WorldWideScience

Sample records for lentiviral chop shrna

  1. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  2. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... The essence of cancer development and growth is that mutant cells unlimitedly proliferate and cannot ... big enzyme family that can act on ester bonds between phosphoglyceric acetic substituents and .... extracted using small plasmid extractive kit (Takara, Japan). The absorbance and concentrations of the ...

  4. Lentiviral delivery of short hairpin RNAs

    Science.gov (United States)

    Manjunath, N; Haoquan, Wu; Sandesh, Subramanya; Premlata, Shankar

    2009-01-01

    In less than a decade after discovery, RNA interference-mediated gene silencing is already being tested as potential therapy in clinical trials for a number of diseases. Lentiviral vectors provide a means to express short hairpin RNA (shRNA) to induce stable and long-term gene silencing in both dividing and non-dividing cells and thus, are being intensively investigated for this purpose. However, induction of long-term shRNA expression can also cause toxicities by inducing off target effects and interference with the endogenous micro RNA (miRNA) pathway that regulates cellular gene expression. Recently, several advances have been made in the shRNA vector design to mimic cellular miRNA processing and to express multiplex siRNAs in a tightly regulated and reversible manner to overcome toxicities. In this review we describe some of these advances, focusing on the progress made in the development of lentiviral shRNA delivery strategies to combat viral infections. PMID:19341774

  5. Chopping a Point

    DEFF Research Database (Denmark)

    Chaochen, Z.; Hansen, Michael Reichhardt

    1996-01-01

    This paper introduces a super-dense chop modality into the Duration Calculi. The super-dense chop can be used to specify a super-dense computation, where a number of operations happens simultaneously, but in a specific order. With this modality, the paper defines a real-time semantics for an OCCA...

  6. Construction of RNAi lentiviral vector targeting mouse Islet-1 gene

    Directory of Open Access Journals (Sweden)

    Shen-shen ZHI

    2011-02-01

    Full Text Available Objective To construct and select RNAi lentiviral vectors that can silence mouse Islet-1 gene effectively.Methods Three groups of RNAi-target of mouse Islet-1 gene were designed,and corresponding shRNA oligo(sh1,sh2 and sh3 were synthesized,and then they were respectively inserted to the PLVTHM vector that had been digested by endonuclease.Agarose gel electrophoresis and sequencing were used to select and indentify the positive clones.The positive clones were extracted and then mixed with E.coli to amplify positive clones.The amplified clones were then infected into 293T along with the other 3 helper plasmids to produce lentiviral vector.After the construction of the lentiviral vector,plaque formation test was performed to determine the titer of lentiviral vector.The lentiviral vectors were then infected into C3H10T1/2 cells.The transfect efficiency of the lentiviral vectors was determined with flow cytometry with detection of green fluorescent protein(GFP.Q-PCR was employed to detect the RNAi efficiency of the lentiviral vectors.Results Agarose gel electrophoresis analysis showed that the clones with right gene at the target size were successfully established;gene sequencing showed that the right DNA fragments had been inserted;plaque formation test showed that the titer of the virus solution was 3.87×108TU/ml;the transfect efficiency of the lentiviral vector infected into C3H10T1/2 cells was 90.36%.All the 3 groups of shRNA targets(sh1,sh2 and sh3 showed an inhibitory effect on Islet-1 gene,and the sh1 showed the highest inhibitory effect(76.8%,as compared with that of normal cells(P < 0.05.Conclusion The RNAi lentiviral vector that can effectively silence the mouse Islet-1 gene has been constructed successfully,which may lay a foundation for further investigation of Islet-1 gene.

  7. Modified gateway system for double shRNA expression and Cre/lox based gene expression

    Directory of Open Access Journals (Sweden)

    Leung Lisa

    2011-03-01

    Full Text Available Abstract Background The growing need for functional studies of genes has set the stage for the development of versatile tools for genetic manipulations. Results Aiming to provide tools for high throughput analysis of gene functions, we have developed a modified short hairpin RNA (shRNA and gene expression system based on Gateway Technology. The system contains a series of entry and destination vectors that enables easy transfer of shRNA or cDNA into lentiviral expression systems with a variety of selection or marker genes (i.e. puromycin, hygromycin, green fluorescent protein-EGFP, yellow fluorescent protein-YFP and red fluorescent protein-dsRed2. Our shRNA entry vector pENTR.hU6.hH1 containing two tandem human shRNA expression promoters, H1 and U6, was capable of co-expressing two shRNA sequences simultaneously. The entry vector for gene overexpression, pENTR.CMV.ON was constructed to contain CMV promoter with a multiple cloning site flanked by loxP sites allowing for subsequent Cre/lox recombination. Both shRNA and cDNA expression vectors also contained attL sites necessary for recombination with attR sites in our destination expression vectors. As proof of principle we demonstrate the functionality and efficiency of this system by testing expression of several cDNA and shRNA sequences in a number of cell lines. Conclusion Our system is a valuable addition to already existing library of Gateway based vectors and can be an essential tool for many aspects of gene functional studies.

  8. Modified gateway system for double shRNA expression and Cre/lox based gene expression.

    Science.gov (United States)

    Radulovich, Nikolina; Leung, Lisa; Tsao, Ming-Sound

    2011-03-22

    The growing need for functional studies of genes has set the stage for the development of versatile tools for genetic manipulations. Aiming to provide tools for high throughput analysis of gene functions, we have developed a modified short hairpin RNA (shRNA) and gene expression system based on Gateway Technology. The system contains a series of entry and destination vectors that enables easy transfer of shRNA or cDNA into lentiviral expression systems with a variety of selection or marker genes (i.e. puromycin, hygromycin, green fluorescent protein-EGFP, yellow fluorescent protein-YFP and red fluorescent protein-dsRed2). Our shRNA entry vector pENTR.hU6.hH1 containing two tandem human shRNA expression promoters, H1 and U6, was capable of co-expressing two shRNA sequences simultaneously. The entry vector for gene overexpression, pENTR.CMV.ON was constructed to contain CMV promoter with a multiple cloning site flanked by loxP sites allowing for subsequent Cre/lox recombination. Both shRNA and cDNA expression vectors also contained attL sites necessary for recombination with attR sites in our destination expression vectors. As proof of principle we demonstrate the functionality and efficiency of this system by testing expression of several cDNA and shRNA sequences in a number of cell lines. Our system is a valuable addition to already existing library of Gateway based vectors and can be an essential tool for many aspects of gene functional studies.

  9. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  10. Commercial production of chopped firewood

    International Nuclear Information System (INIS)

    Jouhiaho, A.

    2004-01-01

    The aim of the reseach project was to improve the competitiveness of chopped firewood by producing information that can help to reduce production and distribution costs as well as increase the quality of chopped firewood produced. The sub-project 'New logistics solutions for the chopped firewood production process' studied current production and distribution efficiency of commerical chopped firewood and tried to find cost saving methods. The sub-project 'The current situation of the firewood trade in Europe' surveyed firewood trade volumes, operational methods and the firewood production equipment found on sale in European countries. Information about the chopped firewood trade and chopping device market was for the most part an estimate. This is because there is no research and statistical information available. Indicative information was obtained from Denmark, Germany, Norway, Spain, Sweden and Finland. The sub-project 'Productivity, costs and development targets of new chopped firewood machines' researched ten new firewood processing devices suitable for professional and domestic use by means of work-study methods. The research studied productivity and chopping costs, and analysed the quality of chopped firewood manufactured by the firewood processing devices. It also analysed the occupational safety and ergonomics of chopping work and suggestions were made for the device manufacturers on how to develop chopping devices. Sub-project 'The artificial drying and storage management for chopped firewood' carried out field tests on different types of cold and warm air dryers being used by chopped firewood entrepreneurs. The aim was to find the most promising dryer type according to its cost and operating efficiency. In addition, the suitability of resistance based electronic wood moisture meter for measuring the moisture content of single chopped firewood pieces was also studied. (orig.)

  11. Preclinical Evaluation of a Lentiviral Vector for Huntingtin Silencing

    Directory of Open Access Journals (Sweden)

    Karine Cambon

    2017-06-01

    Full Text Available Huntington’s disease (HD is an autosomal dominant neurodegenerative disorder resulting from a polyglutamine expansion in the huntingtin (HTT protein. There is currently no cure for this disease, but recent studies suggest that RNAi to downregulate the expression of both normal and mutant HTT is a promising therapeutic approach. We previously developed a small hairpin RNA (shRNA, vectorized in an HIV-1-derived lentiviral vector (LV, that reduced pathology in an HD rodent model. Here, we modified this vector for preclinical development by using a tat-independent third-generation LV (pCCL backbone and removing the original reporter genes. We demonstrate that this novel vector efficiently downregulated HTT expression in vitro in striatal neurons derived from induced pluripotent stem cells (iPSCs of HD patients. It reduced two major pathological HD hallmarks while triggering a minimal inflammatory response, up to 6 weeks after injection, when administered by stereotaxic surgery in the striatum of an in vivo rodent HD model. Further assessment of this shRNA vector in vitro showed proper processing by the endogenous silencing machinery, and we analyzed gene expression changes to identify potential off-targets. These preclinical data suggest that this new shRNA vector fulfills primary biosafety and efficiency requirements for further development in the clinic as a cure for HD.

  12. Target discovery screens using pooled shRNA libraries and next-generation sequencing: A model workflow and analytical algorithm.

    Directory of Open Access Journals (Sweden)

    Christiane Schaefer

    Full Text Available In the search for novel therapeutic targets, RNA interference screening has become a valuable tool. High-throughput technologies are now broadly accessible but their assay development from baseline remains resource-intensive and challenging. Focusing on this assay development process, we here describe a target discovery screen using pooled shRNA libraries and next-generation sequencing (NGS deconvolution in a cell line model of Ewing sarcoma. In a strategy designed for comparative and synthetic lethal studies, we screened for targets specific to the A673 Ewing sarcoma cell line. Methods, results and pitfalls are described for the entire multi-step screening procedure, from lentiviral shRNA delivery to bioinformatics analysis, illustrating a complete model workflow. We demonstrate that successful studies are feasible from the first assay performance and independent of specialized screening units. Furthermore, we show that a resource-saving screen depth of 100-fold average shRNA representation can suffice to generate reproducible target hits despite heterogeneity in the derived datasets. Because statistical analysis methods are debatable for such datasets, we created ProFED, an analysis package designed to facilitate descriptive data analysis and hit calling using an aim-oriented profile filtering approach. In its versatile design, this open-source online tool provides fast and easy analysis of shRNA and other count-based datasets to complement other analytical algorithms.

  13. The chopped firewood trade in Finland

    International Nuclear Information System (INIS)

    Seppaenen, A.; Kaerhae, K.

    2003-01-01

    The TTS Institute studied the operations of chopped firewood merchants and described the cost structure of commercial chopped firewood production. The research material was collected via postal questionnaire in 2002 after being sent to those firewood merchants assumed to be selling chopped firewood. Acceptable responses were received from 244 firewood merchants. In addition, ten firewood merchants were interviewed. In 2001, the firewood merchants sold an average of 151 m 3 of chopped firewood. Half of the firewood merchants sold less than 51 m 3 of chopped firewood. The main source of income for the majority of chopped firewood merchants was agriculture and forestry. If approximately 300,000 m 3 of chopped firewood is sold annually, according to the research there are about 2,000 chopped firewood merchants in Finland. However, only a very few entrepreneurs get their main income from the chopped firewood trade. The majority of raw material for chopped firewood came from the merchant's own forest. Birch was the most commonly used species. 54% of the chopped firewood was made from pulpwood, 19% from pole size trees and 18% from split firewood. The drying methods for chopped firewood were most often natural drying outside in covered stocks or cages, natural drying in stacks or natural drying of mechanically debarked or debarked timber in stacks. Less than a tenth of the merchants dried their chopped, firewood using artificial cold air-drying. The share of packaged chopped firewood was 14% i.e. approximately 42,000 m 3 . Chopped firewood was packed mostly into small packages (about 10 kg). The chopped firewood trade is a local business: the average transport distance from the merchant's store to the customer was 25 km. The chopped firewood merchants delivered 73% of lie chopped firewood themselves. An agricultural tractor and a trailer were the most common transport method. The most important customer group is detached houses. The average production costs amongst the

  14. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kruithof Egbert KO

    2004-08-01

    Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

  15. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)

    2014-05-09

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  16. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Directory of Open Access Journals (Sweden)

    L. Ding

    2014-06-01

    Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  17. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    International Nuclear Information System (INIS)

    Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.

    2014-01-01

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis

  18. Producing chopped firewood with firewood processors

    International Nuclear Information System (INIS)

    Kaerhae, K.; Jouhiaho, A.

    2009-01-01

    The TTS Institute's research and development project studied both the productivity of new, chopped firewood processors (cross-cutting and splitting machines) suitable for professional and independent small-scale production, and the costs of the chopped firewood produced. Seven chopped firewood processors were tested in the research, six of which were sawing processors and one shearing processor. The chopping work was carried out using wood feeding racks and a wood lifter. The work was also carried out without any feeding appliances. Altogether 132.5 solid m 3 of wood were chopped in the time studies. The firewood processor used had the most significant impact on chopping work productivity. In addition to the firewood processor, the stem mid-diameter, the length of the raw material, and of the firewood were also found to affect productivity. The wood feeding systems also affected productivity. If there is a feeding rack and hydraulic grapple loader available for use in chopping firewood, then it is worth using the wood feeding rack. A wood lifter is only worth using with the largest stems (over 20 cm mid-diameter) if a feeding rack cannot be used. When producing chopped firewood from small-diameter wood, i.e. with a mid-diameter less than 10 cm, the costs of chopping work were over 10 EUR solid m -3 with sawing firewood processors. The shearing firewood processor with a guillotine blade achieved a cost level of 5 EUR solid m -3 when the mid-diameter of the chopped stem was 10 cm. In addition to the raw material, the cost-efficient chopping work also requires several hundred annual operating hours with a firewood processor, which is difficult for individual firewood entrepreneurs to achieve. The operating hours of firewood processors can be increased to the required level by the joint use of the processors by a number of firewood entrepreneurs. (author)

  19. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  20. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  1. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  2. Effect of lentivirus-mediated shRNA inactivation of HK1, HK2, and HK3 genes in colorectal cancer and melanoma cells.

    Science.gov (United States)

    Kudryavtseva, Anna V; Fedorova, Maria S; Zhavoronkov, Alex; Moskalev, Alexey A; Zasedatelev, Alexander S; Dmitriev, Alexey A; Sadritdinova, Asiya F; Karpova, Irina Y; Nyushko, Kirill M; Kalinin, Dmitry V; Volchenko, Nadezhda N; Melnikova, Nataliya V; Klimina, Kseniya M; Sidorov, Dmitry V; Popov, Anatoly Y; Nasedkina, Tatiana V; Kaprin, Andrey D; Alekseev, Boris Y; Krasnov, George S; Snezhkina, Anastasiya V

    2016-12-22

    The switch from oxidative phosphorylation to glycolysis in proliferating cancer cells, even under aerobic conditions, has been shown first in 1926 by Otto Warburg. Today this phenomenon is known as the "Warburg effect" and recognized as a hallmark of cancer. The metabolic shift to glycolysis is associated with the alterations in signaling pathways involved in energy metabolism, including glucose uptake and fermentation, and regulation of mitochondrial functions. Hexokinases (HKs), which catalyze the first step of glycolysis, have been identified to play a role in tumorigenesis of human colorectal cancer (CRC) and melanoma. However, the mechanism of action of HKs in the promotion of tumor growth remains unclear. The purpose of the present study was to investigate the effect of silencing of hexokinase genes (HK1, HK2, and HK3) in colorectal cancer (HT-29, SW 480, HCT-15, RKO, and HCT 116) and melanoma (MDA-MB-435S and SK-MEL-28) cell lines using short hairpin RNA (shRNA) lentiviral vectors. shRNA lentiviral plasmid vectors pLSLP-HK1, pLSLP-HK2, and pLSLP-HK3 were constructed and then transfected separately or co-transfected into the cells. HK2 inactivation was associated with increased expression of HK1 in colorectal cancer cell lines pointing to the compensation effect. Simultaneous attenuation of HK1 and HK2 levels led to decreased cell viability. Co-transfection with shRNA vectors against HK1, HK2, and HK3 mRNAs resulted in a rapid cell death via apoptosis. We have demonstrated that simultaneous inactivation of HK1 and HK2 was sufficient to decrease proliferation and viability of melanoma and colorectal cancer cells. Our results suggest that HK1 and HK2 could be the key therapeutic targets for reducing aerobic glycolysis in examined cancers.

  3. Lentiviral vectors in cancer immunotherapy.

    Science.gov (United States)

    Oldham, Robyn Aa; Berinstein, Elliot M; Medin, Jeffrey A

    2015-01-01

    Basic science advances in cancer immunotherapy have resulted in various treatments that have recently shown success in the clinic. Many of these therapies require the insertion of genes into cells to directly kill them or to redirect the host's cells to induce potent immune responses. Other analogous therapies work by modifying effector cells for improved targeting and enhanced killing of tumor cells. Initial studies done using γ-retroviruses were promising, but safety concerns centered on the potential for insertional mutagenesis have highlighted the desire to develop other options for gene delivery. Lentiviral vectors (LVs) have been identified as potentially more effective and safer alternative delivery vehicles. LVs are now in use in clinical trials for many different types of inherited and acquired disorders, including cancer. This review will discuss current knowledge of LVs and the applications of this viral vector-based delivery vehicle to cancer immunotherapy.

  4. Lentiviral Delivery of Proteins for Genome Engineering.

    Science.gov (United States)

    Cai, Yujia; Mikkelsen, Jacob Giehm

    2016-01-01

    Viruses have evolved to traverse cellular barriers and travel to the nucleus by mechanisms that involve active transport through the cytoplasm and viral quirks to resist cellular restriction factors and innate immune responses. Virus-derived vector systems exploit the capacity of viruses to ferry genetic information into cells, and now - more than three decades after the discovery of HIV - lentiviral vectors based on HIV-1 have become instrumental in biomedical research and gene therapies that require genomic insertion of transgenes. By now, the efficacy of lentiviral gene delivery to stem cells, cells of the immune system including T cells, hepatic cells, and many other therapeutically relevant cell types is well established. Along with nucleic acids, HIV-1 virions carry the enzymatic tools that are essential for early steps of infection. Such capacity to package enzymes, even proteins of nonviral origin, has unveiled new ways of exploiting cellular intrusion of HIV-1. Based on early findings demonstrating the packaging of heterologous proteins into virus particles as part of the Gag and GagPol polypeptides, we have established lentiviral protein transduction for delivery of DNA transposases and designer nucleases. This strategy for delivering genome-engineering proteins facilitates high enzymatic activity within a short time frame and may potentially improve the safety of genome editing. Exploiting the full potential of lentiviral vectors, incorporation of foreign protein can be combined with the delivery of DNA transposons or a donor sequence for homology-directed repair in so-called 'all-in-one' lentiviral vectors. Here, we briefly describe intracellular restrictions that may affect lentiviral gene and protein delivery and review the current status of lentiviral particles as carriers of tool kits for genome engineering.

  5. A minimally invasive, lentiviral based method for the rapid and sustained genetic manipulation of renal tubules.

    Science.gov (United States)

    Espana-Agusti, Judit; Tuveson, David A; Adams, David J; Matakidou, Athena

    2015-06-05

    The accelerated discovery of disease-related genes emerging from genomic studies has strained the capacity of traditional genetically engineered mouse models (GEMMs) to provide in-vivo validation. Direct, somatic, genetic engineering approaches allow for accelerated and flexible genetic manipulation and represent an attractive alternative to GEMMs. In this study we investigated the feasibility, safety and efficiency of a minimally invasive, lentiviral based approach for the sustained in-vivo modification of renal tubular epithelial cells. Using ultrasound guidance, reporter vectors were directly injected into the mouse renal parenchyma. We observed transgene expression confined to the renal cortex (specifically proximal and distal tubules) and sustained beyond 2 months post injection. Furthermore, we demonstrate the ability of this methodology to induce long-term, in-vivo knockdown of candidate genes either through somatic recombination of floxed alleles or by direct delivery of specific shRNA sequences. This study demonstrates that ultrasound-guided injection of lentiviral vectors provides a safe and efficient method for the genetic manipulation of renal tubules, representing a quick and versatile alternative to GEMMs for the functional characterisation of disease-related genes.

  6. A Biomechanical Analysis of the Karate Chop.

    Science.gov (United States)

    Cavanagh, Peter R.; Landa, Jean

    Although the sport of karate has been somewhat neglected by scientists, the following two isolated biomechanical studies exist in literature: (1) tracings of a karate chop in two planes were presented, but no data was given concerning the rates of movement of the limb segments, and (2) pre- and postimpact phenomena of five subjects were studied,…

  7. A facile lentiviral vector system for expression of doxycycline-inducible shRNAs: knockdown of the pre-miRNA processing enzyme Drosha

    DEFF Research Database (Denmark)

    Aagaard, Lars; Amarzguioui, Mohammed; Sun, Guihua

    2007-01-01

    RNA interference (RNAi) is a powerful genetic tool for loss-of-function studies in mammalian cells and is also considered a potentially powerful therapeutic modality for the treatment of a variety of human diseases. During the past 3 years a number of systems for conditional RNAi have been...... developed that allow controlled expression of short hairpin RNA (shRNA) triggers of RNAi. The simplest strategy relies on tet-operable polymerase III–promoted shRNAs and co-expression of the tetracycline regulatory protein, TetR. In this study we have combined these features into a single lentiviral vector...

  8. Lentiviral Vector Gene Transfer to Porcine Airways

    Directory of Open Access Journals (Sweden)

    Patrick L Sinn

    2012-01-01

    Full Text Available In this study, we investigated lentiviral vector development and transduction efficiencies in well-differentiated primary cultures of pig airway epithelia (PAE and wild-type pigs in vivo. We noted gene transfer efficiencies similar to that observed for human airway epithelia (HAE. Interestingly, feline immunodeficiency virus (FIV-based vectors transduced immortalized pig cells as well as pig primary cells more efficiently than HIV-1–based vectors. PAE express TRIM5α, a well-characterized species-specific lentiviral restriction factor. We contrasted the restrictive properties of porcine TRIM5α against FIV- and HIV-based vectors using gain and loss of function approaches. We observed no effect on HIV-1 or FIV conferred transgene expression in response to porcine TRIM5α overexpression or knockdown. To evaluate the ability of GP64-FIV to transduce porcine airways in vivo, we delivered vector expressing mCherry to the tracheal lobe of the lung and the ethmoid sinus of 4-week-old pigs. One week later, epithelial cells expressing mCherry were readily detected. Our findings indicate that pseudotyped FIV vectors confer similar tropisms in porcine epithelia as observed in human HAE and provide further support for the selection of GP64 as an appropriate envelope pseudotype for future preclinical gene therapy studies in the porcine model of cystic fibrosis (CF.

  9. The management and development of the chopped firewood production process

    International Nuclear Information System (INIS)

    Jouhiaho, A.; Kouki, J.; Kara, K.; Mutikainen, A.; Oksanen, E.; Seppaenen, A.; Vuorio, K.

    2005-01-01

    The main aim of the project was to improve competitiveness of chopped firewood by producing information that can help to reduce production and distribution costs as well as increase the quality of chopped firewood produced. The aim was to attain the goal through four subprojects: 1. Productivity, Costs and Development Targets of New Firewood Machines, 2. The Artificial Drying and Storage Management of Chopped Firewood, 3. New Logistics Solutions for the Chopped Firewood Production Process, and 4. The Current Situation of the Firewood Trade in Europe. The research project covered an analysis of the productivity of new firewood machines, and the costs and quality of produced chopped firewood. Suggestions were made to firewood machine manufacturers for developing firewood machines. Also, the cost-effectiveness of current chopped firewood production and distribution chains was studied. Field tests were carried out on different types of cold and warm air dryers being used by chopped firewood entrepreneurs. In addition, the suitability of resistance based electronic wood moisture meter for measuring the moisture content of single chopped firewood pieces was also studied. Furthermore, a survey was carried out on the volume of firewood sales and the firewood production equipment available for sale in Europe, and European firewood merchants' methods of operation was studied. (orig.)

  10. shRNA suppression of thymidylate synthase produces DNA mismatches and results in excellent radiosensitization

    Science.gov (United States)

    Flanagan, Sheryl A.; Cooper, Kristin S.; Mannava, Sudha; Nikiforov, Mikhail A.; Shewach, Donna S.

    2012-01-01

    Purpose To determine the effect of shRNA-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials shRNA suppression of TS was compared to FdUrd inactivation of TS ± ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured via clonogenic assay. Cell cycle effects were measured by flow cytometry. Effects of FdUrd or shRNA suppression of TS on dNTP imbalances and consequent nucleotide mis-incorporations into DNA were analyzed by HPLC and as pSP189 plasmid mutations, respectively. Results TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells while FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs compared to FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, though its effects were not as long-lasting as FdUrd. Both treatments resulted in phosphorylation of chk1. TS shRNA alone was less cytotoxic than FdUrd, but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio (RER): TS shRNA, 1.5 – 1.7; FdUrd, 1.4 – 1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions TS shRNA produced less cytotoxicity than FdUrd, but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches following TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA suppression of TS avoids FP-mediated TS elevation and its negative prognostic role. These studies support further exploration of TS suppression as a novel

  11. The management and development of the chopped firewood production process

    International Nuclear Information System (INIS)

    Kaehrae, K.

    2002-01-01

    The main aim of the research project is to improve competitiveness by reducing the production and distribution costs of chopped firewood and raising the quality of chopped firewood, and also to increase the use of bioenergy to the target level of the Renewable Energy Sources promotion programme. The aim is to attain the goal through four subprojects: 1. The Productivity, Costs and Development Targets of New Firewood Machines, 2. The Artificial Drying and Storage Management of Chopped Firewood, 3. New Logistic Solutions for the Chopped Firewood Production Process, and 4. The Current Situation of the Firewood Trade in Europe. The research project will cover the development of an automatic wood feeder for firewood sawing machines, an analysis of the productivity of new firewood machines and the costs and quality of produced chopped firewood. Suggestions will be made to firewood machine manufacturers for developing firewood machines, the drying process will be modelled for artificial drying, and the functionality of a theoretical drying programme will be tested under field conditions. Also, instructions will be prepared for building a chopped firewood drier, the cost-effectiveness of current chopped firewood distribution chains will be studied, and it will try to find cost saving methods in distribution chains through different kinds of logistic solutions. Furthermore, a survey will be carried out on the volume of firewood sales and the firewood production equipment available for sale in Europe, and the European firewood merchants' methods of operation will be studied. (orig.)

  12. Envelope determinants of equine lentiviral vaccine protection.

    Directory of Open Access Journals (Sweden)

    Jodi K Craigo

    Full Text Available Lentiviral envelope (Env antigenic variation and associated immune evasion present major obstacles to vaccine development. The concept that Env is a critical determinant for vaccine efficacy is well accepted, however defined correlates of protection associated with Env variation have yet to be determined. We reported an attenuated equine infectious anemia virus (EIAV vaccine study that directly examined the effect of lentiviral Env sequence variation on vaccine efficacy. The study identified a significant, inverse, linear correlation between vaccine efficacy and increasing divergence of the challenge virus Env gp90 protein compared to the vaccine virus gp90. The report demonstrated approximately 100% protection of immunized ponies from disease after challenge by virus with a homologous gp90 (EV0, and roughly 40% protection against challenge by virus (EV13 with a gp90 13% divergent from the vaccine strain. In the current study we examine whether the protection observed when challenging with the EV0 strain could be conferred to animals via chimeric challenge viruses between the EV0 and EV13 strains, allowing for mapping of protection to specific Env sequences. Viruses containing the EV13 proviral backbone and selected domains of the EV0 gp90 were constructed and in vitro and in vivo infectivity examined. Vaccine efficacy studies indicated that homology between the vaccine strain gp90 and the N-terminus of the challenge strain gp90 was capable of inducing immunity that resulted in significantly lower levels of post-challenge virus and significantly delayed the onset of disease. However, a homologous N-terminal region alone inserted in the EV13 backbone could not impart the 100% protection observed with the EV0 strain. Data presented here denote the complicated and potentially contradictory relationship between in vitro virulence and in vivo pathogenicity. The study highlights the importance of structural conformation for immunogens and emphasizes

  13. Envelope Determinants of Equine Lentiviral Vaccine Protection

    Science.gov (United States)

    Craigo, Jodi K.; Ezzelarab, Corin; Cook, Sheila J.; Chong, Liu; Horohov, David; Issel, Charles J.; Montelaro, Ronald C.

    2013-01-01

    Lentiviral envelope (Env) antigenic variation and associated immune evasion present major obstacles to vaccine development. The concept that Env is a critical determinant for vaccine efficacy is well accepted, however defined correlates of protection associated with Env variation have yet to be determined. We reported an attenuated equine infectious anemia virus (EIAV) vaccine study that directly examined the effect of lentiviral Env sequence variation on vaccine efficacy. The study identified a significant, inverse, linear correlation between vaccine efficacy and increasing divergence of the challenge virus Env gp90 protein compared to the vaccine virus gp90. The report demonstrated approximately 100% protection of immunized ponies from disease after challenge by virus with a homologous gp90 (EV0), and roughly 40% protection against challenge by virus (EV13) with a gp90 13% divergent from the vaccine strain. In the current study we examine whether the protection observed when challenging with the EV0 strain could be conferred to animals via chimeric challenge viruses between the EV0 and EV13 strains, allowing for mapping of protection to specific Env sequences. Viruses containing the EV13 proviral backbone and selected domains of the EV0 gp90 were constructed and in vitro and in vivo infectivity examined. Vaccine efficacy studies indicated that homology between the vaccine strain gp90 and the N-terminus of the challenge strain gp90 was capable of inducing immunity that resulted in significantly lower levels of post-challenge virus and significantly delayed the onset of disease. However, a homologous N-terminal region alone inserted in the EV13 backbone could not impart the 100% protection observed with the EV0 strain. Data presented here denote the complicated and potentially contradictory relationship between in vitro virulence and in vivo pathogenicity. The study highlights the importance of structural conformation for immunogens and emphasizes the need for

  14. MedlinePlus: Baked Pork Chops With Apple Cranberry Sauce

    Science.gov (United States)

    ... gov/recipe/bakedporkchopswithapplecranberrysauce.html Baked Pork Chops With Apple Cranberry Sauce To use the sharing features on ... 4 cup low-sodium chicken broth 1 medium apple, peeled and grated (about 1 cup) (use a ...

  15. Design and cloning strategies for constructing shRNA expression vectors

    Directory of Open Access Journals (Sweden)

    McIntyre Glen J

    2006-01-01

    Full Text Available Abstract Background Short hairpin RNA (shRNA encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies, a PCR approach using hairpin containing primers (22 % and primer extension of hairpin templates (4 %. Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process.

  16. Cyclophilin A interacts with diverse lentiviral capsids

    Directory of Open Access Journals (Sweden)

    Emerman Michael

    2006-10-01

    Full Text Available Abstract Background The capsid (CA protein of HIV-1 binds with high affinity to the host protein cyclophilin A (CypA. This binding positively affects some early stage of the viral life-cycle because prevention of binding either by drugs that occupy that active site of cyclophilin A, by mutation in HIV-1 CA, or RNAi that knocks down intracellular CypA level diminishes viral infectivity. The closely related lentivirus, SIVcpz also binds CypA, but it was thought that this interaction was limited to the HIV-1/SIVcpz lineage because other retroviruses failed to interact with CypA in a yeast two-hybrid assay. Results We find that diverse lentiviruses, FIV and SIVagmTAN also bind to CypA. Mutagenesis of FIV CA showed that an amino acid that is in a homologous position to the proline at amino acid 90 of HIV-1 CA is essential for FIV interactions with CypA. Conclusion These results demonstrate that CypA binding to lentiviruses is more widespread than previously thought and suggest that this interaction is evolutionarily important for lentiviral infection.

  17. shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

    Science.gov (United States)

    Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

    2016-12-01

    RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

  18. High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing.

    Science.gov (United States)

    Sims, David; Mendes-Pereira, Ana M; Frankum, Jessica; Burgess, Darren; Cerone, Maria-Antonietta; Lombardelli, Cristina; Mitsopoulos, Costas; Hakas, Jarle; Murugaesu, Nirupa; Isacke, Clare M; Fenwick, Kerry; Assiotis, Ioannis; Kozarewa, Iwanka; Zvelebil, Marketa; Ashworth, Alan; Lord, Christopher J

    2011-10-21

    RNA interference (RNAi) screening is a state-of-the-art technology that enables the dissection of biological processes and disease-related phenotypes. The commercial availability of genome-wide, short hairpin RNA (shRNA) libraries has fueled interest in this area but the generation and analysis of these complex data remain a challenge. Here, we describe complete experimental protocols and novel open source computational methodologies, shALIGN and shRNAseq, that allow RNAi screens to be rapidly deconvoluted using next generation sequencing. Our computational pipeline offers efficient screen analysis and the flexibility and scalability to quickly incorporate future developments in shRNA library technology.

  19. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    In this study, shRNA vectors having different stem length were constructed and their silencing effect was tested in mouse embryonic fibroblast and in vivo. Interfering RNAs were designed with stems of 21, 27, and 29 bp. The enhanced green fluorescent protein gene was used as target gene. The synthesized single strands ...

  20. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... and are presumably processed similar to the microRNA maturation pathways. The basic structure of an ordinary. shRNA consists of paired antisense and sense strands connected by a loop of unpaired nucleotides. A duplex stem of 19 to 29 bp, either fully paired or with miRNA- style internal mismatches, is ...

  1. The Power Decoder Simulator for the Evaluation of Pooled shRNA Screen Performance.

    Science.gov (United States)

    Stombaugh, Jesse; Licon, Abel; Strezoska, Žaklina; Stahl, Joshua; Anderson, Sarah Bael; Banos, Michael; van Brabant Smith, Anja; Birmingham, Amanda; Vermeulen, Annaleen

    2015-09-01

    RNA interference screening using pooled, short hairpin RNA (shRNA) is a powerful, high-throughput tool for determining the biological relevance of genes for a phenotype. Assessing an shRNA pooled screen's performance is difficult in practice; one can estimate the performance only by using reproducibility as a proxy for power or by employing a large number of validated positive and negative controls. Here, we develop an open-source software tool, the Power Decoder simulator, for generating shRNA pooled screening experiments in silico that can be used to estimate a screen's statistical power. Using the negative binomial distribution, it models both the relative abundance of multiple shRNAs within a single screening replicate and the biological noise between replicates for each individual shRNA. We demonstrate that this simulator can successfully model the data from an actual laboratory experiment. We then use it to evaluate the effects of biological replicates and sequencing counts on the performance of a pooled screen, without the necessity of gathering additional data. The Power Decoder simulator is written in R and Python and is available for download under the GNU General Public License v3.0. © 2015 Society for Laboratory Automation and Screening.

  2. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision

    Directory of Open Access Journals (Sweden)

    Hubert Denise

    2014-01-01

    Full Text Available TT-034 (PF-05095808 is a recombinant adeno-associated virus serotype 8 (AAV8 agent expressing three short hairpin RNA (shRNA pro-drugs that target the hepatitis C virus (HCV RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA drugs. Using next-generation sequencing (NGS to identify and characterize active shRNAs maturation products, we observed that each TT-034–encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5′ RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi enzymes Dicer and siRNA-induced silencing complex (siRISC.

  3. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  4. Optimal construction and delivery of dual-functioning lentiviral vectors for type I collagen-suppressed chondrogenesis in synovium-derived mesenchymal stem cells.

    Science.gov (United States)

    Zhang, Feng; Yao, Yongchang; Zhou, Ruijie; Su, Kai; Citra, Fudiman; Wang, Dong-An

    2011-06-01

    This study aims to deliver both transforming growth factor β3 (TGF-β3) and shRNA targeting type I collagen (Col I) by optimal construction and application of various dual-functioning lentiviral vectors to induce Col I-suppressed chondrogenesis in synovium-derived mesenchymal stem cells (SMSCs). We constructed four lentiviral vectors (LV-1, LV-2, LV-3 and LV-4) with various arrangements of the two expression cassettes in different positions and orientations. Col I inhibition efficiency and chondrogenic markers were assessed with qPCR, ELISA and staining techniques. Among the four vectors, LV-1 has two distant and reversely oriented cassettes, LV-2 has two distant and same-oriented cassettes, LV-3 has two proximal and reversely oriented cassettes, and LV-4 has two proximal and same-oriented cassettes. Col I and chondrogenic markers, including type II collagen (Col II), aggrecan and glycosaminoglycan (GAG), were examined in SMSCs cultured in 3-D alginate hydrogel. All of the four vectors showed distinct effects in Col I level as well as diverse inductive efficiencies in upregulation of the cartilaginous markers. Based on real-time PCR results, LV-1 was optimal towards Col I-suppressed chondrogenesis. LV-1 vector is competent to promote Col I-suppressed chondrogenesis in SMSCs.

  5. Combination of grafted Schwann cells and lentiviral-mediated prevention of glial scar formation improve recovery of spinal cord injured rats.

    Science.gov (United States)

    Do-Thi, Anh; Perrin, Florence E; Desclaux, Mathieu; Saillour, Paulette; Amar, Lahouari; Privat, Alain; Mallet, Jacques

    2016-10-01

    The present study was intended to combine three therapeutic approaches in a well-defined rat model of spinal cord injury, a lateral hemisection at thoracic level. A guidance channel was implanted at the lesion site. This channel was seeded with native Schwann cells or Schwann cells that had been previously transduced with a lentiviral vector carrying the GDNF gene. Thereafter, these experiences were reproduced in animals injected with lentiviral vectors carrying a shRNA for GFAP (Lv-shGFAP), which has recently been shown to block glial scar formation. Functional evaluations showed that Lv-shGFAP induced a significant improvement in recovery in animals grafted with Schwann cells. Histological studies demonstrated the outgrowth of axons in the guidance channel containing Schwann cells transduced or not with GDNF. This axonal growth was enhanced in rats receiving Lv-shGFAP vector. Also, a significant increase of serotonergic innervation of the injured hemicord, distal to the lesion, was found only in animals treated with Lv-shGFAP vectors. Importantly, this study confirms that glial scar formation is a major impediment for axonal sprouting after spinal cord injury, and emphasizes the importance of serotonergic innervation for locomotor function. Moreover we show a significant additive effect of a combinatorial approach to axonal regeneration in the injured spinal cord. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Effects of lentiviral RNA interference-mediated downregulation of integrin-linked kinase on biological behaviors of human lens epithelial cells

    Directory of Open Access Journals (Sweden)

    Yu-Ping Zheng

    2016-01-01

    Full Text Available AIM: To investigate the effects of lentivirus (LV mediated integrin-linked kinase (ILK RNA interference (RNAi on biological behaviors of human lens epithelial cells (LECs. METHODS: Human cataract LECs and immortalized human LEC line, human lens epithelial (HLE B-3 cells were transfected by lentiviral vector expressing ILK-specific short hairpin RNA (shRNA and then stimulated by transforming growth factor- (TGF-, the silencing of ILK gene and protein was identified by reverse transcription-polymerase chain reaction (RT-PCR and Western blot methods; biological behaviors including cell cycle and apoptosis, cell morphology, -smooth muscle actin (SMA stress fiber formation and cell migration were examined. RESULTS: Remarkable decreases of ILK protein expression were detected in LECs carrying lentiviral ILK-shRNA vector; flow cytometry revealed arresting of cell cycle progression through the G1/S transition and higher apoptosis rate in ILK-RNAi-LV transfected cells. Less -SMA stress fiber formation and migration was observed in ILK-RNAi-LV transfected LECs. CONCLUSION: The present study demonstrated that ILK was an important regulator for LECs proliferation and migration. LV mediated ILK RNAi is an effective way to decrease ILK-regulated cell growth by arresting cell cycle progression and increasing cell apoptosis, as well as, to prevent cell migration by inhibiting TGF- induced -SMA stress fiber formation. Thus, LV mediated ILK RNAi might be useful to prevent posterior capsular opacification.

  7. Gene Therapy for Neuropathic Pain by Silencing of TNF-α Expression with Lentiviral Vectors Targeting the Dorsal Root Ganglion in Mice

    Science.gov (United States)

    Ogawa, Nobuhiro; Kawai, Hiromichi; Terashima, Tomoya; Kojima, Hideto; Oka, Kazuhiro; Chan, Lawrence; Maegawa, Hiroshi

    2014-01-01

    Neuropathic pain can be a debilitating condition. Many types of drugs that have been used to treat neuropathic pain have only limited efficacy. Recent studies indicate that pro-inflammatory mediators including tumor necrosis factor α (TNF-α) are involved in the pathogenesis of neuropathic pain. In the present study, we engineered a gene therapy strategy to relieve neuropathic pain by silencing TNF-α expression in the dorsal root ganglion (DRG) using lentiviral vectors expressing TNF short hairpin RNA1-4 (LV-TNF-shRNA1-4) in mice. First, based on its efficacy in silencing TNF-α in vitro, we selected shRNA3 to construct LV-TNF-shRNA3 for in vivo study. We used L5 spinal nerve transection (SNT) mice as a neuropathic pain model. These animals were found to display up-regulated mRNA expression of activating transcription factor 3 (ATF3) and neuropeptide Y (NPY), injury markers, and interleukin (IL)-6, an inflammatory cytokine in the ipsilateral L5 DRG. Injection of LV-TNF-shRNA3 onto the proximal transected site suppressed significantly the mRNA levels of ATF3, NPY and IL-6, reduced mechanical allodynia and neuronal cell death of DRG neurons. These results suggest that lentiviral-mediated silencing of TNF-α in DRG relieves neuropathic pain and reduces neuronal cell death, and may constitute a novel therapeutic option for neuropathic pain. PMID:24642694

  8. CCR5 gene disruption via lentiviral vectors expressing Cas9 and single guided RNA renders cells resistant to HIV-1 infection.

    Science.gov (United States)

    Wang, Weiming; Ye, Chaobaihui; Liu, Jingjing; Zhang, Di; Kimata, Jason T; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1.

  9. Control of Constipation in Patients Receiving CHOP or CHOP-Like Chemotherapy Regimens for Non-Hodgkin's Lymphoma.

    Science.gov (United States)

    Hayashi, Hiroko; Suzuki, Akio; Ohata, Koichi; Ishihara, Masashi; Kubota, Yushi; Kobayashi, Ryo; Shibata, Yuhei; Nakamura, Hiroshi; Nakamura, Nobuhiko; Kitagawa, Junichi; Tsurumi, Hisashi; Shimizu, Masahito; Itoh, Yoshinori

    2017-01-01

    Management of constipation in patients receiving cyclophosphamide, doxorubicin, vincristine and prednisolone (CHOP) or CHOP-like chemotherapy regimens is important for prevention of paralytic ileus. We reported earlier that the laxative action of magnesium oxide is reversed by the concomitant use of antacids in cancer patients receiving opioid analgesics. Here, we assessed the prevalence of prophylactic laxative medication for the control of constipation in patients receiving CHOP or CHOP-like regimens for non-Hodgkin's lymphoma. Data obtained from 211 eligible patients were retrospectively analyzed. Almost all patients (99%) received anti-ulcer agents such as proton pump inhibitors and H 2 receptor antagonists for the prophylaxis of gastric disorders associated with prednisolone. Prophylactic laxatives were prescribed in 86 patients (40.8%), in which magnesium oxide was used most predominantly (88.4%). However, magnesium oxide at doses of ≦2000 mg/d was not effective for prevention of constipation, although the compound totally inhibited the incidence of constipation at doses higher than 2000 mg/d. Therefore, it is important to avoid negative drug interaction between magnesium oxide and antacids in patients receiving CHOP chemotherapy.

  10. The effect of long or chopped straw on pig behaviour.

    Science.gov (United States)

    Lahrmann, H P; Oxholm, L C; Steinmetz, H; Nielsen, M B F; D'Eath, R B

    2015-05-01

    In the EU, pigs must have permanent access to manipulable materials such as straw, rope, wood, etc. Long straw can fulfil this function, but can increase labour requirements for cleaning pens, and result in problems with blocked slatted floors and slurry systems. Chopped straw might be more practical, but what is the effect on pigs' behaviour of using chopped straw instead of long straw? Commercial pigs in 1/3 slatted, 2/3 solid pens of 15 pigs were provided with either 100 g/pig per day of long straw (20 pens) or of chopped straw (19 pens). Behavioural observations were made of three focal pigs per pen (one from each of small, medium and large weight tertiles) for one full day between 0600 and 2300 h at each of ~40 and ~80 kg. The time spent rooting/investigating overall (709 s/pig per hour at 40 kg to 533 s/pig per hour at 80 kg), or directed to the straw/solid floor (497 s/pig per hour at 40 kg to 343 s/pig per hour at 80 kg), was not affected by straw length but reduced with age. Time spent investigating other pigs (83 s/pig per hour at 40 kg), the slatted floor (57 s/pig per hour) or pen fixtures (21 s/pig per hour) was not affected by age or straw length. Aggressive behaviour was infrequent, but lasted about twice as long in pens with chopped straw (2.3 s/pig per hour at 40 kg) compared with pens with long straw (1.0 s/pig per hour at 40 kg, P=0.060). There were no significant effects of straw length on tail or ear lesions, but shoulders were significantly more likely to have minor scratches with chopped straw (P=0.031), which may reflect the higher levels of aggression. Smaller pigs showed more rooting/investigatory behaviour, and in particular directed towards the straw/solid floor and the slatted floor than their larger pen-mates. Females exhibited more straw and pen fixture-directed behaviour than males. There were no effects of pig size or sex on behaviour directed towards other pigs. In summary, pigs spent similar amounts of time interacting with straw

  11. [Comparative analysis of liver function in HBsAg-/HBcAb+ patients with diffuse large B-cell lymphoma treated with CHOP and R-CHOP regimens].

    Science.gov (United States)

    Huang, Yan-hua; He, Xiao-hui; Qin, Yan; Yang, Sheng; Lü, Zheng; Dong, Mei; Zhou, Sheng-yu; Liu, Peng; Zhang, Chang-gong; Yang, Jian-liang; Shi, Yuan-kai

    2012-05-01

    To analyze the liver function in patients with diffuse large B-cell lymphoma(DLBCL), who are hepatitis B surface antigen negative/antibody to hepatitis B core antigen positive (HBsAg-/HBcAb+), treated with CHOP and R-CHOP regimens. In this retrospective study, 86 DLBCL patients, who were HBsAg-/HBcAb+, were collected from Cancer Hospital of Chinese Academy of Medical Sciences between January 2005 and December 2008. The patients were given at least two cycles of chemotherapy using CHOP-like or R-CHOP-like regimen without anti-HBV treatment, and followed-up for at least 12 months after completion of therapy. Forty-seven patients received CHOP-like regimen while 39 patients received R-CHOP-like regimen. There were no significant differences in the degree of liver dysfunction between CHOP group and R-CHOP group after the 1st, 2nd, 3rd, 4th and 6th cycles (22.7% - 46.7% with CHOP and 17.6% - 34.2% with R-CHOP, respectively, (all P > 0.05), except for the 5th cycles (28.6% vs. 6.2%, P = 0.026). Liver function in most patients in CHOP group and R-CHOP group was normal after every cycle (53.3% - 77.3% and 65.8%-93.8%, respectively). Meanwhile, there were no significant differences in the degree of liver dysfunction between CHOP group and R-CHOP group in the 1st-3rd month, 4th-6th month, 7th-9th month and 10th-12th month after completion of therapy (7.7% - 40.0% with CHOP and 7.4% - 32.0% with R-CHOP, respectively, all P > 0.05). The present study reveals a low incidence of liver dysfunction in HBsAg-/HBcAb+ DLBCL patients, both in CHOP group and in R-CHOP group. It may indicate a potential low incidence of HBV reactivation in these groups, and Rituximab do not increase the rate of liver dysfunction. Therefore, these data may not support regularly prophylactic antiviral therapy during chemotherapy, but close monitoring of liver function, HBV serum markers and HBV DNA level are demanded.

  12. Inhibition of HIV-1 lentiviral particles infectivity by Gynostemma ...

    African Journals Online (AJOL)

    Yomi

    2012-01-24

    Jan 24, 2012 ... simian immunodeficiency virus: implications for the safety of lentiviral vectors. Hum. Genet. Ther. 11: 2403-2413. Williams JE (2001). Review of antiviral and immuno modulating properties of plants of the Peruvian rainforest with a particular emphasis on Una de Gato and Sangre de Grado. Altern. Med. Rev.

  13. Lentiviral vectors for treating and modeling human CNS disorders.

    Science.gov (United States)

    Azzouz, Mimoun; Kingsman, Susan M; Mazarakis, Nicholas D

    2004-09-01

    Vectors based on lentiviruses efficiently deliver genes into many different types of primary neurons from a broad range of species including man and the resulting gene expression is long term. These vectors are opening up new approaches for the treatment of neurological diseases such as Parkinson's disease (PD), Huntington's disease (HD), and motor neuron diseases (MNDs). Numerous animal studies have now been undertaken with these vectors and correction of disease models has been obtained. Lentiviral vectors also provide a new strategy for in vivo modeling of human diseases; for example, the lentiviral-mediated overexpression of mutated human alpha-synuclein or huntingtin genes in basal ganglia induces neuronal pathology in animals resembling PD and HD in man. These vectors have been refined to a very high level and can be produced safely for the clinic. This review will describe the general features of lentiviral vectors with particular emphasis on vectors derived from the non-primate lentivirus, equine infectious anemia virus (EIAV). It will then describe some key examples of genetic correction and generation of genetic animal models of neurological diseases. The prospects for clinical application of lentiviral vectors for the treatment of PD and MNDs will also be outlined. Copyright 2004 John Wiley & Sons, Ltd.

  14. The feasibility of incorporating Vpx into lentiviral gene therapy vectors

    Directory of Open Access Journals (Sweden)

    Samantha A McAllery

    2016-01-01

    Full Text Available While current antiretroviral therapy has significantly improved, challenges still remain in life-long targeting of HIV-1 reservoirs. Lentiviral gene therapy has the potential to deliver protective genes into the HIV-1 reservoir. However, inefficient reverse transcription (RT occurs in HIV-1 reservoirs during lentiviral gene delivery. The viral protein Vpx is capable of increasing lentiviral RT by antagonizing the restriction factor SAMHD1. Incorporating Vpx into lentiviral vectors could substantially increase gene delivery into the HIV-1 reservoir. The feasibility of this Vpx approach was tested in resting cell models utilizing macrophages and dendritic cells. Our results showed Vpx exposure led to increased permissiveness of cells over a period that exceeded 2 weeks. Consequently, significant lower potency of HIV-1 antiretrovirals inhibiting RT and integration was observed. When Vpx was incorporated with anti-HIV-1 genes inhibiting either pre-RT or post-RT stages of the viral life-cycle, transduction levels significantly increased. However, a stronger antiviral effect was only observed with constructs that inhibit pre-RT stages of the viral life cycle. In conclusion this study demonstrates a way to overcome the major delivery obstacle of gene delivery into HIV-1 reservoir cell types. Importantly, incorporating Vpx with pre-RT anti-HIV-1 genes, demonstrated the greatest protection against HIV-1 infection.

  15. Inhibition of HIV-1 lentiviral particles infectivity by Gynostemma ...

    African Journals Online (AJOL)

    These claims motivated the study in which the inhibition of viral vector infectivity of HeLa cells was assessed flow cytometrically by measuring the expression of green fluorescent protein (GFP) transgene incorporated in the lentiviral vector construct. An infectious VSV-G-pseudotyped, human immunodeficiency virus type ...

  16. Design and Potential of Non-Integrating Lentiviral Vectors

    Directory of Open Access Journals (Sweden)

    Aaron Shaw

    2014-01-01

    Full Text Available Lentiviral vectors have demonstrated promising results in clinical trials that target cells of the hematopoietic system. For these applications, they are the vectors of choice since they provide stable integration into cells that will undergo extensive expansion in vivo. Unfortunately, integration can have unintended consequences including dysregulated cell growth. Therefore, lentiviral vectors that do not integrate are predicted to have a safer profile compared to integrating vectors and should be considered for applications where transient expression is required or for sustained episomal expression such as in quiescent cells. In this review, the system for generating lentiviral vectors will be described and used to illustrate how alterations in the viral integrase or vector Long Terminal Repeats have been used to generate vectors that lack the ability to integrate. In addition to their safety advantages, these non-integrating lentiviral vectors can be used when persistent expression would have adverse consequences. Vectors are currently in development for use in vaccinations, cancer therapy, site-directed gene insertions, gene disruption strategies, and cell reprogramming. Preclinical work will be described that illustrates the potential of this unique vector system in human gene therapy.

  17. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Development of Oscillating Classifiers for Forage Chop Length ...

    African Journals Online (AJOL)

    The only reliable method being tedious hand measurement of every particle in a sample of chopped material. Three oscillating particle length classifiers have been developed. Each of them differed from one another in their stroke patterns. The three different drive-mechanisms produce three screen motions: Linear motion, ...

  19. CHOP compared with CHOP plus granulocyte colony-stimulating factor in elderly patients with aggressive non-Hodgkin's lymphoma

    NARCIS (Netherlands)

    Doorduijn, JK; van der Holt, B; van Imhoff, GW; van der Hem, KG; Kramer, MHH; van Oers, MHJ; Ossenkoppele, GJ; Verdonck, LF; Verhoef, GEG; Steijaert, MMC; Buijt, I.; Uyl-de Groot, CA; van Agthoven, M; Mulder, AH; Sonneveld, P; Schaafsma, M.

    2003-01-01

    Purpose : To investigate whether the relative close-intensity of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy could be improved by prophylactic administration of granulocyte colony-stimulating factor (G-CSF) in elderly patients with aggressive non-Hodgkin's lymphoma

  20. CHOP compared with CHOP plus granulocyte colony-stimulating factor in elderly patients with aggressive non-Hodgkin's lymphoma

    NARCIS (Netherlands)

    Doorduijn, J. K.; van der Holt, B.; van Imhoff, G. W.; van der Hem, K. G.; Kramer, M. H. H.; van Oers, M. H. J.; Ossenkoppele, G. J.; Schaafsma, M. R.; Verdonck, L. F.; Verhoef, G. E. G.; Steijaert, M. M. C.; Buijt, I.; Uyl-de Groot, C. A.; van Agthoven, M.; Mulder, A. H.; Sonneveld, P.

    2003-01-01

    PURPOSE: To investigate whether the relative dose-intensity of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy could be improved by prophylactic administration of granulocyte colony-stimulating factor (G-CSF) in elderly patients with aggressive non-Hodgkin's lymphoma

  1. A novel type of EWS-CHOP fusion gene in myxoid liposarcoma

    International Nuclear Information System (INIS)

    Matsui, Yoshito; Ueda, Takafumi; Kubo, Takahiro; Hasegawa, Tadashi; Tomita, Yasuhiko; Okamoto, Mina; Myoui, Akira; Kakunaga, Shigeki; Yasui, Natsuo; Yoshikawa, Hideki

    2006-01-01

    The cytogenetic hallmark of myxoid type and round cell type liposarcoma consists of reciprocal translocation of t(12;16)(q13;p11) and t(12;22)(q13;q12), which results in fusion of TLS/FUS and CHOP, and EWS and CHOP, respectively. Nine structural variations of the TLS/FUS-CHOP chimeric transcript have been reported, however, only two types of EWS-CHOP have been described. We describe here a case of myxoid liposarcoma containing a novel EWS-CHOP chimeric transcript and identified the breakpoint occurring in intron 13 of EWS. Reverse transcription-polymerase chain reaction and direct sequence showed that exon 13 of EWS was in-frame fused to exon 2 of CHOP. Genomic analysis revealed that the breaks were located in intron 13 of EWS and intron 1 of CHOP

  2. Application of phaco prechop with phaco chop technique in phacoemulsification

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2014-03-01

    Full Text Available AIM:To compare two phaco techniques, namely phaco prechop with phaco chop and divide and conquer, and to discuss the technical advantages of phaco prechop with phaco chop METHODS:The study included 131 patients(156 eyeswith age-related cataract eyes divided into 2 groups, group A including 68 patients(82 eyes, in which phaco prechop with phaco chop was performed, and group B including 63 patients(74 eyes, in which divide and conquer was performed. The mean parameters including average power(AP, U/S time, accumulated energy complex parameter(AECP, mean endothelial cell count, mean endothelial cell loss, intraoperative complications, postoperative uncorrected visual acuity(UCVAat 1d and 1wk, and corneal edema were reported in the two groups both preoperative and postoperative.RESULTS:The subgroups with same grade of lens nucleus hardness were compared. Parameters such as AP, U/S time, AECP in group A were significantly less than those in group B. Postoperative corneal clarity and UCVA at 1d in group A was better than that in group B. No significant difference was found in UCVA at 1wk after operation between the two groups. The difference in mean endothelial cell count at 3mo postoperative between the two groups was statistically insignificant(P>0.05, however the difference in endothelial cell loss at 3mo postoperatively between the two groups was statistically significant(PCONCLUSION:Compare with divide and conquer, phaco prechop with phaco chop utilized less phaco time, energy, and the rate of endothelial cell loss at 3mo postoperatively, and better early postoperative uncorrected visual acuity.

  3. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  4. Suppression of cancer progression by MGAT1 shRNA knockdown.

    Directory of Open Access Journals (Sweden)

    Reza Beheshti Zavareh

    Full Text Available Oncogenic signaling promotes tumor invasion and metastasis, in part, by increasing the expression of tri- and tetra- branched N-glycans. The branched N-glycans bind to galectins forming a multivalent lattice that enhances cell surface residency of growth factor receptors, and focal adhesion turnover. N-acetylglucosaminyltransferase I (MGAT1, the first branching enzyme in the pathway, is required for the addition of all subsequent branches. Here we have introduced MGAT1 shRNA into human HeLa cervical and PC-3-Yellow prostate tumor cells lines, generating cell lines with reduced transcript, enzyme activity and branched N-glycans at the cell surface. MGAT1 knockdown inhibited HeLa cell migration and invasion, but did not alter cell proliferation rates. Swainsonine, an inhibitor of α-mannosidase II immediately downstream of MGAT1, also inhibited cell invasion and was not additive with MGAT1 shRNA, consistent with a common mechanism of action. Focal adhesion and microfilament organization in MGAT1 knockdown cells also indicate a less motile phenotype. In vivo, MGAT1 knockdown in the PC-3-Yellow orthotopic prostate cancer xenograft model significantly decreased primary tumor growth and the incidence of lung metastases. Our results demonstrate that blocking MGAT1 is a potential target for anti-cancer therapy.

  5. Lentivirus-mediated shRNA interference targeting SLUG inhibits lung cancer growth and metastasis.

    Science.gov (United States)

    Wang, Yao-Peng; Wang, Ming-Zhao; Luo, Yi-Ren; Shen, Yi; Wei, Zhao-Xia

    2012-01-01

    Lung cancer is a deadly cancer, whose kills more people worldwide than any other malignancy. SLUG (SNAI2, Snail2) is involved in the epithelial mesenchymal transition in physiological and in pathological contexts and is implicated in the development and progression of lung cancer. We constructed a lentivirus vector with SLUG shRNA (LV-shSLUG). LV-shSLUG and a control lentivirus were infected into the non-small cell lung cancer cell A549 and real-time PCR, Western blot and IHC were applied to assess expression of the SLUG gene. Cell proliferation and migration were detected using MTT and clony formation methods. Real-time PCR, Western Blot and IHC results confirmed down-regulation of SLUG expression by its shRNA by about 80%~90% at both the mRNA and protein levels. Knockdown of SLUG significantly suppressed lung cancer cell proliferation. Furthermore, knockdown of SLUG significantly inhibited lung cancer cell invasion and metastasis. Finally, knockdown of SLUG induced the down-regulation of Bcl-2 and up-regulation of E-cadherin. These results indicate that SLUG is a newly identified gene associated with lung cancer growth and metastasis. SLUG may serve as a new therapeutic target for the treatment of lung cancer in the future.

  6. Processing of chopped mussel meat in retort pouch

    Directory of Open Access Journals (Sweden)

    Giustino TRIBUZI

    2015-01-01

    Full Text Available Abstract Chopped mussel meat packaged in retort pouches was processed in a laboratory-scale water immersion retort, adapted for processing under overpressure conditions. Retort temperature effects on product yield and on cook value were evaluated by setting the F0 at 7 min. The effects of different pre-treatments (salting and marination on the characteristics of mussels were evaluated after processing at retort temperature of 118 °C and during a whole year of storage at 25 °C. The salted samples showed better yield during storage, while no differences were found for the other physicochemical parameters.

  7. Differential Impact of Relative Dose-Intensity Reductions in Diffuse Large B-Cell Lymphoma Treated with R-CHOP21 or R-CHOP14.

    Directory of Open Access Journals (Sweden)

    Antonio Gutiérrez

    Full Text Available DLBCL is an aggressive lymphoma treated with R-CHOP. Recently, attempts have been made to improve the outcome by increasing both dose-density and intensity but there have been no benefits in terms of survival. When treating malignancies RDI is important to consider but there is little published information on DLBCL. The purpose of this study was to analyze the differential prognostic impact of RDI in two cohorts of DLBCL patients treated with R-CHOP21 or R-CHOP14. From January 2001 to August 2013 we included DLBCL patients homogenously treated with R-CHOP21 or R-CHOP14, with or without radiotherapy, at University Hospital Son Espases, Hospital Son Llatzer of Palma and Hospital del Mar of Barcelona (N = 157. In order to avoid selection bias the patients were retrospectively identified from the Pathology Department and Pharmacy registries. Median follow-up was 68 months. There was no difference in the response or survival between the two cohorts. In the R-CHOP21 group, both a reduction higher than 15% in RDI (RR 7.41 and R-IPI (RR 2.99 were independently associated with OS. However, a reduction higher than 15% in RDI (RR 4.41 was only noted for PFS. In the R-CHOP14 group, NCCN-IPI (RR 7.09 and B-symptoms (RR 5.37 for OS; AA stage III-IV (RR 6.26 and bulky disease (RR 4.05 for PFS. There was a trend towards a higher rate of RDI reduction observed in the R-CHOP14 group but it only made an impact in the R-CHOP21 group. We conclude that R-CHOP21 and R-CHOP14 are equivalent regimens in terms of response and survival, but only if RDI reductions are avoided. For patients receiving R-CHOP21 we recommend using clinical and support measures in order to avoid RDI reductions.

  8. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    demonstrate robust knockdown of green fluorescent protein using lentiviral vectors driving RNAi from the ubiquitously-expressing promoter of the cytomegalovirus (CMV) and, in addition, we show for the first time neuron-specific knockdown in the brain using a neuron-specific promoter. Furthermore, we show...... that the expression pattern of the presumed ubiquitously-expressing CMV promoter changes over time from being expressed initially in neurons and glial cells to being expressed almost exclusively in neurons in later stages. CONCLUSIONS: In the present study, we developed vectors for cell-specific RNAi for use...

  9. Low titer lentiviral transgenesis in rodents with simian immundeficiency virus vector.

    Science.gov (United States)

    Bender, Balázs; Hoffmann, Orsolya Ivett; Negre, Didier; Kvell, Krisztián; Bősze, Zsuzsanna; Hiripi, László

    2013-09-01

    Efficient production of transgenic animals using low-titer lentiviral constructs remains challenging. Here we demonstrate that microinjection of simian immundeficiency virus-derived lentiviral constructs can produce transgenic mice and rats with high efficiency even when using low-titer virus preparations.

  10. Construction of a novel lentiviral vector carrying human B-domain ...

    African Journals Online (AJOL)

    ... integration were detected in all cell lines after transfection. A novel lentiviral vector carrying human FVIII³BD was constructed, which was able to transfect different mammalian cell types accompanied by high-level activity. This lentiviral vector may provide a theoretical basis for the gene therapy of patients with hemophilia ...

  11. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  12. Efficient transduction of neurons using Ross River glycoprotein-pseudotyped lentiviral vectors

    DEFF Research Database (Denmark)

    Jakobsson, J; Nielsen, T Tolstrup; Staflin, K

    2006-01-01

    Lentiviral vectors are promising tools for CNS gene transfer since they efficiently transduce the cells of the nervous system in vivo. In this study, we have investigated the transduction efficiency of lentiviral vectors pseudotyped with Ross River virus glycoprotein (RRV-G) (RRV-G-pseudotyped le......Lentiviral vectors are promising tools for CNS gene transfer since they efficiently transduce the cells of the nervous system in vivo. In this study, we have investigated the transduction efficiency of lentiviral vectors pseudotyped with Ross River virus glycoprotein (RRV-G) (RRV...... and human glial fibrillary acidic protein, we demonstrated cell-specific transgene expression in the desired cell type. Ross River virus glycoprotein-pseudotyped lentiviral vectors also transduced human neural progenitor cells in vitro, showing that receptors for the RRV-G are present on human neural cells....

  13. Efficient transgenesis in farm animals by lentiviral vectors

    Science.gov (United States)

    Hofmann, Andreas; Kessler, Barbara; Ewerling, Sonja; Weppert, Myriam; Vogg, Barbara; Ludwig, Harald; Stojkovic, Miodrag; Boelhauve, Marc; Brem, Gottfried; Wolf, Eckhard; Pfeifer, Alexander

    2003-01-01

    Microinjection of DNA is now the most widespread method for generating transgenic animals, but transgenesis rates achieved this way in higher mammals are extremely low. To address this longstanding problem, we used lentiviral vectors carrying a ubiquitously active promoter (phosphoglycerate kinase, LV-PGK) to deliver transgenes to porcine embryos. Of the 46 piglets born, 32 (70%) carried the transgene DNA and 30 (94%) of these pigs expressed the transgene (green fluorescent protein, GFP). Direct fluorescence imaging and immunohistochemistry showed that GFP was expressed in all tissues of LV-PGK transgenic pigs, including germ cells. Importantly, the transgene was transmitted through the germ-line. Tissue-specific transgene expression was achieved by infecting porcine embryos with lentiviral vectors containing the human keratin K14 promoter (LV-K14). LV-K14 transgenic animals expressed GFP specifically in basal keratinocytes of the skin. Finally, infection of bovine oocytes after and before in vitro fertilization with LV-PGK resulted in transgene expression in 45% and 92% of the infected embryos, respectively. PMID:14566324

  14. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    Directory of Open Access Journals (Sweden)

    David Escors

    2013-07-01

    Full Text Available The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(g-retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and b-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells.

  15. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    Energy Technology Data Exchange (ETDEWEB)

    Liechtenstein, Therese, E-mail: t.liechtenstein.12@ucl.ac.uk [University College London, 5 University Street, London, WC1E 6JF (United Kingdom); Perez-Janices, Noemi; Escors, David [University College London, 5 University Street, London, WC1E 6JF (United Kingdom); Navarrabiomed Fundacion Miguel Servet, 3 Irunlarrea St., Hospital Complex of Navarra, 31008 Pamplona, Navarra (Spain)

    2013-07-02

    The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(γ-)retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and β-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells.

  16. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    International Nuclear Information System (INIS)

    Liechtenstein, Therese; Perez-Janices, Noemi; Escors, David

    2013-01-01

    The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(γ-)retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and β-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells

  17. A low noise, low residial offset chopped amplifier for mixed level applications

    NARCIS (Netherlands)

    Sanduleanu, M.A.T.; van Tuijl, Adrianus Johannes Maria; Wassenaar, R.F.; Lammers, M.C.; Wallinga, Hans

    1998-01-01

    This paper describes the principle and the design of a CMOS low noise, low residual offset, chopped amplifier with a class AB output stage for noise and offset reduction in mixed analog digital applications. The operation is based on chopping and dynamic element matching to reduce noise and offset,

  18. Low-power low-voltage chopped transconductance amplifier for noise and offset reduction

    NARCIS (Netherlands)

    Sanduleanu, M.A.T.; Nauta, Bram; Wallinga, Hans

    1997-01-01

    This paper describes the principle and design of a CMOS low-power, low-voltage, chopped transconductance amplifier, for noise and offset reduction in mixed analogue digital applications. The operation is based on chopping and dynamic element matching, to reduce noise and offset, without excessive

  19. Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

    Science.gov (United States)

    Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

    2013-12-01

    First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

  20. piggyBac transposon-derived targeting shRNA interference against the Bombyx mori nucleopolyhedrovirus (BmNPV).

    Science.gov (United States)

    Zhou, Fang; Chen, Rui-ting; Lu, Yan; Liang, Shuang; Wang, Mei-xian; Miao, Yun-gen

    2014-12-01

    The Bombyx mori nucleopolyhedrovirus (BmNPV) is one of the most destructive diseases in silkworm, which has caused the main damage to sericulture industry. In this study, we developed a system of RNAi to prevent the BmNPV infection using the piggyBac transposon-derived targeting short hairpin RNA (shRNA) interference. The shRNAs targeting the genes of i.e.-1, lef-1, lef-2 and lef-3 of BmNPV were designed and used to inhibit the intracellular replication or multiplication of BmNPV in Bm cells. The highest activity was presented in the shRNA targeting the i.e.-1c of BmNPV, of which the inhibition rate reached 94.5 % in vitro. Further a stable Bm cell line of piggyBac transposon-derived targeting shRNA interference against BmNPV was established, which has a highly efficacious suppression on virus proliferation. These results indicated that the recombinant shRNA expression system was a useful tool for resistance to BmNPV in vitro. The approach by recombinant shRNAs opens a door of RNAi technology as a strategy that offering technically simpler, cheaper, and quicker gene knockdown for promising research and biotechnology application on silkworm lethal diseases.

  1. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  2. Changes in Temperature, the Heat Released and the Power Required for Chopping Meat

    Directory of Open Access Journals (Sweden)

    Daniela Ianiţchi

    2010-10-01

    Full Text Available Chopping meat is an important operation in the technological process to obtaining meat products, which can have negative implications on quality of emulsions and on the properties of finished products when temperature rises recorded during the process is not kept in check by adding water-cooled or ice flakes. Experiments showed that the largest increase in temperature and the highest heat generated in chopping have been reported for the compositions obtained from beef meats, without added water cooled, the lowest final temperature recorded in the case of compositions of pork that was added cooling water. Power required registered at chopping, fell towards the end of the process of chopping, as a result of reducing the size of fragments of meat.

  3. Correlation between compressive strength and ultrasonic pulse velocity of high strength concrete incorporating chopped basalt fibre

    Science.gov (United States)

    Shafiq, Nasir; Fadhilnuruddin, Muhd; Elshekh, Ali Elheber Ahmed; Fathi, Ahmed

    2015-07-01

    Ultrasonic pulse velocity (UPV), is considered as the most important test for non-destructive techniques that are used to evaluate the mechanical characteristics of high strength concrete (HSC). The relationship between the compressive strength of HSC containing chopped basalt fibre stands (CBSF) and UPV was investigated. The concrete specimens were prepared using a different ratio of CBSF as internal strengthening materials. The compressive strength measurements were conducted at the sample ages of 3, 7, 28, 56 and 90 days; whilst, the ultrasonic pulse velocity was measured at 28 days. The result of HSC's compressive strength with the chopped basalt fibre did not show any improvement; instead, it was decreased. The UPV of the chopped basalt fibre reinforced concrete has been found to be less than that of the control mix for each addition ratio of the basalt fibre. A relationship plot is gained between the cube compressive strength for HSC and UPV with various amounts of chopped basalt fibres.

