1, F2 and F3. Arrhenius-type model...

  11. Study of Maca (Lepidium meyenii Walp., Andean crop with therapeutic properties

    Directory of Open Access Journals (Sweden)

    Gabriel Sifuentes-Penagos

    2015-06-01

    Full Text Available The maca is a native product of the Central Andes of Peru, it is resistant to hail, to frost and to prolonged droughts. It is cultivated from the Inca period in altitudes between 3800 - 4500 meters above sea level. This herbaceous plant, has not only a high nutritional value, but it is also valued for its medicinal role. Among the chemical components of this andean crop that have been related with therapeutic actions the increasing fertility and the energy levels, the antioxidant actions, the improving sexual desire and the growth rate. There are glucosinolates, sterols, fatty acids (macaene and their corresponding amides (macamides, alkaloids (lepidilines A and B, macaridine and polyphenols. This article presents a compilation of the researches that has been performed on the therapeutic properties of maca and its compounds responsible of them.

  12. Correlations between Antioxidant Activity and Alkaloids and Phenols of Maca (Lepidium meyenii

    Directory of Open Access Journals (Sweden)

    Jin Gan

    2017-01-01

    Full Text Available The antioxidant capacity of maca has been considered to be the basis for other bioactivities, and revealing the active antioxidant compounds would help to elucidate a variety of bioactive compounds. In this study, the correlation between the antioxidant activity of maca and secondary metabolites, including ferric reducing antioxidant potential (FRAP, hydroxyl radical scavenging ability (HRSA, lipid peroxidation inhibition ability (LPIA, total phenolic contents (TPCs, total alkaloid contents (TACs, and total sterol contents (TSCs, was investigated by measuring. Chloroform was selected to be an efficient extraction solvent for antioxidant compounds in maca by polarity fractions test. The results showed that TPC exhibited significant linear correlations (P<0.05 to FRAP and LPIA, while TAC had significant linear correlations (P<0.05 to FRAP, HRSA, and LPIA. These results suggested that alkaloids and phenols were the most important substances for the antioxidation of maca, of which the antioxidant effect of alkaloids seemed to be higher than that of phenols.

  13. Aqueous Extract of Black Maca (Lepidium meyenii on Memory Impairment Induced by Ovariectomy in Mice

    Directory of Open Access Journals (Sweden)

    Julio Rubio

    2011-01-01

    Full Text Available The present study aims to test two different doses of aqueous extract of black maca on learning and memory in ovariectomized (OVX mice and their relation with malonalehyde (MDA, acetylcholinesterase (Ache and monoamine oxidase (MAO brain levels. Female mice were divided into five groups: (i naive (control, (ii sham, (iii OVX mice and OVX mice treated with (iv 0.50 g kg−1 and (v 2.00 g kg−1 black maca. Mice were orally treated with distilled water or black maca during 35 days starting 7 days after surgery. Memory and learning were assessed using the water Morris maze (from day 23–27 and the step-down avoidance test (days 34 and 35. At the end of each treatment, mice were sacrificed by decapitation and brains were dissected out for MDA, Ache and MAO determinations. Black maca (0.5 and 2.0 g/kg increased step-down latency when compared to OVX control mice. Black maca decreased MDA and Ache levels in OVX mice; whereas, no differences were observed in MAO levels. Finally, black maca improved experimental memory impairment induced by ovariectomy, due in part, by its antioxidant and Ache inhibitory activities.

  14. Estudio de la Maca (Lepidium meyenii Walp., cultivo andino con propiedades terapéuticas

    Directory of Open Access Journals (Sweden)

    Gabriel Sifuentes-Penagos

    2015-01-01

    Full Text Available La maca es un producto originario de los Andes Centrales del Perú, resistente a granizadas, heladas y sequías prolongadas. Se cultiva desde la época incaica en altitudes comprendidas entre los 3800 a 4500 m.s.n.m. Esta planta herbácea, presenta no sólo un alto valor nutricional sino también es valorada por su papel medicinal. Entre los componentes químicos de este cultivo andino que se han relacionado con sus acciones terapéuticas como el aumento de la fertilidad, niveles de energía, acción antioxidante, mejora del deseo sexual y la tasa de crecimiento, destacan: los glucosinolatos, esteroles, ácidos grasos (macaeno y sus respectivas amidas (macamidas, alcaloides (lepidilinas A y B, macaridina y polifenoles. El objetivo de este trabajo fue, recopilar las diferentes investigaciones que se han llevado a cabo sobre las propiedades terapéuticas de la maca y los compuestos responsables de las mismas.

  15. The Composition Analysis of Maca (Lepidium meyenii Walp. from Xinjiang and Its Antifatigue Activity

    Directory of Open Access Journals (Sweden)

    Jieying Li

    2017-01-01

    Full Text Available Environment would affect the nutritional composition of maca, especially its secondary metabolite. The chemical compositions and function of Xinjiang maca were not very clear. The chemical compositions and bioactivity of Xinjiang maca were determined. A mouse model was also used to evaluate the antifatigue activity of Xinjiang maca as a forced swimming test was performed and certain biochemical parameters related were estimated. The results show that the Xinjiang maca is rich in protein content and amino acids, especially branched chain amino acids such as Valine and Isoleucine related to the effect of antifatigue. It also has considerable minerals ions such as Ca and Mg. Besides, bioactive ingredients such as maca amide, glucosinolate, and alkaloid of Xinjiang maca are similar to those of maca from other areas, which qualify the biological value of Xinjiang maca. The results of mice model suggest that maca has a dose-dependent antifatigue activity by decreasing blood lactic acid, as well as increasing liver glycogen content and the forced swimming time.

  16. Development of near-infrared spectroscopy calibrations to measure quality characteristics in intact Brassicaceae germplasm

    Science.gov (United States)

    Determining seed quality parameters is an integral part of cultivar improvement and germplasm screening. However, quality tests are often time cnsuming, seed destructive, and can require large seed samples. This study describes the development of near-infrared spectroscopy (NIRS) calibrations to mea...

  17. An integrated approach for the conservation of threatened plants: The case of Arabis kennedyae (Brassicaceae)

    Science.gov (United States)

    Andreou, M.; Delipetrou, P.; Kadis, C.; Tsiamis, G.; Bourtzis, K.; Georghiou, K.

    2011-05-01

    The aim of this paper is to propose an integrated approach (including population and habitat monitoring and the study of reproductive biology and genetic diversity) for the comprehensive study of threatened plants, for which conservation measures are imperative. We applied this model to the plant species Arabis kennedyae which is classified as endangered according to the IUCN criteria. The current population of the species consists of three small subpopulations (AR1, AR2, and AR3) at three locations. Population size was characterized by considerable annual fluctuations. The distribution pattern of the plant followed habitat availability. Relative Reproductive Success remained stable but moderate. Germination of dormant seeds was promoted by light and was optimal at 15 and 20 °C. Genetic analysis showed low interpopulation variability and detected two groups: haplotype I (AR1 and AR3) and haplotype II (AR2), which may represent two altitudinal ecotypes. The direct threats identified were related to recreation activities, road construction and fire. The subpopulations of the plant are regulated by density and depend on fecundity and on the soil seedbank while their persistence depends mainly on habitat availability. Low genetic diversity combined with small population size and a possible reduction in fitness suggest increased susceptibility to loss of genetic variation. The overall results suggest that ex situ conservation in a seed bank, and in situ conservation in the form of population restoration, are suitable conservation measures and the study of the different aspects of the species' biology has provided the data required for their implementation.

  18. A new species of Hesperis (Brassicaceae) from SW Anatolia, Turkey

    DEFF Research Database (Denmark)

    Parolly, G.; Tan, Kit

    2006-01-01

    Hesperis kuerschneri, from the vilayet of Denizli in the Western Taurus is described as a species new to science and illustrated. Its affinities are with H. theophrasti, which has several infraspecific taxa in the Balkans and Anatolia. The new species occurs on steep serpentine scree slopes...... together with other serpentine plants of the Western Taurus and is rather local in distribution....

  19. Models of the fate of glucosinolates in Brassicaceae from processing to digestion

    NARCIS (Netherlands)

    Kruse, I.

    2015-01-01

    Abstract

    Glucosinolates are secondary metabolites of Brassica vegetables. Glucosinolates are not bioactive themselves, but their hydrolysis products isothiocyanates have been associated with health benefits. The concentrations of glucosinolates and their break down products are

  20. Pleiotropic effects of flowering time genes in the annual crucifer Arabidopsis thaliana (Brassicaceae)

    NARCIS (Netherlands)

    Van Tienderen, P.H.; Hammad, I.; Zwaal, F.C.

    1996-01-01

    Variation in flowering time of Arabidopsis thaliana was studied in an experiment with mutant lines. The pleiotropic effects of flowering time genes on morphology and reproductive yield were assessed under three levels of nutrient supply. At all nutrient levels flowering time and number of rosette

  1. Sinapate esters provide greater UV-B attenuation than flavonoids in Arabidopsis thaliana (Brassicaceae)

    International Nuclear Information System (INIS)

    Sheahan, J.J.

    1996-01-01

    Mutants affected in flavonoid (tt4) or sinapate ester (fah1) biosynthesis were used to assess the relative importance of these phenolic UV photoprotectants in Arabidopsis. Flavonoid and sinapate ester absorption was more specific for UV-B than major nonphenolic chromophores in crude extracts. A new method of evaluating phenolic UV-B attenuation was developed using fluorescence analysis. When excited by UV-B, sinapate ester containing leaves and cotyledons had enhanced sinapate ester fluorescence and reduced chlorophyll fluorescence relative to those without sinapate esters. Although fluorescence analysis gave no evidence of UV-B attenuation by flavonoids, enhanced chlorophyll and protein loss were observed upon UV-B exposure in flavonoid-deficient leaves, suggesting they have another mechanism of UV-B protection. The hydroxycinnamates have been largely ignored as UV-B attenuating pigments. and the results indicate that greater attention should be paid to their role in attenuating UV-B

  2. Chemosystematic significance of flavonoids isolated from Diplotaxis acris (Brassicaceae) and related taxa.

    Science.gov (United States)

    Hussein, Sameh R; Marzouk, Mona M; Kassem, Mona E S; Abdel Latif, Rasha R; Mohammed, Reda S

    2017-02-01

    The chemosystematic relationship of four Diplotaxis species; Diplotaxis acris, Diplotaxis erucoides, Diplotaxis harra and Diplotaxis muralis were surveyed from the flavonoids point of view. These species were found to produce 33 flavonoids (7 flavones and 26 flavonols), including 11 compounds were isolated in the present study from D. acris. Among them, seven flavonoids were identified for the first time; luteolin (4), kaempferol (8), kaempferol 3-O-β-glucopyranoside-7-O-α-rhamnopyranoside (13), quercetin 3-O-β-glucopyranoside (16), quercetin 7-O-β-glucopyranoside (20), isorhamnetin (22) and isorhamnetin 3-O-β-glucopyranoside-7-O-α-rhamnopyranoside (32). Their structures were recognized on the basis of chemical and spectroscopic techniques (1D & 2D NMR, UV, EI & ESI/MS). The isolated flavonoids may provide useful taxonomic characters at the infraspecific levels of classification where the flavonoid profile of D. acris and D. harra is similar and different from the other species.

  3. The efficiency of Arabidopsis thaliana (Brassicaceae) root hairs in phosphorus acquisition.

    Science.gov (United States)

    Bates, T R; Lynch, J P

    2000-07-01

    Arabidopsis thaliana root hairs grow longer and denser in response to low-phosphorus availability. In addition, plants with the root hair response acquire more phosphorus than mutants that have root hairs that do not respond to phosphorus limiting conditions. The purpose of this experiment was to determine the efficiency of root hairs in phosphorus acquisition at high- and low-phosphorus availability. Root hair growth, root growth, root respiration, plant phosphorus uptake, and plant phosphorus content of 3-wk-old wild-type Arabidopsis (WS) were compared to two root hair mutants (rhd6 and rhd2) under high (54 mmol/m) and low (0.4 mmol/m) phosphorus availability. A cost-benefit analysis was constructed from the measurements to determine root hair efficiency. Under high-phosphorus availability, root hairs did not have an effect on any of the parameters measured. Under low-phosphorus availability, wild-type Arabidopsis had greater total root surface area, shoot biomass, phosphorus per root length, and specific phosphorus uptake. The cost-benefit analysis shows that under low phosphorus, wild-type roots acquire more phosphorus for every unit of carbon respired or unit of phosphorus invested into the roots than the mutants. We conclude that the response of root hairs to low-phosphorus availability is an efficient strategy for phosphorus acquisition.

  4. The Brassicaceae family displays divergent, shoot-skewed NLR resistance gene expression

    DEFF Research Database (Denmark)

    Munch, David; Gupta, Vikas; Bachmann, Asger

    2018-01-01

    Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 ...

  5. Assessment of genetic diversity in Brassica juncea Brassicaceae genotypes using phenotypic differences and SSR markers

    Directory of Open Access Journals (Sweden)

    Vinu V.

    2013-12-01

    Full Text Available Las especies de mostaza del género Brassica representan uno de los cultivos de semillas oleaginosas más importantes en India, sin embargo, su diversidad genética es poco conocida. Para la utilización de genotipos en programas de cultivos resulta esencial un mayor conocimiento sobre este tema. Debido a ello, se evaluó la diversidad genética entre 44 genotipos de mostaza de la India Brassica juncea incluyendo variedades y líneas puras de diferentes zonas agro-climáticas de la India y algunos genotipos exóticos Australia, Polonia y China. Para ello, se utilizaron marcadores SSR específicos del genoma A y B y datos fenotípicos del rendimiento de 12 cosechas y sus características. De los 143 primers evaluados, 134 reportaron polimorfismo y un total de 355 alelos fueron amplificados. Se generaron dendrogramas a partir de los coeficientes de similitud de Jaccard y de disimilitud Manhattan, basados en un algoritmo de vinculación promedio UPGMA. Se utilizaron datos de marcadores genéticos y datos fenotípicos. Los genotipos se agruparon en cuatro grupos basados en las distancias genéticas. Ambos patrones de agrupamiento, tanto los basados en los coeficientes de similitud de Jaccard como los basados en los de disimilitud Manhattan, separaron independientemente los genotipos por su genealogía y origen, de una manera efectiva. El PCoA reveló que la agrupación de genotipos basada en datos de marcadores SSR, es más convincente que los datos fenotípicos, sin embargo, se observó que la correlación entre las matrices de distancia fenotípica y genética resultó muy baja r=0.11. Por lo tanto, para estudios de diversidad basados en marcadores moleculares es necesario realizar más pruebas. Los marcadores SSR constituyen herramientas más eficientes para discriminar entre genotipos de B. juncea, que las características cuantitativas.

  6. Sulfur-associated polioencephalomalacia in cattle grazing plants in the Family Brassicaceae.

    Science.gov (United States)

    McKenzie, R A; Carmichael, A M; Schibrowski, M L; Duigan, S A; Gibson, J A; Taylor, J D

    2009-01-01

    Polioencephalomalacia was diagnosed histologically in cattle from two herds on the Darling Downs, Queensland, during July-August 2007. In the first incident, 8 of 20 18-month-old Aberdeen Angus steers died while grazing pastures comprising 60%Sisymbrium irio (London rocket) and 40%Capsella bursapastoris (shepherd's purse). In the second incident, 2 of 150 mixed-breed adult cattle died, and another was successfully treated with thiamine, while grazing a pasture comprising almost 100%Raphanus raphanistrum (wild radish). Affected cattle were either found dead or comatose or were seen apparently blind and head-pressing in some cases. For both incidents, plant and water assays were used to calculate the total dietary sulfur content in dry matter as 0.62% and 1.01% respectively, both exceeding the recommended 0.5% for cattle eating more than 40% forage. Blood and tissue assays for lead were negative in both cases. No access to thiaminase, concentrated sodium ion or extrinsic hydrogen sulfide sources were identified in either incident. Below-median late summer and autumn rainfall followed by above-median unseasonal winter rainfall promoted weed growth at the expense of wholesome pasture species before these incidents.

  7. Bidirectional but asymmetrical sexual hybridization between Brassica carinata and Sinapis arvensis (Brassicaceae).

    Science.gov (United States)

    Cheung, Kyle W; Razeq, Fakhria M; Sauder, Connie A; James, Tracey; Martin, Sara L

    2015-05-01

    With transgenic crop development it is important to evaluate the potential for transgenes to escape into populations of wild, weedy relatives. Ethiopian mustard (Brassica carinata, BBCC) is easily transformed and is being investigated for uses from biodiesel fuels to biopharmaceuticals. However, little work has been done evaluating its ability to cross with relatives such as wild mustard (Sinapsis arvensis, SrSr), an abundant, cosmopolitan weedy relative. Here we conducted bidirectional crosses with Ethiopian mustard as a maternal parent in 997 crosses and paternal parent in 1,109 crosses. Hybrids were confirmed using flow cytometry and species-specific ITS molecular markers and indicate a high hybridization rate of 6.43 % between Ethiopian mustard (♀) and wild mustard (♂) and a lower, but not insignificant, hybridization rate of 0.01 % in the reverse direction. The majority of the hybrids were homoploid (BCSr) with less than 1 % of pollen production of their parents and low seed production (0.26 seeds/pollination) in crosses and backcrosses indicating a potential for advanced generation hybrids. The accession used had a significant effect on hybrid seed production with different accessions of Ethopian mustard varying in their production of hybrid offspring from 2.69 to 16.34 % and one accession of wild mustard siring almost twice as many hybrid offspring per flower as the other. One pentaploid (BBCCSr) and one hexaploid (BBCCSrSr) hybrid were produced and had higher pollen viability, though no and low seed production, respectively. As wild mustard is self-incompatible and the outcrossing rate of Ethiopian mustard has been estimated as 30 % potential for hybrid production in the wild appears to be high, though the hybridization rate found here represents a worst case scenario as it does not incorporate pre-pollination barriers. Hybridization in the wild needs to be directly evaluated as does the propensity of Ethiopian mustard to volunteer.

  8. Root transcript profiling of two Rorippa (brassicaceae) species reveals gene clusters associated with extreme submergence tolerance.

    NARCIS (Netherlands)

    Sasidharan, R.; Mustroph, A.; Boonman, A.; Akman, M.; Ammerlaan, A.M.H.; Breit, T.M.; Schranz, M.E.; Voesenek, L.A.C.J.; Tienderen, van P.H.

    2013-01-01

    Complete submergence represses photosynthesis and aerobic respiration, causing rapid mortality in most terrestrial plants. However, some plants have evolved traits allowing them to survive prolonged flooding, such as species of the genus Rorippa, close relatives of Arabidopsis (Arabidopsis

  9. Oxygen-depleted zones inside reproductive structures of Brassicaceae: implications for oxygen control of seed development

    Science.gov (United States)

    Porterfield, D. M.; Kuang, A.; Smith, P. J.; Crispi, M. L.; Musgrave, M. E.

    1999-01-01

    Growth of Arabidopsis thaliana (L.) Heynh. in decreasing oxygen partial pressures revealed a linear decrease in seed production below 15 kPa, with a complete absence of seed production at 2.5 kPa oxygen. This control of plant reproduction by oxygen had previously been attributed to an oxygen effect on the partitioning between vegetative and reproductive growth. However, plants grown in a series of decreasing oxygen concentrations produced progressively smaller embryos that had stopped developing at progressively younger stages, suggesting instead that their growth is limited by oxygen. Internal oxygen concentrations of buds, pistils, and developing siliques of Brassica rapa L. and siliques of Arabidopsis were measured using a small-diameter glass electrode that was moved into the structures using a micromanipulator. Oxygen partial pressures were found to be lowest in the developing perianth (11.1 kPa) and pistils (15.2 kPa) of the unopened buds. Pollination reduced oxygen concentration inside the pistils by 3 kPa after just 24 h. Inside Brassica silique locules, partial pressures of oxygen averaged 12.2 kPa in darkness, and increased linearly with increasing light levels to 16.2 kPa. Measurements inside Arabidopsis siliques averaged 6.1 kPa in the dark and rose to 12.2 kPa with light. Hypoxia in these microenvironments is postulated to be the point of control of plant reproduction by oxygen.

  10. Cardamine hamiltonii G.Don – Aziatische veldkers (Brassicaceae) in Nederland

    NARCIS (Netherlands)

    Dirkse, Gerard M.; Zonneveld, Ben J.M.; Duistermaat, Leni H.

    2015-01-01

    Sinds een paar jaar wordt een winterbloeiende, nagenoeg kale en kleinbloemige Cardamine waargenomen die niet met regionale Flora’s gedetermineerd kan worden. Deze vorm heeft geen bladrozet, bloemen met 6 meeldraden, en bladen zonder oortjes. Uit metingen van het genoomgewicht blijkt, dat het geen

  11. Lectotypification of names of Himalayan Brassicaceae taxa currently placed in the genus Cardamine

    Directory of Open Access Journals (Sweden)

    Karol Marhold

    2015-05-01

    Full Text Available Lectotypes of twenty-eight names of taxa currently recognized or synonymized in Cardamine are designated as part of the work on the account of the genus for the Pan-Himalayan Flora. Among them, the previous first-step lectotypification of the name C. calthifolia is finalized. In cases when specimen images are available online, stable identifiers for specimens, other permanent links, or links via JSTOR Global Plants are provided.

