WorldWideScience

Sample records for lentiviral chop shrna

  1. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  2. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  3. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  4. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  6. Lentiviral Delivery of a Vesicular Glutamate Transporter 1 (VGLUT1)-Targeting Short Hairpin RNA Vector Into the Mouse Hippocampus Impairs Cognition

    NARCIS (Netherlands)

    King, Madeleine V.; Kurian, Nisha; Qin, Si; Papadopoulou, Nektaria; Westerink, Ben H. C.; Cremers, Thomas I.; Epping-Jordan, Mark P.; Le Poul, Emmanuel; Ray, David E.; Fone, Kevin C. F.; Kendall, David A.; Marsden, Charles A.; Sharp, Tyson V.

    Glutamate is the principle excitatory neurotransmitter in the mammalian brain, and dysregulation of glutamatergic neurotransmission is implicated in the pathophysiology of several psychiatric and neurological diseases. This study utilized novel lentiviral short hairpin RNA (shRNA) vectors to target

  7. Construction of RNAi lentiviral vector targeting mouse Islet-1 gene

    Directory of Open Access Journals (Sweden)

    Shen-shen ZHI

    2011-02-01

    Full Text Available Objective To construct and select RNAi lentiviral vectors that can silence mouse Islet-1 gene effectively.Methods Three groups of RNAi-target of mouse Islet-1 gene were designed,and corresponding shRNA oligo(sh1,sh2 and sh3 were synthesized,and then they were respectively inserted to the PLVTHM vector that had been digested by endonuclease.Agarose gel electrophoresis and sequencing were used to select and indentify the positive clones.The positive clones were extracted and then mixed with E.coli to amplify positive clones.The amplified clones were then infected into 293T along with the other 3 helper plasmids to produce lentiviral vector.After the construction of the lentiviral vector,plaque formation test was performed to determine the titer of lentiviral vector.The lentiviral vectors were then infected into C3H10T1/2 cells.The transfect efficiency of the lentiviral vectors was determined with flow cytometry with detection of green fluorescent protein(GFP.Q-PCR was employed to detect the RNAi efficiency of the lentiviral vectors.Results Agarose gel electrophoresis analysis showed that the clones with right gene at the target size were successfully established;gene sequencing showed that the right DNA fragments had been inserted;plaque formation test showed that the titer of the virus solution was 3.87×108TU/ml;the transfect efficiency of the lentiviral vector infected into C3H10T1/2 cells was 90.36%.All the 3 groups of shRNA targets(sh1,sh2 and sh3 showed an inhibitory effect on Islet-1 gene,and the sh1 showed the highest inhibitory effect(76.8%,as compared with that of normal cells(P < 0.05.Conclusion The RNAi lentiviral vector that can effectively silence the mouse Islet-1 gene has been constructed successfully,which may lay a foundation for further investigation of Islet-1 gene.

  8. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  9. Commercial production of chopped firewood

    International Nuclear Information System (INIS)

    Jouhiaho, A.

    2004-01-01

    The aim of the reseach project was to improve the competitiveness of chopped firewood by producing information that can help to reduce production and distribution costs as well as increase the quality of chopped firewood produced. The sub-project 'New logistics solutions for the chopped firewood production process' studied current production and distribution efficiency of commerical chopped firewood and tried to find cost saving methods. The sub-project 'The current situation of the firewood trade in Europe' surveyed firewood trade volumes, operational methods and the firewood production equipment found on sale in European countries. Information about the chopped firewood trade and chopping device market was for the most part an estimate. This is because there is no research and statistical information available. Indicative information was obtained from Denmark, Germany, Norway, Spain, Sweden and Finland. The sub-project 'Productivity, costs and development targets of new chopped firewood machines' researched ten new firewood processing devices suitable for professional and domestic use by means of work-study methods. The research studied productivity and chopping costs, and analysed the quality of chopped firewood manufactured by the firewood processing devices. It also analysed the occupational safety and ergonomics of chopping work and suggestions were made for the device manufacturers on how to develop chopping devices. Sub-project 'The artificial drying and storage management for chopped firewood' carried out field tests on different types of cold and warm air dryers being used by chopped firewood entrepreneurs. The aim was to find the most promising dryer type according to its cost and operating efficiency. In addition, the suitability of resistance based electronic wood moisture meter for measuring the moisture content of single chopped firewood pieces was also studied. (orig.)

  10. Full dose CHOP chemotherapy

    International Nuclear Information System (INIS)

    Tominaga, Shinichi; Kondo, Makoto; Ando, Yutaka; Yamashita, Shoji; Uematsu, Minoru; Shigematsu, Naoyuki; Nishiguchi, Iku; Hashimoto, Shozo

    1985-01-01

    Since 1982, we have performed 125 courses of CHOP chemotherapy for 27 patients of malignancy, adhering to the original regimen as strictly as possible. CHOP chemotherapy consisted of Cyclophosphamide 750 mg/m 2 , iv, on day 1; Adriamycin 50 mg/m 2 , iv, on day 1; Vincristine 1.4 mg/m 2 , iv, on day 1 (maximum single dose 2.0 mg) and Prednisolone 50 mg/m 2 , po, day 1 through 5. The cycle was repeated every 21 days. As side effects, myelosuppression, hair loss, fever, nausea, vomiting, liver dysfunction, stomatitis, neuropathy, herpes zoster, arrhythmia and hemorrhagic cystitis were seen. Due to myelosuppression, twenty patients experienced febrile episodes at each nadir of WBC counts on 40 courses. However, any febrile patient did not have life threatening infection. Other side effects were also reversible. The radiotherapy of most patients was carried out as initially scheduled, except for 3 patients in whom irradiation was interrupted due to severe stomatitis or herpes zoster. We consider that CHOP chemotherapy is excellent in feasibility even when combined with radiotherapy. (author)

  11. Production of lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Otto-Wilhelm Merten

    2016-01-01

    Full Text Available Lentiviral vectors (LV have seen considerably increase in use as gene therapy vectors for the treatment of acquired and inherited diseases. This review presents the state of the art of the production of these vectors with particular emphasis on their large-scale production for clinical purposes. In contrast to oncoretroviral vectors, which are produced using stable producer cell lines, clinical-grade LV are in most of the cases produced by transient transfection of 293 or 293T cells grown in cell factories. However, more recent developments, also, tend to use hollow fiber reactor, suspension culture processes, and the implementation of stable producer cell lines. As is customary for the biotech industry, rather sophisticated downstream processing protocols have been established to remove any undesirable process-derived contaminant, such as plasmid or host cell DNA or host cell proteins. This review compares published large-scale production and purification processes of LV and presents their process performances. Furthermore, developments in the domain of stable cell lines and their way to the use of production vehicles of clinical material will be presented.

  12. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  13. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kruithof Egbert KO

    2004-08-01

    Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

  14. The chopped firewood trade in Finland

    International Nuclear Information System (INIS)

    Seppaenen, A.; Kaerhae, K.

    2003-01-01

    The TTS Institute studied the operations of chopped firewood merchants and described the cost structure of commercial chopped firewood production. The research material was collected via postal questionnaire in 2002 after being sent to those firewood merchants assumed to be selling chopped firewood. Acceptable responses were received from 244 firewood merchants. In addition, ten firewood merchants were interviewed. In 2001, the firewood merchants sold an average of 151 m 3 of chopped firewood. Half of the firewood merchants sold less than 51 m 3 of chopped firewood. The main source of income for the majority of chopped firewood merchants was agriculture and forestry. If approximately 300,000 m 3 of chopped firewood is sold annually, according to the research there are about 2,000 chopped firewood merchants in Finland. However, only a very few entrepreneurs get their main income from the chopped firewood trade. The majority of raw material for chopped firewood came from the merchant's own forest. Birch was the most commonly used species. 54% of the chopped firewood was made from pulpwood, 19% from pole size trees and 18% from split firewood. The drying methods for chopped firewood were most often natural drying outside in covered stocks or cages, natural drying in stacks or natural drying of mechanically debarked or debarked timber in stacks. Less than a tenth of the merchants dried their chopped, firewood using artificial cold air-drying. The share of packaged chopped firewood was 14% i.e. approximately 42,000 m 3 . Chopped firewood was packed mostly into small packages (about 10 kg). The chopped firewood trade is a local business: the average transport distance from the merchant's store to the customer was 25 km. The chopped firewood merchants delivered 73% of lie chopped firewood themselves. An agricultural tractor and a trailer were the most common transport method. The most important customer group is detached houses. The average production costs amongst the

  15. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  16. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    International Nuclear Information System (INIS)

    Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.

    2014-01-01

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis

  17. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)

    2014-05-09

    Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  18. Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

    Directory of Open Access Journals (Sweden)

    L. Ding

    2014-06-01

    Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

  19. Lentiviral Vector Mediated Claudin1 Silencing Inhibits Epithelial to Mesenchymal Transition in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xianqi Zhao

    2015-06-01

    Full Text Available Breast cancer has a high incidence and mortality rate worldwide. Several viral vectors including lentiviral, adenoviral and adeno-associated viral vectors have been used in gene therapy for various forms of human cancer, and have shown promising effects in controlling tumor development. Claudin1 (CLDN1 is a member of the tetraspan transmembrane protein family that plays a major role in tight junctions and is associated with tumor metastasis. However, the role of CLDN1 in breast cancer is largely unexplored. In this study, we tested the therapeutic potential of silencing CLDN1 expression in two breast cancer (MDA-MB-231 and MCF7 cell lines using lentiviral vector mediated RNA interference. We found that a CLDN1 short hairpin (shRNA construct efficiently silenced CLDN1 expression in both breast cancer cell lines, and CLDN1 knockdown resulted in reduced cell proliferation, survival, migration and invasion. Furthermore, silencing CLDN1 inhibited epithelial to mesenchymal transition (EMT by upregulating the epithelial cell marker, E-cadherin, and downregulating mesenchymal markers, smooth muscle cell alpha-actin (SMA and Snai2. Our data demonstrated that lentiviral vector mediated CLDN1 RNA interference has great potential in breast cancer gene therapy by inhibiting EMT and controlling tumor cell growth.

  20. Lentiviral vectors in cancer immunotherapy.

    Science.gov (United States)

    Oldham, Robyn Aa; Berinstein, Elliot M; Medin, Jeffrey A

    2015-01-01

    Basic science advances in cancer immunotherapy have resulted in various treatments that have recently shown success in the clinic. Many of these therapies require the insertion of genes into cells to directly kill them or to redirect the host's cells to induce potent immune responses. Other analogous therapies work by modifying effector cells for improved targeting and enhanced killing of tumor cells. Initial studies done using γ-retroviruses were promising, but safety concerns centered on the potential for insertional mutagenesis have highlighted the desire to develop other options for gene delivery. Lentiviral vectors (LVs) have been identified as potentially more effective and safer alternative delivery vehicles. LVs are now in use in clinical trials for many different types of inherited and acquired disorders, including cancer. This review will discuss current knowledge of LVs and the applications of this viral vector-based delivery vehicle to cancer immunotherapy.

  1. Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

    Science.gov (United States)

    Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

    2015-01-01

    Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

  2. Producing chopped firewood with firewood processors

    International Nuclear Information System (INIS)

    Kaerhae, K.; Jouhiaho, A.

    2009-01-01

    The TTS Institute's research and development project studied both the productivity of new, chopped firewood processors (cross-cutting and splitting machines) suitable for professional and independent small-scale production, and the costs of the chopped firewood produced. Seven chopped firewood processors were tested in the research, six of which were sawing processors and one shearing processor. The chopping work was carried out using wood feeding racks and a wood lifter. The work was also carried out without any feeding appliances. Altogether 132.5 solid m 3 of wood were chopped in the time studies. The firewood processor used had the most significant impact on chopping work productivity. In addition to the firewood processor, the stem mid-diameter, the length of the raw material, and of the firewood were also found to affect productivity. The wood feeding systems also affected productivity. If there is a feeding rack and hydraulic grapple loader available for use in chopping firewood, then it is worth using the wood feeding rack. A wood lifter is only worth using with the largest stems (over 20 cm mid-diameter) if a feeding rack cannot be used. When producing chopped firewood from small-diameter wood, i.e. with a mid-diameter less than 10 cm, the costs of chopping work were over 10 EUR solid m -3 with sawing firewood processors. The shearing firewood processor with a guillotine blade achieved a cost level of 5 EUR solid m -3 when the mid-diameter of the chopped stem was 10 cm. In addition to the raw material, the cost-efficient chopping work also requires several hundred annual operating hours with a firewood processor, which is difficult for individual firewood entrepreneurs to achieve. The operating hours of firewood processors can be increased to the required level by the joint use of the processors by a number of firewood entrepreneurs. (author)

  3. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  4. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  5. Lentiviral Delivery of Proteins for Genome Engineering.

    Science.gov (United States)

    Cai, Yujia; Mikkelsen, Jacob Giehm

    2016-01-01

    Viruses have evolved to traverse cellular barriers and travel to the nucleus by mechanisms that involve active transport through the cytoplasm and viral quirks to resist cellular restriction factors and innate immune responses. Virus-derived vector systems exploit the capacity of viruses to ferry genetic information into cells, and now - more than three decades after the discovery of HIV - lentiviral vectors based on HIV-1 have become instrumental in biomedical research and gene therapies that require genomic insertion of transgenes. By now, the efficacy of lentiviral gene delivery to stem cells, cells of the immune system including T cells, hepatic cells, and many other therapeutically relevant cell types is well established. Along with nucleic acids, HIV-1 virions carry the enzymatic tools that are essential for early steps of infection. Such capacity to package enzymes, even proteins of nonviral origin, has unveiled new ways of exploiting cellular intrusion of HIV-1. Based on early findings demonstrating the packaging of heterologous proteins into virus particles as part of the Gag and GagPol polypeptides, we have established lentiviral protein transduction for delivery of DNA transposases and designer nucleases. This strategy for delivering genome-engineering proteins facilitates high enzymatic activity within a short time frame and may potentially improve the safety of genome editing. Exploiting the full potential of lentiviral vectors, incorporation of foreign protein can be combined with the delivery of DNA transposons or a donor sequence for homology-directed repair in so-called 'all-in-one' lentiviral vectors. Here, we briefly describe intracellular restrictions that may affect lentiviral gene and protein delivery and review the current status of lentiviral particles as carriers of tool kits for genome engineering.

  6. Baked Pork Chops With Apple Cranberry Sauce

    Science.gov (United States)

    ... bakedporkchopswithapplecranberrysauce.html Baked Pork Chops With Apple Cranberry Sauce To use the sharing features on this page, ... minutes Number of Servings: 4 A wonderful fruit sauce adds the perfect touch to these pork chops— ...

  7. [Construction of lentiviral mediated CyPA siRNA and its functions in non-small cell lung cancer].

    Science.gov (United States)

    FENG, Yan-ming; WU, Yi-ming; TU, Xin-ming; XU, Zheng-shun; WU, Wei-dong

    2010-02-01

    To construct a lentiviral-vector-mediated CyPA small interference RNA (siRNA) and study its function in non-small cell lung cancer. First, four target sequences were selected according to CyPA mRNA sequence, the complementary DNA contained both sense and antisense oligonucleotides were designed, synthesized and cloned into the pGCL-GFP vector, which contained U6 promoter and green fluorescent protein (GFP). The resulting lentiviral vector containing CyPA shRNA was named Lv-shCyPA, and it was confirmed by PCR and sequencing. Next, it was cotransfected by Lipofectamine 2000 along with pHelper1.0 and pHelper 2.0 into 293T cells to package lentivirus particles. At the same time, the packed virus infected non-small cell lung cancer cell (A549), the level of CyPA protein at 5 d after infection was detected by Western Blot to screen the target of CyPA. A549 were infected with Lv-shCyPA and grown as xenografts in severe combined immunodeficient mice. Cell cycle and apoptosis were measured by FCM. It was confirmed by PCR and DNA sequencing that lentiviral-vector-mediated CyPA siRNA (Lv-shCyPA) producing CyPA shRNA was constructed successfully. The titer of concentrated virus were 1 x 10(7) TU/ml. Flow cytometric analysis demonstrated G2-M phase (11.40% +/- 0.68%) was decreased relatively in A549/LvshCyPA compared with control groups (14.52% +/- 1.19%) (Ppathways may lead to new targeted therapies for non-small cell lung cancer.

  8. Manipulating the cell differentiation through lentiviral vectors.

    Science.gov (United States)

    Coppola, Valeria; Galli, Cesare; Musumeci, Maria; Bonci, Désirée

    2010-01-01

    The manipulation of cell differentiation is important to create new sources for the treatment of degenerative diseases or solve cell depletion after aggressive therapy against cancer. In this chapter, the use of a tissue-specific promoter lentiviral vector to obtain a myocardial pure lineage from murine embryonic stem cells (mES) is described in detail. Since the cardiac isoform of troponin I gene product is not expressed in skeletal or other muscle types, short mouse cardiac troponin proximal promoter is used to drive reporter genes. Cells are infected simultaneously with two lentiviral vectors, the first expressing EGFP to monitor the transduction efficiency, and the other expressing a puromycin resistance gene to select the specific cells of interest. This technical approach describes a method to obtain a pure cardiomyocyte population and can be applied to other lineages of interest.

  9. Lentiviral Vector Gene Transfer to Porcine Airways

    Directory of Open Access Journals (Sweden)

    Patrick L Sinn

    2012-01-01

    Full Text Available In this study, we investigated lentiviral vector development and transduction efficiencies in well-differentiated primary cultures of pig airway epithelia (PAE and wild-type pigs in vivo. We noted gene transfer efficiencies similar to that observed for human airway epithelia (HAE. Interestingly, feline immunodeficiency virus (FIV-based vectors transduced immortalized pig cells as well as pig primary cells more efficiently than HIV-1–based vectors. PAE express TRIM5α, a well-characterized species-specific lentiviral restriction factor. We contrasted the restrictive properties of porcine TRIM5α against FIV- and HIV-based vectors using gain and loss of function approaches. We observed no effect on HIV-1 or FIV conferred transgene expression in response to porcine TRIM5α overexpression or knockdown. To evaluate the ability of GP64-FIV to transduce porcine airways in vivo, we delivered vector expressing mCherry to the tracheal lobe of the lung and the ethmoid sinus of 4-week-old pigs. One week later, epithelial cells expressing mCherry were readily detected. Our findings indicate that pseudotyped FIV vectors confer similar tropisms in porcine epithelia as observed in human HAE and provide further support for the selection of GP64 as an appropriate envelope pseudotype for future preclinical gene therapy studies in the porcine model of cystic fibrosis (CF.

  10. The management and development of the chopped firewood production process

    International Nuclear Information System (INIS)

    Jouhiaho, A.; Kouki, J.; Kara, K.; Mutikainen, A.; Oksanen, E.; Seppaenen, A.; Vuorio, K.

    2005-01-01

    The main aim of the project was to improve competitiveness of chopped firewood by producing information that can help to reduce production and distribution costs as well as increase the quality of chopped firewood produced. The aim was to attain the goal through four subprojects: 1. Productivity, Costs and Development Targets of New Firewood Machines, 2. The Artificial Drying and Storage Management of Chopped Firewood, 3. New Logistics Solutions for the Chopped Firewood Production Process, and 4. The Current Situation of the Firewood Trade in Europe. The research project covered an analysis of the productivity of new firewood machines, and the costs and quality of produced chopped firewood. Suggestions were made to firewood machine manufacturers for developing firewood machines. Also, the cost-effectiveness of current chopped firewood production and distribution chains was studied. Field tests were carried out on different types of cold and warm air dryers being used by chopped firewood entrepreneurs. In addition, the suitability of resistance based electronic wood moisture meter for measuring the moisture content of single chopped firewood pieces was also studied. Furthermore, a survey was carried out on the volume of firewood sales and the firewood production equipment available for sale in Europe, and European firewood merchants' methods of operation was studied. (orig.)

  11. A comparison between hominy chop and defatted maize germ meal ...

    African Journals Online (AJOL)

    Defatted maize germ meal (DMG) is arbitrarily rated at a lower economic value than maize meal or hominy chop (HC). Five treatments with 15 steers each were fed different inclusion levels of DMG (0%, 25%, 50%, 75% and 100%), replacing hominy chop during the fattening period. Slaughter data were collected for carcass ...