  4. Energy Absorption in Chopped Carbon Fiber Compression Molded Composites

    International Nuclear Information System (INIS)

    Starbuck, J.M.

    2001-01-01

    In passenger vehicles the ability to absorb energy due to impact and be survivable for the occupant is called the ''crashworthiness'' of the structure. To identify and quantify the energy absorbing mechanisms in candidate automotive composite materials, test methodologies were developed for conducting progressive crush tests on composite plate specimens. The test method development and experimental set-up focused on isolating the damage modes associated with the frond formation that occurs in dynamic testing of composite tubes. Quasi-static progressive crush tests were performed on composite plates manufactured from chopped carbon fiber with an epoxy resin system using compression molding techniques. The carbon fiber was Toray T700 and the epoxy resin was YLA RS-35. The effect of various material and test parameters on energy absorption was evaluated by varying the following parameters during testing: fiber volume fraction, fiber length, fiber tow size, specimen width, profile radius, and profile constraint condition. It was demonstrated during testing that the use of a roller constraint directed the crushing process and the load deflection curves were similar to progressive crushing of tubes. Of all the parameters evaluated, the fiber length appeared to be the most critical material parameter, with shorter fibers having a higher specific energy absorption than longer fibers. The combination of material parameters that yielded the highest energy absorbing material was identified

  5. Energy Saving by Chopping off Peak Demand Using Day Light

    Directory of Open Access Journals (Sweden)

    Ashok Kumar Maitra

    2011-08-01

    Full Text Available An artificial intelligent technique has been implemented in this research using real time datas to calculate how much energy can be chopped from peak load demand. The results are based on real time data that are taken from power delivering centers. These datas do reflect the present condition of power and a solution to those critical conditions during the peak period. These are done in such a way such that helps in judicious scheduling of load. The time based load scheduling has been done so as to understand the basic criteria for solving power crisis during morning peak and early evening peak. The sunray availability and percentage of load that will use day light saving (DLS technique has been taken into account in this work. The results shows that about 0.5% to 1% of load can be shedded off from the peak load period which otherwise is reduction of power. Thus it otherwise also means that an equivalent amount of energy is saved which amounts to a large saving of national money. This result is obtained on monthly and even daily basis. Thus this paper justifies DLS gives a new renewable technique to save energy.

  6. Fatigue Characteristic of Chopped Strand Mat/Polyester Composite

    Directory of Open Access Journals (Sweden)

    I Made Astika

    2012-11-01

    Full Text Available The application of composite as an alternatif material to substitute of metal has better properties than metal such as light, high elasticity, corrosion and fatigue resistance. Some components in its application are subjected to millions of varying stress cycles that initiated to fatigue failure such as crack, delamination and fracture. The strength of composite is influenced by construction, fiber type, orientation and fiber fraction. The objective of this experiment is to investigate the fatigue characteristic on SCM composite. Material composite to be used is glass fiber with chopped strand mat (CSM as fiber and Yukalac 157 BQTN-EX with 1% hardener (Mexpox as matrix. The mold process was built with hand lay-up. Fiber volume fractions in composite are 40, 32 and 24 %. The tests to be done on composite are fatigue and tensile test. The research show that the increasing of fiber fraction in composite affects increasing of fatigue life, endurance limit and tensile strength. Fatigue failure modes of composite are debonding, matrix cracking, delamination and fiber fracture.

  7. Intrinsic stress of bismuth oxide thin films: effect of vapour chopping and air ageing

    International Nuclear Information System (INIS)

    Patil, R B; Puri, R K; Puri, V

    2008-01-01

    Bismuth oxide thin films of thickness 1000 A 0 have been prepared by thermal oxidation (in air) of vacuum evaporated bismuth thin films (on glass substrate) at different oxidation temperatures and duration. Both the vapour chopped and nonchopped bismuth oxide thin films showed polycrystalline and polymorphic structure. The monoclinic bismuth oxide was found to be predominant in both the cases. The effect of vapour chopping and air exposure for 40 days on the intrinsic stress of bismuth oxide thin films has been studied. The vapour chopped films showed low (3.92 - 4.80 x 10 9 N/m 2 ) intrinsic stress than those of nonchopped bismuth oxide thin films (5.77 - 6.74 x 10 9 N/m 2 ). Intrinsic stress was found to increase due to air ageing. The effect of air ageing on the vapour chopped films was found low. The vapour chopped films showed higher packing density. Higher the packing density, lower the film will age. The process of chopping vapour flow creates films with less inhomogenety i.e. a low concentration of flaws and non-planar defects which results in lower intrinsic stress

  8. Structural basis for functional tetramerization of lentiviral integrase.

    Directory of Open Access Journals (Sweden)

    Stephen Hare

    2009-07-01

    Full Text Available Experimental evidence suggests that a tetramer of integrase (IN is the protagonist of the concerted strand transfer reaction, whereby both ends of retroviral DNA are inserted into a host cell chromosome. Herein we present two crystal structures containing the N-terminal and the catalytic core domains of maedi-visna virus IN in complex with the IN binding domain of the common lentiviral integration co-factor LEDGF. The structures reveal that the dimer-of-dimers architecture of the IN tetramer is stabilized by swapping N-terminal domains between the inner pair of monomers poised to execute catalytic function. Comparison of four independent IN tetramers in our crystal structures elucidate the basis for the closure of the highly flexible dimer-dimer interface, allowing us to model how a pair of active sites become situated for concerted integration. Using a range of complementary approaches, we demonstrate that the dimer-dimer interface is essential for HIV-1 IN tetramerization, concerted integration in vitro, and virus infectivity. Our structures moreover highlight adaptable changes at the interfaces of individual IN dimers that allow divergent lentiviruses to utilize a highly-conserved, common integration co-factor.

  9. Desmin-regulated lentiviral vectors for skeletal muscle gene transfer.

    Science.gov (United States)

    Talbot, Gillian E; Waddington, Simon N; Bales, Olivia; Tchen, Rose C; Antoniou, Michael N

    2010-03-01

    Lentiviral vectors (LVs) are highly attractive as a gene therapy agent as they are able to stably integrate their genomes in both dividing and nondividing cells and, in principle, provide long-term therapeutic benefit. However, their performance in skeletal muscle in adult animals has, to date, been disappointing. In order to gain clearer insight into their utility in this tissue type, we have conducted an extensive quantitative comparison of constitutive and muscle-specific promoter activities in skeletal muscle and nonmuscle systems following LV delivery in cell lines and neonatal mice. Our data show that LV delivery to hind leg skeletal muscle of neonatal mouse results in long-term transgene expression in adulthood. We find that the human desmin (DES) promoter/enhancer is the first muscle-specific control region to match the activity of the highly active constitutive human cytomegalovirus (hCMV) promoter/enhancer in skeletal muscle within a LV context both in vitro and in vivo. Furthermore, the DES promoter/enhancer provides six- to eightfold greater expression per viral copy than the muscle-specific human muscle creatine kinase (CKM) promoter/enhancer. DES also confers a more reproducible and tissue-specific transgene expression profile compared to CKM and is therefore a highly attractive regulatory element for use in muscle gene therapy vectors.

  10. Targeting lentiviral vectors to antigen-specific immunoglobulins.

    Science.gov (United States)

    Ziegler, Leslie; Yang, Lili; Joo, Kye il; Yang, Haiguang; Baltimore, David; Wang, Pin

    2008-09-01

    Gene transfer into B cells by lentivectors can provide an alternative approach to managing B lymphocyte malignancies and autoreactive B cell-mediated autoimmune diseases. These pathogenic B cell populations can be distinguished by their surface expression of monospecific immunoglobulin. Development of a novel vector system to deliver genes to these specific B cells could improve the safety and efficacy of gene therapy. We have developed an efficient method to target lentivectors to monospecific immunoglobulin-expressing cells in vitro and in vivo. We were able to incorporate a model antigen CD20 and a fusogenic protein derived from the Sindbis virus as two distinct molecules into the lentiviral surface. This engineered vector could specifically bind to cells expressing surface immunoglobulin recognizing CD20 (alphaCD20), resulting in efficient transduction of target cells in a cognate antigen-dependent manner in vitro, and in vivo in a xenografted tumor model. Tumor suppression was observed in vivo, using the engineered lentivector to deliver a suicide gene to a xenografted tumor expressing alphaCD20. These results show the feasibility of engineering lentivectors to target immunoglobulin- specific cells to deliver a therapeutic effect. Such targeting lentivectors also could potentially be used to genetically mark antigen-specific B cells in vivo to study their B cell biology.

  11. Lentiviral vectors for the treatment of primary immunodeficiencies.

    Science.gov (United States)

    Farinelli, Giada; Capo, Valentina; Scaramuzza, Samantha; Aiuti, Alessandro

    2014-07-01

    In the last years important progress has been made in the treatment of several primary immunodeficiency disorders (PIDs) with gene therapy. Hematopoietic stem cell (HSC) gene therapy indeed represents a valid alternative to conventional transplantation when a compatible donor is not available and recent success confirmed the great potential of this approach. First clinical trials performed with gamma retroviral vectors were promising and guaranteed clinical benefits to the patients. On the other hand, the outcome of severe adverse events as the development of hematological abnormalities highlighted the necessity to develop a safer platform to deliver the therapeutic gene. Self-inactivating (SIN) lentiviral vectors (LVVs) were studied to overcome this hurdle through their preferable integration pattern into the host genome. In this review, we describe the recent advancements achieved both in vitro and at preclinical level with LVVs for the treatment of Wiskott-Aldrich syndrome (WAS), chronic granulomatous disease (CGD), ADA deficiency (ADA-SCID), Artemis deficiency, RAG1/2 deficiency, X-linked severe combined immunodeficiency (γchain deficiency, SCIDX1), X-linked lymphoproliferative disease (XLP) and immune dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome.

  12. Lentiviral vectors can be used for full-length dystrophin gene therapy.

    Science.gov (United States)

    Counsell, John R; Asgarian, Zeinab; Meng, Jinhong; Ferrer, Veronica; Vink, Conrad A; Howe, Steven J; Waddington, Simon N; Thrasher, Adrian J; Muntoni, Francesco; Morgan, Jennifer E; Danos, Olivier

    2017-03-06

    Duchenne Muscular Dystrophy (DMD) is caused by a lack of dystrophin expression in patient muscle fibres. Current DMD gene therapy strategies rely on the expression of internally deleted forms of dystrophin, missing important functional domains. Viral gene transfer of full-length dystrophin could restore wild-type functionality, although this approach is restricted by the limited capacity of recombinant viral vectors. Lentiviral vectors can package larger transgenes than adeno-associated viruses, yet lentiviral vectors remain largely unexplored for full-length dystrophin delivery. In our work, we have demonstrated that lentiviral vectors can package and deliver inserts of a similar size to dystrophin. We report a novel approach for delivering large transgenes in lentiviruses, in which we demonstrate proof-of-concept for a 'template-switching' lentiviral vector that harnesses recombination events during reverse-transcription. During this work, we discovered that a standard, unmodified lentiviral vector was efficient in delivering full-length dystrophin to target cells, within a total genomic load of more than 15,000 base pairs. We have demonstrated gene therapy with this vector by restoring dystrophin expression in DMD myoblasts, where dystrophin was expressed at the sarcolemma of myotubes after myogenic differentiation. Ultimately, our work demonstrates proof-of-concept that lentiviruses can be used for permanent full-length dystrophin gene therapy, which presents a significant advancement in developing an effective treatment for DMD.

  13. Thermosensitivity of the reverse transcription process as an inactivation mechanism of lentiviral vectors.

    Science.gov (United States)

    Carmo, M; Dias, J D; Panet, A; Coroadinha, A S; Carrondo, M J T; Alves, P M; Cruz, P E

    2009-10-01

    Lentiviral vectors are an important tool for gene transfer research and gene therapy purposes. However, the low stability of these vectors affects their production, storage, and efficacy in preclinical and clinical settings. In the present work the mechanism underlying the thermosensitivity of lentiviral vectors was evaluated. For lentiviral vectors pseudotyped with amphotropic and RDpro envelopes, the capacity to perform reverse transcription was lost rapidly at 37 degrees C, in high correlation with the loss of infectivity. The vector with RDpro envelope presented a higher level of stability than that with amphotropic envelope for both the reverse transcription process and viral infectivity. Reverse transcriptase enzyme inactivation and viral template RNA degradation were not implicated in the loss of the viral capacity to perform reverse transcription. Furthermore, early entry steps in the infection process do not determine the rate of viral inactivation, as the amount of viral RNA and p24 protein entering the cells decreased slowly for both vectors. Taken together, it can be concluded that the reverse transcription process is thermolabile and thus determines the rate of lentiviral inactivation. Strategies to stabilize the reverse transcription process should be pursued to improve the applicability of lentiviral vectors in gene therapy.

  14. The Hypothermic Influence on CHOP and Ero1-α in an Endoplasmic Reticulum Stress Model of Cerebral Ischemia

    DEFF Research Database (Denmark)

    Poone, Gagandip K.; Hasseldam, Henrik; Munkholm, Nina

    2015-01-01

    globalischemia. A stable increase in CHOP expression was observed throughout the time course (p PC12 cells resulted in a decreased expression of CHOP after three, six and twelve hours...... hippocampi following global cerebral ischemia, and inhypoxic pheochromocytoma cells during normothermic (37 °C) and hypothermic (31 °C)conditions. As a result of ischemia, a significant increase in expression of CHOP andEro1-α was observed after three, six and twelve hours of reperfusion following...

  15. Chop Suey as Imagined Authentic Chinese Food: The Culinary Identity of Chinese Restaurants in the United States

    OpenAIRE

    Haiming Liu

    2009-01-01

    At least until the 1960s, chop suey was synonymous with Chinese food in the United States, where most Chinese restaurants were called chop suey houses. By uncovering the history of chop suey, this article analyzes the development of Chinese cuisine in the U.S. as an example of transnational cultural exchange. The authenticity and culinary identity of Chinese food in America often rested on its real or imagined Chinese roots while its popularity depended on how well Chinese restaurant...

  16. Packaging of HCV-RNA into lentiviral vector

    Energy Technology Data Exchange (ETDEWEB)

    Caval, Vincent [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Piver, Eric [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Service de Biochimie et Biologie Moleculaire, CHRU de Tours (France); Ivanyi-Nagy, Roland; Darlix, Jean-Luc [LaboRetro, ENS-Lyon INSERM, U758, 46 Allee d' Italie, 69364 Lyon (France); Pages, Jean-Christophe, E-mail: jean-christophe.pages@univ-tours.fr [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Service de Biochimie et Biologie Moleculaire, CHRU de Tours (France)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Description of HCV-RNA Core-D1 interactions. Black-Right-Pointing-Pointer In vivo evaluation of the packaging of HCV genome. Black-Right-Pointing-Pointer Determination of the role of the three basic sub-domains of D1. Black-Right-Pointing-Pointer Heterologous system involving HIV-1 vector particles to mobilise HCV genome. Black-Right-Pointing-Pointer Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein and HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.

  17. Viral delivery of shRNA to amygdala neurons leads to neurotoxicity and deficits in Pavlovian fear conditioning.

    Science.gov (United States)

    de Solis, Christopher A; Holehonnur, Roopashri; Banerjee, Anwesha; Luong, Jonathan A; Lella, Srihari K; Ho, Anthony; Pahlavan, Bahram; Ploski, Jonathan E

    2015-10-01

    The use of viral vector technology to deliver short hairpin RNAs (shRNAs) to cells of the nervous system of many model organisms has been widely utilized by neuroscientists to study the influence of genes on behavior. However, there have been numerous reports that delivering shRNAs to the nervous system can lead to neurotoxicity. Here we report the results of a series of experiments where adeno-associated viruses (AAV), that were engineered to express shRNAs designed to target known plasticity associated genes (i.e. Arc, Egr1 and GluN2A) or control shRNAs that were designed not to target any rat gene product for depletion, were delivered to the rat basal and lateral nuclei of the amygdala (BLA), and auditory Pavlovian fear conditioning was examined. In our first set of experiments we found that animals that received AAV (3.16E13-1E13 GC/mL; 1 μl/side), designed to knockdown Arc (shArc), or control shRNAs targeting either luciferase (shLuc), or nothing (shCntrl), exhibited impaired fear conditioning compared to animals that received viruses that did not express shRNAs. Notably, animals that received shArc did not exhibit differences in fear conditioning compared to animals that received control shRNAs despite gene knockdown of Arc. Viruses designed to harbor shRNAs did not induce obvious morphological changes to the cells/tissue of the BLA at any dose of virus tested, but at the highest dose of shRNA virus examined (3.16E13 GC/mL; 1 μl/side), a significant increase in microglia activation occurred as measured by an increase in IBA1 immunoreactivity. In our final set of experiments we infused viruses into the BLA at a titer of (1.60E+12 GC/mL; 1 μl/side), designed to express shArc, shLuc, shCntrl or shRNAs designed to target Egr1 (shEgr1), or GluN2A (shGluN2A), or no shRNA, and found that all groups exhibited impaired fear conditioning compared to the group which received a virus that did not express an shRNA. The shEgr1 and shGluN2A groups exhibited gene

  18. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  19. Bone marrow mesenchymal stem cells decrease CHOP expression and neuronal apoptosis after spinal cord injury.

    Science.gov (United States)

    Gu, Chuanlong; Li, Heyangzi; Wang, Chao; Song, Xinghui; Ding, Yuemin; Zheng, Mingzhi; Liu, Wei; Chen, Yingying; Zhang, Xiaoming; Wang, Linlin

    2017-01-01

    Spinal cord injury (SCI) leads to irreversible neuronal loss and ultimately leads to paralysis. Bone marrow derived mesenchymal stem cells (BMSCs) have been demonstrated to be an effective approach to treat SCI. The present study was designed to investigate the role of BMSCs in rats with spinal cord injury and in oxygen-glucose deprivation (OGD) treated motor neurons. The results demonstrated that BMSCs could improve locomotor function and decrease expression of pro-apoptotic transcription factor C/EBP homologous protein (CHOP) and apoptosis after SCI. Furthermore, co-culture with BMSCs or conditioned medium from BMSCs could also decrease the expression of CHOP and apoptosis in post-OGD motor neurons, supporting that BMSCs exerts protective effects by decreasing the expression of CHOP in injured motor neurons. Our findings provide a potential novel mechanism for BMSCs treatments in patients with SCI. Copyright © 2016. Published by Elsevier Ireland Ltd.

  20. Characterization of methane emissions from five cold heavy oil production with sands (CHOPS) facilities.

    Science.gov (United States)

    Roscioli, J R; Herndon, S C; Yacovitch, T I; Knighton, W Berk; Zavala-Araiza, D; Johnson, M R; Tyner, D R

    2018-03-07

    Cold Heavy Oil Production with Sands (CHOPS) is a common oil extraction method in the Canadian provinces of Alberta and Saskatchewan that can result in significant methane emissions due to annular venting. Little is known about the magnitude of these emissions, nor their contributions to the regional methane budget. Here we present the results of field measurements of methane emissions from CHOPS wells and compare them to self-reported venting rates. The tracer ratio method was used not only to analyze total site emissions but at one site it was also used to locate primary emission sources and quantify their contributions to the facility-wide emission rate, revealing the annular vent to be a dominant source. Emissions measured from five different CHOPS sites in Alberta showed large discrepancies between the measured and reported rates, with emissions being mainly under-reported. These methane emission rates are placed in the context of current reporting procedures and the role that gas-oil ratio (GOR) measurements play in vented volume estimates. In addition to methane, emissions of higher hydrocarbons were also measured; a chemical "fingerprint" associated with CHOPS wells in this region reveals very low emission ratios of ethane, propane, and aromatics versus methane. The results of this study may inform future studies of CHOPS site, and aid in developing policy to mitigate regional methane emissions. Implications Methane measurements from Cold Heavy Oil Production with Sand (CHOPS) sites identify annular venting to be a potentially major source of emissions at these facilities. The measured emission rates are generally larger than reported by operators, with uncertainty in the gas-oil ratio (GOR) possibly playing a large role in this discrepancy. These results have potential policy implications for reducing methane emissions in Alberta in order to achieve the Canadian Government's goal of reducing methane emissions by 40-45% below 2012 levels within 8 years.

  1. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... (FSIS) is delaying the effective date of the final regulations that require nutrition labeling of the major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry...

  2. RNase L controls terminal adipocyte differentiation, lipids storage and insulin sensitivity via CHOP10 mRNA regulation

    DEFF Research Database (Denmark)

    Fabre, Odile Martine Julie; Salehzada, T; Lambert, K

    2012-01-01

    Adipose tissue structure is altered during obesity, leading to deregulation of whole-body metabolism. Its function depends on its structure, in particular adipocytes number and differentiation stage. To better understand the mechanisms regulating adipogenesis, we have investigated the role...... is associated with CHOP10 mRNA and regulates its stability. CHOP10 expression is conserved in RNase L(-/-)-MEFs, maintaining preadipocyte state while impairing their terminal differentiation. RNase L(-/-)-MEFs have decreased lipids storage capacity, insulin sensitivity and glucose uptake. Expression of ectopic...... RNase L in RNase L(-/-)-MEFs triggers CHOP10 mRNA instability, allowing increased lipids storage, insulin response and glucose uptake. Similarly, downregulation of CHOP10 mRNA with CHOP10 siRNA in RNase L(-/-)-MEFs improves their differentiation in adipocyte. In vivo, aged RNase L(-)/(-) mice present...

  3. Incorporating double copies of a chromatin insulator into lentiviral vectors results in less viral integrants

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Jakobsson, Johan; Rosenqvist, Nina

    2009-01-01

    BACKGROUND: Lentiviral vectors hold great promise as gene transfer vectors in gene therapeutic settings. However, problems related to the risk of insertional mutagenesis, transgene silencing and positional effects have stalled the use of such vectors in the clinic. Chromatin insulators are bounda...

  4. Mouse transplant models for evaluating the oncogenic risk of a self-inactivating XSCID lentiviral vector.

    Directory of Open Access Journals (Sweden)

    Sheng Zhou

    Full Text Available Hematopoietic stem cell gene therapy requires the use of integrating retroviral vectors in order to stably transmit a therapeutic gene to mature blood cells. Human clinical trials have shown that some vector integration events lead to disrupted regulation of proto-oncogenes resulting in disordered hematopoiesis including T-cell leukemia. Newer vectors have been designed to decrease the incidence of these adverse events but require appropriate pre-clinical assays to demonstrate safety. We have used two distinct mouse serial transplant assays to evaluate the safety of a self-inactivating lentiviral vector intended for use in X-linked severe combined immunodeficiency (XSCID gene therapy trials. These experiments entailed 28 months of total follow-up and included 386 mice. There were no cases in which the XSCID lentiviral vector clearly caused hematopoietic malignancies, although a single case of B cell malignancy was observed that contained the lentiviral vector as a likely passenger event. In contrast, a SFFV-DsRed γ-retroviral vector resulted in clonal transformation events in multiple secondary recipients. Non-specific pathology not related to vector insertions was noted including T cell leukemias arising from irradiated recipient cells. Overall, this comprehensive study of mouse transplant safety assays demonstrate the relative safety of the XSCID lentiviral vector but also highlight the limitations of these assays.

  5. Direct gene transfer in the Gottingen minipig CNS using stereotaxic lentiviral microinjections

    DEFF Research Database (Denmark)

    GLUD, AN; Hedegaard, Claus; nielsen, MS

    2010-01-01

    We aim to induce direct viral mediated gene transfer in the substantia nigra (SN) of the Gottingen minipig using MRI guided stereotaxic injections of lentiviral vectors encoding enhanced green fluorescent protein (EGFP). Nine female Gottingen minipigs were injected unilaterally into the SN with 6...

  6. Dustiness of chopped straw as affected by lignosulfonate as a dust suppressant.

    Science.gov (United States)

    Breum, N O; Nielsen, B H; Lyngbye, M; Midtgård, U

    1999-01-01

    Many sources add to the concentration of bioaerosols in livestock buildings, and source control is the number one priority for keeping a low concentration. Straw is a common but dusty bedding material in livestock buildings and the present study is focused on the dustiness of chopped straw (barley) as affected by lignosulfonate (LS) as a dust suppressant. A LS-solution was aerosolized in a spray chamber fitted to an existing bedding chopper to allow the chopped straw to adsorb the LS-solution. The dustiness of straw treated with LS was compared to non-treated straw. As storage conditions may affect dustiness, the study included treated straw kept for 4 weeks in sealed plastic bags. Dustiness of the chopped straw was measured in terms of the potential of the straw to emit bioaerosols in a rotating drum. The LS-treated straw proved low in dustiness compared to the non-treated straw. The dustiness with respect to the mass of dust was reduced by at least a factor of 6, and for fungi and endotoxin the factors of reduction were 4 and 3, respectively. Dustiness of LS-treated straw kept in plastic bags was reduced by a factor of 2 for mass of dust and by a factor of 4 for endotoxin, but dustiness for fungi was increased by a factor of 3. It is concluded that lignosulfonate has potential as a dust suppressant for chopped straw.

  7. Emissions from cold heavy oil production with sands (CHOPS) facilities in Alberta, Canada

    Science.gov (United States)

    Roscioli, J. R.; Herndon, S. C.; Yacovitch, T. I.; Knighton, W. B.; Zavala-Araiza, D.; Johnson, M. R.; Tyner, D. R.

    2017-12-01

    Cold heavy oil production with sands (CHOPS) is generally characterized as a pump driven oil extraction method producing a mixture of sand, water, and heavy oil to heated liquid storage tanks. In addition to fluids, CHOPS sites also produce solution gas, primarily composed of methane, through the well annulus. Depending on formation and well production characteristics, large volumes of this solution gas are frequently vented to the atmosphere without flaring or conservation. To better understand these emission we present measurements of methane, ethane, propane and aromatic emission rates from CHOPS sites using dual tracer flux ratio methodology. The use of two tracers allowed on-site emission sources to be accurately identified and in one instance indicated that the annular vent was responsible for >75% of emissions at the facility. Overall, a measurement survey of five CHOPS sites finds that the methane emissions are in general significantly under-reported by operators. This under-reporting may arise from uncertainties associated with measured gas-to-oil ratios upon which the reported vent volume is based. Finally, measurements of ethane, propane and aromatics from these facilities indicates surprisingly low non-methane hydrocarbon content.

  8. Chopped or Long Roughage: What Do Calves Prefer? Using Cross Point Analysis of Double Demand Functions

    DEFF Research Database (Denmark)

    Webb, Laura E.; Jensen, Margit Bak; Engel, Bas

    2014-01-01

    The present study aimed to quantify calves'(Bos taurus) preference for long versus chopped hay and straw, and hay versus straw, using cross point analysis of double demand functions, in a context where energy intake was not a limiting factor. Nine calves, fed milk replacer and concentrate, were...

  9. study on the chopping and mixing of cotton stalks with soil | Sa glam ...

    African Journals Online (AJOL)

    da), while the highest fuel consumption was recorded by the vertical-blade rotating dredge (7.1 l/ha). The largest “mean post-chopping piece size” was achieved by the vertical-blade rotating dredge plus geared cylinder (28.36 cm), while the ...

  10. 9 CFR 319.311 - Chow mein vegetables with meat, and chop suey vegetables with meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chow mein vegetables with meat, and chop suey vegetables with meat. 319.311 Section 319.311 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  11. ATF4- and CHOP-Dependent Induction of FGF21 through Endoplasmic Reticulum Stress

    Directory of Open Access Journals (Sweden)

    Xiao-shan Wan

    2014-01-01

    Full Text Available Fibroblast growth factor 21 (FGF21 is an important endogenous regulator involved in the regulation of glucose and lipid metabolism. FGF21 expression is strongly induced in animal and human subjects with metabolic diseases, but little is known about the molecular mechanism. Endoplasmic reticulum (ER stress plays an essential role in metabolic homeostasis and is observed in numerous pathological processes, including type 2 diabetes, overweight, nonalcoholic fatty liver disease (NAFLD. In this study, we investigate the correlation between the expression of FGF21 and ER stress. We demonstrated that TG-induced ER stress directly regulated the expression and secretion of FGF21 in a dose- and time-dependent manner. FGF21 is the target gene for activating transcription factor 4 (ATF4 and CCAAT enhancer binding protein homologous protein (CHOP. Suppression of CHOP impaired the transcriptional activation of FGF21 by TG-induced ER stress in CHOP−/− mouse primary hepatocytes (MPH, and overexpression of ATF4 and CHOP resulted in FGF21 promoter activation to initiate the transcriptional programme. In mRNA stability assay, we indicated that ER stress increased the half-life of mRNA of FGF21 significantly. In conclusion, FGF21 expression is regulated by ER stress via ATF- and CHOP-dependent transcriptional mechanism and posttranscriptional mechanism, respectively.

  12. Effect of grass silage chop length on chewing activity and digestibility

    DEFF Research Database (Denmark)

    Garmo, T.H.; Randby, Å.T.; Eknæs, M.

    2008-01-01

    ad libitum and supplemented with 6 kg concentrate. Early harvested silage significantly decreased total ration eating (ET), rumination (RT) and chewing time (CT) per kg silage DM compared with normal harvested silage (CT = 38 vs. 46 min kg-1 DM). Chopping of silage reduced CT significantly, mainly...

  13. Salmonella Immunotherapy Improves the Outcome of CHOP Chemotherapy in Non-Hodgkin Lymphoma-Bearing Mice

    Science.gov (United States)

    Bascuas, Thais; Moreno, María; Grille, Sofía; Chabalgoity, José A.

    2018-01-01

    We have previously shown that Salmonella immunotherapy is effective to treat B-cell non-Hodgkin lymphoma (B-NHL) in mice. However, this model involves animals with high tumor burden, whereas in the clinics B-NHL patients are usually treated with chemotherapy (CHOP: cyclophosphamide, doxorubicin, vincristine, and prednisone) as first-line therapy prior to immunotherapy. Recently, we have described a NHL-B preclinical model using CHOP chemotherapy to achieve MRD in immunocompetent animals that closely resemble patients’ conditions. In this work, we assessed the efficacy of Salmonella immunotherapy in B-NHL-bearing mice undergoing chemotherapy. Salmonella administration significantly delayed tumor growth and prolonged survival of chemotherapy-treated NHL-bearing animals. Mice receiving the CHOP–Salmonella combined therapy showed increased numbers of tumor-infiltrating leukocytes and a different profile of cytokines and chemokines expressed in the tumor microenvironment. Further, Salmonella immunotherapy in CHOP-treated animals also enhanced NK cells cytotoxic activity as well as induced systemic lymphoma-specific humoral and cellular responses. Chemotherapy treatment profoundly impacted on the general health status of recipient animals, but those receiving Salmonella showed significantly better overall body condition. Altogether, the results clearly demonstrated that Salmonella immunotherapy could be safely used in individuals under CHOP treatment, resulting in a better prognosis. These results give strong support to consider Salmonella as a neoadjuvant therapy in a clinical setting. PMID:29410666

  14. Dimension and quality requirements for chopped firewood; Pilkkeen mitta- ja laatuvaatimukset

    Energy Technology Data Exchange (ETDEWEB)

    Tuomi, S. [Work Efficiency Inst., Rajamaeki (Finland)

    1997-12-01

    Over the heating season of 1992-1993 in total 5.6 million m{sup 3} of firewood was used for heating one-family houses in Finland. Major part consisted of chopped firewood. Two-thirds of firewood was acquired from consumers` own forests. The proportion of purchased wood was less than a fifth, about one million m{sup 3}. More than half, i.e. 750 000 house-owners consider the use of purchased firewood possible. Chopped firewood is the most favoured type of wood. A crucial problem of firewood sales is the lack of dimension and quality requirements. The measuring practice of chopped firewood has neither been standardised. These problems hamper the development of the commercial firewood market and prevents the increase of firewood use in particular in one-family houses, in which stoves and fireplaces are presently under-used. The aim of the project is to promote firewood sales and to protect consumers by preparing a proposal for the measurement and dimension and quality requirements for chopped firewood. The work is carried out on the basis of material based on field and laboratory measurements and on a literature survey. The most important results will be published as a guide book for firewood entrepreneurs and buyers. (orig.)

  15. Inhibition of geranylgeranylation mediates sensitivity to CHOP-induced cell death of DLBCL cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Ageberg, Malin, E-mail: Malin.Ageberg@med.lu.se [Division of Hematology and Transfusion Medicine, Lund University, BMC C14, 221 84 Lund (Sweden); Rydstroem, Karin, E-mail: Karin.Rydstom@skane.se [Department of Oncology, Skanes University Hospital, Allmaenmott, Onkologiska kliniken i Lund, 221 85 Lund (Sweden); Linden, Ola, E-mail: Ola.Linden@skane.se [Department of Oncology, Skanes University Hospital, Allmaenmott, Onkologiska kliniken i Lund, 221 85 Lund (Sweden); Linderoth, Johan, E-mail: Johan.Linderoth@skane.se [Department of Oncology, Skanes University Hospital, Allmaenmott, Onkologiska kliniken i Lund, 221 85 Lund (Sweden); Jerkeman, Mats, E-mail: Mats.Jerkeman@skane.se [Department of Oncology, Skanes University Hospital, Allmaenmott, Onkologiska kliniken i Lund, 221 85 Lund (Sweden); Drott, Kristina, E-mail: Kristina.Drott@med.lu.se [Division of Hematology and Transfusion Medicine, Lund University, BMC C14, 221 84 Lund (Sweden)

    2011-05-01

    Prenylation is a post-translational hydrophobic modification of proteins, important for their membrane localization and biological function. The use of inhibitors of prenylation has proven to be a useful tool in the activation of apoptotic pathways in tumor cell lines. Rab geranylgeranyl transferase (Rab GGT) is responsible for the prenylation of the Rab family. Overexpression of Rab GGTbeta has been identified in CHOP refractory diffuse large B cell lymphoma (DLBCL). Using a cell line-based model for CHOP resistant DLBCL, we show that treatment with simvastatin, which inhibits protein farnesylation and geranylgeranylation, sensitizes DLBCL cells to cytotoxic treatment. Treatment with the farnesyl transferase inhibitor FTI-277 or the geranylgeranyl transferase I inhibitor GGTI-298 indicates that the reduction in cell viability was restricted to inhibition of geranylgeranylation. In addition, treatment with BMS1, a combined inhibitor of farnesyl transferase and Rab GGT, resulted in a high cytostatic effect in WSU-NHL cells, demonstrated by reduced cell viability and decreased proliferation. Co-treatment of BMS1 or GGTI-298 with CHOP showed synergistic effects with regard to markers of apoptosis. We propose that inhibition of protein geranylgeranylation together with conventional cytostatic therapy is a potential novel strategy for treating patients with CHOP refractory DLBCL.

  16. New World feline APOBEC3 potently controls inter-genus lentiviral transmission.

    Science.gov (United States)

    Konno, Yoriyuki; Nagaoka, Shumpei; Kimura, Izumi; Yamamoto, Keisuke; Kagawa, Yumiko; Kumata, Ryuichi; Aso, Hirofumi; Ueda, Mahoko Takahashi; Nakagawa, So; Kobayashi, Tomoko; Koyanagi, Yoshio; Sato, Kei

    2018-04-10

    The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3; A3) gene family appears only in mammalian genomes. Some A3 proteins can be incorporated into progeny virions and inhibit lentiviral replication. In turn, the lentiviral viral infectivity factor (Vif) counteracts the A3-mediated antiviral effect by degrading A3 proteins. Recent investigations have suggested that lentiviral vif genes evolved to combat mammalian APOBEC3 proteins, and have further proposed that the Vif-A3 interaction may help determine the co-evolutionary history of cross-species lentiviral transmission in mammals. Here we address the co-evolutionary relationship between two New World felids, the puma (Puma concolor) and the bobcat (Lynx rufus), and their lentiviruses, which are designated puma lentiviruses (PLVs). We demonstrate that PLV-A Vif counteracts the antiviral action of APOBEC3Z3 (A3Z3) of both puma and bobcat, whereas PLV-B Vif counteracts only puma A3Z3. The species specificity of PLV-B Vif is irrespective of the phylogenic relationships of feline species in the genera Puma, Lynx and Acinonyx. We reveal that the amino acid at position 178 in the puma and bobcat A3Z3 is exposed on the protein surface and determines the sensitivity to PLV-B Vif-mediated degradation. Moreover, although both the puma and bobcat A3Z3 genes are polymorphic, their sensitivity/resistance to PLV Vif-mediated degradation is conserved. To the best of our knowledge, this is the first study suggesting that the host A3 protein potently controls inter-genus lentiviral transmission. Our findings provide the first evidence suggesting that the co-evolutionary arms race between lentiviruses and mammals has occurred in the New World.

  17. Expression of P2X7R in breast cancer tissue and the induction of apoptosis by the gene-specific shRNA in MCF-7 cells

    OpenAIRE

    TAN, CHAO; HAN, LI; ZOU, LILI; LUO, CHUNHUA; LIU, AIHUA; SHENG, XIEJING; XI, DEE

    2015-01-01

    The aim of the present study was to investigate the effects of P2X7R short hairpin (sh)RNA on the proliferation and apoptosis of MCF-7 cells, and to detect the expression of P2X7R in breast cancer and MCF-7 cells. In order to detect the expression of P2X7R in normal breast and breast cancer tissues, quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blot analysis and immunohistochemistry were performed. A P2X7-targeted shRNA sequence and a scrambled sequence were ...

  18. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  19. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  20. Effect of chopping time and heating on1H nuclear magnetic resonance and rheological behavior of meat batter matrix.

    Science.gov (United States)

    Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong

    2017-12-27

    The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.

  1. Tracking differentiating neural progenitors in pluripotent cultures using microRNA-regulated lentiviral vectors.

    Science.gov (United States)

    Sachdeva, Rohit; Jönsson, Marie E; Nelander, Jenny; Kirkeby, Agnete; Guibentif, Carolina; Gentner, Bernhard; Naldini, Luigi; Björklund, Anders; Parmar, Malin; Jakobsson, Johan

    2010-06-22

    In this study, we have used a microRNA-regulated lentiviral reporter system to visualize and segregate differentiating neuronal cells in pluripotent cultures. Efficient suppression of transgene expression, specifically in undifferentiated pluripotent cells, was achieved by using a lentiviral vector expressing a fluorescent reporter gene regulated by microRNA-292. Using this strategy, it was possible to track progeny from murine ES, human ES cells, and induced pluripotent stem cells as they differentiated toward the neural lineage. In addition, this strategy was successfully used to FACS purify neuronal progenitors for molecular analysis and transplantation. FACS enrichment reduced tumor formation and increased survival of ES cell-derived neuronal progenitors after transplantation. The properties and versatility of the microRNA-regulated vectors allows broad use of these vectors in stem cell applications.

  2. Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

    Directory of Open Access Journals (Sweden)

    Dismuke Adria D

    2009-07-01

    Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

  3. Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

    Directory of Open Access Journals (Sweden)

    Kohn Aimee

    2009-01-01

    Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

  4. Lentiviral vectors in neurodegenrative disorders - Aspects in gene therapy and disease models

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup

    2009-01-01

    Neurodegenerative disorders remain a complex group of diseases (i.e. Huntington's disease, HD) that are characterized by progressive loss of neurons resulting in movement disorders, cognitive decline, dementia and death. There is no cure for these diseases and treatment relies on symptomatic relief......, which is most often only satisfactory in the initial phase of the disease. Gene therapy is a novel treatment strategy intended to treat or alleviate disease by genetically modifying cells by introducing nucleic acids into the cells. Lentiviral vectors hold great promise as gene transfer vectors...... and in vivo. Robust gene knock-down was shown using a ubiquitous promoter (CMV) and for the first time neuron specific RNAi was obtained using a neuron specific promoter (NSE). Furthermore, optimization of lentiviral vectors was conducted using an insulator element (cHS4) in order to enhance transgene...

  5. Role of PSIP1/LEDGF/p75 in lentiviral infectivity and integration targeting.

    Directory of Open Access Journals (Sweden)

    Heather M Marshall

    2007-12-01

    Full Text Available To replicate, lentiviruses such as HIV must integrate DNA copies of their RNA genomes into host cell chromosomes. Lentiviral integration is favored in active transcription units, which allows efficient viral gene expression after integration, but the mechanisms directing integration targeting are incompletely understood. A cellular protein, PSIP1/LEDGF/p75, binds tightly to the lentiviral-encoded integrase protein (IN, and has been reported to be important for HIV infectivity and integration targeting.Here we report studies of lentiviral integration targeting in 1 human cells with intensified RNAi knockdowns of PSIP1/LEDGF/p75, and 2 murine cells with homozygous gene trap mutations in the PSIP1/LEDGF/p75 locus. Infections with vectors derived from equine infections anemia virus (EIAV and HIV were compared. Integration acceptor sites were analyzed by DNA bar coding and pyrosequencing.In both PSIP1/LEDGF/p75-depleted cell lines, reductions were seen in lentiviral infectivity compared to controls. For the human cells, integration was reduced in transcription units in the knockdowns, and this reduction was greater than in our previous studies of human cells less completely depleted for PSIP1/LEDGF/p75. For the homozygous mutant mouse cells, similar reductions in integration in transcription units were seen, paralleling a previous study of a different mutant mouse line. Integration did not become random, however-integration in transcription units in both cell types was still favored, though to a reduced degree. New trends also appeared, including favored integration near CpG islands. In addition, we carried out a bioinformatic study of 15 HIV integration site data sets in different cell types, which showed that the frequency of integration in transcription units was correlated with the cell-type specific levels of PSIP1/LEDGF/p75 expression.

  6. Lentiviral Vector Design and Imaging Approaches to Visualize the Early Stages of Cellular Reprogramming

    OpenAIRE

    Warlich, Eva; Kuehle, Johannes; Cantz, Tobias; Brugman, Martijn H; Maetzig, Tobias; Galla, Melanie; Filipczyk, Adam A; Halle, Stephan; Klump, Hannes; Schöler, Hans R; Baum, Christopher; Schroeder, Timm; Schambach, Axel

    2011-01-01

    Induced pluripotent stem cells (iPSCs) can be derived from somatic cells by gene transfer of reprogramming transcription factors. Expression levels of these factors strongly influence the overall efficacy to form iPSC colonies, but additional contribution of stochastic cell-intrinsic factors has been proposed. Here, we present engineered color-coded lentiviral vectors in which codon-optimized reprogramming factors are co-expressed by a strong retroviral promoter that is rapidly silenced in iP...

  7. Expression characteristics of dual-promoter lentiviral vectors targeting retinal photoreceptors and M?ller cells

    OpenAIRE

    Semple-Rowland, Susan L.; Coggin, William E.; Geesey, Mero; Eccles, Kristofer S.; Abraham, Leah; Pachigar, Krunal; Ludlow, Rachel; Khani, Shahrokh C.; Smith, W. Clay

    2010-01-01

    Purpose Growing evidence suggests that successful treatment of many inherited photoreceptor diseases will require multi-protein therapies that not only correct the genetic defects linked to these diseases but also slow or halt the related degenerative phenotypes. To be effective, it is likely that therapeutic protein expression will need to be targeted to specific cell types. The purpose of this study was to develop dual-promoter lentiviral vectors that target expression of two proteins to re...

  8. Elements of lentiviral vector design toward gene therapy for treating mucopolysaccharidosis I

    Directory of Open Access Journals (Sweden)

    Li Ou

    2016-09-01

    Full Text Available Mucopolysaccharidosis type I (MPS I is a lysosomal disease caused by α-l-iduronidase (IDUA deficiency and accumulation of glycosaminoglycans (GAG. Lentiviral vector encoding correct IDUA cDNA could be used for treating MPS I. To optimize the lentiviral vector design, 9 constructs were designed by combinations of various promoters, enhancers, and codon optimization. After in vitro transfection into 293FT cells, 5 constructs achieved the highest IDUA activities (5613 to 7358 nmol/h/mg protein. These 5 candidate vectors were then tested by injection (1 × 107 TU/g into neonatal MPS I mice. After 30 days, one vector, CCEoIDW, achieved the highest IDUA levels: 2.6% of wildtype levels in the brain, 9.9% in the heart, 200% in the liver and 257% in the spleen. CCEoIDW achieved the most significant GAG reduction: down 49% in the brain, 98% in the heart, 100% in the liver and 95% in the spleen. Further, CCEoIDW had the lowest transgene frequency, especially in the gonads (0.03 ± 0.01 copies/100 cells, reducing the risk of insertional mutagenesis and germ-line transmission. Therefore, CCEoIDW is selected as the optimal lentiviral vector for treating MPS I disease and will be applied in large animal preclinical studies. Further, taken both in vitro and in vivo comparisons together, codon optimization, use of EF-1α promoter and woodchuck hepatitis virus posttranscriptional response element (WPRE could enhance transgene expression. These results provided a better understanding of factors contributing efficient transgene expression in lentiviral gene therapies.

  9. RFQ-, chopping- and funneling-studies for the ESS-injector-linac

    International Nuclear Information System (INIS)

    Schempp, A.; Madlung, J.; Firjahn-Andersch, A.; Deitinghoff, H.; Parisi, G.

    1996-01-01

    The front end of the ESS Linac has to provide a bunched high current H-beam with a special time structure for injection into the following DTL. This can be achieved by a system of two 175 MHz RFQ lines, each with a current of 54 mA, whose beams will be combined in a funnel section to a 107 mA beam with a bunch repetition rate of 350 MHz. For a proper operation of the compressor rings the linac beam must be chopped with a 60 % duty factor at the ring revolution frequency of 1.67 MHz which implies beam pulses of 360 ns and gaps of 240 ns during the macro pulse of 1.2 ms. A layout of the chopping line will be presented. A new concept for beam funneling using a two-beam RFQ and a multigap funneling deflector will be discussed. (author)

  10. A Comparative study of two RVE modelling methods for chopped carbon fiber SMC

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zhangxing; Li, Yi; Shao, Yimin; Huang, Tianyu; Xu, Hongyi; Li, Yang; Chen, Wei; Zeng, Danielle; Avery, Katherine; Kang, HongTae; Su, Xuming

    2017-04-06

    To achieve vehicle light-weighting, the chopped carbon fiber sheet molding compound (SMC) is identified as a promising material to replace metals. However, there are no effective tools and methods to predict the mechanical property of the chopped carbon fiber SMC due to the high complexity in microstructure features and the anisotropic properties. In this paper, the Representative Volume Element (RVE) approach is used to model the SMC microstructure. Two modeling methods, the Voronoi diagram-based method and the chip packing method, are developed for material RVE property prediction. The two methods are compared in terms of the predicted elastic modulus and the predicted results are validated using the Digital Image Correlation (DIC) tensile test results. Furthermore, the advantages and shortcomings of these two methods are discussed in terms of the required input information and the convenience of use in the integrated processing-microstructure-property analysis.

  11. Challenges of reservoir properties and production history matching in a CHOPS reservoir study

    Energy Technology Data Exchange (ETDEWEB)

    Alam, Mahbub [Department of Geoscience, University of Calgary (Canada)

    2011-07-01

    In order to meet increasing world energy demand, wells have to be drilled within very thin reservoir beds. This paper, we present one of the solutions for optimizing the reservoir characterization. Reservoir characterization is the process between the discovery of a property and the reservoir management phase. Principal data for reservoir modeling are: 4D Seismic interpretation, wireline log interpretation, core analysis, and petrophysical analysis. Reservoir conditions, perforation and completion technology are the key issues to the production rate of cold production. Reservoir modeling intends to minimize the risk factor, maximize production, and help determine the location for infill drillings. Cold heavy oil production with sand (CHOPS) is a method for enhancing primary production from heavy oil reservoirs. Gravitational forces, natural fluid pressure gradients and foamy oil flow phenomena are the major driving forces of the CHOPS mechanism. Finally, Reservoir characterization allows better understanding of permeability and porosity prediction.

  12. Einzel lens chopper and behavior of the chopped beam in the KEK digital accelerator

    Directory of Open Access Journals (Sweden)

    K. W. Leo

    2013-04-01

    Full Text Available The KEK digital accelerator (KEK-DA, which is a small-scale rapid-cycle induction synchrotron (IS, has commenced operation. A permanent magnet x-band electron cyclotron resonance ion source serves as the KEK-DA ion source and delivers various ions. A new Einzel lens beam chopper has been developed to provide the necessary pulse width of a few microseconds. The chopper is implemented by applying a rectangular pulse voltage generated by a solid-state Marx generator to the middle electrode of the Einzel lens. Momentum modulation at the bunch head and tail resulting from chopping in longitudinal direction has been observed. This intrinsic property of the chopped pulse has been clearly observed in a long drift (a free run in the circular ring in KEK-DA.

  13. [Construction and identification of Nogo extra cellular peptide residues 1-40 gene lentiviral vector].

    Science.gov (United States)

    Yuan, Haifeng; Song, Yueming; Liu, Hao; Zhou, Chunguang; Kong, Qingquan; Liu, Liming; Gong, Quan

    2012-02-01

    To construct a lentiviral expression vector carrying Nogo extra cellular peptide residues 1-40 (NEP1-40) and to obtain NEP1-40 efficient and stable expression in mammalian cells. The DNA fragment of NEP1-40 coding sequence was amplified by PCR with designed primer from the cDNA library including NEP1-40 gene, and then subcloned into pGC-FU vector with in-fusion technique to generate the lentiviral expression vector, pGC-FU-NEP1-40. The positive clones were screened by PCR and the correct NEP1-40 was confirmed by sequencing. Recombinant lentiviruses were produced in 293T cells after the cotransfection of pGC-FU-NEP1-40, and packaging plasmids of pHelper 1.0 and pHelper 2.0. Green fluorescent protein (GFP) expression of infected 293T cells was observed to evaluate gene delivery efficiency. NEP1-40 protein expression in 293T cells was detected by Western blot. The lentiviral expression vector carrying NEP1-40 was successfully constructed by GFP observation, and NEP1-40 protein expression was detected in 293T cells by Western blot. The recombinant lentivirus pGC-FU-NEP1-40 is successfully constructed and it lays a foundation for further molecular function study of NEP 1-40.

  14. Lentiviral hematopoietic stem cell gene therapy for X-linked severe combined immunodeficiency.

    Science.gov (United States)

    De Ravin, Suk See; Wu, Xiaolin; Moir, Susan; Anaya-O'Brien, Sandra; Kwatemaa, Nana; Littel, Patricia; Theobald, Narda; Choi, Uimook; Su, Ling; Marquesen, Martha; Hilligoss, Dianne; Lee, Janet; Buckner, Clarissa M; Zarember, Kol A; O'Connor, Geraldine; McVicar, Daniel; Kuhns, Douglas; Throm, Robert E; Zhou, Sheng; Notarangelo, Luigi D; Hanson, I Celine; Cowan, Mort J; Kang, Elizabeth; Hadigan, Coleen; Meagher, Michael; Gray, John T; Sorrentino, Brian P; Malech, Harry L; Kardava, Lela

    2016-04-20

    X-linked severe combined immunodeficiency (SCID-X1) is a profound deficiency of T, B, and natural killer (NK) cell immunity caused by mutations inIL2RGencoding the common chain (γc) of several interleukin receptors. Gamma-retroviral (γRV) gene therapy of SCID-X1 infants without conditioning restores T cell immunity without B or NK cell correction, but similar treatment fails in older SCID-X1 children. We used a lentiviral gene therapy approach to treat five SCID-X1 patients with persistent immune dysfunction despite haploidentical hematopoietic stem cell (HSC) transplant in infancy. Follow-up data from two older patients demonstrate that lentiviral vector γc transduced autologous HSC gene therapy after nonmyeloablative busulfan conditioning achieves selective expansion of gene-marked T, NK, and B cells, which is associated with sustained restoration of humoral responses to immunization and clinical improvement at 2 to 3 years after treatment. Similar gene marking levels have been achieved in three younger patients, albeit with only 6 to 9 months of follow-up. Lentiviral gene therapy with reduced-intensity conditioning appears safe and can restore humoral immune function to posthaploidentical transplant older patients with SCID-X1. Copyright © 2016, American Association for the Advancement of Science.

  15. Generating Transgenic Mice by Lentiviral Transduction of Spermatozoa Followed by In Vitro Fertilization and Embryo Transfer.

    Science.gov (United States)

    Chandrashekran, Anil; Casimir, Colin; Dibb, Nick; Readhead, Carol; Winston, Robert

    2016-01-01

    Most transgenic technologies rely on the oocyte as a substrate for genetic modification. Transgenics animals are usually generated by the injection of the gene constructs (including lentiviruses encoding gene constructs or modified embryonic stem cells) into the pronucleus of a fertilized egg followed by the transfer of the injected embryos into the uterus of a foster mother. Male germ cells also have potential as templates for transgenic development. We have previously shown that mature sperm can be utilized as template for lentiviral transduction and as such used to generate transgenic mice efficiently with germ line capabilities. We provide here a detailed protocol that is relatively simple, to establish transgenic mice using lentivirally transduced spermatozoa. This protocol employs a well-established lentiviral gene delivery system (usual for somatic cells) delivering a variety of transgenes to be directly used with sperm, and the subsequent use of these modified sperm in in vitro fertilization studies and embryo transfer into foster female mice, for the establishment of transgenic mice.

  16. A lentiviral gene therapy strategy for the in vitro production of feline erythropoietin.

    Directory of Open Access Journals (Sweden)

    Natalia Vapniarsky

    Full Text Available Nonregenerative anemia due to chronic renal failure is a common problem in domestic cats. Unfortunately, administration of recombinant human erythropoietin often only improves anemia temporarily due to antibody development. In this in vitro study, feline erythropoietin cDNA was cloned from feline renal tissue and utilized in the construction of a replication-defective lentiviral vector. The native recombinant feline erythropoietin (rfEPO sequence was confirmed by sequencing. Upon viral vector infection of human 293H cells, Crandall Renal Feline Kidney cell line and primary feline peripheral blood mononuclear cells, bioactive rfEPO protein was produced. The presence of cellular rfEPO cDNA was confirmed by standard PCR, production of abundant rfEPO mRNA was confirmed by real-time PCR, and secretion of rfEPO protein was demonstrated by Western blot analyses, while rfEPO protein bioactivity was confirmed via an MTT proliferation bioassay. This in vitro study demonstrates the feasibility of a replication-defective lentiviral vector delivery system for the in vitro production of biologically active feline erythropoietin. Anemic cats with chronic renal failure represent a potential in vivo application of a lentiviral gene therapy system.

  17. Development of a replication-competent lentivirus assay for dendritic cell-targeting lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Daniel C Farley

    Full Text Available It is a current regulatory requirement to demonstrate absence of detectable replication-competent lentivirus (RCL in lentiviral vector products prior to use in clinical trials. Immune Design previously described an HIV-1-based integration-deficient lentiviral vector for use in cancer immunotherapy (VP02. VP02 is enveloped with E1001, a modified Sindbis virus glycoprotein which targets dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN expressed on dendritic cells in vivo. Vector enveloped with E1001 does not transduce T-cell lines used in standard HIV-1-based RCL assays, making current RCL testing formats unsuitable for testing VP02. We therefore developed a novel assay to test for RCL in clinical lots of VP02. This assay, which utilizes a murine leukemia positive control virus and a 293F cell line expressing the E1001 receptor DC-SIGN, meets a series of evaluation criteria defined in collaboration with US regulatory authorities and demonstrates the ability of the assay format to amplify and detect a hypothetical RCL derived from VP02 vector components. This assay was qualified and used to test six independent GMP production lots of VP02, in which no RCL was detected. We propose that the evaluation criteria used to rationally design this novel method should be considered when developing an RCL assay for any lentiviral vector.

  18. A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

    Science.gov (United States)

    White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

    2017-06-12

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  19. Mechanical and abrasive wear characterization of bidirectional and chopped E-glass fiber reinforced composite materials

    International Nuclear Information System (INIS)

    Siddhartha,; Gupta, Kuldeep

    2012-01-01

    Highlights: ► Bi-directional and chopped E-glass fiber reinforced epoxy composites are fabricated. ► Three body abrasive wear behavior of fabricated composites has been assessed. ► Results are validated against existing microscopic models of Lancaster and Wang. ► Tensile strength of bi-directional E-glass fiber reinforced composites increases. ► Chopped glass fiber composites are found better in abrasive wear situations. -- Abstract: Bi-directional and chopped E-glass fiber reinforced epoxy composites are fabricated in five different (15, 20, 25, 30 and 35) wt% in an epoxy resin matrix. The mechanical characterization of these composites is performed. The three body abrasive wear behavior of fabricated composites has been assessed under different operating conditions. Abrasive wear characteristics of these composites are successfully analysed using Taguchi’s experimental design scheme and analysis of variance (ANOVA). The results obtained from these experiments are also validated against existing microscopic models of Ratner-Lancaster and Wang. It is observed that quite good linear relationships is held between specific wear rate and reciprocal of ultimate strength and strain at tensile fracture of these composites which is an indicative that the experimental results are in fair agreement with these existing models. Out of all composites fabricated it is found that tensile strength of bi-directional E-glass fiber reinforced composites increases because of interface strength enhancement. Chopped glass fiber reinforced composites are observed to perform better than bi-directional glass fiber reinforced composites under abrasive wear situations. The morphology of worn composite specimens has been examined by scanning electron microscopy (SEM) to understand about dominant wear mechanisms.

  20. Durability-Based Design Criteria for a Chopped-Glass-Fiber Automotive Structural Composite; TOPICAL

    International Nuclear Information System (INIS)

    Battiste, R.L.; Corum, J.M.; Ren, W.; Ruggles, M.B.

    1999-01-01

    This report provides recommended durability-based design criteria for a chopped-glass-fiber reinforced polymeric composite for automotive structural applications. The criteria closely follow the framework of an earlier criteria document for a continuous-strand-mat (CSM) glass-fiber reference composite. Together these design criteria demonstrate a framework that can be adapted for future random-glass-fiber composites for automotive structural applications

  1. Durability-Based Design Criteria for a Chopped-Glass-Fiber Automotive Structural Composite

    Energy Technology Data Exchange (ETDEWEB)

    Battiste, R.L.; Corum, J.M.; Ren, W.; Ruggles, M.B.

    1999-11-01

    This report provides recommended durability-based design criteria for a chopped-glass-fiber reinforced polymeric composite for automotive structural applications. The criteria closely follow the framework of an earlier criteria document for a continuous-strand-mat (CSM) glass-fiber reference composite. Together these design criteria demonstrate a framework that can be adapted for future random-glass-fiber composites for automotive structural applications.

  2. Kaempferol induces hepatocellular carcinoma cell death via endoplasmic reticulum stress-CHOP-autophagy signaling pathway.

    Science.gov (United States)

    Guo, Haiqing; Lin, Wei; Zhang, Xiangying; Zhang, Xiaohui; Hu, Zhongjie; Li, Liying; Duan, Zhongping; Zhang, Jing; Ren, Feng

    2017-10-10

    Kaempferol is a flavonoid compound that has gained widespread attention due to its antitumor functions. However, the underlying mechanisms are still not clear. The present study investigated the effect of kaempferol on hepatocellular carcinoma and its underlying mechanisms. Kaempferol induced autophagy in a concentration- and time-dependent manner in HepG2 or Huh7 cells, which was evidenced by the significant increase of autophagy-related genes. Inhibition of autophagy pathway, through 3-methyladenine or Atg7 siRNA, strongly diminished kaempferol-induced apoptosis. We further hypothesized that kaempferol can induce autophagy via endoplasmic reticulum (ER) stress pathway. Indeed, blocking ER stress by 4-phenyl butyric acid (4-PBA) or knockdown of CCAAT/enhancer-binding protein homologous protein (CHOP) with siRNA alleviated kaempferol-induced HepG2 or Huh7 cells autophagy; while transfection with plasmid overexpressing CHOP reversed the effect of 4-PBA on kaempferol-induced autophagy. Our results demonstrated that kaempferol induced hepatocarcinoma cell death via ER stress and CHOP-autophagy signaling pathway; kaempferol may be used as a potential chemopreventive agent for patients with hepatocellular carcinoma.

  3. Straight and chopped DC performance data for a reliance EV-250AT motor with a General Electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Straight and chopped DC motor performances for a Reliance EV-250AT motor with an EV-1 controller were examined. Effects of motor temperature and operating voltage are shown. It is found that the maximum motor efficiency is approximately 85% at low operating temperatures in the straight DC mode. Chopper efficiency is 95% under all operating conditions. For equal speeds, the motor operated in the chopped mode develops slightly more torque and draws more current than it does in the straight DC mode.

  4. [Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

    Science.gov (United States)

    Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

    2011-07-01

    To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

  5. Resultados de la técnica stop and chop en la facoemulsificación Results of stop and chop technique in phacoemulsification

    Directory of Open Access Journals (Sweden)

    Juan Raúl Hernández Silva

    2010-06-01

    Full Text Available OBJETIVOS: Describir los resultados morfofuncionales alcanzados con la técnica stop and chop en la cirugía de catarata por facoemulsificación (faco, en el Centro de Microcirugía Ocular del Instituto Cubano de Oftalmología "Ramón Pando Ferrer" entre Junio de 2006 y Marzo de 2009. MÉTODOS: Se realizó un estudio descriptivo, transversal en el cual el universo y la muestra del trabajo lo constituyeron todos los pacientes con diagnóstico de catarata presenil y senil, quienes cumplían con los criterios de selección y aceptaron someterse a la técnica quirúrgica señalada, lo cual correspondió a 201 ojos operados. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas; además se emplearon medias con el uso del programa de procesamiento de datos SPSS versión 11.1, donde se aplicó la prueba t de student para su comparación. RESULTADOS: Se encontró que la catarata predominó en mayores de 70 años en el 33,4 % de los pacientes. La mejor agudeza visual con corrección obtenida se incrementó hasta siete líneas en la escala de Snellen en el 93,0 % de los casos; el cilindro refractivo apenas se modificó en 0,15 dioptrías; la pérdida de células endoteliales fue de 8,2 % y las complicaciones operatorias fueron de 1,5 %. CONCLUSIONES: La edad de los pacientes sometidos a cirugía de catarata por la técnica de stop and chop fue en su mayoría de más de 70 años. La MAVC posoperatoria ganó hasta siete líneas en la escala de Snellen; el astigmatismo que se indujo en la cirugía fue menor de media dioptría; la pérdida celular y las complicaciones posoperatorias no fueron significativas.OBJECTIVES: To describe the morphofunctional results of the stop and chop technique in cataract surgery in phacoemulsification at the Eye Microsurgery Center of "Ramón Pando Ferrer" Cuban Institute of Ophthalmology from June 2006 to March 2009. METHODS: A cross-sectional descriptive study was conducted. The

  6. Resultados quirúrgicos de la facoemulsificación por técnicas de Pre Chop Surgical results of phacoemulsification by Pre Chop techniques

    Directory of Open Access Journals (Sweden)

    Juan R. Hernández Silva

    2004-12-01

    Full Text Available Este estudio se propuso determinar los resultados obtenidos con la técnica de Pre-Chop en la cirugía de catarata por facoemulsificación en el Centro de Microcirugía Ocular del Hospital Oftalmológico Docente "Ramón Pando Ferrer" en el 2001. El universo de trabajo estuvo constituido por todos los pacientes (ojos con diagnóstico de catarata presenil y senil y recibieron tratamiento quirúrgico con la técnica de Pre-Chop por facoemulsificación. Se analizaron como variables: edad, sexo, agudeza visual con corrección, microscopia endotelial y cilindro refractivo, todos en el pre y posoperatorio, así como el tiempo de ultrasonido y complicaciones más frecuentes. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas, medias y se utilizó la prueba T de Student para su comparación. Se encontró que la catarata predominó en el sexo masculino entre los 46 y los 60 años; la agudeza visual con corrección mejoró a 0.64 (20/40 como promedio, el cilindro refractivo apenas se modificó, el tiempo de ultrasonido aplicado estuvo dentro de valores normales, la pérdida de células endoteliales no fue importante y la complicación transoperatoria más frecuente fue rotura de cápsula posterior con salida de vítreo y queratitis.The aim of this paper was to determine the results obtained with the Pre Chop technique in the cataract surgery by phacoemulsification at the Center of Ocular Microsurgery of "Ramón Pando Ferrer" Ophthalmological Teaching Hospital in 2001. All the patients (eyes with diagnosis of presenile and senile cataract that received surgical treatment with the Pre Chop technique by phacoemulsification were included in the study. Variables such as age, sex, visual acuity with correction, endothelial microscopy, refractive cylinder in the pre- and postoperative, time of ultrasound and the most frequent complications, were analyzed through contingency tables with mean absolute and relative

  7. Human neutrophil elastase induces endothelial cell apoptosis by activating the PERK-CHOP branch of the unfolded protein response.

    Science.gov (United States)

    Grechowa, Irina; Horke, Sven; Wallrath, Anja; Vahl, Christian-Friedrich; Dorweiler, Bernhard

    2017-09-01

    Human neutrophil elastase impacts on atherosclerotic plaque stability by inducing apoptosis in endothelial cells. Our aim was to investigate the proapoptotic mechanism of elastase on endothelial cells and to evaluate the presence of elastase in human plaque material. Human endothelial cells were treated with purified human neutrophil elastase. Apoptosis was assayed by capsase-3/7 activation, TUNEL, and sub-G 1 assay. Activation of unfolded protein response (UPR) effector molecules binding Ig protein, soluble X-binding protein-1, protein kinase RNA-like ER kinase (PERK), and C/EBP-homologous protein (CHOP) was analyzed by RT-PCR, immunocytochemistry, and Western blot. Genetic silencing of CHOP was achieved by small interfering RNA. Elastase induces autophagic-apoptotic forms of endothelial cell death in a time- and dose-dependent manner, in conjunction with a significant increase in phosphorylation/expression of the canonical UPR-activation markers PERK and CHOP. By using CHOP knockdown, we identified CHOP as a key mediator of elastase-induced endothelial cell death. Immunohistochemical analysis of human rupture-prone plaque specimens confirmed the presence of elastase and colocalization with apoptosis. We have demonstrated for the first time that the PERK-CHOP branch of the UPR is causally involved in elastase-induced apoptosis of endothelial cells. Ex vivo analysis of human rupture-prone plaques confirmed the presence of elastase and its colocalization with markers of apoptosis. This novel role of elastase underlines the potential of combined targeting of elastase and endoplasmic reticulum stress in the prevention of plaque progression and cardiovascular events.-Grechowa, I., Horke, S., Wallrath, A., Vahl, C.-F., Dorweiler, B. Human neutrophil elastase induces endothelial cell apoptosis by activating the PERK-CHOP branch of the unfolded protein response. © FASEB.

  8. Ex-Vivo Gene Therapy Using Lentiviral Mediated Gene Transfer Into Umbilical Cord Blood Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Hanieh Jalali

    2016-02-01

    Full Text Available Background Introduction of therapeutic genes into the injured site of nervous system can be achieved using transplantation of cellular vehicles containing desired gene. To transfer exogenous genes into the cellular vehicles, lentiviral vectors are one of interested vectors because of advantages such high transduction efficiency of dividing and non-dividing cells. Unrestricted somatic stem cells are subclasses of umbilical cord blood derived stem cells which are appreciate candidates to use as cellular vehicles for ex vivo gene therapy of nervous system. Objectives In current study we investigated the effect of lentiviral vector transduction on the neuronal related features of unrestricted somatic stem cells to indicate the probable and unwanted changes related to transduction procedure. Materials and Methods In this experimental study, lentiviral vector containing green fluorescent protein (GFP were transduced into unrestricted somatic stem cells and its effect was investigated with using MTT assay, qPCR and immunohistochemistry techniques. For statistical comparison of real time PCR results, REST software (2009, Qiagen was used. Results Obtained results showed lentiviral vector transduction did not have cytotoxic effects on unrestricted somatic stem cells and did not change neuronal differentiation capacity of them as well the expression of some neuronal related genes and preserved them in multilineage situation. Conclusions In conclusion, we suggested that lentiviral vectors could be proper vectors to transfer therapeutic gene into unrestricted somatic stem cells to provide a cellular vehicle for ex vivo gene therapy of nervous system disorders.

  9. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Directory of Open Access Journals (Sweden)

    Michele E Murphy

    2016-01-01

    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  10. Expression of P2X7R in breast cancer tissue and the induction of apoptosis by the gene-specific shRNA in MCF-7 cells.

    Science.gov (United States)

    Tan, Chao; Han, L I; Zou, Lili; Luo, Chunhua; Liu, Aihua; Sheng, Xiejing; Xi, Dee

    2015-10-01

    The aim of the present study was to investigate the effects of P2X7R short hairpin (sh)RNA on the proliferation and apoptosis of MCF-7 cells, and to detect the expression of P2X7R in breast cancer and MCF-7 cells. In order to detect the expression of P2X7R in normal breast and breast cancer tissues, quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blot analysis and immunohistochemistry were performed. A P2X7-targeted shRNA sequence and a scrambled sequence were inserted into the pLKO.1 expression vector, and MCF-7 cells with stable transfection of P2X7R-shRNA and P2X7R-scrambled shRNA (control) were selected. qRT-PCR was used to detect the mRNA expression levels of P2X7R in the MCF-7 cells transfected with P2X7R-shRNA and scrambled shRNA. In addition, protein expression levels of P2X7R in the fresh tumor tissues were detected by western blot analysis. An MTT assay was used to detect the proliferation rate at different time points, while flow cytometry was used to detect the growth inhibition and apoptosis rate of the stably transfected MCF-7 cells. P2X7R expression levels in the breast cancer tissues were higher when compared with the normal breast tissue, and a positive correlation was observed with the estrogen receptor (ER + ), as shown by qRT-PCR, western blot analysis and immunohistochemistry. Plasmids expressing P2X7 gene-specific shRNA and scrambled shRNA were constructed and transfected into MCF-7 cells. The qRT-PCR results revealed lower mRNA expression levels of P2X7 in the P2X7R-shRNA cells when compared with the scrambled shRNA cells. Furthermore, western blot analysis demonstrated that P2X7 protein was highly expressed in the MCF-7 cells transfected with scrambled shRNA, while low expression was observed in the P2X7R-shRNA-transfected cells. Following transfection of the recombinant plasmids into the MCF-7 cells, the proliferation rate in each group was analyzed. The P2X7R-shRNA and KN-62 groups were shown to have

  11. Outcome of elderly patients with diffuse large B-cell lymphoma treated with R-CHOP: results from the UK NCRI R-CHOP14v21 trial with combined analysis of molecular characteristics with the DSHNHL RICOVER-60 trial.