  12. Lectotypification of names of Himalayan Brassicaceae taxa currently placed in the genus Cardamine.

    Science.gov (United States)

    Marhold, Karol; Kempa, Matúš; Al-Shehbaz, Ihsan A

    2015-01-01

    Lectotypes of twenty-eight names of taxa currently recognized or synonymized in Cardamine are designated as part of the work on the account of the genus for the Pan-Himalayan Flora. Among them, the previous first-step lectotypification of the name Cardaminecalthifolia is finalized. In cases when specimen images are available online, stable identifiers for specimens, other permanent links, or links via JSTOR Global Plants are provided.

  13. Phytoremediation of lead by a wild, non-edible Pb accumulator Coronopus didymus (L.) Brassicaceae.

    Science.gov (United States)

    Sidhu, Gagan Preet Singh; Singh, Harminder Pal; Batish, Daizy R; Kohli, Ravinder Kumar

    2017-10-11

    Coronopus didymus was examined in terms of its ability to remediate Pb-contaminated soils. Pot experiments were conducted for 4 and 6 weeks to compare the growth, biomass, photosynthetic efficiency, lead (Pb) uptake and accumulation by C. didymus plants. The plants grew well having no visible toxic symptoms and 100% survivability, exposed to different Pb-spiked soils 100, 350, 1500 and 2500 mg kg -1 , supplied as lead nitrate. After 4 weeks, root and shoot concentrations reached 1652 and 502 mg Pb kg -1 DW while after 6 weeks they increased upto 3091 and 527 mg Pb kg -1 DW respectively, at highest Pb concentration. As compared to the 4 week experiments, the plant growth and biomass yield were higher after 6 weeks of Pb exposure. However, the chlorophyll content of leaves decreased but only a slight decline in photosynthetic efficiency was observed on exposure to Pb at both 4 and 6 weeks. The Pb accumulation was higher in roots than in the shoots. The bioconcentration factor of Pb was > 1 in all the plant samples but the translocation factor was < 1. This suggested C. didymus as a good candidate for phytoremediation of Pb-contaminated soils and can be used for future remediation purposes.

  14. Resprouting after disturbance in the short-lived herb Rorippa palustris (Brassicaceae): an experiment with juveniles

    Czech Academy of Sciences Publication Activity Database

    Martínková, Jana; Kočvarová, Marie; Klimešová, Jitka

    2004-01-01

    Roč. 25, č. 3 (2004), s. 143-150 ISSN 1146-609X R&D Projects: GA AV ČR KSK6005114; GA ČR GD206/03/H034; GA ČR GA206/01/1039 Institutional research plan: CEZ:AV0Z6005908 Keywords : root-sprouting * bud bank * disturbance Subject RIV: EF - Botanics Impact factor: 1.034, year: 2004

  15. Three times out of Asia Minor: the phylogeography of Arabis alpina L. (Brassicaceae).

    Science.gov (United States)

    Koch, Marcus A; Kiefer, Christiane; Ehrich, Dorothee; Vogel, Johannes; Brochmann, Christian; Mummenhoff, Klaus

    2006-03-01

    Arabis alpina is a characteristic plant in arctic-alpine habitats and serves as a classical example to demonstrate biology, ecology and biogeography of arctic-alpine disjuncts. It has a wider distribution than most other arctic-alpine plants, covering all European mountain systems, the Canary Islands, North Africa, the high mountains of East Africa and Ethiopia, the Arabian Peninsula and mountain ranges of Central Asia in Iran and Iraq. Additionally it is found in the northern amphi-Atlantic area including northeastern North America, Greenland, Iceland, Svalbard and northwestern Europe. We used markers from the nuclear (internal transcribed spacer of ribosomal DNA) and chloroplast genome (trnL-F region) to reconstruct its phylogeographic history. Both markers revealed clear phylogeographic structure. We suggest that A. alpina originated in Asia Minor less than 2 million years ago based on synonymous mutation rates of different genes (plastidic matK, nuclear adh and chs). From the Asian ancestral stock one group migrated via the Arabian Peninsula to the East African high mountains. A second group gave rise to all European and northern populations, and also served as source for the northwest African populations. A third group, which is still centred in Asia, migrated independently southwards and came into secondary contact with the East African lineage in Ethiopia, resulting in high genetic diversity in this area. In the Mediterranean regions, the genetic diversity was relatively high with numerous unique haplotypes, but almost without geographic structure. In contrast, the populations in the northern amphi-Atlantic area were extremely depauperate, suggesting very recent (postglacial) expansion into this vast area from the south.

  16. Reproductive ecology and severe pollen limitation in the polychromic tundra plant, Parrya nudicaulis (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Justin R Fulkerson

    Full Text Available Pollen limitation is predicted to be particularly severe in tundra habitats. Numerous reproductive patterns associated with alpine and arctic species, particularly mechanisms associated with reproductive assurance, are suggested to be driven by high levels of pollen limitation. We studied the reproductive ecology of Parrya nudicaulis, a species with relatively large sexual reproductive investment and a wide range of floral pigmentation, in tundra habitats in interior montane Alaska to estimate the degree of pollen limitation. The plants are self-compatible and strongly protandrous, setting almost no seed in the absence of pollinators. Supplemental hand pollinations within pollinator exclusion cages indicated no cage effect on seed production. Floral visitation rates were low in both years of study and particularly infrequent in 2010. A diversity of insects visited P. nudicaulis, though syrphid and muscid flies composed the majority of all visits. Pollen-ovule ratios and levels of heterozygosity are consistent with a mixed mating system. Pollen limitation was severe; hand pollinations increased seed production per plant five-fold. Seed-to-ovule ratios remained low following hand pollinations, indicating resource limitation is likely to also be responsible for curtailing seed set. We suggest that pollen limitation in P. nudicaulis may be the result of selection favoring an overproduction of ovules as a bet-hedging strategy in this environmental context of highly variable pollen receipt.

  17. Models of the fate of glucosinolates in Brassicaceae from processing to digestion

    NARCIS (Netherlands)

    Kruse, I.

    2015-01-01

    Abstract Glucosinolates are secondary metabolites of Brassica vegetables. Glucosinolates are not bioactive themselves, but their hydrolysis products isothiocyanates have been associated with health benefits. The concentrations of glucosinolates and their break down products are strongly affected by

  18. Morphological, Anatomical and Palynological Studies on Endemic Matthiola anchoniifolia Hub. -Mor. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Mehmet TEKIN

    2013-05-01

    Full Text Available In this paper, anatomical, palynological and seed micromorphological properties of an endemic plant Matthiola anchoniifolia Hub.-Mor. are recorded for the first time. A description and descriptive illustrations of the species are given based on the collected specimens for morphological study. Seed surface of M. anchoniifolia is examined by scanning electron microscope. The seed of M. anchoniifolia was compressed, brownish in colour and the cells of testa were nearly 60-80 μm in diameter and ranged from isodiametric, tetragonal or pentagonal. The anticlinal walls were straight or weakly curved while the outer periclinal walls were concave to flat with smooth surface. In anatomical study, cross sections of root, stem and stem leaf are examined. The root had secondary structure. Periderm consists of 5-8 layers of cells for phellem. Cortex consists of 9-12 layered parenchymatic tissue under the periderm. Secondary phloem ring-shaped, 6-9 layered and consists of companion cells and grouped sieve tubes. Stem had primary structure when analyzed. It is circular with a few irregular ribs in cross section. Cortex is 8-12 layered and parenchymatous. Stoma cells are present on both epidermis. Leaf is isobilateral. There are unicellular and ramified hairs on both surface. Palisade parenchyma cells are 1-2 layered and spongy parenchyma cells are 5-12 layered. M. anchoniifolia has tricolpate pollen type, prolate pollen shape and reticulate exine ornamentation.

  19. Antibacterial and antifungal activity of Isatis tinctoria L. (Brassicaceae) using the micro-plate method

    International Nuclear Information System (INIS)

    Ullah, I.; Wakeel, A.; Jan, S.A.

    2017-01-01

    Isatis tinctoria L. has well-documented history as conventional therapeutic herb. In present study its crude extract was examined for broad-spectrum antimicrobial activity using micro-titer plate method. Four different plant parts were extracted with 14 different solvents. All fractions were analyzed against seven bacterial and four fungal strains. Ethyl acetate, chloroform, n-hexane and acetone showed maximum antibacterial activity with minimum IC50 value (=200 mu g/ml). Leaves>branches> roots>flower is the order of different parts based on antibacterial activity. Although, in some cases like against Klebsiella pneumonia and Micrococcus luteus the flower showed better results as compared to other parts. Roots showed better results against Staphylococcus aureus and Pseudomonas aeruginosa. Extracts showed better antimicrobial activity as compared to antibiotics (cefotaxime). The activity of the extracts against gram positive was better than gram negative. For antifungal activity, ethyl acetate > n-hexane-ethyl acetate (1:1) > chloroform> acetone was the order of the fraction with increasing growth inhibition rate. All the parts (except branches) were observed having antifungal activity. The most resistant strains found in this study were Mucor mycosis, none of the fraction have more than 30% inhibition on used concentration. Plant crude extract being having broad spectrum antimicrobial activity is suggested for pre-clinical and clinical trials. (author)

  20. Distribution of the species Matthiola fruticulosa (L.) Maire (Brassicaceae) in Croatia

    OpenAIRE

    Šegota, Vedran; Jasprica, Nenad; Bogdanović, Sandro; Pandža, Marija; Milović, Milenko; Alegro, Antun

    2016-01-01

    This paper presents the distribution of the rare plant species Matthiola fruticulosa (L.) Maire in Croatia. During our study, previous records on the Pelješac peninsula were confirmed, and new records were found, extending the Croatian areal to the southern U radu se analizira rasprostranjenost rijetke biljne vrste Matthiola fruticulosa (L.) Maire u Hrvatskoj. Tijekom našeg istraživanja potvrđena su prethodna nalazišta vrste na Pelješcu, a nova nalazišta su proširila areal vrste u Hrvatskoj s...

  1. Study of phylogenetic relationship of Turkish species ofMatthiola (Brassicaceae) based on ISSR amplification

    OpenAIRE

    DOĞAN, BEKİR; ÇELİK, MUSTAFA; ÜNAL, MURAT; SEFALI, ABDURRAHMAN; MARTİN, ESRA; KAYA, AYLA

    2016-01-01

    Matthiola W.T.Aiton is a taxonomically complex genus in which there are many problems, mostly with Matthiola longipetala and M. Odoratissima. Matthiola species native to Turkey were collected from various locations in Anatolia, and their DNA was isolated. Revision studies performed on the basis of molecular data obtained from studies conducted in recent years have made the phylogenetic relationships and systematic positions of the taxa more apparent and reliable. Consequently, the remaining t...

  2. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se ha diversificado profusamente en la región mediterránea, con más de un centenar de especies descritas en dicha área, del total de las alrededor de 200 especies incluidas en el género. Usamos dos regiones de ADN plastidial (ndhF y trnT-L y una región de ADN nuclear (ITS1-5.8S rDNA-ITS2, con una longitud total de 3.556 pb, para llevar a cabo análisis filogenéticos mediante inferencia bayesiana, máxima verosimilitud y máxima parsimonia, con el fin de explorar las relaciones evolutivas entre las especies de Erysimum que habitan en éstas cordilleras. El análisis de secuencias concatenadas de los dos genomas identifica dos clados principales y las muestras de la misma especie aparecen siempre en un clado o en el otro pero no en ambos. Las relaciones filogenéticas que indican esos dos clados no apoyan la circunscripción del grupo taxonómico E. nevadense, previamente definido en dicho género. Además, los análisis indican cambios recurrentes en el color floral de las especies de Erysimum que habitan los Sistemas Béticos aunque la evolución reticulada, que sugiere la posición de algunos taxones en uno y otro árbol, puede haber también afectado a este rasgo, lo que sería una hipótesis alternativa.

  3. Interactive impacts of a herbivore and a pathogen on two resistance types of Barbarea vulgaris (Brassicaceae)

    DEFF Research Database (Denmark)

    Heimes, Christine; Thiele, Jan; van Mölken, Tamara

    2015-01-01

    symptoms were not reduced. Most of the insect-susceptible P-plants were resistant to white rust; however, the number of flea beetle mines tended to increase in plants also exposed to Albugo, and biomass at the last harvest was slightly lower in the combined treatment. Thus, interactive impacts......It is well known that pathogens and arthropod herbivores attacking the same host plant may affect each other. Little is known, however, about their combined impact on plant fitness, which may differ from simple additive expectations. In a 2-year common garden field experiment, we tested whether...... by interactive impacts of the antagonists. Most of the insect-resistant G-plants were severely affected by white rust, which reduced biomass and reproductive potential compared to the controls. However, when also exposed to flea beetles, biomass loss was mitigated in G-plants, even though apparent disease...

  4. Ethylene Interacts with Abscisic Acid to Regulate Endosperm Rupture during Germination: A Comparative Approach Using Lepidium sativum and Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Linkies, A.; Müller, L.; Morris, K.; Turečková, Veronika; Wenk, M.; Cadman, C. S. C.; Corbineau, F.; Strnad, Miroslav; Lynn, J. R .; Finch-Savage, W. E.; Leubner-Metzger, G.

    2009-01-01

    Roč. 21, č. 12 (2009), s. 3803-3822 ISSN 1040-4651 Institutional research plan: CEZ:AV0Z50380511 Keywords : SEED DORMANCY RELEASE * GIBBERELLIN BIOSYNTHESIS * FEEDBACK-REGULATION Subject RIV: EF - Botanics Impact factor: 9.293, year: 2009

  5. Germination of Lepidium sativum as a method to evaluate polycyclic aromatic hydrocarbons (PAHs) removal from contaminated soil

    CSIR Research Space (South Africa)

    Maila, MP

    2002-01-01

    Full Text Available used as potential bioindicator ofPAH removal. 2.4. L. sativum bioindicator The seeds of L. sativum were exposed to diVTerent con- centrations (50, 150, 300, 500 and 1000ppm) ofPAHs in soil A. For each treatment, 75ml ofdeionised water was added to 375 g... and natural day?night cycles. Hundred milli- litres ofwater wasused to waterthe plants every 2 days. In instances were leachates were produced, the leachate was used to water the same pots. Each treatment had 10 pots and one pot for each treatment was sacri...

  6. Protective Effects of Lepidium meyenii (Maca) Aqueous Extract and Lycopene on Testosterone Propionate-Induced Prostatic Hyperplasia in Mice.

    Science.gov (United States)

    Zou, Ying; Aboshora, Waleed; Li, Jing; Xiao, Tiancun; Zhang, Lianfu

    2017-08-01

    The inhibitory effect of maca extractant, lycopene, and their combination was evaluated in benign prostatic hyperplasia (BPH) mice induced by testosterone propionate. Mice were divided into a saline group, solvent control group and testosterone propionate-induced BPH mice [BPH model group, solvent BPH model group, benzyl glucosinolate group (1.44 mg/kg), maca group (60 mg/kg), lycopene treated (15, 5, and 2.5 mg/kg), maca (30 mg/kg) combine lycopene treated (7.5, 2.5, and 1.25 mg/kg), and finasteride treated]. Benzyl glucosinolate was used in order to evaluate its pharmacological activity on BPH to find out whether it is the major active component of maca aqueous extract. Finasteride was used as positive control. The compounds were administered once for 30 successive days. Compared with solvent BPH model group, BPH mice fed with maca (30 mg/kg) and lycopene (7.5 mg/kg) combination exhibited significant reductions in the prostatic index, prostatic acid phospatase, estradiol, testosterone, and dihydrotestosterone levels in serum. They also had similar histological compared with those aspects observed in the mice in the solvent control group. The results indicated that combination of maca and lycopene synergistically inhibits BPH in mice. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  7. Dose-response effect of black maca (Lepidium meyenii) in mice with memory impairment induced by ethanol.

    Science.gov (United States)

    Rubio, Julio; Yucra, Sandra; Gasco, Manuel; Gonzales, Gustavo F

    2011-10-01

    Previous studies have shown that black variety of maca has beneficial effects on learning and memory in experimental animal models. The present study aimed to determine whether the hydroalcoholic extract of black maca (BM) showed a dose-response effect in mice treated with ethanol 20% (EtOH) as a model of memory impairment. Mice were divided in the following groups: control, EtOH, ascorbic acid (AA) and 0.125, 0.25, 0.50 and 1.00 g/kg of BM plus EtOH. All treatments were orally administered for 28 days. Open field test was performed to determine locomotor activity and water Morris maze was done to determine spatial memory. Also, total polyphenol content in the hydroalcoholic extract of BM was determined (0.65 g pyrogallol/100 g). Mice treated with EtOH took more time to find the hidden platform than control during escape acquisition trials; meanwhile, AA and BM reversed the effect of EtOH. In addition, AA and BM ameliorated the deleterious effect of EtOH during the probe trial. Correlation analyses showed that the effect of BM a dose-dependent behavior. Finally, BM improved experimental memory impairment induced by ethanol in a dose-response manner due, in part, to its content of polyphenolic compounds.

  8. Maca (Lepidium meyenii) and yacon (Smallanthus sonchifolius) in combination with silymarin as food supplements: in vivo safety assessment.

    Science.gov (United States)

    Valentová, Katerina; Stejskal, David; Bartek, Josef; Dvorácková, Svatava; Kren, Vladimír; Ulrichová, Jitka; Simánek, Vilím

    2008-03-01

    Yacon and maca are native Andean crops with growing popularity as food supplements often in combination with other components, e.g. silymarin. There are however no published data on their toxicity and safety in humans. The aim of our randomized placebo-controlled 90-day study was to evaluate the effects of yacon and maca in combination with silymarin on plasma and lipoprotein lipids, serum glucose and safety parameters in patients suffering from the metabolic syndrome. No adverse effects were found in volunteers using silymarin (0.8 g/day), silymarin+yacon (0.8+2.4 g/day) and silymarin+maca (0.6+0.2 g/day). A moderate AST level and diastolic blood pressure increase was found in volunteers using maca (0.6 g/day). In conclusion, the combination silymarin+yacon appears to be promising as a nutraceutical in the prevention of diseases with a proatherogenic lipoprotein profile and liver steatosis. The effect of maca on AST level and blood pressure must be considered when using high doses of maca powder. This effect could be reversed by supplementation with silymarin.

  9. Uptake of barium and strontium by cress (Lepidium sativum) in water culture and the presence of an inhibiting soluble factor

    International Nuclear Information System (INIS)

    Oestling, O.; Kopp, P.; Burkart, W.

    1991-01-01

    Seeds of cress were sown in various densities on plastic grids placed in half-litre dishes filled with either a dilute salt solution or distilled water. After 2 days the radionuclides 133 Ba, 134 Cs and 85 Sr were added, and after another 5 days the plants were harvested and the radioactivity measured by γ-ray spectrometry. Plants in alternated sparse cultures concentrated less radioactivity of Ba and Sr than the corresponding non-alternated cultures. Furthermore, when water from very dense cultures on which plants had grown for a week was sterile-filtered and added to fresh cultures, it was shown that this conditioned water strongly inhibited the uptake of Ba and Sr. The difference in radionuclide concentration in the plants as a function of plant density disappeared when the concentrations of Ca and Mg in the nutrient solution were raised to 0.15 and 0.40 mM, respectively. Apparently a chelating substance, possibly excreted from the plant roots, is responsible for the inhibition of the uptake of bivalent cations, and this agent becomes saturated when bivalent cations are present at sufficiently high concentrations. (author)

  10. Bio-availability and metabolism of n-3 fatty acid rich garden cress (Lepidium sativum) seed oil in albino rats.

    Science.gov (United States)

    Diwakar, B T; Dutta, P K; Lokesh, B R; Naidu, K A

    2008-02-01

    The ratio of fatty acids namely linoleic acid (LA, 18:2, n-6) and alpha linolenic acid (ALA, 18:3, n-3) in the diet plays an important role in enrichment of ALA in tissues and further conversion to long-chain polyunsaturated fatty acids (LC-PUFA) like eicosapentaenoic acid (EPA, 20:5, n-3) and docosahexaenoic acid (DHA, 22:6, n-3). Garden cress seed oil (GCO) is one of the richest sources of omega-3 fatty acid and contains 29-34.5% of ALA. In this study, dietary supplementation of GCO on bio-availability and metabolism of alpha-linolenic acid was investigated in growing rats. Male wistar rats were fed with semi-purified diets supplemented with 10.0% sunflower oil (SFO 10%); 2.5% GCO and 7.5% SFO (GCO 2.5%); 5% GCO and 5% SFO (GCO 5.0%); 10% GCO (GCO 10%) for a period of 8 weeks. There was no significant difference with regard to the food intake, body weight gain and organ weights of rats in different dietary groups. Rats fed with GCO showed significant increase in ALA levels in serum and tissues compared to SFO fed rats. Feeding rats with 10% GCO lowered hepatic cholesterol by 12.3% and serum triglycerides by 40.4% compared to SFO fed group. Very low density lipoprotein cholesterol (VLDL-C) and low density lipoprotein cholesterol (LDL-C) levels decreased by 9.45% in serum of 10% GCO fed rats, while HDL remained unchanged among GCO fed rats. Adipose tissue showed incorporation of 3.3-17.4% of ALA and correlated with incremental intake of ALA. Except in adipose tissue, the EPA, DHA levels increased significantly in serum, liver, heart and brain tissues in GCO fed rats. A maximum level of DHA was registered in brain (11.6%) and to lesser extent in serum and liver tissues. A significant decrease in LA and its metabolite arachidonic acid (AA) was observed in serum and liver tissue of rats fed on GCO. Significant improvement in n-6/n-3 fatty acid ratio was observed in GCO based diets compared to diet containing SFO. This is the first study to demonstrate that supplementation of GCO increases serum and liver ALA, EPA, DHA and decreases LA and AA in rats. Therefore, the GCO can be considered as a potential, alternate dietary source of ALA.