  12. Consumer choice of pork chops in Taiwan.

    Science.gov (United States)

    Chen, M T; Guo, H L; Tseng, T F; Roan, S W; Ngapo, T M

    2010-07-01

    Digital photographs of pork chops varying systematically in appearance were presented to 716 Taiwanese consumers in a study that aimed to identify the most important characteristics of fresh pork which determine consumer choice in Taiwan. Relationships between consumer segmentation in choice and socio-demographic and cultural differences were also investigated. Colour and fat cover were the most frequently chosen of the four characteristics studied. Dark red colour was preferred by 64% of consumers and lean fat cover by 44%. Marbling and drip were less important in the decision making process being used by less than a half of consumers. The four preference-based clusters of consumers showed no correlation with socio-demographic-based consumer clusters, but did show significant links with possession of a refrigerator, age at which schooling was completed, liking pork for its price and gender of consumer. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

  13. Cyclophilin A interacts with diverse lentiviral capsids

    Directory of Open Access Journals (Sweden)

    Emerman Michael

    2006-10-01

    Full Text Available Abstract Background The capsid (CA protein of HIV-1 binds with high affinity to the host protein cyclophilin A (CypA. This binding positively affects some early stage of the viral life-cycle because prevention of binding either by drugs that occupy that active site of cyclophilin A, by mutation in HIV-1 CA, or RNAi that knocks down intracellular CypA level diminishes viral infectivity. The closely related lentivirus, SIVcpz also binds CypA, but it was thought that this interaction was limited to the HIV-1/SIVcpz lineage because other retroviruses failed to interact with CypA in a yeast two-hybrid assay. Results We find that diverse lentiviruses, FIV and SIVagmTAN also bind to CypA. Mutagenesis of FIV CA showed that an amino acid that is in a homologous position to the proline at amino acid 90 of HIV-1 CA is essential for FIV interactions with CypA. Conclusion These results demonstrate that CypA binding to lentiviruses is more widespread than previously thought and suggest that this interaction is evolutionarily important for lentiviral infection.

  14. Voltammetric detection of biological molecules using chopped carbon fiber.

    Science.gov (United States)

    Sugawara, Kazuharu; Yugami, Asako; Kojima, Akira

    2010-01-01

    Voltammetric detection of biological molecules was carried out using chopped carbon fibers produced from carbon fiber reinforced plastics that are biocompatible and inexpensive. Because chopped carbon fibers normally are covered with a sizing agent, they are difficult to use as an electrode. However, when the surface of a chopped carbon fiber was treated with ethanol and hydrochloric acid, it became conductive. To evaluate the functioning of chopped carbon fibers, voltammetric measurements of [Fe(CN)(6)](3-) were carried out. Redoxes of FAD, ascorbic acid and NADH as biomolecules were recorded using cyclic voltammetry. The sizing agents used to bundle the fibers were epoxy, polyamide and polyurethane resins. The peak currents were the greatest when using the chopped carbon fibers that were created with epoxy resins. When the electrode response of the chopped carbon fibers was compared with that of a glassy carbon electrode, the peak currents and the reversibility of the electrode reaction were sufficient. Therefore, the chopped carbon fibers will be useful as disposable electrodes for the sensing of biomolecules.

  15. Diffraction, chopping, and background subtraction for LDR

    Science.gov (United States)

    Wright, Edward L.

    1988-01-01

    The Large Deployable Reflector (LDR) will be an extremely sensitive infrared telescope if the noise due to the photons in the large thermal background is the only limiting factor. For observations with a 3 arcsec aperture in a broadband at 100 micrometers, a 20-meter LDR will emit 10(exp 12) per second, while the photon noise limited sensitivity in a deep survey observation will be 3,000 photons per second. Thus the background subtraction has to work at the 1 part per billion level. Very small amounts of scattered or diffracted energy can be significant if they are modulated by the chopper. The results are presented for 1-D and 2-D diffraction calculations for the lightweight, low-cost LDR concept that uses an active chopping quaternary to correct the wavefront errors introduced by the primary. Fourier transforms were used to evaluate the diffraction of 1 mm waves through this system. Unbalanced signals due to dust and thermal gradients were also studied.

  16. Optimal construction and delivery of dual-functioning lentiviral vectors for type I collagen-suppressed chondrogenesis in synovium-derived mesenchymal stem cells.

    Science.gov (United States)

    Zhang, Feng; Yao, Yongchang; Zhou, Ruijie; Su, Kai; Citra, Fudiman; Wang, Dong-An

    2011-06-01

    This study aims to deliver both transforming growth factor β3 (TGF-β3) and shRNA targeting type I collagen (Col I) by optimal construction and application of various dual-functioning lentiviral vectors to induce Col I-suppressed chondrogenesis in synovium-derived mesenchymal stem cells (SMSCs). We constructed four lentiviral vectors (LV-1, LV-2, LV-3 and LV-4) with various arrangements of the two expression cassettes in different positions and orientations. Col I inhibition efficiency and chondrogenic markers were assessed with qPCR, ELISA and staining techniques. Among the four vectors, LV-1 has two distant and reversely oriented cassettes, LV-2 has two distant and same-oriented cassettes, LV-3 has two proximal and reversely oriented cassettes, and LV-4 has two proximal and same-oriented cassettes. Col I and chondrogenic markers, including type II collagen (Col II), aggrecan and glycosaminoglycan (GAG), were examined in SMSCs cultured in 3-D alginate hydrogel. All of the four vectors showed distinct effects in Col I level as well as diverse inductive efficiencies in upregulation of the cartilaginous markers. Based on real-time PCR results, LV-1 was optimal towards Col I-suppressed chondrogenesis. LV-1 vector is competent to promote Col I-suppressed chondrogenesis in SMSCs.

  17. CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection

    Science.gov (United States)

    Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul

    2014-01-01

    CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967

  18. Preclinical safety and efficacy of an anti–HIV-1 lentiviral vector containing a short hairpin RNA to CCR5 and the C46 fusion inhibitor

    Directory of Open Access Journals (Sweden)

    Orit Wolstein

    2014-01-01

    Full Text Available Gene transfer has therapeutic potential for treating HIV-1 infection by generating cells that are resistant to the virus. We have engineered a novel self-inactivating lentiviral vector, LVsh5/C46, using two viral-entry inhibitors to block early steps of HIV-1 cycle. The LVsh5/C46 vector encodes a short hairpin RNA (shRNA for downregulation of CCR5, in combination with the HIV-1 fusion inhibitor, C46. We demonstrate here the effective delivery of LVsh5/C46 to human T cell lines, peripheral blood mononuclear cells, primary CD4+ T lymphocytes, and CD34+ hematopoietic stem/progenitor cells (HSPC. CCR5-targeted shRNA (sh5 and C46 peptide were stably expressed in the target cells and were able to effectively protect gene-modified cells against infection with CCR5- and CXCR4-tropic strains of HIV-1. LVsh5/C46 treatment was nontoxic as assessed by cell growth and viability, was noninflammatory, and had no adverse effect on HSPC differentiation. LVsh5/C46 could be produced at a scale sufficient for clinical development and resulted in active viral particles with very low mutagenic potential and the absence of replication-competent lentivirus. Based on these in vitro results, plus additional in vivo safety and efficacy data, LVsh5/C46 is now being tested in a phase 1/2 clinical trial for the treatment of HIV-1 disease.

  19. The feasibility of incorporating Vpx into lentiviral gene therapy vectors

    Directory of Open Access Journals (Sweden)

    Samantha A McAllery

    2016-01-01

    Full Text Available While current antiretroviral therapy has significantly improved, challenges still remain in life-long targeting of HIV-1 reservoirs. Lentiviral gene therapy has the potential to deliver protective genes into the HIV-1 reservoir. However, inefficient reverse transcription (RT occurs in HIV-1 reservoirs during lentiviral gene delivery. The viral protein Vpx is capable of increasing lentiviral RT by antagonizing the restriction factor SAMHD1. Incorporating Vpx into lentiviral vectors could substantially increase gene delivery into the HIV-1 reservoir. The feasibility of this Vpx approach was tested in resting cell models utilizing macrophages and dendritic cells. Our results showed Vpx exposure led to increased permissiveness of cells over a period that exceeded 2 weeks. Consequently, significant lower potency of HIV-1 antiretrovirals inhibiting RT and integration was observed. When Vpx was incorporated with anti-HIV-1 genes inhibiting either pre-RT or post-RT stages of the viral life-cycle, transduction levels significantly increased. However, a stronger antiviral effect was only observed with constructs that inhibit pre-RT stages of the viral life cycle. In conclusion this study demonstrates a way to overcome the major delivery obstacle of gene delivery into HIV-1 reservoir cell types. Importantly, incorporating Vpx with pre-RT anti-HIV-1 genes, demonstrated the greatest protection against HIV-1 infection.

  20. Design and Potential of Non-Integrating Lentiviral Vectors

    Directory of Open Access Journals (Sweden)

    Aaron Shaw

    2014-01-01

    Full Text Available Lentiviral vectors have demonstrated promising results in clinical trials that target cells of the hematopoietic system. For these applications, they are the vectors of choice since they provide stable integration into cells that will undergo extensive expansion in vivo. Unfortunately, integration can have unintended consequences including dysregulated cell growth. Therefore, lentiviral vectors that do not integrate are predicted to have a safer profile compared to integrating vectors and should be considered for applications where transient expression is required or for sustained episomal expression such as in quiescent cells. In this review, the system for generating lentiviral vectors will be described and used to illustrate how alterations in the viral integrase or vector Long Terminal Repeats have been used to generate vectors that lack the ability to integrate. In addition to their safety advantages, these non-integrating lentiviral vectors can be used when persistent expression would have adverse consequences. Vectors are currently in development for use in vaccinations, cancer therapy, site-directed gene insertions, gene disruption strategies, and cell reprogramming. Preclinical work will be described that illustrates the potential of this unique vector system in human gene therapy.

  1. Inhibition of HIV-1 lentiviral particles infectivity by Gynostemma ...

    African Journals Online (AJOL)

    These claims motivated the study in which the inhibition of viral vector infectivity of HeLa cells was assessed flow cytometrically by measuring the expression of green fluorescent protein (GFP) transgene incorporated in the lentiviral vector construct. An infectious VSV-G-pseudotyped, human immunodeficiency virus type ...

  2. An optimized lentiviral vector system for conditional RNAi and efficient cloning of microRNA embedded short hairpin RNA libraries.

    Science.gov (United States)

    Adams, Felix F; Heckl, Dirk; Hoffmann, Thomas; Talbot, Steven R; Kloos, Arnold; Thol, Felicitas; Heuser, Michael; Zuber, Johannes; Schambach, Axel; Schwarzer, Adrian

    2017-09-01

    RNA interference (RNAi) and CRISPR-Cas9-based screening systems have emerged as powerful and complementary tools to unravel genetic dependencies through systematic gain- and loss-of-function studies. In recent years, a series of technical advances helped to enhance the performance of virally delivered RNAi. For instance, the incorporation of short hairpin RNAs (shRNAs) into endogenous microRNA contexts (shRNAmiRs) allows the use of Tet-regulated promoters for synchronous onset of gene knockdown and precise interrogation of gene dosage effects. However, remaining challenges include lack of efficient cloning strategies, inconsistent knockdown potencies and leaky expression. Here, we present a simple, one-step cloning approach for rapid and efficient cloning of miR-30 shRNAmiR libraries. We combined a human miR-30 backbone retaining native flanking sequences with an optimized all-in-one lentiviral vector system for conditional RNAi to generate a versatile toolbox characterized by higher doxycycline sensitivity, reduced leakiness and enhanced titer. Furthermore, refinement of existing shRNA design rules resulted in substantially improved prediction of powerful shRNAs. Our approach was validated by accurate quantification of the knockdown potency of over 250 single shRNAmiRs. To facilitate access and use by the scientific community, an online tool was developed for the automated design of refined shRNA-coding oligonucleotides ready for cloning into our system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Lentiviral hematopoietic cell gene therapy for X-linked adrenoleukodystrophy.

    Science.gov (United States)

    Cartier, Nathalie; Hacein-Bey-Abina, Salima; Bartholomae, Cynthia C; Bougnères, Pierre; Schmidt, Manfred; Kalle, Christof Von; Fischer, Alain; Cavazzana-Calvo, Marina; Aubourg, Patrick

    2012-01-01

    X-linked adrenoleukodystrophy (X-ALD) is a severe genetic demyelinating disease caused by a deficiency in ALD protein, an adenosine triphosphate-binding cassette transporter encoded by the ABCD1 gene. When performed at an early stage of the disease, allogeneic hematopoietic stem cell transplantation (HCT) can arrest the progression of cerebral demyelinating lesions. To overcome the limitations of allogeneic HCT, hematopoietic stem cell (HSC) gene therapy strategy aiming to perform autologous transplantation of lentivirally corrected cells was developed. We demonstrated the preclinical feasibility of HSC gene therapy for ALD based on the correction of CD34+ cells from X-ALD patients using an HIV1-derived lentiviral vector. These results prompted us to initiate an HSC gene therapy trial in two X-ALD patients who had developed progressive cerebral demyelination, were candidates for allogeneic HCT, but had no HLA-matched donors or cord blood. Autologous CD34+ cells were purified from the peripheral blood after G-CSF stimulation, genetically corrected ex vivo with a lentiviral vector encoding wild-type ABCD1 cDNA, and then reinfused into the patients after they had received full myeloablative conditioning. Over 3 years of follow-up, the hematopoiesis remained polyclonal in the two patients treated with 7-14% of granulocytes, monocytes, and T and B lymphocytes expressing the lentivirally encoded ALD protein. There was no evidence of clonal dominance or skewing based on the retrieval of lentiviral insertion repertoire in different hematopoietic lineages by deep sequencing. Cerebral demyelination was arrested 14 and 16months, respectively, in the two treated patients, without further progression up to the last follow-up, a clinical outcome that is comparable to that observed after allogeneic HCT. Longer follow-up of these two treated patients and HSC gene therapy performed in additional ALD patients are however needed to evaluate the safety and efficacy of lentiviral HSC

  4. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  5. The effect of long or chopped straw on pig behaviour.

    Science.gov (United States)

    Lahrmann, H P; Oxholm, L C; Steinmetz, H; Nielsen, M B F; D'Eath, R B

    2015-05-01

    In the EU, pigs must have permanent access to manipulable materials such as straw, rope, wood, etc. Long straw can fulfil this function, but can increase labour requirements for cleaning pens, and result in problems with blocked slatted floors and slurry systems. Chopped straw might be more practical, but what is the effect on pigs' behaviour of using chopped straw instead of long straw? Commercial pigs in 1/3 slatted, 2/3 solid pens of 15 pigs were provided with either 100 g/pig per day of long straw (20 pens) or of chopped straw (19 pens). Behavioural observations were made of three focal pigs per pen (one from each of small, medium and large weight tertiles) for one full day between 0600 and 2300 h at each of ~40 and ~80 kg. The time spent rooting/investigating overall (709 s/pig per hour at 40 kg to 533 s/pig per hour at 80 kg), or directed to the straw/solid floor (497 s/pig per hour at 40 kg to 343 s/pig per hour at 80 kg), was not affected by straw length but reduced with age. Time spent investigating other pigs (83 s/pig per hour at 40 kg), the slatted floor (57 s/pig per hour) or pen fixtures (21 s/pig per hour) was not affected by age or straw length. Aggressive behaviour was infrequent, but lasted about twice as long in pens with chopped straw (2.3 s/pig per hour at 40 kg) compared with pens with long straw (1.0 s/pig per hour at 40 kg, P=0.060). There were no significant effects of straw length on tail or ear lesions, but shoulders were significantly more likely to have minor scratches with chopped straw (P=0.031), which may reflect the higher levels of aggression. Smaller pigs showed more rooting/investigatory behaviour, and in particular directed towards the straw/solid floor and the slatted floor than their larger pen-mates. Females exhibited more straw and pen fixture-directed behaviour than males. There were no effects of pig size or sex on behaviour directed towards other pigs. In summary, pigs spent similar amounts of time interacting with straw

  6. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  7. Gene therapy of Fanconi anemia: preclinical efficacy using lentiviral vectors.

    Science.gov (United States)

    Galimi, Francesco; Noll, Meenakshi; Kanazawa, Yoshiyuki; Lax, Timothy; Chen, Cindy; Grompe, Markus; Verma, Inder M

    2002-10-15

    Fanconi anemia (FA) is an inherited cancer susceptibility syndrome caused by mutations in a DNA repair pathway including at least 6 genes (FANCA, FANCC, FANCD2, FANCE, FANCF, and FANCG). The clinical course of the disease is dominated by progressive, life-threatening bone marrow failure and high incidence of acute myelogenous leukemia and solid tumors. Allogeneic bone marrow transplantation (BMT) is a therapeutic option but requires HLA-matched donors. Gene therapy holds great promise for FA, but previous attempts to use retroviral vectors in humans have proven ineffective given the impaired proliferation potential of human FA hematopoietic progenitors (HPCs). In this work, we show that using lentiviral vectors efficient genetic correction can be achieved in quiescent hematopoietic progenitors from Fanca(-/-) and Fancc(-/-) mice. Long-term repopulating HPCs were transduced by a single exposure of unfractionated bone marrow mononuclear cells to lentivectors carrying the normal gene. Notably, no cell purification or cytokine prestimulation was necessary. Resistance to DNA- damaging agents was fully restored by lentiviral transduction, allowing for in vivo selection of the corrected cells with nonablative doses of cyclophosphamide. This study strongly supports the use of lentiviral vectors for FA gene therapy in humans.

  8. Chopping and webbing control saw-palmetto in south Florida

    Science.gov (United States)

    Clifford E. Lewis

    1972-01-01

    Saw-palmetto is one of the more troublesome plants growing in south Florida, and its control is often desirable in programs of range and timber management. Both cross-chopping and webbing (root plowing) proved to be effective control measures, but webbing appeared to be less effective on a moist site. Many other shrubs were also effectively reduced by these treatments...

  9. development of oscillating classifiers for forage chop length ...

    African Journals Online (AJOL)

    Dr Obe

    1987-09-01

    Sep 1, 1987 ... 6.Calculation of Forage Chop Size. Particle size distribution is characterised by the parameters that measure the central tendency of the distribution and the dispersion about the central tendency. Most fine particle systems obey the logarithmic normal distribution function [4]. This means that the distribution.

  10. Prolonged Integration Site Selection of a Lentiviral Vector in the Genome of Human Keratinocytes.

    Science.gov (United States)

    Qian, Wei; Wang, Yong; Li, Rui-Fu; Zhou, Xin; Liu, Jing; Peng, Dai-Zhi

    2017-03-03

    BACKGROUND Lentiviral vectors have been successfully used for human skin cell gene transfer studies. Defining the selection of integration sites for retroviral vectors in the host genome is crucial in risk assessment analysis of gene therapy. However, genome-wide analyses of lentiviral integration sites in human keratinocytes, especially after prolonged growth, are poorly understood. MATERIAL AND METHODS In this study, 874 unique lentiviral vector integration sites in human HaCaT keratinocytes after long-term culture were identified and analyzed with the online tool GTSG-QuickMap and SPSS software. RESULTS The data indicated that lentiviral vectors showed integration site preferences for genes and gene-rich regions. CONCLUSIONS This study will likely assist in determining the relative risks of the lentiviral vector system and in the design of a safe lentiviral vector system in the gene therapy of skin diseases.

  11. CHOP compared with CHOP plus granulocyte colony-stimulating factor in elderly patients with aggressive non-Hodgkin's lymphoma

    NARCIS (Netherlands)

    Doorduijn, JK; van der Holt, B; van Imhoff, GW; van der Hem, KG; Kramer, MHH; van Oers, MHJ; Ossenkoppele, GJ; Verdonck, LF; Verhoef, GEG; Steijaert, MMC; Buijt, I.; Uyl-de Groot, CA; van Agthoven, M; Mulder, AH; Sonneveld, P; Schaafsma, M.