    Science.gov (United States)

    Kühnl, A; Cunningham, D; Counsell, N; Hawkes, E A; Qian, W; Smith, P; Chadwick, N; Lawrie, A; Mouncey, P; Jack, A; Pocock, C; Ardeshna, K M; Radford, J; McMillan, A; Davies, J; Turner, D; Kruger, A; Johnson, P W; Gambell, J; Rosenwald, A; Ott, G; Horn, H; Ziepert, M; Pfreundschuh, M; Linch, D

    2017-07-01

    There is an on-going debate whether 2- or 3-weekly administration of R-CHOP is the preferred first-line treatment for elderly patients with diffuse large B-cell lymphoma (DLBCL). The UK NCRI R-CHOP14v21 randomized phase 3 trial did not demonstrate a difference in outcomes between R-CHOP-14 and R-CHOP-21 in newly diagnosed DLBCL patients aged 19-88 years, but data on elderly patients have not been reported in detail so far. Here, we provide a subgroup analysis of patients ≥60 years treated on the R-CHOP14v21 trial with extended follow-up. Six hundred and four R-CHOP14v21 patients ≥60 years were included in this subgroup analysis, with a median follow-up of 77.7 months. To assess the impact of MYC rearrangements (MYC-R) and double-hit-lymphoma (DHL) on outcome in elderly patients, we performed a joint analysis of cases with available molecular data from the R-CHOP14v21 (N = 217) and RICOVER-60 (N = 204) trials. Elderly DLBCL patients received high dose intensities with median total doses of ≥98% for all agents. Toxicities were similar in both arms with the exception of more grade ≥3 neutropenia (P elderly patient population had a favorable 5-year overall survival (OS) of 69% (95% CI: 65-73). We did not identify any subgroup of patients that showed differential response to either regimen. In multivariable analysis including individual factors of the IPI, gender, bulk, B2M and albumin levels, only age and B2M were of independent prognostic significance for OS. Molecular analyses demonstrated a significant impact of MYC-R (HR = 1.96; 95% CI: 1.22-3.16; P = 0.01) and DHL (HR = 2.21; 95% CI: 1.18-4.11; P = 0.01) on OS in the combined trial cohorts, independent of other prognostic factors. Our data support equivalence of both R-CHOP application forms in elderly DLBCL patients. Elderly MYC-R and DHL patients have inferior prognosis and should be considered for alternative treatment approaches. ISCRTN 16017947 (R-CHOP14v21); NCT

  12. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  13. Enhancing the throughput and multiplexing capabilities of next generation sequencing for efficient implementation of pooled shRNA and CRISPR screens.

    Science.gov (United States)

    Islam, Md Fahmid; Watanabe, Atsushi; Wong, Lai; Lazarou, Conor; Vizeacoumar, Frederick S; Abuhussein, Omar; Hill, Wayne; Uppalapati, Maruti; Geyer, C Ronald; Vizeacoumar, Franco J

    2017-04-21

    Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This results in polyclonal, low quality, and incomplete reads and reduces sequencing throughput. Unfortunately, this challenge is significantly magnified in low-to-medium throughput bench-top sequencers as failed reads significantly perturb the maximization of sequence coverage and multiplexing capabilities. Here, we report a methodology that can be adapted to maximize the coverage on a bench-top, Ion PGM System for smaller shRNA libraries with high efficiency. This ligation-based, half-shRNA sequencing strategy minimizes failed sequences and is also equally amenable to high-throughput sequencers for increased multiplexing. Towards this, we also demonstrate that our strategy to reduce heteroduplex formation improves multiplexing capabilities of pooled CRISPR screens using Illumina NextSeq 500. Overall, our method will facilitate sequencing of pooled shRNA or CRISPR libraries from genomic DNA and maximize sequence coverage.

  14. Transgenic quail production by microinjection of lentiviral vector into the early embryo blood vessels.

    Directory of Open Access Journals (Sweden)

    Zifu Zhang

    Full Text Available Several strategies have been used to generate transgenic birds. The most successful method so far has been the injection of lentiviral vectors into the subgerminal cavity of a newly laid egg. We report here a new, easy and effective way to produce transgenic quails through direct injection of a lentiviral vector, containing an enhanced-green fluorescent protein (eGFP transgene, into the blood vessels of quail embryos at Hamburger-Hamilton stage 13-15 (HH13-15. A total of 80 embryos were injected and 48 G0 chimeras (60% were hatched. Most injected embryo organs and tissues of hatched quails were positive for eGFP. In five out of 21 mature G0 male quails, the semen was eGFP-positive, as detected by polymerase chain reaction (PCR, indicating transgenic germ line chimeras. Testcross and genetic analyses revealed that the G0 quail produced transgenic G1 offspring; of 46 G1 hatchlings, 6 were transgenic (6/46, 13.0%. We also compared this new method with the conventional transgenesis using stage X subgerminal cavity injection. Total 240 quail embryos were injected by subgerminal cavity injection, of which 34 (14.1% were hatched, significantly lower than the new method. From these hatched quails semen samples were collected from 19 sexually matured males and tested for the transgene by PCR. The transgene was present in three G0 male quails and only 4/236 G1 offspring (1.7% were transgenic. In conclusion, we developed a novel bird transgenic method by injection of lentiviral vector into embryonic blood vessel at HH 13-15 stage, which result in significant higher transgenic efficiency than the conventional subgerminal cavity injection.

  15. [RelB silencing in mouse bone-marrow derived dendritic cells mediated by lentiviral vector].

    Science.gov (United States)

    Bao, Jie; Wang, Qian; Zheng, Lei; Qiu, Yu-rong; Zeng, Fang-yin; Yang, Chun-li; Huang, Xian-zhang

    2008-09-01

    To silence RelB gene in mouse bone-marrow derived dendritic cells (DC) utilizing lentiviral vector, a novel tolerogenic dendritic cell with a relatively low expression level RelB was constructed and a new way to treat and prevent autoimmune diseases was explored. Interferential targeting sequence R5 of RelB in mice was designed, synthesized and cloned into lentiviral vectors. Together with viral packaging materials were co-cultured in 293FT cell line to package lentiviral vector. Supernatant fluids were harvested, then virus titer detected. Mouse bone marrow derived DCs were infected by lentivirus particle. RelB gene expression level was detected by RT-PCR and immunofluorescence staining and analyzed by software of geo pro. There are three experiment control groups including immature DC, mature DC and DC infected by a negative independent control of T6. A similar RelB expression was detected by RT-PCR and immunofluorescence staining assay between DC infected virus R5 and immature DC, but was lower than that of mature DC. Significant difference in statistics P < 0.05. A similar RelB expression was detected by RT-PCR and immunofluorescence staining approaches between DC infected virus T6 and mature DC, but was higher than that of immature DC. Significant difference in statistics P < 0.05. RelB gene expressed by mouse bone marrow derived DC was silenced by Lentivirus vector effectively. The lentivirus vector with a low immunogenicity can be used to immunotherapy in vivo and overcome difficult transfection problem of primary DC. A new viral vector of DC immunotherapy can be obtained.

  16. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung [School of Medicine, Chonnam National University, Gwangju (Korea, Republic of); Kim, Yeon Soo [Schoole of Medicine, Inje University, Seoul (Korea, Republic of)

    2004-07-01

    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells.

  17. Feline immunodeficiency virus cross-species transmission: Implications for emergence of new lentiviral infections

    Science.gov (United States)

    Lee, Justin; Malmberg, Jennifer L.; Wood, Britta A.; Hladky, Sahaja; Troyer, Ryan; Roelke, Melody; Cunningham, Mark W.; McBride, Roy; Vickers, Winston; Boyce, Walter; Boydston, Erin E.; Serieys, Laurel E.K.; Riley, Seth P D; Crooks, Kevin R.; VandeWoude, Sue

    2016-01-01

    Owing to a complex history of host-parasite coevolution, lentiviruses exhibit a high degree of species specificity. Given the well-documented viral archeology of HIV emergence following human exposures to SIV, understanding processes that promote successful cross-species lentiviral transmissions is highly relevant. We have previously reported natural cross-species transmission of a subtype of feline immunodeficiency virus, puma lentivirus A (PLVA), between bobcats (Lynx rufus) and mountain lions (Puma concolor) in a small number of animals in California and Florida. In this study we investigate host-specific selection pressures, within-host viral fitness, and inter- vs. intra-species transmission patterns among a larger collection of PLV isolates from free-ranging bobcats and mountain lions. Analysis of proviral and viral RNA levels demonstrates that PLVA fitness is severely restricted in mountain lions compared to bobcats. We document evidence of diversifying selection in three of six PLVA genomes from mountain lions, but did not detect selection among twenty PLVA isolates from bobcats. These findings support that PLVA is a bobcat-adapted virus, which is less fit in mountain lions and under intense selection pressure in the novel host. Ancestral reconstruction of transmission events reveals intraspecific PLVA transmission has occurred among panthers (Puma concolor coryi) in Florida following initial cross-species infection from bobcats. In contrast, interspecific transmission from bobcats to mountain lions predominates in California. These findings document outcomes of cross-species lentiviral transmission events among felids that compare to emergence of HIV from nonhuman primates.IMPORTANCE Cross-species transmission episodes can be singular, dead-end events or can result in viral replication and spread in the new species. The factors that determine which outcome will occur are complex, and the risk of new virus emergence is therefore difficult to predict. Here

  18. Feline Immunodeficiency Virus Cross-Species Transmission: Implications for Emergence of New Lentiviral Infections.

    Science.gov (United States)

    Lee, Justin; Malmberg, Jennifer L; Wood, Britta A; Hladky, Sahaja; Troyer, Ryan; Roelke, Melody; Cunningham, Mark; McBride, Roy; Vickers, Winston; Boyce, Walter; Boydston, Erin; Serieys, Laurel; Riley, Seth; Crooks, Kevin; VandeWoude, Sue

    2017-03-01

    Owing to a complex history of host-parasite coevolution, lentiviruses exhibit a high degree of species specificity. Given the well-documented viral archeology of human immunodeficiency virus (HIV) emergence following human exposures to simian immunodeficiency virus (SIV), an understanding of processes that promote successful cross-species lentiviral transmissions is highly relevant. We previously reported natural cross-species transmission of a subtype of feline immunodeficiency virus, puma lentivirus A (PLVA), between bobcats ( Lynx rufus ) and mountain lions ( Puma concolor ) for a small number of animals in California and Florida. In this study, we investigate host-specific selection pressures, within-host viral fitness, and inter- versus intraspecies transmission patterns among a larger collection of PLV isolates from free-ranging bobcats and mountain lions. Analyses of proviral and viral RNA levels demonstrate that PLVA fitness is severely restricted in mountain lions compared to that in bobcats. We document evidence of diversifying selection in three of six PLVA genomes from mountain lions, but we did not detect selection among 20 PLVA isolates from bobcats. These findings support the hypothesis that PLVA is a bobcat-adapted virus which is less fit in mountain lions and under intense selection pressure in the novel host. Ancestral reconstruction of transmission events reveals that intraspecific PLVA transmission has occurred among panthers ( Puma concolor coryi ) in Florida following the initial cross-species infection from bobcats. In contrast, interspecific transmission from bobcats to mountain lions predominates in California. These findings document outcomes of cross-species lentiviral transmission events among felids that compare to the emergence of HIV from nonhuman primates. IMPORTANCE Cross-species transmission episodes can be singular, dead-end events or can result in viral replication and spread in the new species. The factors that determine which

  19. Resting lymphocyte transduction with measles virus glycoprotein pseudotyped lentiviral vectors relies on CD46 and SLAM

    International Nuclear Information System (INIS)

    Zhou Qi; Schneider, Irene C.; Gallet, Manuela; Kneissl, Sabrina; Buchholz, Christian J.

    2011-01-01

    The measles virus (MV) glycoproteins hemagglutinin (H) and fusion (F) were recently shown to mediate transduction of resting lymphocytes by lentiviral vectors. MV vaccine strains use CD46 or signaling lymphocyte activation molecule (SLAM) as receptor for cell entry. A panel of H protein mutants derived from vaccine strain or wild-type MVs that lost or gained CD46 or SLAM receptor usage were investigated for their ability to mediate gene transfer into unstimulated T lymphocytes. The results demonstrate that CD46 is sufficient for efficient vector particle association with unstimulated lymphocytes. For stable gene transfer into these cells, however, both MV receptors were found to be essential.

  20. R-CHOP with dose-attenuated radiation therapy could induce good prognosis in gastric diffuse large B cell lymphoma

    Directory of Open Access Journals (Sweden)

    Mishima Yuko

    2012-09-01

    Full Text Available Abstract Background The treatment strategy for gastric diffuse large cell lymphoma (DLBCL has not been standardized in such as to the cycles of chemotherapy, dose of radiation, or necessity for the surgery. Although the results of CHOP or R-CHOP treatments have demonstrated the good prognosis, the treatments have been controversial in many cases. Methods We retrospectively analyzed 40 gastric DLBCL patients receiving chemotherapy with or without radiation in our institute. Those in stages II-IV were treated with six cycles of R-CHOP without radiation; for those in stage I, we administered three cycles of R-CHOP with radiation. Results The three-year overall survival (OS and progression-free survival (PFS rates were 95.2 and 91.8%, respectively. Those in stage I obtained 100% of OS. The radiation dose prescribed was 30.6 Gy for CR cases and 39.6 to 40 Gy for PR after chemotherapy. Although survival rates tended to correlate with staging groups or age-adjusted IPI classifications, multivariate statistical analysis did not show clear differences. All 14 patients with initial bleeding were successfully managed without surgery during treatment. Conclusion R-CHOP therapy was very effective for gastric DLBCL. It may be not necessary to use more than 30.6 Gy of radiotherapy in the highly chemo-sensitive cases. Less toxic treatments should be made available to gastric DLBCL patients.

  1. MYC-rearranged lymphomas other than Burkitt: Comparison between R-CHOP and Burkitt-type immunochemotherapy.

    Science.gov (United States)

    Baptista, Maria Joao; Tapia, Gustavo; Hernández-Rivas, José-Ángel; Martínez-Trillos, Alejandra; Mate, José-Luis; Navarro, José-Tomás

    2017-10-23

    MYC-rearranged (MYC-R) lymphomas other than Burkitt lymphoma (BL) are very aggressive, with poor prognosis when treated with standard regimens. We aimed to study the characteristics and outcome of a series of MYC-R lymphomas comparing the treatment results between R-CHOP based and a specific intensive regimen for BL (BURKIMAB). Retrospective study of patients diagnosed with MYC-R. Translocations of MYC, BCL2 and BCL6 were evaluated by fluorescent in situ hybridization. Patients were treated with either, R-CHOP based immunochemotherapy or the Burkitt type regimen, BURKIMAB. Thirty-four MYC-R lymphoma cases were studied: 21 treated with R-CHOP and 13 treated with BURKIMAB. There were no differences in CR rate; 45% (9/20) for R-CHOP and 42% (5/12) for BURKIMAB (P=.99). Although overall survival (OS) and progression free survival (PFS) of BURKIMAB-treated patients were better than those of R-CHOP-treated (3y-OS: 46 vs. 24%; 3y-PFS: 46 vs. 10%), the differences were not statistically significant. MYC-R lymphomas show poor outcomes even when treated with intensive immunochemotherapy for BL. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  2. Chop Suey as Imagined Authentic Chinese Food: The Culinary Identity of Chinese Restaurants in the United States

    Directory of Open Access Journals (Sweden)

    Haiming Liu

    2009-02-01

    Full Text Available

    At least until the 1960s, chop suey was synonymous with Chinese food in the United States, where most Chinese restaurants were called chop suey houses. By uncovering the history of chop suey, this article analyzes the development of Chinese cuisine in the U.S. as an example of transnational cultural exchange. The authenticity and culinary identity of Chinese food in America often rested on its real or imagined Chinese roots while its popularity depended on how well Chinese restaurant proprietors adapted the flavors, ingredients, and cooking methods of Chinese cuisine to the tastes and markets of local American communities. The dynamic interaction between Chinese food and American customers functioned as a complex cultural negotiation. While Chinese restaurants helped shape the American diet, Chinese food was at the same time being shaped and transformed by American popular taste. By appealing to a wide range of American diners, chop suey eventually evolved into a popular American ethnic food and a central component in the culinary identity of Chinese restaurants. Chop suey generated numerous jobs for Chinese immigrants and established a culinary bond between Chinese food and American customers. Also, as an imagined authentic Chinese dish, it represented a type of affordable exoticism in the eyes of American consumers, meeting not only American tastes but also their social expectations of Chinese culture.

  3. A comparison of foamy and lentiviral vector genotoxicity in SCID-repopulating cells shows foamy vectors are less prone to clonal dominance

    Directory of Open Access Journals (Sweden)

    Elizabeth M Everson

    2016-01-01

    Full Text Available Hematopoietic stem cell (HSC gene therapy using retroviral vectors has immense potential, but vector-mediated genotoxicity limits use in the clinic. Lentiviral vectors are less genotoxic than gammaretroviral vectors and have become the vector of choice in clinical trials. Foamy retroviral vectors have a promising integration profile and are less prone to read-through transcription than gammaretroviral or lentiviral vectors. Here, we directly compared the safety and efficacy of foamy vectors to lentiviral vectors in human CD34+ repopulating cells in immunodeficient mice. To increase their genotoxic potential, foamy and lentiviral vectors with identical transgene cassettes with a known genotoxic spleen focus forming virus promoter were used. Both vectors resulted in efficient marking in vivo and a total of 825 foamy and 460 lentiviral vector unique integration sites were recovered in repopulating cells 19 weeks after transplantation. Foamy vector proviruses were observed less often near RefSeq gene and proto-oncogene transcription start sites than lentiviral vectors. The foamy vector group were also more polyclonal with fewer dominant clones (two out of six mice than the lentiviral vector group (eight out of eight mice, and only lentiviral vectors had integrants near known proto-oncogenes in dominant clones. Our data further support the relative safety of foamy vectors for HSC gene therapy.

  4. Rituximab, cyclophosphamide, doxorubicin, vincristine and prednisolone (R-CHOP) in the management of primary mediastinal B-cell lymphoma: a subgroup analysis of the UK NCRI R-CHOP 14 versus 21 trial.

    Science.gov (United States)

    Gleeson, Mary; Hawkes, Eliza A; Cunningham, David; Chadwick, Nick; Counsell, Nicholas; Lawrie, Anthony; Jack, Andrew; Smith, Paul; Mouncey, Paul; Pocock, Christopher; Ardeshna, Kirit M; Radford, John; McMillan, Andrew; Davies, John; Turner, Deborah; Kruger, Anton; Johnson, Peter W M; Gambell, Joanna; Linch, David

    2016-11-01

    We performed a subgroup analysis of the phase III UK National Cancer Research Institute R-CHOP-14 versus R-CHOP-21 (two- versus three-weekly rituximab, cyclophosphamide, doxorubicin, vincristine and prednisolone) trial to evaluate the outcomes for 50 patients with World Health Organization 2008 classified primary mediastinal B-cell lymphoma identified from the trial database. At a median follow-up of 7·2 years the 5-year progression-free survival and overall survival was 79·8% and 83·8%, respectively. An exploratory analysis raised the possibility of a better outcome in those who received R-CHOP-14 and time intensification may still, in the rituximab era, merit testing in a randomised trial in this subgroup of patients. © 2016 John Wiley & Sons Ltd.

  5. Improvement in mechanical properties of glass fiber fabric/PVC composites with chopped glass fibers and coupling agent

    Science.gov (United States)

    Lee, Jaewoong; Park, Su Bin; Lee, Joon Seok; Kim, Jong Won

    2017-07-01

    Glass fiber reinforced polyvinylchloride (PVC) composite is used widely because of its low price, chemical resistance, and dimensional stability, but most are short fiber reinforced PVC composites. Fabric reinforced composite have undulated regions, which is the only region without fiber, due to the characteristics of the weave construction, and it limits increasing the mechanical properties. Therefore, in this study, to increase the mechanical properties, the undulated regions of the glass fiber fabric/PVC composite were filled with a silane coupling agent treated chopped fiber. The physical properties, dynamic mechanical thermal properties, and mechanical properties of the prepared composite were observed. The critical fiber aspect ratio of the chopped fiber is different for each mechanical property. This shows that the fabric-reinforced composite of chopped fibers affect each of the mechanical properties differently. In addition, the silane coupling treatment increases the compatibility of the composite components, improving the mechanical properties.

  6. Lactacystin inhibits 3T3-L1 adipocyte differentiation through induction of CHOP-10 expression

    International Nuclear Information System (INIS)

    Li Xi; Huang Haiyan; Chen Jiegen; Jiang Lin; Liu Honglei; Liu Deguo; Song Tanjing; He Qun; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    Hormonal induction triggers a cascade leading to the expression of CCAAT/enhancer-binding protein(C/EBP)α and peroxisome proliferator-activated receptor (PPAR) γ, C/EBPα, and PPARγ turns on series of adipocyte genes that give rise to the adipocyte phenotype. Previous findings indicate that C/EBPβ, a transcriptional activator of the C/EBPα and PPARγ genes, is rapidly expressed after induction, but lacks DNA-binding activity and therefore cannot activate transcription of the C/EBPα and PPARγ genes early in the differentiation program. Acquisition of DNA-binding activity of C/EBPβ occurs when CHOP-10, a dominant-negative form of C/EBP family members, is down-regulated and becomes hyperphosphorylated as preadipocytes traverse the G 1 -S checkpoint of mitotic clonal expansion. Evidences are presented in this report that lactacystin, a proteasome inhibitor, up-regulated the CHOP-10 expression, blocked the DNA-binding activity of C/EBPβ, and subsequently inhibited MCE as well as adipocyte differentiation

  7. Evaluation of a simple method for chopping Penning surface-plasma source H- beams

    International Nuclear Information System (INIS)

    Smith, H.V. Jr.; Allison, P.; Schneider, J.D.; Stelzer, J.E.; Stevens, R.R. Jr.

    1995-01-01

    Accumulator rings proposed for use in high-intensity spallation-neutron sources require a chopped beam with ∼100-ns-wide particle-free gaps at 1--2 MHz rates, with fall and rise times ≤20 ns. Chopping the beam directly in the ion source may be an attractive way to provide the desired beam structure. Previous measurements showed that placing a grounded collar in the drift region just before the emission aperture lowers the e - /H - ratio in the Penning surface-plasma source H - beam. We electrically isolated the collar and biased it to modulate the extracted H - current. Positive collar bias decreases the H - beam by up to 90%. The fastest H - current fall and rise times achieved to date are 400 ns and 2 μs, respectively. The current fall time is close to the 300-ns pulser rise time. The current rise time is considerably longer than the 500-ns pulser fall time. Negative collar bias lowers the H - beam by up to 50%. Simulations indicate that the beam time structure will be preserved in transport from the ion source to the radio-frequency quadrupole entrance

  8. Solid-phase microextraction of volatile compounds from the chopped leaves of three species of Eucalyptus.

    Science.gov (United States)

    Zini, Cláudia A; Zanin, Kelen D; Christensen, Eva; Caramão, Elina B; Pawliszyn, Janusz

    2003-04-23

    Headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography and ion-trap mass spectrometry has been used to identify biogenic volatile organic compounds present in the headspace of chopped leaves of Eucalyptus (E.) dunnii, E. citriodora, and E. saligna. A simple HS-SPME method entailing 30 min of extraction at 30 degrees C was developed for this purpose. Thirty compounds were identified in the headspace of 60 juvenile chopped Eucalyptus leaves, and another 30 were tentatively identified. The presence of compounds such as (E)-4,8-dimethyl-1,3,7-nonatriene (DMNT), (E,E)-4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMNT), (E,E)-alpha-farnesene, (E,E,E)-3,7,11,15-tetramethyl-1,3,6,10,14-hexadecapentaene (TMHP), beta-caryophyllene, alpha-humulene, germacrene D, and beta-cubebene in the headspace of the leaves but not in the essential oils from the same Eucalyptus trees and information about the infochemical roles of some of these compounds in other living plant systems suggest they might play a bioactive role in Eucalyptus leaves.

  9. Fabrication of porous calcite using chopped nylon fiber and its evaluation using rats.

    Science.gov (United States)

    Ishikawa, Kunio; Tram, Nguyen Xuan Thanh; Tsuru, Kanji; Toita, Riki

    2015-02-01

    Although porous calcite has attracted attention as bone substitutes, limited studies have been made so far. In the present study, porous calcite block was fabricated by introducing chopped nylon fiber as porogen. Ca(OH)2 powder containing 10 wt% chopped nylon fiber was compacted at 150 MPa, and sintered to burn out the fiber and to carbonate the Ca(OH)2 under stream of 1:2 O2-CO2. Sintering of Ca(OH)2 at 750 °C or lower temperature resulted in incomplete burning out of the fiber whereas sintering at 800 °C or higher temperature resulted in the formation of CaO due to the thermal decomposition of Ca(OH)2. However, sintering at 770 °C resulted in complete burning out of the fiber and complete carbonation of Ca(OH)2 to calcite without forming CaO. Macro- and micro-porosities of the porous calcite were approximately 23 and 16%, respectively. Diameter of the macropores was approximately 100 μm which is suitable for bone tissue penetration. Porous calcite block fabricated by this method exhibited good tissue response when implanted in the bone defect in femur of 12-weeks-old rat. Four weeks after implantation, bone bonded on the surface of calcite. Furthermore, bone tissue penetrated interior to the macropore at 8 weeks. These results demonstrated the good potential value of porous calcite as artificial bone substitutes.

  10. CHOP THERAPY INDUCED MITOCHONDRIAL REDOX STATE ALTERATION IN NON-HODGKIN'S LYMPHOMA XENOGRAFTS

    Directory of Open Access Journals (Sweden)

    H. N. XU

    2013-04-01

    Full Text Available We are interested in investigating whether cancer therapy may alter the mitochondrial redox state in cancer cells to inhibit their growth and survival. The redox state can be imaged by the redox scanner that collects the fluorescence signals from both the oxidized-flavoproteins (Fp and the reduced form of nicotinamide adenine dinucleotide (NADH in snap-frozen tissues and has been previously employed to study tumor aggressiveness and treatment responses. Here, with the redox scanner we investigated the effects of chemotherapy on mouse xenografts of a human diffuse large B-cell lymphoma cell line (DLCL2. The mice were treated with CHOP therapy, i.e., cyclophosphamide (C + hydroxydoxorubicin (H + Oncovin (O + prednisone (P with CHO administration on day 1 and prednisone administration on days 1–5. The Fp content of the treated group was significantly decreased (p = 0.033 on day 5, and the mitochondrial redox state of the treated group was slightly more reduced than that of the control group (p = 0.048. The decrease of the Fp heterogeneity (measured by the mean standard deviation had a border-line statistical significance (p = 0.071. The result suggests that the mitochondrial metabolism of lymphoma cells was slightly suppressed and the lymphomas became less aggressive after the CHOP therapy.

  11. Chopped hemp: Logistics, compaction and financial viability; Logistik, komprimering och ekonomi angaaende hackad hampa

    Energy Technology Data Exchange (ETDEWEB)

    Soederstroem, Yvonne

    2010-05-15

    In this project compaction and logistics experiments were conducted using chopped hemp. The aim was to reduce the hemp to 250 kg/m3, as well as to identify the best possible logistical system for compaction and subsequent transportation to the end-user in terms of cost and environmental impact. The project primarily focused on landowners and power companies. Other stakeholders are industries, universities and other ongoing projects in related fields. These studies have shown that it is possible to compact chopped hemp from a density of 60 kg dm/m3 (0.30 MWh/m3) when harvesting directly into the container, to a density of 202 kg dm/m3 (1.01 MWh/m3) using the baler. The original compaction target was a volumetric weight of 250 kg/m3. It was determined that straw and hemp react similarly to compaction. This project has demonstrated that the transport rig system has the best potential for large-scale use as compared with the alternate systems used. According to our calculations, the transport rig was the most cost-effective system measured in kronor per energy content. In addition, this system is also flexible. From an environmental standpoint, however, the energy balance showed that the container system was slightly superior

  12. Genetic engineering of cell lines using lentiviral vectors to achieve antibody secretion following encapsulated implantation.

    Science.gov (United States)

    Lathuilière, Aurélien; Bohrmann, Bernd; Kopetzki, Erhard; Schweitzer, Christoph; Jacobsen, Helmut; Moniatte, Marc; Aebischer, Patrick; Schneider, Bernard L

    2014-01-01

    The controlled delivery of antibodies by immunoisolated bioimplants containing genetically engineered cells is an attractive and safe approach for chronic treatments. To reach therapeutic antibody levels there is a need to generate renewable cell lines, which can long-term survive in macroencapsulation devices while maintaining high antibody specific productivity. Here we have developed a dual lentiviral vector strategy for the genetic engineering of cell lines compatible with macroencapsulation, using separate vectors encoding IgG light and heavy chains. We show that IgG expression level can be maximized as a function of vector dose and transgene ratio. This approach allows for the generation of stable populations of IgG-expressing C2C12 mouse myoblasts, and for the subsequent isolation of clones stably secreting high IgG levels. Moreover, we demonstrate that cell transduction using this lentiviral system leads to the production of a functional glycosylated antibody by myogenic cells. Subsequent implantation of antibody-secreting cells in a high-capacity macroencapsulation device enables continuous delivery of recombinant antibodies in the mouse subcutaneous tissue, leading to substantial levels of therapeutic IgG detectable in the plasma.

  13. Lentiviral transgenesis in mice via a simple method of viral concentration.

    Science.gov (United States)

    Cheng, Pei-Hsun; Chang, Yu-Fan; Mao, Su-Han; Lin, Hsiu-Lien; Chen, Chuan-Mu; Yang, Shang-Hsun

    2016-10-01

    Transgenic animals are important in vivo models for biological research. However, low transgenic rates are commonly reported in the literature. Lentiviral transgenesis is a promising method that has greater efficiency with regard to generating transgenic animals, although the transgenic rate of this approach is highly dependent on different transgenes and concentrated lentiviruses. In this study, we modified a method to concentrate lentiviruses using a table centrifuge, commonly available in most laboratories, and carried out analysis of the transgenic efficiency in mice. Based on 26 individual constructs and 627 live pups, we found that the overall transgenic rate was more than 30%, which is higher than obtained with pronuclear microinjection. In addition, we did not find any significant differences in transgenic efficiency when the size of inserts was less than 5000 bp. These results not only show that our modified method can successfully generate transgenic mice but also suggest that this approach could be generally applied to different constructs when the size of inserts is less than 5000 bp. It is anticipated that the results of this study can help encourage the wider laboratory use of lentiviral transgenesis in mice. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Engineering Cellular Resistance to HIV-1 Infection In Vivo Using a Dual Therapeutic Lentiviral Vector

    Directory of Open Access Journals (Sweden)

    Bryan P Burke

    2015-01-01

    Full Text Available We described earlier a dual-combination anti-HIV type 1 (HIV-1 lentiviral vector (LVsh5/C46 that downregulates CCR5 expression of transduced cells via RNAi and inhibits HIV-1 fusion via cell surface expression of cell membrane-anchored C46 antiviral peptide. This combinatorial approach has two points of inhibition for R5-tropic HIV-1 and is also active against X4-tropic HIV-1. Here, we utilize the humanized bone marrow, liver, thymus (BLT mouse model to characterize the in vivo efficacy of LVsh5/C46 (Cal-1 vector to engineer cellular resistance to HIV-1 pathogenesis. Human CD34+ hematopoietic stem/progenitor cells (HSPC either nonmodified or transduced with LVsh5/C46 vector were transplanted to generate control and treatment groups, respectively. Control and experimental groups displayed similar engraftment and multilineage hematopoietic differentiation that included robust CD4+ T-cell development. Splenocytes isolated from the treatment group were resistant to both R5- and X4-tropic HIV-1 during ex vivo challenge experiments. Treatment group animals challenged with R5-tropic HIV-1 displayed significant protection of CD4+ T-cells and reduced viral load within peripheral blood and lymphoid tissues up to 14 weeks postinfection. Gene-marking and transgene expression were confirmed stable at 26 weeks post-transplantation. These data strongly support the use of LVsh5/C46 lentiviral vector in gene and cell therapeutic applications for inhibition of HIV-1 infection.

  15. Generation of transgene-free mouse induced pluripotent stem cells using an excisable lentiviral system.

    Science.gov (United States)

    Varga, E; Nemes, C; Davis, R P; Ujhelly, O; Klincumhom, N; Polgar, Z; Muenthaisong, S; Pirity, M K; Dinnyes, A

    2014-04-01

    One goal of research using induced pluripotent stem cell (iPSC) is to generate patient-specific cells which can be used to obtain multiple types of differentiated cells as disease models. Minimally or non-integrating methods to deliver the reprogramming genes are considered to be the best but they may be inefficient. Lentiviral delivery is currently among the most efficient methods but it integrates transgenes into the genome, which may affect the behavior of the iPSC if integration occurs into an important locus. Here we designed a polycistronic lentiviral construct containing four pluripotency genes with an EGFP selection marker. The cassette was excisable with the Cre-loxP system making possible the removal of the integrated transgenes from the genome. Mouse embryonic fibroblasts were reprogrammed using this viral system, rapidly resulting in large number of iPSC colonies. Based on the lowest EGFP expression level, one parental line was chosen for excision. Introduction of the Cre recombinase resulted in transgene-free iPSC subclones. The effect of the transgenes was assessed by comparing the parental iPSC with two of its transgene-free subclones. Both excised and non-excised iPSCs expressed standard pluripotency markers. The subclones obtained after Cre recombination were capable of differentiation in vitro, in contrast to the parental, non-excised cells and formed germ-line competent chimeras in vivo. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Expression profiles of Vpx/Vpr proteins are co-related with the primate lentiviral lineage

    Directory of Open Access Journals (Sweden)

    Yosuke Sakai

    2016-08-01

    Full Text Available Viruses of human immunodeficiency virus type 2 (HIV-2 and some simian immunodeficiency virus (SIV lineages carry a unique accessory protein called Vpx. Vpx is essential or critical for viral replication in natural target cells such as macrophages and T lymphocytes. We have previously shown that a poly-proline motif (PPM located at the C-terminal region of Vpx is required for its efficient expression in two strains of HIV-2 and SIVmac, and that the Vpx expression levels of the two clones are significantly different. Notably, the PPM sequence is conserved and confined to Vpx and Vpr proteins derived from certain lineages of HIV-2/SIVs. In this study, Vpx/Vpr proteins from diverse primate lentiviral lineages were experimentally and phylogenetically analyzed to obtain the general expression picture in cells. While both the level and PPM-dependency of Vpx/Vpr expression in transfected cells varied among viral strains, each viral group, based on Vpx/Vpr amino acid sequences, was found to exhibit a characteristic expression profile. Moreover, phylogenetic tree analyses on Gag and Vpx/Vpr proteins gave essentially the same results. Taken together, our study described here suggests that each primate lentiviral lineage may have developed a unique expression pattern of Vpx/Vpr proteins for adaptation to its hostile cellular and species environments in the process of viral evolution.

  17. Lentiviral vector induced insertional haploinsufficiency of Ebf1 causes murine leukemia.

    Science.gov (United States)

    Heckl, Dirk; Schwarzer, Adrian; Haemmerle, Reinhard; Steinemann, Doris; Rudolph, Cornelia; Skawran, Britta; Knoess, Sabine; Krause, Johanna; Li, Zhixiong; Schlegelberger, Brigitte; Baum, Christopher; Modlich, Ute

    2012-06-01

    Integrating vectors developed on the basis of various retroviruses have demonstrated therapeutic potential following genetic modification of long-lived hematopoietic stem and progenitor cells. Lentiviral vectors (LV) are assumed to circumvent genotoxic events previously observed with γ-retroviral vectors, due to their integration bias to transcription units in comparison to the γ-retroviral preference for promoter regions and CpG islands. However, recently several studies have revealed the potential for gene activation by LV insertions. Here, we report a murine acute B-lymphoblastic leukemia (B-ALL) triggered by insertional gene inactivation. LV integration occurred into the 8th intron of Ebf1, a major regulator of B-lymphopoiesis. Various aberrant splice variants could be detected that involved splice donor and acceptor sites of the lentiviral construct, inducing downregulation of Ebf1 full-length message. The transcriptome signature was compatible with loss of this major determinant of B-cell differentiation, with partial acquisition of myeloid markers, including Csf1r (macrophage colony-stimulating factor (M-CSF) receptor). This was accompanied by receptor phosphorylation and STAT5 activation, both most likely contributing to leukemic progression. Our results highlight the risk of intragenic vector integration to initiate leukemia by inducing haploinsufficiency of a tumor suppressor gene. We propose to address this risk in future vector design.

  18. Epigenetic changes of lentiviral transgenes in porcine stem cells derived from embryonic origin.

    Science.gov (United States)

    Choi, Kwang-Hwan; Park, Jin-Kyu; Kim, Hye-Sun; Uh, Kyung-Jun; Son, Dong-Chan; Lee, Chang-Kyu

    2013-01-01

    Because of the physiological and immunological similarities that exist between pigs and humans, porcine pluripotent cell lines have been identified as important candidates for preliminary studies on human disease as well as a source for generating transgenic animals. Therefore, the establishment and characterization of porcine embryonic stem cells (pESCs), along with the generation of stable transgenic cell lines, is essential. In this study, we attempted to efficiently introduce transgenes into Epiblast stem cell (EpiSC)-like pESCs. Consequently, a pluripotent cell line could be derived from a porcine-hatched blastocyst. Enhanced green fluorescent protein (EGFP) was successfully introduced into the cells via lentiviral vectors under various multiplicities of infection, with pluripotency and differentiation potential unaffected after transfection. However, EGFP expression gradually declined during extended culture. This silencing effect was recovered by in vitro differentiation and treatment with 5-azadeoxycytidine. This phenomenon was related to DNA methylation as determined by bisulfite sequencing. In conclusion, we were able to successfully derive EpiSC-like pESCs and introduce transgenes into these cells using lentiviral vectors. This cell line could potentially be used as a donor cell source for transgenic pigs and may be a useful tool for studies involving EpiSC-like pESCs as well as aid in the understanding of the epigenetic regulation of transgenes.

  19. Use of lentiviral vectors to deliver and express bicistronic transgenes in developing chicken embryos.

    Science.gov (United States)

    Semple-Rowland, Susan L; Berry, Jonathan

    2014-04-01

    The abilities of lentiviral vectors to carry large transgenes (∼8kb) and to efficiently infect and integrate these genes into the genomes of both dividing and non-dividing cells make them ideal candidates for transport of genetic material into cells and tissues. Given the properties of these vectors, it is somewhat surprising that they have seen only limited use in studies of developing tissues and in particular of the developing nervous system. Over the past several years, we have taken advantage of the large capacity of these vectors to explore the expression characteristics of several dual promoter and 2A peptide bicistronic transgenes in developing chick neural retina, with the goal of identifying transgene designs that reliably express multiple proteins in infected cells. Here we summarize the activities of several of these transgenes in neural retina and provide detailed methodologies for packaging lentivirus and delivering the virus into the developing neural tubes of chicken embryos in ovo, procedures that have been optimized over the course of several years of use in our laboratory. Conditions to hatch injected embryos are also discussed. The chicken-specific techniques will be of highest interest to investigators using avian embryos, development and packaging of lentiviral vectors that reliably express multiple proteins in infected cells should be of interest to all investigators whose experiments demand manipulation and expression of multiple proteins in developing cells and tissues. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Latent Membrane Protein 1 as a molecular adjuvant for single-cycle lentiviral vaccines

    Directory of Open Access Journals (Sweden)

    Rahmberg Andrew R

    2011-05-01

    Full Text Available Abstract Background Molecular adjuvants are a promising method to enhance virus-specific immune responses and protect against HIV-1 infection. Immune activation by ligands for receptors such as CD40 can induce dendritic cell activation and maturation. Here we explore the incorporation of two CD40 mimics, Epstein Barr Virus gene LMP1 or an LMP1-CD40 chimera, into a strain of SIV that was engineered to be limited to a single cycle of infection. Results Full length LMP1 or the chimeric protein LMP1-CD40 was cloned into the nef-locus of single-cycle SIV. Human and Macaque monocyte derived macrophages and DC were infected with these viruses. Infected cells were analyzed for activation surface markers by flow cytometry. Cells were also analyzed for secretion of pro-inflammatory cytokines IL-1β, IL-6, IL-8, IL-12p70 and TNF by cytometric bead array. Conclusions Overall, single-cycle SIV expressing LMP1 and LMP1-CD40 produced a broad and potent TH1-biased immune response in human as well as rhesus macaque macrophages and DC when compared with control virus. Single-cycle SIV-LMP1 also enhanced antigen presentation by lentiviral vector vaccines, suggesting that LMP1-mediated immune activation may enhance lentiviral vector vaccines against HIV-1.

  1. Targeted genome editing by lentiviral protein transduction of zinc-finger and TAL-effector nucleases.

    Science.gov (United States)

    Cai, Yujia; Bak, Rasmus O; Mikkelsen, Jacob Giehm

    2014-04-24

    Future therapeutic use of engineered site-directed nucleases, like zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), relies on safe and effective means of delivering nucleases to cells. In this study, we adapt lentiviral vectors as carriers of designer nuclease proteins, providing efficient targeted gene disruption in vector-treated cell lines and primary cells. By co-packaging pairs of ZFN proteins with donor RNA in 'all-in-one' lentiviral particles, we co-deliver ZFN proteins and the donor template for homology-directed repair leading to targeted DNA insertion and gene correction. Comparative studies of ZFN activity in a predetermined target locus and a known nearby off-target locus demonstrate reduced off-target activity after ZFN protein transduction relative to conventional delivery approaches. Additionally, TALEN proteins are added to the repertoire of custom-designed nucleases that can be delivered by protein transduction. Altogether, our findings generate a new platform for genome engineering based on efficient and potentially safer delivery of programmable nucleases.DOI: http://dx.doi.org/10.7554/eLife.01911.001. Copyright © 2014, Cai et al.

  2. beta-hexosaminidase lentiviral vectors: transfer into the CNS via systemic administration.

    Science.gov (United States)

    Kyrkanides, Stephanos; Miller, Jennie H; Brouxhon, Sabine M; Olschowka, John A; Federoff, Howard J

    2005-02-18

    Brain inflammation in GM2 gangliosidosis has been recently realized as a key factor in disease development. The aim of this study was to investigate the effects of a FIV beta-hexosaminidase vector in the brain of HexB-deficient (Sandhoff disease) mice following intraperitoneal administration to pups of neonatal age. Since brain inflammation, lysosomal storage and neuromuscular dysfunction are characteristics of HexB deficiency, these parameters were employed as experimental outcomes in our study. The ability of the lentiviral vector FIV(HEX) to infect murine cells was initially demonstrated with success in normal mouse fibroblasts and human Tay-Sachs cells in vitro. Furthermore, systemic transfer of FIV(HEX) to P2 HexB-/- knockout pups lead to transduction of peripheral and central nervous system tissues. Specifically, beta-hexosaminidase expressing cells were immunolocalized in periventricular areas of the cerebrum as well as in the cerebellar cortex. FIV(HEX) neonatal treatment resulted in reduction of GM2 storage along with attenuation of the brain inflammation and amelioration of the attendant neuromuscular deterioration. In conclusion, these results demonstrate the effective transfer of a beta-hexosaminidase lentiviral vector to the brain of Sandhoff mice and resolution of the GM2 gangliosidosis after neonatal intraperitoneal administration.

  3. Cell loss during pseudoislet formation hampers profound improvements in islet lentiviral transduction efficacy for transplantation purposes.

    Science.gov (United States)

    Callewaert, H; Gysemans, C; Cardozo, A K; Elsner, M; Tiedge, M; Eizirik, D L; Mathieu, C

    2007-01-01

    Islet transplantation is a promising treatment in type 1 diabetes, but the need for chronic immunosuppression is a major hurdle to broad applicability. Ex vivo introduction of agents by lentiviral vectors-improving beta-cell resistance against immune attack-is an attractive path to pursue. The aim of this study was to investigate whether dissociation of islets to single cells prior to viral infection and reaggregation before transplantation would improve viral transduction efficacy without cytotoxicity. This procedure improved transduction efficacy with a LV-pWPT-CMV-EGFP construct from 11.2 +/- 4.1% at MOI 50 in whole islets to 80.0 +/- 2.8% at MOI 5. Viability (as measured by Hoechst/PI) and functionality (as measured by glucose challenge) remained high. After transplantation, the transfected pseudoislet aggregates remained EGFP positive for more than 90 days and the expression of EGFP colocalized primarily with the insulin-positive beta-cells. No increased vulnerability to immune attack was observed in vitro or in vivo. These data demonstrate that dispersion of islets prior to lentiviral transfection and reaggregation prior to transplantation is a highly efficient way to introduce genes of interest into islets for transplantation purposes in vitro and in vivo, but the amount of beta-cells needed for normalization of glycemia was more than eightfold higher when using dispersed cell aggregates versus unmanipulated islets. The high price to pay to reach stable and strong transgene expression in islet cells is certainly an important cell loss.

  4. Production of germline transgenic prairie voles (Microtus ochrogaster) using lentiviral vectors.

    Science.gov (United States)

    Donaldson, Zoe R; Yang, Shang-Hsun; Chan, Anthony W S; Young, Larry J

    2009-12-01

    The study of alternative model organisms has yielded tremendous insights into the regulation of behavioral and physiological traits not displayed by more widely used animal models, such as laboratory rats and mice. In particular, comparative approaches often exploit species ideally suited for investigating specific phenomenon. For instance, comparative studies of socially monogamous prairie voles and polygamous meadow voles have been instrumental toward gaining an understanding of the genetic and neurobiological basis of social bonding. However, laboratory studies of less commonly used organisms, such as prairie voles, have been limited by a lack of genetic tools, including the ability to manipulate the genome. Here, we show that lentiviral vector-mediated transgenesis is a rapid and efficient approach for creating germline transgenics in alternative laboratory rodents. Injection of a green fluorescent protein (GFP)-expressing lentiviral vector into the perivitelline space of 23 single-cell embryos yielded three live offspring (13 %), one of which (33%) contained germline integration of a GFP transgene driven by the human ubiquitin-C promoter. In comparison, transfer of 23 uninjected embryos yielded six live offspring (26%). Green fluorescent protein is present in all tissues examined and is expressed widely in the brain. The GFP transgene is heritable and stably expressed until at least the F(2) generation. This technology has the potential to allow investigation of specific gene candidates in prairie voles and provides a general protocol to pursue germline transgenic manipulation in many different rodent species.

  5. Validation of the Children's Hospital of Philadelphia Retinopathy of Prematurity (CHOP ROP) Model.

    Science.gov (United States)

    Binenbaum, Gil; Ying, Gui-Shuang; Tomlinson, Lauren A

    2017-08-01

    The Children's Hospital of Philadelphia Retinopathy of Prematurity (CHOP ROP) model uses birth weight (BW), gestational age at birth (GA), and weight gain rate to predict the risk of severe retinopathy of prematurity (ROP). In a model development study, it predicted all infants requiring treatment, while greatly reducing the number of examinations compared with current screening guidelines. To validate the CHOP ROP model in a multicenter cohort that is large enough to obtain a precise estimate of the model's sensitivity for treatment-requiring ROP. This investigation was a secondary analysis of data from the Postnatal Growth and Retinopathy of Prematurity (G-ROP) Study. The setting was 30 hospitals in the United States and Canada between January 1, 2006, and June 30, 2012. The dates of analysis were September 28 to October 5, 2015. Participants were premature infants at risk for ROP with a known ROP outcome. Sensitivity for Early Treatment of Retinopathy of Prematurity type 1 ROP and potential reduction in the number of infants requiring examinations. In the primary analysis, the CHOP ROP model was applied weekly to predict the risk of ROP. If the risk was above a cut-point level (high risk), examinations were indicated, while low-risk infants received no examinations. In a secondary analysis, low-risk infants received fewer examinations rather than no examinations. Participants included 7483 premature infants at risk for ROP with a known ROP outcome. Their median BW was 1070 g (range, 310-3000 g), and their median GA was 28 weeks (range, 22-35 weeks). Among them, 3575 (47.8%) were female, and their race/ethnicity was 3615 white (48.3%), 2310 black (30.9%), 233 Asian (3.1%), 93 Pacific Islander (1.2%), and 40 American Indian/Alaskan native (0.5%). The original CHOP ROP model correctly predicted 452 of 459 infants who developed type 1 ROP (sensitivity, 98.5%; 95% CI, 96.9%-99.3%), reducing the number of infants requiring examinations by 34.3% if only high

  6. Lipopolysaccharide preconditioning protects hepatocytes from ischemia/reperfusion injury (IRI through inhibiting ATF4-CHOP pathway in mice.

    Directory of Open Access Journals (Sweden)

    Jianhua Rao

    Full Text Available BACKGROUND: Low-dose lipopolysaccharide (LPS preconditioning-induced liver protection has been demonstrated during ischemia-reperfusion injury (IRI in several organs but has not been sufficiently elucidated underlying causal mechanism. This study investigated the role of low-dose LPS preconditioning on ATF4-CHOP pathway as well as the effects of the pathway on tissue injury and inflammation in a mouse model of liver partial-warm IRI. METHODS: LPS (100 µg/kg/d was injected intraperitoneally two days before ischemia. Hepatic injury was evaluated based on serum alanine aminotransferase levels, histopathology, and caspase-3 activity. The ATF4-CHOP pathway and its related apoptotic molecules were investigated after reperfusion. The role of LPS preconditioning on apoptosis and ATF4-CHOP pathway was examined in vitro. Moreover, the effects of the ATF4-CHOP pathway on apoptosis, Caspase-12, and Caspase-3 were determined with ATF4 small interfering RNA (siRNA. Inflammatory cytokine expression was also checked after reperfusion. Inflammatory cytokines and related signaling pathways were analyzed in vitro in macrophages treated by LPS preconditioning or ATF4 siRNA. RESULTS: LPS preconditioning significantly attenuated liver injury after IRI. As demonstrated by in vitro experiments, LPS preconditioning significantly reduced the upregulation of the ATF4-CHOP pathway and inhibited Caspase-12 and Caspase-3 activation after IRI. Later experiments showed that ATF4 knockdown significantly suppressed CHOP, cleaved caspase-12 and caspase-3 expression, as well as inhibited hepatocellular apoptosis. In addition, in mice pretreated with LPS, TNF-α and IL-6 were inhibited after reperfusion, whereas IL-10 was upregulated. Similarly, low-dose LPS significantly inhibited TNF-α, IL-6, ATF4-CHOP pathway, NF-κB pathway, and ERK1/2 in high-dose LPS-stimulated macrophages, whereas IL-10 and cytokine signaling (SOCS-3 suppressor were induced. Importantly, ATF4 siRNA is

  7. Lentiviral vector-mediated genetic modification of cell substrates for the manufacture of proteins and other biologics.

    Science.gov (United States)

    Baranyi, Lajos; Roy, Andre; Embree, Heather D; Dropulic, Boro

    2010-01-01

    Transduction with Lentiviral vectors has been shown to be the most efficient method for the stable delivery of nucleic acid sequences into mammalian cells. Lentiviral vectors have been widely used in research and have recently shown success in clinical trials for human gene therapy. In this paper, we describe the use of lentiviral vectors to generate genetically modified cell substrates for the manufacture of proteins and other complex biologics. The use of lentiviral vectors for the generation of genetically modified cell substrates for the production of biologic material has several advantages over other systems: (1) highly productive mammalian cell lines can be rapidly generated without selection or gene amplification; (2) the high number of vector copies are distributed throughout the open chromatin of the genome, resulting in cell lines that are extremely stable for high levels of gene expression and, consequently, protein production; and (3) high levels of protein glycosylation are maintained despite very high levels of protein production. These advantages offer the potential to significantly improve the quality, time-to-market, and manufacturing cost of biologics for human use.

  8. Delivery of the Cre recombinase by a self-deleting lentiviral vector: efficient gene targeting in vivo

    NARCIS (Netherlands)

    Pfeifer, A.; Brandon, E. P.; Kootstra, N.; Gage, F. H.; Verma, I. M.

    2001-01-01

    The Cre recombinase (Cre) from bacteriophage P1 is an important tool for genetic engineering in mammalian cells. We constructed lentiviral vectors that efficiently deliver Cre in vitro and in vivo. Surprisingly, we found a significant reduction in proliferation and an accumulation in the G(2)/M

  9. Multigenic lentiviral vectors for combined and tissue-specific expression of miRNA- and protein-based antiangiogenic factors

    Directory of Open Access Journals (Sweden)

    Anne Louise Askou

    Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.

  10. A quasi-lentiviral green fluorescent protein reporter exhibits nuclear export features of late human immunodeficiency virus type 1 transcripts

    International Nuclear Information System (INIS)

    Graf, Marcus; Ludwig, Christine; Kehlenbeck, Sylvia; Jungert, Kerstin; Wagner, Ralf

    2006-01-01

    We have previously shown that Rev-dependent expression of HIV-1 Gag from CMV immediate early promoter critically depends on the AU-rich codon bias of the gag gene. Here, we demonstrate that adaptation of the green fluorescent protein (GFP) reporter gene to HIV codon bias is sufficient to turn this hivGFP RNA into a quasi-lentiviral message following the rules of late lentiviral gene expression. Accordingly, GFP expression was significantly decreased in transfected cells strictly correlating with reduced RNA levels. In the presence of the HIV 5' major splice donor, the hivGFP RNAs were stabilized in the nucleus and efficiently exported to the cytoplasm following fusion of the 3' Rev-responsive element (RRE) and coexpression of HIV-1 Rev. This Rev-dependent translocation was specifically inhibited by leptomycin B suggesting export via the CRM1-dependent pathway used by late lentiviral transcripts. In conclusion, this quasi-lentiviral reporter system may provide a new platform for developing sensitive Rev screening assays

  11. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  12. Coordinate enhancement of transgene transcription and translation in a lentiviral vector

    Directory of Open Access Journals (Sweden)

    Fernandez Soledad

    2006-02-01

    Full Text Available Abstract Background Coordinate enhancement of transgene transcription and translation would be a potent approach to significantly improve protein output in a broad array of viral vectors and nonviral expression systems. Many vector transgenes are complementary DNA (cDNA. The lack of splicing can significantly reduce the efficiency of their translation. Some retroviruses contain a 5' terminal post-transcriptional control element (PCE that facilitates translation of unspliced mRNA. Here we evaluated the potential for spleen necrosis virus PCE to stimulate protein production from HIV-1 based lentiviral vector by: 1 improving translation of the internal transgene transcript; and 2 functionally synergizing with a transcriptional enhancer to achieve coordinate increases in RNA synthesis and translation. Results Derivatives of HIV-1 SIN self-inactivating lentiviral vector were created that contain PCE and cytomegalovirus immediate early enhancer (CMV IE. Results from transfected cells and four different transduced cell types indicate that: 1 PCE enhanced transgene protein synthesis; 2 transcription from the internal promoter is enhanced by CMV IE; 3 PCE and CMV IE functioned synergistically to significantly increase transgene protein yield; 4 the magnitude of translation enhancement by PCE was similar in transfected and transduced cells; 5 differences were observed in steady state level of PCE vector RNA in transfected and transduced cells; 6 the lower steady state was not attributable to reduced RNA stability, but to lower cytoplasmic accumulation in transduced cells. Conclusion PCE is a useful tool to improve post-transcriptional expression of lentiviral vector transgene. Coordinate enhancement of transcription and translation is conferred by the combination of PCE with CMV IE transcriptional enhancer and increased protein yield up to 11 to 17-fold in transfected cells. The incorporation of the vector provirus into chromatin correlated with reduced

  13. Effect of Different Tumbling Marination Methods and Time on the Water Status and Protein Properties of Prepared Pork Chops

    Directory of Open Access Journals (Sweden)

    Tian Gao

    2015-07-01

    Full Text Available The combined effect of tumbling marination methods (vacuum continuous tumbling marination, CT; vacuum intermittent tumbling marination, IT and effective tumbling time (4, 6, 8, and 10 h on the water status and protein properties of prepared pork chops was investigated. Results showed that regardless of tumbling time, CT method significantly decreased the muscle fiber diameter (MD and significantly increased the total moisture content, product yield, salt soluble proteins (SSP solubility, immobilized water component (p<0.05 compared with IT method. With the effective tumbling time increased from 4 h to 10 h, the fat content and the MD were significantly decreased (p<0.05, whereas the SSP solubility of prepared pork chops increased firstly and then decreased. Besides, an interactive effect between CT method and effective tumbling time was also observed for the chemical composition and proportion of immobilized water (p<0.05. These results demonstrated that CT method of 8 h was the most beneficial for improving the muscle structure and water distribution status, increasing the water-binding capacity and accelerating the marinade efficiency of pork chops; and thus, it should be chosen as the most optimal treatment method for the processing production of prepared pork chops.

  14. Modulator considerations for beam chopping in the low energy beam transport at the SSC Laboratory

    International Nuclear Information System (INIS)

    Anderson, D.; Pappas, G.

    1991-06-01

    Beam chopping in the low energy transport line at the Superconducting Super Collider Laboratory is accomplished using an electrostatic deflection system. LINAC requirements dictate the design of two modulators operating at 10 Hz with rise and fall times (as measured from approximately 10--99%) of ∼100 ns. Design of the first pulser, normally at 10 kV and pulsed to ground potential, utilizes a transformer-coupled diode-clamped solid state circuit to achieve the 2--35 μs pulse width range required. The second pulser, which pulses from ground to approximately 7 kV, relies on a series vacuum tube circuit. The current designs, as well as recent test results and other circuit topologies considered, will be presented. 6 refs

  15. Model and Study on Cascade Control System Based on IGBT Chopping Control

    Science.gov (United States)

    Niu, Yuxin; Chen, Liangqiao; Wang, Shuwen

    2018-01-01

    Thyristor cascade control system has a wide range of applications in the industrial field, but the traditional cascade control system has some shortcomings, such as a low power factor, serious harmonic pollution. In this paper, not only analyzing its system structure and working principle, but also discussing the two main factors affecting the power factor. Chopping-control cascade control system, adopted a new power switching device IGBT, which could overcome traditional cascade control system’s two main drawbacks efficiently. The basic principle of this cascade control system is discussed in this paper and the model of speed control system is built by using MATLAB/Simulink software. Finally, the simulation results of the system shows that the system works efficiently. This system is worthy to be spread widely in engineering application.

  16. Effects of alfalfa hay and its physical form (chopped versus pelleted) on performance of Holstein calves.

    Science.gov (United States)

    Jahani-Moghadam, M; Mahjoubi, E; Hossein Yazdi, M; Cardoso, F C; Drackley, J K

    2015-06-01

    Inclusion of forage and its physical form in starter may affect rumen development, average daily gain (ADG), and dry matter intake (DMI) of dairy calves. To evaluate the effects of forage and its physical form (chopped vs. pelleted) on growth of calves under a high milk feeding regimen, 32 Holstein calves (38.8±1.1kg) were assigned at birth to 1 of 3 treatments in a completely randomized block design. Dietary treatments (% of dry matter) were (1) 100% semi-texturized starter (CON); (2) 90% semi-texturized starter + 10% chopped alfalfa hay (mean particle size=5.4mm) as a total mixed ration (TMR; CH); and (3) 90% semi-texturized starter + 10% pelleted alfalfa (mean=5.8mm) hay as a TMR (PH). Data were subjected to mixed model analysis with contrasts used to evaluate effect of forage inclusion. Calves were weaned at 76 d of age and the experiment finished 2 wk after weaning. Individual milk and solid feed consumption were recorded daily. Solid feed consumption and ADG increased as age increased (effect of week), but neither forage inclusion nor physical form of forage affected these variables pre- or postweaning. Plasma urea N was affected by treatments such that the CON group had a lower concentration than forage-fed groups. Forage inclusion, but not physical form, resulted in increased total protein in plasma. Although days with elevated rectal temperature, fecal score, and general appearance were not affected by dietary treatments, calves fed alfalfa hay during the first month of life had fewer days with respiratory issues, regardless of physical form of hay. We concluded that provision of forage does have some beneficial effects in calves fed large amounts of milk replacer, but pelleted alfalfa hay did not result in any improvement in calf performance or health. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Optimized PEI-based Transfection Method for Transient Transfection and Lentiviral Production.

    Science.gov (United States)

    Yang, Shaozhe; Zhou, Xiaoling; Li, Rongxiang; Fu, Xiuhong; Sun, Pingnan

    2017-09-14

    Polyethyleneimine (PEI), a cationic polymer vehicle, forms a complex with DNA which then can carry anionic nucleic acids into eukaryotic cells. PEI-based transfection is widely used for transient transfection of plasmid DNA. The efficiency of PEI-based transfection is affected by numerous factors, including the way the PEI/DNA complex is prepared, the ratio of PEI to DNA, the concentration of DNA, the storage conditions of PEI solutions, and more. Considering the major influencing factors, PEI-based transfection has been optimized to improve its efficiency, reproducibility, and consistency. This protocol outlines the steps for ordinary transient transfection and lentiviral production using PEI. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.

  18. Lentiviral-mediated administration of IL-25 in the CNS induces alternative activation of microglia

    DEFF Research Database (Denmark)

    Maiorino, C; Khorooshi, R; Ruffini, F

    2013-01-01

    was partly inhibited and the CNS protected from immune-mediated damage. To our knowledge, this is the first example of M2 shift (alternative activation) induced in vivo on CNS-resident myeloid cells by gene therapy, and may constitute a promising strategy to investigate the potential role of protective...... immune system, namely macrophages. We used a lentiviral-mediated gene therapy approach to deliver IL-25 to the central nervous system (CNS) in two mouse models of neuroinflammation, entorhinal cortex lesion and experimental autoimmune encephalomyelitis. In both, we found that IL-25 gene therapy was able...... to modulate CNS myeloid cells, either infiltrating macrophages or resident microglia, towards an anti-inflammatory, tissue-protective phenotype, as testified by the increase in markers such as Arginase-1 (Arg1), Mannose receptor 1 (CD206) and Chitinase 3-like 3 (Ym1). As a consequence, neuroinflammation...

  19. Dynamics of lentiviral infection in vivo in the absence of adaptive immune responses.

    Science.gov (United States)

    Schwartz, Elissa J; Vaidya, Naveen K; Dorman, Karin S; Carpenter, Susan; Mealey, Robert H

    2018-01-01

    Understanding the dynamics of acute viral infection is crucial for developing strategies to prevent and control infection. In this study, lentiviral dynamics in a host without adaptive immunity were examined in order to determine kinetic parameters of infection and quantify the effect of neutralizing antibodies in preventing infection, using mathematical modeling of data from equine infectious anemia virus (EIAV) infection of horses with severe combined immunodeficiency (SCID). Estimated parameters were used to calculate the basic reproductive number and virus doubling time and found that the rate that antibodies neutralized virus was ~18 times greater than the virus clearance rate. These results establish EIAV replication kinetics in SCID horses and the minimal efficacy of antibodies that blocked infection. Furthermore, they indicate that EIAV is at most mildly cytopathic. This study advances our understanding of EIAV infection and may have important implications for the control of other viral infections, including HIV. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy

    Directory of Open Access Journals (Sweden)

    Matthew M Wielgosz

    Full Text Available We have developed a producer cell line that generates lentiviral vector particles of high titer. The vector encodes the Wiskott-Aldrich syndrome (WAS protein. An insulator element has been added to the long terminal repeats of the integrated vector to limit proto-oncogene activation. The vector provides high-level, stable expression of WAS protein in transduced murine and human hematopoietic cells. We have also developed a monoclonal antibody specific for intracellular WAS protein. This antibody has been used to monitor expression in blood and bone marrow cells after transfer into lineage negative bone marrow cells from WAS mice and in a WAS negative human B-cell line. Persistent expression of the transgene has been observed in transduced murine cells 12–20 weeks following transplantation. The producer cell line and the specific monoclonal antibody will facilitate the development of a clinical protocol for gene transfer into WAS protein deficient stem cells.

  1. Ethical considerations in the use of lentiviral vectors for genetic transfer.

    Science.gov (United States)

    Roy, I

    2001-11-01

    This chapter will outline the various concerns which have been raised in scientific, bioethics, and lay communities about the use of lentiviral vectors for purposes of gene therapy. Many of these concerns are ranged around gene therapy itself; others are concerns particular to using this sort of vector for genetic modification of human cells. These concerns are outlined within the chapter, and arguments are given in favor and against various approaches to these concerns. Lastly, it is noted throughout that at this stage of research into gene therapy, the most practical approach to these dilemmas is to maintain awareness of the ethical problems and provide information to those concerned with all aspects of the development of this set of technologies.

  2. Lentiviral Modulation of Wnt/β-Catenin Signaling Affects In Vivo LTP.

    Science.gov (United States)

    Ivanova, Olga Ya; Dobryakova, Yulia V; Salozhin, Sergey V; Aniol, Viktor A; Onufriev, Mikhail V; Gulyaeva, Natalia V; Markevich, Vladimir A

    2017-10-01

    Wnt signaling is involved in hippocampal development and synaptogenesis. Numerous recent studies have been focused on the role of Wnt ligands in the regulation of synaptic plasticity. Inhibitors and activators of canonical Wnt signaling were demonstrated to decrease or increase, respectively, in vitro long-term potentiation (LTP) maintenance in hippocampal slices (Chen et al. in J Biol Chem 281:11910-11916, 2006; Vargas et al. in J Neurosci 34:2191-2202, 2014, Vargas et al. in Exp Neurol 264:14-25, 2015). Using lentiviral approach to down- and up-regulate the canonical Wnt signaling, we explored whether Wnt/β-catenin signaling is critical for the in vivo LTP. Chronic suppression of Wnt signaling induced an impairment of in vivo LTP expression 14 days after lentiviral suspension injection, while overexpression of Wnt3 was associated with a transient enhancement of in vivo LTP magnitude. Both effects were related to the early phase LTP and did not affect LTP maintenance. A loss-of-function study demonstrated decreased initial paired pulse facilitation ratio, β-catenin, and phGSK-3β levels. A gain-of-function study revealed not only an increase in PSD-95, β-catenin, and Cyclin D1 protein levels, but also a reduced phGSK-3β level and enhanced GSK-3β kinase activity. These results suggest a presynaptic dysfunction predominantly underlying LTP impairment while postsynaptic modifications are primarily involved in transient LTP amplification. This study is the first demonstration of the involvement of Wnt/β-catenin signaling in synaptic plasticity regulation in an in vivo LTP model.

  3. A nonintegrative lentiviral vector-based vaccine provides long-term sterile protection against malaria.

    Directory of Open Access Journals (Sweden)

    Frédéric Coutant

    Full Text Available Trials testing the RTS,S candidate malaria vaccine and radiation-attenuated sporozoites (RAS have shown that protective immunity against malaria can be induced and that an effective vaccine is not out of reach. However, longer-term protection and higher protection rates are required to eradicate malaria from the endemic regions. It implies that there is still a need to explore new vaccine strategies. Lentiviral vectors are very potent at inducing strong immunological memory. However their integrative status challenges their safety profile. Eliminating the integration step obviates the risk of insertional oncogenesis. Providing they confer sterile immunity, nonintegrative lentiviral vectors (NILV hold promise as mass pediatric vaccine by meeting high safety standards. In this study, we have assessed the protective efficacy of NILV against malaria in a robust pre-clinical model. Mice were immunized with NILV encoding Plasmodium yoelii Circumsporozoite Protein (Py CSP and challenged with sporozoites one month later. In two independent protective efficacy studies, 50% (37.5-62.5 of the animals were fully protected (p = 0.0072 and p = 0.0008 respectively when compared to naive mice. The remaining mice with detectable parasitized red blood cells exhibited a prolonged patency and reduced parasitemia. Moreover, protection was long-lasting with 42.8% sterile protection six months after the last immunization (p = 0.0042. Post-challenge CD8+ T cells to CSP, in contrast to anti-CSP antibodies, were associated with protection (r = -0.6615 and p = 0.0004 between the frequency of IFN-g secreting specific T cells in spleen and parasitemia. However, while NILV and RAS immunizations elicited comparable immunity to CSP, only RAS conferred 100% of sterile protection. Given that a better protection can be anticipated from a multi-antigen vaccine and an optimized vector design, NILV appear as a promising malaria vaccine.

  4. Lentiviral Vector-Mediated GFP/fluc gene introduction into primary mouse NK cells

    International Nuclear Information System (INIS)

    L, Thi Thanh Hoa; Tae, Seong Ho; Min, Jung Joon

    2007-01-01

    NK cell is a type of lymphocyte that has ability in defense against virus infection and some kinds of cancer diseases. Recently, using genetic engineering, studies about the roles and functions of NK cells have been developing. In this study, we used lentivirus-based vector encoding GFP/Fluc gene to transfer into primary mouse NK cells. This model is a tool in studying characteristics of NK cells. The lentivirus used in this study was a commercial one, named LentiM1.3-Fluc, encoding GFP and Flue reporter genes under the control of the murine cytomegalovirus (MCMV) promoter. LentiM1.3-Fluc was infected into freshly isolated mouse NK cells at 2 20 MOl by incubating or using spin infection. In the spin infection, we gently suspended NK cells in viral fluid, then centrifuged at 2000 rpm, 20 minutes at room temperature and incubated for 1 day. After 1 day, virus was discarded and NK cells were cultured in IL-2 with or without IL-12 supplemented media. Infected NK cells were monitored by using fluorescent microscope for GFP and IVIS machine for Fire-fly luciferase expression. The results showed that using spin infection had much effect on introducing lentiviral vector-mediated reporter gene into NK cells than the way without spin. Also, NK cells which were cultured in IL-2 and IL-12 added media expressed higher fluorescent and luminescent signals than those cultured in only IL-2 supplemented media. When these NK cells were injected subcutaneously in Balb/C mice, the imaging signal was observed transiently. Our study demonstrates that by using a simple method, mouse NK cells can be transfected by lentivirus. And this will be useful in studying biology and therapeutic potential of NK cells. However, we require developing alternative lentiviral vectors with different promoter for in vivo application

  5. Lentiviral Vector-Mediated GFP/fluc gene introduction into primary mouse NK cells

    Energy Technology Data Exchange (ETDEWEB)

    L, Thi Thanh Hoa; Tae, Seong Ho; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    NK cell is a type of lymphocyte that has ability in defense against virus infection and some kinds of cancer diseases. Recently, using genetic engineering, studies about the roles and functions of NK cells have been developing. In this study, we used lentivirus-based vector encoding GFP/Fluc gene to transfer into primary mouse NK cells. This model is a tool in studying characteristics of NK cells. The lentivirus used in this study was a commercial one, named LentiM1.3-Fluc, encoding GFP and Flue reporter genes under the control of the murine cytomegalovirus (MCMV) promoter. LentiM1.3-Fluc was infected into freshly isolated mouse NK cells at 2 20 MOl by incubating or using spin infection. In the spin infection, we gently suspended NK cells in viral fluid, then centrifuged at 2000 rpm, 20 minutes at room temperature and incubated for 1 day. After 1 day, virus was discarded and NK cells were cultured in IL-2 with or without IL-12 supplemented media. Infected NK cells were monitored by using fluorescent microscope for GFP and IVIS machine for Fire-fly luciferase expression. The results showed that using spin infection had much effect on introducing lentiviral vector-mediated reporter gene into NK cells than the way without spin. Also, NK cells which were cultured in IL-2 and IL-12 added media expressed higher fluorescent and luminescent signals than those cultured in only IL-2 supplemented media. When these NK cells were injected subcutaneously in Balb/C mice, the imaging signal was observed transiently. Our study demonstrates that by using a simple method, mouse NK cells can be transfected by lentivirus. And this will be useful in studying biology and therapeutic potential of NK cells. However, we require developing alternative lentiviral vectors with different promoter for in vivo application.