  11. Hydroxyl and methoxyl derivatives of benzylglucosinolate in Lepidium densiflorum with hydrolysis to isothiocyanates and non-isothiocyanate products

    DEFF Research Database (Denmark)

    Pagnotta, Eleonora; Agerbirk, Niels; Olsen, Carl Erik

    2017-01-01

    -level glucosinolates were 3,4-dimethoxybenzylglucosinolate and 3,4,5-trimethoxybenzylglucosinolate. Minor glucosinolates included benzylglucosinolate, 3-hydroxy- and 3-methoxybenzylglucosinolate, 4-hydroxybenzylglucosinolate (sinalbin), the novel 4-hydroxy-3-methoxybenzylglucosinolate (3-methoxysinalbin), and indole...

  12. Efecto de la maca roja (Lepidium meyenii sobre los niveles de IFN-γ en ratas ovariectomizadas

    Directory of Open Access Journals (Sweden)

    Johanna Leiva-Revilla

    Full Text Available Objetivos. Comparar el efecto de diferentes dosis de maca roja sobre los niveles de interferón gamma (IFN-γ en ratas ovariectomizadas (OVX. Materiales y métodos. Ratas hembras adultas fueron divididas al azar en los siguientes seis grupos: Grupo 1: ratas pesudo-ovariectomizadas (PO; Grupo 2: ratas OVX; Grupo 3: ratas OVX tratadas con 4 ug/kg de estradiol, y Grupo 4, 5 y 6: ratas OVX tratadas con extractos de maca con 2,15, 4,3 y 8,6 mg polifenoles/kilogramo de peso corporal, respectivamente. Resultados. Las ratas OVX mostraron niveles bajos de IFN-γ en comparación con las ratas PO. El estradiol y la maca roja revirtieron el efecto de la ovariectomía sobre los niveles de IFN-γ. La maca roja presenta un incremento dosis-respuesta de los niveles de IFN-γ (r=0,57, p<0,05. Conclusiones. La administración de la maca roja incrementa los niveles de IFN-γ en ratas ovariectomizadas.

  13. Maca (Lepidium meyenii) and yacon (Smallanthus sonchifolius) in combination with silymarin as food supplements: In vivo safety assessment

    Czech Academy of Sciences Publication Activity Database

    Valentová, K.; Stejskal, D.; Bartek, J.; Dvořáčková, S.; Křen, Vladimír; Ulrichová, J.; Šimánek, V.

    2008-01-01

    Roč. 46, č. 3 (2008), s. 1003-1013 ISSN 0278-6915 Institutional research plan: CEZ:AV0Z50200510 Keywords : food supplement * volunteers * blood pressure Subject RIV: EE - Microbiology, Virology Impact factor: 2.321, year: 2008

  14. Screening of medicinal plants for induction of somatic segregation activity in Aspergillus nidulans.

    Science.gov (United States)

    Ramos Ruiz, A; De la Torre, R A; Alonso, N; Villaescusa, A; Betancourt, J; Vizoso, A

    1996-07-05

    Knowledge about mutagenic properties of plants commonly used in traditional medicine is limited. A screening for genotoxic activity was carried out in aqueous or alcoholic extracts prepared from 13 medicinal plants widely used as folk medicine in Cuba: Lepidium virginicum L. (Brassicaceae): Plantago major L. and Plantago lanceolata L. (Plantaginaceae); Ortosiphon aristatus Blume, Mentha x piperita L., Melissa officinalis L. and Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Cymbopogon citratus (DC.) Stapf (Poaceae); Passiflora incarnata L. (Passifloraceae); Zingiber officinale Roscoe (Zingiberaceae); Piper auritum HBK. (Piperaceae); Schinus terebinthifolius Raddi (Anacardeaceae) and Momordica charantia L. (Cucurbitaceae). A plate incorporation assay with Aspergillus nidulans was employed, allowing detection of somatic segregation as a result of mitotic crossing-over, chromosome malsegregation or clastogenic effects. Aspergillus nidulans D-30, a well-marked strain carrying four recessive mutations for conidial color in heterozygosity, which permitted the direct visual detection of segregants, was used throughout this study. As a result, only in the aqueous extract of one of the plants screened (Momordica charantia) a statistical significant increase in the frequency of segregant sectors per colony was observed, and consequently, a genotoxic effect is postulated.

  15. Manipulating the antioxidant capacity of halophytes to increase their cultural and economic value through saline cultivation.

    Science.gov (United States)

    Boestfleisch, Christian; Wagenseil, Niko B; Buhmann, Anne K; Seal, Charlotte E; Wade, Ellie Merrett; Muscolo, Adele; Papenbrock, Jutta

    2014-08-13

    Halophytes, salt-tolerant plants, are a source of valuable secondary metabolites with potential economic value. The steady-state pools of many stress-related metabolites are already enhanced in halophytes when compared with glycophytes, but growth under conditions away from the optimum can induce stress and consequently result in changes to secondary metabolites such as antioxidants. However, direct evidence for increasing the concentration of valuable secondary metabolites as a consequence of altering the salinity of the growing environment still remains equivocal. To address this, we analysed a range of metabolites with antioxidant capacity (including total phenols, flavonoids, ascorbate, reduced/oxidized glutathione and reactive oxygen species scavenging enzymes) in seedlings and plants from different families (Amaranthaceae, Brassicaceae, Plantaginaceae and Rhizophoraceae) and habitats grown under different salt concentrations. We show that it is possible to manipulate the antioxidant capacity of plants and seedlings by altering the saline growing environment, the length of time under saline cultivation and the developmental stage. Among the species studied, the halophytes Tripolium pannonicum, Plantago coronopus, Lepidium latifolium and Salicornia europaea demonstrated the most potential as functional foods or nutraceuticals. Published by Oxford University Press on behalf of the Annals of Botany Company.

  16. Adaptógenos: plantas medicinales tradicionales comercializadas como suplementos dietéticos en la conurbación Buenos Aires-La Plata (Argentina

    Directory of Open Access Journals (Sweden)

    Patricia M. Arenas

    2011-07-01

    Full Text Available En el presente trabajo se presentan los resultados de un estudio sobre tres especies de las cuales se comercializan productos considerados adaptógenos: Lepidium meyenii Walp. (Brassicaceae, "maca", Morinda citrifolia L. (Rubiaceae, "noni", y Petiveria alliacea L. (Phytolaccaceae, "pipi". Los datos provienen de estudios en Etnobotánica urbana realizados en la conurbación Buenos Aires-La Plata, se presentan los usos tradicionales de las especies, sus vías de ingreso, comercialización y difusión como suplementos dietéticos en el contexto pluricultural urbano, los modos actuales de empleo y los saberes relacionados, que forman parte del conocimiento botánico local. De este modo, se evalúan las modificaciones en los usos originalmente asignados, como consecuencia de la expansión de los productos en el marco de la globalización, y los cambios consecuentes en los patrones tradicionales de saberes, creencias y prácticas referidos a estos recursos vegetales

  17. Promotion of testa rupture during garden cress germination involves seed compartment-specific expression and activity of pectin methylesterases.

    Science.gov (United States)

    Scheler, Claudia; Weitbrecht, Karin; Pearce, Simon P; Hampstead, Anthony; Büttner-Mainik, Annette; Lee, Kieran J D; Voegele, Antje; Oracz, Krystyna; Dekkers, Bas J W; Wang, Xiaofeng; Wood, Andrew T A; Bentsink, Leónie; King, John R; Knox, J Paul; Holdsworth, Michael J; Müller, Kerstin; Leubner-Metzger, Gerhard

    2015-01-01

    Pectin methylesterase (PME) controls the methylesterification status of pectins and thereby determines the biophysical properties of plant cell walls, which are important for tissue growth and weakening processes. We demonstrate here that tissue-specific and spatiotemporal alterations in cell wall pectin methylesterification occur during the germination of garden cress (Lepidium sativum). These cell wall changes are associated with characteristic expression patterns of PME genes and resultant enzyme activities in the key seed compartments CAP (micropylar endosperm) and RAD (radicle plus lower hypocotyl). Transcriptome and quantitative real-time reverse transcription-polymerase chain reaction analysis as well as PME enzyme activity measurements of separated seed compartments, including CAP and RAD, revealed distinct phases during germination. These were associated with hormonal and compartment-specific regulation of PME group 1, PME group 2, and PME inhibitor transcript expression and total PME activity. The regulatory patterns indicated a role for PME activity in testa rupture (TR). Consistent with a role for cell wall pectin methylesterification in TR, treatment of seeds with PME resulted in enhanced testa permeability and promoted TR. Mathematical modeling of transcript expression changes in germinating garden cress and Arabidopsis (Arabidopsis thaliana) seeds suggested that group 2 PMEs make a major contribution to the overall PME activity rather than acting as PME inhibitors. It is concluded that regulated changes in the degree of pectin methylesterification through CAP- and RAD-specific PME and PME inhibitor expression play a crucial role during Brassicaceae seed germination. © 2015 American Society of Plant Biologists. All Rights Reserved.

  18. Promotion of Testa Rupture during Garden Cress Germination Involves Seed Compartment-Specific Expression and Activity of Pectin Methylesterases1[OPEN

    Science.gov (United States)

    Scheler, Claudia; Weitbrecht, Karin; Pearce, Simon P.; Hampstead, Anthony; Büttner-Mainik, Annette; Lee, Kieran J.D.; Voegele, Antje; Oracz, Krystyna; Dekkers, Bas J.W.; Wang, Xiaofeng; Wood, Andrew T.A.; Bentsink, Leónie; King, John R.; Knox, J. Paul; Holdsworth, Michael J.; Müller, Kerstin; Leubner-Metzger, Gerhard

    2015-01-01

    Pectin methylesterase (PME) controls the methylesterification status of pectins and thereby determines the biophysical properties of plant cell walls, which are important for tissue growth and weakening processes. We demonstrate here that tissue-specific and spatiotemporal alterations in cell wall pectin methylesterification occur during the germination of garden cress (Lepidium sativum). These cell wall changes are associated with characteristic expression patterns of PME genes and resultant enzyme activities in the key seed compartments CAP (micropylar endosperm) and RAD (radicle plus lower hypocotyl). Transcriptome and quantitative real-time reverse transcription-polymerase chain reaction analysis as well as PME enzyme activity measurements of separated seed compartments, including CAP and RAD, revealed distinct phases during germination. These were associated with hormonal and compartment-specific regulation of PME group 1, PME group 2, and PME inhibitor transcript expression and total PME activity. The regulatory patterns indicated a role for PME activity in testa rupture (TR). Consistent with a role for cell wall pectin methylesterification in TR, treatment of seeds with PME resulted in enhanced testa permeability and promoted TR. Mathematical modeling of transcript expression changes in germinating garden cress and Arabidopsis (Arabidopsis thaliana) seeds suggested that group 2 PMEs make a major contribution to the overall PME activity rather than acting as PME inhibitors. It is concluded that regulated changes in the degree of pectin methylesterification through CAP- and RAD-specific PME and PME inhibitor expression play a crucial role during Brassicaceae seed germination. PMID:25429110

  19. Efeitos da radiação ultravioleta-B sobre a morfologia foliar de Arabidopsis thaliana (L. Heynh. (Brassicaceae Effects of ultraviolet-B radiation on leaf morphology of Arabidopsis thaliana (L. Heynh. (Brassicaceae

    Directory of Open Access Journals (Sweden)

    Maria Regina Torres Boeger

    2006-06-01

    Full Text Available A redução da camada de ozônio resulta no aumento da radiação ultravioleta que atinge a superfície terrestre, especialmente a radiação ultravioletaB (UV-B. O aumento da radiação poderá induzir a mudanças estruturais e fisiológicas nas plantas, influenciando no seu crescimento e desenvolvimento. O objetivo deste trabalho foi determinar os efeitos da radiação UV-B ambiente sobre a morfologia das folhas de Arabidopsis thaliana desenvolvidas em condições controladas. As sementes de A. thaliana cresceram em câmaras de crescimento, com 300 µmol m-2s-1 de radiação fotossinteticamente ativa (PAR com ou sem 6 kJ m-2 s-1 de radiação UV-Bbe (UV-Bbe; UV-B biologicamente efetiva. Após 21 dias, 10 folhas de cada tratamento (com e sem radiação UV-B foram coletadas para avaliar área foliar, massa fresca e seca, AEF, densidades estomáticas e de tricomas de ambas as faces da folha, espessura da lâmina foliar e concentração de compostos fenólicos e de clorofila total, a e b. As folhas tratadas com radiação UV-B apresentaram menor área foliar, massa fresca e seca, densidade de tricomas na face adaxial e densidade de estômatos na face abaxial da folha. Entretanto, apresentaram os maiores valores médios de espessura total da lâmina e do mesofilo, maior concentração de clorofila total, clorofila a e clorofila b e compostos fenólicos foliares do que as folhas não tratadas com radiação UV-B. Essas diferenças morfológicas significativas (p Reduction of the ozone layer results in the increase in ultraviolet radiation reaching the earth's surface, especially the ultraviolet-B (UV-B. The increase of radiation may induce structural and physiological changes in plants, influencing their growth and development. This paper evaluates the effects of ambient UV-B radiation upon to the leaf morphology of Arabidopsis thaliana developed under controlled conditions. The seeds of A. thaliana grown in environmental chamber, with 300 µmol m-2s-1 de photosynthetically active radiation (PAR with and without 6 kJ m-2 s-1 of radiation UV-Bbe (UV-Bbe; UV-B biologically effective. After 21 days, ten leaves of each treatment (with and without UV-B radiation were collected to measure leaf area, fresh and dry mass, AEF, stomata and trichome densities of both leaf surfaces, leaf thickness and concentration of phenolic compounds and total chlorophyll, and chlorophyll a and b. Leaves treated with UV-B radiation presented smaller leaf area, fresh and dry weight, hair density, and stomata density on the adaxial epidermis. However, leaves treated with UV-B presented higher mean values for total thickness, mesophyll thickness, higher concentration of total chlorophyll, chlorophyll a and b, and phenolic compounds when compared to leaves without UV-B radiation. These significant morphological differences (p < 0.05 between leaves treated with and without UV-B radiation indicate that A. thaliana is not insensible to UV-B radiation and possess mechanisms that minimize the negative effects on leaf development and growth. Although, the plant responses to UV-B radiation involves several physiological mechanisms, that need more detailed investigation.

  20. Termoestabilidade de processos extrativos de Nasturtium officinale R. Br., brassicaceae por sistema Soxhlet modificado Term-stability of extractive processes from Nasturtium officinale R. Br., brassicaceae for soxhlet modified system

    OpenAIRE

    João Luiz de Souza Carvalho; Miriam Machado Cunico; Josiane de Fátima Gaspari Dias; Marilis Dallarmi Miguel; Obdulio Gomes Miguel

    2009-01-01

    This work had as objective verified the term-stability of the Soxhlet modified system with analytical and pharmacothecnical application in extractive processes of Nasturtium officinale. It has proven that the process is thermo-stable. The analysis with analytical have determined 3.606 mg g-1 in chlorogenic acid and 11.813 mg g-1 in rutin (extract 1:20 w/v) and with pharmacotecnical 3.427 mg g-1 in chlorogenic acid and 11.278 mg g-1 in rutin (extract 1:6 w/v). The income of the pharmacothecnic...

  1. Colonization history and introduction dynamics of capsella bursa-pastoris (Brassicaceae) in north america: isozymes and quantitative traits

    Science.gov (United States)

    Neuffer; Hurka

    1999-10-01

    Multilocus isozyme genotypic composition for aspartate aminotransferase (AAT), leucine aminopeptidase (LAP) and glutamate dehydrogenase (GDH) was studied for Capsella in the source continent, Europe (9000 plants from 593 populations), and in the colonized continent, North America (2700 plants from 88 populations). North America was depauperate in the number of genotypes (by approximately 50%), but in terms of frequencies, a few genotypes were common and shared by both continents. Although some, very rare, genotypes were, however, unique for North America, our data provided no evidence to indicate that the introduced gene pools were reconstructed on a multilocus genetic basis after introduction. Instead, they argued for a considerable number of independent introduction events. Geographical distribution patterns of multilocus genotypes in Europe and North America were pronounced and enabled us to trace the colonization history of Californian Capsella back to Spanish ancestral populations and those of temperate North America back to temperate European gene pools. A random-block field experiment with 14 Californian populations from different climatic regions revealed that variation patterns of quantitative traits reflect ecotypic variation, and the ecological amplitude of Capsella in North America is similar to that in Europe, which can be traced back to the introduction of preadapted genotypes. It appears that certain multilocus isozyme genotypes are associated with certain ecotypes. The variable European gene pool of Capsella was essentially introduced into North America without major genetic changes.

  2. Effect of enhanced UV-B radiation on pollen quantity, quality, and seed yield in Brassica rapa (Brassicaceae)

    Energy Technology Data Exchange (ETDEWEB)

    Demchik, S.M.; Day, T.A. [West Virginia Univ., Morgantown, WV (United States)

    1996-05-01

    Three experiments examined the influence of ultraviolet-B radiation (UV-B; 280-320 nm) exposure on reproduction in Brassica rapa (Brassicacaeae). Plants were grown in a greenhouse under three biologically effective UV-B levels that stimulated either an ambient stratospheric ozone level (control), 16% ({open_quotes}low enhanced{close_quotes}), or 32% ({open_quotes}high enhanced{close_quotes}) ozone depletion levels at Morgantown, WV, USA in mid-March. In the first experiment,pollen production and viability per flower were reduced by {approx}50% under both enhanced UV-B levels relative to ambient controls. While plants under high-enhanced UV-B produced over 40% more flowers than plants under the two lower UV-B treatments, whole-plant production of viable pollen was reduced under low-enhanced UV-B to 34% of ambient controls. In the second experiment, the influence of source-plant UV-B exposure on in vitro pollen from plants was examined and whether source-plant UV-B exposure influenced in vitro pollen germination and viability. Pollen from plants under both enhanced-UV-B was reduced from 65 to 18%. Viability of the pollen from plants grown under both enhanced UV-B treatments was reduced to a much lesser extent: only from {approx}43 to 22%. Thus, ambient source-plant pollen was more sensitive to enhanced UV-B levels to fertilize plants growing under ambient-UV-B levels, and assessed subsequent seed production and germination. Seed abortion rates were higher in plants pollinated with pollen from the enhanced UV-B treatments, than from ambient UV-B. Despite this, seed yield (number and mass) per plant was similar, regardless of the UV-B exposure of their pollen source. Our findings demonstrate that enhanced UV-B levels associated with springtime ozone depletion events have the capacity to substantially reduce viable pollen production, and could ultimately reduce reproductive success of B. rapa. 37 refs., 4 figs., 2 tabs.

  3. 3D Plant cell architecture of Arabidopsis thaliana (Brassicaceae) using focused ion beam-scanning electron microscopy.

    Science.gov (United States)

    Bhawana; Miller, Joyce L; Cahoon, A Bruce

    2014-06-01

    Focused ion beam-scanning electron microscopy (FIB-SEM) combines the ability to sequentially mill the sample surface and obtain SEM images that can be used to create 3D renderings with micron-level resolution. We have applied FIB-SEM to study Arabidopsis cell architecture. The goal was to determine the efficacy of this technique in plant tissue and cellular studies and to demonstrate its usefulness in studying cell and organelle architecture and distribution. • Seed aleurone, leaf mesophyll, stem cortex, root cortex, and petal lamina from Arabidopsis were fixed and embedded for electron microscopy using protocols developed for animal tissues and modified for use with plant cells. Each sample was sectioned using the FIB and imaged with SEM. These serial images were assembled to produce 3D renderings of each cell type. • Organelles such as nuclei and chloroplasts were easily identifiable, and other structures such as endoplasmic reticula, lipid bodies, and starch grains were distinguishable in each tissue. • The application of FIB-SEM produced 3D renderings of five plant cell types and offered unique views of their shapes and internal content. These results demonstrate the usefulness of FIB-SEM for organelle distribution and cell architecture studies.