    2003-01-01

    Purpose : To investigate whether the relative close-intensity of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy could be improved by prophylactic administration of granulocyte colony-stimulating factor (G-CSF) in elderly patients with aggressive non-Hodgkin's lymphoma

  12. CHOP compared with CHOP plus granulocyte colony-stimulating factor in elderly patients with aggressive non-Hodgkin's lymphoma

    NARCIS (Netherlands)

    Doorduijn, J. K.; van der Holt, B.; van Imhoff, G. W.; van der Hem, K. G.; Kramer, M. H. H.; van Oers, M. H. J.; Ossenkoppele, G. J.; Schaafsma, M. R.; Verdonck, L. F.; Verhoef, G. E. G.; Steijaert, M. M. C.; Buijt, I.; Uyl-de Groot, C. A.; van Agthoven, M.; Mulder, A. H.; Sonneveld, P.

    2003-01-01

    PURPOSE: To investigate whether the relative dose-intensity of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy could be improved by prophylactic administration of granulocyte colony-stimulating factor (G-CSF) in elderly patients with aggressive non-Hodgkin's lymphoma

  13. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  14. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  15. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  16. A novel type of EWS-CHOP fusion gene in myxoid liposarcoma

    International Nuclear Information System (INIS)

    Matsui, Yoshito; Ueda, Takafumi; Kubo, Takahiro; Hasegawa, Tadashi; Tomita, Yasuhiko; Okamoto, Mina; Myoui, Akira; Kakunaga, Shigeki; Yasui, Natsuo; Yoshikawa, Hideki

    2006-01-01

    The cytogenetic hallmark of myxoid type and round cell type liposarcoma consists of reciprocal translocation of t(12;16)(q13;p11) and t(12;22)(q13;q12), which results in fusion of TLS/FUS and CHOP, and EWS and CHOP, respectively. Nine structural variations of the TLS/FUS-CHOP chimeric transcript have been reported, however, only two types of EWS-CHOP have been described. We describe here a case of myxoid liposarcoma containing a novel EWS-CHOP chimeric transcript and identified the breakpoint occurring in intron 13 of EWS. Reverse transcription-polymerase chain reaction and direct sequence showed that exon 13 of EWS was in-frame fused to exon 2 of CHOP. Genomic analysis revealed that the breaks were located in intron 13 of EWS and intron 1 of CHOP

  17. Application of phaco prechop with phaco chop technique in phacoemulsification

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2014-03-01

    Full Text Available AIM:To compare two phaco techniques, namely phaco prechop with phaco chop and divide and conquer, and to discuss the technical advantages of phaco prechop with phaco chop METHODS:The study included 131 patients(156 eyeswith age-related cataract eyes divided into 2 groups, group A including 68 patients(82 eyes, in which phaco prechop with phaco chop was performed, and group B including 63 patients(74 eyes, in which divide and conquer was performed. The mean parameters including average power(AP, U/S time, accumulated energy complex parameter(AECP, mean endothelial cell count, mean endothelial cell loss, intraoperative complications, postoperative uncorrected visual acuity(UCVAat 1d and 1wk, and corneal edema were reported in the two groups both preoperative and postoperative.RESULTS:The subgroups with same grade of lens nucleus hardness were compared. Parameters such as AP, U/S time, AECP in group A were significantly less than those in group B. Postoperative corneal clarity and UCVA at 1d in group A was better than that in group B. No significant difference was found in UCVA at 1wk after operation between the two groups. The difference in mean endothelial cell count at 3mo postoperative between the two groups was statistically insignificant(P>0.05, however the difference in endothelial cell loss at 3mo postoperatively between the two groups was statistically significant(PCONCLUSION:Compare with divide and conquer, phaco prechop with phaco chop utilized less phaco time, energy, and the rate of endothelial cell loss at 3mo postoperatively, and better early postoperative uncorrected visual acuity.

  18. Etching radical controlled gas chopped deep reactive ion etching

    Science.gov (United States)

    Olynick, Deidre; Rangelow, Ivo; Chao, Weilun

    2013-10-01

    A method for silicon micromachining techniques based on high aspect ratio reactive ion etching with gas chopping has been developed capable of producing essentially scallop-free, smooth, sidewall surfaces. The method uses precisely controlled, alternated (or chopped) gas flow of the etching and deposition gas precursors to produce a controllable sidewall passivation capable of high anisotropy. The dynamic control of sidewall passivation is achieved by carefully controlling fluorine radical presence with moderator gasses, such as CH.sub.4 and controlling the passivation rate and stoichiometry using a CF.sub.2 source. In this manner, sidewall polymer deposition thicknesses are very well controlled, reducing sidewall ripples to very small levels. By combining inductively coupled plasmas with controlled fluorocarbon chemistry, good control of vertical structures with very low sidewall roughness may be produced. Results show silicon features with an aspect ratio of 20:1 for 10 nm features with applicability to nano-applications in the sub-50 nm regime. By comparison, previous traditional gas chopping techniques have produced rippled or scalloped sidewalls in a range of 50 to 100 nm roughness.

  19. Construction of a novel lentiviral vector carrying human B-domain ...

    African Journals Online (AJOL)

    ... integration were detected in all cell lines after transfection. A novel lentiviral vector carrying human FVIII³BD was constructed, which was able to transfect different mammalian cell types accompanied by high-level activity. This lentiviral vector may provide a theoretical basis for the gene therapy of patients with hemophilia ...

  20. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    Energy Technology Data Exchange (ETDEWEB)

    Liechtenstein, Therese, E-mail: t.liechtenstein.12@ucl.ac.uk [University College London, 5 University Street, London, WC1E 6JF (United Kingdom); Perez-Janices, Noemi; Escors, David [University College London, 5 University Street, London, WC1E 6JF (United Kingdom); Navarrabiomed Fundacion Miguel Servet, 3 Irunlarrea St., Hospital Complex of Navarra, 31008 Pamplona, Navarra (Spain)

    2013-07-02

    The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(γ-)retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and β-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells.

  1. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    International Nuclear Information System (INIS)

    Liechtenstein, Therese; Perez-Janices, Noemi; Escors, David

    2013-01-01

    The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(γ-)retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and β-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells

  2. Lentiviral Vectors for Cancer Immunotherapy and Clinical Applications

    Directory of Open Access Journals (Sweden)

    David Escors

    2013-07-01

    Full Text Available The success of immunotherapy against infectious diseases has shown us the powerful potential that such a treatment offers, and substantial work has been done to apply this strategy in the fight against cancer. Cancer is however a fiercer opponent than pathogen-caused diseases due to natural tolerance towards tumour associated antigens and tumour-induced immunosuppression. Recent gene therapy clinical trials with viral vectors have shown clinical efficacy in the correction of genetic diseases, HIV and cancer. The first successful gene therapy clinical trials were carried out with onco(g-retroviral vectors but oncogenesis by insertional mutagenesis appeared as a serious complication. Lentiviral vectors have emerged as a potentially safer strategy, and recently the first clinical trial of patients with advanced leukemia using lentiviral vectors has proven successful. Additionally, therapeutic lentivectors have shown clinical efficacy for the treatment of HIV, X-linked adrenoleukodystrophy, and b-thalassaemia. This review aims at describing lentivectors and how they can be utilized to boost anti-tumour immune responses by manipulating the effector immune cells.

  3. Processing of chopped mussel meat in retort pouch

    Directory of Open Access Journals (Sweden)

    Giustino TRIBUZI

    2015-01-01

    Full Text Available Abstract Chopped mussel meat packaged in retort pouches was processed in a laboratory-scale water immersion retort, adapted for processing under overpressure conditions. Retort temperature effects on product yield and on cook value were evaluated by setting the F0 at 7 min. The effects of different pre-treatments (salting and marination on the characteristics of mussels were evaluated after processing at retort temperature of 118 °C and during a whole year of storage at 25 °C. The salted samples showed better yield during storage, while no differences were found for the other physicochemical parameters.

  4. Differential Impact of Relative Dose-Intensity Reductions in Diffuse Large B-Cell Lymphoma Treated with R-CHOP21 or R-CHOP14.

    Directory of Open Access Journals (Sweden)

    Antonio Gutiérrez

    Full Text Available DLBCL is an aggressive lymphoma treated with R-CHOP. Recently, attempts have been made to improve the outcome by increasing both dose-density and intensity but there have been no benefits in terms of survival. When treating malignancies RDI is important to consider but there is little published information on DLBCL. The purpose of this study was to analyze the differential prognostic impact of RDI in two cohorts of DLBCL patients treated with R-CHOP21 or R-CHOP14. From January 2001 to August 2013 we included DLBCL patients homogenously treated with R-CHOP21 or R-CHOP14, with or without radiotherapy, at University Hospital Son Espases, Hospital Son Llatzer of Palma and Hospital del Mar of Barcelona (N = 157. In order to avoid selection bias the patients were retrospectively identified from the Pathology Department and Pharmacy registries. Median follow-up was 68 months. There was no difference in the response or survival between the two cohorts. In the R-CHOP21 group, both a reduction higher than 15% in RDI (RR 7.41 and R-IPI (RR 2.99 were independently associated with OS. However, a reduction higher than 15% in RDI (RR 4.41 was only noted for PFS. In the R-CHOP14 group, NCCN-IPI (RR 7.09 and B-symptoms (RR 5.37 for OS; AA stage III-IV (RR 6.26 and bulky disease (RR 4.05 for PFS. There was a trend towards a higher rate of RDI reduction observed in the R-CHOP14 group but it only made an impact in the R-CHOP21 group. We conclude that R-CHOP21 and R-CHOP14 are equivalent regimens in terms of response and survival, but only if RDI reductions are avoided. For patients receiving R-CHOP21 we recommend using clinical and support measures in order to avoid RDI reductions.

  5. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  6. Construction of a novel lentiviral vector carrying human B-domain ...

    African Journals Online (AJOL)

    USER

    2010-03-29

    Mar 29, 2010 ... Construction of the lentiviral expression vector. Both self-inactivating (SIN) ..... activated partial thromboplastin time. Figure 4. Expression of ... 1 entry to an endocytic pathway and suppresses both the requirement for Nef and ...

  7. Quantitative analysis of lentiviral transgene expression in mice over seven generations.

    Science.gov (United States)

    Wang, Yong; Song, Yong-tao; Liu, Qin; Liu, Cang'e; Wang, Lu-lu; Liu, Yu; Zhou, Xiao-yang; Wu, Jun; Wei, Hong

    2010-10-01

    Lentiviral transgenesis is now recognized as an extremely efficient and cost-effective method to produce transgenic animals. Transgenes delivered by lentiviral vectors exhibited inheritable expression in many species including those which are refractory to genetic modification such as non-human primates. However, epigenetic modification was frequently observed in lentiviral integrants, and transgene expression found to be inversely correlated with methylation density. Recent data showed that about one-third lentiviral integrants exhibited hypermethylation and low expression, but did not demonstrate whether those integrants with high expression could remain constant expression and hypomethylated during long term germline transmission. In this study, using lentiviral eGFP transgenic mice as the experimental animals, lentiviral eGFP expression levels and its integrant numbers in genome were quantitatively analyzed by fluorescent quantitative polymerase-chain reaction (FQ-PCR), using the house-keeping gene ribosomal protein S18 (Rps18) and the single copy gene fatty acid binding protein of the intestine (Fabpi) as the internal controls respectively. The methylation densities of the integrants were quantitatively analyzed by bisulfite sequencing. We found that the lentiviral integrants with high expression exhibited a relative constant expression level per integrant over at least seven generations. Besides, the individuals containing these integrants exhibited eGFP expression levels which were positively and almost linearly correlated with the integrant numbers in their genomes, suggesting that no remarkable position effect on transgene expression of the integrants analyzed was observed. In addition, over seven generations the methylation density of these integrants did not increase, but rather decreased remarkably, indicating that these high expressing integrants were not subjected to de novo methylation during at least seven generations of germline transmission. Taken

  8. Modeling wormhole growth and wormhole networks in unconsolidated sand media using the BP CHOPS model

    Energy Technology Data Exchange (ETDEWEB)

    Vanderheyden, W.B. [BP America, Inc. Exploration and Production Technology Unconventional Oil Flagship (United States); Zhang, D. Z.; Jayaraman, B. [Los Alamos National Laboratory Theoretical Division Solid and Fluid Dynamics Group (United States)

    2011-07-01

    Cold Heavy Oil Production with Sand (CHOPS) is a recovery method used in unconsolidated sands to produce heavy oil. During the use of the CHOPS method, wormholes originating from production wells are generated. The aim of this paper is to present 2 modeling tools developed by BP in order to improve reservoir simulation of CHOPS operations with wormholes. The first tool developed is a CHOPS modeling framework representing wormhole networks through reservoir simulation and its wellbore model. The second one consists of the application of advanced fluid-structure interaction modeling into the simulation of wormhole and its network growth. Experiments were carried out and a qualitative agreement was achieved with the model. In addition the BP CHOPS model can predict probable oil production without calibration. This paper presented an improved model for reservoir simulation with wormholes but further work is required to predict wormhole shape in a more accurate manner.

  9. 76 FR 76890 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products...

    Science.gov (United States)

    2011-12-09

    .... FSIS-2005-0018] Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry... major cuts of single-ingredient, raw meat and poultry products and ground or chopped meat and poultry... Ground or Chopped Meat and Poultry Products'' in the Federal Register (75 FR 82148) that, among other...

  10. Two kinds of manual chopping methods applied in small incision extracapsular cataract extraction

    Directory of Open Access Journals (Sweden)

    Xia Jiang

    2016-02-01

    Full Text Available AIM:To research clinical effect of two manual chopping methods for small incision extracapsular cataract extraction. METHODS: We observed 143 cases(184 eyeswith grade Ⅳ or higher taken the small incision cataract extraction and intraocular lens implantation. Patients were given randomly knifed chopping with closed hook(92 eyesor double knifed chopping(92 eyes. The intra-operative posterior capsule rupture was observed and compared. At 1d, 1wk and 1mo postoperatively, visual acuity, corneal edema and corneal astigmatism were observed and analyzed. RESULTS:There were 10 eyes in patients accepting knifed chopping with closed hook with intra-operative posterior capsule rupture and 1 eye in patients accepting double knifed chopping. The difference between the two groups was statistically significant. The visual acuity of patients accepting knifed chopping with closed hook(92 eyesat 1d postoperatively was 0.380±0.105, and that of patients accepting double knifed chopping(92 eyeswas 0.420±0.095; the difference between the two groups was statistically significant. The visual acuity of patients accepting knifed chopping with closed hook(84 eyesat 1wk postoperatively was 0.480±0.123, and that of patients accepting double knifed chopping(86 eyeswas 0.520±0.085; the difference between the two groups was statistically significant. The visual acuity of patients accepting knifed chopping with closed hook(60 eyesat 1mo postoperatively was 0.610±0.083, and that of patients accepting double knifed chopping(52 eyeswas 0.643±0.072; the difference between the two groups was not statistically significant. The differences on corneal edema and corneal astigmatism between the two methods at 1d, 1wk and 1mo postoperatively were not statistically significant. CONCLUSION:The application of knifed chopping with closed hook and double knifed chopping in small incision extracapsular cataract extraction and intraocular lens implantation can effectively treat with

  11. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  12. Effect of grass silage chop length on chewing activity and digestibility

    DEFF Research Database (Denmark)

    Garmo, T.H.; Randby, Å.T.; Eknæs, M.

    2008-01-01

    Round bale grass silage harvested early (D-value 757 g kg-1 DM) or at a normal (D-value 696 g kg-1 DM) time was used to study the effect of harvesting time, chop length and their interaction on chewing activity and digestibility by dairy cows. Six early lactating Norwegian Red cows were used in a 6...... due to reduced ET, CT = 45, 41 and 39 min kg-1 DM for rations with long, coarsely and finely chopped silage, respectively. Grass silage chop length did not influence diet digestibility, but there was a significant effect of harvesting time on digestibility. No interaction between harvesting time...

  13. Packaging of HCV-RNA into lentiviral vector

    International Nuclear Information System (INIS)

    Caval, Vincent; Piver, Eric; Ivanyi-Nagy, Roland; Darlix, Jean-Luc; Pagès, Jean-Christophe

    2011-01-01

    Highlights: ► Description of HCV-RNA Core-D1 interactions. ► In vivo evaluation of the packaging of HCV genome. ► Determination of the role of the three basic sub-domains of D1. ► Heterologous system involving HIV-1 vector particles to mobilise HCV genome. ► Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein and HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.

  14. Packaging of HCV-RNA into lentiviral vector

    Energy Technology Data Exchange (ETDEWEB)

    Caval, Vincent [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Piver, Eric [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Service de Biochimie et Biologie Moleculaire, CHRU de Tours (France); Ivanyi-Nagy, Roland; Darlix, Jean-Luc [LaboRetro, ENS-Lyon INSERM, U758, 46 Allee d' Italie, 69364 Lyon (France); Pages, Jean-Christophe, E-mail: jean-christophe.pages@univ-tours.fr [INSERM U966, Universite Francois Rabelais de Tours, Faculte de Medecine, 10 Bd. Tonnelle, 37000 Tours (France); Service de Biochimie et Biologie Moleculaire, CHRU de Tours (France)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Description of HCV-RNA Core-D1 interactions. Black-Right-Pointing-Pointer In vivo evaluation of the packaging of HCV genome. Black-Right-Pointing-Pointer Determination of the role of the three basic sub-domains of D1. Black-Right-Pointing-Pointer Heterologous system involving HIV-1 vector particles to mobilise HCV genome. Black-Right-Pointing-Pointer Full length mobilisation of HCV genome and HCV-receptor-independent entry. -- Abstract: The advent of infectious molecular clones of Hepatitis C virus (HCV) has unlocked the understanding of HCV life cycle. However, packaging of the genomic RNA, which is crucial to generate infectious viral particles, remains poorly understood. Molecular interactions of the domain 1 (D1) of HCV Core protein and HCV RNA have been described in vitro. Since compaction of genetic information within HCV genome has hampered conventional mutational approach to study packaging in vivo, we developed a novel heterologous system to evaluate the interactions between HCV RNA and Core D1. For this, we took advantage of the recruitment of Vpr fusion-proteins into HIV-1 particles. By fusing HCV Core D1 to Vpr we were able to package and transfer a HCV subgenomic replicon into a HIV-1 based lentiviral vector. We next examined how deletion mutants of basic sub-domains of Core D1 influenced HCV RNA recruitment. The results emphasized the crucial role of the first and third basic regions of D1 in packaging. Interestingly, the system described here allowed us to mobilise full-length JFH1 genome in CD81 defective cells, which are normally refractory to HCV infection. This finding paves the way to an evaluation of the replication capability of HCV in various cell types.

  15. Polybrene inhibits human mesenchymal stem cell proliferation during lentiviral transduction.

    Directory of Open Access Journals (Sweden)

    Paul Lin

    Full Text Available Human mesenchymal stem cells (hMSCs can be engineered to express specific genes, either for their use in cell-based therapies or to track them in vivo over long periods of time. To obtain long-term expression of these genes, a lentivirus- or retrovirus-mediated cell transduction is often used. However, given that the efficiency with these viruses is typically low in primary cells, additives such as polybrene are always used for efficient viral transduction. Unfortunately, as presented here, exposure to polybrene alone at commonly used concentratons (1-8 µg/mL negatively impacts hMSC proliferation in a dose-dependent manner as measured by CyQUANT, EdU incorporation, and cell cycle analysis. This inhibition of proliferation was observable in culture even 3 weeks after exposure. Culturing the cells in the presence of FGF-2, a potent mitogen, did not abrogate this negative effect of polybrene. In fact, the normally sharp increase in hMSC proliferation that occurs during the first days of exposure to FGF-2 was absent at 4 µg/mL or higher concentrations of polybrene. Similarly, the effect of stimulating cell proliferation under simulated hypoxic conditions was also decreased when cells were exposed to polybrene, though overall proliferation rates were higher. The negative influence of polybrene was, however, reduced when the cells were exposed to polybrene for a shorter period of time (6 hr vs 24 hr. Thus, careful evaluation should be done when using polybrene to aid in lentiviral transduction of human MSCs or other primary cells, especially when cell number is critical.