  6. A Small Indel Mutant Mouse Model of Epidermolytic Palmoplantar Keratoderma and Its Application to Mutant-specific shRNA Therapy

    Directory of Open Access Journals (Sweden)

    Ya-Su Lyu

    2016-01-01

    Full Text Available Epidermolytic palmoplantar keratoderma (EPPK is a relatively common autosomal-dominant skin disorder caused by mutations in the keratin 9 gene (KRT9, with few therapeutic options for the affected so far. Here, we report a knock-in transgenic mouse model that carried a small insertion–deletion (indel mutant of Krt9, c.434delAinsGGCT (p.Tyr144delinsTrpLeu, corresponding to the human mutation KRT9/c.500delAinsGGCT (p.Tyr167delinsTrpLeu, which resulted in a human EPPK-like phenotype in the weight-stress areas of the fore- and hind-paws of both Krt9+/mut and Krt9mut/mut mice. The phenotype confirmed that EPPK is a dominant-negative condition, such that mice heterozygotic for the K9-mutant allele (Krt9+/mut showed a clear EPPK-like phenotype. Then, we developed a mutant-specific short hairpin RNA (shRNA therapy for EPPK mice. Mutant-specific shRNAs were systematically identified in vitro using a luciferase reporter gene assay and delivered into Krt9+/mut mice. shRNA-mediated knockdown of mutant protein resulted in almost normal morphology and functions of the skin, whereas the same shRNA had a negligible effect in wild-type K9 mice. Our results suggest that EPPK can be treated by gene therapy, and this has significant implications for future clinical application.

  7. Lentiviral vector mediated modification of mesenchymal stem cells & enhanced survival in an in vitro model of ischaemia.

    LENUS (Irish Health Repository)

    McGinley, Lisa

    2012-01-31

    INTRODUCTION: A combination of gene and cell therapies has the potential to significantly enhance the therapeutic value of mesenchymal stem cells (MSCs). The development of efficient gene delivery methods is essential if MSCs are to be of benefit using such an approach. Achieving high levels of transgene expression for the required period of time, without adversely affecting cell viability and differentiation capacity, is crucial. In the present study, we investigate lentiviral vector-mediated genetic modification of rat bone-marrow derived MSCs and examine any functional effect of such genetic modification in an in vitro model of ischaemia. METHODS: Transduction efficiency and transgene persistence of second and third generation rHIV-1 based lentiviral vectors were tested using reporter gene constructs. Use of the rHIV-pWPT-EF1-alpha-GFP-W vector was optimised in terms of dose, toxicity, cell species, and storage. The in vivo condition of ischaemia was modelled in vitro by separation into its associated constituent parts i.e. hypoxia, serum and glucose deprivation, in which the effect of therapeutic gene over-expression on MSC survival was investigated. RESULTS: The second generation lentiviral vector rHIV-pWPT-EF1-alpha-GFP-W, was the most efficient and provided the most durable transgene expression of the vectors tested. Transduction with this vector did not adversely affect MSC morphology, viability or differentiation potential, and transgene expression levels were unaffected by cryopreservation of transduced cells. Over-expression of HSP70 resulted in enhanced MSC survival and increased resistance to apoptosis in conditions of hypoxia and ischaemia. MSC differentiation capacity was significantly reduced after oxygen deprivation, but was preserved with HSP70 over-expression. CONCLUSIONS: Collectively, these data validate the use of lentiviral vectors for efficient in vitro gene delivery to MSCs and suggest that lentiviral vector transduction can facilitate

  8. Lentiviral vector mediated modification of mesenchymal stem cells & enhanced survival in an in vitro model of ischaemia

    LENUS (Irish Health Repository)

    McGinley, Lisa

    2011-03-07

    Abstract Introduction A combination of gene and cell therapies has the potential to significantly enhance the therapeutic value of mesenchymal stem cells (MSCs). The development of efficient gene delivery methods is essential if MSCs are to be of benefit using such an approach. Achieving high levels of transgene expression for the required period of time, without adversely affecting cell viability and differentiation capacity, is crucial. In the present study, we investigate lentiviral vector-mediated genetic modification of rat bone-marrow derived MSCs and examine any functional effect of such genetic modification in an in vitro model of ischaemia. Methods Transduction efficiency and transgene persistence of second and third generation rHIV-1 based lentiviral vectors were tested using reporter gene constructs. Use of the rHIV-pWPT-EF1-α-GFP-W vector was optimised in terms of dose, toxicity, cell species, and storage. The in vivo condition of ischaemia was modelled in vitro by separation into its associated constituent parts i.e. hypoxia, serum and glucose deprivation, in which the effect of therapeutic gene over-expression on MSC survival was investigated. Results The second generation lentiviral vector rHIV-pWPT-EF1-α-GFP-W, was the most efficient and provided the most durable transgene expression of the vectors tested. Transduction with this vector did not adversely affect MSC morphology, viability or differentiation potential, and transgene expression levels were unaffected by cryopreservation of transduced cells. Over-expression of HSP70 resulted in enhanced MSC survival and increased resistance to apoptosis in conditions of hypoxia and ischaemia. MSC differentiation capacity was significantly reduced after oxygen deprivation, but was preserved with HSP70 over-expression. Conclusions Collectively, these data validate the use of lentiviral vectors for efficient in vitro gene delivery to MSCs and suggest that lentiviral vector transduction can facilitate

  9. Novel CHOP activator LGH00168 induces necroptosis in A549 human lung cancer cells via ROS-mediated ER stress and NF-κB inhibition.

    Science.gov (United States)

    Ma, Yi-Ming; Peng, Yan-Min; Zhu, Qiong-Hua; Gao, An-Hui; Chao, Bo; He, Qiao-Jun; Li, Jia; Hu, You-Hong; Zhou, Yu-Bo

    2016-09-01

    C/EBP homologous protein (CHOP) is a transcription factor that is activated at multiple levels during ER stress and plays an important role in ER stress-induced apoptosis. In this study we identified a novel CHOP activator, and further investigated its potential to be a therapeutic agent for human lung cancer. HEK293-CHOP-luc reporter cells were used in high-throughput screening (HTS) to identify CHOP activators. The cytotoxicity against cancer cells in vitro was measured with MTT assay. The anticancer effects were further examined in A549 human non-small cell lung cancer xenograft mice. The mechanisms underlying CHOP activation were analyzed using luciferase assays, and the anticancer mechanisms were elucidated in A549 cells. From chemical libraries of 50 000 compounds, LGH00168 was identified as a CHOP activator, which showed cytotoxic activities against a panel of 9 cancer cell lines with an average IC 50 value of 3.26 μmol/L. Moreover, administration of LGH00168 significantly suppressed tumor growth in A549 xenograft bearing mice. LGH00168 activated CHOP promoter via AARE1 and AP1 elements, increased DR5 expression, decreased Bcl-2 expression, and inhibited the NF-κB pathway. Treatment of A549 cells with LGH00168 (10 μmol/L) did not induce apoptosis, but lead to RIP1-dependent necroptosis, accompanied by cell swelling, plasma membrane rupture, lysosomal membrane permeabilization, MMP collapse and caspase 8 inhibition. Furthermore, LGH00168 (10 and 20 μmol/L) dose-dependently induced mito-ROS production in A549 cells, which was reversed by the ROS scavenger N-acetyl-L-cysteine (NAC, 10 mmol/L). Moreover, NAC significantly diminished LGH00168-induced CHOP activation, NF-κB inhibition and necroptosis in A549 cells. LGH00168 is a CHOP activator that inhibits A549 cell growth in vitro and lung tumor growth in vivo.

  10. Effects of vacuum chopping on physicochemical and gelation properties of myofibrillar proteins from silver carp (Hypophthalmichthys molitrix).

    Science.gov (United States)

    Ma, Yaolan; Xiong, Shanbai; You, Juan; Hu, Yang; Huang, Qilin; Yin, Tao

    2018-04-15

    Physicochemical and gelation properties of myofibrillar proteins from silver carp surimi as affected by chopping under different vacuum degrees (0, 0.01, 0.02, 0.04, 0.06 and 0.08 MPa) were investigated. With the increase of vacuum degree, size and quantity of air bubbles in surimi paste decreased, disulfide bond content of myofibrillar proteins decreased significantly (p  .05), while surface hydrophobicity of myofibrillar proteins increased gradually (p vacuum degree. Scanning electron microscopy (SEM) observation showed that three-dimensional network of surimi gel under higher vacuum degree was more compact and orderly. Results indicated that vacuum chopping imparted physicochemical and structural changes of fish myofibrillar protein, which might contribute to the improvement in gelling properties of myofibrillar proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Eliminating HIV-1 Packaging Sequences from Lentiviral Vector Proviruses Enhances Safety and Expedites Gene Transfer for Gene Therapy.

    Science.gov (United States)

    Vink, Conrad A; Counsell, John R; Perocheau, Dany P; Karda, Rajvinder; Buckley, Suzanne M K; Brugman, Martijn H; Galla, Melanie; Schambach, Axel; McKay, Tristan R; Waddington, Simon N; Howe, Steven J

    2017-08-02

    Lentiviral vector genomic RNA requires sequences that partially overlap wild-type HIV-1 gag and env genes for packaging into vector particles. These HIV-1 packaging sequences constitute 19.6% of the wild-type HIV-1 genome and contain functional cis elements that potentially compromise clinical safety. Here, we describe the development of a novel lentiviral vector (LTR1) with a unique genomic structure designed to prevent transfer of HIV-1 packaging sequences to patient cells, thus reducing the total HIV-1 content to just 4.8% of the wild-type genome. This has been achieved by reconfiguring the vector to mediate reverse-transcription with a single strand transfer, instead of the usual two, and in which HIV-1 packaging sequences are not copied. We show that LTR1 vectors offer improved safety in their resistance to remobilization in HIV-1 particles and reduced frequency of splicing into human genes. Following intravenous luciferase vector administration to neonatal mice, LTR1 sustained a higher level of liver transgene expression than an equivalent dose of a standard lentivirus. LTR1 vectors produce reverse-transcription products earlier and start to express transgenes significantly quicker than standard lentiviruses after transduction. Finally, we show that LTR1 is an effective lentiviral gene therapy vector as demonstrated by correction of a mouse hemophilia B model. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Breeding of transgenic cattle for human coagulation factor IX by a combination of lentiviral system and cloning.

    Science.gov (United States)

    Monzani, P S; Sangalli, J R; De Bem, T H C; Bressan, F F; Fantinato-Neto, P; Pimentel, J R V; Birgel-Junior, E H; Fontes, A M; Covas, D T; Meirelles, F V

    2013-02-28

    Recombinant coagulation factor IX must be produced in mammalian cells because FIX synthesis involves translational modifications. Human cell culture-based expression of human coagulation factor IX (hFIX) is expensive, and large-scale production capacity is limited. Transgenic animals may greatly increase the yield of therapeutic proteins and reduce costs. In this study, we used a lentiviral system to obtain transgenic cells and somatic cell nuclear transfer (SCNT) to produce transgenic animals. Lentiviral vectors carrying hFIX driven by 3 bovine β-casein promoters were constructed. Bovine epithelial mammary cells were transduced by lentivirus, selected with blasticidin, plated on extracellular matrix, and induced by lactogenic hormones; promoter activity was evaluated by quantitative PCR. Transcriptional activity of the 5.335-kb promoter was 6-fold higher than the 3.392- and 4.279-kb promoters, which did not significantly differ. Transgenic bovine fibroblasts were transduced with lentivirus carrying the 5.335-kb promoter and used as donor cells for SCNT. Cloned transgenic embryo production yielded development rates of 28.4%, similar to previous reports on cloned non-transgenic embryos. The embryos were transferred to recipient cows (N = 21) and 2 births of cloned transgenic cattle were obtained. These results suggest combination of the lentiviral system and cloning may be a good strategy for production of transgenic cattle.

  13. Mutational profile and prognostic significance of TP53 in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Xu-Monette, Zijun Y; Wu, Lin; Visco, Carlo

    2012-01-01

    TP53 mutation is an independent marker of poor prognosis in patients with diffuse large B-cell lymphoma (DLBCL) treated with cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (CHOP) therapy. However, its prognostic value in the rituximab immunochemotherapy era remains undefined. ...

  14. Febrile Neutropenia Risk Assessment and Granulocyte-Colony Stimulating Factor Support in Patients with Diffuse Large B Cell Lymphoma Receiving R-CHOP Regimens

    DEFF Research Database (Denmark)

    Salar, Antonio; Haioun, Corinne; Rossi, Francesca Gaia

    2009-01-01

    of chemotherapy. In IMPACT NHL, we evaluated current practice in FN risk assessment and use of G-CSF prophylaxis in patients receiving (R)CHOP. METHODS: IMPACT NHL is a retrospective and prospective observational study conducted in 14 European countries and Australia. Physicians assessed the overall FN risk...... prophylaxis despite physicians' awareness of elevated risk, while primary G-CSF support was not given to almost one fifth of R-CHOP-14 patients, contrary to guideline recommendations. Both R-CHOP-14 and R-CHOP-21 resulted in significant myelotoxicity (with substantial FN even in those evaluated as being...... at lower risk), and only around two-thirds of patients received optimal chemotherapy RDI. Our data suggest that improvements in neutropenia management are required. More consistent use of G-CSF primary prophylaxis may further reduce FN and assist in optimal chemotherapy delivery. Sponsored by Amgen...

  15. Time-Dependent Deformation Modelling for a Chopped-Glass Fiber Composite for Automotive Durability Design Criteria

    Energy Technology Data Exchange (ETDEWEB)

    Ren, W

    2001-08-24

    Time-dependent deformation behavior of a polymeric composite with chopped-glass-fiber reinforcement was investigated for automotive applications, The material under stress was exposed to representative automobile service environments. Results show that environment has substantial effects on time-dependent deformation behavior of the material. The data were analyzed and experimentally-based models developed for the time-dependent deformation behavior as a basis for automotive structural durability design criteria.

  16. Investigation on Stress-Rupture Behavior of a Chopped-Glass-Fiber Composite for Automotive Durability Design Criteria

    Energy Technology Data Exchange (ETDEWEB)

    Ren, W

    2001-08-24

    Practical and inexpensive testing methods were developed to investigate stress-rupture properties of a polymeric composite with chopped glass fiber reinforcement for automotive applications. The material was tested in representative automotive environments to generate experimental data. The results indicate that environments have substantial effects on the stress-rupture behavior. The data were analyzed and developed into stress-rupture design criteria to address one of the durability aspects of the material for automotive structural applications.

  17. FUS-CHOP Promotes Invasion in Myxoid Liposarcoma through a SRC/FAK/RHO/ROCK-Dependent Pathway

    Directory of Open Access Journals (Sweden)

    Juan Tornin

    2018-01-01

    Full Text Available Deregulated SRC/FAK signaling leads to enhanced migration and invasion in many types of tumors. In myxoid and round cell liposarcoma (MRCLS, an adipocytic tumor characterized by the expression of the fusion oncogene FUS-CHOP, SRC have been found as one of the most activated kinases. Here we used a cell-of-origin model of MRCLS and an MRCLS cell line to thoroughly characterize the mechanisms of cell invasion induced by FUS-CHOP using in vitro (3D spheroid invasion assays and in vivo (chicken chorioallantoic membrane model approaches. FUS-CHOP expression activated SRC-FAK signaling and increased the invasive ability of MRCLS cells. In addition, FAK expression was found to significantly correlate with tumor aggressiveness in sarcoma patient samples. The involvement of SRC/FAK activation in FUS-CHOP–mediated invasion was further confirmed using the SRC inhibitor dasatinib, the specific FAK inhibitor PF-573228, and FAK siRNA. Notably, dasatinib and PF573228 could also efficiently block the invasion of cancer stem cell subpopulations. Downstream of SRC/FAK signaling, we found that FUS-CHOP expression increases the levels of the RHO/ROCK downstream effector phospho-MLC2 (T18/S19 and that this activation was prevented by dasatinib or PF573228. Moreover, the ROCK inhibitor RKI-1447 was able to completely abolish invasion in FUS-CHOP–expressing cells. These data uncover the involvement of SRC/FAK/RHO/ROCK signaling axis in FUS-CHOP–mediated invasion, thus providing a rationale for testing inhibitors of this pathway as potential novel antimetastatic agents for MRCLS treatment.

  18. Time-Dependent Deformation Modelling for a Chopped-Glass Fiber Composite for Automotive Durability Design Criteria; FINAL

    International Nuclear Information System (INIS)

    Ren, W

    2001-01-01

    Time-dependent deformation behavior of a polymeric composite with chopped-glass-fiber reinforcement was investigated for automotive applications, The material under stress was exposed to representative automobile service environments. Results show that environment has substantial effects on time-dependent deformation behavior of the material. The data were analyzed and experimentally-based models developed for the time-dependent deformation behavior as a basis for automotive structural durability design criteria

  19. Investigation on Stress-Rupture Behavior of a Chopped-Glass-Fiber Composite for Automotive Durability Design Criteria; FINAL

    International Nuclear Information System (INIS)

    Ren, W

    2001-01-01

    Practical and inexpensive testing methods were developed to investigate stress-rupture properties of a polymeric composite with chopped glass fiber reinforcement for automotive applications. The material was tested in representative automotive environments to generate experimental data. The results indicate that environments have substantial effects on the stress-rupture behavior. The data were analyzed and developed into stress-rupture design criteria to address one of the durability aspects of the material for automotive structural applications

  20. Effect of gamma irradiation on the B vitamins of pork chops and chicken breasts

    International Nuclear Information System (INIS)

    Fox, J.B. Jr.; Thayer, D.W.; Jenkins, R.K.; Phillips, J.G.; Ackerman, S.A.; Beecher, G.R.; Holden, J.M.; Morrow, F.D.; Quirbach, D.M.

    1989-01-01

    A study was made of the effect of low-dose gamma irradiation on the content of thiamine (B 1 ), riboflavin (B 2 ), niacin, pyridoxine (B 6 ) and cobalamin (B 12 ) in pork chops, and thiamine, riboflavin and niacin in chicken breasts. Over the range of dose and temperature studied (0.49-6.65 kGy from -20 to 20 0 C) it was possible to derive a mathematical expression for predicting losses. A calculation was made of the effect of the loss of thiamine, riboflavin and niacin due to irradiation on overall loss of these vitamins in the American diet. Losses of riboflavin and niacin were of the order of a fraction of a per cent. The calculated loss at 1.0kGy of thiamine in cooked pork was only 1.5%. There were initial increases with radiation doses up to 2-4 kGy in measured concentrations of riboflavin and niacin in pork and chicken. Increases were highly significant, and of concern to the study of radiation effects and the chemical method of determination of these vitamins. (author)

  1. Mechanical Properties of Light Weight Polymer Modified Concrete Made with Chopped Rubber Tires

    Directory of Open Access Journals (Sweden)

    Hassanien Mohammed Thiyab

    2017-07-01

    Full Text Available Lightweight concrete is highly used as loaded and unloaded parts in structures. The low values of compressive strength leads to the production of lightweight concrete blocks that can be used in partitions and the types that have more than 17 MPa and in some structural members that are not highly loaded. This research includes study of mechanical properties of this type of concrete which produced from the waste materials ( chopped rubber tires that are used as a percentage from coarse aggregates by the replacing method. The replacement was as 10%, 20%, 30%, 40% and 50% by weight of coarse aggregates. The mixes were modified by using the styrene butadiene rubber (SBR to increase the values of the mechanical properties and durability. The aim of this investigation is to product special mixes of concrete with a low density and good mechanical properties to reduce the dead load and more economic construction . This study proof the CRT effect on compressive strength whereas it dropped from 62.5 Mpa to 40.8 Mpa by increase percentage of the CRT from 10% to 50%, but in the same time the density lowered up to 33%. The mixes with 10%, 20%, 30% can be regarded as a structural lightweight concrete (exceeded 17 MPa and the other mixes can be used for the production of lightweight blocks used in partitions.

  2. ACCELEROMETERS IN FLOW FIELDS: A STRUCTURAL ANALYSIS OF THE CHOPPED DUMMY INPILE TUBE

    Energy Technology Data Exchange (ETDEWEB)

    Howard, T. K.; Marcum, W. R.; Latimer, G. D.; Weiss, A.; Jones, W. F.; Phillips, A. M.; Woolstenhulme, N.; Holdaway, K.; Campbell, J.

    2016-06-01

    Four tests characterizing the structural response of the Chopped-Dummy In-Pile tube (CDIPT) experiment design were measured in the Hydro-Mechanical Fuel Test Facility (HMFTF). Four different test configurations were tried. These configurations tested the pressure drop and flow impact of various plate configurations and flow control orifices to be used later at different reactor power levels. Accelerometers were placed on the test vehicle and flow simulation housing. A total of five accelerometers were used with one on the top and bottom of the flow simulator and vehicle, and one on the outside of the flow simulator. Data were collected at a series of flow rates for 5 seconds each at an acquisition rate of 2 kHz for a Nyquist frequency of 1 kHz. The data were then analyzed using a Fast Fourier Transform (FFT) algorithm. The results show very coherent vibrations of the CDIPT experiment on the order of 50 Hz in frequency and 0.01 m/s2 in magnitude. The coherent vibrations, although small in magnitude pose a potential design problem if the frequencies coincide with the natural frequency of the fueled plates or test vehicle. The accelerometer data was integrated and combined to create a 3D trace of the experiment during the test. The merits of this data as well as further anomalies and artifacts are also discussed as well as their relation to the instrumentation and experiment design.

  3. Efficacy on chopping with lens loop-pad in the small incision extracapsular cataract surgery with intraocular lens implantation

    Directory of Open Access Journals (Sweden)

    Xiao-Ning Peng

    2014-04-01

    Full Text Available AIM: To study the clinical effects of chopping with lens loop-pad in the small incision extracapsular cataract surgery with intraocular lens implantation.METHODS:A total of 75 cases(80 eyes, in which loop-pad and chop knife were performed to chop nucleus before implanting intraocular lens. Visual acuity, postoperative astigmatism degree, intraoperative and postoperative complications were observed. The post-operative follow-up periods ranged from 3 to 12mo.RESULTS: The visual acuity was 0.3-0.5 in 37 eyes and 0.6 or better in 21 eyes at 1d, while was respectively in 43 eyes and in 26 eyes at 1mo. Compared with preoperative astigmatism(0.85±0.29D, there were significant difference at postoperative 1wk(1.75±0.55D(PP>0.05. Intraoperative posterior capsule rupture occurred in 4 eyes, which implantation was successful in 1 eye and 3 eyes was managed viaciliary sulcus. Two eyes had dermatoglyphic pattern edema in corneal endothelium which recovered after about 3d. Two eyes had local patchy opacities which recovered in 2wk. Two eyes had transient high intraocular pressure.CONCLUSION: The surgery is efficient, low cost, easy process and less complications, it is worth to be popularized.

  4. Additional Survival Benefit of Involved-Lesion Radiation Therapy After R-CHOP Chemotherapy in Limited Stage Diffuse Large B-Cell Lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Jeanny [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Il Han, E-mail: ihkim@snu.ac.kr [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Institute of Radiation Medicine, Medical Research Center, Seoul National University, Seoul (Korea, Republic of); Kim, Byoung Hyuck [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Tae Min; Heo, Dae Seog [Department of Internal Medicine, Seoul National University Hospital, Seoul (Korea, Republic of)

    2015-05-01

    Purpose: The purpose of this study was to evaluate the role of involved-lesion radiation therapy (ILRT) after rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy in limited stage diffuse large B-cell lymphoma (DLBCL) by comparing outcomes of R-CHOP therapy alone with R-CHOP followed by ILRT. Methods and Materials: We identified 198 patients treated with R-CHOP (median, 6 cycles) for pathologically confirmed DLBCL of limited stage from July 2004 to December 2012. Clinical characteristics of these patients were 33% with stage I and 66.7% with stage II; 79.8% were in the low or low-intermediate risk group; 13.6% had B symptoms; 29.8% had bulky tumors (≥7 cm); and 75.3% underwent ≥6 cycles of R-CHOP therapy. RT was given to 43 patients (21.7%) using ILRT technique, which included the prechemotherapy tumor volume with a median margin of 2 cm (median RT dose: 36 Gy). Results: After a median follow-up of 40 months, 3-year progression-free survival (PFS) and overall survival (OS) were 85.8% and 88.9%, respectively. Multivariate analysis showed ≥6 cycles of R-CHOP (PFS, P=.004; OS, P=.004) and ILRT (PFS, P=.021; OS, P=.014) were favorable prognosticators of PFS and OS. A bulky tumor (P=.027) and response to R-CHOP (P=.012) were also found to be independent factors of OS. In subgroup analysis, the effect of ILRT was prominent in patients with a bulky tumor (PFS, P=.014; OS, P=.030) or an elevated level of serum lactate dehydrogenase (LDH; PFS, P=.004; OS, P=.012). Conclusions: Our results suggest that ILRT after R-CHOP therapy improves PFS and OS in patients with limited stage DLBCL, especially in those with bulky disease or an elevated serum LDH level.

  5. Ultrasound-targeted microbubble destruction (UTMD assisted delivery of shRNA against PHD2 into H9C2 cells.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Gene therapy has great potential for human diseases. Development of efficient delivery systems is critical to its clinical translation. Recent studies have shown that microbubbles in combination with ultrasound (US can be used to facilitate gene delivery. An aim of this study is to investigate whether the combination of US-targeted microbubble destruction (UTMD and polyethylenimine (PEI (UTMD/PEI can mediate even greater gene transfection efficiency than UTMD alone and to optimize ultrasonic irradiation parameters. Another aim of this study is to investigate the biological effects of PHD2-shRNA after its transfection into H9C2 cells. pEGFP-N1 or eukaryotic shPHD2-EGFP plasmid was mixed with albumin-coated microbubbles and PEI to form complexes for transfection. After these were added into H9C2 cells, the cells were exposed to US with various sets of parameters. The cells were then harvested and analyzed for gene expression. UTMD/PEI was shown to be highly efficient in gene transfection. An US intensity of 1.5 W/cm2, a microbubble concentration of 300μl/ml, an exposure time of 45s, and a plasmid concentration of 15μg/ml were found to be optimal for transfection. UTMD/PEI-mediated PHD2-shRNA transfection in H9C2 cells significantly down regulated the expression of PHD2 and increased expression of HIF-1α and downstream angiogenesis factors VEGF, TGF-β and bFGF. UTMD/PEI, combined with albumin-coated microbubbles, warrants further investigation for therapeutic gene delivery.

  6. Coupling shRNA screens with single-cell RNA-seq identifies a dual role for mTOR in reprogramming-induced senescence.

    Science.gov (United States)

    Aarts, Marieke; Georgilis, Athena; Beniazza, Meryam; Beolchi, Patrizia; Banito, Ana; Carroll, Thomas; Kulisic, Marizela; Kaemena, Daniel F; Dharmalingam, Gopuraja; Martin, Nadine; Reik, Wolf; Zuber, Johannes; Kaji, Keisuke; Chandra, Tamir; Gil, Jesús

    2017-10-15

    Expression of the transcription factors OCT4, SOX2, KLF4, and cMYC (OSKM) reprograms somatic cells into induced pluripotent stem cells (iPSCs). Reprogramming is a slow and inefficient process, suggesting the presence of safeguarding mechanisms that counteract cell fate conversion. One such mechanism is senescence. To identify modulators of reprogramming-induced senescence, we performed a genome-wide shRNA screen in primary human fibroblasts expressing OSKM. In the screen, we identified novel mediators of OSKM-induced senescence and validated previously implicated genes such as CDKN1A We developed an innovative approach that integrates single-cell RNA sequencing (scRNA-seq) with the shRNA screen to investigate the mechanism of action of the identified candidates. Our data unveiled regulation of senescence as a novel way by which mechanistic target of rapamycin (mTOR) influences reprogramming. On one hand, mTOR inhibition blunts the induction of cyclin-dependent kinase (CDK) inhibitors (CDKIs), including p16 INK4a , p21 CIP1 , and p15 INK4b , preventing OSKM-induced senescence. On the other hand, inhibition of mTOR blunts the senescence-associated secretory phenotype (SASP), which itself favors reprogramming. These contrasting actions contribute to explain the complex effect that mTOR has on reprogramming. Overall, our study highlights the advantage of combining functional screens with scRNA-seq to accelerate the discovery of pathways controlling complex phenotypes. © 2017 Aarts et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Intrahippocampal injection of a lentiviral vector expressing neurogranin enhances cognitive function in 5XFAD mice.

    Science.gov (United States)

    Jeon, Seong Gak; Kang, Moonkyung; Kim, Yeon-Soo; Kim, Dong-Hyun; Nam, Dong Woo; Song, Eun Ji; Mook-Jung, Inhee; Moon, Minho

    2018-03-23

    Progressive cognitive declines are the main clinical symptoms of Alzheimer's disease (AD). Cognitive impairment in AD is directly correlated with amyloid beta (Aβ)-mediated synaptic deficits. It is known that upregulation of neurogranin (Ng), a postsynaptic protein, contributes to the enhancement of synaptic plasticity and cognitive function. By contrast, downregulation of Ng expression results in learning and memory impairments. Interestingly, Ng expression is significantly reduced in the parenchyma of brains with AD. However, the pathological role that downregulated Ng plays in the cognitive dysfunctions observed in AD remains unclear. Therefore, the present study examined whether enhancing Ng expression affected cognitive functions in 5XFAD mice, an animal model of AD. We found that the Ng reductions and cognitive decline observed in 5XFAD mice were restored in mice that were intrahippocampally injected with an Ng-expressing lentiviral vector. Furthermore, overexpression of Ng upregulated expression of postsynaptic density protein-95 in the hippocampus of 5XFAD mice. These results suggest that the cause of cognitive decline in AD may be at least partially associated with reduced Ng levels, and thus, supplementation of Ng may be an appropriate therapeutic strategy for individuals with AD.

  8. Mucosal immunization with integrase-defective lentiviral vectors protects against influenza virus challenge in mice.

    Directory of Open Access Journals (Sweden)

    Judith M Fontana

    Full Text Available Recent reports highlight the potential for integrase-defective lentiviral vectors (IDLV to be developed as vaccines due to their ability to elicit cell-mediated and humoral immune responses after intramuscular administration. Differently from their integrase-competent counterpart, whose utility for vaccine development is limited by the potential for insertional mutagenesis, IDLV possess a mutation in their integrase gene that prevents genomic integration. Instead, they are maintained as episomal DNA circles that retain the ability to stably express functional proteins. Despite their favorable profile, it is unknown whether IDLV elicit immune responses after intranasal administration, a route that could be advantageous in the case of infection with a respiratory agent. Using influenza as a model, we constructed IDLV expressing the influenza virus nucleoprotein (IDLV-NP, and tested their ability to generate NP-specific immune responses and protect from challenge in vivo. We found that administration of IDLV-NP elicited NP-specific T cell and antibody responses in BALB/c mice. Importantly, IDLV-NP was protective against homologous and heterosubtypic influenza virus challenge only when given by the intranasal route. This is the first report demonstrating that IDLV can induce protective immunity after intranasal administration, and suggests that IDLV may represent a promising vaccine platform against infectious agents.

  9. DNA Methylation and Histone Modifications Are the Molecular Lock in Lentivirally Transduced Hematopoietic Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Siew Ching Ngai

    2015-01-01

    Full Text Available Stable introduction of a functional gene in hematopoietic progenitor cells (HPCs has appeared to be an alternative approach to correct genetically linked blood diseases. However, it is still unclear whether lentiviral vector (LV is subjected to gene silencing in HPCs. Here, we show that LV carrying green fluorescent protein (GFP reporter gene driven by cytomegalovirus (CMV promoter was subjected to transgene silencing after transduction into HPCs. This phenomenon was not due to the deletion of proviral copy number. Study using DNA demethylating agent and histone deacetylase (HDAC inhibitor showed that the drugs could either prevent or reverse the silencing effect. Using sodium bisulfite sequencing and chromatin immunoprecipitation (ChIP assay, we demonstrated that DNA methylation occurred soon after LV transduction. At the highest level of gene expression, CMV promoter was acetylated and was in a euchromatin state, while GFP reporter gene was acetylated but was strangely in a heterochromatin state. When the expression declined, CMV promoter underwent transition from acetylated and euchromatic state to a heterochromatic state, while the GFP reporter gene was in deacetylated and heterochromatic state. With these, we verify that DNA methylation and dynamic histone modifications lead to transgene silencing in HPCs transduced with LV.

  10. Visualization of cortical projection neurons with retrograde TET-off lentiviral vector.

    Directory of Open Access Journals (Sweden)

    Akiya Watakabe

    Full Text Available We are interested in identifying and characterizing various projection neurons that constitute the neocortical circuit. For this purpose, we developed a novel lentiviral vector that carries the tetracycline transactivator (tTA and the transgene under the TET Responsive Element promoter (TRE on a single backbone. By pseudotyping such a vector with modified rabies G-protein, we were able to express palmitoylated-GFP (palGFP or turboFP635 (RFP in corticothalamic, corticocortical, and corticopontine neurons of mice. The high-level expression of the transgene achieved by the TET-Off system enabled us to observe characteristic elaboration of neuronal processes for each cell type. At higher magnification, we were able to observe fine structures such as boutons and spines as well. We also injected our retrograde TET-Off vector to the marmoset cortex and proved that it can be used to label the long-distance cortical connectivity of millimeter scale. In conclusion, our novel retrograde tracer provides an attractive option to investigate the morphologies of identified cortical projection neurons of various species.

  11. Alleviation of Trigeminal Nociception Using p75 Neurotrophin Receptor Targeted Lentiviral Interference Therapy.

    Science.gov (United States)

    O'Leary, Valerie B; O'Connell, Marie; Antyborzec, Inga; Ntziachristos, Vasilis; Oliver Dolly, J; Ovsepian, Saak V

    2018-02-09

    Acute and chronic trigeminal (TG) neuropathies are the cause of considerable distress, with limited treatments available at present. Nociceptive neurons enriched with the vanilloid type 1 receptor (VR1) partake in pain sensation and sensitization in the TG system. While VR1 blockers with anti-nociceptive potential are of substantial medical interest, their use remains limited due to poor selectivity and lack of cell-targeting capabilities. This study describes a methodology for the alleviation of nociception via targeted depletion of VR1 in TG sensory neurons in rats. In cultured TG ganglion neurons, VR1 expression was virtually abolished by lentiviral short hairpin RNA (LV-VR1). By decorating GFP encoding LV (LV-GFP) and LV-VR1 with IgG192 for targeting TG sensory neurons enriched with the p75 neurotrophin receptor (p75NTR), transduction of a reporter GFP and VR1 depletion was achieved after injection of targeted vectors into the whisker pad. In IgG192/LV-VR1-injected rats, the behavioral response to capsaicin exposure as well as Erk 1/2 phosphorylation and VR1 current activation by capsaicin were significantly reduced. This pioneering investigation, thus, provides a proof of principle for a means of attenuating TG nociception, revealing therapeutic potential.

  12. Immune modulation by genetic modification of dendritic cells with lentiviral vectors.

    Science.gov (United States)

    Liechtenstein, Therese; Perez-Janices, Noemi; Bricogne, Christopher; Lanna, Alessio; Dufait, Inès; Goyvaerts, Cleo; Laranga, Roberta; Padella, Antonella; Arce, Frederick; Baratchian, Mehdi; Ramirez, Natalia; Lopez, Natalia; Kochan, Grazyna; Blanco-Luquin, Idoia; Guerrero-Setas, David; Breckpot, Karine; Escors, David

    2013-09-01

    Our work over the past eight years has focused on the use of HIV-1 lentiviral vectors (lentivectors) for the genetic modification of dendritic cells (DCs) to control their functions in immune modulation. DCs are key professional antigen presenting cells which regulate the activity of most effector immune cells, including T, B and NK cells. Their genetic modification provides the means for the development of targeted therapies towards cancer and autoimmune disease. We have been modulating with lentivectors the activity of intracellular signalling pathways and co-stimulation during antigen presentation to T cells, to fine-tune the type and strength of the immune response. In the course of our research, we have found unexpected results such as the surprising immunosuppressive role of anti-viral signalling pathways, and the close link between negative co-stimulation in the immunological synapse and T cell receptor trafficking. Here we review our major findings and put them into context with other published work. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Safe and Effective Gene Therapy for Murine Wiskott-Aldrich Syndrome Using an Insulated Lentiviral Vector

    Directory of Open Access Journals (Sweden)

    Swati Singh

    2017-03-01

    Full Text Available Wiskott-Aldrich syndrome (WAS is a life-threatening immunodeficiency caused by mutations within the WAS gene. Viral gene therapy to restore WAS protein (WASp expression in hematopoietic cells of patients with WAS has the potential to improve outcomes relative to the current standard of care, allogeneic bone marrow transplantation. However, the development of viral vectors that are both safe and effective has been problematic. While use of viral transcriptional promoters may increase the risk of insertional mutagenesis, cellular promoters may not achieve WASp expression levels necessary for optimal therapeutic effect. Here we evaluate a self-inactivating (SIN lentiviral vector combining a chromatin insulator upstream of a viral MND (MPSV LTR, NCR deleted, dl587 PBS promoter driving WASp expression. Used as a gene therapeutic in Was−/− mice, this vector resulted in stable WASp+ cells in all hematopoietic lineages and rescue of T and B cell defects with a low number of viral integrations per cell, without evidence of insertional mutagenesis in serial bone marrow transplants. In a gene transfer experiment in non-human primates, the insulated MND promoter (driving GFP expression demonstrated long-term polyclonal engraftment of GFP+ cells. These observations demonstrate that the insulated MND promoter safely and efficiently reconstitutes clinically effective WASp expression and should be considered for future WAS therapy.

  14. Distinct cytoplasmic and nuclear functions of the stress induced protein DDIT3/CHOP/GADD153.

    Directory of Open Access Journals (Sweden)

    Alexandra Jauhiainen

    Full Text Available DDIT3, also known as GADD153 or CHOP, encodes a basic leucine zipper transcription factor of the dimer forming C/EBP family. DDIT3 is known as a key regulator of cellular stress response, but its target genes and functions are not well characterized. Here, we applied a genome wide microarray based expression analysis to identify DDIT3 target genes and functions. By analyzing cells carrying tamoxifen inducible DDIT3 expression constructs we show distinct gene expression profiles for cells with cytoplasmic and nuclear localized DDIT3. Of 175 target genes identified only 3 were regulated by DDIT3 in both cellular localizations. More than two thirds of the genes were downregulated, supporting a role for DDIT3 as a dominant negative factor that could act by either cytoplasmic or nuclear sequestration of dimer forming transcription factor partners. Functional annotation of target genes showed cell migration, proliferation and apoptosis/survival as the most affected categories. Cytoplasmic DDIT3 affected more migration associated genes, while nuclear DDIT3 regulated more cell cycle controlling genes. Cell culture experiments confirmed that cytoplasmic DDIT3 inhibited migration, while nuclear DDIT3 caused a G1 cell cycle arrest. Promoters of target genes showed no common sequence motifs, reflecting that DDIT3 forms heterodimers with several alternative transcription factors that bind to different motifs. We conclude that expression of cytoplasmic DDIT3 regulated 94 genes. Nuclear translocation of DDIT3 regulated 81 additional genes linked to functions already affected by cytoplasmic DDIT3. Characterization of DDIT3 regulated functions helps understanding its role in stress response and involvement in cancer and degenerative disorders.

  15. Investigation of the Mesenchymal Stem Cell Compartment by Means of a Lentiviral Barcode Library.

    Science.gov (United States)

    Bigildeev, A E; Cornils, K; Aranyossy, T; Sats, N V; Petinati, N A; Shipounova, I N; Surin, V L; Pshenichnikova, O S; Riecken, K; Fehse, B; Drize, N I

    2016-04-01

    The hematopoietic bone marrow microenvironment is formed by proliferation and differentiation of mesenchymal stem cells (MSCs). The MSC compartment has been less studied than the hematopoietic stem cell compartment. To characterize the structure of the MSC compartment, it is necessary to trace the fate of distinct mesenchymal cells. To do so, mesenchymal progenitors need to be marked at the single-cell level. A method for individual marking of normal and cancer stem cells based on genetic "barcodes" has been developed for the last 10 years. Such approach has not yet been applied to MSCs. The aim of this study was to evaluate the possibility of using such barcoding strategy to mark MSCs and their descendants, colony-forming units of fibroblasts (CFU-Fs). Adherent cell layers (ACLs) of murine long-term bone marrow cultures (LTBMCs) were transduced with a lentiviral library with barcodes consisting of 32 + 3 degenerate nucleotides. Infected ACLs were suspended, and CFU-F derived clones were obtained. DNA was isolated from each individual colony, and barcodes were analyzed in marked CFU-F-derived colonies by means of conventional polymerase chain reaction and Sanger sequencing. Barcodes were identified in 154 marked colonies. All barcodes appeared to be unique: there were no two distinct colonies bearing the same barcode. It was shown that ACLs included CFU-Fs with different proliferative potential. MSCs are located higher in the hierarchy of mesenchymal progenitors than CFU-Fs, so the presented data indicate that MSCs proliferate rarely in LTBMCs. A method of stable individual marking and comparing the markers in mesenchymal progenitor cells has been developed in this work. We show for the first time that a barcoded library of lentiviruses is an effective tool for studying stromal progenitor cells.

  16. The transduction pattern of IL-12-encoding lentiviral vectors shapes the immunological outcome.

    Science.gov (United States)

    Goyvaerts, Cleo; Broos, Katrijn; Escors, David; Heirman, Carlo; Raes, Geert; De Baetselier, Patrick; Thielemans, Kris; Breckpot, Karine

    2015-12-01

    In situ modification of antigen-presenting cells garnered interest in cancer immunotherapy. Therefore, we developed APC-targeted lentiviral vectors (LVs). Unexpectedly, these LVs were inferior vaccines to broad tropism LVs. Since IL-12 is a potent mediator of antitumor immunity, we evaluated whether this proinflammatory cytokine could enhance antitumor immunity of an APC-targeted LV-based vaccine. Therefore, we compared subcutaneous administration of broad tropism LVs (VSV-G-LV) with APC-targeted LVs (DC2.1-LV)-encoding enhanced GFP and ovalbumin, or IL-12 and ovalbumin in mice. We show that codelivery of IL-12 by VSV-G-LVs or DC2.1-LVs augments CD4(+) or CD8(+) T-cell proliferation, respectively. Furthermore, we demonstrate that codelivery of IL-12 enhances the CD4(+) TH 1 profile irrespective of its delivery mode, while an increase in cytotoxic and therapeutic CD8(+) T cells was only induced upon VSV-G-LV injection. While codelivery of IL-12 by DC2.1-LVs did not enhance CD8(+) T-cell performance, it increased expression of inhibitory checkpoint markers Lag3, Tim3, and PD-1. Finally, the discrepancy between CD4(+) T-cell stimulation with and without functional CD8(+) T-cell stimulation by VSV-G- and DC2.1-LVs is partly explained by the observation that IL-12 relieves CD8(+) T cells from CD4(+) T-cell help, implying that a T(H)1 profile is of minor importance for antitumor immunotherapy if IL-12 is exogenously delivered. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Optical control of retrogradely infected neurons using drug-regulated "TLoop" lentiviral vectors.

    Science.gov (United States)

    Cetin, Ali; Callaway, Edward M

    2014-05-01

    Many approaches that use viral vectors to deliver transgenes have limited transduction efficiency yet require high levels of transgene expression. In particular, infection via axon terminals is relatively inefficient but is a powerful means of achieving infection of specific neuron types. Combining this with optogenetic approaches requires high gene expression levels that are not typically achieved with nontoxic retrogradely infecting vectors. We generated rabies glycoprotein-pseudotyped lentiviral vectors that use a positive feedback loop composed of a Tet promoter driving both its own tetracycline-dependent transcription activator (tTA) ("TLoop") and channelrhodopsin-2-YFP (ChR2YFP). We show that TLoop vectors strongly express proteins in a drug-controllable manner in neurons that project to injection sites within the mouse brain. After initial infection, the virus travels retrogradely, stably integrates into the host genome, and expresses gene products. The expression is robust and allows optogenetic studies of neurons projecting to the location of virus injection, as demonstrated by fluorescence-targeted intracellular recordings. ChR2YFP expression did not cause observable signs of toxicity and continued for up to 6 mo after infection. Expression can be reversibly blocked by administration of doxycycline, if necessary, for expression of gene products that might be more toxic. Overall, we present a system that will allow researchers to achieve high levels of gene expression even in the face of inefficient viral transduction. The particular vectors that we demonstrate may enhance efforts to gain a precise understanding of the contributions of specific types of projection neurons to brain function. Copyright © 2014 the American Physiological Society.

  18. Oviduct-Specific Expression of Human Neutrophil Defensin 4 in Lentivirally Generated Transgenic Chickens

    Science.gov (United States)

    Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang

    2015-01-01

    The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529

  19. Improving expression of reporter transgene in stem cell by construction of different lentiviral vectors

    Energy Technology Data Exchange (ETDEWEB)

    Tae, Seong Ho; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of); Le, Uyenchi N.; Padmanabhan, Parasuraman [Singapore Bio-Imaging Imaging Consortium, Singapore (Singapore)

    2007-07-01

    For stem cell trafficking applications, it is imperative to express transgenes at desired and stable levels. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in proliferative or nonproliferative states. Moreover, transgene expression levels can be controlled by using different promoters. The present study was designed to compare the potency of various promoters regulating expression of imaging reporter genes in embryonic H9c2 cardiomyoblasts derived from rat heart. Lentiviral vector was produced by the transient transfection of plasmids carrying required genes and those encoding for virus coating proteins into 293T cells. Harvested viral constructs were incubated with Hela and H9c2 cells, respectively. Transgene expressions were detected by several imaging modalities and evaluated by enzymatic assays. Results - We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in embryonic cardiomyoblasts in vitro and that transgene expression levels can be varied by using different well-characterized gene promoters. In vivo trials about gene expression will probably further determine the potential of long-term trafficking stem cells using lentivirus.

  20. Improving expression of reporter transgene in stem cell by construction of different lentiviral vectors

    International Nuclear Information System (INIS)

    Tae, Seong Ho; Min, Jung Joon; Le, Uyenchi N.; Padmanabhan, Parasuraman

    2007-01-01

    For stem cell trafficking applications, it is imperative to express transgenes at desired and stable levels. In recent years, lentivirus-mediated gene transfer was shown to be an efficient method to stably introduce genetic modifications in target cells, even if these are in proliferative or nonproliferative states. Moreover, transgene expression levels can be controlled by using different promoters. The present study was designed to compare the potency of various promoters regulating expression of imaging reporter genes in embryonic H9c2 cardiomyoblasts derived from rat heart. Lentiviral vector was produced by the transient transfection of plasmids carrying required genes and those encoding for virus coating proteins into 293T cells. Harvested viral constructs were incubated with Hela and H9c2 cells, respectively. Transgene expressions were detected by several imaging modalities and evaluated by enzymatic assays. Results - We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. We observed that the level of stable transgene expression in lentivirus-transduced myoblasts could be modulated over several orders of magnitude, with the Ubiquitin (Ub) promoter exhibiting the highest activity, intermediate expression was observed with the CAG promoter, whereas expression observed with the CMV promoter was very weak. Here we show that lentivirus-mediated gene transfer allows efficient and stable transgene expression in embryonic cardiomyoblasts in vitro and that transgene expression levels can be varied by using different well-characterized gene promoters. In vivo trials about gene expression will probably further determine the potential of long-term trafficking stem cells using lentivirus

  1. Prior Virus Exposure Alters the Long-Term Landscape of Viral Replication during Feline Lentiviral Infection

    Directory of Open Access Journals (Sweden)

    Sue VandeWoude

    2011-10-01

    Full Text Available We developed a feline model of lentiviral cross-species transmission using a puma lentivirus (PLV or FIVPco which infects domestic cats but does not cause disease. Infection with PLV protects cats from CD4+ T-cell decline caused by subsequent infection with virulent feline immunodeficiency virus (FIV. Previous studies implicate innate immune and/or cellular restriction mechanisms for FIV disease attenuation in PLV-infected cats. In this study, we evaluated viral infection and cytokine mRNA transcription in 12 different tissue reservoirs approximately five months post infection. We quantitated tissue proviral load, viral mRNA load and relative transcription of IL-10, IL-12p40 and IFNγ from tissues of cats exposed to FIV, PLV or both viruses and analyzed these parameters using a multivariate statistical approach. The distribution and intensity of FIV infection and IFNγ transcription differed between single and co-infected cats, characterized by higher FIV proviral loads and IFNγ expression in co-infected cat tissues. Variability in FIV mRNA load and IFNγ was significantly more constrained in co-infected versus singly infected cat tissues. Single-infected:co-infected ratios of FIV mRNA load compared to FIV proviral load indicated that active viral transcription was apparently inhibited during co-infection. These results indicate that previous PLV infection increases activation of tissue innate immunity and constrains the ability of FIV to productively infect tissue reservoirs of infection for months, independent of FIV proviral load, supporting a model in which innate immunity and/or modulation of target cell susceptibility play a key role in PLV-induced protection from FIV disease.

  2. Gene transfer to chicks using lentiviral vectors administered via the embryonic chorioallantoic membrane.

    Directory of Open Access Journals (Sweden)

    Gideon Hen

    Full Text Available The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV, into the chorioallantoic membrane (CAM of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP or recombinant alpha-melanocyte-stimulating hormone (α-MSH genes, driven by the cytomegalovirus (CMV promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP nick end labeling (TUNEL assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA, and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides.

  3. Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein.

    Directory of Open Access Journals (Sweden)

    Miyabi Hirano

    Full Text Available The development of gene therapy techniques to introduce transgenes that promote neuronal survival and protection provides effective therapeutic approaches for neurological and neurodegenerative diseases. Intramuscular injection of adenoviral and adeno-associated viral vectors, as well as lentiviral vectors pseudotyped with rabies virus glycoprotein (RV-G, permits gene delivery into motor neurons in animal models for motor neuron diseases. Recently, we developed a vector with highly efficient retrograde gene transfer (HiRet by pseudotyping a human immunodeficiency virus type 1 (HIV-1-based vector with fusion glycoprotein B type (FuG-B or a variant of FuG-B (FuG-B2, in which the cytoplasmic domain of RV-G was replaced by the corresponding part of vesicular stomatitis virus glycoprotein (VSV-G. We have also developed another vector showing neuron-specific retrograde gene transfer (NeuRet with fusion glycoprotein C type, in which the short C-terminal segment of the extracellular domain and transmembrane/cytoplasmic domains of RV-G was substituted with the corresponding regions of VSV-G. These two vectors afford the high efficiency of retrograde gene transfer into different neuronal populations in the brain. Here we investigated the efficiency of the HiRet (with FuG-B2 and NeuRet vectors for retrograde gene transfer into motor neurons in the spinal cord and hindbrain in mice after intramuscular injection and compared it with the efficiency of the RV-G pseudotype of the HIV-1-based vector. The main highlight of our results is that the HiRet vector shows the most efficient retrograde gene transfer into both spinal cord and hindbrain motor neurons, offering its promising use as a gene therapeutic approach for the treatment of motor neuron diseases.

  4. Co-delivery of doxorubicin and recombinant plasmid pHSP70-Plk1-shRNA by bacterial magnetosomes for osteosarcoma therapy

    Science.gov (United States)

    Cheng, Li; Ke, Youqun; Yu, Shuisheng; Jing, Juehua

    2016-01-01

    To explore a novel combination of chemotherapy, gene therapy, and thermotherapy for osteosarcoma, a targeted heat-sensitive co-delivery system based on bacterial magnetosomes (BMs) was developed. The optimal culture conditions of magnetotactic bacteria (MTB) AMB-1 and characterization of BMs were achieved. A recombinant eukaryotic plasmid heat shock protein 70-polo-like kinase 1-short hairpin RNA (pHSP70-Plk1-shRNA) under transcriptional control of a thermosensitive promoter (human HSP70 promoter) was constructed for gene therapy. Doxorubicin (DOX) and pHSP70-Plk1-shRNA were included in the targeted thermosensitive co-delivery system, and in vitro DOX release activity, targeted gene silencing efficiency and in vitro antitumor efficacy were investigated. The results showed that the optimal culture conditions of MTB AMB-1 are an oxygen concentration of 4.0%, a pH value of 7.0, 20 μmol/L of ferrous sulfate, 800 mg/L of sodium nitrate, and 200 mg/L of succinic acid. The temperature of BMs reached 43°C within 3 minutes and could be maintained for 30 minutes by adjusting the magnitude of the alternating magnetic field (AMF). The diameters of BMs, BM-DOX, BM-recombinant eukaryotic plasmid pHSP70-Plk1-shRNA (shPlk1), and BM-DOX-shPlk1 were 43.7±4.6, 79.2±5.4, 88.9±7.8, and 133.5±11.4 nm, respectively. The zeta potentials of BMs, BM-DOX, BM-shPlk1, and BM-DOX-shPlk1 were −29.4±6.9, −9.5±5.6, −16.7±4.8, and −10.3±3.1 mV, respectively. Besides, the system exhibited good release behavior. DOX release rate from BM-DOX-shPlk1 was 54% after incubation with phosphate-buffered saline at 43°C and 37% after incubation with 50% fetal bovine serum, which was significantly higher than that at 37°C (P<0.05). In addition, the expressions of Plk1 mRNA and protein were significantly suppressed in cells treated with BM-DOX-shPlk1 following hyperthermia treatment under the influence of an AMF compared to other groups (P<0.05). Furthermore, evaluation of the effect of in

  5. Lentiviral-mediated transfer of CDNF promotes nerve regeneration and functional recovery after sciatic nerve injury in adult rats

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Lei; Liu, Yi; Zhao, Hua; Zhang, Wen; Guo, Ying-Jun; Nie, Lin, E-mail: chengleiyx@126.com

    2013-10-18

    Highlights: •CDNF was successfully transfected by a lentiviral vector into the distal sciatic nerve. •CDNF improved S-100, NF200 expression and nerve regeneration after sciatic injury. •CDNF improved the remyelination and thickness of the regenerated sciatic nerve. •CDNF improved gastrocnemius muscle weight and sciatic functional recovery. -- Abstract: Peripheral nerve injury is often followed by incomplete and unsatisfactory functional recovery and may be associated with sensory and motor impairment of the affected limb. Therefore, a novel method is needed to improve the speed of recovery and the final functional outcome after peripheral nerve injuries. This report investigates the effect of lentiviral-mediated transfer of conserved dopamine neurotrophic factor (CDNF) on regeneration of the rat peripheral nerve in a transection model in vivo. We observed notable overexpression of CDNF protein in the distal sciatic nerve after recombinant CDNF lentiviral vector application. We evaluated sciatic nerve regeneration after surgery using light and electron microscopy and the functional recovery using the sciatic functional index and target muscle weight. HE staining revealed better ordered structured in the CDNF-treated group at 8 weeks post-surgery. Quantitative analysis of immunohistochemistry of NF200 and S-100 in the CDNF group revealed significant improvement of axonal and Schwann cell regeneration compared with the control groups at 4 weeks and 8 weeks after injury. The thickness of the myelination around the axons in the CDNF group was significantly higher than in the control groups at 8 weeks post-surgery. The CDNF group displayed higher muscle weights and significantly increased sciatic nerve index values. Our findings suggest that CDNF gene therapy could provide durable and stable CDNF protein concentration and has the potential to enhance peripheral nerve regeneration, morphological and functional recovery following nerve injury, which suggests a

  6. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P

    2006-03-01

    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  7. Germ-line transmission of lentiviral PGK-EGFP integrants in transgenic cattle: new perspectives for experimental embryology.

    Science.gov (United States)

    Reichenbach, Myriam; Lim, Tiongti; Reichenbach, Horst-Dieter; Guengoer, Tuna; Habermann, Felix A; Matthiesen, Marieke; Hofmann, Andreas; Weber, Frank; Zerbe, Holm; Grupp, Thomas; Sinowatz, Fred; Pfeifer, Alexander; Wolf, Eckhard

    2010-08-01

    Lentiviral vectors are a powerful tool for the genetic modification of livestock species. We previously generated transgenic founder cattle with lentiviral integrants carrying enhanced green fluorescent protein (EGFP) under the control of the phosphoglycerate kinase (PGK) promoter. In this study, we investigated the transmission of LV-PGK-EGFP integrants through the female and male germ line in cattle. A transgenic founder heifer (#562, Kiki) was subjected to superovulation treatment and inseminated with semen from a non-transgenic bull. Embryos were recovered and transferred to synchronized recipient heifers, resulting in the birth of a healthy male transgenic calf expressing EGFP as detected by in vivo imaging. Semen from a transgenic founder bull (#561, Jojo) was used for in vitro fertilization (IVF) of in vitro matured (IVM) oocytes from non-transgenic cows. The rates of cleavage and development to blastocyst in vitro corresponded to 52.0 +/- 4.1 and 24.5 +/- 4.4%, respectively. Expression of EGFP was observed at blastocyst stage (day 7 after IVF) and was seen in 93.0% (281/302) of the embryos. 24 EGFP-expressing embryos were transferred to 9 synchronized recipients. Analysis of 2 embryos, flushed from the uterus on day 15, two fetuses recovered on day 45, and a healthy male transgenic calf revealed consistent high-level expression of EGFP in all tissues investigated. Our study shows for the first time transmission of lentiviral integrants through the germ line of female and male transgenic founder cattle. The pattern of inheritance was consistent with Mendelian rules. Importantly, high fidelity expression of EGFP in embryos, fetuses, and offspring of founder #561 provides interesting tools for developmental studies in cattle, including interactions of gametes, embryos and fetuses with their maternal environment.

  8. Generation of multi-functional antigen-specific human T-cells by lentiviral TCR gene transfer.

    Science.gov (United States)

    Perro, M; Tsang, J; Xue, S-A; Escors, D; Cesco-Gaspere, M; Pospori, C; Gao, L; Hart, D; Collins, M; Stauss, H; Morris, E C

    2010-06-01

    T-cell receptor (TCR) gene transfer is an attractive strategy to generate antigen-specific T-cells for adoptive immunotherapy of cancer and chronic viral infection. However, current TCR gene transfer protocols trigger T-cell differentiation into terminally differentiated effector cells, which likely have reduced ability to mediate disease protection in vivo. We have developed a lentiviral gene transfer strategy to generate TCR-transduced human T-cells without promoting T-cell differentiation. We found that a combination of interleukin-15 (IL15) and IL21 facilitated lentiviral TCR gene transfer into non-proliferating T-cells. The transduced T-cells showed redirection of antigen specificity and produced IL2, IFNgamma and TNFalpha in a peptide-dependent manner. A significantly higher proportion of the IL15/IL21-stimulated T-cells were multi-functional and able to simultaneously produce all three cytokines (P<0.01), compared with TCR-transduced T-cells generated by conventional anti-CD3 plus IL2 stimulation, which primarily secreted only one cytokine. Similarly, IL15/IL21 maintained high levels of CD62L and CD28 expression in transduced T-cells, whereas anti-CD3 plus IL2 accelerated the loss of CD62L/CD28 expression. The data demonstrate that the combination of lentiviral TCR gene transfer together with IL15/IL21 stimulation can efficiently redirect the antigen specificity of resting primary human T-cells and generate multi-functional T-cells.

  9. Grinding energy and physical properties of chopped and hammer-milled barley, wheat, oat, and canola straws

    Energy Technology Data Exchange (ETDEWEB)

    J.S. Tumuluru; L.G. Tabil; Y. Song; K.L. Iroba; V. Meda

    2014-01-01

    In the present study, specific energy for grinding and physical properties of wheat, canola, oat and barley straw grinds were investigated. The initial moisture content of the straw was about 0.13–0.15 (fraction total mass basis). Particle size reduction experiments were conducted in two stages: (1) a chopper without a screen, and (2) a hammer mill using three screen sizes (19.05, 25.4, and 31.75 mm). The lowest grinding energy (1.96 and 2.91 kWh t-1) was recorded for canola straw using a chopper and hammer mill with 19.05-mm screen size, whereas the highest (3.15 and 8.05 kWh t-1) was recorded for barley and oat straws. The physical properties (geometric mean particle diameter, bulk, tapped and particle density, and porosity) of the chopped and hammer-milled wheat, barley, canola, and oat straw grinds measured were in the range of 0.98–4.22 mm, 36–80 kg m-3, 49–119 kg m-3, 600–1220 kg m-3, and 0.9–0.96, respectively. The average mean particle diameter was highest for the chopped wheat straw (4.22-mm) and lowest for the canola grind (0.98-mm). The canola grinds produced using the hammer mill (19.05-mm screen size) had the highest bulk and tapped density of about 80 and 119 kg m-3; whereas, the wheat and oat grinds had the lowest of about 58 and 88–90 kg m-3. The results indicate that the bulk and tapped densities are inversely proportional to the particle size of the grinds. The flow properties of the grinds calculated are better for chopped straws compared to hammer milled using smaller screen size (19.05 mm).

  10. The exacerbating roles of CCAAT/enhancer-binding protein homologous protein (CHOP) in the development of bleomycin-induced pulmonary fibrosis and the preventive effects of tauroursodeoxycholic acid (TUDCA) against pulmonary fibrosis in mice.

    Science.gov (United States)

    Tanaka, Yuta; Ishitsuka, Yoichi; Hayasaka, Marina; Yamada, Yusei; Miyata, Keishi; Endo, Motoyoshi; Kondo, Yuki; Moriuchi, Hiroshi; Irikura, Mitsuru; Tanaka, Ken-ichiro; Mizushima, Tohru; Oike, Yuichi; Irie, Tetsumi

    2015-09-01

    The purpose of this study was to evaluate the role of CCAAT/enhancer-binding protein homologous protein (CHOP), an important transcription factor that regulates the inflammatory reaction during the endoplasmic reticulum (ER) stress response, in the development of pulmonary fibrosis induced by bleomycin (BLM) in mice. An intratracheal injection of BLM transiently increased the expression of CHOP mRNA and protein in an early phase (days 1 and 3) in mice lungs. BLM-induced pulmonary fibrosis was significantly attenuated in Chop gene deficient (Chop KO) mice, compared with wild-type (WT) mice. Furthermore, the inflammatory reactions evaluated by protein concentration, the total number of leucocytes and neutrophils in the bronchoalveolar lavage fluid (BALF), the mRNA expression of interleukin 1b and caspase 11, and the apoptotic cell death were suppressed in Chop KO mice compared with those in WT mice. In addition, administration of tauroursodeoxycholic acid (TUDCA), a pharmacological agent that can inhibit CHOP expression, inhibited the BLM-induced pulmonary fibrosis and inflammation, and the increase in Chop mRNA expression in WT mice in a dose-dependent manner. These results suggest that the ER stress-induced transcription factor, CHOP, at least in part, plays an important role in the development of BLM-induced pulmonary fibrosis in mice, and that the inhibition of CHOP expression by a pharmacological agent, such as TUDCA, may be a promising strategy for the prevention of pulmonary fibrosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Randomized Phase II Study of R-CHOP With or Without Bortezomib in Previously Untreated Patients With Non-Germinal Center B-Cell-Like Diffuse Large B-Cell Lymphoma.

    Science.gov (United States)

    Leonard, John P; Kolibaba, Kathryn S; Reeves, James A; Tulpule, Anil; Flinn, Ian W; Kolevska, Tatjana; Robles, Robert; Flowers, Christopher R; Collins, Robert; DiBella, Nicholas J; Papish, Steven W; Venugopal, Parameswaran; Horodner, Andrew; Tabatabai, Amir; Hajdenberg, Julio; Park, Jaehong; Neuwirth, Rachel; Mulligan, George; Suryanarayan, Kaveri; Esseltine, Dixie-Lee; de Vos, Sven

    2017-11-01

    Purpose To evaluate the impact of the addition of bortezomib to rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) on outcomes in previously untreated patients with non-germinal center B-cell-like (non-GCB) diffuse large B-cell lymphoma (DLBCL). Patients and Methods After real-time determination of non-GCB DLBCL using the Hans immunohistochemistry algorithm, 206 patients were randomly assigned (1:1; stratified by International Prognostic Index [IPI] score) to six 21-day cycles of standard R-CHOP alone or R-CHOP plus bortezomib 1.3 mg/m 2 intravenously on days 1 and 4 (VR-CHOP). The primary end point, progression-free survival (PFS), was evaluated in 183 patients with centrally confirmed non-GCB DLBCL who received one or more doses of study drug (91 R-CHOP, 92 VR-CHOP). Results After a median follow-up of 34 months, with 25% (R-CHOP) and 18% (VR-CHOP) of patients having had PFS events, the hazard ratio (HR) for PFS was 0.73 (90% CI, 0.43 to 1.24) with VR-CHOP ( P = .611). Two-year PFS rates were 77.6% with R-CHOP and 82.0% with VR-CHOP; they were 65.1% versus 72.4% in patients with high-intermediate/high IPI (HR, 0.67; 90% CI, 0.34 to 1.29), and 90.0% versus 88.9% (HR, 0.85; 90% CI, 0.35 to 2.10) in patients with low/low-intermediate IPI. Overall response rate with R-CHOP and VR-CHOP was 98% and 96%, respectively. The overall survival HR was 0.75 (90% CI, 0.38 to 1.45); 2-year survival rates were 88.4% and 93.0%, respectively. In the safety population (100 R-CHOP and 101 VR-CHOP patients), grade ≥ 3 adverse events included neutropenia (53% v 49%), thrombocytopenia (13% v 29%), anemia (7% v 15%), leukopenia (26% v 25%), and neuropathy (1% v 5%). Conclusion Outcomes for newly diagnosed, prospectively enrolled patients with non-GCB DLBCL were more favorable than expected with R-CHOP and were not significantly improved by adding bortezomib.

  12. Electron-beam induced current characterization of back-surface field solar cells using a chopped scanning electron microscope beam

    Science.gov (United States)

    Luke, K. L.; Cheng, L.-J.

    1984-01-01

    A chopped electron beam induced current (EBIC) technique for the chacterization of back-surface field (BSF) solar cells is presented. It is shown that the effective recombination velocity of the low-high junction forming the back-surface field of BSF cells, in addition to the diffusion length and the surface recombination velocity of the surface perpendicular to both the p-n and low-high junctions, can be determined from the data provided by a single EBIC scan. The method for doing so is described and illustrated. Certain experimental considerations taken to enhance the quality of the EBIC data are also discussed.

  13. Magnolol protects neurons against ischemia injury via the downregulation of p38/MAPK, CHOP and nitrotyrosine

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jiann-Hwa [Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); School of Medicine, Fu-Jen Catholic University, Taipei, Taiwan (China); Department of Emergency Medicine, Cathay General Hospital, Taipei, Taiwan (China); Kuo, Hsing-Chun [Institute of Nursing and Department of Nursing, Chang Gung University of Science and Technology, Taiwan (China); Chronic Diseases and Health Promotion Research Center, CGUST, Taiwan (China); Research Center for Industry of Human Ecology, Chang Gung University of Science and Technology, Taoyuan, Taiwan (China); Lee, Kam-Fai [Department of Pathology, Chang Gung Memorial Hospital at Chiayi, Taiwan (China); Tsai, Tung-Hu, E-mail: thtsai@ym.edu.tw [Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Graduate Institute of Acupuncture Science, China Medical University, Taichung, Taiwan (China); Department of Education and Research, Taipei City Hospital, Taipei, Taiwan (China)

    2014-09-15

    Magnolol is isolated from the herb Magnolia officinalis, which has been demonstrated to exert pharmacological effects. Our aim was to investigate whether magnolol is able to act as an anti-inflammatory agent that brings about neuroprotection using a global ischemic stroke model and to determine the mechanisms involved. Rats were treated with and without magnolol after ischemia reperfusion brain injury by occlusion of the two common carotid arteries. The inflammatory cytokine production in serum and the volume of infarction in the brain were measured. The proteins present in the brains obtained from the stroke animal model (SAM) and control animal groups with and without magnolol treatment were compared. Magnolol reduces the total infarcted volume by 15% and 30% at dosages of 10 and 30 mg/kg, respectively, compared to the untreated SAM group. The levels of acute inflammatory cytokines, including interleukin-1 beta, tumor necrosis factor alpha, and interleukin-6 were attenuated by magnolol. Magnolol was also able to suppress the production of nitrotyrosine, 4-hydroxy-2-nonenal (4-HNE), inducible NO synthase (iNOS), various phosphorylated p38 mitogen-activated protein kinases and various C/EBP homologues. Furthermore, this modulation of ischemia injury factors in the SAM model group treated with magnolol seems to result from a suppression of reactive oxygen species production and the upregulation of p-Akt and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings confirm the anti-oxidative properties of magnolol, including the inhibition of ischemic injury to neurons; this protective effect seems to involve changes in the in vivo activity of Akt, GSK3β and NF-κB. - Graphical abstract: Schematic presentation of the signaling pathways involved in magnolol inhibited transient global ischemia brain apoptosis and inflammation in rats. The effect of magnolol on the scavenger of ROS, which inhibits p38 MAPK and CHOP protein inactivation

  14. Magnolol protects neurons against ischemia injury via the downregulation of p38/MAPK, CHOP and nitrotyrosine

    International Nuclear Information System (INIS)

    Chen, Jiann-Hwa; Kuo, Hsing-Chun; Lee, Kam-Fai; Tsai, Tung-Hu

    2014-01-01

    Magnolol is isolated from the herb Magnolia officinalis, which has been demonstrated to exert pharmacological effects. Our aim was to investigate whether magnolol is able to act as an anti-inflammatory agent that brings about neuroprotection using a global ischemic stroke model and to determine the mechanisms involved. Rats were treated with and without magnolol after ischemia reperfusion brain injury by occlusion of the two common carotid arteries. The inflammatory cytokine production in serum and the volume of infarction in the brain were measured. The proteins present in the brains obtained from the stroke animal model (SAM) and control animal groups with and without magnolol treatment were compared. Magnolol reduces the total infarcted volume by 15% and 30% at dosages of 10 and 30 mg/kg, respectively, compared to the untreated SAM group. The levels of acute inflammatory cytokines, including interleukin-1 beta, tumor necrosis factor alpha, and interleukin-6 were attenuated by magnolol. Magnolol was also able to suppress the production of nitrotyrosine, 4-hydroxy-2-nonenal (4-HNE), inducible NO synthase (iNOS), various phosphorylated p38 mitogen-activated protein kinases and various C/EBP homologues. Furthermore, this modulation of ischemia injury factors in the SAM model group treated with magnolol seems to result from a suppression of reactive oxygen species production and the upregulation of p-Akt and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings confirm the anti-oxidative properties of magnolol, including the inhibition of ischemic injury to neurons; this protective effect seems to involve changes in the in vivo activity of Akt, GSK3β and NF-κB. - Graphical abstract: Schematic presentation of the signaling pathways involved in magnolol inhibited transient global ischemia brain apoptosis and inflammation in rats. The effect of magnolol on the scavenger of ROS, which inhibits p38 MAPK and CHOP protein inactivation

  15. Effects of oil-water mixed frying and pure-oil frying on the quality characteristics of soybean oil and chicken chop

    Directory of Open Access Journals (Sweden)

    Ruixue MA

    2016-01-01

    Full Text Available Abstract The effects of oil-water mixed frying (OWF and pure-oil frying (POF on changes in quality characteristics of soybean oil and chicken chop during six days of frying were comparatively investigated. The results showed that the changes in specific extinction coefficients, p-anisidine value, carbonyl value, viscosity and color of soybean oil were more pronounced in the case of POF, indicating that oil oxidative and polymeric degradation was retarded by OWF. Concerning fat content of chicken chop, lower (p<0.05 values were observed in the last three days in the case of OWF than POF. Meanwhile, OWF led to lower acrylamide formation in chops during the six days. Sensory evaluation showed that OWF provided chops with five attributes similar to those of chops fried by POF on the first day. As frying days increased, the decreases in scores for color, odor, flavor and overall acceptability were less in the case of OWF. In conclusion, OWF could be a worthwhile alternative for retarding oil deterioration and producing healthier and higher quality fried meat products.