  4. Effect of enhanced UV-B radiation on pollen quantity, quality, and seed yield in Brassica rapa (Brassicaceae)

    International Nuclear Information System (INIS)

    Demchik, S.M.; Day, T.A.

    1996-01-01

    Three experiments examined the influence of ultraviolet-B radiation (UV-B; 280-320 nm) exposure on reproduction in Brassica rapa (Brassicacaeae). Plants were grown in a greenhouse under three biologically effective UV-B levels that stimulated either an ambient stratospheric ozone level (control), 16% (open-quotes low enhancedclose quotes), or 32% (open-quotes high enhancedclose quotes) ozone depletion levels at Morgantown, WV, USA in mid-March. In the first experiment,pollen production and viability per flower were reduced by ∼50% under both enhanced UV-B levels relative to ambient controls. While plants under high-enhanced UV-B produced over 40% more flowers than plants under the two lower UV-B treatments, whole-plant production of viable pollen was reduced under low-enhanced UV-B to 34% of ambient controls. In the second experiment, the influence of source-plant UV-B exposure on in vitro pollen from plants was examined and whether source-plant UV-B exposure influenced in vitro pollen germination and viability. Pollen from plants under both enhanced-UV-B was reduced from 65 to 18%. Viability of the pollen from plants grown under both enhanced UV-B treatments was reduced to a much lesser extent: only from ∼43 to 22%. Thus, ambient source-plant pollen was more sensitive to enhanced UV-B levels to fertilize plants growing under ambient-UV-B levels, and assessed subsequent seed production and germination. Seed abortion rates were higher in plants pollinated with pollen from the enhanced UV-B treatments, than from ambient UV-B. Despite this, seed yield (number and mass) per plant was similar, regardless of the UV-B exposure of their pollen source. Our findings demonstrate that enhanced UV-B levels associated with springtime ozone depletion events have the capacity to substantially reduce viable pollen production, and could ultimately reduce reproductive success of B. rapa. 37 refs., 4 figs., 2 tabs

  5. Antioxidant and pro-oxidant properties of acylated pelargonidin derivatives extracted from red radish (Raphanus sativus var. niger, Brassicaceae).

    Science.gov (United States)

    Wang, Lin-Song; Sun, Xiang-Dong; Cao, Ying; Wang, Li; Li, Fang-Jun; Wang, Yi-Fan

    2010-10-01

    The antioxidant and pro-oxidant potential of an extract from red radish, in which the major compounds were acylated pelargonidin derivatives, were assessed with a variety of assays in vitro. The extract appeared to form a complex with Fe(3+) or Cu(2+). It displayed a concentration-dependant reducing power (1.16OD(700 nm) at a concentration of 4mM) and scavenging effect against 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) radicals (with IC(50)=1.74 +/- 0.03 mM). It could promote the cleavage of plasmid DNA with Cu(II)/H(2)O(2) or Cu(II) alone. This DNA damage could be inhibited by horseradish peroxidase, catalase, and EDTA, respectively. The extract also showed growth inhibition of Bel-7402 cells at lower concentration. The results suggested that the formation of reactive oxygen species might be involved in the mechanism of DNA damage. The acylated pelargonidin derivatives extracted from red radish could act as antioxidant and pro-oxidant and their antioxidant and pro-oxidant properties were relative to the reaction conditions. It might provide novel antioxidant and anticarcinogenic agents. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  6. Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae

    Czech Academy of Sciences Publication Activity Database

    Daniel, B.; Wallner, S.; Steiner, B.; Oberdorfer, G.; Kumar, P.; van der Graaff, E.; Roitsch, Thomas; Sensen, Ch. W.; Gruber, K.

    2016-01-01

    Roč. 11, č. 6 (2016), e0156892 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 Keywords : Covalently attached fad * flavoproteins * arabidopsis * metabolism * identification * oxidation * mutagenesis * alkaloids * software * proteins Subject RIV: CE - Biochemistry Impact factor: 2.806, year: 2016

  7. Phylogeography of Thlaspi arvense (Brassicaceae in China Inferred from Chloroplast and Nuclear DNA Sequences and Ecological Niche Modeling

    Directory of Open Access Journals (Sweden)

    Miao An

    2015-06-01

    Full Text Available Thlaspi arvense is a well-known annual farmland weed with worldwide distribution, which can be found from sea level to above 4000 m high on the Qinghai-Tibetan Plateau (QTP. In this paper, a phylogeographic history of T. arvense including 19 populations from China was inferred by using three chloroplast (cp DNA segments (trnL-trnF, rpl32-trnL and rps16 and one nuclear (n DNA segment (Fe-regulated transporter-like protein, ZIP. A total of 11 chloroplast haplotypes and six nuclear alleles were identified, and haplotypes unique to the QTP were recognized (C4, C5, C7 and N4. On the basis of molecular dating, haplotypes C4, C5 and C7 have separated from others around 1.58 Ma for cpDNA, which corresponds to the QTP uplift. In addition, this article suggests that the T. arvense populations in China are a mixture of diverged subpopulations as inferred by hT/vT test (hT ≤ vT, cpDNA and positive Tajima’s D values (1.87, 0.05 < p < 0.10 for cpDNA and 3.37, p < 0.01 for nDNA. Multimodality mismatch distribution curves and a relatively large shared area of suitable environmental conditions between the Last Glacial Maximum (LGM as well as the present time recognized by MaxEnt software reject the sudden expansion population model.

  8. 3D Plant Cell Architecture of Arabidopsis thaliana (Brassicaceae Using Focused Ion Beam–Scanning Electron Microscopy

    Directory of Open Access Journals (Sweden)

    Bhawana

    2014-06-01

    Full Text Available Premise of the study: Focused ion beam–scanning electron microscopy (FIB-SEM combines the ability to sequentially mill the sample surface and obtain SEM images that can be used to create 3D renderings with micron-level resolution. We have applied FIB-SEM to study Arabidopsis cell architecture. The goal was to determine the efficacy of this technique in plant tissue and cellular studies and to demonstrate its usefulness in studying cell and organelle architecture and distribution. Methods: Seed aleurone, leaf mesophyll, stem cortex, root cortex, and petal lamina from Arabidopsis were fixed and embedded for electron microscopy using protocols developed for animal tissues and modified for use with plant cells. Each sample was sectioned using the FIB and imaged with SEM. These serial images were assembled to produce 3D renderings of each cell type. Results: Organelles such as nuclei and chloroplasts were easily identifiable, and other structures such as endoplasmic reticula, lipid bodies, and starch grains were distinguishable in each tissue. Discussion: The application of FIB-SEM produced 3D renderings of five plant cell types and offered unique views of their shapes and internal content. These results demonstrate the usefulness of FIB-SEM for organelle distribution and cell architecture studies.

  9. Plant growth and phosphorus accumulation of wild type and two root hair mutants of Arabidopsis thaliana (Brassicaceae).

    Science.gov (United States)

    Bates, T R; Lynch, J P

    2000-07-01

    Arabidopsis thaliana root hairs grow longer and denser in response to low-phosphorus availability. We tested the hypothesis that wild-type Arabidopsis would acquire more phosphorus under phosphorus-limiting conditions than mutants that do not have the root hair response. The growth and phosphorus acquisition of wild-type Arabidopsis (WS) were compared to two root hair mutants (rhd6 and rhd2) under eight phosphorus treatments ranging from 0.4 mmol/m to 54 mmol/m phosphorus. At the lowest phosphorus treatment, all plants were small and showed severe phosphorus stress symptoms. At 1.5 mmol/m phosphorus, WS plants had greater shoot biomass, absolute growth rate, total phosphorus, and specific phosphorus absorption than the two root hair mutants. At the highest phosphorus treatment, there was no difference between genotypes in any of the parameters measured. We conclude that the response of increased root hair growth under low phosphorus availability in Arabidopsis is important in increasing phosphorus acquisition under phosphorus-limiting conditions.

  10. Phylogeny and colonization history of Pringlea antiscorbutica (Brassicaceae), an emblematic endemic from the South Indian Ocean Province

    Czech Academy of Sciences Publication Activity Database

    Bartish, Igor V.; Ainouche, A.; Jia, Dongrui; Bergstrom, D.; Chown, S.L.; Winkworth, R.C.; Hennion, F.

    2012-01-01

    Roč. 65, č. 2 (2012), s. 748-756 ISSN 1055-7903 Institutional support: RVO:67985939 Keywords : biogeography * long-distance dispersal * molecular dating Subject RIV: EF - Botanics Impact factor: 4.066, year: 2012

  11. Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae

    DEFF Research Database (Denmark)

    Daniel, Bastian; Wallner, Silvia; Steiner, Barbara

    2016-01-01

    be exploited for catalysis. The structure also indicates a shift of the position of the isoalloxazine ring in comparison to other members of the BBE-like family. The dioxygen surrogate chloride was found near the C(4a) position of the isoalloxazine ring in the oxygen pocket, pointing to a rapid reoxidation......Berberine bridge enzyme-like (BBE-like) proteins form a multigene family (pfam 08031), which is present in plants, fungi and bacteria. They adopt the vanillyl alcohol-oxidase fold and predominantly show bi-covalent tethering of the FAD cofactor to a cysteine and histidine residue, respectively......, suggesting that it plays a specific role in the metabolism of this plant family....

  12. Fruit and seed heteromorphism in the cold desert annual ephemeral Diptychocarpus strictus (Brassicaceae) and possible adaptive significance

    Science.gov (United States)

    Lu, Juanjuan; Tan, Dunyan; Baskin, Jerry M.; Baskin, Carol C.

    2010-01-01

    Background and Aims Diptychocarpus strictus is an annual ephemeral in the cold desert of northwest China that produces heteromorphic fruits and seeds. The primary aims of this study were to characterize the morphology and anatomy of fruits and seeds of this species and compare the role of fruit and seed hetermorphism in dispersal and germination. Methods Shape, size, mass and dispersal of siliques and seeds and the thickness of the mucilage layer on seeds were measured, and the anatomy of siliques and seeds, the role of seed mucilage in water absorption/dehydration, germination and adherence of seeds to soil particles, the role of pericarp of lower siliques in seed dormancy and seed after-ripening and germination phenology were studied using standard procedures. Key Results Plants produce dehiscent upper siliques with a thin pericarp containing seeds with large wings and a thick mucilage layer and indehiscent lower siliques with a thick pericarp containing nearly wingless seeds with a thin mucilage layer. The dispersal ability of seeds from the upper siliques was much greater than that of intact lower siliques. Mucilage increased the amount of water absorbed by seeds and decreased the rate of dehydration. Seeds with a thick mucilage layer adhered to soil particles much better than those with a thin mucilage layer or those from which mucilage had been removed. Fresh seeds were physiologically dormant and after-ripened during summer. Non-dormant seeds germinated to high percentages in light and in darkness. Germination of seeds from upper siliques is delayed until spring primarily by drought in summer and autumn, whereas the thick, indehiscent pericarp prevents germination for >1 year of seeds retained in lower siliques. Conclusions The life cycle of D. strictus is morphologically and physiologically adapted to the cold desert environment in time and space via a combination of characters associated with fruit and seed heteromorphism. PMID:20348559

  13. Multiple hybridization events in Cardamine (Brassicaceae) during the last 150 years: revisiting a textbook example of neoallopolyploidy

    Czech Academy of Sciences Publication Activity Database

    Zozomová-Lihová, J.; Krak, Karol; Mandáková, T.; Shimizu, K. K.; Španiel, S.; Vít, Petr; Lysák, M. A.

    2014-01-01

    Roč. 113, č. 5 (2014), s. 817-830 ISSN 0305-7364 Institutional support: RVO:67985939 Keywords : allopolyploidy * hybridization * microsatellites Subject RIV: EF - Botanics Impact factor: 3.654, year: 2014

  14. Defence mechanisms of Brassicaceae: implications for plant-insect interactions and potential for integrated pest management. A review

    OpenAIRE

    Ahuja, Ishita; Rohloff, Jens; Bones, Atle Magnar

    2010-01-01

    International audience; Brassica crops are grown worldwide for oil, food and feed purposes, and constitute a significant economic value due to their nutritional, medicinal, bioindustrial, biocontrol and crop rotation properties. Insect pests cause enormous yield and economic losses in Brassica crop production every year, and are a threat to global agriculture. In order to overcome these insect pests, Brassica species themselves use multiple defence mechanisms, which can be constitutive, induc...

  15. Magnitude and timing of leaf damage affect seed production in a natural population of Arabidopsis thaliana (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Reiko Akiyama

    Full Text Available The effect of herbivory on plant fitness varies widely. Understanding the causes of this variation is of considerable interest because of its implications for plant population dynamics and trait evolution. We experimentally defoliated the annual herb Arabidopsis thaliana in a natural population in Sweden to test the hypotheses that (a plant fitness decreases with increasing damage, (b tolerance to defoliation is lower before flowering than during flowering, and (c defoliation before flowering reduces number of seeds more strongly than defoliation during flowering, but the opposite is true for effects on seed size.In a first experiment, between 0 and 75% of the leaf area was removed in May from plants that flowered or were about to start flowering. In a second experiment, 0, 25%, or 50% of the leaf area was removed from plants on one of two occasions, in mid April when plants were either in the vegetative rosette or bolting stage, or in mid May when plants were flowering. In the first experiment, seed production was negatively related to leaf area removed, and at the highest damage level, also mean seed size was reduced. In the second experiment, removal of 50% of the leaf area reduced seed production by 60% among plants defoliated early in the season at the vegetative rosettes, and by 22% among plants defoliated early in the season at the bolting stage, but did not reduce seed output of plants defoliated one month later. No seasonal shift in the effect of defoliation on seed size was detected.The results show that leaf damage may reduce the fitness of A. thaliana, and suggest that in this population leaf herbivores feeding on plants before flowering should exert stronger selection on defence traits than those feeding on plants during flowering, given similar damage levels.

  16. Preferential exclusion of hybrids in mixed pollinations between oilseed rape (Brassica napus) and weedy B. campestris (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Bagger Jørgensen, Rikke; Østergård, Hanne

    1997-01-01

    to seeds. B. campestris pollen in B. napus styles had a significantly lower fitness than the conspecific pollen, whereas no difference between pollen types was found in B. campestris styles. Hybrid zygotes survived to significantly lower proportions than conspecific zygotes in both species, with the lowest......In most experimental hybridizations between oilseed rape (Brassica napus) and weedy B. campestris, either intra- or interspecific pollen has been applied to individual flowers. Under field conditions, however, stigmas will often receive a mixture of the two types of pollen, thereby allowing...... for competition between male gametophytes and/or seeds within pods. To test whether competition influences the success of hybridization, pollen from the two species was mixed in different proportions and applied to stigmas of both species. The resulting seeds were scored for paternity by isozyme and randomly...

  17. Using fitness parameters to evaluate three oilseed Brassicaceae species as potential oil crops in two contrasting environments

    Science.gov (United States)

    Thlaspi arvense and Camelina sativa have gained considerable attention as biofuel crops. But in some areas, these species, including C. microcarpa, are becoming rare weeds because of agriculture intensification. Including them as crops could guarantee their conservation in agricultural systems. The ...

  18. Divergence of annual and perennial species in the Brassicaceae and the contribution of cis-acting variation at FLC orthologues

    NARCIS (Netherlands)

    Kiefer, C.; Severing, E.; Karl, R.; Bergonzi, S.; Koch, M.; Tresch, A.; Coupland, G.

    2017-01-01

    Variation in life history contributes to reproductive success in different environments. Divergence of annual and perennial angiosperm species is an extreme example that has occurred frequently. Perennials survive for several years and restrict the duration of reproduction by cycling between

  19. Apis mellifera (Hymenoptera: Apidae) as a potential Brassica napus pollinator (cv. Hyola 432) (Brassicaceae), in Southern Brazil.

    Science.gov (United States)

    Rosa, A S; Blochtein, B; Ferreira, N R; Witter, S

    2010-11-01

    Brassica napus Linnaeus is considered a self-compatible crop; however, studies show that bee foraging elevates their seed production. Considering bee food shortages during the winter season and that the canola is a winter crop, this study aimed to evaluate the foraging behaviour of Apis mellifera Linnaeus, 1758 regarding those flowers, and to verify if it presents adequate behaviour for successfully pollinating this crop in Rio Grande do Sul State. The study was carried out in a canola field, in Southern Brazil. The anthesis stages were morphologically characterised and then related to stigma receptivity and pollen grain viability. Similarly, the behaviour of A. mellifera individuals on flowers was followed, considering the number of flowers visited per plant, the amount of time spent on the flowers, touched structures, and collected resources. Floral fidelity was inferred by analysing the pollen load of bees collected on flowers. The bees visited from 1-7 flowers/plant (x = 2.02; sd = 1.16), the time spent on the flowers varied between 1-43 seconds (x = 3.29; sd = 2.36) and, when seeking nectar and pollen, they invariably touched anthers and stigmas. The pollen load presented 100% of B. napus pollen. The bees' attendance to a small number of flowers/plants, their short permanence on flowers, their contact with anthers and stigma and the integral floral constancy allows their consideration as potential B. napus pollinators.

  20. The Natural and Cultural Environmental Resources of the Aquilla Creek Watershed, Hill County, Texas.

    Science.gov (United States)

    1972-11-01

    canadensis Jacq. Wild Lettuce Lactuca serriola L. Prickly Lettuce Lepidium austrinum Small Southern Peppergrass Lepidium virginicum L. var. medium...white ants) Plecoptera (Stoneflies) Hemiptera (Bugs) Homoptera (Cicadas, leafhoppers, aphids , scale insects) Heteroptera Hymenoptera (Sawflies, ants

  1. The first report of Pb and Zn accumulation in some native plants from the Peruvian Andes

    Science.gov (United States)

    Bech, Jaume; Duran, Paola; Poma, Wilfredo; Sánchez, Isidoro; Barceló, Juan; Roca, Núria; Boluda, Rafael; Roca-Pérez, Luís.; Poschenrieder, Charlotte

    2010-05-01

    Until recent decades little has been known about the remediation of mining sites using metalophytes in Latin America. Metal mining has helped to create severe and diverse environmental problems. The present study proposed to identify and characterize spontaneously growing heavy metal tolerant plant species in the area around the polimetalic mine in Hualgayoc (Cajamarca, Peru). These species are potentially useful for phytorremediation. Plant and soils from their rhizosphere were sampled and analized for concentration of As, Fe, Mn, Pb and Zn. Translocation Factor (TF) defined the metals concentrations ratio between shoots and root biomass and Shoot Accumulation Factor (SAF) the metal concentration ratio between shoot and soil concentration were determined and used to measure the effectiveness of a plant in concentrating metals into its biomass. The soils were neutral pH (7,4±0,5) with variable content of organic carbon (2,4±1,1) and loam texture: sand (42,9±10,8) and clay (16,7±4,6). According to the total metals, all samples exceeded toxicity thresholds, high Pb (20016 ± 32559 mg•kg-1) and Zn (22512 ± 13056 mg•kg-1) concentrations were detected. High shoot Pb and Zn concentrations were found in Plantaginaceae Plantago orbignyana (6998 and 9617 μg/g); Brassicaceae Lepidium bipinnatifidum (6886 and 5034 mg•kg-1) and Asteraceae Senecio sp (4253 and 3870 mg•kg-1) and Baccharis latifolia (2554 and 1284 mg•kg-1 respectively). The high values of TFs indicates that the plants effectively traslocated metales. Lepidium bipinnatifidum shows the highest TFs values (143 in Pb and 21,5 in Zn). The SAF values were much lower than those reported for other species such as Paspalum sp in the Peruvian copper mine, which may be due to a high top soil Pb and Zn concentrations. These species can surely be considered as interesting for phytoextraction, due not only to its accumulative capacity but also since they showed an elevated transfer factor and grew in the

  2. The occurrence of arbuscular mycorrhizal fungi in soil and root of medicinal plants in Bu-Ali Sina garden in Hamadan, Iran

    Directory of Open Access Journals (Sweden)

    Ali Akbar Safari Sinegani

    2017-01-01

    Full Text Available Introduction: The study of symbiotic relationship between arbuscular mycorrhizal fungi (AMF and medicinal plants is very important. Information about the symbiosis of medicinal plant species with AMF in the semi-arid regions of Iran is rare. This information allows increasing knowledge of the biology and ecology of these plant species. Materials and methods: The existence of AM symbiosis in 48 medicinal plant species (belonging to 9 families was studied by root staining. Soil around the root of each species was sampled and analyzed for all soil properties which may be interrelated to AM symbiosis. The importance of different soil properties in AMF and plant biological relationship and the dependency of root colonization and spore formation by AMF on soil properties were statistically analyzed. Results: Among them Lepidium sativum, Brassica oleracea, Cheiranthus cheiri, Beta vulgaris, Spinacia oleracea, Malva sylvestris, Zygophyllum fabago, Arctium Lappa have not been colonized by AM fungi. Colonization and spore density of perennial plants were slightly higher than those of annual plants and were varied among different plant families. Soil texture and available phosphorous were the most important soil properties affecting fungal root colonization and spore numbers. Discussion and conclusion: Although in accordance with other researches, most of the medicinal plants from Brassicaceae family had no mycorrhizal symbiosis, a few of them had this type of symbiosis. Dependency of spore formation by AM fungi on soil properties was higher than dependency of root colonization percentage on soil properties. Increasing root colonization and spore numbers with increasing the percentage of sand and decreasing the percentage of clay and available phosphorous in soils show that plants are more depended on mycorrhizal symbiosis in hard environments and less productive soils.