  16. Energy Saving by Chopping off Peak Demand Using Day Light

    Directory of Open Access Journals (Sweden)

    Ashok Kumar Maitra

    2011-08-01

    Full Text Available An artificial intelligent technique has been implemented in this research using real time datas to calculate how much energy can be chopped from peak load demand. The results are based on real time data that are taken from power delivering centers. These datas do reflect the present condition of power and a solution to those critical conditions during the peak period. These are done in such a way such that helps in judicious scheduling of load. The time based load scheduling has been done so as to understand the basic criteria for solving power crisis during morning peak and early evening peak. The sunray availability and percentage of load that will use day light saving (DLS technique has been taken into account in this work. The results shows that about 0.5% to 1% of load can be shedded off from the peak load period which otherwise is reduction of power. Thus it otherwise also means that an equivalent amount of energy is saved which amounts to a large saving of national money. This result is obtained on monthly and even daily basis. Thus this paper justifies DLS gives a new renewable technique to save energy.

  17. Energy Absorption in Chopped Carbon Fiber Compression Molded Composites

    International Nuclear Information System (INIS)

    Starbuck, J.M.

    2001-01-01

    In passenger vehicles the ability to absorb energy due to impact and be survivable for the occupant is called the ''crashworthiness'' of the structure. To identify and quantify the energy absorbing mechanisms in candidate automotive composite materials, test methodologies were developed for conducting progressive crush tests on composite plate specimens. The test method development and experimental set-up focused on isolating the damage modes associated with the frond formation that occurs in dynamic testing of composite tubes. Quasi-static progressive crush tests were performed on composite plates manufactured from chopped carbon fiber with an epoxy resin system using compression molding techniques. The carbon fiber was Toray T700 and the epoxy resin was YLA RS-35. The effect of various material and test parameters on energy absorption was evaluated by varying the following parameters during testing: fiber volume fraction, fiber length, fiber tow size, specimen width, profile radius, and profile constraint condition. It was demonstrated during testing that the use of a roller constraint directed the crushing process and the load deflection curves were similar to progressive crushing of tubes. Of all the parameters evaluated, the fiber length appeared to be the most critical material parameter, with shorter fibers having a higher specific energy absorption than longer fibers. The combination of material parameters that yielded the highest energy absorbing material was identified

  18. Fatigue Characteristic of Chopped Strand Mat/Polyester Composite

    Directory of Open Access Journals (Sweden)

    I Made Astika

    2012-11-01

    Full Text Available The application of composite as an alternatif material to substitute of metal has better properties than metal such as light, high elasticity, corrosion and fatigue resistance. Some components in its application are subjected to millions of varying stress cycles that initiated to fatigue failure such as crack, delamination and fracture. The strength of composite is influenced by construction, fiber type, orientation and fiber fraction. The objective of this experiment is to investigate the fatigue characteristic on SCM composite. Material composite to be used is glass fiber with chopped strand mat (CSM as fiber and Yukalac 157 BQTN-EX with 1% hardener (Mexpox as matrix. The mold process was built with hand lay-up. Fiber volume fractions in composite are 40, 32 and 24 %. The tests to be done on composite are fatigue and tensile test. The research show that the increasing of fiber fraction in composite affects increasing of fatigue life, endurance limit and tensile strength. Fatigue failure modes of composite are debonding, matrix cracking, delamination and fiber fracture.

  19. Correlation between compressive strength and ultrasonic pulse velocity of high strength concrete incorporating chopped basalt fibre

    Science.gov (United States)

    Shafiq, Nasir; Fadhilnuruddin, Muhd; Elshekh, Ali Elheber Ahmed; Fathi, Ahmed

    2015-07-01

    Ultrasonic pulse velocity (UPV), is considered as the most important test for non-destructive techniques that are used to evaluate the mechanical characteristics of high strength concrete (HSC). The relationship between the compressive strength of HSC containing chopped basalt fibre stands (CBSF) and UPV was investigated. The concrete specimens were prepared using a different ratio of CBSF as internal strengthening materials. The compressive strength measurements were conducted at the sample ages of 3, 7, 28, 56 and 90 days; whilst, the ultrasonic pulse velocity was measured at 28 days. The result of HSC's compressive strength with the chopped basalt fibre did not show any improvement; instead, it was decreased. The UPV of the chopped basalt fibre reinforced concrete has been found to be less than that of the control mix for each addition ratio of the basalt fibre. A relationship plot is gained between the cube compressive strength for HSC and UPV with various amounts of chopped basalt fibres.

  20. Non-Primate Lentiviral Vectors and Their Applications in Gene Therapy for Ocular Disorders

    Directory of Open Access Journals (Sweden)

    Vincenzo Cavalieri

    2018-06-01

    Full Text Available Lentiviruses have a number of molecular features in common, starting with the ability to integrate their genetic material into the genome of non-dividing infected cells. A peculiar property of non-primate lentiviruses consists in their incapability to infect and induce diseases in humans, thus providing the main rationale for deriving biologically safe lentiviral vectors for gene therapy applications. In this review, we first give an overview of non-primate lentiviruses, highlighting their common and distinctive molecular characteristics together with key concepts in the molecular biology of lentiviruses. We next examine the bioengineering strategies leading to the conversion of lentiviruses into recombinant lentiviral vectors, discussing their potential clinical applications in ophthalmological research. Finally, we highlight the invaluable role of animal organisms, including the emerging zebrafish model, in ocular gene therapy based on non-primate lentiviral vectors and in ophthalmology research and vision science in general.

  1. Intrinsic stress of bismuth oxide thin films: effect of vapour chopping and air ageing

    International Nuclear Information System (INIS)

    Patil, R B; Puri, R K; Puri, V

    2008-01-01

    Bismuth oxide thin films of thickness 1000 A 0 have been prepared by thermal oxidation (in air) of vacuum evaporated bismuth thin films (on glass substrate) at different oxidation temperatures and duration. Both the vapour chopped and nonchopped bismuth oxide thin films showed polycrystalline and polymorphic structure. The monoclinic bismuth oxide was found to be predominant in both the cases. The effect of vapour chopping and air exposure for 40 days on the intrinsic stress of bismuth oxide thin films has been studied. The vapour chopped films showed low (3.92 - 4.80 x 10 9 N/m 2 ) intrinsic stress than those of nonchopped bismuth oxide thin films (5.77 - 6.74 x 10 9 N/m 2 ). Intrinsic stress was found to increase due to air ageing. The effect of air ageing on the vapour chopped films was found low. The vapour chopped films showed higher packing density. Higher the packing density, lower the film will age. The process of chopping vapour flow creates films with less inhomogenety i.e. a low concentration of flaws and non-planar defects which results in lower intrinsic stress

  2. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  3. Large-scale production of lentiviral vector in a closed system hollow fiber bioreactor

    Directory of Open Access Journals (Sweden)

    Jonathan Sheu

    Full Text Available Lentiviral vectors are widely used in the field of gene therapy as an effective method for permanent gene delivery. While current methods of producing small scale vector batches for research purposes depend largely on culture flasks, the emergence and popularity of lentiviral vectors in translational, preclinical and clinical research has demanded their production on a much larger scale, a task that can be difficult to manage with the numbers of producer cell culture flasks required for large volumes of vector. To generate a large scale, partially closed system method for the manufacturing of clinical grade lentiviral vector suitable for the generation of induced pluripotent stem cells (iPSCs, we developed a method employing a hollow fiber bioreactor traditionally used for cell expansion. We have demonstrated the growth, transfection, and vector-producing capability of 293T producer cells in this system. Vector particle RNA titers after subsequent vector concentration yielded values comparable to lentiviral iPSC induction vector batches produced using traditional culture methods in 225 cm2 flasks (T225s and in 10-layer cell factories (CF10s, while yielding a volume nearly 145 times larger than the yield from a T225 flask and nearly three times larger than the yield from a CF10. Employing a closed system hollow fiber bioreactor for vector production offers the possibility of manufacturing large quantities of gene therapy vector while minimizing reagent usage, equipment footprint, and open system manipulation.

  4. Polyploidization without mitosis improves in vivo liver transduction with lentiviral vectors.

    Science.gov (United States)

    Pichard, Virginie; Couton, Dominique; Desdouets, Chantal; Ferry, Nicolas

    2013-02-01

    Lentiviral vectors are efficient gene delivery vehicles for therapeutic and research applications. In contrast to oncoretroviral vectors, they are able to infect most nonproliferating cells. In the liver, induction of cell proliferation dramatically improved hepatocyte transduction using all types of retroviral vectors. However, the precise relationship between hepatocyte division and transduction efficiency has not been determined yet. Here we compared gene transfer efficiency in the liver after in vivo injection of recombinant lentiviral or Moloney murine leukemia viral (MoMuLV) vectors in hepatectomized rats treated or not with retrorsine, an alkaloid that blocks hepatocyte division and induces megalocytosis. Partial hepatectomy alone resulted in a similar increase in hepatocyte transduction using either vector. In retrorsine-treated and partially hepatectomized rats, transduction with MoMuLV vectors dropped dramatically. In contrast, we observed that retrorsine treatment combined with partial hepatectomy increased lentiviral transduction to higher levels than hepatectomy alone. Analysis of nuclear ploidy in single cells showed that a high level of transduction was associated with polyploidization. In conclusion, endoreplication could be exploited to improve the efficiency of liver-directed lentiviral gene therapy.

  5. Transduction of liver cells by lentiviral vectors: analysis in living animals by fluorescence imaging

    NARCIS (Netherlands)

    Pfeifer, A.; Kessler, T.; Yang, M.; Baranov, E.; Kootstra, N.; Cheresh, D. A.; Hoffman, R. M.; Verma, I. M.

    2001-01-01

    Viral vectors based on lentiviruses, such as the human immunodeficiency virus, are able to transduce a broad spectrum of nondividing cells in vivo. This ability of lentiviral vectors makes them an attractive vehicle for gene transfer into the liver. In order to determine the requirements for

  6. Incorporating double copies of a chromatin insulator into lentiviral vectors results in less viral integrants

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Jakobsson, Johan; Rosenqvist, Nina

    2009-01-01

    BACKGROUND: Lentiviral vectors hold great promise as gene transfer vectors in gene therapeutic settings. However, problems related to the risk of insertional mutagenesis, transgene silencing and positional effects have stalled the use of such vectors in the clinic. Chromatin insulators are boundary...

  7. Chop Suey as Imagined Authentic Chinese Food: The Culinary Identity of Chinese Restaurants in the United States

    OpenAIRE

    Haiming Liu

    2009-01-01

    At least until the 1960s, chop suey was synonymous with Chinese food in the United States, where most Chinese restaurants were called chop suey houses. By uncovering the history of chop suey, this article analyzes the development of Chinese cuisine in the U.S. as an example of transnational cultural exchange. The authenticity and culinary identity of Chinese food in America often rested on its real or imagined Chinese roots while its popularity depended on how well Chinese restaurant...

  8. Addition of rituximab to chop does not increase the risk of cardiotoxicity in patients with non-Hodgkin's lymphoma.

    Science.gov (United States)

    Kilickap, Saadettin; Yavuz, Bunyamin; Aksoy, Sercan; Sahiner, Levent; Dincer, Murat; Harputluoglu, Hakan; Erman, Mustafa; Aytemir, Kudret; Tokgozoglu, Lale; Barista, Ibrahim

    2008-01-01

    The addition of rituximab to doxorubicin-containing standard chemotherapy significantly improves response to therapy and reduces the risk of death in B-cell non-Hodgkin's lymphoma (NHL) patients. However, the impact of this approach on doxorubicin-induced cardiotoxicity has not been elucidated. Patients who had been planned to receive CHOP or rituximab plus CHOP (R-CHOP) combination chemotherapy with a diagnosis of NHL were included in the study. In all patients, systolic and diastolic parameters were measured by using conventional and pulsed-wave tissue Doppler echocardiography, which is more sensitive than conventional lead-dependent techniques, both before and in the sixth month of therapy. There were 28 (M/F; 14/14) patients on CHOP and 33 (M/F; 16/17) patients on R-CHOP. Median age in CHOP and R-CHOP was 49 and 50 years (P = 0.44), respectively. Cumulative doxorubicin doses were 280 and 286 mg/m(2) on CHOP and R-CHOP (P = 0.65), respectively. None of the patients developed clinically evident congestive heart failure. Parameters of systolic function such as LVEF and FS did not significantly change in any patients. In both arms, tissue Doppler parameters of diastolic function such as lateral E and septal E velocity of mitral annulus decreased significantly after therapy (P 0.05). Conventional Doppler echocardiography yielded consistent findings. Both CHOP and R-CHOP cause diastolic dysfunction in the early period following their administration. The addition of rituximab to CHOP chemotherapy does not significantly increase the risk of doxorubicin-induced cardiotoxicity during this period.

  9. New World feline APOBEC3 potently controls inter-genus lentiviral transmission.

    Science.gov (United States)

    Konno, Yoriyuki; Nagaoka, Shumpei; Kimura, Izumi; Yamamoto, Keisuke; Kagawa, Yumiko; Kumata, Ryuichi; Aso, Hirofumi; Ueda, Mahoko Takahashi; Nakagawa, So; Kobayashi, Tomoko; Koyanagi, Yoshio; Sato, Kei

    2018-04-10

    The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3; A3) gene family appears only in mammalian genomes. Some A3 proteins can be incorporated into progeny virions and inhibit lentiviral replication. In turn, the lentiviral viral infectivity factor (Vif) counteracts the A3-mediated antiviral effect by degrading A3 proteins. Recent investigations have suggested that lentiviral vif genes evolved to combat mammalian APOBEC3 proteins, and have further proposed that the Vif-A3 interaction may help determine the co-evolutionary history of cross-species lentiviral transmission in mammals. Here we address the co-evolutionary relationship between two New World felids, the puma (Puma concolor) and the bobcat (Lynx rufus), and their lentiviruses, which are designated puma lentiviruses (PLVs). We demonstrate that PLV-A Vif counteracts the antiviral action of APOBEC3Z3 (A3Z3) of both puma and bobcat, whereas PLV-B Vif counteracts only puma A3Z3. The species specificity of PLV-B Vif is irrespective of the phylogenic relationships of feline species in the genera Puma, Lynx and Acinonyx. We reveal that the amino acid at position 178 in the puma and bobcat A3Z3 is exposed on the protein surface and determines the sensitivity to PLV-B Vif-mediated degradation. Moreover, although both the puma and bobcat A3Z3 genes are polymorphic, their sensitivity/resistance to PLV Vif-mediated degradation is conserved. To the best of our knowledge, this is the first study suggesting that the host A3 protein potently controls inter-genus lentiviral transmission. Our findings provide the first evidence suggesting that the co-evolutionary arms race between lentiviruses and mammals has occurred in the New World.

  10. Effect of meat appearance on consumer preferences for pork chops in Greece and Cyprus.

    Science.gov (United States)

    Fortomaris, P; Arsenos, G; Georgiadis, M; Banos, G; Stamataris, C; Zygoyiannis, D

    2006-04-01

    The effect of meat appearance on consumers' preferences for pork chops was assessed using images manipulated for appearance characteristics. Data were collected from 412 consumers in Greece and Cyprus. Consumers were asked for their preference for pork chops from a book of computer-modified images and then completed a questionnaire of socio-demographic information, including eating and purchasing behaviour. Consumers under the age of 35 years showed preferences for dark red, lean pork, while consumers aged 35 years and older preferred either dark or light red pork. Gender appeared to be an important selection factor as men showed an increased preference for dark red pork while women preferred the light red. Consumers who stated that they like pork for its taste (91%) preferred either dark or light red pork chops while those who like pork for reasons other than taste preferred dark red, lean pork. Urban consumers preferred light red, fatty pork chops while the rural consumers preferred the dark red pork chops.

  11. Role of intrinsic search cues in the formation of consumer preferences and choice for pork chops.

    Science.gov (United States)

    Verbeke, Wim; De Smet, Stefaan; Vackier, Isabelle; Van Oeckel, Monique J; Warnants, Nathalie; Van Kenhove, Patrick

    2005-02-01

    This study investigates the role of drip, colour, marbling and fat cover as intrinsic search cues in the formation of pork chop preferences and individual determinants. Data are collected from a sample of 443 pork consumers in Belgium through using repeated selection of chops from randomised photobooks and questionnaires including socio-demographic, attitudinal and behavioural variables. Data analysis includes mixture regression analysis, bivariate descriptive statistics and the estimation of multivariate probit models. Consumers sampled in this study prefer pork chops without fat cover. Preference for fat cover is stronger among male, 35+ aged consumers with lower levels of awareness of the relation between food and health and who like pork for other reasons than taste and nutritional value (all p<0.05). Preference for colour is equally consistent within an individual, though fifty-fifty light-dark, with dark chops being more preferred by 35+ aged consumers (p<0.05). Preferences for marbling and drip are not consistent and not determined by joint socio-demographic, attitudinal and behavioural factors. Preferences for cue levels are not correlated, except a weak relation between preference for dark chops without drip (r=0.116). Preferences are apparently formed by deductions with the use of single cues as key information, mainly based on fat cover or colour, and random choice on marbling and drip.

  12. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  13. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  14. Characterization of methane emissions from five cold heavy oil production with sands (CHOPS) facilities.

    Science.gov (United States)

    Roscioli, Joseph R; Herndon, Scott C; Yacovitch, Tara I; Knighton, W Berk; Zavala-Araiza, Daniel; Johnson, Matthew R; Tyner, David R

    2018-03-07

    Cold heavy oil production with sands (CHOPS) is a common oil extraction method in the Canadian provinces of Alberta and Saskatchewan that can result in significant methane emissions due to annular venting. Little is known about the magnitude of these emissions, nor their contributions to the regional methane budget. Here the authors present the results of field measurements of methane emissions from CHOPS wells and compare them with self-reported venting rates. The tracer ratio method was used not only to analyze total site emissions but at one site it was also used to locate primary emission sources and quantify their contributions to the facility-wide emission rate, revealing the annular vent to be a dominant source. Emissions measured from five different CHOPS sites in Alberta showed large discrepancies between the measured and reported rates, with emissions being mainly underreported. These methane emission rates are placed in the context of current reporting procedures and the role that gas-oil ratio (GOR) measurements play in vented volume estimates. In addition to methane, emissions of higher hydrocarbons were also measured; a chemical "fingerprint" associated with CHOPS wells in this region reveals very low emission ratios of ethane, propane, and aromatics versus methane. The results of this study may inform future studies of CHOPS sites and aid in developing policy to mitigate regional methane emissions. Methane measurements from cold heavy oil production with sand (CHOPS) sites identify annular venting to be a potentially major source of emissions at these facilities. The measured emission rates are generally larger than reported by operators, with uncertainty in the gas-oil ratio (GOR) possibly playing a large role in this discrepancy. These results have potential policy implications for reducing methane emissions in Alberta in order to achieve the Canadian government's goal of reducing methane emissions by 40-45% below 2012 levels within 8 yr.