  16. A robust transfection reagent for the transfection of CHO and HEK293 cells and production of recombinant proteins and lentiviral particles - PTG1.

    Science.gov (United States)

    Gonçalves, Cristine; Gross, Fabian; Guégan, Philippe; Cheradame, Hervé; Midou, Patrick

    2014-11-01

    Bioproduction of recombinant proteins (r-proteins) and recombinant lentiviral particles (r-lentiviral particles) requires robust transfections consisting of efficient protocols that are easy to implement, with good reproducibility for a maximum production of proteins and lentiviral particles in a short time with low cytotoxicity. This study evaluates the capacity of histidinylated polyethyleneimine I (PTG1) to facilitate robust DNA transfection, with low cytotoxicity, of Chinese hamster ovary (CHO) and human embryonic kidney (HEK293T) cells for the production of r-proteins and r-lentiviral particles. We report that PTG1 transfection of cells in suspension with a plasmid DNA encoding enhanced green fluorescent protein leads to 72 and 97% of transfected CHO and HEK293T cells respectively, and does not significantly affect cell viability. PTG1 transfection of 100 mL of CHO-S cell culture in suspension at a cell density of 2 × 10(6) cells /mL resulted in a high level of transfected cells and protein expression after transfection with 0.75 μg/mL plasmid DNA. Transfection with PTG1 is more efficient than LipofectAmine2000™, and gene expression is higher than observed with FreeStyle™ and JetPEI®. Tri-transfection of HEK293T packaging cells leads to the production of a higher level of r-lentiviral particles compared to the calcium phosphate method, and permits two harvests of viral particles within three days. These results show that PTG1 is a powerful new transfection reagent for cell lines frequently used for recombinant protein and lentiviral particle production. PTG1 could be used in protocols for bioproduction of therapeutic proteins such as antibodies for cancer treatments and viral vectors for gene therapy applications. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  19. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  20. Lentiviral-mediated knockdown during ex vivo erythropoiesis of human hematopoietic stem cells.

    Science.gov (United States)

    Palii, Carmen G; Pasha, Roya; Brand, Marjorie

    2011-07-16

    the erythroid lineage. Studying erythropoiesis at the transcriptional level also requires the ability to over-express or knockdown specific factors in primary erythroid cells. For this purpose, we use a lentivirus-mediated gene delivery system that allows for the efficient infection of both dividing and non-dividing cells. Here we show that we are able to efficiently knockdown the transcription factor TAL1 in primary human erythroid cells. In addition, GFP expression demonstrates an efficiency of lentiviral infection close to 90%. Thus, our protocol provides a highly useful system for characterization of the regulatory network of transcription factors that control erythropoiesis.

  1. Lentiviral Reprogramming of A-T Patient Fibroblasts to Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Nayler, Sam; Kozlov, Sergei V; Lavin, Martin F; Wolvetang, Ernst

    2017-01-01

    Reprogramming of cells enables generation of pluripotent stem cells and resulting progeny through directed differentiation, making this technology an invaluable tool for the study of human development and disease. Reprogramming occurs with a wide range of efficiency, a culmination of intrinsic and extrinsic factors including the tissue of origin, the passage number and culture history of the target cells. Another major factor affecting reprogramming is the methodology used and the quality of the reprogramming process itself, including for conventional viral-based approaches viral titer and subsequent viral transduction efficiency, including downstream transgene insertion and stoichiometry. Genetic background is an important parameter affecting the efficiency of the reprogramming process with reports that cells from individuals harboring specific mutations are more difficult to reprogram than control counterparts.Ataxia-Telangiectasia (A-T) fibroblasts underwent reprogramming at reduced efficiency in contrast to their controls. To optimize reprogramming of fibroblasts from patients with A-T, we examined the response of A-T cells to various cell culture conditions after lentiviral transduction with reprogramming factors Oc4/Sox2 (pSIN4-EF2-O2S) and Klf4/c-Myc (pSIN4-CMV-K2M). Parameters included media type (KSR or serum-containing DMEM), treatment with a p53 inhibitor (small-molecule cyclic pifithrin-α), and either a low or high concentration of bFGF. Post-transduction, equivalent numbers of cells from heterozygote and homozygote patients were plated and assessed at regular intervals for survival and proliferation. Our findings indicate that A-T cells responded favorably to the addition of FCS and gradual weaning away from their native media into KSR-containing stem cell media that produced suitable conditions for their reprogramming. We examined a range of properties to identify and isolate good quality iPSCs including the expression status of important stem cell

  2. Integrase Defective Lentiviral Vector as a Vaccine Platform for Delivering Influenza Antigens

    Directory of Open Access Journals (Sweden)

    Alessandra Gallinaro

    2018-02-01

    Full Text Available Viral vectors represent an attractive technology for vaccine delivery. We exploited the integrase defective lentiviral vector (IDLV as a platform for delivering relevant antigens within the context of the ADITEC collaborative research program. In particular, Influenza virus hemagglutinin (HA and nucleoprotein (NP were delivered by IDLVs while H1N1 A/California/7/2009 subunit vaccine (HAp with or without adjuvant was used to compare the immune response in a murine model of immunization. In order to maximize the antibody response against HA, both IDLVs were also pseudotyped with HA (IDLV-HA/HA and IDLV-NP/HA, respectively. Groups of CB6F1 mice were immunized intramuscularly with a single dose of IDLV-NP/HA, IDLV-HA/HA, HAp alone, or with HAp together with the systemic adjuvant MF59. Six months after the vaccine prime all groups were boosted with HAp alone. Cellular and antibody responses to influenza antigens were measured at different time points after the immunizations. Mice immunized with HA-pseudotyped IDLVs showed similar levels of anti-H1N1 IgG over time, evaluated by ELISA, which were comparable to those induced by HAp + MF59 vaccination, but significantly higher than those induced by HAp alone. The boost with HAp alone induced an increase of antibodies in all groups, and the responses were maintained at higher levels up to 18 weeks post-boost. The antibody response was functional and persistent overtime, capable of neutralizing virus infectivity, as evaluated by hemagglutination inhibition and microneutralization assays. Moreover, since neuraminidase (NA-expressing plasmid was included during IDLV preparation, immunization with IDLV-NP/HA and IDLV-HA/HA also induced functional anti-NA antibodies, evaluated by enzyme-linked lectin assay. IFNγ-ELISPOT showed evidence of HA-specific response in IDLV-HA/HA immunized animals and persistent NP-specific CD8+ T cell response in IDLV-NP/HA immunized mice. Taken together our results indicate

  3. Natural host genetic resistance to lentiviral CNS disease: a neuroprotective MHC class I allele in SIV-infected macaques.

    Directory of Open Access Journals (Sweden)

    Joseph L Mankowski

    Full Text Available Human immunodeficiency virus (HIV infection frequently causes neurologic disease even with anti-retroviral treatment. Although associations between MHC class I alleles and acquired immunodeficiency syndrome (AIDS have been reported, the role MHC class I alleles play in restricting development of HIV-induced organ-specific diseases, including neurologic disease, has not been characterized. This study examined the relationship between expression of the MHC class I allele Mane-A*10 and development of lentiviral-induced central nervous system (CNS disease using a well-characterized simian immunodeficiency (SIV/pigtailed macaque model. The risk of developing CNS disease (SIV encephalitis was 2.5 times higher for animals that did not express the MHC class I allele Mane-A*10 (P = 0.002; RR = 2.5. Animals expressing the Mane-A*10 allele had significantly lower amounts of activated macrophages, SIV RNA, and neuronal dysfunction in the CNS than Mane-A*10 negative animals (P<0.001. Mane-A*10 positive animals with the highest CNS viral burdens contained SIV gag escape mutants at the Mane-A*10-restricted KP9 epitope in the CNS whereas wild type KP9 sequences dominated in the brain of Mane-A*10 negative animals with comparable CNS viral burdens. These concordant findings demonstrate that particular MHC class I alleles play major neuroprotective roles in lentiviral-induced CNS disease.

  4. SHARP-2 gene silencing by lentiviral-based short hairpin RNA interference prolonged rat kidney transplant recipients' survival time.

    Science.gov (United States)

    Shou, Z; Xiao, H; Xu, Y; Wang, Y; Yang, Y; Jiang, H; Chen, J; Yamada, K; Miyamoto, K

    2009-01-01

    Split- and hairy-related protein-2 (SHARP-2) controls the expression of interleukin-2 (IL-2) and interferon-gamma (IFN-gamma), which both play a key role in transplant rejection. This study was designed to investigate whether SHARP-2 short hairpin RNA interference (shRNAi) could prolong the survival of rat kidney transplant recipients. A lentiviral-based shRNAi construct, LV-SHARP-2iC, showed a SHARP-2 gene silencing efficiency of 84% in normal rat kidney cells. In activated T-cells, SHARP-2 gene silencing with the LV-SHARP-2iC construct resulted in 61% and 69% down-regulation of IL-2 and IFN-gamma, respectively, compared with a scramble control construct. When donor kidney was perfused with 5 x 10(7) transforming units of the LV-SHARP-2iC construct, the median survival time of the transplant recipients was prolonged by 4 - 5 days compared with control groups. In conclusion, recombinant lentiviral LV-SHARP-2iC construct effectively silenced SHARP-2 gene expression, which reduced IL-2 and IFN-gamma mRNA expression and prolonged rat kidney transplant recipients' survival.

  5. Immune Modulatory Cell Therapy for Hemophilia B Based on CD20-Targeted Lentiviral Gene Transfer to Primary B Cells

    Directory of Open Access Journals (Sweden)

    Xiaomei Wang

    2017-06-01

    Full Text Available Gene-modified B cells expressing immunoglobulin G (IgG fusion proteins have been shown to induce tolerance in several autoimmune and other disease models. However, lack of a vector suitable for gene transfer to human B cells has been an obstacle for translation of this approach. To overcome this hurdle, we developed an IgG-human factor IX (hFIX lentiviral fusion construct that was targeted to specifically transduce cells expressing human CD20 (hCD20. Receptor-specific retargeting by mutating envelope glycoproteins of measles virus (MV-lentiviral vector (LV and addition of a single-chain variable fragment specific for hCD20 resulted in gene delivery into primary human and transgenic hCD20 mouse B cells with high specificity. Notably, this protocol neither required nor induced activation of the B cells, as confirmed by minimal activation of inflammatory cytokines. Using this strategy, we were able to demonstrate induction of humoral tolerance, resulting in suppression of antibody formation against hFIX in a mouse model of hemophilia B (HB. In conclusion, transduction of receptor-specific retargeted LV into resting B cells is a promising method to develop B cell therapies for antigen-specific tolerance induction in human disease.

  6. Febrile Neutropenia Risk Assessment and Granulocyte-Colony Stimulating Factor Support in Patients with Diffuse Large B Cell Lymphoma Receiving R-CHOP Regimens

    DEFF Research Database (Denmark)

    Salar, Antonio; Haioun, Corinne; Rossi, Francesca Gaia

    2009-01-01

    initiated chemotherapy between 01/2005 and 08/2008; 1136 had DLBCL. The mean age±SD of patients receiving R-CHOP-21 (N=704) was 62.6±13.8 years, 51% were aged ≥65 years and 53% had Stage III-IV disease. For R-CHOP-14 patients (N=409), the mean age was 58.4±14.7 years, 41% were ≥65 years and 59% had Stage...... III-IV disease. In total, 434 R-CHOP-21 patients were assessed as being at high risk for FN and 47% of them actually received G-CSF primary prophylaxis (with either pegfilgrastim or daily G-CSF) (see Table). Furthermore, almost a fifth of patients assessed as being at

  7. Consumer visual appraisal and shelf life of leg chops from suckling kids raised with natural milk or milk replacer.

    Science.gov (United States)

    Ripoll, Guillermo; Alcalde, María J; Argüello, Anastasio; Córdoba, María G; Panea, Begoña

    2018-05-01

    The use of milk replacers to feed suckling kids could affect the shelf life and appearance of the meat. Leg chops were evaluated by consumers and the instrumental color was measured. A machine learning algorithm was used to relate them. The aim of this experiment was to study the shelf life of the meat of kids reared with dam's milk or milk replacers and to ascertain which illuminant and instrumental color variables are used by consumers as criteria to evaluate that visual appraisal. Meat from kids reared with milk replacers was more valuable and had a longer shelf life than meat from kids reared with natural milk. Consumers used the color of the whole surface of the leg chop to assess the appearance of meat. Lightness and hue angle were the prime cues used to evaluate the appearance of meat. Illuminant D65 was more useful for relating the visual appraisal with the instrumental color using a machine learning algorithm. The machine learning algorithms showed that the underlying rules used by consumers to evaluate the appearance of suckling kid meat are not at all linear and can be computationally schematized into a simple algorithm. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  8. Activating transcription factor 6 mediates oxidized LDL-induced cholesterol accumulation and apoptosis in macrophages by up-regulating CHOP expression.

    Science.gov (United States)

    Yao, Shutong; Zong, Chuanlong; Zhang, Ying; Sang, Hui; Yang, Mingfeng; Jiao, Peng; Fang, Yongqi; Yang, Nana; Song, Guohua; Qin, Shucun

    2013-01-01

    This study was to explore whether activating transcription factor 6 (ATF6), an important sensor to endoplasmic reticulum (ER) stress, would mediate oxidized low-density lipoprotein (ox-LDL)- induced cholesterol accumulation and apoptosis in cultured macrophages and the underlying molecular mechanisms. Intracellular lipid droplets and total cholesterol levels were assayed by oil red O staining and enzymatic colorimetry, respectively. Cell viability and apoptosis were determined using MTT assay and AnnexinV-FITC apoptosis detection kit, respectively. The nuclear translocation of ATF6 in cells was detected by immunofluorescence analysis. Protein and mRNA levels were examined by Western blot analysis and real time-PCR, respectively. ATF6 siRNA was transfected to RAW264.7 cells by lipofectamin. Exposure of cells to ox-LDL induced glucose-regulated protein 78 (GRP78). C/EBP homologous protein (CHOP), a key-signaling component of ER stress-induced apoptosis, was up-regulated in ox-LDL-treated cells. ATF6, a factor that positively regulates CHOP expression, was activated by ox-LDL in a concentration- and time- dependent manner. The role of the ATF6-mediated ER stress pathway was further confirmed through the siRNA-mediated knockdown of ATF6, which attenuated ox-LDL-induced upregulation of CHOP, cholesterol accumulation and apoptosis in macrophages. In addition, the phosphorylation of double-stranded RNA-activated protein kinase-like endoplasmic reticulum kinase (PERK), another factor that positively regulates CHOP expression, was induced in the presence of ox-LDL, and PERK-specific siRNA also inhibited the ox-LDL-induced upregulation of CHOP and apoptosis in RAW264.7 cells. These results demonstrate that ER stress-related proteins, particularly ATF6 and its downstream molecule CHOP, are involved in ox-LDL-induced cholesterol accumulation and apoptosis in macrophages.

  9. Straight and chopped DC performance data for a General Electric 5BY436A1 DC shunt motor with a General Electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Both straight and chopped dc motor performance data for a General Electric 5BY436A1 motor with a General Electric EV-1 controller is presented in tabular and graphical formats. Effects of motor temperature and operating voltage are also shown. The maximum motor efficiency is approximately 85% at low operating temperatures in the straight dc mode. Chopper efficiency can be assumed to be 95% under all operating conditions. For equal speeds, the motor operated in the chopped mode develops slightly more torque and draws more current than it does in the straight mode.

  10. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  11. In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells

    DEFF Research Database (Denmark)

    Holmgaard, Andreas; Askou, Anne Louise; Benckendorff, Josephine Natalia Esther

    2017-01-01

    Virus-based gene therapy by CRISPR/Cas9-mediated genome editing and knockout may provide a new option for treatment of inherited and acquired ocular diseases of the retina. In support of this notion, we show that Streptococcus pyogenes (Sp) Cas9, delivered by lentiviral vectors (LVs), can be used...

  12. Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.

    Science.gov (United States)

    Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming

    2017-01-01

    CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.

  13. Construction of a single lentiviral vector containing tetracycline-inducible Alb-uPA for transduction of uPA expression in murine hepatocytes.

    Directory of Open Access Journals (Sweden)

    Jiasi Bai

    Full Text Available The SCID-beige/Alb-uPA mouse model is currently the best small animal model available for viral hepatitis infection studies [1]. But the construction procedure is often costly and time-consuming due to logistic and technical difficulties. Thus, the widespread application of these chimeric mice has been hampered [2]. In order to optimize the procedure, we constructed a single lentiviral vector containing modified tetracycline-regulated system to control Alb-uPA gene expression in the cultured hepatocytes. The modified albumin promoter controlled by tetracycline (Tet-dependent transactivator rtTA2S-M2 was integrated into a lentiviral vector. The full-length uPA cDNA was inserted into another lentiviral vector containing PTight, a modified Tet-responsive promoter. Two vectors were then digested by specific enzymes and ligated by DNA ligase 4. The ligated DNA fragment was inserted into a modified pLKO.1 cloning vector and the final lentiviral vector was then successfully constructed. H2.35 cell, Lewis lung carcinoma, primary kidney, primary hepatic interstitial and CT26 cells were infected with recombinant lentivirus at selected MOI. The expression of uPA induced by DOX was detectable only in the infected H2.35 cells, which was confirmed by real-time PCR and Western blot analysis. Moreover, DOX induced uPA expression on the infected H2.35 cells in a dose-dependent manner. The constructed single lentiviral vector has many biological advantages, including that the interested gene expression under "Tet-on/off" system is controlled by DOX in a dose-depending fashion only in murine liver cells, which provides an advantage for simplifying generation of conditional transgenic animals.

  14. Treatment of multicentric or cranial mediastinal high-grade T-cell lymphoma in dogs with a first-line CCNU-L(-chlorambucil)-CHOP protocol

    NARCIS (Netherlands)

    Ossowska, M.; Teske, E.; Beirens-Van Kuijk, L.; Zandvliet, Maurice; De Vos, J. P.

    2016-01-01

    This retrospective study determined disease free survival (DFS) and progression free survival (PFS) in chemo-naïve dogs with multicentric or cranial mediastinal high-grade T-cell lymphoma, treated with a first-line CCNU-L(-chlorambucil)-CHOP protocol. Of thirteen dogs with multicentric lymphoma,

  15. DNMT1 is predictive of survival and associated with Ki-67 expression in R-CHOP-treated diffuse large B-cell lymphomas

    DEFF Research Database (Denmark)

    Loo, Suet Kee; Ch'ng, Ewe Seng; Lawrie, Charles H

    2017-01-01

    DNMT1 is a target of approved anti-cancer drugs including decitabine. However, the prognostic value of DNMT1 protein expression in R-CHOP-treated diffuse large B-cell lymphomas (DLBCLs) remains unexplored. Here we showed that DNMT1 was expressed in the majority of DLBCL cases (n = 209/230, 90.9%)...

  16. Tensile and Flexural Properties of Chopped Strand E-glass Fibre Mat Reinforced CNSL-Epoxy Composites.

    Directory of Open Access Journals (Sweden)

    Nayak Suhas Yeshwant

    2018-01-01

    Full Text Available Glass fibres have the principal advantages such as high tensile strength, high chemical resistance, low cost, and excellent insulating properties which makes them an important constituent in fibre reinforced plastic and composite industry. In this study, E-glass fibre in the form of Chopped Strand Mat (CSM with different weight fractions such as 15%, 30%, and 45% were used as reinforcement in CNSL-epoxy resin composites. Fabrication of the composites was done by hand layup technique. Micro-hardness, tensile and flexural properties were investigated for all the composite panels of different compositions. The results clearly indicated an improvement in micro hardness, tensile and flexural properties with the increase in fibre content.

  17. Straight and chopped dc performance data for a Prestolite MTC-4001 motor and a general electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Performance data on the Prestolite MTC-4001 series wound dc motor and General Electric EV-1 Chopper Controller is supplied for the electric vehicle manufacturer. Data are provided for both straight and chopped dc input to the motor, at 2 motor temperature levels. Testing was done at 6 voltage increments to the motor, and 2 voltage increments to the controller. Data results are presented in both tabular and graphical forms. Tabular information includes motor voltage and current input data, motor speed and torque output data, power data and temperature data. Graphical information includes torque-speed, motor power output-speed, torque-current, and efficiency-speed plots under the various operating conditions. The data resulting from this testing show the speed-torque plots to have the most variance with operating temperature. The maximum motor efficiency is between 76% and 82%, regardless of temperature or mode of operation.

  18. Interleukin-10 Polymorphisms in Association with Prognosis in Patients with B-Cell Lymphoma Treated by R-CHOP

    Directory of Open Access Journals (Sweden)

    Min Kyeong Kim

    2016-12-01

    Full Text Available Interleukin-10 (IL10 plays an important role in initiating and maintaining an appropriate immune response to non-Hodgkin lymphoma (NHL. Previous studies have revealed that the transcription of IL10 mRNA and its protein expression may be infl uenced by several single-nucleotide polymorphisms in the promoter and intron regions, including rs1800896, rs1800871, and rs1800872. However, the impact of polymorphisms of the IL10 gene on NHL prognosis has not been fully elucidated. Here, we investigated the association between IL10 polymorphisms and NHL prognosis. This study involved 112 NHL patients treated at the National Cancer Center, Korea. The median age was 57 years, and 70 patients (62.5% were men. Clinical characteristics, including age, performance status, stage, and extra-nodal involvement, as well as cell lineage and International Prognostic Index (IPI, were evaluated. A total of four polymorphisms in IL10 with heterozygous alleles were analyzed for hazard ratios of overall survival (OS and progression-free survival (PFS using Cox proportional hazards regression analysis. Diffuse large B-cell lymphoma was the most common histologic type (n = 83, followed by T-cell lymphoma (n = 18, mantle cell lymphoma (n = 6, and others (n = 5. Cell lineage, IPI, and extra-nodal involvement were predictors of prognosis. In the additive genetic model results for each IL10 polymorphism, the rs1800871 and rs1800872 polymorphisms represented a marginal association with OS (p = 0.09 and p = 0.06 and PFS (p = 0.05 and p = 0.08 in B-cell lymphoma patients treated with rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP. These findings suggest that IL10 polymorphisms might be prognostic indicators for patients with B-cell NHL treated with R-CHOP.

  19. Huaiqihuang may protect from proteinuria by resisting MPC5 podocyte damage via targeting p-ERK/CHOP pathway

    Directory of Open Access Journals (Sweden)

    Tingxia Li

    2016-08-01

    Full Text Available The purpose of this study was to investigate the potential effects of Huaiqihuang (HQH granule, a Chinese herbal medicine, in treating proteinuria and to reveal its possible mechanism. MPC5 podocytes were cultured in vitro at 37°C and induced with tunicamycin (TM. The TM-induced cells were treated with HQH at different concentrations. The cell proliferation was detected using the MTT assay. The optimal effective dose of HQH for MPC5 cells was determined by the MTT assay and LDH assay respectively. The influences of HQH on the proteinuria-related protein expression and the signaling pathway associated protein expression were also detected using quantitative reverse transcription PCR and Western blotting analysis. The results showed that the MPC5 cell model was successfully constructed in vitro. The HQH application could improve the harmful effects induced by TM on the MPC5 cells, including promoted cell proliferation and suppressed cell apoptosis. Furthermore, the protein expression, including podocin, nephrin, and synaptopodin was down-regulated by the TM treatment in the MPC5 cells. On contrary, the expression of these proteins was up-regulated after the HQH application. Also, the effect of TM on integrin α3 and integrin β1 expressions was also reversed by the HQH treatment. Moreover, the HQH application decreased the expression of p-ERK and DNA-damage-inducible transcript 3 (DDIT3 or CHOP in the MPC5 cells, which was opposite to the effect observed in the cells treated with TM. Taken together, our study suggest that HQH application may protect podocytes from TM damage by suppressing the p-ERK/CHOP signaling pathway.

  20. Development of an equine-tropic replication-competent lentivirus assay for equine infectious anemia virus-based lentiviral vectors.

    Science.gov (United States)

    Farley, Daniel C; Bannister, Richard; Leroux-Carlucci, Marie A; Evans, Nerys E; Miskin, James E; Mitrophanous, Kyriacos A

    2012-10-01

    The release of lentiviral vectors for clinical use requires the testing of vector material, production cells, and, if applicable, ex vivo-transduced cells for the presence of replication-competent lentivirus (RCL). Vectors derived from the nonprimate lentivirus equine infectious anemia virus (EIAV) have been directly administered to patients in several clinical trials, with no toxicity observed to date. Because EIAV does not replicate in human cells, and because putative RCLs derived from vector components within human vector production cells would most likely be human cell-tropic, we previously developed an RCL assay using amphotropic murine leukemia virus (MLV) as a surrogate positive control and human cells as RCL amplification/indicator cells. Here we report an additional RCL assay that tests for the presence of theoretical "equine-tropic" RCLs. This approach provides further assurance of safety by detecting putative RCLs with an equine cell-specific tropism that might not be efficiently amplified by the human cell-based RCL assay. We tested the ability of accessory gene-deficient EIAV mutant viruses to replicate in a highly permissive equine cell line to direct our choice of a suitable EIAV-derived positive control. In addition, we report for the first time the mathematical rationale for use of the Poisson distribution to calculate minimal infectious dose of positive control virus and for use in monitoring assay positive/spike control failures in accumulating data sets. No RCLs have been detected in Good Manufacturing Practice (GMP)-compliant RCL assays to date, further demonstrating that RCL formation is highly unlikely in contemporary minimal lentiviral vector systems.

  1. Overexpression of thioredoxin in islets transduced by a lentiviral vector prolongs graft survival in autoimmune diabetic NOD mice

    Directory of Open Access Journals (Sweden)

    Sytwu Huey-Kang

    2009-08-01

    Full Text Available Abstract Pancreatic islet transplantation is considered an appropriate treatment to achieve insulin independence in type I diabetic patients. However, islet isolation and transplantation-induced oxidative stress and autoimmune-mediated destruction are still the major obstacles to the long-term survival of graft islets in this potential therapy. To protect islet grafts from inflammatory damage and prolong their survival, we transduced islets with an antioxidative gene thioredoxin (TRX using a lentiviral vector before transplantation. We hypothesized that the overexpression of TRX in islets would prolong islet graft survival when transplanted into diabetic non-obese diabetic (NOD mice. Methods Islets were isolated from NOD mice and transduced with lentivirus carrying TRX (Lt-TRX or enhanced green fluorescence protein (Lt-eGFP, respectively. Transduced islets were transplanted under the left kidney capsule of female diabetic NOD mice, and blood glucose concentration was monitored daily after transplantation. The histology of the islet graft was assessed at the end of the study. The protective effect of TRX on islets was investigated. Results The lentiviral vector effectively transduced islets without altering the glucose-stimulating insulin-secretory function of islets. Overexpression of TRX in islets reduced hydrogen peroxide-induced cytotoxicity in vitro. After transplantation into diabetic NOD mice, euglycemia was maintained for significantly longer in Lt-TRX-transduced islets than in Lt-eGFP-transduced islets; the mean graft survival was 18 vs. 6.5 days (n = 9 and 10, respectively, p Conclusion We successfully transduced the TRX gene into islets and demonstrated that these genetically modified grafts are resistant to inflammatory insult and survived longer in diabetic recipients. Our results further support the concept that the reactive oxygen species (ROS scavenger and antiapoptotic functions of TRX are critical to islet survival after

  2. 3' self-inactivating long terminal repeat inserts for the modulation of transgene expression from lentiviral vectors.

    Science.gov (United States)

    Manic, Gwenola; Maurin-Marlin, Aurélie; Galluzzi, Lorenzo; Subra, Frédéric; Mouscadet, Jean-François; Bury-Moné, Stéphanie

    2012-04-01

    Gene transfer for research or gene therapy requires the design of vectors that allow for adequate and safe transgene expression. Current methods to modulate the safety and expression profile of retroviral vectors can involve the insertion of insulators or scaffold/matrix-attachment regions in self-inactivating long terminal repeats (SIN-LTRs). Here, we generated a set of lentiviral vectors (with internal CMV or PGK promoter) in which we inserted (at the level of SIN-LTRs) sequences of avian (i.e., chicken hypersensitive site-4, cHS4), human (i.e., putative insulator and desert sequence), or bacterial origin. We characterized them with respect to viral titer, integration, transduction efficiency and transgene expression levels, in both integrase-proficient and -deficient contexts. We found that the cHS4 insulator enhanced transgene expression by a factor of 1.5 only when cloned in the antisense orientation. On the other hand, cHS4 in the sense orientation as well as all other inserts decreased transgene expression. This attenuation phenomenon persisted over long periods of time and did not correspond to extinction or variegation. Decreased transgene expression was associated with lower mRNA levels, yet RNA stability was not affected. Insertions within the SIN-LTRs may negatively affect transgene transcription in a direct fashion through topological rearrangements. The lentiviral vectors that we generated constitute valuable genetic tools for manipulating the level of transgene expression. Moreover, this study demonstrates that SIN-LTR inserts can decrease transgene expression, a phenomenon that might be overcome by modifying insert orientation, thereby highlighting the importance of careful vector design for gene therapy.

  3. Characterization and comparative performance of lentiviral vector preparations concentrated by either one-step ultrafiltration or ultracentrifugation.

    Science.gov (United States)

    Papanikolaou, Eleni; Kontostathi, Georgia; Drakopoulou, Ekati; Georgomanoli, Maria; Stamateris, Evangelos; Vougas, Kostas; Vlahou, Antonia; Maloy, Andrew; Ware, Mark; Anagnou, Nicholas P

    2013-07-01

    Gene therapy utilizing lentiviral vectors (LVs) constitutes a real therapeutic alternative for many inherited monogenic diseases. Therefore, the generation of functional vectors using fast, non-laborious and cost-effective strategies is imperative. Among the available concentration methods for VSV-G pseudotyped lentiviruses to achieve high therapeutic titers, ultracentrifugation represents the most common approach. However, the procedure requires special handling and access to special instrumentation, it is time-consuming, and most importantly, it is cost-ineffective due to the high maintenance expenses and consumables of the ultracentrifuge apparatus. Here we describe an improved protocol in which vector stocks are prepared by transient transfection using standard cell culture media and are then concentrated by ultrafiltration, resulting in functional vector titers of up to 6×10(9) transducing units per millilitre (TU/ml) without the involvement of any purification step. Although ultrafiltration per se for concentrating viruses is not a new procedure, our work displays one major novelty; we characterized the nature and the constituents of the viral batches produced by ultrafiltration using peptide mass fingerprint analysis. We also determined the viral functional titer by employing flow cytometry and evaluated the actual viral particle size and concentration in real time by using laser-based nanoparticle tracking analysis based on Brownian motion. Vectors generated by this production method are contained in intact virions and when tested to transduce in vitro either murine total bone marrow or human CD34(+) hematopoietic stem cells, resulted in equal transduction efficiency and reduced toxicity, compared to lentiviral vectors produced using standard ultracentrifugation-based methods. The data from this study can eventually lead to the improvement of protocols and technical modifications for the clinical trials for gene therapy. Copyright © 2013 Elsevier B.V. All

  4. R-CHOP versus dose-adjusted R-EPOCH in frontline management of primary mediastinal B-cell lymphoma: a multi-centre analysis.

    Science.gov (United States)

    Shah, Nirav N; Szabo, Aniko; Huntington, Scott F; Epperla, Narendranath; Reddy, Nishitha; Ganguly, Siddhartha; Vose, Julie; Obiozor, Cynthia; Faruqi, Fahad; Kovach, Alexandra E; Costa, Luciano J; Xaiver, Ana C; Okal, Ryan; Kanate, Abraham S; Ghosh, Nilanjan; Kharfan-Dabaja, Mohamed A; Strelec, Lauren; Hamadani, Mehdi; Fenske, Timothy S; Calzada, Oscar; Cohen, Jonathon B; Chavez, Julio; Svoboda, Jakub

    2018-02-01

    Primary mediastinal (thymic) large B-cell lymphoma (PMBCL) is an uncommon subtype of non-Hodgkin lymphoma (NHL) that presents with a mediastinal mass and has unique clinicopathological features. Historically, patients with PMBCL were treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone) chemotherapy ± involved field radiation. Since a phase II trial, published in April 2013, demonstrated excellent results using dose-adjusted (DA) R-EPOCH (rituximab, etoposide, prednisone, vincristine, cyclophosphamide, doxorubicin), this treatment has gained popularity. We performed a retrospective, multicentre analysis of patients aged ≥18 years with PMBCL since January 2011. Patients were stratified by frontline regimen, R-CHOP versus DA-R-EPOCH. 132 patients were identified from 11 contributing centres (56 R-CHOP and 76 DA-R-EPOCH). The primary outcome was overall survival. Secondary outcomes included progression-free survival, complete response (CR) rate, and rates of treatment-related complications. Demographic characteristics were similar in both groups. DA-R-EPOCH use increased after April 2013 (79% vs. 45%, P < 0·001), and there was less radiation use after DA-R-EPOCH (13% vs. 59%, P < 0·001). While CR rates were higher with DA-R-EPOCH (84% vs. 70%, P = 0·046), these patients were more likely to experience treatment-related toxicities. At 2 years, 89% of R-CHOP patients and 91% of DA-R-EPOCH patients were alive. To our knowledge, this represents the largest series comparing outcomes of R-CHOP to DA-R-EPOCH for PMBCL. © 2017 John Wiley & Sons Ltd.

  5. Injectable supramolecular hydrogel formed from α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron for sustained MMP-9 shRNA plasmid delivery.

    Science.gov (United States)

    Lin, Qianming; Yang, Yumeng; Hu, Qian; Guo, Zhong; Liu, Tao; Xu, Jiake; Wu, Jianping; Kirk, Thomas Brett; Ma, Dong; Xue, Wei

    2017-02-01

    Hydrogels have attracted much attention in cancer therapy and tissue engineering due to their sustained gene delivery ability. To obtain an injectable and high-efficiency gene delivery hydrogel, methoxypolyethylene glycol (MPEG) was used to conjugate with the arginine-functionalized poly(l-lysine) dendron (PLLD-Arg) by click reaction, and then the synthesized MPEG-PLLD-Arg interacted with α-cyclodextrin (α-CD) to form the supramolecular hydrogel by the host-guest interaction. The gelation dynamics, hydrogel strength and shear viscosity could be modulated by α-CD content in the hydrogel. MPEG-PLLD-Arg was confirmed to bind and deliver gene effectively, and its gene transfection efficiency was significantly higher than PEI-25k under its optimized condition. After gelation, MMP-9 shRNA plasmid (pMMP-9) could be encapsulated into the hydrogel matrix in situ and be released from the hydrogels sustainedly, as the release rate was dependent on α-CD content. The released MPEG-PLLD-Arg/pMMP-9 complex still showed better transfection efficiency than PEI-25k and induced sustained tumor cell apoptosis. Also, in vivo assays indicated that this pMMP-9-loaded supramolecular hydrogel could result in the sustained tumor growth inhibition meanwhile showed good biocompatibility. As an injectable, sustained and high-efficiency gene delivery system, this supramolecular hydrogel is a promising candidate for long-term gene therapy. To realize the sustained gene delivery for gene therapy, a supramolecular hydrogel with high-efficiency gene delivery ability was prepared through the host-guest interaction between α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron. The obtained hydrogel was injectable and biocompatible with adjustable physicochemical property. More importantly, the hydrogel showed the high-efficiency and sustained gene transfection to our used cells, better than PEI-25k. The supramolecular hydrogel resulted in the sustained tumor growth

  6. Effects of grilling to 80 °C on the chemical composition of pork loin chops and some observations on the UK National Food Survey estimate of fat consumption.

    Science.gov (United States)

    Sheard, P R; Wood, J D; Nute, G R; Ball, R C

    1998-06-01

    The physical and chemical composition of pork loin chops was investigated, examining the changes that occurred in (i) the whole chop, (ii) the fat tissue and (iii) the lean tissue by grilling to 80 °C. Adjacent 25 mm thick chops, with backfat and rind attached, were cut from loins of 90 kg live weight pigs having a fat thickness (P(2)) of 11 mm, representative of current UK production. One chop was analysed fresh by dissection and standard analytical techniques and the other after grilling. Weights of chop (including rind) before and after cooking were 210 and 136 g, respectively. The average weight loss for the whole chop was 35%; the weight loss from fat, 44%, being greater than that from lean, 34%, or rind, 27%, the latter accounting for 14% of the whole raw chop. When expressed conventionally, on a percentage basis, the fat content of the whole rindless chop increased from 22 to 23%, and the fat content of the lean increased from 5.5 to 9%. In absolute terms, based on an initial 100 g, the fat content in the whole chop reduced from 22 to 15 g, with a slight increase in the fat content of the lean, from 5.5 to 6.0 g. It is argued that the National Food Survey (NFS) approach of estimating fat consumption on the basis of the fat content of the raw product is flawed. The terms 'meat consumption' and 'fat consumption' are misleading since they reflect amounts purchased rather than the amount of meat and fat actually consumed, making no allowance for fat lost during cooking or for subcutaneous fat removed by consumers before consumption. Actual fat consumption from cooked meat and meat products, after allowing for a 25% fat loss during cooking and trimming of visible fat, is estimated at 10.3 g per person per day compared with the NFS estimate of 18.1 g.

  7. Autocrine human growth hormone (hGH) regulation of human mammary carcinoma cell gene expression. Identification of CHOP as a mediator of hGH-stimulated human mammary carcinoma cell survival.

    Science.gov (United States)

    Mertani, H C; Zhu, T; Goh, E L; Lee, K O; Morel, G; Lobie, P E

    2001-06-15

    By use of cDNA array technology we have screened 588 genes to determine the effect of autocrine production of human growth hormone (hGH) on gene expression in human mammary carcinoma cells. We have used a previously described cellular model to study autocrine hGH function in which the hGH gene or a translation-deficient hGH gene was stably transfected into MCF-7 cells. Fifty two of the screened genes were regulated, either positively () or negatively (), by autocrine production of hGH. We have now characterized the role of one of the up-regulated genes, chop (gadd153), in the effect of autocrine production of hGH on mammary carcinoma cell number. The effect of autocrine production of hGH on the level of CHOP mRNA was exerted at the transcriptional level as autocrine hGH increased chloramphenicol acetyltransferase production from a reporter plasmid containing a 1-kilobase pair fragment of the chop promoter. The autocrine hGH-stimulated increase in CHOP mRNA also resulted in an increase in CHOP protein. As a consequence, autocrine hGH stimulation of CHOP-mediated transcriptional activation was increased. Stable transfection of human CHOP cDNA into mammary carcinoma cells demonstrated that CHOP functioned not as a mediator of hGH-stimulated mitogenesis but rather enhanced the protection from apoptosis afforded by hGH in a p38 MAPK-dependent manner. Thus transcriptional up-regulation of chop is one mechanism by which hGH regulates mammary carcinoma cell number.

  8. R-CHOEP-14 improves overall survival in young high-risk patients with diffuse large B-cell lymphoma compared with R-CHOP-14. A population-based investigation from the Danish Lymphoma Group

    DEFF Research Database (Denmark)

    Gang, A O; Strøm, C; Pedersen, M

    2012-01-01

    Optimal treatment of young patients with high-risk diffuse large B-cell lymphoma (DLBCL) remains a matter of debate and requires improvement. The combination chemotherapy with cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP) with addition of etoposide (CHOEP) has in other patient...... groups been shown to be effective. Further improvement has been accomplished with the use of rituximab in combination with the regimens every 2 weeks (R-CHOP-14, R-CHOEP-14). The aim of the present retrospective population-based study was to compare R-CHOP-14 with R-CHOEP-14 in a cohort of high...

  9. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  10. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  11. Differential Effects of Strategies to Improve the Transduction Efficiency of Lentiviral Vector that Conveys an Anti-HIV Protein, Nullbasic, in Human T Cells.

    Science.gov (United States)

    Rustanti, Lina; Jin, Hongping; Li, Dongsheng; Lor, Mary; Sivakumaran, Haran; Harrich, David

    2018-03-14

    Nullbasic is a mutant form of HIV-1 Tat that has strong ability to protect cells from HIV-1 replication by inhibiting three different steps of viral replication: reverse transcription, Rev export of viral mRNA from the nucleus to the cytoplasm and transcription of viral mRNA by RNA polymerase II. We previously showed that Nullbasic inhibits transduction of human cells including T cells by HIV-1-based lentiviral vectors. Here we investigated whether the Nullbasic antagonists huTat2 (a Tat targeting intrabody), HIV-1 Tat or Rev proteins or cellular DDX1 protein could improve transduction by a HIV-1 lentiviral vector conveying Nullbasic-ZsGreen1 to human T cells. We show that overexpression of huTat2, Tat-FLAG and DDX1-HA in virus-like particle (VLP) producer cells significantly improved transduction efficiency of VLPs that convey Nullbasic in Jurkat cells. Specifically, co-expression of Tat-FLAG and DDX1-HA in the VLP producer cell improved transduction efficiency better than if used individually. Transduction efficiencies could be further improved by including a spinoculation step. However, the same optimised protocol and using the same VLPs failed to transduce primary human CD4 + T cells. The results imply that the effects of Nullbasic on VLPs on early HIV-1 replication are robust in human CD4 + T cells. Given this significant block to lentiviral vector transduction by Nullbasic in primary CD4 + T cells, our data indicate that gammaretroviral, but not lentiviral, vectors are suitable for delivering Nullbasic to primary human T cells.

  12. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2005-01-01

    Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.

  13. A rapid and efficient polyethylenimine-based transfection method to prepare lentiviral or retroviral vectors: useful for making iPS cells and transduction of primary cells.

    Science.gov (United States)

    Yang, Shaozhe; Shi, Haijun; Chu, Xinran; Zhou, Xiaoling; Sun, Pingnan

    2016-09-01

    To improve the efficiency, reproducibility and consistency of the PEI-based transfection method that is often used in preparation of recombinant lentiviral or retroviral vectors. The contributions to transfection efficiency of multi-factors including concentration of PEI or DNA, dilution buffer for PEI/DNA, manner to prepare PEI/DNA complexes, influence of serum, incubation time for PEI/DNA complexes, and transfection time were studied. Gentle mixing during the preparation of PEI/DNA transfection complexes is critical for a high transfection efficiency. PEI could be stored at room temperature or 4 °C, and most importantly, multigelation should be avoided. The transfection efficiency of the PEI-based new method in different types of cells, such as 293T, Cos-7, HeLa, HepG2, Hep3B, Huh7 and L02, was also higher than that of the previous method. After optimization, the titer of our lentiviral system or retroviral system produced by PEI-based new method was about 10- or 3-times greater than that produced by PEI-based previous method, respectively. We provide a rapid and efficient PEI-based method for preparation of recombinant lentiviral or retroviral vectors which is useful for making iPS cells as well as transduction of primary cell cultures.

  14. Prognostic Significance of Monocytes and Monocytic Myeloid-Derived Suppressor Cells in Diffuse Large B-Cell Lymphoma Treated with R-CHOP

    Directory of Open Access Journals (Sweden)

    Chongyang Wu

    2016-07-01

    Full Text Available Background/Aims: To evaluate the prognostic significance of monocytes and monocytic myeloid-derived suppressor cells (M-MDSCs for patients with diffuse large B-cell lymphoma (DLBCL under R-CHOP chemotherapy. Methods: Flow cytometry (FCM was applied to measure M-MDSCs (CD14+ HLA-DRlow/− M-MDSCs. Results: Analysis of 144 patients with DLBCL under R-CHOP treatment showed that the 5-year overall survival rate was 61.09% (95% CI: 43.72%-72.56% and the average survival time of patients with monocytes (% ≥ 8% was shorter than those with monocytes (% 2 (P = 0.0397, meanwhile, there was no significant difference in survival of patients with monocytes (% ≥ 8% compared to patients with monocytes (% Conclusion: Our results indicated that monocytes (% and M-MDSCs combined with R-IPI may be a simple and efficient immunological index to evaluate prognosis.

  15. Expression of CD40 is a positive prognostic factor of diffuse large B-cell lymphoma treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone

    Directory of Open Access Journals (Sweden)

    Song G

    2016-06-01

    Full Text Available Guoqi Song,1 Huiyun Ni,1 Linqing Zou,2 Shukui Wang,3 Fuliang Tian,4 Hong Liu,1 William C Cho5 1Department of Hematology, Affiliated Hospital of Nantong University, Nantong, 2Department of Human Anatomy, Nantong University, Nantong, 3Central Laboratory of Nanjing First Hospital, Nanjing Medical University, Nanjing, 4Maternal and Child Health Hospital of Lianyungang, Lianyungang, Jiangsu, People’s Republic of China; 5Department of Clinical Oncology, Queen Elizabeth Hospital, Kowloon, Hong Kong Objectives: The objective of this study was to investigate the expression level of CD40 and its role in the prognosis of patients with diffuse large B-cell lymphoma (DLBCL who were treated with rituximab-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone.Design and methods: The immunohistochemical expressions of CD40 in 186 well-characterized DLBCL patients were evaluated by tissue microarrays, thereby revealing the relationship of the molecule CD40 with known tumor, patient-related variables, and survival rates.Results: The results showed that CD40 expressions were not statistically different between the germinal center B-cell-like (GCB type and the non-GCB type. We also analyzed the relationships of CD40 expression with overall survival (OS and progression-free survival (PFS in DLBCL patients who were uniformly treated with R-CHOP. A low expression of CD40 compared to high expression is related to poor OS and PFS. Conclusion: Our findings indicate that the CD40 level at onset acts as an independent prognostic predictor of DLBCL patients treated with R-CHOP. Keywords: CD40, diffuse large B-cell lymphoma, R-CHOP, prognostic factor

  16. Randomized Trial Comparing R-CHOP Versus High-Dose Sequential Chemotherapy in High-Risk Patients With Diffuse Large B-Cell Lymphomas.

    Science.gov (United States)

    Cortelazzo, Sergio; Tarella, Corrado; Gianni, Alessandro Massimo; Ladetto, Marco; Barbui, Anna Maria; Rossi, Andrea; Gritti, Giuseppe; Corradini, Paolo; Di Nicola, Massimo; Patti, Caterina; Mulé, Antonino; Zanni, Manuela; Zoli, Valerio; Billio, Atto; Piccin, Andrea; Negri, Giovanni; Castellino, Claudia; Di Raimondo, Francesco; Ferreri, Andrés J M; Benedetti, Fabio; La Nasa, Giorgio; Gini, Guido; Trentin, Livio; Frezzato, Maurizio; Flenghi, Leonardo; Falorio, Simona; Chilosi, Marco; Bruna, Riccardo; Tabanelli, Valentina; Pileri, Stefano; Masciulli, Arianna; Delaini, Federica; Boschini, Cristina; Rambaldi, Alessandro

    2016-11-20

    Purpose The benefit of high-dose chemotherapy with autologous stem-cell transplantation (ASCT) as first-line treatment in patients with diffuse large B-cell lymphomas is still a matter of debate. To address this point, we designed a randomized phase III trial to compare rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP)-14 (eight cycles) with rituximab plus high-dose sequential chemotherapy (R-HDS) with ASCT. Patients and Methods From June 2005 to June 2011, 246 high-risk patients with a high-intermediate (56%) or high (44%) International Prognostic Index score were randomly assigned to the R-CHOP or R-HDS arm, and 235 were analyzed by intent to treat. The primary efficacy end point of the study was 3-year event-free survival, and results were analyzed on an intent-to-treat basis. Results Clinical response (complete response, 78% v 76%; partial response, 5% v 9%) and failures (no response, 15% v 11%; and early treatment-related mortality, 2% v 3%) were similar after R-CHOP versus R-HDS, respectively. After a median follow-up of 5 years, the 3-year event-free survival was 62% versus 65% ( P = .83). At 3 years, compared with the R-CHOP arm, the R-HDS arm had better disease-free survival (79% v 91%, respectively; P = .034), but this subsequently vanished because of late-occurring treatment-related deaths. No difference was detected in terms of progression-free survival (65% v 75%, respectively; P = .12), or overall survival (74% v 77%, respectively; P = .64). Significantly higher hematologic toxicity ( P < .001) and more infectious complications ( P < .001) were observed in the R-HDS arm. Conclusion In this study, front-line intensive R-HDS chemotherapy with ASCT did not improve the outcome of high-risk patients with diffuse large B-cell lymphomas.

  17. A Case of an Unusually Aggressive Cutaneous Anaplastic Large T-Cell Lymphoma in an HIV Patient Treated with CHOP

    Directory of Open Access Journals (Sweden)

    Jorge Hurtado-Cordovi

    2011-01-01

    Full Text Available Anaplastic large cell lymphoma (ALCL is the second most common malignancy of T-cell phenotype. This case report describes an unusual rapidly progressing cutaneous anaplastic large T-cell lymphoma in an HIV patient. Our patient is a twenty-year-old African American male with perinatally acquired HIV who presented with a 2×2 centimeter necrotic lesion in the right 1st toe; however, 2-3 weeks later multiple smaller lesions appeared on the anterior aspect of the right foot, ankle, and thigh. Biopsy showed cells strongly positive for CD3 and CD30 and negative for CD56 and the ALK gene product. CT of the chest, abdomen, and pelvis was negative for extracutaneous involvement favoring cutaneous ALCL. Patient was treated with 6 cycles of CHOP (cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone chemotherapy and went into complete remission. Due to the aggressive course that this malignancy follows in HIV patients we suggest prompt treatment with systemic therapy.

  18. Miscible blends of biobased poly(lactide) with poly(methyl methacrylate): Effects of chopped glass fiber incorporation

    Energy Technology Data Exchange (ETDEWEB)

    Cousins, Dylan S. [Chemical and Biological Engineering Department, Colorado School of Mines, Golden Colorado 80401; Lowe, Corinne [Chemical and Biological Engineering Department, Colorado School of Mines, Golden Colorado 80401; Swan, Dana [Arkema, King of Prussia Pennsylvania; Barsotti, Robert [Arkema, King of Prussia Pennsylvania; Zhang, Mingfu [Johns Manville, Littleton Colorado; Gleich, Klaus [Johns Manville, Littleton Colorado; Berry, Derek [National Renewable Energy Laboratory, Golden Colorado; Snowberg, David [National Renewable Energy Laboratory, Golden Colorado; Dorgan, John R. [Chemical and Biological Engineering Department, Colorado School of Mines, Golden Colorado 80401

    2017-02-22

    Poly(lactide) (PLA) and poly(methyl methacrylate) (PMMA) are melt compounded with chopped glass fiber using laboratory scale twin-screw extrusion. Physical properties are examined using differential scanning calorimetry (DSC), dynamic mechanical thermal analysis (DMTA), thermogravimetric analysis (TGA), tensile testing, impact testing, X-ray computed tomography (CT) scanning, and field emission scanning electron microscopy (FE-SEM). Molecular weight is determined using gel permeation chromatography (GPC). Miscibility of the blends is implied by the presence of a single glass transition temperature and homogeneous morphology. PLA/PMMA blends tend to show positive deviations from a simple linear mixing rule in their mechanical properties (e.g., tensile toughness, modulus, and stress at break). The addition of 40 wt % glass fiber to the system dramatically increases physical properties. Across all blend compositions, the tensile modulus increases from roughly 3 GPa to roughly 10 GPa. Estimated heat distortion temperatures (HDTs) are also greatly enhanced; the pure PLA sample HDT increases from 75 degrees C to 135 degrees C. Fiber filled polymer blends represent a sustainable class of earth abundant materials which should prove useful across a range of applications.

  19. Effect of Chopped Basalt Fibers on the Mechanical Properties and Microstructure of High Performance Fiber Reinforced Concrete

    Directory of Open Access Journals (Sweden)

    Tehmina Ayub

    2014-01-01

    Full Text Available This paper presents the mechanical properties and the microstructure of the high performance fiber reinforced concrete (HPFRC containing up to 3% volume fraction of chopped Basalt fibers. Three types of the concrete were prepared, out of which, the first type was prepared by utilizing 100% cement content. The other two types of the concrete were prepared by replacing 10% cement content with silica fume and the locally produced metakaolin. Using each concrete type, four mixes were prepared in which Basalt fibers were added in the range of 0–3%; that is, total twelve mixes of the HPFRC concrete were prepared. From each of the twelve concrete mixes, total twelve specimens were cast to determine the mechanical properties of the HPFRC including compressive strength (cube and cylinder, splitting tensile strength, and the flexural strength. In this way, a total of 108 specimens were cast and tested in this study. Test results showed that the addition of the Basalt fibers significantly increased the tensile splitting strength and the flexural strength of the HPFRC, while there was slight improvement in the compressive strength with the addition of Basalt fibers. The microstructure of HPFRC was examined to determine the interfacial transition zone (ITZ between the aggregates and the paste by using field emission scanning electron microscope (FESEM, which showed the improvement of the ITZ due to the addition of the Basalt fibers.

  20. [Prognostic significance of NCCN-International Prognostic Index (NCCN-IPI) for patients with peripheral T-cell lymphoma treated with CHOP-based chemotherapy].

    Science.gov (United States)

    Zhang, M C; Xu, P P; Zhong, H J; Zhao, X; Zhao, W L; Cheng, S

    2017-09-14

    Objective: To validate the prognostic value of NCCN-International Prognostic Index (NCCN-IPI) for patients with peripheral T-cell lymphoma (PTCL) treated with CHOP-based chemotherapy. Methods: A retrospective analysis in 162 PTCL patients who were initially diagnosed and treated in Rui Jin Hospital from January 2003 to May 2013 was conducted. Baseline characteristics were collected, and survival analysis was performed according to the IPI and NCCN-IPI model. Results: The estimated 5-year overall survival (OS) rate and progression free survival (PFS) rate were 33% and 20%, with median OS and PFS of 17.0 months and 9.2 months, respectively. Multivariate analysis indicated ECOG score (PFS: HR =2.418, 95% CI 1.535-3.809, P IPI were remarkably higher than the counterparts based on IPI (5-year OS 74% vs 54%, χ (2)=5.041, P =0.025, 5-year PFS 50% vs 38%, χ (2)= 5.295, P =0.021) . NCCN-IPI was outstanding to identify the subgroup of low risk patients with PTCL, who may benefit from conventional chemotherapy such as CHOP or CHOP-like regimen. Conclusion: NCCN-IPI is more powerful for low risk PTCL patients and a strong supplement for IPI.

  1. The international staging system improves the IPI risk stratification in patients with diffuse large B-cell lymphoma treated with R-CHOP.

    Science.gov (United States)

    Wei, Xiaolei; Hao, Xiaoxiao; Zhou, Lizhi; Wei, Qi; Zhang, Yuankun; Huang, Weimin; Song, Jialin; Feng, Ru; Wei, Yongqiang

    2017-10-19

    The international staging system (ISS), based on serum beta-2 microglobulin and albumin, is used to predict survival in multiple myeloma, but its prognostic significance in diffuse large B-cell lymphoma (DLBCL) remains unknown. Herein, we retrospectively analyzed 215 de novo DLBCL patients. According to ISS, there were 90 of 215 (41.9%) patients in stage I, 98 of 215 (45.6%) in stage II and 27 of 215 (12.6%) in stage III group. Patients with ISS stage II/III showed shorter overall survival (OS) and event free survival (EFS) than those with stage I treated with R-CHOP (p = 0.012 and p = 0.043, respectively), but not those treated with CHOP regimen (p > 0.05). Multivariable analysis revealed that ISS, independent of IPI, indicated different survival in both OS (HR, 5.690; 95% CI, 1.270-25.495, p = 0.023) and EFS (HR, 2.116; 95% CI, 1.005-4.455, p = 0.049) in DLBCL patients treated with R-CHOP. ISS could identify patients with better outcome in intermediate-high/high IPI risk patients (p IPI risk patients, which may help to avoid intensive therapy.

  2. Application of the gravimetric method to closing the material balance around the chop-leach cell of a spent-fuel reprocessing plant

    International Nuclear Information System (INIS)

    Fishbone, L.G.

    1985-01-01

    For a spent-fuel reprocessing plant handling commercial light-water-reactor fuel, plutonium accounting is traditionally done for the material balance area (MBA) extending from the input accountability tank to the product accountability tank - the process MBA. Consider an MBA comprising the chop-leach cell, with an inward flow consisting of the intact spent-fuel assemblies and outward flows consisting of leached hulls and dissolver solution. Given knowledge of the original uranium mass in the fuel and a measurement of the uranium-plutonium concentration ratio in the dissolver solution, the gravimetric method can be used to determine the amount of plutonium in the spent-fuel assemblies. A measurement of residual plutonium in the leached hulls would then permit the determination of a plutonium material balance for the chop-leach cell alone, since the volumetrically determined plutonium in the input accountability tank yields the plutonium in the flow leaving the chop-leach cell for the process MBA. The uncertainty in the balance can be estimated given the individual measurement uncertainties

  3. Significance of tumor size and radiation dose to local control in stage I-III diffuse large cell lymphoma treated with CHOP-Bleo and radiation

    International Nuclear Information System (INIS)

    Fuller, Lillian M.; Krasin, Matthew J.; Velasquez, William S.; Allen, Pamela K.; McLaughlin, Peter; Rodriguez, M. Alma; Hagemeister, Fredrick B.; Swan, Forrest; Cabanillas, Fernando; Palmer, Judy L.; Cox, James D.

    1995-01-01

    Purpose: The purpose of this study was to evaluate the possible effect of adjunctive involved field (IF) radiotherapy on long-term local control for patients with Ann Arbor Stage I-III diffuse large cell lymphoma (DLCL) who achieved a complete remission on a combined modality program which included cyclophosphamide, doxorubicin, vincristine, prednisone, and Bleomycin (CHOP-Bleo). Methods and Materials: One hundred and ninety patients with Ann Arbor Stage I-III DLCL were treated with CHOP-Bleo and radiotherapy. Analyses were undertaken to determine (a) response to treatment according to stage, extent of maximum local disease, and irradiation dose either < 40 Gy or ≥ 40 Gy and (b) relapse patterns. Results: A complete remission (CR) was achieved in 162 patients. Among patients who achieved a CR, local control was better for those who received tumor doses of ≥ 40 Gy (97%) than for those who received < 40 Gy (83%) (p = 0.002.) Among those with extensive local disease, the corresponding control rates were 88% and 71%, respectively. A study of distant relapse patterns following a CR showed that the first relapse usually involved an extranodal site. Conclusion: Radiotherapy was an effective adjunctive treatment to CHOP-Bleo for patients with stage I-III DLCL who achieved a CR. Patterns of relapse suggested that total nodal irradiation (TNI) possibly could have benefited a small subset of patients

  4. Evaluation of two thermal processing schedules at low relative humidity for elimination of Escherichia coli O157:H7 and Salmonella serovars in chopped and formed beef jerky.

    Science.gov (United States)

    Harper, Nigel M; Roberts, Michelle N; Getty, Kelly J K; Boyle, Elizabeth A E; Fung, Daniel Y C; Higgins, James J

    2009-12-01

    Foodborne outbreaks have been linked to jerky produced under insufficient thermal processing schedules. Reduction of Escherichia coli O157:H7 and Salmonella serovars during thermal processing of chopped and formed beef jerky was evaluated under two processing schedules representative of those used by large-scale (LS) and small-scale (SS) jerky production facilities. Fresh chopped and formed all-beef jerky batter was inoculated with 5.8 to 7.3 log CFU of E. coli O157:H7 or Salmonella per g, extruded into strips, and thermally processed by LS or SS schedules. A >or=5.0-log CFU/g reduction of both pathogens occurred with or=5.0-log CFU/g reduction of both pathogens occurred with 15 to 20% relative humidity and a cumulative process of 45 min at 52 degrees C, 60 min at 57 degrees C, 45 min at 60 degrees C, 45 min at 63 degrees C, 90 min at 68 degrees C, and finishing with 30 min at 77 degrees C. After processing for an additional 90 min at 77 degrees C, water activity was 0.60 while the MPR was 0.82. The LS and SS processes for producing chopped and formed jerky provided >or=5.0 log lethality to control E. coli O157:H7 and Salmonella. However, both processes would require additional drying to achieve an MPR of 0.75 to be labeled as jerky.

  5. Receptor-targeted lentiviral vectors are exceptionally sensitive toward the biophysical properties of the displayed single-chain Fv.

    Science.gov (United States)

    Friedel, Thorsten; Hanisch, Lydia J; Muth, Anke; Honegger, Annemarie; Abken, Hinrich; Plückthun, Andreas; Buchholz, Christian J; Schneider, Irene C

    2015-04-01

    An increasing number of applications require the expression of single-chain variable fragments (scFv) fusion proteins in mammalian cells at the cell surface membrane. Here we assessed the CD30-specific scFv HRS3, which is used in immunotherapy, for its ability to retarget lentiviral vectors (LVs) to CD30 and to mediate selective gene transfer into CD30-positive cells. Fused to the C-terminus of the type-II transmembrane protein hemagglutinin (H) of measles virus and expressed in LV packaging cells, gene transfer mediated by the released LV particles was inefficient. A series of point mutations in the scFv framework regions addressing its biophysical properties, which substantially improved production and increased the melting temperature without impairing its kinetic binding behavior to CD30, also improved the performance of LV particles. Gene transfer into CD30-positive cells increased ∼100-fold due to improved transport of the H-scFv protein to the plasma membrane. Concomitantly, LV particle aggregation and syncytia formation in packaging cells were substantially reduced. The data suggest that syncytia formation can be triggered by trans-cellular dimerization of H-scFv proteins displayed on adjacent cells. Taken together, we show that the biophysical properties of the targeting ligand have a decisive role for the gene transfer efficiency of receptor-targeted LVs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. IL10 Released by a New Inflammation-regulated Lentiviral System Efficiently Attenuates Zymosan-induced Arthritis

    Science.gov (United States)

    Garaulet, Guillermo; Alfranca, Arántzazu; Torrente, María; Escolano, Amelia; López-Fontal, Raquel; Hortelano, Sonsoles; Redondo, Juan M; Rodríguez, Antonio

    2013-01-01

    Administration of anti-inflammatory cytokines is a common therapeutic strategy in chronic inflammatory diseases. Gene therapy is an efficient method for delivering therapeutic molecules to target cells. Expression of the cell adhesion molecule E-selectin (ESEL), which is expressed in the early stages of inflammation, is controlled by proinflammatory cytokines, making its promoter a good candidate for the design of inflammation-regulated gene therapy vectors. This study describes an ESEL promoter (ESELp)-based lentiviral vector (LV) that drives localized transgene expression during inflammation. Mouse matrigel plug assays with ESELp-transduced endothelial cells showed that systemic lipopolysaccharide (LPS) administration selectively induces ESELp-controlled luciferase expression in vivo. Inflammation-specific induction was confirmed in a mouse model of arthritis, showing that this LV is repeatedly induced early in acute inflammation episodes and is downregulated during remission. Moreover, the local acute inflammatory response in this animal model was efficiently blocked by expression of the anti-inflammatory cytokine interleukin-10 (IL10) driven by our LV system. This inflammation-regulated expression system has potential application in the design of new strategies for the local treatment of chronic inflammatory diseases such as cardiovascular and autoimmune diseases. PMID:22760540

  7. A stable producer cell line for the manufacture of a lentiviral vector for gene therapy of Parkinson's disease.

    Science.gov (United States)

    Stewart, Hannah J; Fong-Wong, Liang; Strickland, Iain; Chipchase, Daniel; Kelleher, Michelle; Stevenson, Laura; Thoree, Vinay; McCarthy, Janine; Ralph, G Scott; Mitrophanous, Kyriacos A; Radcliffe, Pippa A

    2011-03-01

    ProSavin is an equine infectious anemia virus vector-based gene therapy for Parkinson's disease for which inducible HEK293T-based producer cell lines (PCLs) have been developed. These cell lines demonstrate stringent tetracycline-regulated expression of the packaging components and yield titers comparable to the established transient production system. A prerequisite for the use of PCL-derived lentiviral vectors (LVs) in clinical applications is the thorough characterization of both the LV and respective PCL with regard to identity and genetic stability. We describe the detailed characterization of two ProSavin PCLs (PS5.8 and PS46.2) and resultant ProSavin vector. The two cell lines demonstrate stable production of vector over a time period sufficient to allow generation of master and working cell banks, and subsequent large-scale vector production. ProSavin generated from the PCLs performs comparably in vivo to that produced by the standard transient transfection process with respect to transduction efficiency and immunogenicity. The development of ProSavin PCLs, and the detailed characterization described here, will aid the advancement of ProSavin for clinical application.

  8. The Comparative Value of Feline Virology Research: Can Findings from the Feline Lentiviral Vaccine Be Translated to Humans?

    Science.gov (United States)

    Hosie, Margaret J; Techakriengkrai, Navapon; Bęczkowski, Paweł M; Harris, Matthew; Logan, Nicola; Willett, Brian J

    2017-01-28

    Feline immunodeficiency virus (FIV) is a lentivirus of domestic cats that shares several similarities with its human counterpart, human immunodeficiency virus (HIV). Their analogies include genomic organization, lymphocyte tropism, viral persistence and induction of immunodeficiency. FIV is the only lentivirus for which a commercial vaccine is registered for prevention in either human or veterinary medicine. This provides a unique opportunity to investigate the mechanisms of protection induced by lentivirus vaccines at the population level and might contribute to the development of efficacious HIV vaccines. As well as having comparative value for vaccine studies, FIV research has shed some light on the relationship between lentiviral tropism and pathogenesis. Recent studies in our laboratory demonstrated that the interaction between FIV and its primary receptor changes as disease progresses, reminiscent of the receptor switch observed as disease progresses in HIV infected individuals. Here we summarise findings illustrating that, in addition to its veterinary significance, FIV has comparative value, providing a useful model to explore lentivirus-host interactions and to examine potential immune correlates of protection against HIV infection.

  9. Dendritic cell-targeted lentiviral vector immunization uses pseudotransduction and DNA-mediated STING and cGAS activation.

    Science.gov (United States)

    Kim, Jocelyn T; Liu, Yarong; Kulkarni, Rajan P; Lee, Kevin K; Dai, Bingbing; Lovely, Geoffrey; Ouyang, Yong; Wang, Pin; Yang, Lili; Baltimore, David

    2017-07-21

    Dendritic cell (DC) activation and antigen presentation are critical for efficient priming of T cell responses. Here, we study how lentiviral vectors (LVs) deliver antigen and activate DCs to generate T cell immunization in vivo. We report that antigenic proteins delivered in vector particles via pseudotransduction were sufficient to stimulate an antigen-specific immune response. The delivery of the viral genome encoding the antigen increased the magnitude of this response in vivo but was irrelevant in vitro. Activation of DCs by LVs was independent of MyD88, TRIF, and MAVS, ruling out an involvement of Toll-like receptor or RIG-I-like receptor signaling. Cellular DNA packaged in LV preparations induced DC activation by the host STING (stimulator of interferon genes) and cGAS (cyclic guanosine monophosphate-adenosine monophosphate synthase) pathway. Envelope-mediated viral fusion also activated DCs in a phosphoinositide 3-kinase-dependent but STING-independent process. Pseudotransduction, transduction, viral fusion, and delivery of cellular DNA collaborate to make the DC-targeted LV preparation an effective immunogen. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  10. Efficient transfer of HTLV-1 tax gene in various primary and immortalized cells using a flap lentiviral vector.

    Science.gov (United States)

    Royer-Leveau, Christelle; Mordelet, Elodie; Delebecque, Frédéric; Gessain, Antoine; Charneau, Pierre; Ozden, Simona

    2002-08-01

    Human T cell leukemia virus type 1 (HTLV-1) causes two major diseases: adult T-cell leukemia-lymphoma and tropical spastic paraparesis/HTLV-1 associated myelopathy (TSP/HAM). In order to understand the involvement of Tax protein in HTLV-1 pathogenesis, we constructed a HIV-1 based lentiviral vector containing the central DNA flap sequence and either the green fluorescent protein (GFP) or the HTLV-1 tax genes. Using these vectors, GFP and tax genes were introduced in several primary and immortalized cells of endothelial, lymphoid, astrocytic or macrophagic origin. As assessed by GFP expression, up to 100% efficiency of transduction was obtained for all cell types tested. Tax expression was detected by Western blot and immuno-fluorescence in the transduced cells. After transduction, the Tax transcriptional activity was confirmed by the transactivation of HTLV-1 LTR-lacZ or HTLV-1 LTR-GFP reporter genes. Increased CD25 and HLA DR expression was observed in human peripheral blood lymphocytes transduced with the Tax vector. These results indicate that both pathways of Tax transactivation, CREB (viral LTR) and NF-kappa B (CD25 and HLA DR), are functional after transduction by TRIP Tax vector. Therefore, this vector provides a useful tool for investigating the role of the Tax viral protein in the pathogenesis of diseases linked to HTLV-1 infection.

  11. An adeno-associated viral vector transduces the rat hypothalamus and amygdala more efficient than a lentiviral vector

    Directory of Open Access Journals (Sweden)

    Vreugdenhil Erno

    2010-07-01

    Full Text Available Abstract Background This study compared the transduction efficiencies of an adeno-associated viral (AAV vector, which was pseudotyped with an AAV1 capsid and encoded the green fluorescent protein (GFP, with a lentiviral (LV vector, which was pseudotyped with a VSV-G envelop and encoded the discosoma red fluorescent protein (dsRed, to investigate which viral vector transduced the lateral hypothalamus or the amygdala more efficiently. The LV-dsRed and AAV1-GFP vector were mixed and injected into the lateral hypothalamus or into the amygdala of adult rats. The titers that were injected were 1 × 108 or 1 × 109 genomic copies of AAV1-GFP and 1 × 105 transducing units of LV-dsRed. Results Immunostaining for GFP and dsRed showed that AAV1-GFP transduced significantly more cells than LV-dsRed in both the lateral hypothalamus and the amygdala. In addition, the number of LV particles that were injected can not easily be increased, while the number of AAV1 particles can be increased easily with a factor 100 to 1000. Both viral vectors appear to predominantly transduce neurons. Conclusions This study showed that AAV1 vectors are better tools to overexpress or knockdown genes in the lateral hypothalamus and amygdala of adult rats, since more cells can be transduced with AAV1 than with LV vectors and the titer of AAV1 vectors can easily be increased to transduce the area of interest.