  3. Water-soluble chlorophyll-binding proteins from Arabidopsis thaliana and Raphanus sativus target the endoplasmic reticulum body.

    Science.gov (United States)

    Takahashi, Shigekazu; Aizawa, Kyoko; Nakayama, Katsumi; Satoh, Hiroyuki

    2015-08-20

    Non-photosynthetic chlorophyll (Chl) proteins called water-soluble Chl-binding proteins are distributed in Brassicaceae plants. Brassica oleracea WSCP (BoWSCP) and Lepidium virginicum WSCP (LvWSCP) are highly expressed in leaves and stems, while Arabidopsis thaliana WSCP (AtWSCP) and Raphanus sativus WSCP (RshWSCP) are highly transcribed in floral organs. BoWSCP and LvWSCP exist in the endoplasmic reticulum (ER) body. However, the subcellular localization of AtWSCP and RshWSCP is still unclear. To determine the subcellular localization of these WSCPs, we constructed transgenic plants expressing Venus-fused AtWSCP or RshWSCP. Open reading frames corresponding to full-length AtWSCP and RshWSCP were cloned and ligated between the cauliflower mosaic virus 35S promoter and Venus, a gene encoding a yellow fluorescent protein. We introduced the constructs into A. thaliana by the floral dip method. We succeeded in constructing a number of transformants expressing Venus-fused chimeric AtWSCP (AtWSCP::Venus) or RshWSCP (RshWSCP::Venus). We detected fluorescence derived from the chimeric proteins using a fluorescence microscope system. In cotyledons, fluorescence derived from AtWSCP::Venus and RshWSCP::Venus was detected in spindle structures. The spindle structures altered their shape to a globular form under blue light excitation. In true leaves, the number of spindle structures was drastically reduced. These observations indicate that the spindle structure was the ER body. AtWSCP and RshWSCP have the potential for ER body targeting like BoWSCP and LvWSCP.

  4. Effect of high hydrostatic pressure on seed germination, microbial quality, anatomy-morphology and physiological characteristics of garden cress (Lepidium sativum) seedlings

    Science.gov (United States)

    İşlek, Cemil; Murat Altuner, Ergin; Çeter, Talip; Alpas, Hami

    2013-06-01

    High hydrostatic pressure is a non-thermal food processing technology that is found to increase the percentage of germination, decrease the germination time and improve the microbial quality of seeds. In this study, pressures of 100-400 MPa for 10 min at 30°C are used to compare the percentage of germination, the microbial quality of seeds, chlorophyll a and b, and total phenolic compounds concentrations in seedlings, and the anatomy-morphology characteristics of garden cress. Enhanced reductions of total aerobic mesophilic bacteria, total and fecal coliforms, and yeast and mould populations in seeds were observed, especially at 300 MPa. In addition, the percentage of germination, chlorophyll content and phenolic compounds concentrations, fresh and dry weights, and hypocotyl lengths of the seedlings are higher than those of all samples, where the percentage of germination is equal to controls but higher than other samples, and radicula length is lower than controls but higher than others.

  5. Postharvest Ultrasound-Assisted Freeze-Thaw Pretreatment Improves the Drying Efficiency, Physicochemical Properties, and Macamide Biosynthesis of Maca (Lepidium meyenii).

    Science.gov (United States)

    Chen, Jin-Jin; Gong, Peng-Fei; Liu, Yi-Lan; Liu, Bo-Yan; Eggert, Dawn; Guo, Yuan-Heng; Zhao, Ming-Xia; Zhao, Qing-Sheng; Zhao, Bing

    2018-04-01

    A novel technique of ultrasound-assisted freeze-thaw pretreatment (UFP) was developed to improve the drying efficiency of maca and bioactive amide synthesis in maca. The optimal UFP conditions are ultrasonic processing 90 min at 30 °C with 6 freeze-thaw cycles. Samples with freeze-thaw pretreatment (FP), ultrasound pretreatment (UP), and UFP were prepared for further comparative study. A no pretreatment (NP) sample was included as a control. The results showed that UFP improved the drying efficiency of maca slices, showing the highest effective moisture diffusivity (1.75 × 10 -9 m 2 /s). This result was further supported by low-field nuclear magnetic resonance (LF-NMR) analysis and scanning electron microscopy (SEM). The rehydration capacity and protein content of maca slices were improved by UFP. More importantly, contents of bioactive macamides and their biosynthetic precursors were increased in 2.5- and 10-fold, respectively. In conclusion, UFP is an efficient technique to improve drying efficiency, physicochemical properties, and bioactive macamides of maca, which can be applied in the industrial manufacture of maca products. © 2018 Institute of Food Technologists®.

  6. Preservation of Cognitive Function by Lepidium meyenii (Maca) Is Associated with Improvement of Mitochondrial Activity and Upregulation of Autophagy-Related Proteins in Middle-Aged Mouse Cortex.

    Science.gov (United States)

    Guo, Shan-Shan; Gao, Xiao-Fang; Gu, Yan-Rong; Wan, Zhong-Xiao; Lu, A-Ming; Qin, Zheng-Hong; Luo, Li

    2016-01-01

    Maca has been used as a foodstuff and a traditional medicine in the Andean region for over 2,000 years. Recently the neuroprotective effects of maca also arouse interest of researchers. Decrease in mitochondrial function and decline in autophagy signaling may participate in the process of age-related cognitive decline. This study aimed to investigate if maca could improve cognitive function of middle-aged mice and if this effect was associated with improvement of mitochondrial activity and modulation of autophagy signaling in mouse cortex. Fourteen-month-old male ICR mice received maca powder administered by gavage for five weeks. Maca improved cognitive function, motor coordination, and endurance capacity in middle-aged mice, accompanied by increased mitochondrial respiratory function and upregulation of autophagy-related proteins in cortex. Our findings suggest that maca is a newly defined nutritional plant which can improve mitochondrial function and upregulate autophagy-related proteins and may be an effective functional food for slowing down age-related cognitive decline.

  7. Antidepressant-like behavioral, anatomical, and biochemical effects of petroleum ether extract from maca (Lepidium meyenii) in mice exposed to chronic unpredictable mild stress.

    Science.gov (United States)

    Ai, Zhong; Cheng, Ai-Fang; Yu, Yuan-Tao; Yu, Long-Jiang; Jin, Wenwen

    2014-05-01

    Maca has been consumed as a medical food in Peru for thousands of years, and exerts anxiolytic and antidepressant effects. Our present study aimed to evaluate the behavior and anatomical and biochemical effects of petroleum ether extract from maca (ME) in the chronic unpredictable mild stress (CUMS) model of depression in mice. Three different doses of maca extract (125, 250, and 500 mg/kg) were orally administrated in the six-week CUMS procedure. Fluoxetine (10 mg/kg) was used as a positive control drug. Maca extract (250 and 500 mg/kg) significantly decreased the duration of immobility time in the tail suspension test. After treatment with maca extract (250 and 500 mg/kg), the granule cell layer in the dentate gyrus appeared thicker. Maca extract (250 and 500 mg/kg) also induced a significant reduction in corticosterone levels in mouse serum. In mouse brain tissue, after six weeks of treatment, noradrenaline and dopamine levels were increased by maca extract, and the activity of reactive oxygen species was significantly inhibited. Serotonin levels were not significantly altered. These results demonstrated that maca extract (250 and 500 mg/kg) showed antidepressant-like effects and was related to the activation of both noradrenergic and dopaminergic systems, as well as attenuation of oxidative stress in mouse brain.

  8. Evaluation of the structural, electronic, topological and vibrational properties of N-(3,4-dimethoxybenzyl)-hexadecanamide isolated from Maca (Lepidium meyenii) using different spectroscopic techniques

    Science.gov (United States)

    Chain, Fernando; Iramain, Maximiliano Alberto; Grau, Alfredo; Catalán, César A. N.; Brandán, Silvia Antonia

    2017-01-01

    N-(3,4-dimethoxybenzyl)-hexadecanamide (DMH) was characterized by using Fourier Transform infrared (FT-IR) and Raman (FT-Raman), Ultraviolet- Visible (UV-Visible) and Hydrogen and Carbon Nuclear Magnetic Resonance (1H and 13C NMR) spectroscopies. The structural, electronic, topological and vibrational properties were evaluated in gas phase and in n-hexane employing ONIOM and self-consistent force field (SCRF) calculations. The atomic charges, molecular electrostatic potentials, stabilization energies and topological properties of DMH were analyzed and compared with those calculated for N-(3,4-dimethoxybenzyl)-acetamide (DMA) in order to evaluate the effect of the side chain on the properties of DMH. The reactivity and behavior of this alkamide were predicted by using the gap energies and some descriptors. Force fields and the corresponding force constants were reported for DMA only in gas phase and n-hexane due to the high number of vibration normal modes showed by DMH, while the complete vibrational assignments are presented for DMA and both forms of DMH. The comparisons between the experimental FTIR, FT-Raman, UV-Visible and 1H and 13C NMR spectra with the corresponding theoretical ones showed a reasonable concordance.

  9. Optimization of Ultrasound-Assisted Extraction, HPLC and UHPLC-ESI-Q-TOF-MS/MS Analysis of Main Macamides and Macaenes from Maca (Cultivars of Lepidium meyenii Walp).

    Science.gov (United States)

    Chen, Shu-Xiao; Li, Ke-Ke; Pubu, Duoji; Jiang, Si-Ping; Chen, Bin; Chen, Li-Rong; Yang, Zhen; Ma, Chao; Gong, Xiao-Jie

    2017-12-10

    Ultrasound-assisted extraction (UAE), using petroleum ether as the solvent, was systematically applied to extract main macamides and macaenes from Maca hypocotyls. Extraction yield was related with four variables, including ratio of solution to solid, extraction temperature, extraction time, and extraction power. On the basis of response surface methodology (RSM), the optimal conditions were determined to be the ratio of solution to solid as 10:1 (mL/g), the extraction temperature of 40 °C, the extraction time of 30 min, and the extraction power of 200 W. Based on the optimal extraction method of UAE, the total contents of ten main macamides and two main macaenes of Maca cultivated in twenty different areas of Tibet were analyzed by HPLC and UHPLC-ESI-Q-TOF-MS/MS. This study indicated that UAE was able to effectively extract macamides alkaloids from Maca hypocotyls. Quantitative analysis showed that geographical origins, not ecotypes, played a more important role on the accumulation of active macamides in Maca.

  10. Efecto del extracto acuoso de lepidium meyenii sobre el perfil lipídico y daño oxidativo en ratas ovariectomizadas

    OpenAIRE

    Zelada Chavez, Miguel Angel

    2013-01-01

    La menopausia es el cese permanente de la menstruación, determinado de manera retrospectiva, después de 12 meses consecutivos de amenorrea, sin causas patológicas. Durante la menopausia se observa generalmente una reducción en la producción de estrógenos y un incremento en la secreción de hormonas luteinizante (LH) y folículo estimulante (FSH). Estos cambios hormonales serían responsables de la aparición de los síntomas como bochornos, sudoración (picos elevados de LH), cambios del carácter y...

  11. Preservation of Cognitive Function by Lepidium meyenii (Maca Is Associated with Improvement of Mitochondrial Activity and Upregulation of Autophagy-Related Proteins in Middle-Aged Mouse Cortex

    Directory of Open Access Journals (Sweden)

    Shan-Shan Guo

    2016-01-01

    Full Text Available Maca has been used as a foodstuff and a traditional medicine in the Andean region for over 2,000 years. Recently the neuroprotective effects of maca also arouse interest of researchers. Decrease in mitochondrial function and decline in autophagy signaling may participate in the process of age-related cognitive decline. This study aimed to investigate if maca could improve cognitive function of middle-aged mice and if this effect was associated with improvement of mitochondrial activity and modulation of autophagy signaling in mouse cortex. Fourteen-month-old male ICR mice received maca powder administered by gavage for five weeks. Maca improved cognitive function, motor coordination, and endurance capacity in middle-aged mice, accompanied by increased mitochondrial respiratory function and upregulation of autophagy-related proteins in cortex. Our findings suggest that maca is a newly defined nutritional plant which can improve mitochondrial function and upregulate autophagy-related proteins and may be an effective functional food for slowing down age-related cognitive decline.

  12. Optimization of Ultrasound-Assisted Extraction, HPLC and UHPLC-ESI-Q-TOF-MS/MS Analysis of Main Macamides and Macaenes from Maca (Cultivars of Lepidium meyenii Walp

    Directory of Open Access Journals (Sweden)

    Shu-Xiao Chen

    2017-12-01

    Full Text Available Ultrasound-assisted extraction (UAE, using petroleum ether as the solvent, was systematically applied to extract main macamides and macaenes from Maca hypocotyls. Extraction yield was related with four variables, including ratio of solution to solid, extraction temperature, extraction time, and extraction power. On the basis of response surface methodology (RSM, the optimal conditions were determined to be the ratio of solution to solid as 10:1 (mL/g, the extraction temperature of 40 °C, the extraction time of 30 min, and the extraction power of 200 W. Based on the optimal extraction method of UAE, the total contents of ten main macamides and two main macaenes of Maca cultivated in twenty different areas of Tibet were analyzed by HPLC and UHPLC-ESI-Q-TOF-MS/MS. This study indicated that UAE was able to effectively extract macamides alkaloids from Maca hypocotyls. Quantitative analysis showed that geographical origins, not ecotypes, played a more important role on the accumulation of active macamides in Maca.

  13. Analysis of Maceaene and Macamide Contents of Petroleum Ether Extract of Black, Yellow, and Purple Lepidium Meyenii (Maca and Their Antioxidant Effect on Diabetes Mellitus Rat Model

    Directory of Open Access Journals (Sweden)

    Congyang Qiu

    Full Text Available ABSTRACT Maceaene and macamide contents as well as antioxidant effect of petroleum ether extract of black maca (BM, yellow maca (YM, and purple maca (PM on diabetes mellitus (DM rats were investigated. The results showed that seven, six, and five analogues of macamides were identified from the petroleum ether extracts of BM, YM, and PM, respectively. BM extract exhibited the highest contents of total macamides. Comparatively, the PM extract has the lowest macamide quantity. The maceaene contents in all the extracts showed no significant difference (p>0.05. Macamide contents in maca with the same color were not statistically different. Pharmacological results showed that 60-day oral administration of the petroleum ether extract of maca (100 mg/kg.d can significantly decrease lipid oxidation as indicated by the decreased thiobarbituric acid reactive substances (TBARS and carbonylated proteins (CP concentrations on DM rat model (P<0.05. Among them, oral administration of PM extract showed the lowest TBRAS and CP concentrations. All maca extracts can enhance antioxidant enzyme (SOD, superoxide dismutase; CAT, catalase activity of liver and red blood cells (RBC of DM rat. However, only oral administration of PM extract can increase SOD and CAT activity of both RBC and liver. The glutathion (GSH contents in plasma were significantly increased in DM rats treated with PM extract (p<0.05. But, oral administration of BM and YM extracts did not enhance GSH levels. Take together, the data suggested that PM extract exhibited the most potent antioxidant activity on DM rat model. And, maceaene and macamide in maca extract was not correlated with its antioxidant ability.

  14. Eficacia de la maca fresca (Lepidium meyenii walp en el incremento del rendimiento físico de deportistas en altura

    Directory of Open Access Journals (Sweden)

    Gerardo Ronceros

    2005-12-01

    Full Text Available Objetivo: Determinar el efecto de la maca fresca sobre el rendimiento físico de deportistas en la altura. Diseño: Estudio experimental, prospectivo y comparativo. Materiales y Métodos: La muestra estuvo constituida por 10 deportistas de altura, quienes fueron sometidos a actividad física para medir el consumo máximo de oxígeno (VMO2 basal; luego, se les administró durante 60 días 1500 mg/día de maca fresca en presentación micropulverizado y se determinó el consumo máximo de oxígeno. En cada evaluación se realizó dosaje de transaminasa glutámico oxalacética (TGO, transaminasa glutámico pirúvica (TGP y creatinina sérica. Resultados: En la evaluación basal, se encontró que VMO2 2 mL/kg/min. Al realizar la evaluación luego de 60 días del consumo de la maca fresca, se encontró que la media del VMO2 fue 57,75 mL/kg/min (p=0,001. Se demostró un incremento del rendimiento físico de los deportistas en promedio de 10,3%. En todos los casos, los valores de TGO, TGP y creatinina sérica se mantuvieron en el rango de normalidad y no se presentaron reacciones adversas. Conclusiones: La maca fresca es un producto con actividad energética, que permite el incremento del rendimiento físico de deportistas en la altura a una dosis de 1500 mg/día, durante un período de administración de 60 días.

  15. Embryo growth, testa permeability, and endosperm weakening are major targets for the environmentally regulated inhibition of Lepidium sativum seed germination by myrigalone A

    Czech Academy of Sciences Publication Activity Database

    Voegele, A.; Graeber, K.; Oracz, K.; Tarkowská, Danuše; Jacquemoud, D.; Turečková, Veronika; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, G.

    2012-01-01

    Roč. 63, č. 14 (2012), s. 5337-5350 ISSN 0022-0957 R&D Projects: GA ČR GD522/08/H003; GA AV ČR KAN200380801 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511 Keywords : Allelochemical * apoplastic superoxide * embryo growth Subject RIV: CE - Biochemistry Impact factor: 5.242, year: 2012

  16. Application of multi-block analysis and mixture design with process variable for development of chocolate cake containing yacon (Smallanthus sonchifolius) and maca (Lepidium meyenii).

    Science.gov (United States)

    Tormena, Marcela Marta Lazaretti; de Medeiros, Luana Tabalipa; de Lima, Patrícia Casarin; Possebon, Gabriela; Fuchs, Renata Hernandez Barros; Bona, Evandro

    2017-08-01

    In this study, a chocolate cake formulation was developed with partial substitution of wheat flour by yacon and maca flour. A simplex-centroid design was applied to determine the proportions of the three flours, and the amount of water was included as a process variable at three distinct levels. According to the overall acceptability of the cakes, the tasters were separated into two groups using k-means. After segmentation, regression models were constructed for overall acceptability of each group; R 2 adjusted values of 92.5% for group 1 and 98.9% for group 2 were obtained. Using the sequential simplex method an optimized formulation was determined for group 1 (0.49 kg wheat kg -1 total flour , 0.37 kg yacon kg -1 total flour , 0.14 kg maca kg -1 total flour and 140.0 mL of water) and another for group 2 (0.35 kg wheat kg -1 total flour , 0.65 kg yacon kg -1 total flour and 120.0 mL of water). In addition to these formulations, a third formulation was proposed with a greater maca proportion (0.32 kg maca kg -1 total flour ), which does not significantly alter the overall acceptability of both groups. The three optimized formulations and two control formulations were evaluated through free-choice profiling. The data were evaluated using the multi-block method common components and specific weights analysis (CCSWA). It was observed that a greater proportion of maca intensified brownness and burnt aroma and taste, whereas a larger proportion of yacon produced a better appearance, softness, sweetness and chocolate flavor. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae).

    Science.gov (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki

    2013-12-01

    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  18. Frequency-dependent fitness of hybrids between oilseed rape (¤Brassica napus¤) and weedy ¤B. rapa¤ (Brassicaceae)

    DEFF Research Database (Denmark)

    Hauser, T.P.; Damgaard, C.; Bagger Jørgensen, Rikke

    2003-01-01

    Fitness of interspecific hybrids is sometimes high relative to their parents, despite the conventional belief that they are mostly unfit. F-1 hybrids between oilseed rape (Brassica napus) and weedy B. rapa can be significantly more fit than their weedy parents under some conditions; however, under...... other conditions they are less fit. To understand the reasons, we measured the seed production of B. napus, B. rapa, and different generations of hybrid plants at three different densities and in mixtures of different frequencies (including pure stands). Brassica napus, B. rapa, and backcross plants (F......-1 female x B. rapa) produced many more seeds per plant in pure plots than in mixtures and more seeds in plots when each was present at high frequency. The opposite was true for F-1 plants that produced many more seeds than B. rapa in mixtures, but fewer in pure stands. Both vegetative...