  15. Development of disassembly and pin chopping technology for FBR spent fuels

    International Nuclear Information System (INIS)

    Kobayashi, Tsuguyuki; Namba, Takashi; Kawabe, Yukinari; Washiya, Tadahiro

    2008-01-01

    Japan Atomic Power Company (JAPC) and Japan Atomic Energy Agency (JAEA) have been developing fuel disassembly and fuel pin chopping systems for a future Japanese commercial FBR. At first, the wrapper tube is cut by the slit-cut to pull it out, then the fuel pins are cut by the crop-cut at their end-plugs to separate them from the entrance nozzle. The pins are transferred to the magazine of the chopping machine. A series of tests were performed to develop this procedure. As the result of mechanical cutting tests, the CBN wheel was selected. The slit-cut tests were carried out to evaluated the cutting performance of the wheel. The wrapper tube is normally slit-cut in the circumferential direction. One CBN wheel could cut more than 5 fuel assemblies in this direction. The slit-cut in the axial direction is prepared as provision when the tube is difficult to put out. More work is needed to cut 5mm thick PNC-FMS plate in this direction without damaging the pins beneath it. As the result of the crop-cut tests of end-plugs made of ODS steel, the CBN wheel could cut the 61 pin bundle by two strokes. More work is needed to cut the 217 pin bundle. Fuel pin handling tests were performed to transfer them from the disassembly machine to the chopping machine. The Saucer tray was selected to receive the disassembled pins. All the pins were transferred and loaded into a magazine of the chopping machine. Fuel pin loading tests were conducted to optimize the magazine configuration to make the chopping length within 1.0±0.5 cm. In order to decrease the disturbance during chopping, the width of the magazine was adjusted to be 12 cm and installation of a height adjuster is favourable to control the free space above the pins. (author)

  16. RNase L controls terminal adipocyte differentiation, lipids storage and insulin sensitivity via CHOP10 mRNA regulation

    DEFF Research Database (Denmark)

    Fabre, Odile Martine Julie; Salehzada, T; Lambert, K

    2012-01-01

    Adipose tissue structure is altered during obesity, leading to deregulation of whole-body metabolism. Its function depends on its structure, in particular adipocytes number and differentiation stage. To better understand the mechanisms regulating adipogenesis, we have investigated the role...... is associated with CHOP10 mRNA and regulates its stability. CHOP10 expression is conserved in RNase L(-/-)-MEFs, maintaining preadipocyte state while impairing their terminal differentiation. RNase L(-/-)-MEFs have decreased lipids storage capacity, insulin sensitivity and glucose uptake. Expression of ectopic...... RNase L in RNase L(-/-)-MEFs triggers CHOP10 mRNA instability, allowing increased lipids storage, insulin response and glucose uptake. Similarly, downregulation of CHOP10 mRNA with CHOP10 siRNA in RNase L(-/-)-MEFs improves their differentiation in adipocyte. In vivo, aged RNase L(-)/(-) mice present...

  17. Tracking differentiating neural progenitors in pluripotent cultures using microRNA-regulated lentiviral vectors.

    Science.gov (United States)

    Sachdeva, Rohit; Jönsson, Marie E; Nelander, Jenny; Kirkeby, Agnete; Guibentif, Carolina; Gentner, Bernhard; Naldini, Luigi; Björklund, Anders; Parmar, Malin; Jakobsson, Johan

    2010-06-22

    In this study, we have used a microRNA-regulated lentiviral reporter system to visualize and segregate differentiating neuronal cells in pluripotent cultures. Efficient suppression of transgene expression, specifically in undifferentiated pluripotent cells, was achieved by using a lentiviral vector expressing a fluorescent reporter gene regulated by microRNA-292. Using this strategy, it was possible to track progeny from murine ES, human ES cells, and induced pluripotent stem cells as they differentiated toward the neural lineage. In addition, this strategy was successfully used to FACS purify neuronal progenitors for molecular analysis and transplantation. FACS enrichment reduced tumor formation and increased survival of ES cell-derived neuronal progenitors after transplantation. The properties and versatility of the microRNA-regulated vectors allows broad use of these vectors in stem cell applications.

  18. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  19. Prolonged liver-specific transgene expression by a non-primate lentiviral vector

    International Nuclear Information System (INIS)

    Condiotti, Reba; Curran, Michael A.; Nolan, Garry P.; Giladi, Hilla; Ketzinel-Gilad, Mali; Gross, Eitan; Galun, Eithan

    2004-01-01

    Liver-directed gene therapy has the potential for treatment of numerous inherited diseases affecting metabolic functions. The aim of this study was to evaluate gene expression in hepatocytes using feline immunodeficiency virus-based lentiviral vectors, which may be potentially safer than those based on human immunodeficiency virus. In vitro studies revealed that gene expression was stable for up to 24 days post-transduction and integration into the host cell genome was suggested by Alu PCR and Southern blot analyses. Systemic in vivo administration of viral particles by the hydrodynamics method resulted in high levels of gene expression exclusively in the liver for over 7 months whereas injection of plasmid DNA by the same method led to transient expression levels. Our studies suggest that feline immunodeficiency-based lentiviral vectors specifically transduce liver cells and may be used as a novel vehicle of gene delivery for treatment of metabolic disease

  20. Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

    Directory of Open Access Journals (Sweden)

    Kohn Aimee

    2009-01-01

    Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

  1. Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

    Directory of Open Access Journals (Sweden)

    Dismuke Adria D

    2009-07-01

    Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

  2. Lentiviral Vector Design and Imaging Approaches to Visualize the Early Stages of Cellular Reprogramming

    OpenAIRE

    Warlich, Eva; Kuehle, Johannes; Cantz, Tobias; Brugman, Martijn H; Maetzig, Tobias; Galla, Melanie; Filipczyk, Adam A; Halle, Stephan; Klump, Hannes; Schöler, Hans R; Baum, Christopher; Schroeder, Timm; Schambach, Axel

    2011-01-01

    Induced pluripotent stem cells (iPSCs) can be derived from somatic cells by gene transfer of reprogramming transcription factors. Expression levels of these factors strongly influence the overall efficacy to form iPSC colonies, but additional contribution of stochastic cell-intrinsic factors has been proposed. Here, we present engineered color-coded lentiviral vectors in which codon-optimized reprogramming factors are co-expressed by a strong retroviral promoter that is rapidly silenced in iP...

  3. study on the chopping and mixing of cotton stalks with soil | Sa glam ...

    African Journals Online (AJOL)

    -type, splined-type and vertical-blade rotating dredge). Field experiments were conducted with each type to determine the proportion of non-uprooted cotton stalks; mean “post-chopping height” of the stalks, measured from soil surface; and the ...

  4. Salmonella Immunotherapy Improves the Outcome of CHOP Chemotherapy in Non-Hodgkin Lymphoma-Bearing Mice

    Science.gov (United States)

    Bascuas, Thais; Moreno, María; Grille, Sofía; Chabalgoity, José A.

    2018-01-01

    We have previously shown that Salmonella immunotherapy is effective to treat B-cell non-Hodgkin lymphoma (B-NHL) in mice. However, this model involves animals with high tumor burden, whereas in the clinics B-NHL patients are usually treated with chemotherapy (CHOP: cyclophosphamide, doxorubicin, vincristine, and prednisone) as first-line therapy prior to immunotherapy. Recently, we have described a NHL-B preclinical model using CHOP chemotherapy to achieve MRD in immunocompetent animals that closely resemble patients’ conditions. In this work, we assessed the efficacy of Salmonella immunotherapy in B-NHL-bearing mice undergoing chemotherapy. Salmonella administration significantly delayed tumor growth and prolonged survival of chemotherapy-treated NHL-bearing animals. Mice receiving the CHOP–Salmonella combined therapy showed increased numbers of tumor-infiltrating leukocytes and a different profile of cytokines and chemokines expressed in the tumor microenvironment. Further, Salmonella immunotherapy in CHOP-treated animals also enhanced NK cells cytotoxic activity as well as induced systemic lymphoma-specific humoral and cellular responses. Chemotherapy treatment profoundly impacted on the general health status of recipient animals, but those receiving Salmonella showed significantly better overall body condition. Altogether, the results clearly demonstrated that Salmonella immunotherapy could be safely used in individuals under CHOP treatment, resulting in a better prognosis. These results give strong support to consider Salmonella as a neoadjuvant therapy in a clinical setting. PMID:29410666

  5. Chopped or long roughage: what do calves prefer? Using cross point analysis of double demand functions

    NARCIS (Netherlands)

    Webb, L.E.; Bak Jensen, M.; Engel, B.; Reenen, van C.G.; Gerrits, W.J.J.; Boer, de I.J.M.; Bokkers, E.A.M.

    2014-01-01

    The present study aimed to quantify calves'(Bos taurus) preference for long versus chopped hay and straw, and hay versus straw, using cross point analysis of double demand functions, in a context where energy intake was not a limiting factor. Nine calves, fed milk replacer and concentrate, were

  6. EBV-positive immunodeficiency lymphoma after alemtuzumab-CHOP therapy for peripheral T-cell lymphoma

    NARCIS (Netherlands)

    Kluin-Nelemans, Hanneke C.; Coenen, Jules L.; Boers, James E.; van Imhoff, Gustaaf W.; Rosati, Stefano

    2008-01-01

    Chemotherapy with alemtuzumab and the combination of cyclophosphamide, adriamycin, oncovin, and prednisone (CHOP) has become experimental trial therapy for aggressive T-cell lymphoma. Several multicenter phase 3 trials; will incorporate this scheme. As part of an ongoing phase 2 trial in which we

  7. ATF4- and CHOP-Dependent Induction of FGF21 through Endoplasmic Reticulum Stress

    Directory of Open Access Journals (Sweden)

    Xiao-shan Wan

    2014-01-01

    Full Text Available Fibroblast growth factor 21 (FGF21 is an important endogenous regulator involved in the regulation of glucose and lipid metabolism. FGF21 expression is strongly induced in animal and human subjects with metabolic diseases, but little is known about the molecular mechanism. Endoplasmic reticulum (ER stress plays an essential role in metabolic homeostasis and is observed in numerous pathological processes, including type 2 diabetes, overweight, nonalcoholic fatty liver disease (NAFLD. In this study, we investigate the correlation between the expression of FGF21 and ER stress. We demonstrated that TG-induced ER stress directly regulated the expression and secretion of FGF21 in a dose- and time-dependent manner. FGF21 is the target gene for activating transcription factor 4 (ATF4 and CCAAT enhancer binding protein homologous protein (CHOP. Suppression of CHOP impaired the transcriptional activation of FGF21 by TG-induced ER stress in CHOP−/− mouse primary hepatocytes (MPH, and overexpression of ATF4 and CHOP resulted in FGF21 promoter activation to initiate the transcriptional programme. In mRNA stability assay, we indicated that ER stress increased the half-life of mRNA of FGF21 significantly. In conclusion, FGF21 expression is regulated by ER stress via ATF- and CHOP-dependent transcriptional mechanism and posttranscriptional mechanism, respectively.

  8. Dimension and quality requirements for chopped firewood; Pilkkeen mitta- ja laatuvaatimukset

    Energy Technology Data Exchange (ETDEWEB)

    Tuomi, S [Work Efficiency Inst., Rajamaeki (Finland)

    1997-12-01

    Over the heating season of 1992-1993 in total 5.6 million m{sup 3} of firewood was used for heating one-family houses in Finland. Major part consisted of chopped firewood. Two-thirds of firewood was acquired from consumers` own forests. The proportion of purchased wood was less than a fifth, about one million m{sup 3}. More than half, i.e. 750 000 house-owners consider the use of purchased firewood possible. Chopped firewood is the most favoured type of wood. A crucial problem of firewood sales is the lack of dimension and quality requirements. The measuring practice of chopped firewood has neither been standardised. These problems hamper the development of the commercial firewood market and prevents the increase of firewood use in particular in one-family houses, in which stoves and fireplaces are presently under-used. The aim of the project is to promote firewood sales and to protect consumers by preparing a proposal for the measurement and dimension and quality requirements for chopped firewood. The work is carried out on the basis of material based on field and laboratory measurements and on a literature survey. The most important results will be published as a guide book for firewood entrepreneurs and buyers. (orig.)

  9. 9 CFR 319.311 - Chow mein vegetables with meat, and chop suey vegetables with meat.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chow mein vegetables with meat, and chop suey vegetables with meat. 319.311 Section 319.311 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY...

  10. [Construction and identification of Nogo extra cellular peptide residues 1-40 gene lentiviral vector].

    Science.gov (United States)

    Yuan, Haifeng; Song, Yueming; Liu, Hao; Zhou, Chunguang; Kong, Qingquan; Liu, Liming; Gong, Quan

    2012-02-01

    To construct a lentiviral expression vector carrying Nogo extra cellular peptide residues 1-40 (NEP1-40) and to obtain NEP1-40 efficient and stable expression in mammalian cells. The DNA fragment of NEP1-40 coding sequence was amplified by PCR with designed primer from the cDNA library including NEP1-40 gene, and then subcloned into pGC-FU vector with in-fusion technique to generate the lentiviral expression vector, pGC-FU-NEP1-40. The positive clones were screened by PCR and the correct NEP1-40 was confirmed by sequencing. Recombinant lentiviruses were produced in 293T cells after the cotransfection of pGC-FU-NEP1-40, and packaging plasmids of pHelper 1.0 and pHelper 2.0. Green fluorescent protein (GFP) expression of infected 293T cells was observed to evaluate gene delivery efficiency. NEP1-40 protein expression in 293T cells was detected by Western blot. The lentiviral expression vector carrying NEP1-40 was successfully constructed by GFP observation, and NEP1-40 protein expression was detected in 293T cells by Western blot. The recombinant lentivirus pGC-FU-NEP1-40 is successfully constructed and it lays a foundation for further molecular function study of NEP 1-40.

  11. Comparison of lentiviral and sleeping beauty mediated αβ T cell receptor gene transfer.

    Directory of Open Access Journals (Sweden)

    Anne-Christine Field

    Full Text Available Transfer of tumour antigen-specific receptors to T cells requires efficient delivery and integration of transgenes, and currently most clinical studies are using gamma retroviral or lentiviral systems. Whilst important proof-of-principle data has been generated for both chimeric antigen receptors and αβ T cell receptors, the current platforms are costly, time-consuming and relatively inflexible. Alternative, more cost-effective, Sleeping Beauty transposon-based plasmid systems could offer a pathway to accelerated clinical testing of a more diverse repertoire of recombinant high affinity T cell receptors. Nucleofection of hyperactive SB100X transposase-mediated stable transposition of an optimised murine-human chimeric T cell receptor specific for Wilm's tumour antigen from a Sleeping Beauty transposon plasmid. Whilst transfer efficiency was lower than that mediated by lentiviral transduction, cells could be readily enriched and expanded, and mediated effective target cells lysis in vitro and in vivo. Integration sites of transposed TCR genes in primary T cells were almost randomly distributed, contrasting the predilection of lentiviral vectors for transcriptionally active sites. The results support exploitation of the Sleeping Beauty plasmid based system as a flexible and adaptable platform for accelerated, early-phase assessment of T cell receptor gene therapies.

  12. Development of a replication-competent lentivirus assay for dendritic cell-targeting lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Daniel C Farley

    Full Text Available It is a current regulatory requirement to demonstrate absence of detectable replication-competent lentivirus (RCL in lentiviral vector products prior to use in clinical trials. Immune Design previously described an HIV-1-based integration-deficient lentiviral vector for use in cancer immunotherapy (VP02. VP02 is enveloped with E1001, a modified Sindbis virus glycoprotein which targets dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN expressed on dendritic cells in vivo. Vector enveloped with E1001 does not transduce T-cell lines used in standard HIV-1-based RCL assays, making current RCL testing formats unsuitable for testing VP02. We therefore developed a novel assay to test for RCL in clinical lots of VP02. This assay, which utilizes a murine leukemia positive control virus and a 293F cell line expressing the E1001 receptor DC-SIGN, meets a series of evaluation criteria defined in collaboration with US regulatory authorities and demonstrates the ability of the assay format to amplify and detect a hypothetical RCL derived from VP02 vector components. This assay was qualified and used to test six independent GMP production lots of VP02, in which no RCL was detected. We propose that the evaluation criteria used to rationally design this novel method should be considered when developing an RCL assay for any lentiviral vector.

  13. A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

    Science.gov (United States)

    White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

    2017-06-12

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  14. Chopped or long roughage: what do calves prefer? Using cross point analysis of double demand functions.

    Directory of Open Access Journals (Sweden)

    Laura E Webb

    Full Text Available The present study aimed to quantify calves' (Bos taurus preference for long versus chopped hay and straw, and hay versus straw, using cross point analysis of double demand functions, in a context where energy intake was not a limiting factor. Nine calves, fed milk replacer and concentrate, were trained to work for roughage rewards from two simultaneously available panels. The cost (number of muzzle presses required on the panels varied in each session (left panel/right panel: 7/35, 14/28, 21/21, 28/14, 35/7. Demand functions were estimated from the proportion of rewards achieved on one panel relative to the total number of rewards achieved in one session. Cross points (cp were calculated as the cost at which an equal number of rewards was achieved from both panels. The deviation of the cp from the midpoint (here 21 indicates the strength of the preference. Calves showed a preference for long versus chopped hay (cp = 14.5; P = 0.004, and for hay versus straw (cp = 38.9; P = 0.004, both of which improve rumen function. Long hay may stimulate chewing more than chopped hay, and the preference for hay versus straw could be related to hedonic characteristics. No preference was found for chopped versus long straw (cp = 20.8; P = 0.910. These results could be used to improve the welfare of calves in production systems; for example, in systems where calves are fed hay along with high energy concentrate, providing long hay instead of chopped could promote roughage intake, rumen development, and rumination.

  15. Chopped or Long Roughage: What Do Calves Prefer? Using Cross Point Analysis of Double Demand Functions

    Science.gov (United States)

    Webb, Laura E.; Bak Jensen, Margit; Engel, Bas; van Reenen, Cornelis G.; Gerrits, Walter J. J.; de Boer, Imke J. M.; Bokkers, Eddie A. M.

    2014-01-01

    The present study aimed to quantify calves'(Bos taurus) preference for long versus chopped hay and straw, and hay versus straw, using cross point analysis of double demand functions, in a context where energy intake was not a limiting factor. Nine calves, fed milk replacer and concentrate, were trained to work for roughage rewards from two simultaneously available panels. The cost (number of muzzle presses) required on the panels varied in each session (left panel/right panel): 7/35, 14/28, 21/21, 28/14, 35/7. Demand functions were estimated from the proportion of rewards achieved on one panel relative to the total number of rewards achieved in one session. Cross points (cp) were calculated as the cost at which an equal number of rewards was achieved from both panels. The deviation of the cp from the midpoint (here 21) indicates the strength of the preference. Calves showed a preference for long versus chopped hay (cp  = 14.5; P  = 0.004), and for hay versus straw (cp  = 38.9; P = 0.004), both of which improve rumen function. Long hay may stimulate chewing more than chopped hay, and the preference for hay versus straw could be related to hedonic characteristics. No preference was found for chopped versus long straw (cp  = 20.8; P = 0.910). These results could be used to improve the welfare of calves in production systems; for example, in systems where calves are fed hay along with high energy concentrate, providing long hay instead of chopped could promote roughage intake, rumen development, and rumination. PMID:24558426

  16. A prospective randomized study of Chop versus Chop plus alpha-2B interferon in patients with intermediate and high grade non-Hodgkin's lymphoma: the International Oncology Study Group NHL1 Study .

    Science.gov (United States)

    Giles, F J; Shan, J; Advani, S H; Akan, H; Aydogdu, I; Aziz, Z; Azim, H A; Bapsy, P P; Buyukkececi, F; Chaimongkol, B; Chen, P M; Cheong, S K; Ferhanoglu, B; Hamza, R; Khalid, H M; Intragumtornchai, T; Kim, S W; Kim, S Y; Koc, H; Kumar, L; Kumar, R; Lei, K I; Lekhakula, A; Muthalib, A; Patel, M; Poovalingam, V P; Prayoonwiwat, W; Rana, F; Reksodiputro, A H; Ruff, P; Sagar, T G; Schwarer, A P; Song, H S; Suh, C W; Suharti, C; Supindiman, I; Tee, G Y; Thamprasit, T; Villalon, A H; Wickham, N R; Wong, J E; Yalcin, A; Jootar, S

    2000-12-01

    The addition of a brief alpha interferon regimen to each CHOP induction cycle, plus one year of alpha interferon thrice weekly maintenance therapy, has no early effect on response rates or survival in patients with Intermediate or High grade cell NHL. The CHOP (Cyclophosphamide, Adriamycin. Vincristine, Prednisone) regimen is the most widely used first-line therapy for patients with Intermediate or High Grade (IG/HG) non-Hodgkin's lymphoma (NHL). Alpha 2b interferon (INF) enhances response rates and improves survival in low-grade NHL. The International Oncology Study Group (IOSG) conducted a prospective randomized study comparing CHOP alone or combined with INF in patients with IG/HG-NHL. The primary study aim was to compare the objective response rates in these patient cohorts. Patients with a confirmed diagnosis of measurable NHL of International Working Formulation (IWF) groups D to H histology were randomized to receive CHOP alone or CHOP with 5Mu INF s.c. for 5 days on days 22 to 26 of each 28 day cycle with INF 5 million units (Mu) given three times per week subcutaneously for 52 weeks in those patients who responded to CHOP plus INF. The overall response rates were equivalent in both groups: CHOP alone (214 patients) 81% (complete 55%, partial 26%); CHOP plus INF (221 patients) 80% (complete 54%, partial 26%). At 36 months, the actuarial survival rate was equivalent in both groups. There is no apparent early advantage in terms of response or survival conferred by adding the study INF regimen to CHOP therapy for patients with IG/HG-NHL.