  12. Establishment of clonal MIN-O transplant lines for molecular imaging via lentiviral transduction & in vitro culture.

    Directory of Open Access Journals (Sweden)

    David L Boucher

    Full Text Available As the field of molecular imaging evolves and increasingly is asked to fill the discovery and validation space between basic science and clinical applications, careful consideration should be given to the models in which studies are conducted. The MIN-O mouse model series is an established in vivo model of human mammary precancer ductal carcinoma in situ with progression to invasive carcinoma. This series of transplant lines is propagated in vivo and experiments utilizing this model can be completed in non-engineered immune intact FVB/n wild type mice thereby modeling the tumor microenvironment with biological relevance superior to traditional tumor cell xenografts. Unfortunately, the same qualities that make this and many other transplant lines more biologically relevant than standard cell lines for molecular imaging studies present a significant obstacle as somatic genetic re-engineering modifications common to many imaging applications can be technically challenging. Here, we describe a protocol for the efficient lentiviral transduction of cell slurries derived from precancerous MIN-O lesions, in vitro culture of "MIN-O-spheres" derived from single cell clones, and the subsequent transplantation of these spheres to produce transduced sublines suitable for optical imaging applications. These lines retain the physiologic and pathologic properties, including multilineage differentiation, and complex microanatomic interaction with the host stroma characteristic of the MIN-O model. We also present the in vivo imaging and immunohistochemical analysis of serial transplantation of one such subline and detail the progressive multifocal loss of the transgene in successive generations.

  13. Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

    Science.gov (United States)

    Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

    2007-01-01

    Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

  14. Induction of broadly neutralising HCV antibodies in mice by integration-deficient lentiviral vector-based pseudotyped particles.

    Directory of Open Access Journals (Sweden)

    Yao Deng

    Full Text Available INTRODUCTION: Integration-deficient lentiviral vectors (IDLVs are a promising platform for immunisation to elicit both humoral immunity and cellular mediated immunity (CMI. Here, we compared the specific immunity in mice immunised via different regimens (homologous and cocktail with IDLV-based HCV pseudoparticles (HCVpps carrying pseudotyped glycoproteins E1E2 and bearing the HCV NS3 gene. Humoral and cell-mediated immune responses were also evaluated after IDLV-HCVpp immunisation combined with heterologous rAd5-CE1E2 priming protocols. Sera from the mice effectively elicited anti-E1, -E2, and -NS3 antibody responses, and neutralised various HCVpp subtypes (1a, 1b, 2a, 3a and 5a. No significant CMI was detected in the groups immunised with IDLV-based HCVpps. In contrast, the combination of rAd5-CE1E2 priming and IDLV-based HCVpp boosting induced significant CMI against multiple antigens (E1, E2, and NS3. CONCLUSION: IDLV-based HCVpps are a promising vaccination platform and the combination of rAd5-CE1E2 and IDLV-based HCVpp prime-boost strategy should be further explored for the development of a cross-protective HCV vaccine.

  15. Sindbis Virus-Pseudotyped Lentiviral Vectors Carrying VEGFR2-Specific Nanobody for Potential Transductional Targeting of Tumor Vasculature.

    Science.gov (United States)

    Ahani, Roshank; Roohvand, Farzin; Cohan, Reza Ahangari; Etemadzadeh, Mohammad Hossein; Mohajel, Nasir; Behdani, Mahdi; Shahosseini, Zahra; Madani, Navid; Azadmanesh, Kayhan

    2016-11-01

    Introduction of selectivity/specificity into viral-based gene delivery systems, such as lentiviral vectors (LVs), is crucial in their systemic administration for cancer gene therapy. The pivotal role of tumor-associated endothelial cells (TAECs) in tumor angiogenesis and overexpression of vascular endothelial growth factor receptor-2 (VEGFR2 or KDR) in TAECs makes them a potent target in cancer treatment. Herein, we report the development of VEGFR2-targeted LVs pseudotyped with chimeric sindbis virus E2 glycoprotein (cSVE2s). For this purpose, either sequence of a VEGFR2-specific nanobody or its natural ligand (VEGF 121 ) was inserted into the binding site of sindbis virus E2 glycoprotein. In silico modeling data suggested that the inserted targeting motifs were exposed in the context of cSVE2s. Western blot analysis of LVs indicated the incorporation of cSVE2s into viral particles. Capture ELISA demonstrated the specificity/functionality of the incorporated cSVE2s. Transduction of 293/KDR (expressing VEGFR2) or 293T cells (negative control) by constructed LVs followed by fluorescent microscopy and flow cytometric analyses indicated selective transduction of 293/KDR cells (30 %) by both targeting motifs compared to 293T control cells (1-2 %). These results implied similar targeting properties of VEGFR2-specific nanobody compared to the VEGF 121 and indicated the potential for transductional targeting of tumor vasculature by the nanobody displaying LVs.

  16. Towards a clinically relevant lentiviral transduction protocol for primary human CD34 hematopoietic stem/progenitor cells.

    Directory of Open Access Journals (Sweden)

    Michelle Millington

    2009-07-01

    Full Text Available Hematopoietic stem cells (HSC, in particular mobilized peripheral blood stem cells, represent an attractive target for cell and gene therapy. Efficient gene delivery into these target cells without compromising self-renewal and multi-potency is crucial for the success of gene therapy. We investigated factors involved in the ex vivo transduction of CD34(+ HSCs in order to develop a clinically relevant transduction protocol for gene delivery. Specifically sought was a protocol that allows for efficient transduction with minimal ex vivo manipulation without serum or other reagents of animal origin.Using commercially available G-CSF mobilized peripheral blood (PB CD34(+ cells as the most clinically relevant target, we systematically examined factors including the use of serum, cytokine combinations, pre-stimulation time, multiplicity of infection (MOI, transduction duration and the use of spinoculation and/or retronectin. A self-inactivating lentiviral vector (SIN-LV carrying enhanced green fluorescent protein (GFP was used as the gene delivery vehicle. HSCs were monitored for transduction efficiency, surface marker expression and cellular function. We were able to demonstrate that efficient gene transduction can be achieved with minimal ex vivo manipulation while maintaining the cellular function of transduced HSCs without serum or other reagents of animal origin.This study helps to better define factors relevant towards developing a standard clinical protocol for the delivery of SIN-LV into CD34(+ cells.

  17. Resultados facodinámicos del chopping inverso en la cirugía de catarata 2009 Phacodynamic outcomes of the reversed chopping technique in the cataract surgery in 2009

    Directory of Open Access Journals (Sweden)

    Abel Plasencia Blanco

    2011-12-01

    Full Text Available Objetivo: Evaluar los resultados facodinámicos alcanzados con la técnica de cirugía de catarata por facoemulsificación chopping inverso en el Instituto Cubano de Oftalmología “Ramón Pando Ferrer” en 2009. Métodos: Se realizó un estudio descriptivo y prospectivo en 182 pacientes (ojos con diagnóstico de catarata presenil y senil, que aceptaron someterse a la técnica quirúrgica. Los resultados facodinámicos de la técnica se evaluaron según las siguientes variables: dureza del cristalino, mejor agudeza visual con y sin corrección, poder de ultrasonido, tiempo de facoemulsificación, tiempo efectivo de facoemulsificación, densidad de células endoteliales y complicaciones. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas, se aplicó la prueba t de Student para su comparación. Resultados: La agudeza visual con corrección obtenida significó cinco líneas en la escala de Snellen. El tiempo de ultrasonido aplicado estuvo dentro de valores normales en relación con la dureza del núcleo. La pérdida de células endoteliales no fue importante. La complicación operatoria no fue significativa. Conclusión: La técnica se consideró efectiva con resultados muy favorables. Es perfectamente aplicable para todos los grados de dureza de la catarata, evitándose con ella un gran número de complicaciones. Esto le permite al paciente una rápida incorporación a su vida social.Objectives: To assess the phacodynamic outcomes of the reversed chopping phacoemulsification technique applied in cataract surgery at “Ramon Pando Ferrer” Cuban Institute of Ophthalmology between January and December, 2009. Methods: A prospective and descriptive study was performed on 182 patients (eyes diagnosed with pre-senile and senile cataract, who agreed to be operated on with this procedure. The phacodynamic outcomes were evaluated according to the following variables: lens hardness, best visual acuity with

  18. Heparanase Mechanisms in Melanoma Brain Metastasis

    Science.gov (United States)

    2015-10-01

    lentiviral system yields tractable and inducible RNAi in a cell population, a shRNA targeting HPSE was subcloned into pINDUCER10 viral vector...in BMM cells (70W and 70WSM-3/-4, respectively). ShRNA targeting HPSE was subcloned into pINDUCER10 lentiviral vector (5). BMM cells were then

  19. Effects of energy supplementation on energy losses and nitrogen balance of steers fed green-chopped wheat pasture I: Calorimetry.

    Science.gov (United States)

    Shreck, A L; Ebert, P J; Bailey, E A; Jennings, J S; Casey, K D; Meyer, B E; Cole, N A

    2017-05-01

    Cattle grazing wheat pasture in the southern Great Plains are sometimes fed an energy supplement; however, the benefits of supplementation on nutrient balance, energy metabolism, and greenhouse gas emissions have not been elucidated. Therefore, we used 10 British crossbred steers (206 ± 10.7 kg initial BW) in a respiration calorimetry study to evaluate the effects of energy supplementation on energy losses, N balance, and nutrient digestibility of steers fed green-chopped wheat forage. The study design was an incomplete replicated 4 × 4 Latin square with treatments in a 2 × 2 factorial arrangement. Steers ( = 8) were assigned to 1 of 2 BW blocks (4 steers per block) with dietary factors consisting of 1) no supplementation (CON) or supplemented with a steam-flaked corn-based energy supplement (that also contained monensin sodium) at 0.5% of BW daily (SUP) and 2) NEm intakes of 1 times (1x) or 1.5 times (1.5x) maintenance. Wheat forage was harvested daily and continuously fed as green-chop to steers during the 56-d study. There were no differences ( ≥ 0.32) between CON and SUP for OM (78.3 vs. 80.7%, respectively) or NDF (68.3 vs. 64.8%, respectively) digestibility. At the 1.5x level of intake, there was no difference ( ≥ 0.16) in energy lost in feces (4.27 vs. 3.92 Mcal/d) or urine (0.58 vs. 0.55 Mcal/d), heat production (8.69 vs. 8.44 Mcal/d), or retained energy (3.10 vs. 3.46 Mcal/d) between supplementation treatments. Oxygen consumption (1,777 vs. 1,731 L/d; = 0.67) and CO production (1,704 vs. 1,627 L/d; = 0.56) of CON and SUP steers, respectively, were not different; however, SUP steers tended to have ( = 0.06) lower CH production (115 vs 130 L/d) than CON steers. Methane, as a proportion of GE intake, was similar for CON (6.87%) and SUP (6.07%; = 0.18), as was the ME:DE ratio ( = 0.24; 86.3% for CON and 87.9% for SUP). Fractional N excretion in urine and feces, as a proportion of total N excreted ( ≥ 0.84) or N intake ( ≥ 0.63), was not different

  20. Transduction of Photoreceptors With Equine Infectious Anemia Virus Lentiviral Vectors: Safety and Biodistribution of StarGen for Stargardt Disease

    Science.gov (United States)

    Binley, Katie; Widdowson, Peter; Loader, Julie; Kelleher, Michelle; Iqball, Sharifah; Ferrige, Georgina; de Belin, Jackie; Carlucci, Marie; Angell-Manning, Diana; Hurst, Felicity; Ellis, Scott; Miskin, James; Fernandes, Alcides; Wong, Paul; Allikmets, Rando; Bergstrom, Christopher; Aaberg, Thomas; Yan, Jiong; Kong, Jian; Gouras, Peter; Prefontaine, Annick; Vezina, Mark; Bussieres, Martin; Naylor, Stuart; Mitrophanous, Kyriacos A.

    2013-01-01

    Purpose. StarGen is an equine infectious anemia virus (EIAV)-based lentiviral vector that expresses the photoreceptor-specific adenosine triphosphate (ATP)-binding cassette transporter (ABCA4) protein that is mutated in Stargardt disease (STGD1), a juvenile macular dystrophy. EIAV vectors are able to efficiently transduce rod and cone photoreceptors in addition to retinal pigment epithelium in the adult macaque and rabbit retina following subretinal delivery. The safety and biodistribution of StarGen following subretinal delivery in macaques and rabbits was assessed. Methods. Regular ophthalmic examinations, IOP measurements, ERG responses, and histopathology were carried out in both species to compare control and vector-treated eyes. Tissue and fluid samples were obtained to evaluate the persistence, biodistribution, and shedding of the vector following subretinal delivery. Results. Ophthalmic examinations revealed a slightly higher level of inflammation in StarGen compared with control treated eyes in both species. However, inflammation was transient and no overt toxicity was observed in StarGen treated eyes and there were no abnormal clinical findings. There was no StarGen-associated rise in IOP or abnormal ERG response in either rabbits or macaques. Histopathologic examination of the eyes did not reveal any detrimental changes resulting from subretinal administration of StarGen. Although antibodies to StarGen vector components were detected in rabbit but not macaque serum, this immunologic response did not result in any long-term toxicity. Biodistribution analysis demonstrated that the StarGen vector was restricted to the ocular compartment. Conclusions. In summary, these studies demonstrate StarGen to be well tolerated and localized following subretinal administration. PMID:23620430

  1. Development of B-lineage predominant lentiviral vectors for use in genetic therapies for B cell disorders.

    Science.gov (United States)

    Sather, Blythe D; Ryu, Byoung Y; Stirling, Brigid V; Garibov, Mikhail; Kerns, Hannah M; Humblet-Baron, Stéphanie; Astrakhan, Alexander; Rawlings, David J

    2011-03-01

    Sustained, targeted, high-level transgene expression in primary B lymphocytes may be useful for gene therapy in B cell disorders. We developed several candidate B-lineage predominant self-inactivating lentiviral vectors (LV) containing alternative enhancer/promoter elements including: the immunoglobulin β (Igβ) (B29) promoter combined with the immunoglobulin µ enhancer (EµB29); and the endogenous BTK promoter with or without Eµ (EµBtkp or Btkp). LV-driven enhanced green fluorescent protein (eGFP) reporter expression was evaluated in cell lines and primary cells derived from human or murine hematopoietic stem cells (HSC). In murine primary cells, EµB29 and EµBtkp LV-mediated high-level expression in immature and mature B cells compared with all other lineages. Expression increased with B cell maturation and was maintained in peripheral subsets. Expression in T and myeloid cells was much lower in percentage and intensity. Similarly, both EµB29 and EµBtkp LV exhibited high-level activity in human primary B cells. In contrast to EµB29, Btkp and EµBtkp LV also exhibited modest activity in myeloid cells, consistent with the expression profile of endogenous Bruton's tyrosine kinase (Btk). Notably, EµB29 and EµBtkp activity was superior in all expression models to an alternative, B-lineage targeted vector containing the EµS.CD19 enhancer/promoter. In summary, EµB29 and EµBtkp LV comprise efficient delivery platforms for gene expression in B-lineage cells.

  2. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.

    Science.gov (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2013-07-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  3. Simplified production and concentration of HIV-1-based lentiviral vectors using HYPERFlask vessels and anion exchange membrane chromatography

    Directory of Open Access Journals (Sweden)

    Marino Michael P

    2009-02-01

    Full Text Available Abstract Background During the past twelve years, lentiviral (LV vectors have emerged as valuable tools for transgene delivery because of their ability to transduce nondividing cells and their capacity to sustain long-term transgene expression in target cells in vitro and in vivo. However, despite significant progress, the production and concentration of high-titer, high-quality LV vector stocks is still cumbersome and costly. Methods Here we present a simplified protocol for LV vector production on a laboratory scale using HYPERFlask vessels. HYPERFlask vessels are high-yield, high-performance flasks that utilize a multilayered gas permeable growth surface for efficient gas exchange, allowing convenient production of high-titer LV vectors. For subsequent concentration of LV vector stocks produced in this way, we describe a facile protocol involving Mustang Q anion exchange membrane chromatography. Results Our results show that unconcentrated LV vector stocks with titers in excess of 108 transduction units (TU per ml were obtained using HYPERFlasks and that these titers were higher than those produced in parallel using regular 150-cm2 tissue culture dishes. We also show that up to 500 ml of an unconcentrated LV vector stock prepared using a HYPERFlask vessel could be concentrated using a single Mustang Q Acrodisc with a membrane volume of 0.18 ml. Up to 5.3 × 1010 TU were recovered from a single HYPERFlask vessel. Conclusion The protocol described here is easy to implement and should facilitate high-titer LV vector production for preclinical studies in animal models without the need for multiple tissue culture dishes and ultracentrifugation-based concentration protocols.

  4. Retroviral and Lentiviral Safety Analysis of Gene-Modified T Cell Products and Infused HIV and Oncology Patients.

    Science.gov (United States)

    Marcucci, Katherine T; Jadlowsky, Julie K; Hwang, Wei-Ting; Suhoski-Davis, Megan; Gonzalez, Vanessa E; Kulikovskaya, Irina; Gupta, Minnal; Lacey, Simon F; Plesa, Gabriela; Chew, Anne; Melenhorst, J Joseph; Levine, Bruce L; June, Carl H

    2018-01-03

    Replication-competent retrovirus/lentivirus (RCR/L) and insertional oncogenesis are potential safety risks with integrating viruses in gene-modified cell therapies. As such, the Food and Drug Administration guidances outline RCR/L-monitoring methods throughout the entire gene therapy treatment cycle. We present data for 17 vector lots, 375 manufactured T cell products, and 308 patients post-infusion across both HIV and oncology indications, showing no evidence of RCR/L. Given our data, a Poisson probability model estimates that a single patient, or a group of patients, would need to be followed for at least 52.8 years to observe one positive RCR/L event, highlighting the unlikelihood of RCR/L development. Additionally, we estimate the median time for lentivirus-modified T cell products to fall below the 1% vector sequence threshold in peripheral or whole blood that would trigger vector integration site analysis. These estimated times are 1.4 months in hematologic malignancies, 0.66 month in solid tumors, and 0.92 month in HIV. Based on these considerable safety data in HIV and oncology and recent Biologics License Applications filed for lentiviral-modified T cell products for hematologic malignancies, this may be an opportune time to re-evaluate the current guidelines for T cell gene therapy product testing and long-term patient monitoring. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  5. Effective in vivo and ex vivo gene transfer to intestinal mucosa by VSV-G-pseudotyped lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kasahara Noriyuki

    2010-05-01

    Full Text Available Abstract Background Gene transfer to the gastrointestinal (GI mucosa is a therapeutic strategy which could prove particularly advantageous for treatment of various hereditary and acquired intestinal disorders, including inflammatory bowel disease (IBD, GI infections, and cancer. Methods We evaluated vesicular stomatitis virus glycoprotein envelope (VSV-G-pseudotyped lentiviral vectors (LV for efficacy of gene transfer to both murine rectosigmoid colon in vivo and human colon explants ex vivo. LV encoding beta-galactosidase (LV-β-Gal or firefly-luciferase (LV-fLuc reporter genes were administered by intrarectal instillation in mice, or applied topically for ex vivo transduction of human colorectal explant tissues from normal individuals. Macroscopic and histological evaluations were performed to assess any tissue damage or inflammation. Transduction efficiency and systemic biodistribution were evaluated by real-time quantitative PCR. LV-fLuc expression was evaluated by ex vivo bioluminescence imaging. LV-β-Gal expression and identity of transduced cell types were examined by histochemical and immunofluorescence staining. Results Imaging studies showed positive fLuc signals in murine distal colon; β-Gal-positive cells were found in both murine and human intestinal tissue. In the murine model, β-Gal-positive epithelial and lamina propria cells were found to express cytokeratin, CD45, and CD4. LV-transduced β-Gal-positive cells were also seen in human colorectal explants, consisting mainly of CD45, CD4, and CD11c-positive cells confined to the LP. Conclusions We have demonstrated the feasibility of LV-mediated gene transfer into colonic mucosa. We also identified differential patterns of mucosal gene transfer dependent on whether murine or human tissue was used. Within the limitations of the study, the LV did not appear to induce mucosal damage and were not distributed beyond the distal colon.

  6. Simplified production and concentration of HIV-1-based lentiviral vectors using HYPERFlask vessels and anion exchange membrane chromatography

    Science.gov (United States)

    Kutner, Robert H; Puthli, Sharon; Marino, Michael P; Reiser, Jakob

    2009-01-01

    Background During the past twelve years, lentiviral (LV) vectors have emerged as valuable tools for transgene delivery because of their ability to transduce nondividing cells and their capacity to sustain long-term transgene expression in target cells in vitro and in vivo. However, despite significant progress, the production and concentration of high-titer, high-quality LV vector stocks is still cumbersome and costly. Methods Here we present a simplified protocol for LV vector production on a laboratory scale using HYPERFlask vessels. HYPERFlask vessels are high-yield, high-performance flasks that utilize a multilayered gas permeable growth surface for efficient gas exchange, allowing convenient production of high-titer LV vectors. For subsequent concentration of LV vector stocks produced in this way, we describe a facile protocol involving Mustang Q anion exchange membrane chromatography. Results Our results show that unconcentrated LV vector stocks with titers in excess of 108 transduction units (TU) per ml were obtained using HYPERFlasks and that these titers were higher than those produced in parallel using regular 150-cm2 tissue culture dishes. We also show that up to 500 ml of an unconcentrated LV vector stock prepared using a HYPERFlask vessel could be concentrated using a single Mustang Q Acrodisc with a membrane volume of 0.18 ml. Up to 5.3 × 1010 TU were recovered from a single HYPERFlask vessel. Conclusion The protocol described here is easy to implement and should facilitate high-titer LV vector production for preclinical studies in animal models without the need for multiple tissue culture dishes and ultracentrifugation-based concentration protocols. PMID:19220915

  7. Impact of salvage treatment modalities in patients with positive FDG-PET/CT after R-CHOP chemotherapy for aggressive B-cell non-Hodgkin lymphoma.

    Science.gov (United States)

    Chin, Vicky; Fulham, Michael; Hertzberg, Mark; Jackson, Michael; Lindeman, Robert; Brighton, Timothy; Kidson-Gerber, Giselle; Wegner, Eva A; Cheung, Carol; MacCallum, Susan; Williams, Janet; Thompson, Stephen R

    2018-03-25

    To compare outcomes of different salvage treatment modalities in patients with aggressive B-cell non-Hodgkin lymphoma (NHL) who remain FDG-PET positive after R-CHOP chemotherapy. Existing data on these patients with FDG-PET primary refractory disease are limited. Patients with diffuse large B-cell lymphoma or grade 3 follicular lymphoma were retrospectively reviewed from the Prince of Wales Hospital databases. Eligibility criteria were: age≥18 years, treated with R-CHOP, with positive post-chemotherapy FDG-PET. Salvage treatment modalities were: radical radiotherapy (RT, dose≥30 Gy), high dose chemotherapy and autologous stem cell transplant (ASCT), or non-radical management. Survival was calculated from date of post-chemotherapy FDG-PET to last follow-up. Twenty-six patients from 2003-2015 met the inclusion criteria. Median age was 60 (range 19-84). Most had adverse baseline features: 21 (81%) stage III-IV, 24 (92%) bulky disease and nine (35%) skeletal involvement. Characteristics of PET-positivity post-chemotherapy were single site in 16 (62%), sites of prior bulk in 24 of 24, skeletal sites in five of nine, and able to be encompassed by RT in 21 (81%). Salvage treatment was: radical RT in 17 (65%), ASCT in four (15%) and non-radical in five (20%). Median follow-up of surviving patients was 31 months. Kaplan-Meier estimates of 3-year PFS and OS were 41% and 52%, respectively. By salvage modality, 3-year PFS was 51% for RT, 25% for ASCT and 20% for non-radical treatment, (P = 0.453); 3-year OS was respectively 65%, 25% and 40% (P = 0.173). Patients with FDG-PET positive disease after R-CHOP for aggressive B-cell NHL are salvageable with radiotherapy. © 2018 The Royal Australian and New Zealand College of Radiologists.

  8. Baicalein protects HT22 murine hippocampal neuronal cells against endoplasmic reticulum stress-induced apoptosis through inhibition of reactive oxygen species production and CHOP induction

    Science.gov (United States)

    Choi, Ji Hyun; Choi, A Young; Yoon, Hana; Choe, Wonchae; Yoon, Kyung-Sik; Ha, Joohun

    2010-01-01

    Baicalein is one of the major flavonoids in Scutellaria baicalensis Georgi and possesses various effects, including cytoprotection and anti-inflammation. Because endoplasmic reticulum (ER) stress has been implicated in neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, and cerebral ischemia, we investigated the effects of baicalein on apoptotic death of HT22 mouse hippocampal neuronal cells induced by thapsigargin (TG) and brefeldin A (BFA), two representative ER stress inducers. Apoptosis, reactive oxygen species (ROS) production, and mitochondrial membrane potential (MMP) were measured by flow cytometry. Expression level and phosphorylation status of ER stress-associated proteins and activation and cleavage of apoptosis-associated proteins were analyzed by Western blot. Baicalein reduced TG- and BFA-induced apoptosis of HT22 cells and activation and cleavage of apoptosis-associated proteins, such as caspase-12 and -3 and poly(ADP-ribose) polymerase. Baicalein also reduced the TG- and BFA-induced expression of ER stress-associated proteins, including C/EBP homologous protein (CHOP) and glucose-regulated protein 78, the cleavage of X-box binding protein-1 and activating transcription factor 6α, and the phosphorylation of eukaryotic initiation factor-2α and mitogen-activated protein kinases, such as p38, JNK, and ERK. Knock-down of CHOP expression by siRNA transfection and specific inhibitors of p38 (SB203580), JNK (SP600125), and ERK (PD98059) as well as anti-oxidant (N-acetylcysteine) reduced TG- or BFA-induced cell death. Baicalein also reduced TG- and BFA-induced ROS accumulation and MMP reduction. Taken together, these results suggest that baicalein could protect HT22 neuronal cells against ER stress-induced apoptosis by reducing CHOP induction as well as ROS accumulation and mitochondrial damage. PMID:20959717

  9. The Cytotoxicity of the Ajoene Analogue BisPMB in WHCO1 Oesophageal Cancer Cells Is Mediated by CHOP/GADD153

    Directory of Open Access Journals (Sweden)

    Vuyolwethu Siyo

    2017-05-01

    Full Text Available Garlic is a food and medicinal plant that has been used in folk medicine since ancient times for its beneficial health effects, which include protection against cancer. Crushed garlic cloves contain an array of small sulfur-rich compounds such as ajoene. Ajoene is able to interfere with biological processes and is cytotoxic to cancer cells in the low micromolar range. BisPMB is a synthetic ajoene analogue that has been shown in our laboratory to have superior cytotoxicity to ajoene. In the current study we have performed a DNA microarray analysis of bisPMB-treated WHCO1 oesophageal cancer cells to identify pathways and processes that are affected by bisPMB. The most significantly enriched biological pathways as assessed by gene ontology, KEGG and ingenuity pathway analysis were those involving protein processing in the endoplasmic reticulum (ER and the unfolded protein response. In support of these pathways, bisPMB was found to inhibit global protein synthesis and lead to increased levels of ubiquitinated proteins. BisPMB also induced alternate splicing of the transcription factor XBP-1; increased the expression of the ER stress sensor GRP78 and induced expression of the ER stress marker CHOP/GADD153. CHOP expression was found to be central to the cytotoxicity of bisPMB as its silencing with siRNA rendered the cells resistant to bisPMB. The MAPK proteins, JNK and ERK1/2 were activated following bisPMB treatment. However JNK activation was not critical in the cytotoxicity of bisPMB, and ERK1/2 activation was found to play a pro-survival role. Overall the ajoene analogue bisPMB appears to induce cytotoxicity in WHCO1 cells by activating the unfolded protein response through CHOP/GADD153.

  10. Effect of porcine somatotropin, stress susceptibility, and final end point of cooking on the sensory, physical, and chemical properties of pork loin chops.

    Science.gov (United States)

    Boles, J A; Parrish, F C; Skaggs, C L; Christian, L L

    1991-07-01

    Forty-eight pigs of three known stress susceptibility classes were injected daily with porcine somatotropin (pST; 4 mg/d) or a placebo. Each pig was injected in the neck once daily until taken off test, starting when the pigs weighed 59 kg. The pST treatment was terminated at weekly intervals when individual pigs reached 109 kg, but animals continued to be fed for six additional days to allow for required withdrawal time. The effect of pST and stress classification on the sensory, physical, and chemical characteristics of pork chops was observed. Also, the effect of two end-point temperatures (71 and 77 degrees C) on the sensory attributes was observed. The pST treatment of animals resulted in a small but significant decrease in panel scores for tenderness, juiciness, and flavor. Stress susceptibility class, however, decreased panel scores for tenderness only. The pST treatment reduced intramuscular fat and increased moisture in the longissimus muscle, but stress susceptibility class had no effect on proximate composition. The pST treatment and stress susceptibility decreased and increased Hunter L values of chops, respectively, indicating darker and lighter colors, respectively. Furthermore, a greater end-point temperature reduced sensory scores for tenderness and juiciness. These results suggest that pST treatment does not cause an increased incidence of pale, soft, exudative muscle. Also, the use of a lower temperature of end-point doneness (71 degrees C) should be implemented to optimize palatability of broiled pork chops regardless of pST treatment.

  11. Prognostic significances of overexpression MYC and/or BCL2 in R-CHOP-treated diffuse large B-cell lymphoma: A Systematic review and meta-analysis.

    Science.gov (United States)

    Li, Lu; Li, Yanyan; Que, Ximei; Gao, Xue; Gao, Qian; Yu, Mingxing; Ma, Kaili; Xi, Yanfeng; Wang, Tong

    2018-04-19

    Numerous studies have investigated the prognostic values of MYC and/or BCL2 protein overexpression in diffuse large B-cell lymphoma (DLBCL). However, the results still demonstrate discrepancies among different studies. We aimed to do a systematic review and meta-analysis on the relationships between overexpression MYC and/or BCL2 and DLBCLs treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). This study followed the guidelines of PRISMA and Cochrane handbook. The hazard ratios (HRs) for overall survival (OS) were pooled to estimate the main effect size. Twenty studies recruited a total of 5576 patients were available for this meta-analysis. The results showed that MYC (HR = 1.96, 95%CI (confidence interval) = 1.69-2.27)without heterogeneity(I 2  = 17.2%, P = 0.280), BCL2 (HR = 1.65, 95%CI = 1.43-1.89, I 2  = 20.7%, P = 0.234) protein overexpression, and co-overexpression (HR = 2.58, 95%CI = 2.19-3.04, I 2  = 17.2%, P = 0.275) had a poor prognosis in R-CHOP treated DLBCL patients, respectively. The current analysis indicated that MYC and/or BCL2 protein overexpression, and particularly co-overexpression was related to short overall survival in R-CHOP treated DLBCL patients, showing that application of the two new biomarkers can help to better stratify DLBCL patients and guide targeted treatment.

  12. Carriers of aVEGFAenhancer polymorphism selectively binding CHOP/DDIT3 are predisposed to increased circulating levels of thyroid-stimulating hormone.

    Science.gov (United States)

    Ahluwalia, Tarunveer Singh; Troelsen, Jesper Thorvald; Balslev-Harder, Marie; Bork-Jensen, Jette; Thuesen, Betina Heinsbæk; Cerqueira, Charlotte; Linneberg, Allan; Grarup, Niels; Pedersen, Oluf; Hansen, Torben; Dalgaard, Louise Torp

    2017-03-01

    Levels of serum thyroid-stimulating hormone (TSH) indicate thyroid function, because thyroid hormone negatively controls TSH release. Genetic variants in the vascular endothelial growth factor A ( VEGFA ) gene are associated with TSH levels. The aim of this study was to characterise the association of VEGFA variants with TSH in a Danish cohort and to identify and characterise functional variants. We performed an association study of the VEGFA locus for circulating TSH levels in 8445 Danish individuals. Lead variants were tested for allele-specific effects in vitro using luciferase reporter and gel-shift assays. Four SNPs in VEGFA were associated with circulating TSH (rs9472138, rs881858, rs943080 and rs4711751). For rs881858, the presence of each G-allele was associated with a corresponding decrease in TSH levels of 2.3% (p=8.4×10 -9 ) and an increase in circulating free T4 levels (p=0.0014). The SNP rs881858 is located in a binding site for CHOP (C/EBP homology protein) and c/EBPβ (ccaat enhancer binding protein β). Reporter-gene analysis showed increased basal enhancer activity of the rs881858 A-allele versus the G-allele (34.5±9.9% (average±SEM), p=0.0012), while co-expression of CHOP effectively suppressed the rs881858 A-allele activity. The A-allele showed stronger binding to CHOP in gel-shift assays. VEGF is an important angiogenic signal required for tissue expansion. We show that VEGFA variation giving allele-specific response to transcription factors with overlapping binding sites associate closely with circulating TSH levels. Because CHOP is induced by several types of intracellular stress, this indicates that cellular stress could be involved in the normal or pathophysiological response of the thyroid to TSH. NCT00289237, NCT00316667; Results. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  13. Treatment of multicentric or cranial mediastinal high-grade T-cell lymphoma in dogs with a first-line CCNU-L(-chlorambucil)-CHOP protocol

    OpenAIRE

    Ossowska, M.; Teske, E.; Beirens-Van Kuijk, L.; Zandvliet, Maurice; De Vos, J. P.

    2016-01-01

    This retrospective study determined disease free survival (DFS) and progression free survival (PFS) in chemo-naïve dogs with multicentric or cranial mediastinal high-grade T-cell lymphoma, treated with a first-line CCNU-L(-chlorambucil)-CHOP protocol. Of thirteen dogs with multicentric lymphoma, 92.3% achieved a complete remission (CR), and the median DFS and PFS was 317 and 256 days, respectively. Three dogs had cranial mediastinal lymphoma, and achieved a CR with a median DFS and PFS of 978...

  14. Bullet Design and Fabrication of Dual Mode Pyroelectric Sensor: High Sensitive Energymeter for Nd: YAG Laser and Detector for Chopped He-Ne Laser

    Directory of Open Access Journals (Sweden)

    S. SATAPATHY

    2008-05-01

    Full Text Available Pyroelectric sensor using TGS has been designed and fabricated which can be operated in laser energy meter mode as well as pyroelectric detector mode. The amplifying circuit configuration has very good signal to noise ratio, very high input impedance and low drift. The pyroelectric sensor has been tested using Q-switched Nd: YAG laser and chopped He-Ne laser. The sensitivity of pyroelectric sensor in energymeter mode is 421.7V/J and the voltage responsivity of the pyroelectric sensor is 3.27 V/W in detector mode.

  15. Assessment of different dietary fibers (tomato fiber, beet root fiber, and inulin) for the manufacture of chopped cooked chicken products.

    Science.gov (United States)

    Cava, Ramón; Ladero, Luis; Cantero, V; Rosario Ramírez, M

    2012-04-01

    Three dietary fibers (tomato fiber [TF], beet root fiber [BRF], and inulin) at 3 levels of addition (1%, 2%, and 3%) were assessed for the manufacture of chopped, cooked chicken products and compared with a control product without fiber added. The effect of fiber incorporation on (i) batters, (ii) cooked (30 min at 70 °C), and (iii) cooked and stored (for 10 d at 4 °C) chicken products were studied. The addition of the fiber to chicken meat products reduced the pH of chicken batters in proportional to the level of fiber addition. Fiber incorporation increased water-holding capacity but only the addition of TF reduced cook losses. The color of batters and cooked products was significantly modified by the type and level of fiber added. These changes were more noticeable when TF was added. Texture parameters were affected by the incorporation of TF and BRF; they increased the hardness in proportional to the level of addition. The addition of tomato and BRF to chicken meat products reduced lipid oxidation processes. These changes were dependent on the level of fiber added. The reduction of lipid oxidation processes was more marked in TF meat products than in products with other types of fibers. In contrast, the addition level of inulin increased TBA-RS numbers in chicken meat products. Although the addition of TF increased the redness of the meat products, the use of this fiber was more suitable as it reduced the extent of lipid oxidation processes. INDUSTRIAL APPLICATION: Nowadays, the reduction of fat and the increase of fiber content in meat products is one of the main goals of meat industry. Numerous sources of fiber can be added to the meat products; however, before that it is necessary to study their technological effect on raw and cooked meat products in order to evaluate their suitability for meat products manufacture. In addition, some of them could have beneficial effect on meat products conservation that could also increase their shelf life. © 2012

  16. The revised International Prognostic Index (R-IPI) is a better predictor of outcome than the standard IPI for patients with diffuse large B-cell lymphoma treated with R-CHOP.

    Science.gov (United States)

    Sehn, Laurie H; Berry, Brian; Chhanabhai, Mukesh; Fitzgerald, Catherine; Gill, Karamjit; Hoskins, Paul; Klasa, Richard; Savage, Kerry J; Shenkier, Tamara; Sutherland, Judy; Gascoyne, Randy D; Connors, Joseph M

    2007-03-01

    Diffuse large B-cell lymphoma (DLBCL) is a heterogeneous entity, with patients exhibiting a wide range of outcomes. The addition of rituximab to CHOP chemotherapy (R-CHOP)has led to a marked improvement in survival and has called into question the significance of previously recognized prognostic markers. Since randomized controlled trials of R-CHOP in DLBCL have included select subgroups of patients, the utility of the International Prognostic Index (IPI) has not been reassessed. We performed a retrospective analysis of patients with DLBCL treated with R-CHOP in the province of British Columbia to assess the value of the IPI in the era of immunochemotherapy. The IPI remains predictive, but it identifies only 2 risk groups. Redistribution of the IPI factors into a revised IPI (R-IPI) provides a more clinically useful prediction of outcome. The R-IPI identifies 3 distinct prognostic groups with a very good (4-year progression-free survival [PFS] 94%, overall survival [OS] 94%), good (4-year PFS 80%, OS 79%), and poor (4-year PFS 53%, OS 55%) outcome, respectively (P IPI (or R-IPI) no longer identifies a risk group with less than a 50% chance of survival. In the era of R-CHOP treatment, the R-IPI is a clinically useful prognostic index that may help guide treatment planning and interpretation of clinical trials.

  17. Disease modeling and lentiviral gene transfer in patient-specific induced pluripotent stem cells from late-onset Pompe disease patient

    Directory of Open Access Journals (Sweden)

    Yohei Sato

    Full Text Available Pompe disease is an autosomal recessive inherited metabolic disease caused by deficiency of acid α-glucosidase (GAA. Glycogen accumulation is seen in the affected organ such as skeletal muscle, heart, and liver. Hypertrophic cardiomyopathy is frequently seen in the infantile onset Pompe disease. On the other hand, cardiovascular complication of the late-onset Pompe disease is considered as less frequent and severe than that of infantile onset. There are few investigations which show cardiovascular complication of late onset Pompe disease due to the shortage of appropriate disease model. We have generated late-onset Pompe disease-specific induced pluripotent stem cell (iPSC and differentiated them into cardiomyocytes. Differentiated cardiomyocyte shows glycogen accumulation and lysosomal enlargement. Lentiviral GAA rescue improves GAA enzyme activity and glycogen accumulation in iPSC. The efficacy of gene therapy is maintained following the cardiomyocyte differentiation. Lentiviral GAA transfer ameliorates the disease-specific change in cardiomyocyote. It is suggested that Pompe disease iPSC-derived cardiomyocyte is replicating disease-specific changes in the context of disease modeling, drug screening, and cell therapy.

  18. Induction of SerpinB2 and Th1/Th2 modulation by SerpinB2 during lentiviral infections in vivo.

    Directory of Open Access Journals (Sweden)

    Lee D Major

    Full Text Available SerpinB2, also known as plasminogen activator inhibitor type 2, is a major product of activated monocytes/macrophages and is often strongly induced during infection and inflammation; however, its physiological function remains somewhat elusive. Herein we show that SerpinB2 is induced in peripheral blood mononuclear cells following infection of pigtail macaques with CCR5-utilizing (macrophage-tropic SIVmac239, but not the rapidly pathogenic CXCR4-utilizing (T cell-tropic SHIVmn229. To investigate the role of SerpinB2 in lentiviral infections, SerpinB2(-/- mice were infected with EcoHIV, a chimeric HIV in which HIV gp120 has been replaced with gp80 from ecotropic murine leukemia virus. EcoHIV infected SerpinB2(-/- mice produced significantly lower anti-gag IgG1 antibody titres than infected SerpinB2(+/+ mice, and showed slightly delayed clearance of EcoHIV. Analyses of published microarray studies showed significantly higher levels of SerpinB2 mRNA in monocytes from HIV-1 infected patients when compared with uninfected controls, as well as a significant negative correlation between SerpinB2 and T-bet mRNA levels in peripheral blood mononuclear cells. These data illustrate that SerpinB2 can be induced by lentiviral infection in vivo and support the emerging notion that a physiological role of SerpinB2 is modulation of Th1/Th2 responses.

  19. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    Science.gov (United States)

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  20. CD4(+) tumor infiltrating lymphocytes are prognostic and independent of R-IPI in patients with DLBCL receiving R-CHOP chemo-immunotherapy.

    Science.gov (United States)

    Keane, Colm; Gill, Devinder; Vari, Frank; Cross, Donna; Griffiths, Lynn; Gandhi, Maher

    2013-04-01

    Despite the Revised International Prognostic Index's (R-IPI) undoubted utility in diffuse large B-cell lymphoma (DLBCL), significant clinical heterogeneity within R-IPI categories persists. Emerging evidence indicates that circulating host immunity is a robust and R-IPI independent prognosticator, most likely reflecting the immune status of the intratumoral microenvironment. We hypothesized that direct quantification of immunity within lymphomatous tissue would better permit stratification within R-IPI categories. We analyzed 122 newly diagnosed consecutive DLBCL patients treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemo-immunotherapy. Median follow-up was 4 years. As expected, the R-IPI was a significant predictor of outcome with 5-year overall survival (OS) 87% for very good, 87% for good, and 51% for poor-risk R-IPI scores (P IPI and LMR. Importantly, within very good/good R-IPI patients, CD4(+) T-cells still distinguished patients with different 5 year OS (high 96% versus low 63%, P = 0.02). These results illustrate the importance of circulating and local intratumoral immunity in DLBCL treated with R-CHOP. Copyright © 2013 Wiley Periodicals, Inc.

  1. Chopped basalt fibres: A new perspective in reinforcing poly(lactic acid to produce injection moulded engineering composites from renewable and natural resources

    Directory of Open Access Journals (Sweden)

    P. Tamas

    2013-02-01

    Full Text Available This paper focuses on the reinforcing of Poly(lactic acid with chopped basalt fibres by using silane treated and untreated basalt fibres. Composite materials with 5–10–15–20–30–40 wt% basalt fibre contents were prepared from silane sized basalt fibres using extrusion, and injection moulding, while composites with 5–10–15 wt% basalt fibre contents were also prepared by using untreated basalt fibres as control. The properties of the injection moulded composites were extensively examined by using quasi-static (tensile, three-point bending and dynamic mechanical tests (notched and unnotched Charpy impact tests, dynamic mechanical analysis (DMA, differential scanning calorimetry (DSC, heat deflection temperature (HDT analysis, dimensional stability test, as well as melt flow index (MFI analysis and scanning electron microscopic (SEM observations. It was found that silane treated chopped basalt fibres are much more effective in reinforcing Poly(lactic acid than natural fibres; although basalt fibres are not biodegradable but they are still considered as natural (can be found in nature in the form of volcanic rocks and biologically inert. It is demonstrated in this paper that by using basalt fibre reinforcement, a renewable and natural resource based composite can be produced by injection moulding with excellent mechanical properties suitable even for engineering applications. Finally it was shown that by using adequate drying of the materials, composites with higher mechanical properties can be achieved compared to literature data.

  2. Factors Affecting Detection of Hepatitis E Virus on Canadian Retail Pork Chops and Pork Livers Assayed Using Real-Time RT-PCR.

    Science.gov (United States)

    Wilhelm, B J; Leblanc, D; Avery, B; Pearl, D L; Houde, A; Rajić, A; McEwen, S A

    2016-03-01

    We collected 599 Canadian retail pork chops and 283 pork livers routinely (usually weekly) from April 2011 to March 2012 using the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) retail sampling platform. Samples were assayed using validated real-time (q) reverse transcriptase polymerase chain reaction (RT-PCR) and nested classical RT-PCR for the detection of hepatitis E virus (HEV), porcine enteric calicivirus (PEC) and rotavirus (RV). The presence of Escherichia coli, Salmonella spp. and Campylobacter spp. was measured on a subset of our samples. Exact logistic regression models were fitted for predictors for HEV detection, for each assay. For both assays, sample type (pork chop versus liver) was a significant predictor for HEV RNA detection. For nested classical RT-PCR but not qRT-PCR, region of sample collection was a significant predictor (P = 0.008) of HEV detection. Odds of HEV detection were greatest in spring relative to other seasons. E. coli was a significant predictor for HEV RNA detection using the qRT-PCR (P = 0.03). Overall, the prevalence of E. coli, Salmonella spp. and Campylobacter spp. was significantly greater than HEV, PEC or RV on our retail pork samples. Our sparse data set for the detection of PEC and RV precluded modelling of risk factors for the detection of these viruses. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

  3. Nucleoporin NUP153 phenylalanine-glycine motifs engage a common binding pocket within the HIV-1 capsid protein to mediate lentiviral infectivity.

    Directory of Open Access Journals (Sweden)

    Kenneth A Matreyek

    Full Text Available Lentiviruses can infect non-dividing cells, and various cellular transport proteins provide crucial functions for lentiviral nuclear entry and integration. We previously showed that the viral capsid (CA protein mediated the dependency on cellular nucleoporin (NUP 153 during HIV-1 infection, and now demonstrate a direct interaction between the CA N-terminal domain and the phenylalanine-glycine (FG-repeat enriched NUP153 C-terminal domain (NUP153(C. NUP153(C fused to the effector domains of the rhesus Trim5α restriction factor (Trim-NUP153(C potently restricted HIV-1, providing an intracellular readout for the NUP153(C-CA interaction during retroviral infection. Primate lentiviruses and equine infectious anemia virus (EIAV bound NUP153(C under these conditions, results that correlated with direct binding between purified proteins in vitro. These binding phenotypes moreover correlated with the requirement for endogenous NUP153 protein during virus infection. Mutagenesis experiments concordantly identified NUP153(C and CA residues important for binding and lentiviral infectivity. Different FG motifs within NUP153(C mediated binding to HIV-1 versus EIAV capsids. HIV-1 CA binding mapped to residues that line the common alpha helix 3/4 hydrophobic pocket that also mediates binding to the small molecule PF-3450074 (PF74 inhibitor and cleavage and polyadenylation specific factor 6 (CPSF6 protein, with Asn57 (Asp58 in EIAV playing a particularly important role. PF74 and CPSF6 accordingly each competed with NUP153(C for binding to the HIV-1 CA pocket, and significantly higher concentrations of PF74 were needed to inhibit HIV-1 infection in the face of Trim-NUP153(C expression or NUP153 knockdown. Correlation between CA mutant viral cell cycle and NUP153 dependencies moreover indicates that the NUP153(C-CA interaction underlies the ability of HIV-1 to infect non-dividing cells. Our results highlight similar mechanisms of binding for disparate host factors

  4. Optimization of rituximab for the treatment of DLBCL (I): dose-dense rituximab in the DENSE-R-CHOP-14 trial of the DSHNHL.

    Science.gov (United States)

    Murawski, N; Pfreundschuh, M; Zeynalova, S; Poeschel, V; Hänel, M; Held, G; Schmitz, N; Viardot, A; Schmidt, C; Hallek, M; Witzens-Harig, M; Trümper, L; Rixecker, T; Zwick, C

    2014-09-01

    To improve outcome of elderly patients with diffuse large B-cell lymphoma, dose-dense rituximab was evaluated in the prospective DENSE-R-CHOP-14 trial. Rituximab (375 mg/m(2)) was given on days 0, 1, 4, 8, 15, 22, 29, 43, 57, 71, 85, and 99 together with six CHOP-14 cycles. Results were to be compared with patients who had received the same chemotherapy in combination with eight 2-week applications of rituximab in RICOVER-60. One hundred twenty-four patients are assessable. Dose-dense rituximab resulted in considerably higher serum levels during the first 50 days of treatment, but rituximab exposure time was not prolonged. Grade 3 and 4 infections were exceptionally high in the first 20 patients without anti-infective prophylaxis, but decreased after introduction of prophylaxis with aciclovir and cotrimoxazole in the remaining 104 patients (from 13% to 6% per cycle and from 35% to 18% per patient; P = 0.007 and P = 0.125, respectively). Patients with international prognostic index = 3-5 had higher complete response/complete response unconfirmed rates (82% versus 68%; P = 0.033) than in the respective RICOVER-60 population, but this did not translate into better long-term outcome, even though male hazard was decreased (event-free survival: from 1.5 to 1.1; progression-free survival: from 1.7 to 1.1; overall survival: from 1.4 to 1.0). Dose-dense rituximab achieved higher rituximab serum levels, but was not more effective than eight 2-week applications in the historical control population, even though minor improvements in poor-prognosis and male patients cannot be excluded. The increased, though manageable toxicity, precludes its use in routine practice. Our results strongly support anti-infective prophylaxis with aciclovir and cotrimoxazole for all patients receiving R-CHOP. © The Author 2014. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  5. Lentiviral vectors containing mouse Csf1r control elements direct macrophage-restricted expression in multiple species of birds and mammals

    Science.gov (United States)

    Pridans, Clare; Lillico, Simon; Whitelaw, Bruce; Hume, David A

    2014-01-01

    The development of macrophages requires signaling through the lineage-restricted receptor Csf1r. Macrophage-restricted expression of transgenic reporters based upon Csf1r requires the highly conserved Fms-intronic regulatory element (FIRE). We have created a lentiviral construct containing mouse FIRE and promoter. The lentivirus is capable of directing macrophage-restricted reporter gene expression in mouse, rat, human, pig, cow, sheep, and even chicken. Rat bone marrow cells transduced with the lentivirus were capable of differentiating into macrophages expressing the reporter gene in vitro. Macrophage-restricted expression may be desirable for immunization or immune response modulation, and for gene therapy for lysosomal storage diseases and some immunodeficiencies. The small size of the Csf1r transcription control elements will allow the insertion of large “cargo” for applications in gene therapy and vaccine delivery. PMID:26015955

  6. Integrated Method for Purification and Single-Particle Characterization of Lentiviral Vector Systems by Size Exclusion Chromatography and Tunable Resistive Pulse Sensing.

    Science.gov (United States)

    Heider, Susanne; Muzard, Julien; Zaruba, Marianne; Metzner, Christoph

    2017-07-01

    Elements derived from lentiviral particles such as viral vectors or virus-like particles are commonly used for biotechnological and biomedical applications, for example in mammalian protein expression, gene delivery or therapy, and vaccine development. Preparations of high purity are necessary in most cases, especially for clinical applications. For purification, a wide range of methods are available, from density gradient centrifugation to affinity chromatography. In this study we have employed size exclusion columns specifically designed for the easy purification of extracellular vesicles including exosomes. In addition to viral marker protein and total protein analysis, a well-established single-particle characterization technology, termed tunable resistive pulse sensing, was employed to analyze fractions of highest particle load and purity and characterize the preparations by size and surface charge/electrophoretic mobility. With this study, we propose an integrated platform combining size exclusion chromatography and tunable resistive pulse sensing for monitoring production and purification of viral particles.

  7. 9 CFR 319.105 - “Ham patties,” “Chopped ham,” “Pressed ham,” “Spiced ham,” and similar products.

    Science.gov (United States)

    2010-01-01

    ... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Cured Meats, Unsmoked and Smoked § 319.105 “Ham patties,” “Chopped ham... of cured pork product Minimum meat PFF percentage 1 Product name and qualifying statements “Ham...

  8. Effect of R-CHOP chemotherapy on liver and mediastinal blood pool (18)F-FDG standardized uptake values in patients with non-Hodgkin's lymphoma.

    Science.gov (United States)

    Kaya, Bugra; Dostbil, Zeki; Ismailoglu, Murat; Tasdemir, Bekir; Sahin, Ozlem

    2015-01-01

    We aimed to investigate the impact of chemotherapy on (18)F-FDG uptake in the liver and mediastinal blood pool (MBP) among patients with non-Hodgkin's lymphoma. Twenty-three patients with NHL underwent baseline, interim, and postchemotherapy (18)F-FDG PET/CT. SUVmax and SUVmean values of the liver and MBP at imaging time were compared statistically. We did not find any significant differences between the liver and mediastinum SUVmean and SUVmax values (P>.05). Our study demonstrates that the (18)F-FDG uptake in the liver and MBP are not significantly affected by R-CHOP chemotherapy in patients with NHL. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. MDM2 phenotypic and genotypic profiling, respective to TP53 genetic status, in diffuse large B-cell lymphoma patients treated with rituximab-CHOP immunochemotherapy

    DEFF Research Database (Denmark)

    Xu-Monette, Zijun Y; Møller, Michael B; Tzankov, Alexander

    2013-01-01

    , cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (R-CHOP) chemotherapy, we assessed MDM2 and p53 expression by immunohistochemistry (n = 478), MDM2 gene amplification by fluorescence in situ hybridization (n = 364), and a single nucleotide polymorphism in the MDM2 promoter, SNP309, by SNP...... survival in patients with mutated p53. Variable p53 activities may ultimately determine the survival differences, as suggested by the gene expression profiling analysis. MDM2 amplification was observed in 3 of 364 (0.8%) patients with high MDM2 expression. The presence of SNP309 did not correlate with MDM2......MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically-defined large cohort of de novo DLBCL patients treated with rituximab...

  10. Immortalization and Characterization of Porcine Macrophages That Had Been Transduced with Lentiviral Vectors Encoding the SV40 Large T Antigen and Porcine Telomerase Reverse Transcriptase

    Directory of Open Access Journals (Sweden)

    Takato Takenouchi

    2017-08-01

    Full Text Available The domestic pig is an important agricultural animal, and thus, infectious diseases that affect pigs can cause severe economic losses in the global swine industry. Various porcine pathogens target macrophages, which are classical innate immune cells. Although macrophages basically protect the host from pathogens, they also seem to contribute to infectious processes. Therefore, cultured macrophages can be used to develop in vitro models for studying not only genes associated with porcine innate immunity but also the infectious processes of porcine pathogens. However, the availability of porcine macrophage cell lines is limited. In this study, we describe a novel immortalized porcine kidney-derived macrophage (IPKM cell line, which was generated by transferring the SV40 large T antigen (SV40LT and porcine telomerase reverse transcriptase (pTERT genes into primary porcine kidney-derived macrophages using lentiviral vectors. The IPKM displayed a typical macrophage morphology and was routinely passaged (doubling time: about 4 days. These cells were immunostained for macrophage markers. In addition, they exhibited substantial phagocytosis of polystyrene microbeads and released inflammatory cytokines upon lipopolysaccharide (LPS stimulation. Furthermore, the maturation and secretion of interleukin-1β were observed after nigericin-induced inflammasome activation in LPS-primed IPKM. These findings suggest that IPKM exhibit the typical inflammatory characteristics of macrophages. By transferring the SV40LT and pTERT genes using lentiviral vectors, we also successfully immortalized macrophages derived from the peripheral blood of a low-density lipoprotein receptor-deficient pig. These results suggest that the co-expression of SV40LT and pTERT is an effective way of immortalizing porcine macrophages.

  11. Targeting both viral and host determinants of human immunodeficiency virus entry, using a new lentiviral vector coexpressing the T20 fusion inhibitor and a selective CCL5 intrakine.

    Science.gov (United States)

    Petit, Nicolas; Dorgham, Karim; Levacher, Béatrice; Burlion, Aude; Gorochov, Guy; Marodon, Gilles

    2014-08-01

    Numerous strategies targeting early and late steps of the HIV life cycle have been proposed for gene therapy. However, targeting viral and host determinants of HIV entry is the only strategy that would prevent viral DNA-mediated CD4(+) cell death while diminishing the possibility for the virus to escape. To this end, we devised a bicistronic lentiviral vector expressing the membrane-bound form of the T20 fusion inhibitor, referred to as the C46 peptide, and a CCR5 superagonist, modified to sequester CCR5 away from the cell surface, referred to as the P2-CCL5 intrakine. We tested the effects of the vector on HIV infection and replication, using the human CEMR5 cell line expressing CD4 and CCR5, and primary human T cells. Transduced cells expressed the C46 peptide, detected with the 2F5 monoclonal antibody by flow cytometry. Expression of the P2-CCL5 intrakine correlates with lower levels of cell surface CCR5. Complete protection against HIV infection could be observed in cells expressing the protective transgenes. Importantly, we show that the combination of the transgenes was more potent than either transgene alone, showing the interest of expressing two entry inhibitors to inhibit HIV infection. Last, genetically modified cells possessed a selective advantage over nonmodified cells on HIV challenge in vitro, showing that modified cells were protected from HIV-induced cell death. Our results demonstrate that lentiviral vectors coexpressing the T20 fusion inhibitor and the P2-CCL5 intrakine represent promising tools for HIV gene therapy.

  12. Design and test of a novel cost-effective piezo driven actuator with a two-stage flexure amplifier for chopping mirrors

    Science.gov (United States)

    Wu, Qingguo; Yang, Dehua; Li, Aihua; Zhou, Guohua; Yang, Bintang

    2012-09-01

    A fast chopping secondary mirror is the critical functioning assembly in an astronomical telescope for infrared observation. Normally, a chopping mirror is driven by precision high-load and high-stiffness linear actuators which are expected to be lightweight, compact and further cost-effective. The stroke of the actuator is typically required to up to several hundred microns with typical load capacity up to several hundred Newtons. We developed a novel piezo-based prototype linear actuator with a two-stage rhombic flexure amplifier. In this paper, first we present the detail design scheme of the actuator by analytical calculations with comprehensive Finite Element Analysis (FEA) verification. Afterwards, we also present the procedures and results of tests of linearity, load capacity, eigenfrequency, stability and repeatability. The selected piezoelectric drive unit is a block of 35x10x10 mm3 with output force up to 4000 N. The two-stage displacement amplifier is simply integrated by two identical singular rhombic flexures orthogonally mounted together. Each stage, one rhombic flexure with a longer axis of 76 mm long, is designed with an ideal amplification ratio of 3, which leads to a final theoretical compound amplification ration of 9. In order to realize the basic triangular-amplification principle in a rhombic flexure, we introduced flexure joints at all the eight ends of its four edge bars. The singular rhombic flexures can be efficiently manufactured by electrical discharge wire-cutting process at a time in batch by being overlapped in layers. Afterwards we carried out related measurements to test its performance.

  13. Expression of BAFF-R, but not BAFF, is an independent prognostic factor in diffuse large B-cell lymphoma patients treated with R-CHOP.

    Science.gov (United States)

    Wang, Yu; Li, Ya-Jun; Jiang, Wen-Qi; Rao, Hui-Lan; Huang, Jia-Jia; Xia, Yi; Bi, Xiwen; Sun, Peng; Huang, Hui-Qiang; Lin, Tong-Yu; Guan, Zhong-Zhen; Li, Zhi-Ming

    2015-11-01

    B-cell activating factor (BAFF) and BAFF-receptor (BAFF-R) play crucial roles in the progression of malignant B-cells. The aim of the present study was to evaluate the expression profiles and the clinical significance of BAFF and BAFF-R in diffuse large B-cell lymphoma (DLBCL). Paraffin-embedded specimens from 136 patients with newly diagnosed DLBCL, treated with rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone chemotherapy (R-CHOP), were examined for BAFF and BAFF-R expression by immunohistochemistry. BAFF and BAFF-R were expressed in 72.1 % (98/136) and 47.1 % (64/136) of the DLBCL tissues, respectively. Negative BAFF-R expression was significantly correlated with elevated serum lactate dehydrogenase (LDH) levels (P = 0.036), an International Prognostic Index (IPI) score of 2 or higher (P BAFF-R expression than in those with negative BAFF-R expression (73.4 vs. 56.9 %, P = 0.045). Negative expression of BAFF-R, but not of BAFF, was significantly associated with inferior progression-free survival (PFS; P = 0.020) and overall survival (OS; P = 0.028). Only negative BAFF-R expression was correlated with inferior PFS and OS in multivariate analysis (P = 0.049 and 0.040, respectively). Taken together, our results showed that the majority and approximate one-half of patients with DLBCL were positive for BAFF and BAFF-R, respectively. Negative expression of BAFF-R, but not of BAFF, could be an independent risk factor for PFS and OS in patients with DLBCL treated with standard R-CHOP.

  14. P38 MAPK expression and activation predicts failure of response to CHOP in patients with Diffuse Large B-Cell Lymphoma

    International Nuclear Information System (INIS)

    Vega, Gabriel G.; Avilés-Salas, Alejandro; Chalapud, J. Ramón; Martinez-Paniagua, Melisa; Pelayo, Rosana; Mayani, Héctor; Hernandez-Pando, Rogelio; Martinez-Maza, Otoniel; Huerta-Yepez, Sara; Bonavida, Benjamin; Vega, Mario I.

    2015-01-01

    The p38 MAPK is constitutively activated in B-NHL cell lines and regulates chemoresistance. Accordingly, we hypothesized that activated p38 MAPK may be associated with the in vivo unresponsiveness to chemotherapy in B-NHL patients. Tissue microarrays generated from eighty untreated patients with Diffused Large B Cell Lymphoma (DLBCL) were examined by immunohistochemistry for the expression of p38 and phospho p38 (p-p38) MAPK. In addition, both Bcl-2 and NF-κB expressions were determined. Kaplan Meier analysis was assessed. Tumor tissues expressed p38 MAPK (82 %) and p-p38 MAPK (30 %). Both p38 and p-p38 MAPK expressions correlated with the high score performance status. A significant correlation was found between the expression p-p38 and poor response to CHOP. The five year median follow-up FFS was 81 % for p38 − and 34 % for p38 + and for OS was 83 % for p38 − and 47 % for p38 + . The p-p38 + tissues expressed Bcl-2 and 90 % of p-p38 − where Bcl-2 − . The coexpression of p-p38 and Bcl-2 correlated with pool EFS and OS. There was no correlation between the expression of p-p38 and the expression of NF-κB. The findings revealed, for the first time, that a subset of patients with DLBCL and whose tumors expressed high p-p38 MAPK responded poorly to CHOP therapy and had poor EFS and OS. The expression of p38, p-p38, Bcl2 and the ABC subtype are significant risk factors both p38 and p-p38 expressions remain independent prognostic factors. The online version of this article (doi:10.1186/s12885-015-1778-8) contains supplementary material, which is available to authorized users

  15. Bortezomib sensitizes human osteosarcoma cells to adriamycin-induced apoptosis through ROS-dependent activation of p-eIF2α/ATF4/CHOP axis.

    Science.gov (United States)

    Xian, Miao; Cao, Handi; Cao, Ji; Shao, Xuejing; Zhu, Difeng; Zhang, Ning; Huang, Ping; Li, Weixu; Yang, Bo; Ying, Meidan; He, Qiaojun

    2017-09-01

    Osteosarcoma is the most common bone cancer, and chemotherapy is currently indispensable for its treatment. Adriamycin has been claimed to be the most effective agent for osteosarcoma, however, the outcome of adriamycin chemotherapy remains unsatisfactory. Here, we reported a potent combination therapy that bortezomib, a proteasome inhibitor, enhances adriamycin-induced apoptosis to eliminate osteosarcoma cells and we revealed that the activation of p-eIF2α/ATF4/CHOP axis is the underlying associated mechanisms. First, we observed that bortezomib enhances adriamycin-mediated inhibition of cell proliferation and enhances the apoptosis in osteosarcoma cell lines. Moreover, this drug combination produced more potent tumor-growth inhibitory effects in human osteosarcoma cell line KHOS/NP xenografts. Our study showed that reactive oxygen species (ROS) plays an important role in apoptosis induced by adriamycin plus bortezomib, whereas ROS scavenger NAC could almost completely block the apoptosis induced by the combination treatment. Meanwhile, p-eIF2α is remarkably elevated in the combination group. As a result, ATF4 exhibits strong activation which consequently induces the activation of CHOP and leads to the cell death. Finally, 13 primary osteosarcoma cells demonstrated potent response to the combination treatment. In a human osteosarcoma patient-derived xenograft (PDX) model, our finding suggests that when combined with bortezomib, a relatively low dose of adriamycin produced more potent tumor-growth inhibitory effects without increased toxicity. Thus, our findings not only provide a promising combination strategy to overcome osteosarcoma but also shed new light on the strategy of combining increased ROS and inhibited proteasome to open up new opportunities for the clinical development of chemotherapy regimens. © 2017 UICC.

  16. Real world data on young patients with high-risk diffuse large B-cell lymphoma treated with R-CHOP or R-CHOEP - MYC, BCL2 and BCL6 as prognostic biomarkers.

    Directory of Open Access Journals (Sweden)

    Mette Ølgod Pedersen

    Full Text Available Double expression of MYC and BCL2 proteins (DE and double-hit MYC+BCL2/BCL6 translocations (DH were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL by the 2016 revision of the World Health Organization classification of lymphoid neoplasms. Whether this applies to the subgroup of young patients with high risk DLBCL is not known. We previously found that in a uniform retrospective population-based cohort of patients aged 18-60 years with high-risk DLBCL, the addition of etoposide to R-CHOP chemotherapy (R-CHOEP resulted in improved survival mainly in patients with germinal center B-cell like (GCB immunophenotype. The aim of this study was to investigate the prognostic and predictive value of DE and DH in this patient cohort.Data on all young Danish patients diagnosed with de novo high-risk DLBCL 2004-2008 and treated with R-CHOP or R-CHOEP were obtained from the Danish Lymphoma database (n = 159. Tumor samples were available from 103 patients. MYC and BCL2 proteins were analyzed with quantitative immunohistochemistry (IHC using different cut off values. MYC-, BCL2- and BCL6-translocations were examined with fluorescent in situ hybridization (FISH.DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS in patients treated with R-CHOP but not R-CHOEP (p<0.001, also after exclusion of patients with DH. A predictive effect of DE for response (PFS to R-CHOEP vs. R-CHOP was almost significant (p = 0.07. DH was not prognostic in this patient cohort.In young patients with high-risk DLBCL, treatment with R-CHOEP may overcome the negative prognostic impact of DE observed in patients treated with R-CHOP.

  17. Rolado de fachinales y calidad de suelos en el Chaco occidental, Argentina Roller-chopping of shrub-thickets and soil quality in the western Chaco, Argentina

    Directory of Open Access Journals (Sweden)

    Analía Anriquez

    2005-12-01

    significativo de sitio.In the western Chaco region the suitability for cow-calf operations of areas dominated by shrub thickets of Acacia, Celtis and Prosopis ('fachinales' is reduced because of their low carrying capacity and poor accessibility. Our objective was to assess the effect of practices commonly used to increase the standing forage of 'fachinales' on some indicators of soil quality (bulk density, total soil organic carbon, respiration, particulate organic carbon, microbial biomass carbon and dehydrogenase activity at three range sites of the Chaco region: upland, midland and bottom. The treatments applied were roller chopping, roller chopping plus seeding of Panicum maximum cv trichoglume cv Green panic, roller chopping followed by prescribed fire and controls. Bulk density, total soil organic carbon, particulate organic carbon and microbial biomass carbon were not altered by the treatments. A higher dehydrogenase activity was observed in the bottom site, irrespective of treatments, probably due to a greater soil water content. Soil respiration increased in the upland site in all treatments, probably because of the modification of soil microbial activity, attributable to the stimulation produced by the root exudates of green panic, native grasses and forbs that appeared after the treatments. In general, soil quality indicators were not significantly affected by the treatments used, a fact attributed to their 'low' intensity of application. However, there was a significant effect of range site.

  18. Baboon envelope pseudotyped lentiviral vectors efficiently transduce human B cells and allow active factor IX B cell secretion in vivo in NOD/SCIDγc-/-mice.

    Science.gov (United States)

    Levy, C; Fusil, F; Amirache, F; Costa, C; Girard-Gagnepain, A; Negre, D; Bernadin, O; Garaulet, G; Rodriguez, A; Nair, N; Vandendriessche, T; Chuah, M; Cosset, F-L; Verhoeyen, E

    2016-12-01

    Essentials B cells are attractive targets for gene therapy and particularly interesting for immunotherapy. A baboon envelope pseudotyped lentiviral vector (BaEV-LV) was tested for B-cell transduction. BaEV-LVs transduced mature and plasma human B cells with very high efficacy. BaEV-LVs allowed secretion of functional factor IX from B cells at therapeutic levels in vivo. Background B cells are attractive targets for gene therapy for diseases associated with B-cell dysfunction and particularly interesting for immunotherapy. Moreover, B cells are potent protein-secreting cells and can be tolerogenic antigen-presenting cells. Objective Evaluation of human B cells for secretion of clotting factors such as factor IX (FIX) as a possible treatment for hemophilia. Methods We tested here for the first time our newly developed baboon envelope (BaEV) pseudotyped lentiviral vectors (LVs) for human (h) B-cell transduction following their adaptive transfer into an NOD/SCIDγc -/- (NSG) mouse. Results Upon B-cell receptor stimulation, BaEV-LVs transduced up to 80% of hB cells, whereas vesicular stomatitis virus G protein VSV-G-LV only reached 5%. Remarkably, BaEVTR-LVs permitted efficient transduction of 20% of resting naive and 40% of resting memory B cells. Importantly, BaEV-LVs reached up to 100% transduction of human plasmocytes ex vivo. Adoptive transfer of BaEV-LV-transduced mature B cells into NOD/SCID/γc -/- (NSG) [non-obese diabetic (NOD), severe combined immuno-deficiency (SCID)] mice allowed differentiation into plasmablasts and plasma B cells, confirming a sustained high-level gene marking in vivo. As proof of principle, we assessed BaEV-LV for transfer of human factor IX (hFIX) into B cells. BaEV-LVs encoding FIX efficiently transduced hB cells and their transfer into NSG mice demonstrated for the first time secretion of functional hFIX from hB cells at therapeutic levels in vivo. Conclusions The BaEV-LVs might represent a valuable tool for therapeutic protein

  19. Hepatic lentiviral gene transfer prevents the long-term onset of hepatic tumours of glycogen storage disease type 1a in mice.