  19. Range-wide genetic structure of Arabidopsis halleri (Brassicaceae): glacial persistence in multiple refugia and origin of the Northern Hemisphere disjunction

    Czech Academy of Sciences Publication Activity Database

    Šrámková-Fuxová, G.; Záveská, E.; Kolář, Filip; Lučanová, Magdalena; Španiel, S.; Marhold, K.

    2017-01-01

    Roč. 185, č. 3 (2017), s. 321-342 ISSN 0024-4074 Institutional support: RVO:67985939 Keywords : Cruciferae * extra-Mediterranean refugia * DNA sequencing Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.277, year: 2016

  20. Development of a liquid chromatography-electrospray ionization-tandem mass spectrometry method for the simultaneous analysis of intact glucosinolates and isothiocyanates in Brassicaceae seeds and functional foods.

    Science.gov (United States)

    Franco, P; Spinozzi, S; Pagnotta, E; Lazzeri, L; Ugolini, L; Camborata, C; Roda, A

    2016-01-08

    A new high pressure liquid chromatography-electrospray ionization-tandem mass spectrometry method for the simultaneous determination of glucosinolates, as glucoraphanin and glucoerucin, and the corresponding isothiocyanates, as sulforaphane and erucin, was developed and applied to quantify these compounds in Eruca sativa defatted seed meals and enriched functional foods. The method involved solvent extraction, separation was achieved in gradient mode using water with 0.5% formic acid and acetonitrile with 0.5% formic acid and using a reverse phase C18 column. The electrospray ion source operated in negative and positive mode for the detection of glucosinolates and isothiocyanates, respectively, and the multiple reaction monitoring (MRM) was selected as acquisition mode. The method was validated following the ICH guidelines. Replicate experiments demonstrated a good accuracy (bias%food products enriched with glucosinolates, or nutraceutical bakery products. In addition, the developed method was applied to the simultaneous determination of glucosinolates and isothiocyanates in bakery product enriched with glucosinolates, to evaluate their thermal stability after different industrial processes from cultivation phases to consumer processing. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Alelopatia de Camelina sativa Boiss. (Brassicaceae sobre a germinação e desenvolvimento inicial de Bidens pilosa (L. e Glycine max (L. Merr

    Directory of Open Access Journals (Sweden)

    Jéssica da Silva

    2011-09-01

    Full Text Available http://dx.doi.org/10.5007/2175-7925.2011v24n4p17 O presente trabalho buscou avaliar a possível presença de potencial alelopático na camelina, bem como o seu efeito sobre a germinação e o desenvolvimento inicial de plântulas de soja e picão-preto, a fim de verificar a possibilidade do cultivo dela com a soja no sistema de rotação de culturas e de seu uso como herbicida. Os experimentos foram realizados no Laboratório de Fisiologia Vegetal da Universidade Estadual do Oeste do Paraná, Cascavel, Paraná. O delineamento foi inteiramente casualizado e as avaliações realizadas diariamente. Os parâmetros avaliados foram: porcentagem de germinação, tempo e velocidade média de germinação e comprimento médio de raiz. Os dados obtidos foram submetidos ao Teste F e as médias comparadas pelo Teste de Tukey, a 5% de probabilidade. Os resultados obtidos comprovam a presença de potencial alelopático na camelina. Foi verificado que esta espécie pode ser considerada uma opção para o cultivo com a soja devido à interferência alelopática positiva provocada na cultura e ainda, que ela apresenta capacidade para utilização no controle de plantas invasoras como o picão-preto, já que atuou atrasando o desenvolvimento das plântulas testadas.

  2. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae) populations on kale, Brassica oleracea var. acephala (Brassicaceae) plants.

    Science.gov (United States)

    Silva-Filho, Reinildes; Santos, Ricardo Henrique Silva; Tavares, Wagner de Souza; Leite, Germano Leão Demolin; Wilcken, Carlos Frederico; Serrão, José Eduardo; Zanuncio, José Cola

    2014-01-01

    Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  3. Comparison of growth inhibition profiles and mechanisms of apoptosis induction in human colon cancer cell lines by isothiocyanates and indoles from Brassicaceae

    Energy Technology Data Exchange (ETDEWEB)

    Pappa, Gerlinde [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Lichtenberg, Maike [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Iori, Renato [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Barillari, Jessica [Consiglio per la Ricerca e la Sperimentazione in Agricoltura, Istituto Sperimentale Colture Industriali, 40129 Bologna (Italy); Bartsch, Helmut [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany); Gerhaeuser, Clarissa [Division of Toxicology and Cancer Risk Factors, German Cancer Research Center (DKFZ), 69120 Heidelberg (Germany)]. E-mail: c.gerhauser@dkfz.de

    2006-07-25

    The isothiocyanates sulforaphane and PEITC ({beta}-phenethyl isothiocyanate) as well as the indoles indole-3-carbinol and its condensation product 3,3'-diindolylmethane are known to inhibit cancer cell proliferation and induce apoptosis. In this study, we compared the cell growth inhibitory potential of the four compounds on the p53 wild type human colon cancer cell line 40-16 (p53{sup +/+}) and its p53 knockout derivative 379.2 (p53{sup -/-}) (both derived from HCT116). Using sulforhodamin B staining to assess cell proliferation, we found that the isothiocyanates were strongly cytotoxic, whereas the indoles inhibited cell growth in a cytostatic manner. Half-maximal inhibitory concentrations of all four compounds in both cell lines ranged from 5-15 {mu}M after 24, 48 and 72 h of treatment. Apoptosis induction was analyzed by immunoblotting of poly(ADP-ribose)polymerase (PARP). Treatment with sulforaphane (15 {mu}M), PEITC (10 {mu}M), indole-3-carbinol (10 {mu}M) and 3,3'-diindolylmethane (10 {mu}M) induced PARP cleavage after 24 and 48 h in both 40-16 and the 379.2 cell lines, suggestive of a p53-independent mechanism of apoptosis induction. In cultured 40-16 cells, activation of caspase-9 and -7 detected by Western blotting indicated involvement of the mitochondrial pathway. We detected time- and concentration-dependent changes in protein expression of anti-apoptotic Bcl-x{sub L} as well as pro-apoptotic Bax and Bak proteins. Of note is that for sulforaphane only, ratios of pro- to anti-apoptotic Bcl-2 family protein levels directly correlated with apoptosis induction measured by PARP cleavage. Taken together, we demonstrated that the glucosinolate breakdown products investigated in this study have distinct profiles of cell growth inhibition, potential to induce p53-independent apoptosis and to modulate Bcl-2 family protein expression in human colon cancer cell lines.

  4. Senescence-inducible cell wall and intracellular purple acid phosphatases: implications for phosphorus remobilization in Hakea prostrata (Proteaceae) and Arabidopsis thaliana (Brassicaceae).

    Science.gov (United States)

    Shane, Michael W; Stigter, Kyla; Fedosejevs, Eric T; Plaxton, William C

    2014-11-01

    Despite its agronomic importance, the metabolic networks mediating phosphorus (P) remobilization during plant senescence are poorly understood. Highly efficient P remobilization (~85%) from senescing leaves and proteoid roots of harsh hakea (Hakea prostrata), a native 'extremophile' plant of south-western Australia, was linked with striking up-regulation of cell wall-localized and intracellular acid phosphatase (APase) and RNase activities. Non-denaturing PAGE followed by in-gel APase activity staining revealed senescence-inducible 120kDa and 60kDa intracellular APase isoforms, whereas only the 120kDa isoform was detected in corresponding cell wall fractions. Kinetic and immunological properties of the 120kDa and 60kDa APases partially purified from senescing leaves indicated that they are purple acid phosphatases (PAPs). Results obtained with cell wall-targeted hydrolases of harsh hakea were corroborated using Arabidopsis thaliana in which an ~200% increase in cell wall APase activity during leaf senescence was paralleled by accumulation of immunoreactive 55kDa AtPAP26 polypeptides. Senescing leaves of an atpap26 T-DNA insertion mutant displayed a >90% decrease in cell wall APase activity. Previous research established that senescing leaves of atpap26 plants exhibited a similar reduction in intracellular (vacuolar) APase activity, while displaying markedly impaired P remobilization efficiency and delayed senescence. It is hypothesized that up-regulation and dual targeting of PAPs and RNases to the cell wall and vacuolar compartments make a crucial contribution to highly efficient P remobilization that dominates the P metabolism of senescing tissues of harsh hakea and Arabidopsis. To the best of the authors' knowledge, the apparent contribution of cell wall-targeted hydrolases to remobilizing key macronutrients such as P during senescence has not been previously suggested. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. Spasmolytic, antimicrobial and cytotoxic activities of 5-phenylpentyl isothiocyanate, a new glucosinolate autolysis product from horseradish (Armoracia rusticana P. Gaertn., B. Mey. & Scherb., Brassicaceae).

    Science.gov (United States)

    Dekić, Milan S; Radulović, Niko S; Stojanović, Nikola M; Randjelović, Pavle J; Stojanović-Radić, Zorica Z; Najman, Stevo; Stojanović, Sanja

    2017-10-01

    Detailed analyses of horseradish autolysates led to the identification of a new natural product, 5-phenylpentyl isothiocyanate (PhPeITC). The structural assignment was corroborated by synthesis, and the identity unequivocally established by spectral means. The occurrence of PhPeITC is the first direct proof of the existence of a 5-phenylpentyl glucosinolate in the aerial parts of this species as one of the possible "mustard oil" precursors. To verify its possible contribution to the horseradish functional food status, horseradish above- and underground autolysates, together with five ω-phenylalkyl isothiocyanates were tested for their spasmolytic, cytotoxic and antimicrobial activities. Specifically, the cytotoxic effect on Caco-2, HeLa (cancer) and MDCK (non-cancer) cell lines was established. Additionally, the five tested ITCs exerted significant spasmolytic activity (on rat distal colon), with PhPeITC being almost 100 times more potent than papaverine. A non-selective antimicrobial activity of all ITCs was revealed in the case of 6 bacterial and 2 fungal strains. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Transparent Testa Glabra 1 (TTG1) and TTG1-like genes in Matthiola incana R. Br. and related Brassicaceae and mutation in the WD-40 motif.

    Science.gov (United States)

    Dressel, A; Hemleben, V

    2009-03-01

    TTG1 (Transparent Testa Glabra 1), a WD-40 repeat protein, is involved in regulation of flavonoid/anthocyanin biosynthesis, seed coat (mucilage) development/pigmentation and trichome formation in leaves. Here, we characterized the TTG1 gene of Matthiola incana wild type (e locus), showing 85.3% similarity to TTG1 of A. thaliana on the nucleotide level and 96.2% on the protein level. A white-flowered and glabrous mutant, line 17, of M. incana exhibits one nucleotide change, leading to an amino acid substitution directly in the WD motif (W158R). Correspondingly, the DFR (dihydroflavonol 4-reductase) gene, in which the expression is known to be dependent on TTG1, is not expressed in Matthiola mutant lines 17 (and 19). Comparison of the GC content of the Matthiola TTG1 (54.1%) and Arabidopsis TTG1 (46.1%) genes revealed a strong difference, mostly obtained by neutral substitutions (C to T transitions). To examine whether this is an ecologically influenced trend, a fragment of TTG1 was characterized from another Matthiola species (M. tricuspidata) and from Malcolmia flexuosa subsp. naxensis from the eastern Mediterranean, near a beach with sandy and salty soils. Both Matthiola species have a higher GC content in the TTG1 gene than Arabidopsis and the closer-related Malcolmia, indicating that the GC content is rather an evolutionary than an ecological signal. A similar WD-40 repeat protein gene (containing no intron in the 3' untranslated region) with high similarity to the Arabidopsis TTG1-like (AtAN11) gene was found in Matthiola.

  7. Rice-straw mulch reduces the green peach aphid, Myzus persicae (Hemiptera: Aphididae populations on kale, Brassica oleracea var. acephala (Brassicaceae plants.

    Directory of Open Access Journals (Sweden)

    Reinildes Silva-Filho

    Full Text Available Organic mulches, like peel and rice-straw, besides other materials affect the UV and temperature, which cause a reduction in the aphid arrival. The aim was to evaluate the effect of covering the soil with straw on the populations of the green peach aphid, Myzus persicae on the kale, Brassica oleracea var. acephala plants. The first experiment evaluated the direct effect of the rice-straw mulch and the second its indirect effect on aphid immigration, testing the plant characteristics that could lead to the landing preference of this insect. The third experiment evaluated the direct effect of the mulch on the aphid population. In the second and third experiments, four plants, each in a 14 L polyethylene pot with holes at the bottom, were used in areas with and without soil mulching. These pots were changed between areas, after seven days, to evaluate the effects of this change on the arrival of the winged aphids to the plants. Each plant was covered with anti-aphid gauze and inoculated with one winged M. persicae. Winged and apterous adults of this insect were counted per plant after 15 days. The temperature increased in the mulched plots to a maximum of 21-36°C and to 18-32°C in the plots with or without soil covering, respectively. Plant growth reduced the numbers of the winged aphids landing before and after they were moved to the bare soil plots. The nutrient content was similar in plants in both the mulched and no mulched plots. The population growth of M. persicae was higher in the control than in the mulched plots. This was partially due to temperatures close to 30°C in these plots and changes in the plant physiology. The soil mulching with rice-straw decreased the M. persicae landing, increased the plot temperatures and improved the vegetative growth of the kale plants.

  8. Perennial Pepperweed Patches - San Francisco Estuary [ds295

    Data.gov (United States)

    California Department of Resources — This layer contains polygon data for the perennial pepperweed (Lepidium latifolium) database. This database represents distribution data collected within the areas...

  9. Perennial Pepperweed Patches - San Francisco Estuary [ds295

    Data.gov (United States)

    California Natural Resource Agency — This layer contains polygon data for the perennial pepperweed (Lepidium latifolium) database. This database represents distribution data collected within the areas...

  10. Evaluation of cytotoxicity and oxidative stress induced by alcoholic ...

    African Journals Online (AJOL)

    ... that plays a major role in metabolism, digestion, detoxification, and elimination of substances from the body, the present studies were designed to investigate the possible adverse effect of alcoholic extract of seeds of Lepidium sativum (LSA) and Lepidium sativum seed oil (LSO) on HepG2 cells, a human liver cell line.

  11. Effect of industrial dust on some test organisms

    Energy Technology Data Exchange (ETDEWEB)

    Schuck, H.J.

    1974-01-01

    The effect of industrial dust on the growth of Lepidium sativum Cress and on spore germination and germ-tube development of Botrytis cinerea and Fusarium oxysporum was studied. Lepidium sativum was strongly inhibited and in most cases the fungi were stimulated. The effect was related to the species of trees and the district, where the dust-samples were collected.

  12. Hormone-Balancing Effect of Pre-Gelatinized Organic Maca (Lepidium peruvianum Chacon): (III) Clinical responses of early-postmenopausal women to Maca in double blind, randomized, Placebo-controlled, crossover configuration, outpatient study.

    Science.gov (United States)

    Meissner, H O; Mscisz, A; Reich-Bilinska, H; Mrozikiewicz, P; Bobkiewicz-Kozlowska, T; Kedzia, B; Lowicka, A; Barchia, I

    2006-12-01

    This is the second, conclusive part of the clinical study on clinical responses of early-postmenopausal women to standardized doses of pre-Gelatinized Organic Maca (Maca-GO). Total of 34 Caucasian women volunteers participated in a double-blind, randomized, four months outpatient crossover configuration Trial. After fulfilling the criteria of being early-postmenopausal: blood Estrogen (E230 IU/ml) at admission, they were randomly allocated to Placebo (P) and Maca-GO (M) treatments (2 groups of 11 participants each). Two 500 mg vegetable hard gel capsules with Maca-GO or Placebo powder were self-administered twice daily with meals (total 2 g/day). At admission and follow-up monthly intervals, body mass index (BMI), blood pressure, levels of gonadal, pituitary, thyroid and adrenal hormones, lipids and key minerals were measured. Bone markers were determined after four months M and P use in 12 participants. Menopausal symptoms were assessed according to Greene's Score (GMS) and Kupperman's Index (KMI). Data were analyzed using multivariate technique on blocs of monthly. Results and canonical variate technique was applied to GMS and KMI matrices. Two months application of Maca-GO stimulated (PMaca-GO noticeably increased bone density markers. In conclusion, Maca-GO applied to early-postmenopausal women (i) acted as a toner of hormonal processes along the Hypothalamus-Pituitary-Ovarian axis, (ii) balanced hormone levels and (iii) relieved symptoms of menopausal discomfort, (hot flushes and night sweating in particular), thus, (iv) exhibited a distinctive function peculiar to adaptogens, providing an alternative non-hormonal plant option to reduce dependence on hormone therapy programs (HRT).

  13. Hormone-Balancing Effect of Pre-Gelatinized Organic Maca (Lepidium peruvianum Chacon): (II) Physiological and Symptomatic Responses of Early-Postmenopausal Women to Standardized doses of Maca in Double Blind, Randomized, Placebo-Controlled, Multi-Centre Clinical Study.

    Science.gov (United States)

    Meissner, H O; Mscisz, A; Reich-Bilinska, H; Kapczynski, W; Mrozikiewicz, P; Bobkiewicz-Kozlowska, T; Kedzia, B; Lowicka, A; Barchia, I

    2006-12-01

    This was a double-blind, randomized, placebo-corrected, outpatient, multi-centre (five sites) clinical study, in which a total of 168 Caucasian early-postmenopausal women volunteers (age>49 years) participated after fulfilling the criteria: follicle stimulating hormone (FSH) >30 IU/ml and estrogen (E2) Maca (Maca-GO) treatment, according to different monthly treatment sequences scheduled for each site. Two 500 mg vegetable hard gel capsules with Maca-GO or Placebo powder were self-administered twice daily with meals (total 2 g/day) during three (Trial I; n=102) or four (Trial II; n=66) months study periods. At the baseline and follow- up monthly intervals, blood levels of FSH, E2, progesterone (PRG) and lutinizing hormone (LH), as well as serum cholesterol (CHOL), triglycerides (TRG), high- and low density lipoproteins (HDL and LDL) were measured. Menopausal symptoms were assessed according to Greene's Score (GMS) and Kupperman's Index (KMI). Data were analyzed using multivariate technique on blocs of monthly results in one model and Maca versus Placebo contrast in another model. A total of 124 women concluded the study. Maca-GO significantly stimulated production of E2 (PMaca-GO significantly reduced both frequency and severity of individual menopausal symptoms (hot flushes and night sweating in particular) resulting in significant (P<0.001) alleviation of KMI (from 22 to 10), thus, offering an attractive non-hormonal addition to the choices available to early-postmenopausal women in the form of a natural plant alternative to Hormone Replacement Therapy (HRT) - hence, reducing dependence on hormone therapy programs.

  14. Hormone-Balancing Effect of Pre-Gelatinized Organic Maca (Lepidium peruvianum Chacon): (III) Clinical responses of early-postmenopausal women to Maca in double blind, randomized, Placebo-controlled, crossover configuration, outpatient study

    OpenAIRE

    Meissner, H. O.; Mscisz, A.; Reich-Bilinska, H.; Mrozikiewicz, P.; Bobkiewicz-Kozlowska, T.; Kedzia, B.; Lowicka, A.; Barchia, I.

    2006-01-01

    This is the second, conclusive part of the clinical study on clinical responses of early-postmenopausal women to standardized doses of pre-Gelatinized Organic Maca (Maca-GO). Total of 34 Caucasian women volunteers participated in a double-blind, randomized, four months outpatient crossover configuration Trial. After fulfilling the criteria of being early-postmenopausal: blood Estrogen (E230 IU/ml) at admission, they were randomly allocated to Placebo (P) and Maca-GO (M) treatments (2 groups o...

  15. Descontaminación microbiana de la maca (Lepidium meyenii aplicando el sistema de esterilización orgánica (OSS para preservar sus propiedades nutricionales y sensoriales

    Directory of Open Access Journals (Sweden)

    Américo Guevara Pérez

    2016-01-01

    Full Text Available La investigación tuvo como objetivo aplicar el sistema de esterilización orgánica (OSS en maca, determinando los parámetros del proceso: tiempo y temperatura de inyección de vapor saturado que reduzcan el recuento de microorganismos aerobios, mohos, levaduras, E. Coli, salmonella y coliformes totales, y evaluando la influencia del proceso en el contenido total de glucosinolatos. La máxima descontaminación microbiana de la maca se logró aplicando una carga de 5 kg/saquillo, por 6 min. Con una temperatura de inyección de vapor saturado de 100 °C. Bajo estas condiciones, la reducción de la carga microbiana fue de 99,9% (< 10 UFC/g, 50% (< 10 UFC/g y 93,3% (< 10 UFC/g para aerobios, mohos, y levaduras, respectivamente; el comportamiento de patógenos fue muy similar al de la materia prima: E. coli < 3 UFC/g, ausencia de salmonella (25 g y < 3 UFC/g para coliformes totales. El contenido de glucosinolatos se mantuvo durante el proceso en 1,5 μmol/g, lo que evidenció que al aplicar la tecnología OSS se logra conservar la calidad nutricional, sensorial y funcional de la maca.