  17. [Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

    Science.gov (United States)

    Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

    2011-07-01

    To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

  18. Effect of chopping time and heating on 1 H nuclear magnetic resonance and rheological behavior of meat batter matrix.

    Science.gov (United States)

    Zhou, Fen; Dong, Hui; Shao, Jun-Hua; Zhang, Jun-Long; Liu, Deng-Yong

    2018-04-01

    The effect of chopping time and heating on physicochemical properties of meat batters was investigated by low-field nuclear magnetic resonance and rheology technology. Cooking loss and L* increased while texture profile analysis index decreased between chopping 5 and 6 min. The relaxation time T 21 (bound water) and its peak area ratio decreased, while the ratio of T 22 peak area (immobilized water) in raw meat batters gradually increased with the extension of chopping time. However, T 22 was opposite after being heated and a new component T 23 (free water) appeared (T 2i is the spin - spin relaxation time for the ith component.). The initial damping factor (Tan δ) gradually decreased and there were significant difference between 4 and 5 min of chopping time. There were significantly positive correlations between the ratio of peak area of T 22 and chopping time, the storage modulus (G'), cooking loss, and L*, respectively. Continued chopping time could improve the peak area proportion of T 22 in raw meat batters. Further, the higher the peak area proportion of T 22 in raw meat batters, the cooking loss of heated meat gel was higher. Also, the stronger the mobility of immobilized water in meat batter, the higher the L* of the fresh meat batters. Thus, it is revealed that the physicochemical properties of meat batter are significantly influenced by chopping time which further affects the water holding capacity and the texture of emulsification gel. © 2017 Japanese Society of Animal Science.

  19. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  20. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  1. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  2. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Directory of Open Access Journals (Sweden)

    Michele E Murphy

    2016-01-01

    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  3. Ex-Vivo Gene Therapy Using Lentiviral Mediated Gene Transfer Into Umbilical Cord Blood Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Hanieh Jalali

    2016-02-01

    Full Text Available Background Introduction of therapeutic genes into the injured site of nervous system can be achieved using transplantation of cellular vehicles containing desired gene. To transfer exogenous genes into the cellular vehicles, lentiviral vectors are one of interested vectors because of advantages such high transduction efficiency of dividing and non-dividing cells. Unrestricted somatic stem cells are subclasses of umbilical cord blood derived stem cells which are appreciate candidates to use as cellular vehicles for ex vivo gene therapy of nervous system. Objectives In current study we investigated the effect of lentiviral vector transduction on the neuronal related features of unrestricted somatic stem cells to indicate the probable and unwanted changes related to transduction procedure. Materials and Methods In this experimental study, lentiviral vector containing green fluorescent protein (GFP were transduced into unrestricted somatic stem cells and its effect was investigated with using MTT assay, qPCR and immunohistochemistry techniques. For statistical comparison of real time PCR results, REST software (2009, Qiagen was used. Results Obtained results showed lentiviral vector transduction did not have cytotoxic effects on unrestricted somatic stem cells and did not change neuronal differentiation capacity of them as well the expression of some neuronal related genes and preserved them in multilineage situation. Conclusions In conclusion, we suggested that lentiviral vectors could be proper vectors to transfer therapeutic gene into unrestricted somatic stem cells to provide a cellular vehicle for ex vivo gene therapy of nervous system disorders.

  4. Mars Science Laboratory Launch-Arrival Space Study: A Pork Chop Plot Analysis

    Science.gov (United States)

    Cianciolo, Alicia Dwyer; Powell, Richard; Lockwood, Mary Kae

    2006-01-01

    Launch-Arrival, or "pork chop", plot analysis can provide mission designers with valuable information and insight into a specific launch and arrival space selected for a mission. The study begins with the array of entry states for each pair of selected Earth launch and Mars arrival dates, and nominal entry, descent and landing trajectories are simulated for each pair. Parameters of interest, such as maximum heat rate, are plotted in launch-arrival space. The plots help to quickly identify launch and arrival regions that are not feasible under current constraints or technology and also provide information as to what technologies may need to be developed to reach a desired region. This paper provides a discussion of the development, application, and results of a pork chop plot analysis to the Mars Science Laboratory mission. This technique is easily applicable to other missions at Mars and other destinations.

  5. A Comparative study of two RVE modelling methods for chopped carbon fiber SMC

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zhangxing; Li, Yi; Shao, Yimin; Huang, Tianyu; Xu, Hongyi; Li, Yang; Chen, Wei; Zeng, Danielle; Avery, Katherine; Kang, HongTae; Su, Xuming

    2017-04-06

    To achieve vehicle light-weighting, the chopped carbon fiber sheet molding compound (SMC) is identified as a promising material to replace metals. However, there are no effective tools and methods to predict the mechanical property of the chopped carbon fiber SMC due to the high complexity in microstructure features and the anisotropic properties. In this paper, the Representative Volume Element (RVE) approach is used to model the SMC microstructure. Two modeling methods, the Voronoi diagram-based method and the chip packing method, are developed for material RVE property prediction. The two methods are compared in terms of the predicted elastic modulus and the predicted results are validated using the Digital Image Correlation (DIC) tensile test results. Furthermore, the advantages and shortcomings of these two methods are discussed in terms of the required input information and the convenience of use in the integrated processing-microstructure-property analysis.

  6. Chemoimmunotherapy with ofatumumab in combination with CHOP in previously untreated follicular lymphoma

    DEFF Research Database (Denmark)

    Czuczman, Myron S; Hess, Georg; Gadeberg, Ole V

    2012-01-01

    An international, Phase II trial was conducted to assess two doses of ofatumumab, a human CD20 monoclonal antibody, combined with cyclophosphamide (750 mg/m(2) ), doxorubicin (50 mg/m(2) ), prednisone (100 mg days 3-7) and vincristine (1·4 mg/m(2) ) (O-CHOP), as frontline treatment for follicular...... lymphoma (FL). 59 patients with previously untreated FL were randomized to ofatumumab 500 mg (n = 29) or 1000 mg (n = 30) day 1, with CHOP on day 3 every 3 weeks for six cycles. Median duration of FL was 0·1 years for both dose groups; 34% and 38% of patients had high-risk Follicular Lymphoma International...

  7. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  8. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  9. Efficient biotechnological approach for lentiviral transduction of induced pluripotent stem cells.

    Science.gov (United States)

    Zare, Mehrak; Soleimani, Masoud; Mohammadian, Mozhdeh; Akbarzadeh, Abolfazl; Havasi, Parvaneh; Zarghami, Nosratollah

    2016-01-01

    Induced pluripotent stem (iPS) cells are generated from differentiated adult somatic cells by reprogramming them. Unlimited self-renewal, and the potential to differentiate into any cell type, make iPS cells very promising candidates for basic and clinical research. Furthermore, iPS cells can be genetically manipulated for use as therapeutic tools. DNA can be introduced into iPS cells, using lentiviral vectors, which represent a helpful choice for efficient transduction and stable integration of transgenes. In this study, we compare two methods of lentiviral transduction of iPS cells, namely, the suspension method and the hanging drop method. In contrast to the conventional suspension method, in the hanging drop method, embryoid body (EB) formation and transduction occur concurrently. The iPS cells were cultured to form EBs, and then transduced with lentiviruses, using the conventional suspension method and the hanging drop method, to express miR-128 and green fluorescent protein (GFP). The number of transduced cells were assessed by fluorescent microscopy and flow cytometry. MTT assay and real-time PCR were performed to determine the cell viability and transgene expression, respectively. Morphologically, GFP+ cells were more detectable in the hanging drop method, and this finding was quantified by flow cytometric analysis. According to the results of the MTT assay, cell viability was considerably higher in the hanging drop method, and real-time PCR represented a higher relative expression of miR-128 in the iPS cells introduced with lentiviruses in drops. Altogether, it seems that lentiviral transduction of challenging iPS cells using the hanging drop method offers a suitable and sufficient strategy in their gene transfer, with less toxicity than the conventional suspension method.

  10. Gene transfer to primary corneal epithelial cells with an integrating lentiviral vector

    Directory of Open Access Journals (Sweden)

    Lauro Augusto de Oliveira

    2010-10-01

    Full Text Available PURPOSE: To evaluate the transfer of heterologous genes carrying a Green Fluorescent Protein (GFP reporter cassette to primary corneal epithelial cells ex vivo. METHODS: Freshly enucleated rabbit corneoscleral tissue was used to obtain corneal epithelial cell suspension via enzymatic digestion. Cells were plated at a density of 5×10³ cells/cm² and allowed to grow for 5 days (to 70-80% confluency prior to transduction. Gene transfer was monitored using fluorescence microscopy and fluorescence activated cell sorter (FACS. We evaluated the transduction efficiency (TE over time and the dose-response effect of different lentiviral particles. One set of cells were dual sorted by fluorescence activated cell sorter for green fluorescent protein expression as well as Hoechst dye exclusion to evaluate the transduction of potentially corneal epithelial stem cells (side-population phenotypic cells. RESULTS: Green fluorescent protein expressing lentiviral vectors were able to effectively transduce rabbit primary epithelial cells cultured ex vivo. Live cell imaging post-transduction demonstrated GFP-positive cells with normal epithelial cell morphology and growth. The transduction efficiency over time was higher at the 5th post-transduction day (14.1% and tended to stabilize after the 8th day. The number of transduced cells was dose-dependent, and at the highest lentivirus concentrations approached 7%. When double sorted by fluorescence activated cell sorter to isolate both green fluorescent protein positive and side population cells, transduced side population cells were identified. CONCLUSIONS: Lentiviral vectors can effectively transfer heterologous genes to primary corneal epithelial cells expanded ex vivo. Genes were stably expressed over time, transferred in a dose-dependence fashion, and could be transferred to mature corneal cells as well as presumable putative stem cells.

  11. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    International Nuclear Information System (INIS)

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

    2004-01-01

    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

  12. Mechanical and abrasive wear characterization of bidirectional and chopped E-glass fiber reinforced composite materials

    International Nuclear Information System (INIS)

    Siddhartha,; Gupta, Kuldeep

    2012-01-01

    Highlights: ► Bi-directional and chopped E-glass fiber reinforced epoxy composites are fabricated. ► Three body abrasive wear behavior of fabricated composites has been assessed. ► Results are validated against existing microscopic models of Lancaster and Wang. ► Tensile strength of bi-directional E-glass fiber reinforced composites increases. ► Chopped glass fiber composites are found better in abrasive wear situations. -- Abstract: Bi-directional and chopped E-glass fiber reinforced epoxy composites are fabricated in five different (15, 20, 25, 30 and 35) wt% in an epoxy resin matrix. The mechanical characterization of these composites is performed. The three body abrasive wear behavior of fabricated composites has been assessed under different operating conditions. Abrasive wear characteristics of these composites are successfully analysed using Taguchi’s experimental design scheme and analysis of variance (ANOVA). The results obtained from these experiments are also validated against existing microscopic models of Ratner-Lancaster and Wang. It is observed that quite good linear relationships is held between specific wear rate and reciprocal of ultimate strength and strain at tensile fracture of these composites which is an indicative that the experimental results are in fair agreement with these existing models. Out of all composites fabricated it is found that tensile strength of bi-directional E-glass fiber reinforced composites increases because of interface strength enhancement. Chopped glass fiber reinforced composites are observed to perform better than bi-directional glass fiber reinforced composites under abrasive wear situations. The morphology of worn composite specimens has been examined by scanning electron microscopy (SEM) to understand about dominant wear mechanisms.

  13. 4-Phenylbutyrate inhibits tunicamycin-induced acute kidney injury via CHOP/GADD153 repression.

    Directory of Open Access Journals (Sweden)

    Rachel E Carlisle

    Full Text Available Different forms of acute kidney injury (AKI have been associated with endoplasmic reticulum (ER stress; these include AKI caused by acetaminophen, antibiotics, cisplatin, and radiocontrast. Tunicamycin (TM is a nucleoside antibiotic known to induce ER stress and is a commonly used inducer of AKI. 4-phenylbutyrate (4-PBA is an FDA approved substance used in children who suffer from urea cycle disorders. 4-PBA acts as an ER stress inhibitor by aiding in protein folding at the molecular level and preventing misfolded protein aggregation. The main objective of this study was to determine if 4-PBA could protect from AKI induced by ER stress, as typified by the TM-model, and what mechanism(s of 4-PBA's action were responsible for protection. C57BL/6 mice were treated with saline, TM or TM plus 4-PBA. 4-PBA partially protected the anatomic segment most susceptible to damage, the outer medullary stripe, from TM-induced AKI. In vitro work showed that 4-PBA protected human proximal tubular cells from apoptosis and TM-induced CHOP expression, an ER stress inducible proapoptotic gene. Further, immunofluorescent staining in the animal model found similar protection by 4-PBA from CHOP nuclear translocation in the tubular epithelium of the medulla. This was accompanied by a reduction in apoptosis and GRP78 expression. CHOP(-/- mice were protected from TM-induced AKI. The protective effects of 4-PBA extended to the ultrastructural integrity of proximal tubule cells in the outer medulla. When taken together, these results indicate that 4-PBA acts as an ER stress inhibitor, to partially protect the kidney from TM-induced AKI through the repression of ER stress-induced CHOP expression.

  14. Durability-Based Design Criteria for a Chopped-Glass-Fiber Automotive Structural Composite; TOPICAL

    International Nuclear Information System (INIS)

    Battiste, R.L.; Corum, J.M.; Ren, W.; Ruggles, M.B.

    1999-01-01

    This report provides recommended durability-based design criteria for a chopped-glass-fiber reinforced polymeric composite for automotive structural applications. The criteria closely follow the framework of an earlier criteria document for a continuous-strand-mat (CSM) glass-fiber reference composite. Together these design criteria demonstrate a framework that can be adapted for future random-glass-fiber composites for automotive structural applications

  15. Direct gene transfer in the Gottingen minipig CNS using stereotaxic lentiviral microinjections

    DEFF Research Database (Denmark)

    GLUD, AN; Hedegaard, Claus; Nielsen, Mette Slot

    2010-01-01

    We aim to induce direct viral mediated gene transfer in the substantia nigra (SN) of the Gottingen minipig using MRI guided stereotaxic injections of lentiviral vectors encoding enhanced green fluorescent protein (EGFP). Nine female Gottingen minipigs were injected unilaterally into the SN with 6...... per 2.5 microliters lentivirus capable of transducing cells and mediating expression of recombinant EGFP. The animals were euthanized after four (n=3) or twenty weeks (n=6). Fresh brain tissue from three animals was used for PCR. The remaining six brains were cryo- or paraffin...

  16. Resting lymphocyte transduction with measles virus glycoprotein pseudotyped lentiviral vectors relies on CD46 and SLAM

    International Nuclear Information System (INIS)

    Zhou Qi; Schneider, Irene C.; Gallet, Manuela; Kneissl, Sabrina; Buchholz, Christian J.

    2011-01-01

    The measles virus (MV) glycoproteins hemagglutinin (H) and fusion (F) were recently shown to mediate transduction of resting lymphocytes by lentiviral vectors. MV vaccine strains use CD46 or signaling lymphocyte activation molecule (SLAM) as receptor for cell entry. A panel of H protein mutants derived from vaccine strain or wild-type MVs that lost or gained CD46 or SLAM receptor usage were investigated for their ability to mediate gene transfer into unstimulated T lymphocytes. The results demonstrate that CD46 is sufficient for efficient vector particle association with unstimulated lymphocytes. For stable gene transfer into these cells, however, both MV receptors were found to be essential.

  17. Feline Immunodeficiency Virus Cross-Species Transmission: Implications for Emergence of New Lentiviral Infections.

    Science.gov (United States)

    Lee, Justin; Malmberg, Jennifer L; Wood, Britta A; Hladky, Sahaja; Troyer, Ryan; Roelke, Melody; Cunningham, Mark; McBride, Roy; Vickers, Winston; Boyce, Walter; Boydston, Erin; Serieys, Laurel; Riley, Seth; Crooks, Kevin; VandeWoude, Sue

    2017-03-01

    Owing to a complex history of host-parasite coevolution, lentiviruses exhibit a high degree of species specificity. Given the well-documented viral archeology of human immunodeficiency virus (HIV) emergence following human exposures to simian immunodeficiency virus (SIV), an understanding of processes that promote successful cross-species lentiviral transmissions is highly relevant. We previously reported natural cross-species transmission of a subtype of feline immunodeficiency virus, puma lentivirus A (PLVA), between bobcats ( Lynx rufus ) and mountain lions ( Puma concolor ) for a small number of animals in California and Florida. In this study, we investigate host-specific selection pressures, within-host viral fitness, and inter- versus intraspecies transmission patterns among a larger collection of PLV isolates from free-ranging bobcats and mountain lions. Analyses of proviral and viral RNA levels demonstrate that PLVA fitness is severely restricted in mountain lions compared to that in bobcats. We document evidence of diversifying selection in three of six PLVA genomes from mountain lions, but we did not detect selection among 20 PLVA isolates from bobcats. These findings support the hypothesis that PLVA is a bobcat-adapted virus which is less fit in mountain lions and under intense selection pressure in the novel host. Ancestral reconstruction of transmission events reveals that intraspecific PLVA transmission has occurred among panthers ( Puma concolor coryi ) in Florida following the initial cross-species infection from bobcats. In contrast, interspecific transmission from bobcats to mountain lions predominates in California. These findings document outcomes of cross-species lentiviral transmission events among felids that compare to the emergence of HIV from nonhuman primates. IMPORTANCE Cross-species transmission episodes can be singular, dead-end events or can result in viral replication and spread in the new species. The factors that determine which

  18. Electron beam sub-harmonics chopping system for linear accelerator injector

    International Nuclear Information System (INIS)

    Bourat, Christophe

    1988-01-01

    The need of a 100 % duty cycle electron accelerator for use in nuclear physics, has led in 1981 the CEN Saclay Linear Accelerator Group, to study a machine using the existing linac associated with a pulse stretcher ring. The production of electron bunches at the ring RF frequency (600 MHz) requires the design of a new injector including a chopping beam System with a deflecting electromagnetic cavity and a collimator. A comparison between four transverse magnetic modes, led to choose a TM110 parallelepiped chopper. The construction of a prototype and of a vacuum-tight cavity followed by microwave measurements has permitted to solve several mechanical problems and to specify the cavity electrical properties. In a first step, the beam line, including - focusing, offset deflection coils, chopping with a rectangular collimator - has been studied, for zero intensity beam current, on the basis of a matrix model. An experimental 40 keV beam line, has been assembled to measure the bunch length. The method was based on a spectral analysis of the signal delivered by a large band, 50 ohms adapted beam collector. The bunch shape in the time domain was reconstructed by inverse Fourier transform. The beam dynamics has been studied with a 3D space charge model which has been introduced into the PARMELA tracking code. Simulations showed that a 150 keV, 2 A beam could be chopped with the same deflecting lay-out. (author) [fr

  19. Kaempferol induces hepatocellular carcinoma cell death via endoplasmic reticulum stress-CHOP-autophagy signaling pathway.