    Science.gov (United States)

    Clar, Julie; Mutel, Elodie; Gri, Blandine; Creneguy, Alison; Stefanutti, Anne; Gaillard, Sophie; Ferry, Nicolas; Beuf, Olivier; Mithieux, Gilles; Nguyen, Tuan Huy; Rajas, Fabienne

    2015-04-15

    Glycogen storage disease type 1a (GSD1a) is a rare disease due to the deficiency in the glucose-6-phosphatase (G6Pase) catalytic subunit (encoded by G6pc), which is essential for endogenous glucose production. Despite strict diet control to maintain blood glucose, patients with GSD1a develop hepatomegaly, steatosis and then hepatocellular adenomas (HCA), which can undergo malignant transformation. Recently, gene therapy has attracted attention as a potential treatment for GSD1a. In order to maintain long-term transgene expression, we developed an HIV-based vector, which allowed us to specifically express the human G6PC cDNA in the liver. We analysed the efficiency of this lentiviral vector in the prevention of the development of the hepatic disease in an original GSD1a mouse model, which exhibits G6Pase deficiency exclusively in the liver (L-G6pc(-/-) mice). Recombinant lentivirus were injected in B6.G6pc(ex3lox/ex3lox). SA(creERT2/w) neonates and G6pc deletion was induced by tamoxifen treatment at weaning. Magnetic resonance imaging was then performed to follow up the development of hepatic tumours. Lentiviral gene therapy restored glucose-6 phosphatase activity sufficient to correct fasting hypoglycaemia during 9 months. Moreover, lentivirus-treated L-G6pc(-/-) mice presented normal hepatic triglyceride levels, whereas untreated mice developed steatosis. Glycogen stores were also decreased although liver weight remained high. Interestingly, lentivirus-treated L-G6pc(-/-) mice were protected against the development of hepatic tumours after 9 months of gene therapy while most of untreated L-G6pc(-/-) mice developed millimetric HCA. Thus the treatment of newborns by recombinant lentivirus appears as an attractive approach to protect the liver from the development of steatosis and hepatic tumours associated to GSD1a pathology. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Multicistronic lentiviral vector-mediated striatal gene transfer of aromatic L-amino acid decarboxylase, tyrosine hydroxylase, and GTP cyclohydrolase I induces sustained transgene expression, dopamine production, and functional improvement in a rat model of Parkinson's disease.

    Science.gov (United States)

    Azzouz, Mimoun; Martin-Rendon, Enca; Barber, Robert D; Mitrophanous, Kyriacos A; Carter, Emma E; Rohll, Jonathan B; Kingsman, Susan M; Kingsman, Alan J; Mazarakis, Nicholas D

    2002-12-01

    Parkinson's disease (PD) is a neurodegenerative disorder characterized by the selective loss of dopaminergic neurons in the substantia nigra. This loss leads to complete dopamine depletion in the striatum and severe motor impairment. It has been demonstrated previously that a lentiviral vector system based on equine infectious anemia virus (EIAV) gives rise to highly efficient and sustained transduction of neurons in the rat brain. Therefore, a dopamine replacement strategy using EIAV has been investigated as a treatment in the 6-hydroxydopamine (6-OHDA) animal model of PD. A self-inactivating EIAV minimal lentiviral vector that expresses tyrosine hydroxylase (TH), aromatic amino acid dopa decarboxylase (AADC), and GTP cyclohydrolase 1 (CH1) in a single transcription unit has been generated. In cultured striatal neurons transduced with this vector, TH, AADC, and CH1 proteins can all be detected. After stereotactic delivery into the dopamine-denervated striatum of the 6-OHDA-lesioned rat, sustained expression of each enzyme and effective production of catecholamines were detected, resulting in significant reduction of apomorphine-induced motor asymmetry compared with control animals (p < 0.003). Expression of each enzyme in the striatum was observed for up to 5 months after injection. These data indicate that the delivery of three catecholaminergic synthetic enzymes by a single lentiviral vector can achieve functional improvement and thus open the potential for the use of this vector for gene therapy of late-stage PD patients.

  1. Optimization of Polycistronic Anti-CCR5 Artificial microRNA Leads to Improved Accuracy of Its Lentiviral Vector Transfer and More Potent Inhibition of HIV-1 in CD4⁺ T-Cells.

    Science.gov (United States)

    Urusov, Felix; Glazkova, Dina; Omelchenko, Denis; Bogoslovskaya, Elena; Tsyganova, Galina; Kersting, Katerina; Shipulin, German; Pokrovsky, Vadim

    2018-02-04

    C-C chemokine receptor type 5 (CCR5) is utilized by human immunodeficiency virus (HIV) as a co-receptor for cell entry. Suppression of the CCR5 gene by artificial microRNAs (amiRNAs) could confer cell resistance. In previous work, we created a lentivector that encoded the polycistron of two identical amiRNAs that could effectively suppress CCR5. However, tandem repeats in lentiviral vectors led to deletions of the repeated sequences during reverse transcription of the vector RNA. To solve this problem, we have created a new amiRNA against CCR5, mic1002, which has a different microRNA scaffold and targets a different sequence. Replacing one of the two identical tandem amiRNAs in the polycistron with the mic1002 amiRNA increased the accuracy of its lentiviral vector transfer while retaining its ability to effectively suppress CCR5. A lentiviral vector containing two heterogenic amiRNAs significantly inhibited HIV replication in a vector-transduced human CD4⁺ lymphocyte culture.

  2. Real world data on young patients with high-risk diffuse large B-cell lymphoma treated with R-CHOP or R-CHOEP - MYC, BCL2 and BCL6 as prognostic biomarkers

    DEFF Research Database (Denmark)

    Pedersen, Mette Ølgod; Gang, Anne Ortved; Brown, Peter

    2017-01-01

    BACKGROUND: Double expression of MYC and BCL2 proteins (DE) and double-hit MYC+BCL2/BCL6 translocations (DH) were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL) by the 2016 revision of the World Health Organization classification of lymphoid neoplasms......-CHOP or R-CHOEP were obtained from the Danish Lymphoma database (n = 159). Tumor samples were available from 103 patients. MYC and BCL2 proteins were analyzed with quantitative immunohistochemistry (IHC) using different cut off values. MYC-, BCL2- and BCL6-translocations were examined with fluorescent...... in situ hybridization (FISH). RESULTS: DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS) in patients treated with R-CHOP but not R-CHOEP (p

  3. Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Green, Tina M.; Jensen, Andreas K.; Holst, René

    2016-01-01

    We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...... models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B....... This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs...

  4. Straight and chopped dc performance data for a General Electric 5BT 2366C10 motor and an EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Performance data on the General Electric 5BT 2366C10 series wound dc motor and EV-1 Chopper Controller is supplied for the electric vehicle manufacturer. Data is provided for both straight and chopped dc input to the motor, at 2 motor temperature levels. Testing was done at 6 voltage increments to the motor, and 2 voltage increments to the controller. Data results are presented in both tabular and graphical forms. Tabular information includes motor voltage and current input data, motor speed and torque output data, power data and temperature data. Graphical information includes torque-speed, motor power output-speed, torque-current, and efficiency-speed plots under the various operating conditions. The data resulting from this testing shows the speed-torque plots to have the most variance with operating temperature. The maximum motor efficiency is between 86% and 87%, regardless of temperature or mode of operation. When the chopper is utilized, maximum motor efficiency occurs when the chopper duty cycle approaches 100%.

  5. Modified Lentiviral LTRs Allow Flp Recombinase–mediated Cassette Exchange and In Vivo Tracing of “Factor-free” Induced Pluripotent Stem Cells

    Science.gov (United States)

    Kuehle, Johannes; Turan, Soeren; Cantz, Tobias; Hoffmann, Dirk; Suerth, Julia D; Maetzig, Tobias; Zychlinski, Daniela; Klein, Christoph; Steinemann, Doris; Baum, Christopher; Bode, Juergen; Schambach, Axel

    2014-01-01

    Methods for generating induced pluripotent stem cells (iPSCs) for disease modeling and cell therapies have progressed from integrating vectors to transient delivery of reprogramming factors, avoiding permanent genomic modification. A major limitation of unmodified iPSCs is the assessment of their distribution and contribution to adverse reactions in autologous cell therapy. Here, we report that polycistronic lentiviral vectors with single Flp recombinase (Flp) recognition target (FRT) sites can be used to generate murine iPSCs that are devoid of the reprogramming cassette but carry an intergenic 300-bp long terminal repeat sequence. Performing quantitative polymerase chain reaction on this marker, we could determine genetic identity and tissue contribution of iPSC-derived teratomas in mice. Moreover, we generated iPSCs carrying heterospecific FRT twin sites, enabling excision and recombinase-mediated cassette exchange (RMCE) of the reprogramming cassette for another expression unit of choice. Following screening of iPSCs for “safe harbor” integration sites, expression cassettes were introduced by RMCE into various previously silenced loci of selected single-copy iPSCs. Analysis of DNA methylation showed that RMCE reverted the local epigenetic signature, which allowed transgene expression in undifferentiated iPSCs and in differentiated progeny. These findings support the concept of creating clonotypically defined exchangeable and traceable pluripotent stem cells for disease research and cell therapy. PMID:24434935

  6. Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Hiroko Kita-Matsuo

    Full Text Available Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes.Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and alpha-myosin heavy chain (alphaMHC promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function.The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications.

  7. LV305, a dendritic cell-targeting integration-deficient ZVex(TM)-based lentiviral vector encoding NY-ESO-1, induces potent anti-tumor immune response.

    Science.gov (United States)

    Albershardt, Tina Chang; Campbell, David James; Parsons, Andrea Jean; Slough, Megan Merrill; Ter Meulen, Jan; Berglund, Peter

    2016-01-01

    We have engineered an integration-deficient lentiviral vector, LV305, to deliver the tumor antigen NY-ESO-1 to human dendritic cells in vivo through pseudotyping with a modified Sindbis virus envelop protein. Mice immunized once with LV305 developed strong, dose-dependent, multifunctional, and cytotoxic NY-ESO-1-specific cluster of differentiation 8 (CD8) T cells within 14 days post-immunization and could be boosted with LV305 at least twice to recall peak-level CD8 T-cell responses. Immunization with LV305 protected mice against tumor growth in an NY-ESO-1-expressing CT26 lung metastasis model, with the protective effect abrogated upon depletion of CD8 T cells. Adoptive transfer of CD8 T cells, alone or together with CD4 T cells or natural killer cells, from LV305-immunized donor mice to tumor-bearing recipient mice conferred significant protection against metastatic tumor growth. Biodistribution of injected LV305 in mice was limited to the site of injection and the draining lymph node, and injected LV305 exhibited minimal excretion. Mice injected with LV305 developed little to no adverse effects, as evaluated by toxicology studies adherent to good laboratory practices. Taken together, these data support the development of LV305 as a clinical candidate for treatment against tumors expressing NY-ESO-1.

  8. LV305, a dendritic cell-targeting integration-deficient ZVexTM-based lentiviral vector encoding NY-ESO-1, induces potent anti-tumor immune response

    Science.gov (United States)

    Albershardt, Tina Chang; Campbell, David James; Parsons, Andrea Jean; Slough, Megan Merrill; ter Meulen, Jan; Berglund, Peter

    2016-01-01

    We have engineered an integration-deficient lentiviral vector, LV305, to deliver the tumor antigen NY-ESO-1 to human dendritic cells in vivo through pseudotyping with a modified Sindbis virus envelop protein. Mice immunized once with LV305 developed strong, dose-dependent, multifunctional, and cytotoxic NY-ESO-1-specific cluster of differentiation 8 (CD8) T cells within 14 days post-immunization and could be boosted with LV305 at least twice to recall peak-level CD8 T-cell responses. Immunization with LV305 protected mice against tumor growth in an NY-ESO-1-expressing CT26 lung metastasis model, with the protective effect abrogated upon depletion of CD8 T cells. Adoptive transfer of CD8 T cells, alone or together with CD4 T cells or natural killer cells, from LV305-immunized donor mice to tumor-bearing recipient mice conferred significant protection against metastatic tumor growth. Biodistribution of injected LV305 in mice was limited to the site of injection and the draining lymph node, and injected LV305 exhibited minimal excretion. Mice injected with LV305 developed little to no adverse effects, as evaluated by toxicology studies adherent to good laboratory practices. Taken together, these data support the development of LV305 as a clinical candidate for treatment against tumors expressing NY-ESO-1. PMID:27626061

  9. Development of Lentiviral Vectors Simultaneously Expressing Multiple siRNAs Against CCR5, vif and tat/rev Genes for an HIV-1 Gene Therapy Approach.

    Science.gov (United States)

    Spanevello, Francesca; Calistri, Arianna; Del Vecchio, Claudia; Mantelli, Barbara; Frasson, Chiara; Basso, Giuseppe; Palù, Giorgio; Cavazzana, Marina; Parolin, Cristina

    2016-04-19

    Gene therapy holds considerable promise for the functional cure of HIV-1 infection and, in this context, RNA interference (RNAi)-based approaches represent powerful strategies. Stable expression of small interfering RNAs (siRNAs) targeting HIV genes or cellular cofactors has the potential to render HIV-1 susceptible cells resistant to infection. To inhibit different steps of virus life cycle, self-inactivating lentiviral vectors expressing multiple siRNAs targeting the CCR5 cellular gene as well as vif and tat/rev viral transcripts, under the control of different RNA polymerase III promoters (U6, 7SK, H1) were developed. The use of a single RNA polymerase III promoter driving the expression of a sequence giving rise to three siRNAs directed against the selected targets (e-shRNA) was also investigated. Luciferase assay and inhibition of HIV-1 replication in human Jurkat T-cell line were adopted to select the best combination of promoter/siRNA. The efficacy of selected developed combinatorial vectors in interfering with viral replication was evaluated in human primary CD4(+) T lymphocytes. We identified two effective anti-HIV combinatorial vectors that conferred protection against R5- and X4- tropic viruses. Overall, our results showed that the antiviral effect is influenced by different factors, including the promoter used to express the RNAi molecules and the selected cassette combination. These findings contribute to gain further insights in the design of RNAi-based gene therapy approaches against HIV-1 for clinical application.

  10. A modular lentiviral and retroviral construction system to rapidly generate vectors for gene expression and gene knockdown in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Benjamin Geiling

    Full Text Available The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG and retroviral (pREG vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs. In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems.

  11. A new system for parallel drug screening against multiple-resistant HIV mutants based on lentiviral self-inactivating (SIN vectors and multi-colour analyses

    Directory of Open Access Journals (Sweden)

    Prokofjeva Maria M

    2013-01-01

    Full Text Available Abstract Background Despite progress in the development of combined antiretroviral therapies (cART, HIV infection remains a significant challenge for human health. Current problems of cART include multi-drug-resistant virus variants, long-term toxicity and enormous treatment costs. Therefore, the identification of novel effective drugs is urgently needed. Methods We developed a straightforward screening approach for simultaneously evaluating the sensitivity of multiple HIV gag-pol mutants to antiviral drugs in one assay. Our technique is based on multi-colour lentiviral self-inactivating (SIN LeGO vector technology. Results We demonstrated the successful use of this approach for screening compounds against up to four HIV gag-pol variants (wild-type and three mutants simultaneously. Importantly, the technique was adapted to Biosafety Level 1 conditions by utilising ecotropic pseudotypes. This allowed upscaling to a large-scale screening protocol exploited by pharmaceutical companies in a successful proof-of-concept experiment. Conclusions The technology developed here facilitates fast screening for anti-HIV activity of individual agents from large compound libraries. Although drugs targeting gag-pol variants were used here, our approach permits screening compounds that target several different, key cellular and viral functions of the HIV life-cycle. The modular principle of the method also allows the easy exchange of various mutations in HIV sequences. In conclusion, the methodology presented here provides a valuable new approach for the identification of novel anti-HIV drugs.

  12. In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells

    Directory of Open Access Journals (Sweden)

    Andreas Holmgaard

    2017-12-01

    Full Text Available Virus-based gene therapy by CRISPR/Cas9-mediated genome editing and knockout may provide a new option for treatment of inherited and acquired ocular diseases of the retina. In support of this notion, we show that Streptococcus pyogenes (Sp Cas9, delivered by lentiviral vectors (LVs, can be used in vivo to selectively ablate the vascular endothelial growth factor A (Vegfa gene in mice. By generating LVs encoding SpCas9 targeted to Vegfa, and in parallel the fluorescent eGFP marker protein, we demonstrate robust knockout of Vegfa that leads to a significant reduction of VEGFA protein in transduced cells. Three of the designed single-guide RNAs (sgRNAs induce in vitro indel formation at high frequencies (44%–93%. A single unilateral subretinal injection facilitates RPE-specific localization of the vector and disruption of Vegfa in isolated eGFP+ RPE cells obtained from mice five weeks after LV administration. Notably, sgRNA delivery results in the disruption of Vegfa with an in vivo indel formation efficacy of up to 84%. Sequencing of Vegfa-specific amplicons reveals formation of indels, including 4-bp deletions and 2-bp insertions. Taken together, our data demonstrate the capacity of lentivirus-delivered SpCas9 and sgRNAs as a developing therapeutic path in the treatment of ocular diseases, including age-related macular degeneration.

  13. Inhibiting PHD2 in bone marrow mesenchymal stem cells via lentiviral vector-mediated RNA interference facilitates the repair of periodontal tissue defects in SD rats

    Science.gov (United States)

    Chen, Changxing; Li, Houxuan; Jiang, Jun; Zhang, Qian; Yan, Fuhua

    2017-01-01

    Hypoxia-inducible factors (HIFs) play an important role in angiogenesis, and they can activate the expression of several downstream angiogenic factors. HIF-1 is a major transcriptor of HIFs, composed of α and β subunits. Prolyl hydroxylase domain-containing protein 2 (PHD2) is the main catabolic enzyme for HIF-1α, and it can accelerate its degradation under normoxic conditions. PHD2 expression in bone marrow mesenchymal stem cells (BMMSCs) of SD rats was down-regulated under normoxic conditions in this study by utilizing lentiviral vector-mediated RNA interference to promote HIF-1α accumulation, thus enhancing the expression of angiogenic factors. A tissue-engineered compound was constructed using the composite collagen membrane of BMMSCs after PHD2 gene silencing to repair periodontal fenestration defects in SD rats. The results of this study indicated that, after PHD2 gene silencing, the osteogenic differentiation of BMMSCs was enhanced in vitro, the resistance of cells to oxidative stress was also validated in vitro, thereby illustrating the promotion of the repair of artificially constructed periodontal tissue defects in rats. The results of this study provide a reference and guidance for future applications of RNA interference in periodontal tissue engineering and serve as a basis for improving the survival of seed cells in recipient tissues. PMID:29069818

  14. Efficient Transduction of Feline Neural Progenitor Cells for Delivery of Glial Cell Line-Derived Neurotrophic Factor Using a Feline Immunodeficiency Virus-Based Lentiviral Construct

    Directory of Open Access Journals (Sweden)

    X. Joann You

    2011-01-01

    Full Text Available Work has shown that stem cell transplantation can rescue or replace neurons in models of retinal degenerative disease. Neural progenitor cells (NPCs modified to overexpress neurotrophic factors are one means of providing sustained delivery of therapeutic gene products in vivo. To develop a nonrodent animal model of this therapeutic strategy, we previously derived NPCs from the fetal cat brain (cNPCs. Here we use bicistronic feline lentiviral vectors to transduce cNPCs with glial cell-derived neurotrophic factor (GDNF together with a GFP reporter gene. Transduction efficacy is assessed, together with transgene expression level and stability during induction of cellular differentiation, together with the influence of GDNF transduction on growth and gene expression profile. We show that GDNF overexpressing cNPCs expand in vitro, coexpress GFP, and secrete high levels of GDNF protein—before and after differentiation—all qualities advantageous for use as a cell-based approach in feline models of neural degenerative disease.

  15. A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

    International Nuclear Information System (INIS)

    Strauss, Bryan E.; Patricio, Juliana Rotelli; Vieira de Carvalho, Anna Carolina; Bajgelman, Marcio C.

    2006-01-01

    We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for this factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis

  16. Pretransplant mobilization with granulocyte colony-stimulating factor improves B-cell reconstitution by lentiviral vector gene therapy in SCID-X1 mice.

    Science.gov (United States)

    Huston, Marshall W; Riegman, Adriaan R A; Yadak, Rana; van Helsdingen, Yvette; de Boer, Helen; van Til, Niek P; Wagemaker, Gerard

    2014-10-01

    Hematopoietic stem cell (HSC) gene therapy is a demonstrated effective treatment for X-linked severe combined immunodeficiency (SCID-X1), but B-cell reconstitution and function has been deficient in many of the gene therapy treated patients. Cytoreductive preconditioning is known to improve HSC engraftment, but in general it is not considered for SCID-X1 since the poor health of most of these patients at diagnosis and the risk of toxicity preclude the conditioning used in standard bone marrow stem cell transplantation. We hypothesized that mobilization of HSC by granulocyte colony-stimulating factor (G-CSF) should create temporary space in bone marrow niches to improve engraftment and thereby B-cell reconstitution. In the present pilot study supplementing our earlier preclinical evaluation (Huston et al., 2011), Il2rg(-/-) mice pretreated with G-CSF were transplanted with wild-type lineage negative (Lin(-)) cells or Il2rg(-/-) Lin(-) cells transduced with therapeutic IL2RG lentiviral vectors. Mice were monitored for reconstitution of lymphocyte populations, level of donor cell chimerism, and antibody responses as compared to 2 Gy total body irradiation (TBI), previously found effective in promoting B-cell reconstitution. The results demonstrate that G-CSF promotes B-cell reconstitution similar to low-dose TBI and provides proof of principle for an alternative approach to improve efficacy of gene therapy in SCID patients without adverse effects associated with cytoreductive conditioning.

  17. R-hyper-CVAD versus R-CHOP/cytarabine with high-dose therapy and autologous haematopoietic stem cell support in fit patients with mantle cell lymphoma: 20 years of single-center experience.

    Science.gov (United States)

    Widmer, Fabienne; Balabanov, Stefan; Soldini, Davide; Samaras, Panagiotis; Gerber, Bernhard; Manz, Markus G; Goede, Jeroen S

    2018-02-01

    Standard of care for untreated mantle cell lymphoma (MCL) is still debated. At the University Hospital Zurich, advanced MCL in physically fit patients is treated either with rituximab plus cyclophosphamide, doxorubicin, vincristine and prednisone induction followed by consolidating high-dose chemotherapy and autologous stem cell support (R-CHOP/HD-ASCT), or with rituximab plus fractionated cyclophosphamide, vincristine, doxorubicin and dexamethasone alternating with high-dose methotrexate-cytarabine (R-hyper-CVAD/MTX-AraC) without consolidating HD-ASCT upon physicians' and patients' choice. We retrospectively analysed the outcome and therapy tolerance in patients with MCL treated with R-CHOP/HD-ASCT or R-hyper-CVAD/MTX-AraC at the University Hospital Zurich between January 1996 and January 2016. Forty-three patients were included; 29 patients received R-CHOP/HD-ASCT and 14 patients R-hyper-CVAD/MTX-AraC. Mean age at diagnosis was 54.4 years (range 38-68 years). Thirty-five patients (81.4%) completed the entire first-line therapy (n = 24 in the R-CHOP/HD-ASCT group, n = 11 in the R-hyper-CVAD group). Of those, all patients responded and 97% achieved a complete remission (CR). With a mean follow-up of 5.7 years 10-year progression-free survival (PFS) for all patients was 32% and overall survival (OS) was 76%, with no difference between the two therapy groups. Complication-induced hospitalisation rate, haematological toxicity and economic burden were significantly higher in the R-hyper-CVAD therapy group. In contrast, quality of life and global health state were better in the R-hyper-CVAD therapy group. Both first-line therapies showed similar outcome with a median OS longer than 10 years. Due to significantly lower haematological toxicity and lower economic burden, we recommend R-CHOP/HD-ASCT as first-line therapy in fit adult patients with advanced MCL.

  18. Long-Term Results of the FOLL05 Trial Comparing R-CVP Versus R-CHOP Versus R-FM for the Initial Treatment of Patients With Advanced-Stage Symptomatic Follicular Lymphoma.

    Science.gov (United States)

    Luminari, Stefano; Ferrari, Angela; Manni, Martina; Dondi, Alessandra; Chiarenza, Annalisa; Merli, Francesco; Rusconi, Chiara; Tarantino, Vittoria; Tucci, Alessandra; Vitolo, Umberto; Kovalchuk, Sofia; Angelucci, Emanuele; Pulsoni, Alessandro; Arcaini, Luca; Angrilli, Francesco; Gaidano, Gianluca; Stelitano, Caterina; Bertoldero, Giovanni; Cascavilla, Nicola; Salvi, Flavia; Ferreri, Andrés J M; Vallisa, Daniele; Marcheselli, Luigi; Federico, Massimo

    2018-03-01

    Purpose The FOLL05 trial compared R-CVP (rituximab plus cyclophosphamide, vincristine, and prednisone) with R-CHOP (rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone) and R-FM (rituximab plus fludarabine and mitoxantrone) regimens without rituximab maintenance as initial therapy for patients with advanced-stage follicular lymphoma (FL). A previous analysis with a median follow-up of 34 months showed a superior 3-year time to treatment failure, the primary study end point, with R-CHOP and R-FM versus R-CVP and showed R-CHOP to have a better risk-benefit ratio in terms of toxicity than R-FM. We report a post hoc analysis of this trial after a median follow-up of 7 years. Patients and Methods Of the 534 enrolled patients, 504 were evaluable. At the time of analysis, the median follow-up was 84 months (range, 1 to 119 months). Results The 8-year time to treatment failure and progression-free survival rates were 44% (95% CI, 39% to 49%) and 48% (95% CI, 43% to 53%), respectively. The hazard ratio for progression-free survival adjusted by FL International Prognostic Index 2 versus R-CVP was 0.73 for R-CHOP (95% CI, 0.54 to 0.98; P = .037) and 0.67 for R-FM (95% CI, 0.50 to 0.91; P = .009). The 8-year overall survival (OS) rate was 83% (95% CI, 79% to 87%), with no significant differences among study arms. Overall, we observed a higher risk of dying as a result of causes unrelated to lymphoma progression with R-FM versus R-CVP. Conclusion With an 83% 8-year OS rate, long-term follow-up of the FOLL05 trial confirms the favorable outcome of patients with advanced-stage FL treated with immunochemotherapy. The three study arms had similar OS but different activity and toxicity profiles. Patients initially treated with R-CVP had a higher risk of lymphoma progression compared with those receiving R-CHOP, as well as a higher risk of requiring additional therapy.

  19. Effects of feeding corn modified wet distillers grain plus solubles co-ensiled with chopped whole plant corn on heifer growth performance and diet digestibility in beef cattle.

    Science.gov (United States)

    Arias, R P; Unruh-Snyder, L J; Scholljegerdes, E J; Baird, A N; Johnson, K D; Buckmaster, D; Lemenager, R P; Lake, S L

    2013-09-01

    Two experiments were conducted to evaluate the effect of feeding corn modified wet distillers grain plus solubles (MWDGS; 48% DM) co-ensiled with chopped whole plant corn (WC) on growth performance, dietary intake, and nutrient digestibility of beef cattle. In Exp. 1, 96 Angus-crossed heifers (2 yr old; 522 ± 49.1 kg BW; 5.3 ± 0.1 BCS) were stratified and blocked according to BW and stratified by BCS in each block in a randomized complete block design (24 pens; 4 heifers/pen; 6 treatment replications). Groups were assigned to 1 of 4 dietary treatments for a 62 d trial. Treatments were 1) corn silage (CS) and soybean meal (CON), 2) MWDGS co-ensiled with chopped whole plant corn (WC; CO-EN), 3) CS mixed with MWDGS at feeding (CS+WDG), and 4) CS mixed with dry distillers grain plus solubles (DDGS) at feeding (CS+DDG). In Exp. 2, 4 crossbred beef steers (initial BW = 278 ± 18 kg) fitted with permanent ruminal cannulas were used in a balanced 4 × 4 Latin square to test the effects of feeding MWDGS co-ensiled with WC on DM intake, ruminal fermentation characteristics, and total tract digestibility. There were four 14-d periods, with 10 d for diet adaptation and 4 d for samples collection. Orthogonal contrasts were used and compared CON vs. diets containing distillers grains (DGD), CO-EN vs. diets where distillers grains were mixed at feeding (MIX), and CS+WDG vs. CS+DDG. In Exp. 1, the CON fed heifers resulted in greater G:F (P = 0.04) compared with those fed DGD. However, ADG (P = 0.03), final BW (P = 0.04), and BW gain (P = 0.03) were greatest for DGD diets compared with CON and greatest (P = 0.04) for CO-EN when compared with MIX. Apart from a slightly greater acetate concentration (P = 0.05), which resulted in a greater acetate to propionate ratio (P = 0.03) for the CON diet compared with DGD, no important differences were observed on intake, diet digestibility, or fermentation characteristics when comparing the CON treatment with DGD or when comparing CS

  20. Expression of Myc, but not pSTAT3, is an adverse prognostic factor for diffuse large B-cell lymphoma treated with epratuzumab/R-CHOP.

    Science.gov (United States)

    Gupta, Mamta; Maurer, Matthew J; Wellik, Linda E; Law, Mark E; Han, Jing Jing; Ozsan, Nazan; Micallef, Ivana N; Dogan, Ahmet; Witzig, Thomas E

    2012-11-22

    STAT3 regulates cell growth by up-regulating downstream targets, such as Myc. The frequency of phosphorylated STAT3 (pSTAT3) and Myc expression and their prognostic relevance is unknown within diffuse large B-cell lymphoma (DLBCL) germinal center B-cell (GCB) and non-GCB subtypes. pSTAT3 and Myc were studied by immunohistochemistry (IHC) on tumors from 40 DLBCL patients uniformly treated on a clinical trial of epratuzumab/rituximab-CHOP. A total of 35% of cases were pSTAT3-positive, and pSTAT3 positivity was more frequent in the non-GCB (P = .06) type but did not correlate with event-free survival (EFS). Myc expression was observed in 50% of cases and was more frequent in non-GCB type (P = .07). Myc-positive cases had inferior EFS in all patients, including the GCB and pSTAT3-positive cases, were more likely to express Myc (P = .06). Myc translocations involving the major breakpoint regions were found in 10% (3 of 29) of cases, and all 3 cases were GCB and had an inferior EFS (P = .09). pSTAT3, but not Myc expression, was correlated with elevated pretreatment serum cytokines, such as IL-10 (P = .05), G-CSF (P = .03), and TNF-α (P = .04). pSTAT3 IHC in DLBCL tumors has the potential to identify patients for STAT3 pathway-directed therapy; Myc IHC is a potential marker for inferior EFS in GCB patients.

  1. Effects of chopping, and soaking in water, hydrochloric acidic and calcium hydroxide solutions on the nutritional value of Acacia villosa for goats

    International Nuclear Information System (INIS)

    Wina, E.; Tangendjaja, B.; Susana, I.W.R.

    2005-01-01

    Acacia villosa, a thornless shrub legume, has potential as a feed supplement for ruminants if anti-nutritional factors, especially tannins, can be overcome. The effects of chopping and soaking the leaves on the amounts of tannin in the extracting solution and that left in the recovered leaves were studied. The tannin and non-tannin phenolics were solubilized in the extracting solution and the amount was increased with the soaking time. Soaking in calcium hydroxide solution, hydrochloric acid or water removed 41-76% of tannin and total phenolics removed from the recovered leaves. Soaking of the leaves also removed fermentable materials and reduced the gas production. In the first of two digestibility experiments, three groups of goats received one of these diets, those were: (1) sugar cane tops: unsoaked Acacia leaves (7:3), (2) sugar cane tops: water soaked Acacia leaves (7:3) and (3) sugar cane tops: water soaked Acacia leaves (7:3) + 100 g/day of cassava flour. Live weight of goats was measured every 2 weeks and a large increase in average daily gain was obtained for goats fed diet containing water soaked leaves and cassava flour (71 g/day) compared to those fed diet containing unsoaked leaves and water soaked leaves (38.9 and 44.7 g/day, respectively) (P 0.05) found in intake or digestibility between unsoaked and soaked leaves. In conclusion, soaking reduced tannin in Acacia leaves, improved digestibility and intake of Acacia leaves. In the presence of cassava flour, soaking improved average daily gain. Diets supplemented with water soaked Acacia leaves probably also need an energy supplement and cassava flour is one of the feed ingredients that is satisfactory. (author)

  2. Performance- and safety-enhanced lentiviral vectors containing the human interferon-beta scaffold attachment region and the chicken beta-globin insulator.

    Science.gov (United States)

    Ramezani, Ali; Hawley, Teresa S; Hawley, Robert G

    2003-06-15

    Retroviral vectors are the most efficient means of stable gene delivery to hematopoietic stem cells (HSCs). However, transgene expression from retroviral vectors is frequently subject to the negative influence of chromosomal sequences flanking the site of integration. Toward the development of autonomous transgene expression cassettes, we inserted the human interferon-beta scaffold attachment region (IFN-SAR) and the chicken beta-globin 5' DNase I hypersensitive site 4 (5'HS4) insulator both separately and together into a series of self-inactivating (SIN) lentiviral vector backbones. Transduced cells of the human CD34+ hematopoietic progenitor line KG1a-pooled populations as well as individual clones harboring single integrants--were analyzed for reporter expression during culture periods of up to 4 months. Vectors carrying both the 5'HS4 insulator and the IFN-SAR consistently outperformed control vectors without inserts as well as vectors carrying either element alone. The performance of a set of vectors containing the murine stem cell virus long terminal repeat as an internal promoter was subsequently assessed during in vitro monocytic differentiation of transduced primary human CD34+ cord blood cells. Similar to what was observed in the KG1a hematopoietic progenitor cell model, optimal reporter expression in primary monocytes was obtained with the vector bearing both regulatory elements. These findings indicate that the 5'HS4/IFN-SAR combination is particularly effective at maintaining open chromatin domains permissive for high-level transgene expression at early and late stages of hematopoietic development, and thus could be of utility in HSC-directed retroviral vector-mediated gene transfer applications.

  3. Lentiviral Transfer of γ-Globin with Fusion Gene NUP98-HOXA10HD Expands Hematopoietic Stem Cells and Ameliorates Murine β-Thalassemia.

    Science.gov (United States)

    Zhao, Hui Fen; Abraham, Allistair; Kim, Yoon-Sang; Wang, Yong-Dong; Pestina, Tamara; Zhan, Jun; Humphries, Keith; Nienhuis, Arthur W; Persons, Derek A

    2017-03-01

    Recently, an engineered Homeobox-nucleoporin fusion gene, NUP98-HOXA10HD or NA10HD, was reported to expand and maintain murine hematopoietic stem cells (HSCs). We postulated that NA10HD would increase the number of human γ-globin-expressing cells to therapeutic levels. We developed a double gene lentiviral vector encoding both human γ-globin and NA10HD, which was used to transduce human peripheral blood CD34 + cells and increased engraftment 2- to 2.5-fold at 15 weeks post-transplantation in immunodeficient mice. In β-thalassemic mice transplanted with β-thalassemic HSCs transduced with the γ-globin/NA10HD vector, the number of fetal hemoglobin (HbF)-expressing cells was significantly increased after 3 months, leading to resolution of the anemia. Furthermore, the increases in HbF were maintained at 6 months and persisted after secondary transplantation. In addition, NA10HD enrichment of transduced HSCs led to HbF increases without affecting homeostasis of the white blood cell lineages. Our results suggest that NA10HD increases the number of γ-globin-transduced HSCs that engraft, leading to an elevated number of fetal hemoglobin-containing red cells. These effects of NA10HD provide an improved platform for testing of the therapeutic efficacy of novel globin vectors and provide further impetus to develop safe and effective methods for selective expansion of genetically modified cells. Copyright © 2017. Published by Elsevier Inc.

  4. Efficient delivery of Cre-recombinase to neurons in vivo and stable transduction of neurons using adeno-associated and lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Sablitzky Fred

    2004-01-01

    Full Text Available Abstract Background Inactivating genes in vivo is an important technique for establishing their function in the adult nervous system. Unfortunately, conventional knockout mice may suffer from several limitations including embryonic or perinatal lethality and the compensatory regulation of other genes. One approach to producing conditional activation or inactivation of genes involves the use of Cre recombinase to remove loxP-flanked segments of DNA. We have studied the effects of delivering Cre to the hippocampus and neocortex of adult mice by injecting replication-deficient adeno-associated virus (AAV and lentiviral (LV vectors into discrete regions of the forebrain. Results Recombinant AAV-Cre, AAV-GFP (green fluorescent protein and LV-Cre-EGFP (enhanced GFP were made with the transgene controlled by the cytomegalovirus promoter. Infecting 293T cells in vitro with AAV-Cre and LV-Cre-EGFP resulted in transduction of most cells as shown by GFP fluorescence and Cre immunoreactivity. Injections of submicrolitre quantities of LV-Cre-EGFP and mixtures of AAV-Cre with AAV-GFP into the neocortex and hippocampus of adult Rosa26 reporter mice resulted in strong Cre and GFP expression in the dentate gyrus and moderate to strong labelling in specific regions of the hippocampus and in the neocortex, mainly in neurons. The pattern of expression of Cre and GFP obtained with AAV and LV vectors was very similar. X-gal staining showed that Cre-mediated recombination had occurred in neurons in the same regions of the brain, starting at 3 days post-injection. No obvious toxic effects of Cre expression were detected even after four weeks post-injection. Conclusion AAV and LV vectors are capable of delivering Cre to neurons in discrete regions of the adult mouse brain and producing recombination.

  5. Development of Lentiviral Vectors Simultaneously Expressing Multiple siRNAs Against CCR5, vif and tat/rev Genes for an HIV-1 Gene Therapy Approach

    Directory of Open Access Journals (Sweden)

    Francesca Spanevello

    2016-01-01

    Full Text Available Gene therapy holds considerable promise for the functional cure of HIV-1 infection and, in this context, RNA interference (RNAi-based approaches represent powerful strategies. Stable expression of small interfering RNAs (siRNAs targeting HIV genes or cellular cofactors has the potential to render HIV-1 susceptible cells resistant to infection. To inhibit different steps of virus life cycle, self-inactivating lentiviral vectors expressing multiple siRNAs targeting the CCR5 cellular gene as well as vif and tat/rev viral transcripts, under the control of different RNA polymerase III promoters (U6, 7SK, H1 were developed. The use of a single RNA polymerase III promoter driving the expression of a sequence giving rise to three siRNAs directed against the selected targets (e-shRNA was also investigated. Luciferase assay and inhibition of HIV-1 replication in human Jurkat T-cell line were adopted to select the best combination of promoter/siRNA. The efficacy of selected developed combinatorial vectors in interfering with viral replication was evaluated in human primary CD4+ T lymphocytes. We identified two effective anti-HIV combinatorial vectors that conferred protection against R5- and X4- tropic viruses. Overall, our results showed that the antiviral effect is influenced by different factors, including the promoter used to express the RNAi molecules and the selected cassette combination. These findings contribute to gain further insights in the design of RNAi-based gene therapy approaches against HIV-1 for clinical application.

  6. Striatal modulation of BDNF expression using microRNA124a-expressing lentiviral vectors impairs ethanol-induced conditioned-place preference and voluntary alcohol consumption.

    Science.gov (United States)

    Bahi, Amine; Dreyer, Jean-Luc

    2013-07-01

    Alcohol abuse is a major health, economic and social concern in modern societies, but the exact molecular mechanisms underlying ethanol addiction remain elusive. Recent findings show that small non-coding microRNA (miRNA) signaling contributes to complex behavioral disorders including drug addiction. However, the role of miRNAs in ethanol-induced conditioned-place preference (CPP) and voluntary alcohol consumption has not yet been directly addressed. Here, we assessed the expression profile of miR124a in the dorsal striatum of rats upon ethanol intake. The results show that miR124a was downregulated in the dorso-lateral striatum (DLS) following alcohol drinking. Then, we identified brain-derived neurotrophic factor (BDNF) as a direct target of miR124a. In fact, BDNF mRNA was upregulated following ethanol drinking. We used lentiviral vector (LV) gene transfer technology to further address the role of miR124a and its direct target BDNF in ethanol-induced CPP and alcohol consumption. Results reveal that stereotaxic injection of LV-miR124a in the DLS enhances ethanol-induced CPP as well as voluntary alcohol consumption in a two-bottle choice drinking paradigm. Moreover, miR124a-silencer (LV-siR124a) as well as LV-BDNF infusion in the DLS attenuates ethanol-induced CPP as well as voluntary alcohol consumption. Importantly, LV-miR124a, LV-siR124a and LV-BDNF have no effect on saccharin and quinine intake. Our findings indicate that striatal miR124a and BDNF signaling have crucial roles in alcohol consumption and ethanol conditioned reward. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  7. Reassessment of the prognostic factors of international prognostic index (IPI) in the patients with diffuse large B-cell lymphoma in an era of R-CHOP in Chinese population.

    Science.gov (United States)

    Yang, Shen; Yu, Yao; Jun-Min, Li; Jian-Qing, Mi; Qiu-Sheng, Chen; Yu, Chen; Wei-Li, Zhao; Jian-Hua, You; Hui-Jin, Zhao; Yan, Wang; Li, Wang; Shu, Cheng; Zhi-Xiang, Shen

    2009-09-01

    We performed this study to reassess the prognostic factors of diffuse large B-cell lymphoma (DLBCL) in the era of rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) in Chinese population. One hundred and twenty-five consecutive patients with DLBCL were enrolled in this study from February 2000 to September 2006. They had received six courses of R-CHOP regimen consisting of rituximab 375 mg/m(2), intravenously, D1; cyclophosphamide 750 mg/m(2), bolus infusion, D2; doxorubicin 50 mg/m(2), bolus infusion, D2; vincristine 1.4 mg/m(2), bolus infusion, D2; and prednisone 60 mg, orally, D2-6. All the patients were evaluated and followed-up after the treatment. Eighty-six out of 125 enrolled patients (68.8%) achieved complete response (CR), 16 patients (12.8%) achieved partial response (PR), 11 patients (12.8%) achieved stable disease, and 12 patients (9.6%) experienced progressive disease (PD). In univariate analysis, IPI factors, except for age, was correlated with the treatment outcome of complete remission; however, only early clinical stages and absence of bulky disease was statistically significantly associated with the better CR rate. Lactate dehydrogenase (LDH), extranodal diseases, bulky disease, and obtaining CR after completion of four courses of treatment was correlated with TTF (P = 0.038, 0.044, 0.034, and 0.000, respectively); performance status, LDH level, number of extranodal diseases, and obtaining CR after completion four courses of treatment significantly influenced OS (P = 0.027, 0.000, 0.019, and 0.000, respectively); and presence of bulky disease and obtaining CR at the end of fourth cycle of treatment were significantly correlated with DFS in multivariate analysis (P = 0.006 and 0.001, respectively) in Cox regression. IPI is still important in predicting the prognosis in the R-CHOP era in DLBCL; however, obtaining CR after four cycles of R-CHOP and presence of bulky disease should be considered together.

  8. Determining optimum age of Holstein dairy calves when adding chopped alfalfa hay to meal starter diets based on measures of growth and performance.

    Science.gov (United States)

    Hosseini, S M; Ghorbani, G R; Rezamand, P; Khorvash, M

    2016-04-01

    The present study was conducted to determine the optimum age of Holstein dairy calves for an effective inclusion of alfalfa hay (AH) in starter feed on performance, apparent digestibility and feeding behavior. A total of 40 Holstein dairy calves (20 female and 20 male) were used in a completely randomized design in which calves were randomly assigned to one of four different dietary treatments including control (CON) calves fed starter feed without any forage and three treatments consisting of the same starter feed plus 15% chopped AH fed when calves were at the 2nd (AH2), 4th (AH4) or 6th (AH6) week of age. Calves were individually housed and bedded with sand that was replaced every other day. Feed and water were available ad libitum throughout the experiment. Calves were fed milk at 10% of birth BW twice daily until d 57. The study concluded when calves were 73 days old. Starter intake was recorded daily and BW was measured weekly. Data were analyzed as a complete randomized design by MIXED procedures of SAS. Results demonstrate that calves receiving AH treatments numerically consumed more starter feed (0.62 v. 0.78, 0.71 and 0.65 kg/day for CON, AH2, AH4 and AH6, respectively) and had greater average daily gain (ADG) compared with CON (0.48 v. 0.57, 0.49 and 0.49 kg/day for CON, AH2, AH4 and AH6), although the significant difference was observed only between AH2 and CON. Among AH treatments, calves in AH2 had better performance than AH6 in several cases including starter intake, ADG. No detectable differences were observed, however, in apparent dry matter, organic matter or CP digestibility among treatments. Ruminal pH and NH3 concentrations, measured on weeks 4, 6, 8 and 10, were lower for calves fed CON compared with other treatments, with ammonia concentrations decreasing over time. Calves in the AH treatments spent more time eating and ruminating compared with CON. Calves fed CON, however, spent more time on laying down compared with other treatments

  9. Genetics Home Reference: CHOPS syndrome

    Science.gov (United States)

    ... Defects Patient Support and Advocacy Resources (4 links) American Heart Association Contact a Family: Heart Defects The Arc: For People with Intellectual and Developmental Disabilities University of Kansas Genetics Education Center Resource List: ...

  10. Chopped filter for nuclear spectroscopy

    International Nuclear Information System (INIS)

    Koyama, J.

    1980-12-01

    Some of the theoretical and practical factors affecting the energy resolution of a spectrometry system are considered, specially those related to t he signal-to-noise ratio, and a time-variant filter with the transfer function of the theoretical optimum filter, during its active time, is proposed. A prototype has been tested and experimental results are presented. (Author) [pt

  11. Double transduction of a Cre/LoxP lentiviral vector: a simple method to generate kidney cell-specific knockdown mice.

    Science.gov (United States)

    Nam, Bo Young; Kim, Dong Ki; Park, Jung Tak; Kang, Hye-Young; Paeng, Jisun; Kim, Seonghun; Park, Jimin; Um, Jae Eun; Oh, Hyung Jung; Han, Seung Hyeok; Yoo, Tae-Hyun; Kang, Shin-Wook

    2015-12-15

    In a lentivirus-based gene delivery system, the incorporated gene is continuously expressed for a long time. In this study, we devised a simple way to knock down a specific gene in a kidney cell-specific pattern in adult mice by lentivirus-assisted transfer of short hairpin RNA (shRNA). Kidney collecting duct (CD)-specific aquaporin-3 (AQP3)-knockdown mice were generated by consecutive injection of Hoxb7-Cre-expressing lentivirus (LV-Hoxb7 Cre) and loxP-AQP3 shRNA-expressing lentivirus (LV-loxP shAQP3) in adult C57BL6/J mice. LV-Hoxb7 Cre was designed to express mCherry, while LV-loxP shAQP3 was designed with a floxed enhanced green fluorescent protein (EGFP)-tagged stop sequence, and thus EGFP would be expressed only in the absence of Cre recombination. In mice treated with LV-Hoxb7 Cre alone, mCherry protein expression, which indicates the presence of Cre recombinase, occurred only in CD cells. However, LV-loxP shAQP3 injection alone resulted in an increase in EGFP expression in all kidney cells, indicating the transcription of the floxed region. When LV-Hoxb7 Cre and LV-loxP shAQP3 were sequentially transduced, EGFP expression was attenuated while mCherry expression was sustained in CD cells, demonstrating a CD cell-specific recombination of the floxed region. AQP3 expression in mice injected with LV-Hoxb7 Cre or LV-loxP shAQP3 alone did not differ, but consecutive injection of LV-Hoxb7 Cre and LV-loxP shAQP3 significantly reduced AQP3 expression in CD cells. However, the expression levels of AQP3 were not altered in other cell types. Double transduction of Cre- and loxP-based lentivirus can easily generate kidney cell-specific knockdown mice, and this method might be applicable to other species. Copyright © 2015 the American Physiological Society.

  12. STAT3/NF-κB-Regulated Lentiviral TK/GCV Suicide Gene Therapy for Cisplatin-Resistant Triple-Negative Breast Cancer.

    Science.gov (United States)

    Kuo, Wei-Ying; Hwu, Luen; Wu, Chun-Yi; Lee, Jhih-Shian; Chang, Chi-Wei; Liu, Ren-Shyan

    2017-01-01

    Triple-negative breast cancer (TNBC) represents approximately 20% of all breast cancers and appears resistance to conventional cytotoxic chemotherapy, demonstrating a particularly poor prognosis and a significantly worse clinical outcome than other types of cancer. Suicide gene therapy has been used for the in vivo treatment of various solid tumors in recent clinical trials. In tumor microenvironment, STAT3/NF-κB pathways are constitutively activated in stromal cells as well as in cancer stem cells (CSCs). In this study, we have cloned a novel STAT3/NF-κB-based reporter system to drive the expression of herpes simplex virus thymidine kinase (HSV-TK) against breast cancer. Lentiviral vector expressing HSV-TK under the regulation of STAT3/NF-κB fused response element was developed. In this setting, we exploited the constitutive STAT3/NF-κB activation in tumors to achieve higher transgene expression than that driven by a constitutively active CMV promotor in vivo . An orthotropic MDA-MB-231 triple negative breast cancer mouse model was used for evaluating the feasibility of STAT3-NF-κB-TK/GCV suicide gene therapy system. The basal promoter activity of Lenti-CMV-TK and Lenti-STAT3-NF-κB-TK in MDA-MB-231 cells was compared by 3 H-FEAU uptake assay. The Lenti-CMV-TK showed ~5 fold higher 3 H-FEAU uptake then Lenti -STAT3-NF-κB-TK. In clonogenic assay, cells expressing Lenti-CMV-TK were 2-fold more sensitive to GCV than Lenti-STAT3-NF-κB-TK transduced cells. In vitro effect of STAT3-NF-κB-induced transgene expression was determined by 10ng/mL TNF-α induction and confirmed by western blot analysis and DsRedm fluorescent microscopy. In vivo evaluation of therapeutic effect by bioluminescence and [ 18 F]FHBG microPET imaging indicated that Lenti-STAT3-NF-κB-TK showed more tumor growth retardation than Lenti-CMV-TK when GCV (20 mg/kg) was administered. The invasiveness and expression of cancer stem cell markers were both decreased after STAT3/NF-κB-regulated HSV

  13. Comparison of human sodium iodide symporter (hNIS) gene expression between lentiviral and adenoviral vectors in rat mesenchymal stem cell

    International Nuclear Information System (INIS)

    Park, So Yeon; Lee, Won Woo; Kim, Sung Jin; Lee, Heui Ran; Kim, Hyun Joo; Chung, June Key; Kim, Sang Eun

    2007-01-01

    Quantitative comparison of transgene expression within stem cells between lentivirus and adenovirus-mediated delivery systems has not been done. Here, we evaluated the human sodium iodide symporter (hNIS) gene expression in rat mesenchymal stem cell (rMSC) transduced by lentivirus or adenovirus, and compared the hNIS expression quantitatively between the two delivery systems. Lentiviral-mediated stably hNIS expressing rMSC (lenti-hNIS-rMSC) was constructed by cloning the hNIS gene into pLenti6/UbC/V5-DEST (Invitrogen) to obtain pLenti-hNIS, transducing rMSC with the pLenti-hNIS, and selecting with blasticidin for 3 weeks. Recombinant adenovirus expressing hNIS gene (Rad-hNIS) was produced by homologous recombination and Rad-hNIS transduced rMSC (adeno-hNIS-rMSC) was evaluated for the hNIS expression 48 hours post infection at MOI 1, 5, 20, 50, and 100. The hNIS expression in lenti-hNIS-rMSC or adeno-hNIS-rMSC was assessed by immunocytochemistry, western blot, and I-125 uptake. Immunocytochemistry using mono-clonal anti-hNIS antibody revealed that intensity of hNIS immunoreactivity in lenti-hNIS-rMSC was greater than that in adeno-hNIS-rMSC at MOl 20 but lower than that at MOl 50. Western blot analysis also showed that lenti-hNIS-rMSC was intermediate between adeno-hNIS-rMSCs at MOl 20 and 50 in hNIS expression. However in vitro I-125 uptake test demonstrated that iodide uptake in lenti-hNIS-rMSC (297046659 picomole/106 cells) was greater than that in adeno-hNIS-rMSC at MOI 100 (61682134 picomole/106 cells). These results suggest that lentivirus mediated hNIS expression is greater in terms of hNIS function but lower in terms of hNIS protein amount than adenovirus mediated hNIS expression 48 hours post infection. Stem cell tracking using hNIS as a reporter gene should be conducted in consideration of relative viral efficiency of transgene expression

  14. A lentiviral sponge for miR-101 regulates RanBP9 expression and amyloid precursor protein metabolism in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Christian eBarbato

    2014-02-01

    Full Text Available Neurodegeneration associated with amyloid β (Aβ peptide accumulation, synaptic loss, and memory impairment are pathophysiological features of Alzheimer's disease (AD. Numerous microRNAs regulate amyloid precursor protein (APP expression and metabolism. We previously reported that miR-101 is a negative regulator of APP expression in cultured hippocampal neurons. In this study, a search for predicted APP metabolism-associated miR-101 targets led to the identification of a conserved miR-101 binding site within the 3’ untranslated region (UTR of the mRNA encoding Ran-binding protein 9 (RanBP9. RanBP9 increases APP processing by β-amyloid converting enzyme 1 (BACE1, secretion of soluble APPβ (sAPPβ, and generation of Aβ. MiR-101 significantly reduced reporter gene expression when co-transfected with a RanBP9 3'-UTR reporter construct, while site-directed mutagenesis of the predicted miR-101 target site eliminated the reporter response. To investigate the effect of stable inhibition of miR-101 both in vitro and in vivo, a microRNA sponge was developed to bind miR-101 and derepress its targets. Four tandem bulged miR-101 responsive elements (REs, located downstream of the enhanced green fluorescence protein (EGFP open reading frame and driven by the synapsin promoter, were placed in a lentiviral vector to create the pLSyn-miR-101 sponge. Delivery of the sponge to primary hippocampal neurons significantly increased both APP and RanBP9 expression, as well as sAPPβ levels in the conditioned medium. Importantly, silencing of endogenous RanBP9 reduced sAPPβ levels in miR-101 sponge-containing hippocampal cultures, indicating that miR-101 inhibition may increase amyloidogenic processing of APP by RanBP9. Lastly, the impact of miR-101 on its targets was demonstrated in vivo by intrahippocampal injection of the pLSyn-miR-101 sponge into C57BL6 mice. This study thus provides the basis for studying the consequences of long-term miR-101 inhibition on

  15. MYC and BCL-2 adjusted-International Prognostic Index (A-IPI) is a better predictor of outcome than the standard IPI for patients with diffuse large B-cell lymphoma treated with R-CHOP.

    Science.gov (United States)

    Wang, Jing; Zhou, Min; Xu, Jing-Yan; Yang, Yong-Gong; Zhang, Qi-Guo; Zhou, Rong-Fu; Chen, Bing; Ouyang, Jian; Li, Cuiping

    2016-03-01

    The International Prognostic Index (IPI) has been the basis for determining prognosis in patients with diffuse large B-cell lymphoma (DLBCL) for the past 20 years. The utility of the IPI must be reassessed in the era of immunochemotherapy. Seven risk factors at diagnosis were identified, and a maximum of 7 points were assigned to each patient. Four risk groups were created: low (0-1), low-intermediate (2-3), high-intermediate (4), and high (5-7). Using MYC and BCL-2 clinical data from the Drum Tower Hospital collected during the rituximab era, we performed a retrospective analysis of patients with DLBCL treated with R-CHOP and built an biological markers adjusted IPI with the goal of improving risk stratification.Clinical features from 60 adults with de novo DLBCL diagnosed from 2008-2013 were assessed for their prognostic significance. The IPI remains predictive, but it cannot identify the high-risk subgroup. Compared with the IPI, the MYC and BCL-2 adjusted-IPI (A-IPI) better discriminated patients in the high-risk subgroup (4-year overall survival [OS]: 33.3%) than did the IPI (4 year OS: 48.0%). In the era of R-CHOP treatment, MYC and BCL-2 adjusted-IPI is more powerful than the IPI for helping guide treatment planning and interpretation of clinical trials.

  16. Effect of ensiling time and exogenous protease addition to whole-plant corn silage of various hybrids, maturities, and chop lengths on nitrogen fractions and ruminal in vitro starch digestibility.

    Science.gov (United States)

    Ferraretto, L F; Crump, P M; Shaver, R D

    2015-12-01

    The objective of this study was to evaluate the effects of ensiling time and exogenous protease addition on soluble CP (% of CP), ammonia-N (% of N), and ruminal in vitro starch digestibility (ivSD) of whole-plant corn silage (WPCS) from 3 hybrids, 2 maturities, and 2 chop lengths. Samples from 3 nonisogenic hybrids [brown midrib containing the bm3 gene mutation (BM3), dual-purpose (DP), or floury-leafy (LFY)] at 2 harvest maturities [2/3 kernel milk line (early) or 7d later (late)] with 2 theoretical lengths of cut settings (0.64 or 1.95cm) on a forage harvester were collected at harvest, treated with or without exogenous protease, and ensiled in triplicate in vacuum heat-sealed plastic bags for 0, 30, 60, 120, and 240d. Thus, the experiment consisted of 120 treatments (3 hybrids × 2 maturities × 2 chop lengths × 2 protease treatments × 5 time points) and 360 mini-silos (3 replications per treatment). Vitreousness, measured by dissection on unfermented kernels on the day of harvest, averaged 66.8, 65.0, and 59.0% for BM3, DP, and LFY, respectively. A protease × maturity interaction was observed with protease increasing ivSD in late but not early maturity. Ensiling time × hybrid interactions were observed for ammonia-N and soluble CP concentrations with greater values for FLY than other hybrids only after 120d of ensiling. Ensiling time × hybrid or protease × hybrid interactions were not observed for ivSD. Measurements of ivSD were greatest for FLY and lowest for BM3. Length of the ensiling period did not attenuate negative effects of kernel vitreousness or maturity on ivSD in WPCS. Results suggest that the dosage of exogenous protease addition used in the present study may reduce but not overcome the negative effects of maturity on ivSD in WPCS. No interactions between chop length and ensiling time or exogenous protease addition were observed for ivSD. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  17. Intra-patient variability of FDG standardized uptake values in mediastinal blood pool, liver, and myocardium during R-CHOP chemotherapy in patients with diffuse large B- cell lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Soo Jeong; Yi, Hyun Kyung; Lim, Chae Hong; Cho, Young Seok; Choi, Joon Young; Choe, Yeam Seong; Lee, Kyung Han; Moon, Seung Hwan [Dept. of Nuclear Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2016-12-15

    {sup 18}F-fluorodeoxyglucose (FDG) PET/CT is useful for staging and evaluating treatment response in patients with diffuse large B-cell lymphoma (DLBCL). A five-point scale model using the mediastinal blood pool (MBP) and liver as references is a recommended method for interpreting treatment response. We evaluated the variability in standardized uptake values (SUVs) of the MBP, liver, and myocardium during chemotherapy in patients with DLBCL. We analyzed 60 patients with DLBCL who received rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) treatment and underwent baseline, interim, and final FDG PET/CT scans. The FDG uptakes of lymphoma lesions, MBP, liver, and myocardium were assessed, and changes in the MBP and liver SUV and possible associated factors were evaluated. The SUV of the liver did not change significantly during the chemotherapy. However, the SUV{sub mean} of MBP showed a significant change though the difference was small (p = 0.019). SUV{sub mean} of MBP and liver at baseline and interim scans was significantly lower in patients with advanced Ann Arbor stage on diagnosis. The SUV{sub mean} of the MBP and liver was negatively correlated with the volumetric index of lymphoma lesions in baseline scans (r = -0.547, p < 0.001; r = -0.502, p < 0.001). Positive myocardial FDG uptake was more frequently observed in interim and final scans than in the baseline scan, but there was no significant association between the MBP and liver uptake and myocardial uptake. The SUV of the liver was not significantly changed during R-CHOP chemotherapy in patients with DLBCL, whereas the MBP SUV of the interim scan decreased slightly. However, the SUV of the reference organs may be affected by tumor burden, and this should be considered when assessing follow-up scans. Although myocardial FDG uptake was more frequently observed after R-CHOP chemotherapy, it did not affect the SUV of the MBP and liver.

  18. Intra-patient variability of FDG standardized uptake values in mediastinal blood pool, liver, and myocardium during R-CHOP chemotherapy in patients with diffuse large B- cell lymphoma

    International Nuclear Information System (INIS)

    Kim, Soo Jeong; Yi, Hyun Kyung; Lim, Chae Hong; Cho, Young Seok; Choi, Joon Young; Choe, Yeam Seong; Lee, Kyung Han; Moon, Seung Hwan

    2016-01-01

    18 F-fluorodeoxyglucose (FDG) PET/CT is useful for staging and evaluating treatment response in patients with diffuse large B-cell lymphoma (DLBCL). A five-point scale model using the mediastinal blood pool (MBP) and liver as references is a recommended method for interpreting treatment response. We evaluated the variability in standardized uptake values (SUVs) of the MBP, liver, and myocardium during chemotherapy in patients with DLBCL. We analyzed 60 patients with DLBCL who received rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) treatment and underwent baseline, interim, and final FDG PET/CT scans. The FDG uptakes of lymphoma lesions, MBP, liver, and myocardium were assessed, and changes in the MBP and liver SUV and possible associated factors were evaluated. The SUV of the liver did not change significantly during the chemotherapy. However, the SUV mean of MBP showed a significant change though the difference was small (p = 0.019). SUV mean of MBP and liver at baseline and interim scans was significantly lower in patients with advanced Ann Arbor stage on diagnosis. The SUV mean of the MBP and liver was negatively correlated with the volumetric index of lymphoma lesions in baseline scans (r = -0.547, p < 0.001; r = -0.502, p < 0.001). Positive myocardial FDG uptake was more frequently observed in interim and final scans than in the baseline scan, but there was no significant association between the MBP and liver uptake and myocardial uptake. The SUV of the liver was not significantly changed during R-CHOP chemotherapy in patients with DLBCL, whereas the MBP SUV of the interim scan decreased slightly. However, the SUV of the reference organs may be affected by tumor burden, and this should be considered when assessing follow-up scans. Although myocardial FDG uptake was more frequently observed after R-CHOP chemotherapy, it did not affect the SUV of the MBP and liver

  19. CHOP-like chemotherapy with or without rituximab in young patients with good-prognosis diffuse large-B-cell lymphoma: 6-year results of an open-label randomised study of the MabThera International Trial (MInT) Group

    DEFF Research Database (Denmark)

    Pfreundschuh, Michael; Kuhnt, Evelyn; Trümper, Lorenz

    2011-01-01

    The MInT study was the first to show improved 3-year outcomes with the addition of rituximab to a CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone)-like regimen in young patients with good-prognosis diffuse large-B-cell lymphoma. Extended follow-up was needed to establish long-ter...

  20. Ku70 acetylation and modulation of c-Myc/ATF4/CHOP signaling axis by SIRT1 inhibition lead to sensitization of HepG2 cells to TRAIL through induction of DR5 and down-regulation of c-FLIP

    DEFF Research Database (Denmark)

    Kim, Mi-Ju; Hong, Kyung-Soo; Kim, Hak-Bong

    2013-01-01

    In this study, we investigated the role of c-Myc/ATF4/CHOP signaling pathway in sensitization of human hepatoma HepG2 cells to TRAIL. Knockdown of SIRT1 or treatment with SIRT1 inhibitor caused the up-regulation of DR5 and down-regulation of c-FLIP through modulation of c-Myc/ATF4/CHOP pathway......-FLIP. Moreover, Ku70(-/-) MEF and Ku70-knockdown HepG2 cells showed the increased levels of c-Myc, ATF4, CHOP, and DR5 and decreased level of c-FLIP. These results were followed by increased sensitivity of Ku70(-/-) MEF cells and Ku70-knockdown HepG2 cells to TRAIL compared with their control cells....... These findings reveal for the first time that SIRT1 inhibition increases Ku70 acetylation, and the acetylated Ku70 with a decreased function mediates the induction of DR5 and the down-regulation of c-FLIP by up-regulating c-Myc/ATF4/CHOP pathway, and consequently promotes the TRAIL-induced apoptosis of HepG2...

  1. Polypeptide from Chlamys farreri suppresses ultraviolet-B irradiation-induced apoptosis through restoring ER redox homeostasis, scavenging ROS generation, and suppressing the PERK-eIF2a-CHOP pathway in HaCaT cells.

    Science.gov (United States)

    Zhong, Feng; Xie, Jing; Zhang, Di; Han, Yantao; Wang, Chunbo

    2015-10-01

    The aim of this study was to investigate the effect of polypeptide from Chlamys farreri (PCF) on ultraviolet B (UVB) irradiation-induced apoptosis in human keratinocyte HaCaT cells. HaCaT cells were treated with 20 mJ/cm(2) UVB irradiation for 18 h. The cell viability was measured by MTT assay, and apoptosis was detected with Hoechst 33258 staining and caspase-3 activity detection. Protein expression levels were assessed by Western blot analysis, and the intracellular ROS levels were also measured. Our results from the MTT assay showed that UVB irradiation significantly declined the viability of HaCaT cells, which could be restored by PCF treatment. PCF decreased the apoptosis rate in HaCaT cells treated with UVB irradiation. Moreover, PCF increased the expression levels of PDI and Ero-1a, and scavenged the intracellular ROS. Furthermore, PCF inhibited the expressions of GRP78, p-PERK, p-eIF2a, and CHOP, and suppressed the ER stress-induced apoptosis, in UVB-irradiated HaCaT cells. In addition, the ROS scavenging effect of 4-PBA was less potent than PCF, indicating that ER stress-related ROS production contribute partially to the total ROS level, and ER was not the only target of PCF treatment. Our results indicate that PCF inhibits UVB irradiation-induced apoptosis through restoring ER redox homeostasis and suppressing the PERK-eIF2a-CHOP pathway. These findings provide evidence for the application of PCF in the protection of skin from UV irradiation. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Kaempferol Sensitizes Human Ovarian Cancer Cells-OVCAR-3 and SKOV-3 to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL)-Induced Apoptosis via JNK/ERK-CHOP Pathway and Up-Regulation of Death Receptors 4 and 5.

    Science.gov (United States)

    Zhao, Yingmei; Tian, Binqiang; Wang, Yong; Ding, Haiying

    2017-10-26

    BACKGROUND Ovarian cancer is the most common gynecological malignancies in women, with high mortality rates worldwide. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the tumor necrosis factor (TNF) superfamily which preferentially induces apoptosis of cancer cells. However, acquired resistance to TRAIL hampers its therapeutic application. Identification of compounds that sensitize cancer cells to TRAIL is vital in combating resistance to TRAIL. The effect of kaempferol, a flavonoid enhancing TRAIL-induced apoptosis in ovarian cancer cells, was investigated in this study. MATERIAL AND METHODS The cytotoxic effects of TRAIL (25 ng/mL) and kaempferol (20-100 µM) on human ovarian cancer cells OVCAR-3 and SKOV-3 were assessed. Effect of kaempferol on the expression patterns of cell survival proteins (Bcl-xL, Bcl-2, survivin, XIAP, c-FLIP) and apoptotic proteins (caspase-3, caspase-8, caspase-9, Bax) were studied. The influence of kaempferol on expression of DR4 and DR5 death receptors on the cell surface and protein and mRNA levels was also analyzed. Apoptosis following silencing of DR5 and CHOP by small interfering RNA (siRNA), and activation of MAP kinases were analyzed as well. RESULTS Kaempferol enhanced apoptosis and drastically up-regulated DR4, DR5, CHOP, JNK, ERK1/2, p38 and apoptotic protein expression with decline in the expression of anti-apoptotic proteins. Further transfection with siRNA specific to CHOP and DR5 indicated the involvement of CHOP in DR5 up-regulation and also the contribution of DR5 in kaempferol-enhanced TRAIL-induced apoptosis. CONCLUSIONS Kaempferol sensitized ovarian cancer cells to TRAIL-induced apoptosis via up-regulation of DR4 and DR5 through ERK/JNK/CHOP pathways.

  3. Increased Engraftment of Human Short Term Repopulating Hematopoietic Cells in NOD/SCID/IL2rγnull Mice by Lentiviral Expression of NUP98-HOXA10HD.

    Directory of Open Access Journals (Sweden)

    Allistair Abraham

    Full Text Available Techniques to expand human hematopoietic stem cells ex-vivo could be beneficial to the fields of clinical hematopoietic stem cell transplantation and gene therapy targeted at hematopoietic stem cells. NUP98-HOXA10HD is a relatively newly discovered fusion gene that in mouse transplant experiments has been shown to increase numbers of hematopoietic stem cells. We evaluated whether this fusion gene could be used to expand engrafting human primitive CD34+ cells in an immunodeficient mouse model. Gene transfer was achieved using a lentiviral based vector. The engraftment of mobilized peripheral blood human CD34+ cells grown in culture for one week after gene transfer was evaluated 3-4 months after transplant and found to be 2-3 fold higher in the NUP98-HOXA10HD groups as compared to controls. These data suggest an expansive effect at least at the short term human repopulating cell level. Further evaluation in long term repopulating models and investment in a NUP98-HOXA10HD protein seems worthy of consideration. Additionally, the results here provide strong impetus to utilize NUP98-HOXA10HD as a tool to search for underlying genes and pathways involved in hematopoietic stem cell expansion that can be enhanced and have an even more potent expansive effect.

  4. Increased Engraftment of Human Short Term Repopulating Hematopoietic Cells in NOD/SCID/IL2rγnull Mice by Lentiviral Expression of NUP98-HOXA10HD.

    Science.gov (United States)

    Abraham, Allistair; Kim, Yoon-Sang; Zhao, Huifen; Humphries, Keith; Persons, Derek A

    2016-01-01

    Techniques to expand human hematopoietic stem cells ex-vivo could be beneficial to the fields of clinical hematopoietic stem cell transplantation and gene therapy targeted at hematopoietic stem cells. NUP98-HOXA10HD is a relatively newly discovered fusion gene that in mouse transplant experiments has been shown to increase numbers of hematopoietic stem cells. We evaluated whether this fusion gene could be used to expand engrafting human primitive CD34+ cells in an immunodeficient mouse model. Gene transfer was achieved using a lentiviral based vector. The engraftment of mobilized peripheral blood human CD34+ cells grown in culture for one week after gene transfer was evaluated 3-4 months after transplant and found to be 2-3 fold higher in the NUP98-HOXA10HD groups as compared to controls. These data suggest an expansive effect at least at the short term human repopulating cell level. Further evaluation in long term repopulating models and investment in a NUP98-HOXA10HD protein seems worthy of consideration. Additionally, the results here provide strong impetus to utilize NUP98-HOXA10HD as a tool to search for underlying genes and pathways involved in hematopoietic stem cell expansion that can be enhanced and have an even more potent expansive effect.

  5. First-in-Human Treatment With a Dendritic Cell-targeting Lentiviral Vector-expressing NY-ESO-1, LV305, Induces Deep, Durable Response in Refractory Metastatic Synovial Sarcoma Patient.