  16. Capacidade reprodutiva e preferência da traça-das-crucíferas para diferentes brassicáceas Reproductive capacity and preference of the diamondback moth feeding on different brassicacea

    Directory of Open Access Journals (Sweden)

    Sergio A De Bortoli

    2011-06-01

    Full Text Available O objetivo desta pesquisa foi comparar diferentes cultivares de brassicáceas em relação à capacidade reprodutiva e preferência para alimentação e oviposição da traça-das-crucíferas. Os experimentos foram realizados utilizando-se as cultivares de repolho Midori, Chato-de-Quintal, híbridos da Top Seed® - Agristar (TPC 308, TPC 681 e TPC 668, couve-flor Bola de Neve, couve brócolis Ramoso Piracicaba Precoce e couve Manteiga da Geórgia, sendo esta última utilizada como padrão de suscetibilidade. Por meio dos dados biológicos de P. xylostella foram estimados os parâmetros necessários para a construção de tabela de vida de fertilidade, para comparação das cultivares testadas em relação à capacidade reprodutiva da praga. Em gaiolas de criação da traça-das-crucíferas foram colocados quatro quartos de folha, dois a dois, que justapostos formavam um círculo de 8 cm de diâmetro, confrontando-se os materiais dois a dois. As partes foram dispostas equidistantemente, para realização do teste de dupla chance de escolha (preferência para alimentação e oviposição e de múltipla chance de escolha, confrontando todos os substratos (preferência para alimentação. As cultivares que proporcionaram melhor desenvolvimento e reprodução para a traça-das-crucíferas foram couve Manteiga da Geórgia e couve brócolis. Para preferência alimentar constatou-se alta suscetibilidade em couve Manteiga e TPC 681 e para preferência de oviposição alta preferência para couve-flor Bola de Neve. Com isso, sugere-se a divisão das cultivares estudadas em quatro classes distintas: repolho Midori como moderadamente resistente (MR; couve-flor Bola de Neve e repolho Chato-de-Quintal como suscetíveis (S; couve brócolis, TPC308, TPC681 e TPC668 como moderadamente suscetíveis (MS; e couve Manteiga como altamente suscetível (AS.We compared different cultivars of crucifer in relation to reproductive capacity and preference for feeding and oviposition of the diamondback moth. The experiments were carried out with the following cultivars: Midori and Chato-de-Quintal cabbage, hybrids of cabbage Top Seed® - Agristar (TPC 308, TPC 681 and TPC 668, cauliflower Bola de Neve, broccolis Ramoso Piracicaba Precoce and collard green Manteiga da Geórgia, being this last one used as the susceptible control. Through the biological parameters of P. xylostella we elaborated a fertility life table, Comparing the cultivars in relation to the pest reproductive capacity. Four leaf parts were placed in diamondback moth rearing chambers, being two leaves of the treatment and two of the control which, put together formed a circle with 8 cm in diameter. The parts were disposed in an equidistantly form, to perform the dual-choice test (feeding and oviposition preference and multiple-choice test, confronting all substrates (feeding preference. The cultivars that provided better development and reproduction for the diamondback moth were collard green Manteiga da Georgia and broccolis Ramoso Piracicaba Precoce. For feeding preference high susceptibility was verified in collard green Manteiga da Geórgia and TPC 681 and for oviposition preference high preference was observed for cauliflower Bola de Neve. Four different groups of cultivars could be formed: cabbage Midori as moderately resistant (MR; cauliflower Bola de Neve and cabbage Chato-de-Quintal as susceptible (S; broccolis, TPC 308, TPC 681 and TPC 668 as moderately susceptible (MS; and collard green as highly susceptible (HS.

  17. Glucosinolate diversity within a phylogenetic framework of the tribe Cardamineae (Brassicaceae) unraveled with HPLC-MS/MS and NMR-based analytical distinction of 70 desulfoglucosinolates

    DEFF Research Database (Denmark)

    Olsen, Carl Erik; Huang, Xiao-Chen; Hansen, Cecilie Ida Cetti

    2016-01-01

    As a basis for future investigations of evolutionary trajectories and biosynthetic mechanisms underlying variations in glucosinolate structures, we screened members of the crucifer tribe Cardamineae by HPLC-MS/MS, isolated and identified glucosinolates by NMR, searched the literature for previous...

  18. Research on possibilities of utilization of chosen Brassicaceae plants in protection of cucumber against damping-off caused by Rhizoctonia solani Kühn and Fusarium culmorum (W.G.SmithSacc.

    Directory of Open Access Journals (Sweden)

    Zbigniew J. Burgieł

    2012-12-01

    Full Text Available The aim of the work was to determine the usefulness of dried leaves of savoy cabbage, red cabbage, horse radish and fringed cabbage in protection of cucumber against damping-off caused by fungi Rhizoctonia solani and Fusarium culmorum. In the laboratory experiments, pathogens were grown on PDA containing dried leaves (3g·100 cm-3 and in atmosphere containing volatile substances evolved from plant material. The addition of radish horse leaves into PDA caused total inhibition of R. solani development. Remaining plants were also characterized by high fungistatic activity (% of growth inhibition about 85%. F. culmorum was less sensitive. The horse radish leaves showed the strongest activity (65 %, weakest in combination with fringed cabbage leaves (38,9%. The similar regularity in the case of fumigation activity was observed. The effectiveness of dried leaves in protection of cucumber against damping-off was confirmed in greenhouse experiment. The amendment of soil inoculated with R. solani in dose 2 g per 500 cm3 of soil significantly increased the number of cucumber sprouts compared to the control. In the experiment with F. culmorum only in combination with horse radish and red cabbage leaves significant action was observed.

  19. Utilização de substâncias naturais no controle de pulgões em cultivo orgânico de brócolis, Brassica oleracea var. itálica (Brassicaceae)

    OpenAIRE

    Santos, Adriano Jorge Nunes dos

    2011-01-01

    The aim of this study was to evaluate the effect of aqueous extracts of leaves of neem (Azadirachta indica A. Juss), Meliaceae, leaves and foliage of bitter melon, in Brazil named melão-de-são-caetano (Mormodica charantia L.), Cucurbitaceae, Chili Pepper fruits (Capsicum frutescens), Solanaceae, black pepper seeds (Piper nigrum), Piperaceae, NeenMax® (neem oil) and water (control) to control aphid infestations in organic cultivation of Brassica oleracea var. italic, in Arapiraca city, Alagoas...

  20. Utilização de substâncias naturais para o manejo de Lipaphis erysimi (Kaltenbach, 1843) (Hemiptera: Aphididae) em cultivo orgânico de brócolis, Brassica oleracea var. italica (Brassicaceae).

    OpenAIRE

    Broglio, Sônia Maria Forti; Santos, Adriano Jorge Nunes dos; Dias-Pini, Nivia da Silva; Valente, Ellen Carine Neves; Micheletti, Lígia Broglio

    2014-01-01

    Objetivou-se avaliar o efeito de extratos aquosos de folhas de nim, Azadirachta indica, frutos de pimenta-malagueta, Capsicum frutescens, rama e folhas de melão-de-são-caetano, Mormodica charantia, sementes de pimenta-do-reino, Piper nigrum e NeenMax® (óleo de nim 2% i.a) para o manejo do pulgão, Lipaphis erysimi, em cultivo orgânico de Brassica oleracea. Aplicações dos extratos a 10% (v/v) foram realizadas semanalmente, durante cinco semanas. Avaliou-se o número de plantas infestadas, porcen...

  1. Feeding preferences of Microtheca punctigera (Achard (Coleoptera: Chrysomelidae for some Brassicaceae plants in multiple-choice assays Preferência alimentar de Microtheca punctigera (Achard (Coleoptera: Chrysomelidae por algumas crucíferas em testes de mútipla escolha

    Directory of Open Access Journals (Sweden)

    Ayres Oliveira Menezes Jr.

    2005-01-01

    Full Text Available Host plant feeding preference is important basic information for the development of insect management strategies. Multiple-choice feeding preference assays were conducted in the laboratory for the chrysomelid beetle, Microtheca punctigera (Achard. Feeding was assessed 72 h after onset of experiments. With one larva per Petri dish, food items comprised watercress, Nasturtium officinale L., arugula, Eruca sativa L., mustard, Brassica juncea Cosson, Chinese cabbage, B. pekinensis (Lour. Rupr. and wild radish (Raphanus raphanistrum L.. Feeding ranking preferences were Chinese cabbage, mustard, wild radish, arugula and watercress (7.97, 1.85, 0.98, 0.36 and 0.11 mm², respectively. Feeding on Chinese cabbage was 4.31 times more intense than on mustard. The same experiment was repeated with one adult per dish. Responses of males and females were quite similar. Feeding was higher on mustard (87.2 and 142.8 for males and females, respectively. Feeding on arugula (51.5 and 132.7 and Chinese cabbage (51.8 and 89.0 were intermediate. Watercress (22.96 and 39.3 and wild radish (12.03 and 28.4 were the least preferred host plants. In a third experiment, ten larvae per dish were used and spinach, Tetragonia expansa Murr., radish, Raphanus sativus L. and collard, B. oleracea var. acephala L., were also included. Daily larval frequencies on each food were also measured. Feeding was similar on Chinese cabbage and mustard (47.89 and 53.78, respectively. Number of insects was greater on mustard, Chinese cabbage and wild radish. Probable explanations for results and proposals for further investigations are discussed.Preferência alimentar é informação básica importante para o desenvolvimento de estratégias de manejo. Experimentos de preferência alimentar com múltipla chance de escolha foram conduzidos em laboratório para o crisomelídeo Microtheca punctigera (Acherd. A alimentação foi avaliada 72h após o início dos experimentos. Com uma larva por placa de Petri, foram utilizadas discos de folhas de almeirão, Nasturtium officinale L., rúcula, Eruca sativa L., mostarda, Brassica juncea Cosson, couve chinesa, B. pekinensis (Lour. Rupr., e nabiça (Raphanus raphanistrum L.. A alimentação em ordem decrescente foi em couve chinesa, mostarda, nabiça, rúcula e almeirão (7,97; 1,85; 0,98; 0,36 e 0,11 mm², respectivamente. A alimentação em couve chinesa foi de 4,31 vezes maior do que em mostarda. O mesmo experimento foi repetido com um adulto por placa. Respostas de machos e fêmeas foram similares. A alimentação foi maior em mostarda (87,2 e 142,8 para machos e fêmeas, respectivamente; em rúcula (51,5 e 132,7 e couve chinesa (51,8 e 89,0 foi intermediária. Agrião (22,96 e 39,3 e nabiça (12,03 e 28,4 foram os menos consumidos. Num terceiro experimento, dez larvas por placa foram usadas, incluindo-se também espinafre, Tetragonia expansa Murr., rabanete, Raphanus sativus L., e couve, B. oleracea var. acephala L. A freqüências diárias de larvas em cada alimento foram também medidas. A alimentação foi similar em couve chinesa e mostarda (47,89 e 53,78, respectivamente. O número de insetos foi maior em mostarda, couve chinesa e nabiça. Prováveis explicações da preferência e proposições de novas pesquisas são discutidos.

  2. 76 FR 66369 - Endangered and Threatened Wildlife and Plants; Review of Native Species That Are Candidates for...

    Science.gov (United States)

    2011-10-26

    ...-line herbarium databases, surveys and monitoring data, seed-collection data, and scientific publications. Bracted twistflower, an annual herbaceous plant of the Brassicaceae (mustard family), is endemic...

  3. 78 FR 47109 - Endangered and Threatened Wildlife and Plants; Endangered Status for Physaria globosa (Short's...

    Science.gov (United States)

    2013-08-02

    ...; conversion of agricultural sites for use as pasture; mowing and herbicide treatment prior to seed production... mustard family (Brassicaceae) known from Posey County, Indiana; Clark, Franklin and Woodford Counties...-shaped) hairs, but becoming smooth with time. Taxonomy. A member of the mustard family (Brassicaceae...

  4. A Decision Analysis Perspective on Multiple Response Robust Optimization

    Science.gov (United States)

    2012-03-01

    Response surface methodology for optimization of extraction yield, viscosity, hue and emulsion stability of mucilage extracted from Lepidium perfoliatum...reviewing instructions, searching existing data sources , gathering and maintaining the data needed, and completing and reviewing the collection of

  5. ew diversification crops: MSIRI's recent and innovative contributions

    African Journals Online (AJOL)

    Nafiisah

    Arracacia xanthorrhiza), yacon (Polymnia sonchifolia) and maca (Lepidium meyenii), among the root and tuber crops (Bertram, 1993). Thirdly, crops that used to be very important, at least in certain regions, but whose cultivation has practically ceased.

  6. Pharmacokinetics and tissue distribution of N-3- methoxybenzyl ...

    African Journals Online (AJOL)

    methoxybenzyl-palmitamide (MPM) derived from Lepidium meyenii (Maca). Methods: MPM and N-benzylpalmitamide (BPM, as the internal standard, IS) were prepared by one-pot synthesis method and characterized. For the analysis of MPM in rat ...

  7. Formulation Development and Optimization of Fast Dissolving Tablets of Aceclofenac Using Natural Superdisintegrant

    OpenAIRE

    Kaur, Lovleen; Bala, Rajni; Kanojia, Neha; Nagpal, Manju; Dhingra, Gitika Arora

    2014-01-01

    The current research work involves preparation of fast dissolving tablets of Aceclofenac by direct compression method using different concentrations of Lepidium sativum mucilage as natural superdisintegrant. A two-factor three-level (32) factorial design is being used to optimize the formulation. Nine formulation batches (D1–D9) were prepared accordingly. Two factors as independent variables (X 1-amount of β-cyclodextrin and X 2-amount of Lepidium sativum mucilage) were taken with three level...

  8. M-X Environmental Technical Report. Environmental Characteristics of Alternative Designated Deployment Areas, Protected Species.

    Science.gov (United States)

    1980-12-22

    SE)’ (117) F. pahutensis (RT) (120) Geranium toguimense (RC) (128) Haplopappus watsonii (RC) (136) Lepidium nanum (RC)l (140) Lomatium ravenii (RC...highest SP/HSU index number is .01, or I percent of known locations affected for species #128, the Watson Goldenweed ( Haplopappus watsonii). Likewise...ripleyi (SC) Haplopappus brickellioides (RC) Iiulsea vestita var.inyoensis (RC) Lathyrus hitchcockianus (SE) Lepidium nanum (RC) Lewsia maguirei (RE

  9. Diversified glucosinolate metabolism

    DEFF Research Database (Denmark)

    Frisch, Tina; Motawie, Mohammed Saddik; Olsen, Carl Erik

    2015-01-01

    Alliaria petiolata (garlic mustard, Brassicaceae) contains the glucosinolate sinigrin as well as alliarinoside, a γ-hydroxynitrile glucoside structurally related to cyanogenic glucosides. Sinigrin may defend this plant against a broad range of enemies, while alliarinoside confers resistance...

  10. Pseudomonas moraviensis subsp. stanleyae, a bacterial endophyte of hyperaccumulator Stanleya pinnata, is capable of efficient selenite reduction to elemental selenium under aerobic conditions

    NARCIS (Netherlands)

    Staicu, L. C.; Ackerson, C. J.; Cornelis, P.; Ye, L.; Berendsen, R. L.; Hunter, W. J.; Noblitt, S. D.; Henry, C. S.; Cappa, J. J.; Montenieri, R. L.; Wong, A. O.; Musilova, L.; Sura-de Jong, M.; van Hullebusch, E. D.; Lens, P. N L; Reynolds, R. J B; Pilon-Smits, Elizabeth A H

    2015-01-01

    Aims: To identify bacteria with high selenium tolerance and reduction capacity for bioremediation of wastewater and nanoselenium particle production. Methods and Results: A bacterial endophyte was isolated from the selenium hyperaccumulator Stanleya pinnata (Brassicaceae) growing on seleniferous

  11. Intra-specific Differences in Root and Shoot Glucosinolate Profiles among White Cabbage (Brassica oleracea var capitata)

    NARCIS (Netherlands)

    Kabouw, P.; Biere, A.; Putten, van der W.H.; Dam, van N.M.

    2010-01-01

    Shoot glucosinolate profiles of Brassicaceae are known to vary within species, across environmental conditions, and between developmental stages. Here we study whether root profiles follow the intra-specific, environmental, and developmental variation observed for aerial parts in white cabbage

  12. sur Plutella xylostella (Lepidoptera : Plutellidae)

    African Journals Online (AJOL)

    Efficacité d'extraits de feuilles de neem Azadirachta indica (Sapindale) sur Plutella xylostella (Lepidoptera : Plutellidae), Hellula undalis (Lepidoptera : Pyralidae) et Lipaphis erysimi (Hemiptera : Aphididae) du chou Brassica oleracea (Brassicaceae) da.

  13. Effects of glucosinolates and their hydrolysis products on biochemical and performance parameters in broiler chicken diets

    Science.gov (United States)

    Glucosinolates are important bioactive molecules and widely found in Brassicaceae species (cress, brussels sprouts, mustard, broccoli, kale, etc.). Depending on the amount of these vegetables consumed, both positive and negative metabolic effects from glucosinolate metabolites may occur. The aim of ...

  14. Experimental hybridization of species in the genus Rorippa

    Czech Academy of Sciences Publication Activity Database

    Jarolímová, Vlasta

    2005-01-01

    Roč. 77, - (2005), s. 277-296 ISSN 0032-7786 Institutional research plan: CEZ:AV0Z60050516 Keywords : Brassicaceae * interspecific hybridization * ploidy level Subject RIV: EF - Botanics Impact factor: 1.545, year: 2005

  15. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; Van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  16. Crossfit analysis: a novel method to characterize the dynamics of induced plant responses

    NARCIS (Netherlands)

    Jansen, J.J.; van Dam, N.M.; Hoefsloot, H.C.J.; Smilde, A.K.

    2009-01-01

    Background: Many plant species show induced responses that protect them against exogenous attacks. These responses involve the production of many different bioactive compounds. Plant species belonging to the Brassicaceae family produce defensive glucosinolates, which may greatly influence their

  17. Marker list: QM297979 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM297979 Brassica rapa Brassicaceae cnu_m299a SSR TGTGAGAATGCAGTCCAAAACT TCTGGTCAT...GATGGTGGAAA second generation B. rapa reference linkage map ... 10.1186/1471-2164-10-432 19751531

  18. Marker list: QM297974 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM297974 Brassica rapa Brassicaceae cnu_m291a SSR CCGTACAAAGATACGCACGA ACAGAACTCGG...GGCTACCTC second generation B. rapa reference linkage map ... 10.1186/1471-2164-10-432 19751531

  19. Marker list: QM297797 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM297797 Brassica rapa Brassicaceae nia_m119a SSR GAGTGGGATTCTCATCATGG TACCGTCTTGG...CTCTTGAGT second generation B. rapa reference linkage map ... 10.1186/1471-2164-10-432 19751531

  20. Marker list: QM297976 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QM297976 Brassica rapa Brassicaceae cnu_m294a SSR CAACGGTCCGTAACTGGTCT AGCTTCTCAGG...CTTGATTCG second generation B. rapa reference linkage map ... 10.1186/1471-2164-10-432 19751531

  1. 75 FR 59622 - Supplemental Determination for Renewable Fuels Produced Under the Final RFS2 Program From Canola Oil

    Science.gov (United States)

    2010-09-28

    ... traditional biofuels such as ethanol from corn or biodiesel from soy. We note also that much of the 2012... to extend this rulemaking to other oilseeds in the family Brassicaceae such as camelina. Today's...

  2. Effect of water content and temperature on inactivation kinetics of myrosinase in broccoli (Brassica oleracea var. italica)

    NARCIS (Netherlands)

    Oliviero, T.; Verkerk, R.; Boekel, van M.A.J.S.; Dekker, M.

    2014-01-01

    Broccoli belongs to the Brassicaceae plant family consisting of widely eaten vegetables containing high concentrations of glucosinolates. Enzymatic hydrolysis of glucosinolates by endogenous myrosinase (MYR) can form isothiocyanates with health-promoting activities. The effect of water content (WC)

  3. Heavy Metals in selected Edible Vegetables and their daily intake in Sanandaj, Iran

    Energy Technology Data Exchange (ETDEWEB)

    Alasvand Zarasvand, M.; Maleki, A.