    Science.gov (United States)

    Guo, Haiqing; Lin, Wei; Zhang, Xiangying; Zhang, Xiaohui; Hu, Zhongjie; Li, Liying; Duan, Zhongping; Zhang, Jing; Ren, Feng

    2017-10-10

    Kaempferol is a flavonoid compound that has gained widespread attention due to its antitumor functions. However, the underlying mechanisms are still not clear. The present study investigated the effect of kaempferol on hepatocellular carcinoma and its underlying mechanisms. Kaempferol induced autophagy in a concentration- and time-dependent manner in HepG2 or Huh7 cells, which was evidenced by the significant increase of autophagy-related genes. Inhibition of autophagy pathway, through 3-methyladenine or Atg7 siRNA, strongly diminished kaempferol-induced apoptosis. We further hypothesized that kaempferol can induce autophagy via endoplasmic reticulum (ER) stress pathway. Indeed, blocking ER stress by 4-phenyl butyric acid (4-PBA) or knockdown of CCAAT/enhancer-binding protein homologous protein (CHOP) with siRNA alleviated kaempferol-induced HepG2 or Huh7 cells autophagy; while transfection with plasmid overexpressing CHOP reversed the effect of 4-PBA on kaempferol-induced autophagy. Our results demonstrated that kaempferol induced hepatocarcinoma cell death via ER stress and CHOP-autophagy signaling pathway; kaempferol may be used as a potential chemopreventive agent for patients with hepatocellular carcinoma.

  20. Combined reservoir simulation and seismic technology, a new approach for modeling CHOPS

    Energy Technology Data Exchange (ETDEWEB)

    Aghabarati, H.; Lines, L.; Settari, A. [Calgary Univ., AB (Canada); Dumitrescu, C. [Sensor Geophysical Ltd., Calgary, AB (Canada)

    2008-10-15

    One of the primary recovery schemes for developing heavy oil reservoirs in Canada is cold heavy oil production with sand (CHOPS). With the introduction of progressive cavity pumps, CHOPS can be applied in unconsolidated or weakly consolidated formations. In order to better understand reservoir properties and recovery mechanism, this paper discussed the use of a combined reservoir simulation and seismic technology that were applied for a heavy oil reservoir situated in Saskatchewan, Canada. Using a seismic survey acquired in 1989, the study used geostatistical methods to estimate the initial reservoir porosity. Sand production was then modeled using an erosional velocity approach and the model was run based on oil production. The paper also compared the results of true porosity derived from simulation against the porosity estimated from a second seismic survey acquired in 2001. Last, the extent and the shape of the enhanced permeability region was modelled in order to estimate porosity distribution. It was concluded that the performance of the CHOPS wells depended greatly on the rate of creation of the high permeability zone around the wells. 9 refs., 2 tabs., 18 figs., 1 appendix.

  1. Straight and chopped DC performance data for a reliance EV-250AT motor with a General Electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Straight and chopped DC motor performances for a Reliance EV-250AT motor with an EV-1 controller were examined. Effects of motor temperature and operating voltage are shown. It is found that the maximum motor efficiency is approximately 85% at low operating temperatures in the straight DC mode. Chopper efficiency is 95% under all operating conditions. For equal speeds, the motor operated in the chopped mode develops slightly more torque and draws more current than it does in the straight DC mode.

  2. A comparison of foamy and lentiviral vector genotoxicity in SCID-repopulating cells shows foamy vectors are less prone to clonal dominance

    Directory of Open Access Journals (Sweden)

    Elizabeth M Everson

    2016-01-01

    Full Text Available Hematopoietic stem cell (HSC gene therapy using retroviral vectors has immense potential, but vector-mediated genotoxicity limits use in the clinic. Lentiviral vectors are less genotoxic than gammaretroviral vectors and have become the vector of choice in clinical trials. Foamy retroviral vectors have a promising integration profile and are less prone to read-through transcription than gammaretroviral or lentiviral vectors. Here, we directly compared the safety and efficacy of foamy vectors to lentiviral vectors in human CD34+ repopulating cells in immunodeficient mice. To increase their genotoxic potential, foamy and lentiviral vectors with identical transgene cassettes with a known genotoxic spleen focus forming virus promoter were used. Both vectors resulted in efficient marking in vivo and a total of 825 foamy and 460 lentiviral vector unique integration sites were recovered in repopulating cells 19 weeks after transplantation. Foamy vector proviruses were observed less often near RefSeq gene and proto-oncogene transcription start sites than lentiviral vectors. The foamy vector group were also more polyclonal with fewer dominant clones (two out of six mice than the lentiviral vector group (eight out of eight mice, and only lentiviral vectors had integrants near known proto-oncogenes in dominant clones. Our data further support the relative safety of foamy vectors for HSC gene therapy.

  3. Cyclophilin B is involved in p300-mediated degradation of CHOP in tumor cell adaptation to hypoxia.

    Science.gov (United States)

    Jeong, K; Kim, H; Kim, K; Kim, S-J; Hahn, B-S; Jahng, G-H; Yoon, K-S; Kim, S S; Ha, J; Kang, I; Choe, W

    2014-03-01

    The regulation of CCAAT/enhancer-binding protein-homologous protein (CHOP), an endoplasmic reticulum (ER) stress-response factor, is key to cellular survival. Hypoxia is a physiologically important stress that induces cell death in the context of the ER, especially in solid tumors. Although our previous studies have suggested that Cyclophilin B (CypB), a molecular chaperone, has a role in ER stress, currently, there is no direct information supporting its mechanism under hypoxia. Here, we demonstrate for the first time that CypB is associated with p300 E4 ligase, induces ubiquitination and regulates the proteasomal turnover of CHOP, one of the well-known pro-apoptotic molecules under hypoxia. Our findings show that CypB physically interacts with the N-terminal α-helix domain of CHOP under hypoxia and cooperates with p300 to modulate the ubiquitination of CHOP. We also show that CypB is transcriptionally induced through ATF6 under hypoxia. Collectively, these findings demonstrate that CypB prevents hypoxia-induced cell death through modulation of ubiquitin-mediated CHOP protein degradation, suggesting that CypB may have an important role in the tight regulation of CHOP under hypoxia.

  4. Engineering Cellular Resistance to HIV-1 Infection In Vivo Using a Dual Therapeutic Lentiviral Vector

    Directory of Open Access Journals (Sweden)

    Bryan P Burke

    2015-01-01

    Full Text Available We described earlier a dual-combination anti-HIV type 1 (HIV-1 lentiviral vector (LVsh5/C46 that downregulates CCR5 expression of transduced cells via RNAi and inhibits HIV-1 fusion via cell surface expression of cell membrane-anchored C46 antiviral peptide. This combinatorial approach has two points of inhibition for R5-tropic HIV-1 and is also active against X4-tropic HIV-1. Here, we utilize the humanized bone marrow, liver, thymus (BLT mouse model to characterize the in vivo efficacy of LVsh5/C46 (Cal-1 vector to engineer cellular resistance to HIV-1 pathogenesis. Human CD34+ hematopoietic stem/progenitor cells (HSPC either nonmodified or transduced with LVsh5/C46 vector were transplanted to generate control and treatment groups, respectively. Control and experimental groups displayed similar engraftment and multilineage hematopoietic differentiation that included robust CD4+ T-cell development. Splenocytes isolated from the treatment group were resistant to both R5- and X4-tropic HIV-1 during ex vivo challenge experiments. Treatment group animals challenged with R5-tropic HIV-1 displayed significant protection of CD4+ T-cells and reduced viral load within peripheral blood and lymphoid tissues up to 14 weeks postinfection. Gene-marking and transgene expression were confirmed stable at 26 weeks post-transplantation. These data strongly support the use of LVsh5/C46 lentiviral vector in gene and cell therapeutic applications for inhibition of HIV-1 infection.

  5. Staurosporine Increases Lentiviral Vector Transduction Efficiency of Human Hematopoietic Stem and Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Gretchen Lewis

    2018-06-01

    Full Text Available Lentiviral vector (LVV-mediated transduction of human CD34+ hematopoietic stem and progenitor cells (HSPCs holds tremendous promise for the treatment of monogenic hematological diseases. This approach requires the generation of a sufficient proportion of gene-modified cells. We identified staurosporine, a serine/threonine kinase inhibitor, as a small molecule that could be added to the transduction process to increase the proportion of genetically modified HSPCs by overcoming a LVV entry barrier. Staurosporine increased vector copy number (VCN approximately 2-fold when added to mobilized peripheral blood (mPB CD34+ cells prior to transduction. Limited staurosporine treatment did not affect viability of cells post-transduction, and there was no difference in in vitro colony formation compared to vehicle-treated cells. Xenotransplantation studies identified a statistically significant increase in VCN in engrafted human cells in mouse bone marrow at 4 months post-transplantation compared to vehicle-treated cells. Prostaglandin E2 (PGE2 is known to increase transduction efficiency of HSPCs through a different mechanism. Combining staurosporine and PGE2 resulted in further enhancement of transduction efficiency, particularly in short-term HSPCs. The combinatorial use of small molecules, such as staurosporine and PGE2, to enhance LVV transduction of human CD34+ cells is a promising method to improve transduction efficiency and subsequent potential therapeutic benefit of gene therapy drug products. Keywords: lentiviral, HSPC, transduction

  6. Lentiviral transgenesis in mice via a simple method of viral concentration.

    Science.gov (United States)

    Cheng, Pei-Hsun; Chang, Yu-Fan; Mao, Su-Han; Lin, Hsiu-Lien; Chen, Chuan-Mu; Yang, Shang-Hsun

    2016-10-01

    Transgenic animals are important in vivo models for biological research. However, low transgenic rates are commonly reported in the literature. Lentiviral transgenesis is a promising method that has greater efficiency with regard to generating transgenic animals, although the transgenic rate of this approach is highly dependent on different transgenes and concentrated lentiviruses. In this study, we modified a method to concentrate lentiviruses using a table centrifuge, commonly available in most laboratories, and carried out analysis of the transgenic efficiency in mice. Based on 26 individual constructs and 627 live pups, we found that the overall transgenic rate was more than 30%, which is higher than obtained with pronuclear microinjection. In addition, we did not find any significant differences in transgenic efficiency when the size of inserts was less than 5000 bp. These results not only show that our modified method can successfully generate transgenic mice but also suggest that this approach could be generally applied to different constructs when the size of inserts is less than 5000 bp. It is anticipated that the results of this study can help encourage the wider laboratory use of lentiviral transgenesis in mice. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Latent Membrane Protein 1 as a molecular adjuvant for single-cycle lentiviral vaccines

    Directory of Open Access Journals (Sweden)

    Rahmberg Andrew R

    2011-05-01

    Full Text Available Abstract Background Molecular adjuvants are a promising method to enhance virus-specific immune responses and protect against HIV-1 infection. Immune activation by ligands for receptors such as CD40 can induce dendritic cell activation and maturation. Here we explore the incorporation of two CD40 mimics, Epstein Barr Virus gene LMP1 or an LMP1-CD40 chimera, into a strain of SIV that was engineered to be limited to a single cycle of infection. Results Full length LMP1 or the chimeric protein LMP1-CD40 was cloned into the nef-locus of single-cycle SIV. Human and Macaque monocyte derived macrophages and DC were infected with these viruses. Infected cells were analyzed for activation surface markers by flow cytometry. Cells were also analyzed for secretion of pro-inflammatory cytokines IL-1β, IL-6, IL-8, IL-12p70 and TNF by cytometric bead array. Conclusions Overall, single-cycle SIV expressing LMP1 and LMP1-CD40 produced a broad and potent TH1-biased immune response in human as well as rhesus macaque macrophages and DC when compared with control virus. Single-cycle SIV-LMP1 also enhanced antigen presentation by lentiviral vector vaccines, suggesting that LMP1-mediated immune activation may enhance lentiviral vector vaccines against HIV-1.

  8. Genetic engineering of cell lines using lentiviral vectors to achieve antibody secretion following encapsulated implantation.

    Science.gov (United States)

    Lathuilière, Aurélien; Bohrmann, Bernd; Kopetzki, Erhard; Schweitzer, Christoph; Jacobsen, Helmut; Moniatte, Marc; Aebischer, Patrick; Schneider, Bernard L

    2014-01-01

    The controlled delivery of antibodies by immunoisolated bioimplants containing genetically engineered cells is an attractive and safe approach for chronic treatments. To reach therapeutic antibody levels there is a need to generate renewable cell lines, which can long-term survive in macroencapsulation devices while maintaining high antibody specific productivity. Here we have developed a dual lentiviral vector strategy for the genetic engineering of cell lines compatible with macroencapsulation, using separate vectors encoding IgG light and heavy chains. We show that IgG expression level can be maximized as a function of vector dose and transgene ratio. This approach allows for the generation of stable populations of IgG-expressing C2C12 mouse myoblasts, and for the subsequent isolation of clones stably secreting high IgG levels. Moreover, we demonstrate that cell transduction using this lentiviral system leads to the production of a functional glycosylated antibody by myogenic cells. Subsequent implantation of antibody-secreting cells in a high-capacity macroencapsulation device enables continuous delivery of recombinant antibodies in the mouse subcutaneous tissue, leading to substantial levels of therapeutic IgG detectable in the plasma.

  9. Pseudotyped Lentiviral Vectors for Retrograde Gene Delivery into Target Brain Regions

    Directory of Open Access Journals (Sweden)

    Kenta Kobayashi

    2017-08-01

    Full Text Available Gene transfer through retrograde axonal transport of viral vectors offers a substantial advantage for analyzing roles of specific neuronal pathways or cell types forming complex neural networks. This genetic approach may also be useful in gene therapy trials by enabling delivery of transgenes into a target brain region distant from the injection site of the vectors. Pseudotyping of a lentiviral vector based on human immunodeficiency virus type 1 (HIV-1 with various fusion envelope glycoproteins composed of different combinations of rabies virus glycoprotein (RV-G and vesicular stomatitis virus glycoprotein (VSV-G enhances the efficiency of retrograde gene transfer in both rodent and nonhuman primate brains. The most recently developed lentiviral vector is a pseudotype with fusion glycoprotein type E (FuG-E, which demonstrates highly efficient retrograde gene transfer in the brain. The FuG-E–pseudotyped vector permits powerful experimental strategies for more precisely investigating the mechanisms underlying various brain functions. It also contributes to the development of new gene therapy approaches for neurodegenerative disorders, such as Parkinson’s disease, by delivering genes required for survival and protection into specific neuronal populations. In this review article, we report the properties of the FuG-E–pseudotyped vector, and we describe the application of the vector to neural circuit analysis and the potential use of the FuG-E vector in gene therapy for Parkinson’s disease.

  10. Rapid lentiviral transduction preserves the engraftment potential of Fanca(-/-) hematopoietic stem cells.

    Science.gov (United States)

    Müller, Lars U W; Milsom, Michael D; Kim, Mi-Ok; Schambach, Axel; Schuesler, Todd; Williams, David A

    2008-06-01

    Fanconi anemia (FA) is a rare recessive syndrome, characterized by congenital anomalies, bone marrow failure, and predisposition to cancer. Two earlier clinical trials utilizing gamma-retroviral vectors for the transduction of autologous FA hematopoietic stem cells (HSCs) required extensive in vitro manipulation and failed to achieve detectable long-term engraftment of transduced HSCs. As a strategy for minimizing ex vivo manipulation, we investigated the use of a "rapid" lentiviral transduction protocol in a murine Fanca(-/-) model. Importantly, while this and most murine models of FA fail to completely mimic the human hematopoietic phenotype, we observed a high incidence of HSC transplant engraftment failure and low donor chimerism after conventional transduction (CT) of Fanca(-/-) donor cells. In contrast, rapid transduction (RT) of Fanca(-/-) HSCs preserved engraftment to the level achieved in wild-type cells, resulting in long-term multilineage engraftment of gene-modified cells. We also demonstrate the correction of the characteristic hypersensitivity of FA cells against the cross-linking agent mitomycin C (MMC), and provide evidence for the advantage of using pharmacoselection as a means of further increasing gene-modified cells after RT. Collectively, these data support the use of rapid lentiviral transduction for gene therapy in FA.

  11. A multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors for functional gene analysis.

    Science.gov (United States)

    Weber, Kristoffer; Bartsch, Udo; Stocking, Carol; Fehse, Boris

    2008-04-01

    Functional gene analysis requires the possibility of overexpression, as well as downregulation of one, or ideally several, potentially interacting genes. Lentiviral vectors are well suited for this purpose as they ensure stable expression of complementary DNAs (cDNAs), as well as short-hairpin RNAs (shRNAs), and can efficiently transduce a wide spectrum of cell targets when packaged within the coat proteins of other viruses. Here we introduce a multicolor panel of novel lentiviral "gene ontology" (LeGO) vectors designed according to the "building blocks" principle. Using a wide spectrum of different fluorescent markers, including drug-selectable enhanced green fluorescent protein (eGFP)- and dTomato-blasticidin-S resistance fusion proteins, LeGO vectors allow simultaneous analysis of multiple genes and shRNAs of interest within single, easily identifiable cells. Furthermore, each functional module is flanked by unique cloning sites, ensuring flexibility and individual optimization. The efficacy of these vectors for analyzing multiple genes in a single cell was demonstrated in several different cell types, including hematopoietic, endothelial, and neural stem and progenitor cells, as well as hepatocytes. LeGO vectors thus represent a valuable tool for investigating gene networks using conditional ectopic expression and knock-down approaches simultaneously.

  12. Targeted genome editing by lentiviral protein transduction of zinc-finger and TAL-effector nucleases.

    Science.gov (United States)

    Cai, Yujia; Bak, Rasmus O; Mikkelsen, Jacob Giehm

    2014-04-24

    Future therapeutic use of engineered site-directed nucleases, like zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), relies on safe and effective means of delivering nucleases to cells. In this study, we adapt lentiviral vectors as carriers of designer nuclease proteins, providing efficient targeted gene disruption in vector-treated cell lines and primary cells. By co-packaging pairs of ZFN proteins with donor RNA in 'all-in-one' lentiviral particles, we co-deliver ZFN proteins and the donor template for homology-directed repair leading to targeted DNA insertion and gene correction. Comparative studies of ZFN activity in a predetermined target locus and a known nearby off-target locus demonstrate reduced off-target activity after ZFN protein transduction relative to conventional delivery approaches. Additionally, TALEN proteins are added to the repertoire of custom-designed nucleases that can be delivered by protein transduction. Altogether, our findings generate a new platform for genome engineering based on efficient and potentially safer delivery of programmable nucleases.DOI: http://dx.doi.org/10.7554/eLife.01911.001. Copyright © 2014, Cai et al.

  13. Production of germline transgenic prairie voles (Microtus ochrogaster) using lentiviral vectors.

    Science.gov (United States)

    Donaldson, Zoe R; Yang, Shang-Hsun; Chan, Anthony W S; Young, Larry J

    2009-12-01

    The study of alternative model organisms has yielded tremendous insights into the regulation of behavioral and physiological traits not displayed by more widely used animal models, such as laboratory rats and mice. In particular, comparative approaches often exploit species ideally suited for investigating specific phenomenon. For instance, comparative studies of socially monogamous prairie voles and polygamous meadow voles have been instrumental toward gaining an understanding of the genetic and neurobiological basis of social bonding. However, laboratory studies of less commonly used organisms, such as prairie voles, have been limited by a lack of genetic tools, including the ability to manipulate the genome. Here, we show that lentiviral vector-mediated transgenesis is a rapid and efficient approach for creating germline transgenics in alternative laboratory rodents. Injection of a green fluorescent protein (GFP)-expressing lentiviral vector into the perivitelline space of 23 single-cell embryos yielded three live offspring (13 %), one of which (33%) contained germline integration of a GFP transgene driven by the human ubiquitin-C promoter. In comparison, transfer of 23 uninjected embryos yielded six live offspring (26%). Green fluorescent protein is present in all tissues examined and is expressed widely in the brain. The GFP transgene is heritable and stably expressed until at least the F(2) generation. This technology has the potential to allow investigation of specific gene candidates in prairie voles and provides a general protocol to pursue germline transgenic manipulation in many different rodent species.