    Science.gov (United States)

    Pollack, Seth M; Lu, Hailing; Gnjatic, Sacha; Somaiah, Neeta; O'Malley, Ryan B; Jones, Robin L; Hsu, Frank J; Ter Meulen, Jan

    2017-10-01

    Effective induction of antitumor T cells is a pivotal goal of cancer immunotherapy. To this end, lentiviral vectors (LV) are uniquely poised to directly prime CD8 T-cell responses via transduction of dendritic cells in vivo and have shown promise as active cancer therapeutics in preclinical tumor models. However, until now, significant barriers related to production and regulation have prevented their widespread use in the clinic. We developed LV305, a dendritic cell-targeting, integration-deficient, replication incompetent LV from the ZVex platform, encoding the full-length cancer-testis antigen NY-ESO-1. LV305 is currently being evaluated in phase 1 and 2 trials in metastatic recurrent cancer patients with NY-ESO-1 positive solid tumors as a single agent and in combination with anti-PD-L1. Here we report on the first patient treated with LV305, a young woman with metastatic, recurrent, therapy-refractive NY-ESO-1 synovial sarcoma. The patient developed a robust NY-ESO-1-specific CD4 and CD8 T-cell response after 3 intradermal injections with LV305, and subsequently over 85% disease regression that is continuing for >2.5 years posttherapy. No adverse events >grade 2 occurred. This case demonstrates that LV305 can be safely administered and has the potential to induce a significant clinical benefit and immunologic response in a patient with advanced stage cancer.

  6. Anti-inflammatory effect of unsaturated fatty acids and Ergosta-7,22-dien-3-ol from Marthasterias glacialis: prevention of CHOP-mediated ER-stress and NF-κB activation.

    Directory of Open Access Journals (Sweden)

    David M Pereira

    Full Text Available There has been increasing awareness to the potential interest of drug discovery from marine natural products to treat several pathological conditions, including inflammation. In this work we describe the anti-inflammatory activity of several compounds present in the echinoderm Marthasterias glacialis (spiny sea-star, using the inflammatory model RAW 264.7 cells challenged with LPS. Lipidomic profiling of the organism revealed two major classes of compounds: fatty acids and sterols. Among these, the predominant compounds cis 11-eicosenoic and cis 11,14 eicosadienoic acids and the unsaturated sterol ergosta-7,22-dien-3-ol were evaluated. The mechanism of action of the compounds was distinct as they modulated different levels of the inflammation pathway. Classical inflammatory markers, such as COX-2, iNOS, IL-6 and NF-κB, were evaluated. We also studied the contribution of the CHOP pathway-mediated ER-stress to the inflammatory process. Overall, the sterol ergosta-7,22-dien-3-ol was the most active compound, however maximum activity was obtained when all compounds were tested in combination, thus suggesting a potentially synergistic activity of both classes of metabolites. This work establishes the echinoderm M. glacialis as an interesting source of anti-inflammatory molecules.

  7. shRNA libraries and their use in cancer genetics

    NARCIS (Netherlands)

    Bernards, R.A.; Brummelkamp, T.R.; Beijersbergen, R.L.

    2006-01-01

    RNA interference was originally described as a powerful tool to inhibit gene expression in model organisms. Until recently, loss-of-function genetic screens in mammalian cells were hampered by a lack of suitable tools that can be used in a high-throughput format. Here we discuss the construction of

  8. Pegylated liposomal doxorubicin replacing conventional doxorubicin in standard R-CHOP chemotherapy for elderly patients with diffuse large B-cell lymphoma: an open label, single arm, phase II trial.

    Science.gov (United States)

    Oki, Yasuhiro; Ewer, Michael S; Lenihan, Daniel J; Fisch, Michael J; Hagemeister, Fredrick B; Fanale, Michelle; Romaguera, Jorge; Pro, Barbara; Fowler, Nathan; Younes, Anas; Astrow, Alan B; Huang, Xuelin; Kwak, Larry W; Samaniego, Felipe; McLaughlin, Peter; Neelapu, Sattva S; Wang, Michael; Fayad, Luis E; Durand, Jean-Bernard; Rodriguez, M Alma

    2015-03-01

    The present multicenter phase II trial evaluated the safety and efficacy of pegylated liposomal doxorubicin (PLD) instead of conventional doxorubicin in standard R-CHOP (rituximab plus cyclophosphamide, doxorubicin, vincristine [Oncovin], and prednisone) therapy for elderly patients with diffuse large B-cell lymphoma. Patients aged > 60 years who had stage II to IV disease were included. Treatment consisted of rituximab 375 mg/m(2) intravenously (I.V.); cyclophosphamide 750 mg/m(2) IV; PLD 40 mg/m(2) (maximum, 90 mg) I.V. over 1 hour; and vincristine 2.0 mg I.V., all on day 1. Additionally prednisone, 40 mg/m(2), was given orally on days 1 to 1 to 5 (DRCOP [rituximab, cyclophosphamide, PLD, vincristine, and prednisone]). The cycles were repeated every 3 weeks for 6 to 8 cycles. Eighty patients were enrolled and were evaluable for toxicity. The median age was 69 years. All except 1 had additional cardiac risk factors for anthracycline-induced cardiac toxicity beyond advanced age. From the intent-to-treat analysis of 79 eligible patients, the overall response rate was 86%, and the complete response rate was 78%. Cardiac events greater than grade 3 were identified in 3 patients (4%); grade 1 to 2 events, mostly asymptomatic declines in ejection fraction, were noted in another 16 patients. One death was attributed to cardiac failure. The estimated 5-year event-free and overall survival rate was 52% and 70%, respectively. DRCOP represents an effective strategy for potentially mitigating cardiotoxicity in elderly patients with aggressive B-cell lymphoma. Future studies incorporating baseline cardiac risk assessments, long-term follow-up data, and biospecimen collection for correlative science should be undertaken. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Response of a simian immunodeficiency virus (SIVmac251 to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Greenhouse Jack

    2010-03-01

    Full Text Available Abstract Background In this study we successfully created a new approach to ART in SIVmac251 infected nonhuman primates. This drug regimen is entirely based on drugs affecting the pre-integration stages of replication and consists of only two nucleotidic/nucleosidic reverse transcriptase inhibitors (Nt/NRTIs and raltegravir, a promising new drug belonging to the integrase strand transfer inhibitor (INSTI class. Results In acutely infected human lymphoid CD4+ T-cell lines MT-4 and CEMx174, SIVmac251 replication was efficiently inhibited by raltegravir, which showed an EC90 in the low nanomolar range. This result was confirmed in primary macaque PBMCs and enriched CD4+ T cell fractions. In vivo monotherapy with raltegravir for only ten days resulted in reproducible decreases in viral load in two different groups of animals. When emtricitabine (FTC and tenofovir (PMPA were added to treatment, undetectable viral load was reached in two weeks, and a parallel increase in CD4 counts was observed. In contrast, the levels of proviral DNA did not change significantly during the treatment period, thus showing persistence of this lentiviral reservoir during therapy. Conclusions In line with the high conservation of the three main amino acids Y143, Q148 and N155 (responsible for raltegravir binding and molecular docking simulations showing similar binding modes of raltegravir at the SIVmac251 and HIV-1 IN active sites, raltegravir is capable of inhibiting SIVmac251 replication both in tissue culture and in vivo. This finding may help to develop effective ART regimens for the simian AIDS model entirely based on drugs adopted for treatment in humans. This ART-treated AIDS nonhuman primate model could be employed to find possible strategies for virus eradication from the body.

  10. Marketing plan for coffee chop Green

    OpenAIRE

    Strengell, Juuso

    2017-01-01

    The purpose of this thesis work is to develop and improve the visibility of the Coffee shop Green in terms of different marketing techniques. The company that requested the work is operating in University Tec de Monterrey Mexico Querétaro. The selected company wanted to improve their visibility among the students and wanted to have new tools to improve their marketing. Through new marketing techniques the selected company can have more customers daily bases and is able to earn more profits. ...

  11. Burning and chopping for woodpeckers and wiregrass?

    Science.gov (United States)

    Joan L. Walker; Brian P. van Eerden; David Robinson; Mike Hausch

    2004-01-01

    To restore red-cockaded woodpecker habitat managers must reduce hardwoods while maintaining native ground cover. Fire, chemical, and mechanical methods are used alone or in combination to reduce oaks. Previous studies have reported selected single treatment effects (e.g., Outcalt and Lewis 1990, Robbins and Myers 1992, Glitzenstein et al. 1995, Provencher et al. 2001...

  12. Immunogenetics of Small Ruminant Lentiviral Infections

    Directory of Open Access Journals (Sweden)

    Nancy Stonos

    2014-08-01

    Full Text Available The small ruminant lentiviruses (SRLV include the caprine arthritis encephalitis virus (CAEV and the Maedi-Visna virus (MVV. Both of these viruses limit production and can be a major source of economic loss to producers. Little is known about how the immune system recognizes and responds to SRLVs, but due to similarities with the human immunodeficiency virus (HIV, HIV research can shed light on the possible immune mechanisms that control or lead to disease progression. This review will focus on the host immune response to HIV-1 and SRLV, and will discuss the possibility of breeding for enhanced SRLV disease resistance.

  13. Lentiviral vectors for treatment of haemophilia

    OpenAIRE

    Ward, N. J.

    2010-01-01

    Haemophilia A and B are X‐linked recessive disorders caused by defects in coagulation factors (F) VIII and IX, respectively. Severe cases of haemophilia are characterised by episodes of spontaneous bleeding, predominantly into the joints and muscles, and can result in permanent disability and even mortality if left untreated. The haemophilias are compelling candidates for treatment with gene therapy as therapeutic benefit only requires a modest increase in the endogenous coagul...

  14. Design of lentivirally expressed siRNAs

    NARCIS (Netherlands)

    Liu, Ying Poi; Berkhout, Ben

    2013-01-01

    RNA interference (RNAi) has been widely used as a tool for gene knockdown in fundamental research and for the development of new RNA-based therapeutics. The RNAi pathway is typically induced by expression of ∼22 base pair (bp) small interfering RNAs (siRNAs), which can be transfected into cells. For

  15. Utilisation of chopped wood resulting from the cultivation of forests and maintenance of hedgerows in decentralized heating power stations. Final report; Nutzung von Schwach- und Knickholz fuer dezentrale Heizwerke. Abschlussbericht

    Energy Technology Data Exchange (ETDEWEB)

    Isensee, E.; Stuebig, D.K.

    2000-08-31

    The desired ecological goal is the efficient use of a natural byproduct resulting from the cultivation of forests and the maintenance of hedgerows. Since present expenditure is quite high, rational processing techniques are necessary. The entire process is being investigated within the framework of a project promoted by the Deutsche Bundesstiftung Umwelt (DBU), in co-operation with partners from the industrial and agricultural service sectors. Firstly, the vegetation, amongst which the wood of hedgerows ranks, is characterised. The hedgerows grow on earthen walls and consist of numerous types of wood. They are cut after 10-12 years in order to promote a dense and varied regeneration, facilitating their ecological function. This thesis develops and outlines solutions to be utilised in the collection and reduction (i.e. cutting/chopping) of broad swaths of biomass. Owing to earlier observations, various concepts within the co-operative are being implemented, with an aspect to the examination of processing techniques. In the selection of processing components, emphasis is made on the demand for the use of the existing farming machinery available in agricultural enterprises. The energy requirements of a professional woodcutter are large in comparison to those of a machine. The self-propelled field cutter presents the possibility of fulfilling performance, chassis and drive requirements. The difference between this innovation and existing solutions lies in the aim to replace the present discontinuity of stop-and-go methods with a continuous processing system. As a result of this, the pick-up is gradually being improved. Drive, cutter and pick-up are planned to specifications resulting from past investigations. The application of these units demonstrates that the hedgerows produce more biomass than originally calculated. Therefore, ideas are being generated to facilitate the realization of continuous processing systems. This thesis also investigates the transportation of

  16. A competitive cell growth assay for the detection of subtle effects of gene transduction on cell proliferation

    NARCIS (Netherlands)

    Eekels, J. J. M.; Pasternak, A. O.; Schut, A. M.; Geerts, D.; Jeeninga, R. E.; Berkhout, B.

    2012-01-01

    RNA interference (RNAi) is a sequence-specific gene silencing mechanism with therapeutic potential against many human pathogens. To obtain a durable therapeutic effect, stable transduction of target cells with for instance a lentiviral vector that expresses a short hairpin (shRNA) inducer of the

  17. Modelagem comparativa da cinética da fase sólida do capim-elefante picado, suplementado ou não com concentrados, e fornecido a vacas Holandês x Zebu em lactação Comparative modeling of chopped elephantgrass particulate kinectics in crossbred lactating cows receiving or not concentrate supplement

    Directory of Open Access Journals (Sweden)

    F.C.F. Lopes

    2008-06-01

    Full Text Available Foram comparadas as estimativas da cinética da fase sólida do capim-elefante (Pennisetum purpureum, Schum. picado, mordentado com cromo (Cr, obtidas do ajuste de dois modelos não-lineares (bicompartimental tempo-independente e multicompartimental tempo-dependente a resultados de excreção fecal de vacas Holandês x Zebu em lactação. Utilizaram-se dados de dois experimentos realizados em anos diferentes com capim-elefante cortado aos 60 e 45 dias, e suplementado, 3,3kg/vaca/dia, base matéria natural, ou não com concentrados. Foram utilizadas quatro e três vacas, respectivamente, no primeiro e no segundo ano de experimentação, havendo sempre duas fases de coleta de dados, necessárias para permitir que cada vaca pudesse ser avaliada em cada tratamento. As taxas de passagem ruminal estimadas variaram de 3,0 a 3,2%/h no modelo bicompartimental tempo-independente, e de 2,6 a 3,0%/h no modelo multicompartimental tempo-dependente, enquanto as respectivas taxas de passagem pós-ruminal variaram de 4,9 a 7,4%/h e de 7,4 a 10,9%/h. Os tempos médios de retenção do capim-elefante no trato gastrintestinal das vacas variaram de 66,0 a 76,2h no modelo bicompartimental tempo-independente, e de 48,1 a 57,8h no modelo multicompartimental tempo-dependente. O processo de dependência de tempo imposto pelo modelo multicompartimental permitiu melhor ajuste aos dados de excreção fecal do Cr, em relação ao modelo bicompartimental.Particulate kinetics estimates of chopped elephantgrass (Pennisetum purpureum, Schum. mordanted with Chromium (Cr were obtained and compared by the adjustment of two nonlinear models - age-independent double-compartmental model and age-dependent multicompartmental model - to a Cr faecal excretion dates of lactating crossbred Holstein x Zebu cows. Results from two trials carried out in different years with elephantgrass cut at 60 and 45 days of growth and supplemented, 3,3 kg/cow/day, wet basis, or not with concentrates were

  18. Performance of Nellore steers grazing on Panicum maximum Jacq cv. Mombaça receiving chopped sugar cane tops and protein supplementation =Desempenho de novilhos Nelore em pastagem de Panicum maximum Jacq. cv. Mombaça recebendo cana-de-açúcar picada e suplementação proteica

    Directory of Open Access Journals (Sweden)

    Silvana Teixeira

    2010-10-01

    Full Text Available The aim of this study was to evaluate protein supplementation on theperformance of steers grazing on Mombaça grass and receiving chopped sugar cane tops at a level of 0.80% of live weight (dry matter (DM basis, during the dry season. Forage availability and quality of the experimental pasture were also evaluated. Thirty-two Nellore steers, weighing 300 kg (. 25.80 of initial live weight, eight per treatment, were used. The statistical design was completely randomized and each steer group was allocated to one of four paddocks (1.125 ha paddock-1. All steers received a protein supplement at 0.40% of live weight (DM basis and the four treatments consisted of the following four crude protein (CP concentrations in supplements: 12.5, 25.0, 37.5 and 50.0% CP (DM basis. Average forage mass availability and green leaf blades availability were 10,069 and 2,195 kg of DM ha-1, respectively. Average CP, neutral fiber detergent (NDF and in vitro dry matter digestibility (IVDMD in forage mass were 6.87, 62.63 and 49.80%, respectively. Average daily gain was 0.61 kg steer-1 day-1 and these results show that the strategy of feeding steers in pasture, with chopped sugar cane tops (0.80% LW and protein supplement with 12.50% CP (0.40% LW, during the dry season, allows high gain per area (363 kg live weight ha-1.No experimento foi avaliado o efeito da suplementação proteica sobre o desempenho de novilhos que pastejam capim Mombaça e recebem cana-de-açúcar picada, em nível de 0,80% do peso vivo (PV (base matéria seca, MS. Também foram avaliadas a disponibilidade e a qualidade da forragem da área experimental. Foram usados 32 novilhos da raça Nelore, com peso inicial de 300 kg (± 25,80. O delineamento experimental foi inteiramente casualizado e cada grupo de novilhos foi alocado para cada um dos quatro piquetes (1,125 ha piquete-1. Os animais receberam suplemento proteico em nível de 0,40% do PV (base MS e os quatro tratamentos consistiam de suplementos

  19. Alteraciones en el endotelio corneal después de la facoemulsificación por técnica de pre chop versus extracción tunelizada esclerocorneal del cristalino Alterations of the corneal endothelium after prechop phacoemulsification versus tunnelized scleracorneal extraction of the crystalline

    Directory of Open Access Journals (Sweden)

    Belkys Rodríguez Suárez

    2012-12-01

    Full Text Available Objetivo: evaluar los cambios endoteliales y resultados visuales en los ojos de pacientes con diagnóstico de catarata senil, operados por técnica de facoemulsificación por pre chop o extracción extracapsular del cristalino por túnel esclerocorneal. Métodos: se realizó un estudio descriptivo y prospectivo de 100 pacientes (ojos atendidos en el Instituto Cubano de Oftalmología "Ramón Pando Ferrer", de septiembre a diciembre de 2010. La mitad fueron operados por facoemulsificación y el resto por túnel esclerocorneal. Se analizaron las variables: mejor agudeza visual corregida y sin corrección, dureza del cristalino, conteo celular endotelial, hexagonalidad, coeficiente de variabilidad, astigmatismo medio inducido y tiempo efectivo de ultrasonido. Resultados: la pérdida celular endotelial en el grupo de facoemulsificación fue de 9,8 % y en el de extracción tunelizada, de 6,8 %. La hexagonalidad promedio posoperatoria fue mejor en el grupo de facoemulsificación (53 %. El coeficiente de variabilidad promedio preoperatorio disminuyó de 0,32 a 0,28 en el grupo de facoemulsificación. En este grupo el astigmatismo resultante fue de 1,35 D y el tiempo efectivo de facoemulsificación estuvo por debajo de los 2 minutos. En ambos grupos la mejor agudeza visual preoperatoria sin corrección promedio fue de 0,29 y mejoró a 0,56 en la extracción por túnel esclerocorneal y a 0,8 en la facoemulsificación. Conclusiones: la facoemulsificación por pre chop, constituye una buena opción en la cirugía de catarata. Las alteraciones endoteliales que provoca son similares a las de la extracción tunelizada, con ventaja sobre esta en la visión sin cristales por la menor inducción de astigmatismo.Objective: to evaluate the endothelial changes occurred and the visual results achieved in the eyes of patients diagnosed with senile cataract, who were operated on either by the prechop phacoemulsification technique or by the extracapsular extraction of

  20. Comparison of conventional prognostic indices in patients older than 60 years with diffuse large B-cell lymphoma treated with R-CHOP in the US Intergroup Study (ECOG 4494, CALGB 9793): consideration of age greater than 70 years in an elderly prognostic index (E-IPI).

    Science.gov (United States)

    Advani, Ranjana H; Chen, Haiyan; Habermann, Thomas M; Morrison, Vicki A; Weller, Edie A; Fisher, Richard I; Peterson, Bruce A; Gascoyne, Randy D; Horning, Sandra J

    2010-10-01

    To assess if immunochemotherapy influenced the prognostic value of IPI in elderly diffuse large B-cell lymphoma (DLBCL) patients, we evaluated the performance of the standard International Prognostic Index (IPI) and following modifications: age adjusted (AA)-IPI, revised (R)-IPI, and an elderly IPI with age cut-off 70 years (E-IPI) in patients > 60 years treated with RCHOP (rituximab, cyclophosphamide, doxorubicin, vincristine and prednisone). In 267 patients, by IPI/AA-IPI 60% were high-intermediate, 53% high and 12% low risk. With R-IPI, 60% were poor risk and none very good risk. Using E-IPI, 45% were high-intermediate/high risk and 27% low risk. No differences in outcome were seen in the low/low-intermediate groups with IPI/AA-IPI. For E-IPI, failure-free survival (FFS) and overall survival (OS) were significantly different for low/low-intermediate groups. No differences were detected in the four indices with model fit/discrimination measures; however, E-IPI ranked highest. For elderly R-CHOP treated patients, distribution of IPI/AA-IPI skewed toward high/high-intermediate risk with no differences in FFS/OS between low/low-intermediate risk. In contrast, with E-IPI, more are classified as low risk with significant differences in FFS/OS for low-intermediate compared to low risk. The R-IPI does not identify a very good risk group, thus minimizing its utility in this population. The prognostic discrimination provided by the E-IPI for low and low-intermediate elderly DLBCL patients needs validation by other datasets. © 2010 Blackwell Publishing Ltd.

  1. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  2. G-protein Receptor Kinase 5 Regulates the Cannabinoid Receptor 2-induced Up-regulation of Serotonin 2A Receptors*

    Science.gov (United States)

    Franklin, Jade M.; Carrasco, Gonzalo A.

    2013-01-01

    We have recently reported that cannabinoid agonists can up-regulate and enhance the activity of serotonin 2A (5-HT2A) receptors in the prefrontal cortex (PFCx). Increased expression and activity of cortical 5-HT2A receptors has been associated with neuropsychiatric disorders, such as anxiety and schizophrenia. Here we report that repeated CP55940 exposure selectively up-regulates GRK5 proteins in rat PFCx and in a neuronal cell culture model. We sought to examine the mechanism underlying the regulation of GRK5 and to identify the role of GRK5 in the cannabinoid agonist-induced up-regulation and enhanced activity of 5-HT2A receptors. Interestingly, we found that cannabinoid agonist-induced up-regulation of GRK5 involves CB2 receptors, β-arrestin 2, and ERK1/2 signaling because treatment with CB2 shRNA lentiviral particles, β-arrestin 2 shRNA lentiviral particles, or ERK1/2 inhibitor prevented the cannabinoid agonist-induced up-regulation of GRK5. Most importantly, we found that GRK5 shRNA lentiviral particle treatment prevented the cannabinoid agonist-induced up-regulation and enhanced 5-HT2A receptor-mediated calcium release. Repeated cannabinoid exposure was also associated with enhanced phosphorylation of CB2 receptors and increased interaction between β-arrestin 2 and ERK1/2. These latter phenomena were also significantly inhibited by GRK5 shRNA lentiviral treatment. Our results suggest that sustained activation of CB2 receptors, which up-regulates 5-HT2A receptor signaling, enhances GRK5 expression; the phosphorylation of CB2 receptors; and the β-arrestin 2/ERK interactions. These data could provide a rationale for some of the adverse effects associated with repeated cannabinoid agonist exposure. PMID:23592773

  3. Inhibition of porcine transmissible gastroenteritis virus (TGEV) replication in mini-pigs by shRNA.

    Science.gov (United States)

    Zhou, Junfang; Huang, Fen; Hua, Xiuguo; Cui, Li; Zhang, Wen; Shen, Yan; Yan, Yijia; Chen, Piren; Ding, Dezhong; Mou, Jing; Chen, Qi; Lan, Daoliang; Yang, Zhibiao

    2010-04-01

    Transmissible gastroenteritis virus (TGEV) is the causative agent of porcine transmissible gastroenteritis (TGE), characterized by high mortality and severely retarded growth in piglets that dramatically affects the porcine industry. Previously, we have identified two shRNA-expressing plasmids pEGFP-U6/P1 and pEGFP-U6/P2 that target RNA-dependent RNA polymerase (RdRP) gene of TGEV with more than 95% of virus inhibition in vitro. In this study, inhibition of the TGEV replication by pEGFP-U6/P1 and pEGFP-U6/P2 was tested in mini-pigs. SPF mini-pigs at 25 days old were injected with the shRNA-expressing plasmids and then infected with TGEV. The results from the analyses of clinical signs, histopathology, indirect immunofluorescence (IIF) and RT-PCR show that the two shRNA-expressing plasmids could significantly decrease the quantity of TGEV in different organs and protect mini-pigs from TGEV infection. These findings illustrate the prospect for TGEV-specific shRNAs to be new anti-TGEV agents. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.

  4. Potential of adenovirus and baculovirus vectors for the delivery of shRNA against morbilliviruses.

    Science.gov (United States)

    Nizamani, Zaheer Ahmed; Keil, Gunther M; Albina, Emmanuel; Holz, Carine; Minet, Cécile; Kwiatek, Olivier; Libeau, Geneviève; Servan de Almeida, Renata

    2011-04-01

    Morbilliviruses are important pathogens of humans, ruminants, carnivores and marine mammals. Although good vaccines inducing long-term immunity are available, recurrent outbreaks of measles, canine distemper and peste des petits ruminants (PPR) are observed. In control strategies, antivirals thus could be useful to confine virus spread and application of interfering RNAs is a promising approach, provided they can be delivered efficiently into the host cells. We have constructed recombinant adenovirus and baculovirus vectors expressing short hairpin RNAs (shRNAs) against the PPR virus (PPRV) and compared them in vitro. It was found that both recombinant viruses inhibited PPRV replication with the baculovirus vector, which inhibited generation of infectious progeny by more than 2 log10 and the nucleoprotein expression of PPRV by 73%, being the more efficient. The results show that baculoviral shRNA-expressing vectors have the potential for therapeutic use against morbillivirus infections. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Targeting cleavage and polyadenylation specific factor 1 via shRNA ...

    Indian Academy of Sciences (India)

    Beiguang Zhang

    2017-07-27

    Jul 27, 2017 ... the mRNA level of CPSF1 was overexpressed in ovarian cancer tissues using Oncomine Cancer Microarray database. .... cells was analysed by blue fluorescent Hoechst 33342 dye .... Quantitative data of CDK4 and Cyclin D1 proteins were expressed as mean ± standard deviation (SD) of three repeated.

  6. Targeting cleavage and polyadenylation specific factor 1 via shRNA ...

    Indian Academy of Sciences (India)

    Cleavage and polyadenylation specificity factor 1 (CPSF1), a member of CPSF complex, has been reported to play a keyrole in pre-mRNA 30-end formation, but its possible role in ovarian cancer remains unclear. In the present study, we foundthe mRNA level of CPSF1 was overexpressed in ovarian cancer tissues using ...

  7. Identification of Prostate Cancer Metastasis-Suppressor Genes Using Genomic shRNA Libraries

    National Research Council Canada - National Science Library

    Gelman, Irwin H

    2008-01-01

    .... However, little is known regarding the genetics that control disease recurrence. Our proposed research was to screen for metastasis- inducing genes in LNCaP and LAPC-4 CaP cells using libraries expressing RNAi covering the entire human genome...

  8. Towards improved shRNA and miRNA reagents as inhibitors of HIV-1 replication

    NARCIS (Netherlands)

    Berkhout, Ben; Liu, Ying Poi

    2014-01-01

    miRNAs are the key players of the RNAi mechanism, which regulates the expression of a large number of mRNAs in human cells. shRNAs are man-made synthetic miRNA mimics that exploit similar intracellular RNA processing routes. Massive amounts of data derived from next-generation sequencing have

  9. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  10. Tribological dry sliding behavior of chopped carbon fiber reinforced polyetheretherketone

    Science.gov (United States)

    Chumaevskii, A. V.; Ivanov, A. N.; Filippov, A. V.; Rubtsov, V. E.; Kolubaev, E. A.

    2017-12-01

    Tribological tests on 3D printed pure polyetheretherketone and carbon fiber reinforced polyetheretherketone samples were carried out. The negative effect of carbon fiber sticking out of the matrix on wear and sliding process stability was revealed. These fibers may be too long and oriented to the worn surface in a manner that prevents their removal by wear so that the worn surface becomes irregular and the sliding process instable.

  11. Method of preparing and handling chopped plant materials

    Science.gov (United States)

    Bransby, David I.

    2002-11-26

    The method improves efficiency of harvesting, storage, transport, and feeding of dry plant material to animals, and is a more efficient method for harvesting, handling and transporting dry plant material for industrial purposes, such as for production of bioenergy, and composite panels.

  12. Compression molding of chopped woven thermoplastic composite flakes

    NARCIS (Netherlands)

    Abdul Rasheed, Mohammed Iqbal

    2016-01-01

    Continuous fiber reinforced composites with high-performance thermoplastic polymer matrices have an enormous potential in terms of performance, production rate, cost efficiency and recyclability. The use of this relatively new class of materials by the aerospace and automotive industry has been

  13. Carbon Nanotube Chopped Fiber for Enhanced Properties in Additive Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Menchhofer, Paul A [ORNL; Lindahl, John M [ORNL; JohnsonPhD, DR Joseph E. [Nanocomp Technologies, Inc.

    2016-06-06

    Nanocomp Technologies, Inc. is working with Oak Ridge National Laboratory to develop carbon nanotube (CNT) composite materials and evaluate their use in additive manufacturing (3D printing). The first phase demonstrated feasibility and improvements for carbon nanotube (CNT)- acrylonitrile butadiene styrene (ABS) composite filaments use in additive manufacturing, with potential future work centering on further improvements. By focusing the initial phase on standard processing methods (developed mainly for the incorporation of carbon fibers in ABS) and characterization techniques, a basis of knowledge for the incorporation of CNTs in ABS was learned. The ability to understand the various processing variables is critical to the successful development of these composites. From the degradation effects on ABS (caused by excessive temperatures), to the length of time the ABS is in the melt state, to the order of addition of constituents, and also to the many possible mixing approaches, a workable flow sequence that addresses each processing step is critical to the final material properties. Although this initial phase could not deal with each of these variables in-depth, a future study is recommended that will build on the lessons learned for this effort.

  14. International trade in meat: the tip of the pork chop.

    Science.gov (United States)

    Galloway, James N; Burke, Marshall; Bradford, G Eric; Naylor, Rosamond; Falcon, Walter; Chapagain, Ashok K; Gaskell, Joanne C; McCullough, Ellen; Mooney, Harold A; Oleson, Kirsten L L; Steinfeld, Henning; Wassenaar, Tom; Smil, Vaclav

    2007-12-01

    This paper provides an original account of global land, water, and nitrogen use in support of industrialized livestock production and trade, with emphasis on two of the fastest-growing sectors, pork and poultry. Our analysis focuses on trade in feed and animal products, using a new model that calculates the amount of "virtual" nitrogen, water, and land used in production but not embedded in the product. We show how key meat-importing countries, such as Japan, benefit from "virtual" trade in land, water, and nitrogen, and how key meat-exporting countries, such as Brazil, provide these resources without accounting for their true environmental cost. Results show that Japan's pig and chicken meat imports embody the virtual equivalent of 50% of Japan's total arable land, and half of Japan's virtual nitrogen total is lost in the US. Trade links with China are responsible for 15% of the virtual nitrogen left behind in Brazil due to feed and meat exports, and 20% of Brazil's area is used to grow soybean exports. The complexity of trade in meat, feed, water, and nitrogen is illustrated by the dual roles of the US and The Netherlands as both importers and exporters of meat. Mitigation of environmental damage from industrialized livestock production and trade depends on a combination of direct-pricing strategies, regulatory approaches, and use of best management practices. Our analysis indicates that increased water- and nitrogen-use efficiency and land conservation resulting from these measures could significantly reduce resource costs.

  15. development of oscillating classifiers for forage chop length ...

    African Journals Online (AJOL)

    Dr Obe

    1987-09-01

    Sep 1, 1987 ... size is defined. The size of the particles are reported in terms of geometric mean length and geometric standard deviation by weight. The particle size determined is used to evaluate forage harvesting machine and to define forage characteristics with regards to animal feeding trials. 1. INTRODUCTION.

  16. Supporting mindful eating: InBalance chopping board

    NARCIS (Netherlands)

    Toet, E.N.; Meerbeek, B.W.; Hoonhout, H.C.M.

    2012-01-01

    In our affluent Western society, food is easy to obtain and high calorie food is presented to us everywhere. And apparently hard to resist, since obesity is a growing problem, with an increase in a rangeof health issues attributed to overweight, such as cardiovascular diseases and diabetes. In the

  17. Compression molding of chopped woven thermoplastic composite flakes

    OpenAIRE

    Abdul Rasheed, Mohammed Iqbal

    2016-01-01

    Continuous fiber reinforced composites with high-performance thermoplastic polymer matrices have an enormous potential in terms of performance, production rate, cost efficiency and recyclability. The use of this relatively new class of materials by the aerospace and automotive industry has been growing steadily during the last decade. However, the use of continuous reinforcements limit the complexity of the shape of the end products, as defects such as wrinkles can form during processing. Mor...

  18. Detection and control of lentiviral infections in sheep and goats

    NARCIS (Netherlands)

    Brinkhof, J.M.A.

    2009-01-01

    Infections caused by the small ruminant lentiviruses (SRLV) of sheep (maedi visna virus) and goats (caprine arthritis encephalitis virus) are a serious economical threat to small ruminant farming particularly in the more intensive settings like dairy farms. Revenue is ultimately negatively

  19. Construction and Screening of a Lentiviral Secretome Library.

    Science.gov (United States)

    Liu, Tao; Jia, Panpan; Ma, Huailei; Reed, Sean A; Luo, Xiaozhou; Larman, H Benjamin; Schultz, Peter G

    2017-06-22

    Over 2,000 human proteins are predicted to be secreted, but the biological function of the many of these proteins is still unknown. Moreover, a number of these proteins may act as new therapeutic agents or be targets for the development of therapeutic antibodies. To further explore the extracellular proteome, we have developed a secretome-enriched open reading frame (ORF) library that can be readily screened for autocrine activity in cell-based phenotypic or reporter assays. Next-generation sequencing (NGS) and database analysis predict that the library contains approximately 900 ORFs encoding known secreted proteins (accounting for 77.8% of the library), as well as genes encoding potentially unknown secreted proteins. In a proof-of-principle study, human TF-1 cells were screened for proliferative factors, and the known cytokine GMCSF was identified as a dominant hit. This library offers a relatively low-cost and straightforward approach for functional autocrine screens of secreted proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Lentiviral modification of enriched populations of bovine male gonocytes.

    Science.gov (United States)

    Kim, K-J; Cho, C M; Kim, B-G; Lee, Y-A; Kim, B-J; Kim, Y-H; Kim, C G; Schmidt, J A; Ryu, B-Y

    2014-01-01

    Undifferentiated germ cells have the capacity to develop into sperm capable of fertilizing oocytes and contributing genetic material to subsequent generations. The most primitive prepubertal undifferentiated germ cells include gonocytes and undifferentiated spermatogonia, including spermatogonial stem cells (SSC). Gonocytes, present in the testis at birth, differentiate into SSC, which maintain spermatogenesis for the remainder of the male's life. Because of their capacity to contribute to lifelong spermatogenesis, undifferentiated germ cells are attractive targets for genetic modification to produce transgenic animals, including cattle. To maximize the efficiency of genetic modification of bovine gonocytes and SSC, effective enrichment techniques need to be developed. Selection of bovine gonocytes using differential plating was improved 8-fold (P green fluorescent protein. Transduction efficiency was 17%. Collectively, these data demonstrate effective methods for the selection and genetic modification of bovine undifferentiated germ cells.

  1. Lentiviral Delivery of RNAi Effectors Against HIV-1

    NARCIS (Netherlands)

    Liu, Ying Poi; Berkhout, Ben

    2009-01-01

    RNA interference (RNAi) holds great promise as gene therapy approach against viral pathogens, including HIV-1. A specific anti-HIV-1 response can be induced via transfection of synthetic small interfering RNAs (siRNAs) or via intracellular transgene expression of short hairpin RNAs (shRNAs) or

  2. EFECTO DE LA ADICIÓN DE CARRAGENINA KAPPA I.II Y GOMA TARA SOBRE CARACTERÍSTICAS DE CALIDAD DEL JAMÓN DE CERDO PICADO Y COCIDO EFFECT OF THE ADDITION OF KAPPA I.II CARRAGEENAN AND TARA GUM ON QUALITY CHARACTERISTICS OF COOKED AND CHOPPED PORK HAMS

    Directory of Open Access Journals (Sweden)

    Diego Alonso Restrepo Molina

    2010-12-01

    Full Text Available Se evaluaron sinéresis, color y dureza instrumental y, sensorialmente las características de olor, sabor, color y dureza en jamones inyectados, cocidos y picados de cerdo, los cuales se habían elaborado aplicando en la salmuera de inyección una mezcla de hidrocoloides compuesta por carragenina kappa I.II y goma tara en una proporción de 79:21, en niveles del 1% y 1,2%, usando tres repeticiones para el estudio. Los jamones así elaborados se compararon contra un jamón testigo, elaborado sin el uso de estos hidrocoloides. Los valores obtenidos para los atributos, se analizaron mediante un diseño de una sola vía, con 5 repeticiones en el tiempo (0, 10, 20, 28 y 34 días, dando un arreglo factorial. Los resultados muestran que el tratamiento 2 (1,2% presentó la menor liberación de agua y la mayor dureza. No se registró diferencia entre los tratamientos y el testigo para la característica elasticidad. El testigo mostró las mejores características de color, olor y sabor sensoriales. La edad influyó en las características dureza y sinéresis en forma determinante, señalando el período desde el día 15 hasta el día 28 como aquel en que más se agudiza la sinéresis, siendo ésta más notable en el testigo que no contenía hidrocoloide.Characteristics of quality, color, texture and sineresis (instrumental and, odor, flavor, color and hardness (sensory of injected, cooked and chopped pork hams were assessed, which were manufactured using a mix of hydrocolloids in the brine of injection comprised by kappa I.II carrageenan and tara gum in a 79:21 ratio, at levels of 1% and 1.2%, using three replicates for the study; the finished hams were compared with a control ham, manufactured without the use of these hydrocolloids. The values obtained for the attributes, were analyzed through a one way design, with 5 repetitions in time (0, 10, 20, 28 and 34 days, providing a factorial arrangement. The results showed that the treatment 2 (1

  3. Composição florística de plantas daninhas na dultura do feijão-caupi no sistema de capoeira triturada Floristic composition of weeds in the cowpea (Vigna unguiculata culture under the chopped secondary forest system

    Directory of Open Access Journals (Sweden)

    L.J.P. Marques

    2010-01-01

    . Since weed management is an essential part of the production process, this study aimed to survey the flora in no-tillage areas of a chopped secondary forest cultivated with cowpea. This work was conducted in a rural farming area in the municipality of Zé Doca, MA in the agricultural years 2006/2007 and 2007/2008. The preparation of the area was carried out with a wheel tractor using the implement ahwi FM600. The area was originally planted with maize followed by BRS Guariba cowpea for two years.Weed evaluation was carried out 30 and 60 days after sowing with a rectangle (0.5 x 0.3 m, launched 30 times. Evaluation was performed every time, with the aerial parts of the weeds being harvested for counting, identification, and drying, to obtain the phytosociological indices (frequency, density, dominance index, and importance value. The families with the most weed species were Cyperaceae (7, Fabaceae (7, Poaceae (6, Malvaceae (5 and Rubiaceae (4. In the agricultural years 2006/2007, the species with the highest IVI were: Cyperus diffusus, Fimbristylis dichotoma, Spermacoce verticillata and Cyperus sp. In the agricultural years 2007/2008, the main species were: Digitaria horizontalis, followed by C. diffusus, Pavonia cancellata and F. dichotoma. The secondary forest plants originated from sprouting presented the highest IVIs in the agricultural year 2006/2007 and suffered a drastic reduction in 2007/2008. Thus, it can be concluded that progressive cultivation reduces secondary forest plant sprouting and increases the herbaceous extract.

  4. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  5. Large-pore mesoporous silica nanospheres as vehicles for delivering TRAF3-shRNA plasmids to Kupffer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Junyong, E-mail: zhangmachine@hotmail.com [Department of Hepatobiliary Surgery and Department of Urinary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Guo, Shipeng, E-mail: guoshipeng2008@126.com [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Zhang, Wenfeng, E-mail: Sadengren8881@163.com [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Niu, Dechao, E-mail: niudechao_2002@163.com [Low-Dimensional Materials Chemistry, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology (China); Gong, Jianping, E-mail: gjp_cqmu@yeah.net [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China)

    2016-01-08

    The currently available techniques for transferring exogenous genes into macrophages, especially the targeted import of exogenous genes into Kupffer cells (KCs) in vivo, are inefficient and achieve only low targeting. Novel Large-Pore Mesoporous Silica Nanospheres (LPMSNs) may be a promising gene transfection agent for KCs because of their superior biodegradation and hypotoxic characteristics, as well as their ability to retain the biological function of KCs and the high loading-rate of exogenous plasmid. LPMSNs were able to completely adsorb shRNA-TRAF3 (tumor necrosis factor receptor-associated factor-3) plasmid at a mass ratio as low as 30:1, and exhibited a low cytotoxicity for KCs. LPMSNs were detected in KC cytoplasm in vitro, and transmission electron microscopy (TEM) revealed that they were present only in KCs in liver tissue in vivo. The max KC transfection efficiency with LPMSNs was 34.8± 0.07%, as evaluated using flow cytometry, and the protein and mRNA levels of TRAF3 were significantly inhibited (P < 0.05) by shRNA-TRAF3 plasmid transfection after 24 h in vitro and 48 h in vivo. In conclusion, KC targeted transfection was achieved successfully by LPMSNs carrying shRNA-TRAF3 plasmids in vitro and vivo. The protein and mRNA levels of TRAF3 were suppressed significantly. These results suggest that LPMSNs are a promising vehicle for delivering exogenous genes into KCs in vitro and vivo. - Highlights: • We constructed Large-Pore Mesoporous Silica Nanospheres (LPMSNs). • LPMSNs adsorbed high quantity of plasmid. • Low cytotoxicity of LPMSNs to Kupffer cells. • LPMSNs delivered plasmid into Kupffer cells.

  6. Gene therapy targeting hepatocellular carcinoma by a dual-regulated oncolytic adenovirus harboring the focal adhesion kinase shRNA.

    Science.gov (United States)

    Gao, Yang; Zhu, Yayun; Huang, Xinyu; Ai, Kaixing; Zheng, Qi; Yuan, Zhou

    2015-08-01

    Cancer targeting gene-viro-therapy (CTGVT) approach has become a hotspot and a trend in the field of cancer biotherapy and oncolytic adenovirus is an ideal vector to carry the targeting genes. In this study, we used human telomerase reverse transcriptase (hTERT) promoter to control the adenovirus early region 1a (E1A) and the human α-fetoprotein (AFP) promoter integrated with hypoxia response element (HRE) to control the adenovirus early region 1b (E1B). Then the novel double-regulated adenovirus Ad-hTERT-HREAF (named SG505) was engineered. The short-hairpin RNA against focal adhesion kinase (FAK) was inserted into SG505 and thus forming Ad-hTERT-HREAF-shRNA (called SG505‑siFAK). Then various oncolytic adenoviruses were examined to verify whether they could suppress liver cancer cells selectively and efficiently both in vitro and in vivo. Both replicative and replication-defective adenoviruses carrying FAK-shRNA significantly inhibited the expression of FAK in Hep3B and SMMC-7721 cell lines and efficiently suppressed the growth of liver cancer cell lines with minor effect to normal cells. Furthermore, the recombined oncolytic adenoviruses, SG505-siFAK, SG505-EGFP and SG505 were able to selectively propagate in AFP-positive liver cancer cells in vitro and the SG505-siFAK efficiently suppressed the expression of FAK. SG505-siFAK showed the most potent tumor inhibition capability among the three recombined adenovirus with IC50 levels of 0.092±0.009 and 0.424±0.414 pfu/cell in the Hep3B and HepG2 cell line, respectively. Animal experiment further confirmed that SG505-siFAK achieved the most significant tumor inhibition of Hep3B liver cancer xenografted growth by intratumoral injection comparing to the intravenous injection among the three recombined viruses. Immunohistochemical results indicated that FAK expression was downregulated significantly in the tumors treated with SG505-siFAK. The dual-regulated oncolytic adenovirus SG505-siFAK was proven to inhibit the growth of liver cancer cells selectively and efficiently, therefore SG505-siFAK could be a potential agent for future clinical trials of hepatocellular carcinoma.

  7. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  8. Investigating the Role of Akt1 in Prostate Cancer Development through Phosphorylation-dependent Regulation of Skp2 Stability and Oncogenic Function

    Science.gov (United States)

    2012-09-01

    and SKBR3 cell lines (Fig. 2), depletion of endogenous Akt1, but not Akt2, leads to a significant decrease of Skp2 protein abundance. These results...LY294002 for indicated time points. Figure 2: Depletion of Akt1, but not Akt2, results in a sharp decrease in Skp2 expression levels in SKBR3 cells... SKBR3 cells were infected with indicated lenti-viral shRNA vectors, and then incubated with 2 ug/ml puromycin for at least four days to eliminate

  9. Perturbations of NAD+ salvage systems impact mitochondrial function and energy homeostasis in mouse myoblasts and intact skeletal muscle

    DEFF Research Database (Denmark)

    Andersen, Marianne Agerholm; Dall, Morten; Jensen, Benjamin Anderschou Holbech

    2018-01-01

    Nampt KD) C2C12 cells using a shRNA lentiviral approach. Moreover, we applied gene electrotransfer to express cre recombinase in tibialis anterior muscle of floxed Nampt mice. In shNampt KD C2C12 myoblasts, Nampt and NAD+ levels were reduced by 70% and 50%, respectively, and maximal respiratory capacity......Nampt KD cells, respectively. Expression of cre recombinase in muscle of floxed Nampt mice reduced NAMPT and NAD+ levels by 38% and 43%, respectively. Glucose uptake increased by 40% and mitochondrial complex IV respiration was compromised by 20%. HIF1α-regulated genes and histone H3 lysine 9 (H3K9...

  10. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    characteristics of human psoriasis skin. Blockade of TNF- function with specific inhibitors at the protein level has resulted in a rapid clinical improvement in psoriasis patients, demonstrating that TNF- inhibition offers a promising therapy of psoriasis. Whether TNF- -encoding RNA is a valid therapeutic target...... taken three weeks after injection. qPCR-based measurements of TNF- mRNA in skin treated with lentiviral vector-encoded TNF- shRNA demonstrated a 50% reduction in the level of TNF- mRNA. Most interestingly, the epidermal thickness of the human psoriatic plaques was reduced relative to mice treated...

  11. Low Level of Low-Density Lipoprotein Receptor-Related Protein 1 Predicts an Unfavorable Prognosis of Hepatocellular Carcinoma after Curative Resection

    OpenAIRE

    Huang, Xiao-Yong; Shi, Guo-Ming; Devbhandari, Ranjan Prasad; Ke, Ai-Wu; Wang, Yuwei; Wang, Xiao-Ying; Wang, Zheng; Shi, Ying-Hong; Xiao, Yong-Sheng; Ding, Zhen-Bin; Dai, Zhi; Xu, Yang; Jia, Wei-Ping; Tang, Zhao-You; Fan, Jia

    2012-01-01

    BACKGROUND: Low-density lipoprotein receptor-related protein 1 (LRP1) is a multifunctional receptor involved in receptor-mediated endocytosis and cell signaling. The aim of this study was to elucidate the expression and mechanism of LRP1 in hepatocellular carcinoma (HCC). METHODS: LRP1 expression in 4 HCC cell lines and 40 HCC samples was detected. After interruption of LRP1 expression in a HCC cell line either with specific lentiviral-mediated shRNA LRP1 or in the presence of the LRP1-specif...

  12. ShRNA-mediated knock-down of CXCR7 increases TRAIL-sensitivity in MCF-7 breast cancer cells.

    Science.gov (United States)

    Gao, Weiran; Mei, Xifan; Wang, Jikun; Zhang, Xianglin; Yuan, Yajiang

    2015-09-01

    This study aims to investigate the effects of CXCR7-shRNA on TRAIL-mediated apoptosis and suppression of invasive migration and the underlying mechanisms. (1) We constructed CXCR-7-shRNA lentiviral vectors and confirmed their silencing efficiency in MCF-7 cells by RT-PCR analysis. (2) The effects of CXCR7 and/or TRAIL on cell proliferation were examined by MTT assay. (3) Trans well invasion assay was used to examine the effects of CXCR7 silencing and/or TRAIL on MCF-7 cell invasive migration. (4) Expression of Caspase-3, and Caspase-8, and MMP-2 and MMP-9 proteins was examined by Western blot analysis. (1) Viral titers were 2.95 × 10(8) TU/ml, 3.01 × 10(8) TU/ml, 3.26 × 10(8) TU/ml, and 3.08 × 10(8) TU/ml, respectively. (2) CHXR7 shRNAs markedly decreased CXCR7 mRNA expression in MCF-7 cells, among which CXCR7-shRNA-1 showed significantly higher rate of inhibition (P < 0.05). (3) Combination of TRAIL and CXCR7-shRNA-1 resulted in marked suppression of cell proliferation in time-dependent manner (P < 0.05). (4) Cell invasion capacity was inhibited in each experimental group as compared to blank control group at 48 h post treatments (P < 0.05). Among them, combination of TRAIL and CXCR7-shRNA had the highest inhibitory effect (P < 0.05). (5) Western blot analysis indicated that TRAIL alone does not affect CXCR7 expression, but either TRAIL + CXCR7 shRNA or CXCR7 shRNA alone markedly suppressed CXCR7 protein expression. Furthermore, combination of TRAIL and CXCR-7-shRNA significantly increased Caspase-3 and Caspase-8 expression and decreased MMP-2 and MMP-9 expression (P < 0.05). Knock-down of CXCR-7 expression leads to augmented TRAIL-mediated suppression of MCF-7 cell proliferation and invasion.

  13. A comprehensive platform for highly multiplexed mammalian functional genetic screens

    Directory of Open Access Journals (Sweden)

    Cheung-Ong Kahlin

    2011-05-01

    Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

  14. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    Energy Technology Data Exchange (ETDEWEB)

    Boku, Shuken, E-mail: shuboku@med.hokudai.ac.jp [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Nakagawa, Shin [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takamura, Naoki [Pharmaceutical Laboratories, Dainippon Sumitomo Pharma Co. Ltd., Osaka (Japan); Kato, Akiko [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takebayashi, Minoru [Department of Psychiatry, National Hospital Organization Kure Medical Center, Kure (Japan); Hisaoka-Nakashima, Kazue [Department of Pharmacology, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima (Japan); Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan)

    2013-05-17

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis.

  15. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    International Nuclear Information System (INIS)

    Boku, Shuken; Nakagawa, Shin; Takamura, Naoki; Kato, Akiko; Takebayashi, Minoru; Hisaoka-Nakashima, Kazue; Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro

    2013-01-01

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis

  16. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  17. Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin αv subunit, the FMDV receptor, and against FMDV infection in PK-15 cells

    Directory of Open Access Journals (Sweden)

    Lin Tong

    2011-09-01

    Full Text Available Abstract Background shRNA targeting the integrin αv subunit, which is the foot-and-mouth disease virus (FMDV receptor, plays a key role in virus attachment to susceptible cells. We constructed a RNAi lentiviral vector, iαv pLenti6/BLOCK -iT™, which expressed siRNA targeting the FMDV receptor, the porcine integrin αv subunit, on PK-15 cells. We also produced a lentiviral stock, established an iαv-PK-15 cell line, evaluated the gene silencing efficiency of mRNA using real-time qRT-PCR, integrand αv expression by indirect immunofluorescence assay (IIF and cell enzyme linked immunosorbent assays (cell ELISA, and investigated the in vivo inhibitory effect of shRNA on FMDV replication in PK-15 cells. Results Our results indicated successful establishment of the iαv U6 RNAi entry vector and the iαv pLenti6/BLOCK -iT expression vector. The functional titer of obtained virus was 1.0 × 106 TU/mL. To compare with the control and mock group, the iαv-PK-15 group αv mRNA expression rate in group was reduced by 89.5%, whilst IIF and cell ELISA clearly indicated suppression in the experimental group. Thus, iαv-PK-15 cells could reduce virus growth by more than three-fold and there was a > 99% reduction in virus titer when cells were challenged with 102 TCID50 of FMDV. Conclusions Iαv-PK-15 cells were demonstrated as a cell model for anti-FMDV potency testing, and this study suggests that shRNA could be a viable therapeutic approach for controlling the severity of FMD infection and spread.

  18. Ethanol as a Prodrug: Brain Metabolism of Ethanol Mediates its Reinforcing effects

    Science.gov (United States)

    Karahanian, Eduardo; Quintanilla, María Elena; Tampier, Lutske; Rivera-Meza, Mario; Bustamante, Diego; Gonzalez-Lira, Víctor; Morales, Paola; Herrera-Marschitz, Mario; Israel, Yedy

    2011-01-01

    Backround While the molecular entity responsible for the rewarding effects of virtually all drugs of abuse is known; that for ethanol remains uncertain. Some lines of evidence suggest that the rewarding effects of alcohol are mediated not by ethanol per se but by acetaldehyde generated by catalase in the brain. However, the lack of specific inhibitors of catalase has not allowed strong conclusions to be drawn about its role on the rewarding properties of ethanol. The present studies determined the effect on voluntary alcohol consumption of two gene vectors; one designed to inhibit catalase synthesis and one designed to synthesize alcohol dehydrogenase, to respectively inhibit or increase brain acetaldehyde synthesis. Methods The lentiviral vectors, which incorporate the genes they carry into the cell genome, were: (i) one encoding a shRNA anticatalase synthesis and (ii) one encoding alcohol dehydrogenase (rADH1). These were stereotaxically microinjected into the brain ventral tegmental area (VTA) of Wistar-derived rats bred for generations for their high alcohol preference (UChB), which were allowed access to an ethanol solution and water. Results Microinjection into the VTA of the lentiviral vector encoding the anticatalase shRNA virtually abolished (-94% p<0.001) the voluntary consumption of alcohol by the rats. Conversely, injection into the VTA of the lentiviral vector coding for alcohol dehydrogenase greatly stimulated (2-3 fold p<0.001) their voluntary ethanol consumption. Conclusions The study strongly suggests that to generate reward and reinforcement, ethanol must be metabolized into acetaldehyde in the brain. Data suggest novel targets for interventions aimed at reducing chronic alcohol intake. PMID:21332529

  19. Effects of chopped sinusoidal voltages on the behavior and performance of laying hens

    Energy Technology Data Exchange (ETDEWEB)

    Vidali, G.; Silversides, F.G.; Boily, R. [Laval Univ., Quebec, PQ (Canada). Faculte de Sciences et Genie; Villeneuve, P.; Joncas, R. [Quebec Ministere de l`Agriculture, des Pecheries et de l`Aminentation, Ste-Foy, PQ (Canada)

    1996-04-01

    Studies were conducted to measure the effects of sinusoidal voltages on hens. One hundred and twenty laying hens between 23 and 43 weeks of age were used in these experiments. Normal sinusoidal voltages with constant amplitudes of one to nine volts and pulses with random amplitudes of 3 to 18 volts were applied to the hens. The electrical resistance of hens was also measured to determine their path resistance to electrical currents. No effects on production performance or behavior of laying hens were found. Neither water and feed consumption, nor egg production and quality were affected by the treatments. No behavioral or health problems were observed. 15 refs., 6 tabs., 2 figs.

  20. A study on the chopping and mixing of cotton stalks with soil

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... the cultivation of cotton, illustrating the economic and social significance of this crop. Cotton is grown in four main regions including Southeastern Anatolia, Cukurova,. Aegean and Antalya (Polat et al., 2006). Cotton production comprises approximately, 91% of the area of fiber plants globally (FAO, 2008).

  1. An Enigmatic Death in Farm Chopping Machine: Is This the Perfect Murder?

    Science.gov (United States)

    Gioia, Sara; Lancia, Massimo; Bacci, Mauro; Suadoni, Fabio

    2015-09-01

    Forensic autopsy, like the other sectors in medicine, has benefited from the technological progress and the creation of multidisciplinary teams to unveil more and more finely planned criminal intents.Forensic pathologists, however, can sometimes deal with very enigmatic cases, meeting so with the limits of their own knowledge. Therefore, in these cases, they must not allow themselves to be pressured by inquiring agencies, remaining instead always faithful to empiric observations.With regard to that, we present a peculiar case of death by shredding inside a grinding machinery. The magistrature consequently opened a dossier for willful murder. Lots of figures were appointed to solve the case and among them is the forensic pathologist. However, a great number of obstacles were put in the investigators' inquiries.Was it a perfect murder?

  2. Chop Wood, Carry Water, Use Definitions: Survival Lessons of an IBL Rookie

    Science.gov (United States)

    Retsek, Dylan Q.

    2013-01-01

    This article describes the author's pedagogical transformation from "traditional" lecture-based instruction to Inquiry Based Learning (IBL) instruction of an introductory proofs class for sophomore mathematics majors. The story of the course overhaul follows from inception, through implementation, and ultimately to reflection.…

  3. Study of wear mechanism of chopped fiber reinforced epoxy composite filled with graphite and bronze

    Science.gov (United States)

    Patil, Nitinchand; Prasad, Krishna

    2018-04-01

    The combined effect of graphite and sintered bronze with a short glass fiber reinforced epoxy composites was investigated in this work. A pin on disc wear test was carried out to study the wear behaviour and mechanism of the composites. The objective of this work is to develop an alternate friction resistance material for the application of sliding bearing. It was observed that the addition of sintered bronze improved mechanical and thermal stability of the composites as bronze has low contact resistance with graphite and has high thermal conductivity. It was observed from the test results that increased volume percentage of graphite and presence of bronze are play significant role in wear mechanism of the composites. It was observed from the scanning electronic microscopes (SEM) that the abrasive and adhesive wear mechanism was prominent in this study. It was also evident from the result that the frictional force remains stable irrespective of the applied normal load.

  4. Kaempferol induces hepatocellular carcinoma cell death via endoplasmic reticulum stress-CHOP-autophagy signaling pathway

    OpenAIRE

    Guo, Haiqing; Lin, Wei; Zhang, Xiangying; Zhang, Xiaohui; Hu, Zhongjie; Li, Liying; Duan, Zhongping; Zhang, Jing; Ren, Feng

    2017-01-01

    Kaempferol is a flavonoid compound that has gained widespread attention due to its antitumor functions. However, the underlying mechanisms are still not clear. The present study investigated the effect of kaempferol on hepatocellular carcinoma and its underlying mechanisms. Kaempferol induced autophagy in a concentration- and time-dependent manner in HepG2 or Huh7 cells, which was evidenced by the significant increase of autophagy-related genes. Inhibition of autophagy pathway, through 3-meth...

  5. Effect of irradiation on quality of vacuum packed spicy beef chops

    Science.gov (United States)

    To develop an alternative pasteurization process for the spicy beef jerky (SBJ), SBJ was treated with irradiation doses of 0, 0.5, 1.5, 3, 4, 6 and 8 kGy and the sensory attributes, texture properties, drip loss and the protein biological efficiency were studied. The results showed that lightness, d...

  6. Effect of Irradiation on Quality of Vacuum-Packed Spicy Beef Chops

    Directory of Open Access Journals (Sweden)

    Liming Zhao

    2017-01-01

    Full Text Available To develop an alternative pasteurization process for the spicy beef jerky (SBJ, it was treated with irradiation doses of 0, 0.5, 1.5, 3, 4, 6, and 8 kGy and the sensory attributes, texture properties, drip loss, and the protein biological efficiency were studied. The results showed that lightness, drip loss, and off-odor of SBJ increased, while the hardness, chewiness, gumminess, color preference, and taste of SBJ decreased with the increase in irradiation dose. This tendency was obvious as the irradiation dose increased to 6 kGy and 8 kGy. The possible reason for these quality changes might be due to the free radicals produced by irradiation. This speculation is supported by the decrease of the content of capsanthin and the increase of the content of TBARS of SBJ with the increase in irradiation dose. The plate counts of treated SBJ indicated that 4 kGy was suitable for pasteurization of SBJ.

  7. Digital image processing based identification of nodes and internodes of chopped biomass stems

    Science.gov (United States)

    Chemical composition of biomass feedstock is an important parameter for optimizing the yield and economics of various bioconversion pathways. Although understandably, the chemical composition of biomass varies among species, varieties, and plant components, there is distinct variation even among ste...

  8. On the Mechanical Response of Chopped Glass/Urethane Resin Composite: Data and Model

    Energy Technology Data Exchange (ETDEWEB)

    Elahi, M.; Weitsman, Y.J.

    1999-11-01

    This report presents data on the creep response of a polymeric composite that is a candidate material for automotive applications. The above data were used to establish the basis for the mechanical characterization of the material's response over a wide range of stresses and temperatures, as well as under cyclic loading and due to exposure to distilled water. A constitutive model based upon fundamental principles of irreversible thermodynamics and continuum mechanics was employed to encompass the above mentioned database and to predict the response under more complex inputs. These latter tests verified the validity of the model.

  9. Studies on Carbon-Fly Ash Composites with Chopped PANOX Fibers

    Directory of Open Access Journals (Sweden)

    Rakesh V. Patel

    2013-01-01

    Full Text Available Chemical analysis and morphological studies of fly ash reveals the complex chemical constituents present as spherical particles with diameter of less than 25 μm. The constituents of fly ash are silica, alumina, iron oxide, titanium dioxide, calcium and magnesium oxide, and other trace elements. The use of thermosetting as well thermoplastic polymer matrix has been made by several workers to develop polymer matrix fly ash particulate composites by using the hard and abrasive properties of fly ash and lightweight of polymers. Such composites have poor mechanical strength, fracture toughness, and thermal stability. To overcome these shortcomings, in carbonaceous matrix, the carbon fibers were added as additional reinforcement along with the fly ash. The composites were developed with two different methods known as Dry method and Wet method. The processing parameters such as temperature and pressure were optimized in establishing the carbon matrix. Physical, thermal, and mechanical characteristics were studied. The microstructures of composites show good compatibility between fly ash and fibers with the carbon matrix. These composites have higher strength, thermal stability, and toughness as compared to polymer matrix fly ash particulate composites.

  10. String Chopping and Time-ordered Products of Linear String-localized Quantum Fields

    Science.gov (United States)

    Cardoso, Lucas T.; Mund, Jens; Várilly, Joseph C.

    2018-03-01

    For a renormalizability proof of perturbative models in the Epstein-Glaser scheme with string-localized quantum fields, one needs to know what freedom one has in the definition of time-ordered products of the interaction Lagrangian. This paper provides a first step in that direction. The basic issue is the presence of an open set of n-tuples of strings which cannot be chronologically ordered. We resolve it by showing that almost all such string configurations can be dissected into finitely many pieces which can indeed be chronologically ordered. This fixes the time-ordered products of linear field factors outside a nullset of string configurations. (The extension across the nullset, as well as the definition of time-ordered products of Wick monomials, will be discussed elsewhere).

  11. ‘Licking the Chops of Memory’: Plotting the Social Sins of Jekyll and Hyde

    Directory of Open Access Journals (Sweden)

    Carolyn W. de la L. Oulton

    2018-03-01

    Full Text Available Dr Jekyll and Mr Hyde is hierarchical in its very title—alphabetically Hyde precedes Jekyll, but Jekyll’s superior education and culture are associated with social status whereas Hyde’s ‘Mr.’ is a courtesy title often hedged in with demonic or animalistic terms. But despite the division insisted on in the title, Jekyll’s wilful complicity in the fate that overtakes him is suggested in a series of clues, ranging from his symbolic association with vivisection to the ostentatious exclusion of a female voice (typically the source of spiritual guidance or inspiration in Victorian fiction. As Hyde engages in an ascending scale of brutal acts, beginning with the assault of a child, the middle-class male peer group attempts to exculpate or protect Jekyll from association with this rebarbative and criminal figure. But following the murder of Sir Danvers Carew, the climactic discovery of Hyde’s body provides the final evidence against Jekyll himself—in rejecting the possibility of religious salvation, he has deliberately chosen the evil that his final statement presents as the ‘assault’ of an ungovernable temptation.

  12. RNAi Knockdown of Hypoxia-Inducible Factor-1α Decreased the Proliferation, Migration, and Invasion of Hypoxic Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei

    2015-04-01

    The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.

  13. Lentiviral mediated transgenesis by in vivo manipulation of spermatogonial stem cells.

    Directory of Open Access Journals (Sweden)

    Lalit Sehgal

    Full Text Available This report describes a technique for the generation of transgenic mice by in vivo manipulation of spermatogonial stem cells with a high rate of success. Spermatogonial stem cells (SSCs in pre-pubescent animals were infected in vivo with recombinant lentiviruses expressing EGFP-f and mated with normal females. All male pre-founder mice produced transgenic pups with an overall success rate of over 60%. The transgene was heritable and the pre-founder mice could be used in multiple mating experiments. This technology could be used to perform overexpression/knockdown screens in vivo using bar-coded lentiviruses, thus permitting the design of genetic screens in the mouse. Further, this technology could be adapted to other laboratory animals resulting in the generation of model systems that closely approximate human development and disease.

  14. A lentivirally delivered photoactivatable GFP to assess continuity in the endoplasmic reticulum of neurones and glia

    Czech Academy of Sciences Publication Activity Database

    Jones, V. C.; Rodríguez Arellano, Jose Julio; Verkhratsky, Alexei; Jones, O. T.

    2009-01-01

    Roč. 458, č. 4 (2009), s. 809-818 ISSN 0031-6768 R&D Projects: GA ČR GA305/08/1384 Institutional research plan: CEZ:AV0Z50390512 Keywords : endoplasmic reticulum * calcium store * neurone Subject RIV: FH - Neurology Impact factor: 3.695, year: 2009

  15. IMMUNE SUPPRESSION OF CHALLENGED VACCINATES AS A RIGOROUS ASSESSMENT OF STERILE PROTECTION BY LENTIVIRAL VACCINES

    Science.gov (United States)

    Craigo, Jodi K.; Durkin, Shannon; Sturgeon, Timothy J.; Tagmyer, Tara; Cook, Sheila J.; Issel, Charles J.; Montelaro, Ronald C.

    2007-01-01

    We previously reported that an experimental live-attenuated equine infectious anemia virus (EIAV) vaccine, containing a mutated S2 accessory gene, provided protection from disease and detectable infection after virulent virus (EIAVPV) challenge [1,2]. To determine if attenuated EIAV vaccines actually prevent persistent infection by challenge virus, we employed a 14-day dexamethasone treatment of vaccinated horses post-challenge to suppress host immunity and amplify replication levels of any infecting EIAV. At two months post-challenge the horses were all protected from virulent-virus challenge, evidenced by a lack of EIA signs and detectable challenge plasma viral RNA. Upon immune suppression, 6/12 horses displayed clinical EIA. Post-immune suppression characterizations demonstrated that the attenuated vaccine evidently prevented detectable challenge virus infection in 50% of horses. These data highlight the utility of post-challenge immune suppression for evaluating persistent viral vaccine protective efficacy. PMID:17023099

  16. Lentiviral gene transfer into the dorsal root ganglion of adult rats

    Directory of Open Access Journals (Sweden)

    Park Frank

    2011-08-01

    Full Text Available Abstract Background Lentivector-mediated gene delivery into the dorsal root ganglion (DRG is a promising method for exploring pain pathophysiology and for genetic treatment of chronic neuropathic pain. In this study, a series of modified lentivector particles with different cellular promoters, envelope glycoproteins, and viral accessory proteins were generated to evaluate the requirements for efficient transduction into neuronal cells in vitro and adult rat DRG in vivo. Results In vitro, lentivectors expressing enhanced green fluorescent protein (EGFP under control of the human elongation factor 1α (EF1α promoter and pseudotyped with the conventional vesicular stomatitis virus G protein (VSV-G envelope exhibited the best performance in the transfer of EGFP into an immortalized DRG sensory neuron cell line at low multiplicities of infection (MOIs, and into primary cultured DRG neurons at higher MOIs. In vivo, injection of either first or second-generation EF1α-EGFP lentivectors directly into adult rat DRGs led to transduction rates of 19 ± 9% and 20 ± 8% EGFP-positive DRG neurons, respectively, detected at 4 weeks post injection. Transduced cells included a full range of neuronal phenotypes, including myelinated neurons as well as both non-peptidergic and peptidergic nociceptive unmyelinated neurons. Conclusion VSV-G pseudotyped lentivectors containing the human elongation factor 1α (EF1α-EGFP expression cassette demonstrated relatively efficient transduction to sensory neurons following direct injection into the DRG. These results clearly show the potential of lentivectors as a viable system for delivering target genes into DRGs to explore basic mechanisms of neuropathic pain, with the potential for future clinical use in treating chronic pain.

  17. Genetic modification of human sural nerve segments by a lentiviral vector encoding nerve growth factor

    NARCIS (Netherlands)

    Tannemaat, Martijn R; Boer, Gerard J; Verhaagen, J.; Malessy, Martijn J A

    2007-01-01

    OBJECTIVE: Autologous nerve grafts are used to treat severe peripheral nerve injury, but recovery of nerve function after grafting is rarely complete. Exogenous application of neurotrophic factors may enhance regeneration, but thus far the application of neurotrophic factors has been hampered by

  18. Novel Strategy for Lineage Tracing of Cancer Stem Cells by Lentiviral Barcoding

    Science.gov (United States)

    2012-10-01

    time in prospective identification of novel biomarkers. In months 25-36, we build on our previous results and implemented next-generation sequencing methodology to further trave the tumor sublineages in the mouse mammary tumor model.

  19. The roles of five conserved lentiviral RNA structures in HIV-1 replication.

    Science.gov (United States)

    Liu, Yang; Chen, Jianbo; Nikolaitchik, Olga A; Desimmie, Belete A; Busan, Steven; Pathak, Vinay K; Weeks, Kevin M; Hu, Wei-Shau

    2018-01-15

    The HIV-1 RNA genome contains complex structures with many structural elements playing regulatory roles during viral replication. A recent study has identified multiple RNA structures with unknown functions that are conserved among HIV-1 and two simian immunodeficiency viruses. To explore the roles of these conserved RNA structures, we introduced synonymous mutations into the HIV-1 genome to disrupt each structure. These mutants exhibited similar particle production, viral infectivity, and replication kinetics relative to the parent NL4-3 virus. However, when replicating in direct competition with the wild-type NL4-3 virus, mutations of RNA structures at inter-protein domain junctions can cause fitness defects. These findings reveal the ability of HIV-1 to tolerate changes in its sequences, even in apparently highly conserved structures, which permits high genetic diversity in HIV-1 population. Our results also suggest that some conserved RNA structures may function to fine-tune viral replication. Published by Elsevier Inc.

  20. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual infected cats, which are protected from immune decline.

  1. Construction of a novel lentiviral vector carrying human B-domain ...

    African Journals Online (AJOL)

    USER

    2010-03-29

    Mar 29, 2010 ... compared with the use of a 2-tailed paired student's t test. Statistical analysis was performed using the GraphPad Prism 3.0 software. RESULTS. Verification of transfer vector .... Medico E, Naldini L (2005). Promoter trapping reveals significant differences in integration site selection between MLV and HIV ...

  2. A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells

    International Nuclear Information System (INIS)

    Mourez, Thomas; Mesel-Lemoine, Mariana; Combredet, Chantal; Najburg, Valerie; Cayet, Nadege; Tangy, Frederic

    2011-01-01

    We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimeric particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.

  3. Silencing of the hTERT gene by shRNA