    2009-07-01

    The levels of four different heavy metals [cadmium (Cd), lead (Pb), chromium (Cr) and copper (Cu)] were determined in various vegetables [leek (Allium ampeloprasum), sweet basil (Ocimum basilicum), parsley (Petroselium cripsum), gardem cress (lepidium sativum) and tarragon (Artemisia dracuncullus)] cultivated around the Sanandaj city. (Author)

  4. Phytotoxicity of Sodium Fluoride and Uptake of Fluoride in Willow Trees

    DEFF Research Database (Denmark)

    Clausen, Lauge Peter Westergaard; Gosewinkel Karlson, Ulrich; Trapp, Stefan

    2015-01-01

    The willow tree (Salix viminalis) toxicity test and a cress seed germination test (Lepidium sativum) were used to determine uptake and phytotoxicity of NaF. Concentrations in hydroponic solutions were 0-1000 mg F/L and 0-400 mg F/L in the preliminary and definitive test. A third test was done...

  5. Author Details

    African Journals Online (AJOL)

    Musarrat, Javed. Vol 12, No 24 (2013) - Articles Evaluation of cytotoxicity and oxidative stress induced by alcoholic extract and oil of Lepidium Sativum seeds in human liver cell line HepG2. Abstract PDF · Vol 10, No 14 (2011) - Articles Characterization of Sunn hemp begomovirus and its geographical origin based on in ...

  6. Evaluation of Diuretic Activity of Aqueous and Methanol Extracts of ...

    African Journals Online (AJOL)

    Purpose: The present study was undertaken to investigate diuretic effect of aqueous and methanol extracts of the dried seeds of Lepidium sativum in normal rats. Method: Aqueous and methanol extracts of L. sativum seeds were administered to experimental rats orally at doses of 50 and 100 mg/kg p.o. Hydrochlorothiazide ...

  7. In Vitro antibacterial activity of rumex nervosus, plantago lanceolata ...

    African Journals Online (AJOL)

    The finding indicated that Rumex nervosus showed have the highest zone of inhibition (20mm) against the genus Salmonella followed by Plantago lanceolata with the zone of inhibition (16mm) against L. monocytogenes. On the other hand, Lepidium sativum and Solanum incanum did not have any antibacterial activity ...

  8. Promotion of Testa Rupture during Garden Cress Germination Involves Seed Compartment-Specific Expression and Activity of Pectin Methylesterases

    Czech Academy of Sciences Publication Activity Database

    Scheler, C.; Weitbrecht, K.; Pearce, S.; Hampstead, A.; Buettner-Mainik, A.; Lee, K.J.D.; Voegele, A.; Mueller, K.; Leubner-Metzger, Gerhard

    2015-01-01

    Roč. 167, č. 1 (2015), s. 200-215 ISSN 0032-0889 Institutional support: RVO:61389030 Keywords : AVOCADO PERSEA-AMERICANA * ARABIDOPSIS-THALIANA * LEPIDIUM-SATIVUM Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.280, year: 2015

  9. Lubricants and functional fluids from lesquerella oil

    Science.gov (United States)

    Lesquerella fendleri is an oilseed crop belonging to the Brassicaceae (mustard) family that is native to the desert of the southwestern United States. The interest in this crop is due to the high level of hydroxy fatty acids (HFA) in the oil. The seed contains 33% oil, 23% protein, and 15% gums. The...

  10. Genotype-environment interactions affect flower and fruit herbivory and plant chemistry of Arabidopsis thaliana in a transplant experiment

    NARCIS (Netherlands)

    Mosleh Arany, A.; de Jong, T.; Kim, H.K.; Van Dam, N.M.; Choi, Y.L.; van Mil, H.G.J.; Verpoorte, R.; van der Meijden, E.

    2009-01-01

    Large differences exist in flower and fruit herbivory between dune and inland populations of plants of Arabidopsis thaliana (Brassicaceae). Two specialist weevils Ceutorhynchus atomus and C. contractus (Curculionidae) and their larvae are responsible for this pattern in herbivory. We test, by means

  11. The Tarenaya hassleriana Genome Provides Insight into Reproductive Trait and Genome Evolution of Crucifers

    NARCIS (Netherlands)

    Cheng, S.; Bergh, van den E.; Zeng, P.; Zong, X.; Hofberger, J.; Bruijn, de S.A.; Bhide, A.S.; Kuelahoglu, C.; Bian, C.; Chen, J.; Fan, G.; Kaufmann, K.; Hall, J.C.; Becker, A.; Brautigam, A.; Weber, A.P.M.; Shi, C.; Zheng, Z.; Li, W.; Lv, M.; Tao, Y.; Wang, M.; Zou, H.; Quan, Z.; Hibberd, J.M.; Zhang, G.; Zhu, X.; Schranz, M.E.

    2013-01-01

    The Brassicaceae, including Arabidopsis thaliana and Brassica crops, is unmatched among plants in its wealth of genomic and functional molecular data and has long served as a model for understanding gene, genome, and trait evolution. However, genome information from a phylogenetic outgroup that is

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29020 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 16 3 ... 10.1007/s00122-003-1570-z 14740090

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29024 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 4.65 ... 10.1007/s00122-003-1570-z 14740090

  14. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29023 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 2.93 ... 10.1007/s00122-003-1570-z 14740090

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29022 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 17 4.75 ... 10.1007/s00122-003-1570-z 14740090

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29025 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O9/C7 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... LG_O02/C8 ... 11 4.68 ... 10.1007/s00122-003-1570-z 14740090

  17. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT29021 Brassica oleracea Brassicaceae ... regeneration from protoplasts_O2/C8 A trai...t contributing to the plant-regeneration ability of protoplast-derived microcalli ... XsORA43-185/178 LG_O02/C8 ... 17 4.64 ... 10.1007/s00122-003-1570-z 14740090

  18. Role of glucosinolates in insect-plant relationships and multitrophic interactions

    NARCIS (Netherlands)

    Hopkins, R.J.; Dam, van N.M.; Loon, van J.J.A.

    2009-01-01

    Glucosinolates present classical examples of plant compounds affecting insect-plant interactions. They are found mainly in the family Brassicaceae, which includes several important crops. More than 120 different glucosinolates are known. The enzyme myrosinase, which is stored in specialized plant

  19. Compensation of seed production after severe injury in the short-lived herb Barbarea vulgaris

    Czech Academy of Sciences Publication Activity Database

    Martínková, Jana; Klimešová, Jitka; Mihulka, Stanislav

    2008-01-01

    Roč. 9, č. 1 (2008), s. 44-54 ISSN 1439-1791 R&D Projects: GA ČR GA206/01/1039; GA ČR GD206/03/H034 Institutional research plan: CEZ:AV0Z60050516 Keywords : Adventitious sprouting * disturbance * Brassicaceae Subject RIV: EF - Botanics Impact factor: 2.584, year: 2008

  20. 7 CFR 457.171 - Cabbage crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    .... 1. Definitions Cabbage. Plants of the family Brassicaceae and the genus Brassica, grown for their compact heads and used for human consumption. Crop Year. In lieu of the definition contained in section 1... to the definition contained in section 1 of the Basic Provisions, cabbage plants and seeds must...

  1. Phylogenetic signal in growth and reproductive traits and in their plasticity: the Descurainia radiation in the Canary Islands

    Czech Academy of Sciences Publication Activity Database

    Herben, Tomáš; Rydlová, Věra; Fér, T.; Suda, Jan; Münzbergová, Zuzana; Wildová, Radka; Wild, Jan

    2014-01-01

    Roč. 174, č. 3 (2014), s. 384-398 ISSN 0024-4074 R&D Projects: GA ČR GA206/04/0081 Institutional support: RVO:67985939 Keywords : phenotypic plasticity * Brassicaceae * phylogenetic constraints Subject RIV: EF - Botanics Impact factor: 2.534, year: 2014

  2. QTL list: uni13.1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT61665 Brassica napus Brassicaceae uni13.1 controlling homeologous pairing at met...aphase I in haploids PrBn gene (homeologous pairing regulator in B. napus) ... LG_DY13 ... 43.4 2.5 ... 10.1534/genetics.106.064071 16951054

  3. QTL list: uni4.1 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT61663 Brassica napus Brassicaceae uni4.1 controlling homeologous pairing at meta...phase I in haploids PrBn gene (homeologous pairing regulator in B. napus) ... LG_DY04 ... 135.67 3.3 ... 10.1534/genetics.106.064071 16951054

  4. QTL list: PrBn [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT61662 Brassica napus Brassicaceae PrBn controlling homeologous pairing at metaph...ase I in haploids PrBn gene (homeologous pairing regulator in B. napus) ... LG_DY15 ... 34.9 7.7 ... 10.1534/genetics.106.064071 16951054

  5. New floristic records in the Balkans: 8

    DEFF Research Database (Denmark)

    Biel, Burkhard; Tan, Kit

    2008-01-01

    ew chorological data are presented for 90 species and subspecies from Bulgaria (records no. 49-52), Greece (2-36, 53-90) and Turkey-in-Europe (1, 37-48). The taxa belong to the following families: Apiaceae (21), Araceae (87), Asteraceae (5-9, 22-26, 82), Boraginaceae (53, 83), Brassicaceae (54-56...

  6. Biotechnology for improving hydroxy fatty acid production in lesquerella

    Science.gov (United States)

    P Lesquerella [Physaria fendleri (A. Gray)], formerly Lesquerella fendleri, (Brassicaceae), being developed as a new industrial oilseed crop in the southwestern region of the United States, is valued for its unusual hydroxy fatty acid (HFA) in seed. The majority of HFA in lesquerella is lesquerolic...

  7. Genetic structure of Potentilla acaulis (Rosaceae) populations ...

    African Journals Online (AJOL)

    Jane

    2011-07-18

    Jul 18, 2011 ... Ecol. 10: 1811-1819. Bohonak AJ (1999). Dispersal, gene flow, and population structure. Q. Rev. Biol., 74: 21-45. Chen S, Xia T, Chen S, Zhou Y (2005). RAPD Profiling in Detecting. Genetic Variation in Endemic Coelonema (Brassicaceae) of Qinghai-. Tibet Plateau of China. Biochem. Genet., 43: 189-201.

  8. Expression of the Znt1 zinc transporter from the metal hyperaccumulator noccaea caerulescens confers enhanced zinc and cadmium tolerance and accumulation to arabidopsis thaliana

    NARCIS (Netherlands)

    Lin, Ya Fen; Hassan, Zeshan; Talukdar, S.; Schat, Henk; Aarts, Mark G.M.

    2016-01-01

    Prompt regulation of transition metal transporters is crucial for plant zinc homeostasis. NcZNT1 is one of such transporters, found in the metal hyperaccumulator Brassicaceae species Noccaea caerulescens. It is orthologous to AtZIP4 from Arabidopsis thaliana, an important actor in Zn homeostasis.

  9. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51964 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr10 22.94 (2.01-40.94) ... 10.1038/hdy.2010.103 20736971

  10. Aggregation and foraging behavior of imported cabbageworm (Lepidoptera: pieridae) adults on blue vervain flowers

    Science.gov (United States)

    The imported cabbageworm [Pieris rapae (L.) (Lepidoptera: Pieridae)], also known as the cabbage white butterfly, is an important specialized pest on cruciferous plants (Brassicales: Brassicaceae) worldwide. an unusual aggregation of the cabbage white butterflies was observed on a patch of flowering...

  11. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51958 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr06 61.95 (57.03-74.15) ... 10.1038/hdy.2010.103 20736971

  12. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51962 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr10 16.01 (0.01-38.94) ... 10.1038/hdy.2010.103 20736971

  13. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51960 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr09 37.31 (23.46-48.43) ... 10.1038/hdy.2010.103 20736971

  14. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51961 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr09 25.46 (22.46-48.74) ... 10.1038/hdy.2010.103 20736971

  15. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51963 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr10 20.94 (0.01-42.79) ... 10.1038/hdy.2010.103 20736971

  16. QTL list: [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT51959 Brassica rapa Brassicaceae ... Days to the collection of the flowers Collecti...on interval (The number of days from flowering to the collection of the flowers) 5 ... Chr06 65.4 (57.03-80.15) ... 10.1038/hdy.2010.103 20736971

  17. Scientific Opinion on erucic acid in feed and food

    DEFF Research Database (Denmark)

    Petersen, Annette

    Erucic acid is the trivial name of the fatty acid cis-13-docosenoic acid and occurs at high concentrations mainly in the seeds of species of the Brassicaceae (e.g. rape seed or mustard seed). The European Commission requested EFSA to deliver a scientific opinion on the risks for animal and human...

  18. Scientific opinion: Erucic acid in feed and food

    NARCIS (Netherlands)

    Hoogenboom, L.A.P.

    2016-01-01

    Erucic acid is the trivial name of the fatty acid cis-13-docosenoic acid and occurs at high concentrations mainly in the seeds of species of the Brassicaceae (e.g. rape seed or mustard seed). The European Commission requested EFSA to deliver a scientific opinion on the risks for animal and human

  19. Paleopolyploidy in the Brassicales: Analyses of the Cleome transcriptome elucidate the history of genome duplications in Arabidopsis and other Brassicales

    NARCIS (Netherlands)

    Barker, M.S.; Vogel, H.; Schranz, M.E.

    2009-01-01

    The analysis of the Arabidopsis genome revealed evidence of three ancient polyploidy events in the evolution of the Brassicaceae, but the exact phylogenetic placement of these events is still not resolved. The most recent event is called the At-{alpha} (alpha) or 3R, the intermediate event is

  20. Integrating winter camelina into maize and soybean cropping systems

    Science.gov (United States)

    Camelina [Camelina sativa (L.) Crantz.] is an industrial oilseed crop in the Brassicaceae family with multiple uses. Currently, camelina is not used as a cover crop, but it has the potential to be used as such in maize (Zea mays L.)-soybean [Glycine max (L.) Merr.] systems. The objectives of this st...

  1. A comprehensive set of transcript sequences of the heavy metal hyperaccumulator Noccaea caerulescens

    NARCIS (Netherlands)

    Lin, Y.F.; Severing, E.I.; Lintel Hekkert, te B.; Schijlen, E.G.W.M.; Aarts, M.G.M.

    2014-01-01

    Noccaea caerulescens is an extremophile plant species belonging to the Brassicaceae family. It has adapted to grow on soils containing high, normally toxic, concentrations of metals such as nickel, zinc, and cadmium. Next to being extremely tolerant to these metals, it is one of the few species

  2. An early nodulin-like protein accumulates in the sieve element plasma membrane of Arabidopsis

    DEFF Research Database (Denmark)

    Khan, Junaid A.; Wang, Qi; Sjölund, Richard D.

    2007-01-01

    Membrane proteins within the sieve element-companion cell complex have essential roles in the physiological functioning of the phloem. The monoclonal antibody line RS6, selected from hybridomas raised against sieve elements isolated from California shield leaf (Streptanthus tortuosus; Brassicacea...

  3. Isolation and identification of 4-a-rhamnosyloxy benzyl glucosinolate in Noccaea caerulescens showing intraspecific variation

    NARCIS (Netherlands)

    Graaf, de R.M.; Krosse, S.; Swolfs, A.E.M.; Brinke, te E.; Prill, N.; Leimu, R.; Galen, van P.M.; Wang, Y.; Aarts, M.G.M.; Dam, van N.M.

    2015-01-01

    Glucosinolates are secondary plant compounds typically found in members of the Brassicaceae and a few other plant families. Usually each plant species contains a specific subset of the ~130 different glucosinolates identified to date. However, intraspecific variation in glucosinolate profiles is

  4. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine X schulzii trigenomic allopolyploid

    Czech Academy of Sciences Publication Activity Database

    Zozomová-Lihová, J.; Mandáková, T.; Kovaříková, Alena; Muehlhausen, A.; Mummenhoff, K.; Lysák, M. A.; Kovařík, Aleš

    2014-01-01

    Roč. 203, č. 4 (2014), s. 1096-1108 ISSN 0028-646X R&D Projects: GA ČR(CZ) GBP501/12/G090 Institutional support: RVO:68081707 Keywords : Brassicaceae * concerted evolution * hybridization Subject RIV: BO - Biophysics Impact factor: 7.672, year: 2014

  5. Sequestration of Glucosinolates and Iridoid Glucosides in Sawfly Species of the Genus Athalia and Their Role in Defense Against Ants

    DEFF Research Database (Denmark)

    Opitz, Sebastian E. W.; Jensen, Søren Rosendal; Müller, Caroline

    2010-01-01

    ), whereas Plantaginaceae contain iridoid glucosides (IGs) as characteristic secondary compounds. Athalia rosae and A. liberta feed on members of the Brassicaceae. Larvae of A. rosae sequester aromatic and aliphatic GLSs of Sinapis alba in their hemolymph, as shown previously, but no indolic GLSs; A. liberta...

  6. QTL list: qLP-DW-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... ChrA03 34.3 4.1 ... 10.1007/s00122-010-1301-1 20217384 ... QT91785 Brassica napus Brassicaceae qLP-DW-A3a LP and HP constitutive constitutive QTL for low and high pho

  7. QTL list: qHP-PU-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... em1ge34b ... ChrA03 29.9 3.21 ... 10.1007/s00122-010-1301-1 20217384 ... QT91755 Brassica napus Brassicaceae qHP-PU-A3a LP and HP constitutive constitutive QTL for low and high pho

  8. QTL list: qLP-RVol-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ve QTL for low and high phosphorus condition ... em1ge34b ... ChrA03 34.3 4.35 ... 10.1007/s00122-010-1301-1 20217384 ... QT91787 Brassica napus Brassicaceae qLP-RVol-A3a LP and HP constitutive constituti

  9. QTL list: qHP-RVol-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available ve QTL for low and high phosphorus condition ... ChrA03 33.3 5.58 ... 10.1007/s00122-010-1301-1 20217384 ... QT91784 Brassica napus Brassicaceae qHP-RVol-A3a LP and HP constitutive constituti

  10. QTL list: qHP-DW-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... em1ge34b ... ChrA03 34.7 3.62 ... 10.1007/s00122-010-1301-1 20217384 ... QT91756 Brassica napus Brassicaceae qHP-DW-A3a LP and HP constitutive constitutive QTL for low and high pho

  11. QTL list: qLP-RL-C2a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... sR6293 ... ChrC02 43.3 3.37 ... 10.1007/s00122-010-1301-1 20217384 ... QT91792 Brassica napus Brassicaceae qLP-RL-C2a LP and HP constitutive constitutive QTL for low and high pho

  12. QTL list: qHP-RL-C2a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... sR6293 ... ChrC02 45.7 4.46 ... 10.1007/s00122-010-1301-1 20217384 ... QT91791 Brassica napus Brassicaceae qHP-RL-C2a LP and HP constitutive constitutive QTL for low and high pho

  13. QTL list: qHP-DW-C2a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... sR6293 ... ChrC02 44.8 3.67 ... 10.1007/s00122-010-1301-1 20217384 ... QT91789 Brassica napus Brassicaceae qHP-DW-C2a LP and HP constitutive constitutive QTL for low and high pho

  14. QTL list: qHP-RSA-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available e QTL for low and high phosphorus condition ... em1ge34b ... ChrA03 31.7 6.32 ... 10.1007/s00122-010-1301-1 20217384 ... QT91757 Brassica napus Brassicaceae qHP-RSA-A3a LP and HP constitutive constitutiv

  15. QTL list: qHP-PU-C2a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available sphorus condition ... ChrC02 42 3.72 ... 10.1007/s00122-010-1301-1 20217384 ... QT91790 Brassica napus Brassicaceae qHP-PU-C2a LP and HP constitutive constitutive QTL for low and high pho

  16. QTL list: qLP-RSA-A3a [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available e QTL for low and high phosphorus condition ... em1ge34b ... ChrA03 32.6 4.71 ... 10.1007/s00122-010-1301-1 20217384 ... QT91786 Brassica napus Brassicaceae qLP-RSA-A3a LP and HP constitutive constitutiv

  17. Palyonological studies of the semi-desert plant species from Pakistan

    African Journals Online (AJOL)

    USER

    2010-06-14

    Jun 14, 2010 ... The detailed palynological description of 40 angiospermic plant species, belonging to 22 families and 38 genera were made. Out of the 22 families, 3 families were monocotyledonous and 19 dicotyledonous. The. Brassicaceae and Papilionaceae were the largest families regarding number of species ...

  18. QTL list: qRBALB-A7 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available QT89558 Brassica napus Brassicaceae qRBALB-A7 root Boron accumulation root Boron accumulation under low bor...on conditions 4 ... ChrA07 62.4 4.52 ... 10.1371/journal.pone.0112089 25375356

  19. QTL list: qSBALB-A5 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available accumulation under low boron conditions 4 ... ChrA05 77.8 4.61 ... 10.1371/journal.pone.0112089 25375356 ... QT89547 Brassica napus Brassicaceae qSBALB-A5 shoot Boron accumulation shoot Boron

  20. QTL list: qSBALB-A4 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available accumulation under low boron conditions 4 ... ChrA04 85.3 7.28 ... 10.1371/journal.pone.0112089 25375356 ... QT89545 Brassica napus Brassicaceae qSBALB-A4 shoot Boron accumulation shoot Boron