  14. Resultados de la técnica stop and chop en la facoemulsificación Results of stop and chop technique in phacoemulsification

    Directory of Open Access Journals (Sweden)

    Juan Raúl Hernández Silva

    2010-06-01

    Full Text Available OBJETIVOS: Describir los resultados morfofuncionales alcanzados con la técnica stop and chop en la cirugía de catarata por facoemulsificación (faco, en el Centro de Microcirugía Ocular del Instituto Cubano de Oftalmología "Ramón Pando Ferrer" entre Junio de 2006 y Marzo de 2009. MÉTODOS: Se realizó un estudio descriptivo, transversal en el cual el universo y la muestra del trabajo lo constituyeron todos los pacientes con diagnóstico de catarata presenil y senil, quienes cumplían con los criterios de selección y aceptaron someterse a la técnica quirúrgica señalada, lo cual correspondió a 201 ojos operados. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas; además se emplearon medias con el uso del programa de procesamiento de datos SPSS versión 11.1, donde se aplicó la prueba t de student para su comparación. RESULTADOS: Se encontró que la catarata predominó en mayores de 70 años en el 33,4 % de los pacientes. La mejor agudeza visual con corrección obtenida se incrementó hasta siete líneas en la escala de Snellen en el 93,0 % de los casos; el cilindro refractivo apenas se modificó en 0,15 dioptrías; la pérdida de células endoteliales fue de 8,2 % y las complicaciones operatorias fueron de 1,5 %. CONCLUSIONES: La edad de los pacientes sometidos a cirugía de catarata por la técnica de stop and chop fue en su mayoría de más de 70 años. La MAVC posoperatoria ganó hasta siete líneas en la escala de Snellen; el astigmatismo que se indujo en la cirugía fue menor de media dioptría; la pérdida celular y las complicaciones posoperatorias no fueron significativas.OBJECTIVES: To describe the morphofunctional results of the stop and chop technique in cataract surgery in phacoemulsification at the Eye Microsurgery Center of "Ramón Pando Ferrer" Cuban Institute of Ophthalmology from June 2006 to March 2009. METHODS: A cross-sectional descriptive study was conducted. The

  15. Resultados quirúrgicos de la facoemulsificación por técnicas de Pre Chop Surgical results of phacoemulsification by Pre Chop techniques

    Directory of Open Access Journals (Sweden)

    Juan R. Hernández Silva

    2004-12-01

    Full Text Available Este estudio se propuso determinar los resultados obtenidos con la técnica de Pre-Chop en la cirugía de catarata por facoemulsificación en el Centro de Microcirugía Ocular del Hospital Oftalmológico Docente "Ramón Pando Ferrer" en el 2001. El universo de trabajo estuvo constituido por todos los pacientes (ojos con diagnóstico de catarata presenil y senil y recibieron tratamiento quirúrgico con la técnica de Pre-Chop por facoemulsificación. Se analizaron como variables: edad, sexo, agudeza visual con corrección, microscopia endotelial y cilindro refractivo, todos en el pre y posoperatorio, así como el tiempo de ultrasonido y complicaciones más frecuentes. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas, medias y se utilizó la prueba T de Student para su comparación. Se encontró que la catarata predominó en el sexo masculino entre los 46 y los 60 años; la agudeza visual con corrección mejoró a 0.64 (20/40 como promedio, el cilindro refractivo apenas se modificó, el tiempo de ultrasonido aplicado estuvo dentro de valores normales, la pérdida de células endoteliales no fue importante y la complicación transoperatoria más frecuente fue rotura de cápsula posterior con salida de vítreo y queratitis.The aim of this paper was to determine the results obtained with the Pre Chop technique in the cataract surgery by phacoemulsification at the Center of Ocular Microsurgery of "Ramón Pando Ferrer" Ophthalmological Teaching Hospital in 2001. All the patients (eyes with diagnosis of presenile and senile cataract that received surgical treatment with the Pre Chop technique by phacoemulsification were included in the study. Variables such as age, sex, visual acuity with correction, endothelial microscopy, refractive cylinder in the pre- and postoperative, time of ultrasound and the most frequent complications, were analyzed through contingency tables with mean absolute and relative

  16. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  17. Delivery of the Cre recombinase by a self-deleting lentiviral vector: efficient gene targeting in vivo

    NARCIS (Netherlands)

    Pfeifer, A.; Brandon, E. P.; Kootstra, N.; Gage, F. H.; Verma, I. M.

    2001-01-01

    The Cre recombinase (Cre) from bacteriophage P1 is an important tool for genetic engineering in mammalian cells. We constructed lentiviral vectors that efficiently deliver Cre in vitro and in vivo. Surprisingly, we found a significant reduction in proliferation and an accumulation in the G(2)/M

  18. Efficient transduction of equine adipose-derived mesenchymal stem cells by VSV-G pseudotyped lentiviral vectors.

    Science.gov (United States)

    Petersen, Gayle F; Hilbert, Bryan; Trope, Gareth; Kalle, Wouter; Strappe, Padraig

    2014-12-01

    Equine adipose-derived mesenchymal stem cells (EADMSC) provide a unique cell-based approach for treatment of a variety of equine musculoskeletal injuries, via regeneration of diseased or damaged tissue, or the secretion of immunomodulatory molecules. These capabilities can be further enhanced by genetic modification using lentiviral vectors, which provide a safe and efficient method of gene delivery. We investigated the suitability of lentiviral vector technology for gene delivery into EADMSC, using GFP expressing lentiviral vectors pseudotyped with the G glycoprotein from the vesicular stomatitis virus (V-GFP) or, for the first time, the baculovirus gp64 envelope protein (G-GFP). In this study, we produced similarly high titre V-GFP and G-GFP lentiviral vectors. Flow cytometric analysis showed efficient transduction using V-GFP; however G-GFP exhibited a poor ability to transduce EADMSC. Transduction resulted in sustained GFP expression over four passages, with minimal effects on cell viability and doubling time, and an unaltered chondrogenic differentiation potential. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. A quasi-lentiviral green fluorescent protein reporter exhibits nuclear export features of late human immunodeficiency virus type 1 transcripts

    International Nuclear Information System (INIS)

    Graf, Marcus; Ludwig, Christine; Kehlenbeck, Sylvia; Jungert, Kerstin; Wagner, Ralf

    2006-01-01

    We have previously shown that Rev-dependent expression of HIV-1 Gag from CMV immediate early promoter critically depends on the AU-rich codon bias of the gag gene. Here, we demonstrate that adaptation of the green fluorescent protein (GFP) reporter gene to HIV codon bias is sufficient to turn this hivGFP RNA into a quasi-lentiviral message following the rules of late lentiviral gene expression. Accordingly, GFP expression was significantly decreased in transfected cells strictly correlating with reduced RNA levels. In the presence of the HIV 5' major splice donor, the hivGFP RNAs were stabilized in the nucleus and efficiently exported to the cytoplasm following fusion of the 3' Rev-responsive element (RRE) and coexpression of HIV-1 Rev. This Rev-dependent translocation was specifically inhibited by leptomycin B suggesting export via the CRM1-dependent pathway used by late lentiviral transcripts. In conclusion, this quasi-lentiviral reporter system may provide a new platform for developing sensitive Rev screening assays

  20. Multigenic lentiviral vectors for combined and tissue-specific expression of miRNA- and protein-based antiangiogenic factors

    Directory of Open Access Journals (Sweden)

    Anne Louise Askou

    Full Text Available Lentivirus-based gene delivery vectors carrying multiple gene cassettes are powerful tools in gene transfer studies and gene therapy, allowing coexpression of multiple therapeutic factors and, if desired, fluorescent reporters. Current strategies to express transgenes and microRNA (miRNA clusters from a single vector have certain limitations that affect transgene expression levels and/or vector titers. In this study, we describe a novel vector design that facilitates combined expression of therapeutic RNA- and protein-based antiangiogenic factors as well as a fluorescent reporter from back-to-back RNApolII-driven expression cassettes. This configuration allows effective production of intron-embedded miRNAs that are released upon transduction of target cells. Exploiting such multigenic lentiviral vectors, we demonstrate robust miRNA-directed downregulation of vascular endothelial growth factor (VEGF expression, leading to reduced angiogenesis, and parallel impairment of angiogenic pathways by codelivering the gene encoding pigment epithelium-derived factor (PEDF. Notably, subretinal injections of lentiviral vectors reveal efficient retinal pigment epithelium-specific gene expression driven by the VMD2 promoter, verifying that multigenic lentiviral vectors can be produced with high titers sufficient for in vivo applications. Altogether, our results suggest the potential applicability of combined miRNA- and protein-encoding lentiviral vectors in antiangiogenic gene therapy, including new combination therapies for amelioration of age-related macular degeneration.

  1. Utilization of gum tragacanth as bind enhancing agent in extended restructured mutton chops

    OpenAIRE

    Sharma, Heena; Sharma, B. D.; Talukder, S.; Ramasamy, Giriprasad

    2013-01-01

    Use of extenders in meat products is not only health promoting but can also increase the economic worth of the products. Extension of the meat product is generally associated with poor binding and texture. Thus, the present study was envisaged to solve this problem by the incorporation of gum tragacanth (GT) as bind enhancing agent, used at three different levels viz., 0.1, 0.15 and 0.2 % in a pre standardized formulation of extended restructured mutton chops (ERMC), by replacing the lean mea...

  2. Finite element analysis of interface stress between neutron absorption coating and chop disk

    International Nuclear Information System (INIS)

    Tang Changliang; Zhang Xiaozhang; Jiang Lei; Dai Xingjian

    2012-01-01

    The performance of disk chopper is directly affected by bond strength between neutron absorption coating and chop disk. Based on the finite element analysis software ANSYS, the interface stress distribution under high speed centrifugal load was calculated, which was to investigate the effects of coating's elastic modulus, poisson ratio and coating thickness on the interfacial stress distribution. The results show that soft and tough coating can reduce the peak stress effectively, and coating thickness reducing is helpful to avoid the plastic failure of opening in the disk under high speed centrifugal load. (authors)

  3. MYC-rearranged lymphomas other than Burkitt: Comparison between R-CHOP and Burkitt-type immunochemotherapy.

    Science.gov (United States)

    Baptista, Maria Joao; Tapia, Gustavo; Hernández-Rivas, José-Ángel; Martínez-Trillos, Alejandra; Mate, José-Luis; Navarro, José-Tomás

    2017-10-23

    MYC-rearranged (MYC-R) lymphomas other than Burkitt lymphoma (BL) are very aggressive, with poor prognosis when treated with standard regimens. We aimed to study the characteristics and outcome of a series of MYC-R lymphomas comparing the treatment results between R-CHOP based and a specific intensive regimen for BL (BURKIMAB). Retrospective study of patients diagnosed with MYC-R. Translocations of MYC, BCL2 and BCL6 were evaluated by fluorescent in situ hybridization. Patients were treated with either, R-CHOP based immunochemotherapy or the Burkitt type regimen, BURKIMAB. Thirty-four MYC-R lymphoma cases were studied: 21 treated with R-CHOP and 13 treated with BURKIMAB. There were no differences in CR rate; 45% (9/20) for R-CHOP and 42% (5/12) for BURKIMAB (P=.99). Although overall survival (OS) and progression free survival (PFS) of BURKIMAB-treated patients were better than those of R-CHOP-treated (3y-OS: 46 vs. 24%; 3y-PFS: 46 vs. 10%), the differences were not statistically significant. MYC-R lymphomas show poor outcomes even when treated with intensive immunochemotherapy for BL. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  4. Chop Suey as Imagined Authentic Chinese Food: The Culinary Identity of Chinese Restaurants in the United States

    Directory of Open Access Journals (Sweden)

    Haiming Liu

    2009-02-01

    Full Text Available At least until the 1960s, chop suey was synonymous with Chinese food in the United States, where most Chinese restaurants were called chop suey houses. By uncovering the history of chop suey, this article analyzes the development of Chinese cuisine in the U.S. as an example of transnational cultural exchange. The authenticity and culinary identity of Chinese food in America often rested on its real or imagined Chinese roots while its popularity depended on how well Chinese restaurant proprietors adapted the flavors, ingredients, and cooking methods of Chinese cuisine to the tastes and markets of local American communities. The dynamic interaction between Chinese food and American customers functioned as a complex cultural negotiation. While Chinese restaurants helped shape the American diet, Chinese food was at the same time being shaped and transformed by American popular taste. By appealing to a wide range of American diners, chop suey eventually evolved into a popular American ethnic food and a central component in the culinary identity of Chinese restaurants. Chop suey generated numerous jobs for Chinese immigrants and established a culinary bond between Chinese food and American customers. Also, as an imagined authentic Chinese dish, it represented a type of affordable exoticism in the eyes of American consumers, meeting not only American tastes but also their social expectations of Chinese culture.

  5. Chop Suey as Imagined Authentic Chinese Food: The Culinary Identity of Chinese Restaurants in the United States

    Directory of Open Access Journals (Sweden)

    Haiming Liu

    2009-02-01

    Full Text Available

    At least until the 1960s, chop suey was synonymous with Chinese food in the United States, where most Chinese restaurants were called chop suey houses. By uncovering the history of chop suey, this article analyzes the development of Chinese cuisine in the U.S. as an example of transnational cultural exchange. The authenticity and culinary identity of Chinese food in America often rested on its real or imagined Chinese roots while its popularity depended on how well Chinese restaurant proprietors adapted the flavors, ingredients, and cooking methods of Chinese cuisine to the tastes and markets of local American communities. The dynamic interaction between Chinese food and American customers functioned as a complex cultural negotiation. While Chinese restaurants helped shape the American diet, Chinese food was at the same time being shaped and transformed by American popular taste. By appealing to a wide range of American diners, chop suey eventually evolved into a popular American ethnic food and a central component in the culinary identity of Chinese restaurants. Chop suey generated numerous jobs for Chinese immigrants and established a culinary bond between Chinese food and American customers. Also, as an imagined authentic Chinese dish, it represented a type of affordable exoticism in the eyes of American consumers, meeting not only American tastes but also their social expectations of Chinese culture.

  6. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  7. Ethical considerations in the use of lentiviral vectors for genetic transfer.

    Science.gov (United States)

    Roy, I

    2001-11-01

    This chapter will outline the various concerns which have been raised in scientific, bioethics, and lay communities about the use of lentiviral vectors for purposes of gene therapy. Many of these concerns are ranged around gene therapy itself; others are concerns particular to using this sort of vector for genetic modification of human cells. These concerns are outlined within the chapter, and arguments are given in favor and against various approaches to these concerns. Lastly, it is noted throughout that at this stage of research into gene therapy, the most practical approach to these dilemmas is to maintain awareness of the ethical problems and provide information to those concerned with all aspects of the development of this set of technologies.

  8. Generation of a lentiviral vector producer cell clone for human Wiskott-Aldrich syndrome gene therapy

    Directory of Open Access Journals (Sweden)

    Matthew M Wielgosz

    Full Text Available We have developed a producer cell line that generates lentiviral vector particles of high titer. The vector encodes the Wiskott-Aldrich syndrome (WAS protein. An insulator element has been added to the long terminal repeats of the integrated vector to limit proto-oncogene activation. The vector provides high-level, stable expression of WAS protein in transduced murine and human hematopoietic cells. We have also developed a monoclonal antibody specific for intracellular WAS protein. This antibody has been used to monitor expression in blood and bone marrow cells after transfer into lineage negative bone marrow cells from WAS mice and in a WAS negative human B-cell line. Persistent expression of the transgene has been observed in transduced murine cells 12–20 weeks following transplantation. The producer cell line and the specific monoclonal antibody will facilitate the development of a clinical protocol for gene transfer into WAS protein deficient stem cells.

  9. Lentiviral Vector-Mediated GFP/fluc gene introduction into primary mouse NK cells

    International Nuclear Information System (INIS)

    L, Thi Thanh Hoa; Tae, Seong Ho; Min, Jung Joon

    2007-01-01

    NK cell is a type of lymphocyte that has ability in defense against virus infection and some kinds of cancer diseases. Recently, using genetic engineering, studies about the roles and functions of NK cells have been developing. In this study, we used lentivirus-based vector encoding GFP/Fluc gene to transfer into primary mouse NK cells. This model is a tool in studying characteristics of NK cells. The lentivirus used in this study was a commercial one, named LentiM1.3-Fluc, encoding GFP and Flue reporter genes under the control of the murine cytomegalovirus (MCMV) promoter. LentiM1.3-Fluc was infected into freshly isolated mouse NK cells at 2 20 MOl by incubating or using spin infection. In the spin infection, we gently suspended NK cells in viral fluid, then centrifuged at 2000 rpm, 20 minutes at room temperature and incubated for 1 day. After 1 day, virus was discarded and NK cells were cultured in IL-2 with or without IL-12 supplemented media. Infected NK cells were monitored by using fluorescent microscope for GFP and IVIS machine for Fire-fly luciferase expression. The results showed that using spin infection had much effect on introducing lentiviral vector-mediated reporter gene into NK cells than the way without spin. Also, NK cells which were cultured in IL-2 and IL-12 added media expressed higher fluorescent and luminescent signals than those cultured in only IL-2 supplemented media. When these NK cells were injected subcutaneously in Balb/C mice, the imaging signal was observed transiently. Our study demonstrates that by using a simple method, mouse NK cells can be transfected by lentivirus. And this will be useful in studying biology and therapeutic potential of NK cells. However, we require developing alternative lentiviral vectors with different promoter for in vivo application

  10. Inhibition of experimental lung metastasis by systemic lentiviral delivery of kallistatin

    International Nuclear Information System (INIS)

    Shiau, Ai-Li; Wu, Chao-Liang; Lee, Che-Hsin; Teo, Min-Li; Chen, Shin-Yao; Wang, Chrong-Reen; Hsieh, Jeng-Long; Chang, Meng-Ya; Chang, Chih-Jui; Chao, Julie; Chao, Lee

    2010-01-01

    Angiogenesis plays an important role in the development and progression of tumors. Kallistatin exerts anti-angiogenic and anti-inflammatory activities that may be effective in inhibiting tumor metastasis. We investigated the antitumor effect of lentivirus-mediated kallistatin gene transfer in a syngeneic murine tumor model. Lentiviral vector encoding kallistatin (LV-Kallistatin) was constructed. The expression of kallistatin was verified by enzyme-linked immunosorbent assay (ELISA), and the bioactivity of kallistatin was determined by using cell proliferation, migration, and invasion assays. In addition, antitumor effects of LV-Kallistatin were evaluated by the intravenous injection of virus into tumor-bearing mice. The conditioned medium from LV-Kallistatin-treated cells inhibited the migration and proliferation of endothelial cells. Meanwhile, it also reduced the migration and invasion of tumor cells. In the experimental lung metastatic model, tumor-bearing mice receiving LV-Kallistatin had lower tumor nodules and longer survival than those receiving control virus or saline. Moreover, the microvessel densities, the levels of vascular endothelial growth factor (VEGF), tumor necrosis factor (TNF)-α, and nuclear factor κB (NF-κB) transcriptional activity were reduced in the LV-Kallistatin-treated mice. Results of this study showed that systemic administration of lentiviral vectors encoding kallistatin inhibited the growth of metastatic tumor and prolonged the survival of tumor-bearing mice. These results suggest that gene therapy using lentiviruses carrying the kallistatin gene, which exerts anti-angiogenic and anti-inflammatory activities, represents a promising strategy for the treatment of lung cancer

  11. Lentiviral Modulation of Wnt/β-Catenin Signaling Affects In Vivo LTP.

    Science.gov (United States)

    Ivanova, Olga Ya; Dobryakova, Yulia V; Salozhin, Sergey V; Aniol, Viktor A; Onufriev, Mikhail V; Gulyaeva, Natalia V; Markevich, Vladimir A

    2017-10-01

    Wnt signaling is involved in hippocampal development and synaptogenesis. Numerous recent studies have been focused on the role of Wnt ligands in the regulation of synaptic plasticity. Inhibitors and activators of canonical Wnt signaling were demonstrated to decrease or increase, respectively, in vitro long-term potentiation (LTP) maintenance in hippocampal slices (Chen et al. in J Biol Chem 281:11910-11916, 2006; Vargas et al. in J Neurosci 34:2191-2202, 2014, Vargas et al. in Exp Neurol 264:14-25, 2015). Using lentiviral approach to down- and up-regulate the canonical Wnt signaling, we explored whether Wnt/β-catenin signaling is critical for the in vivo LTP. Chronic suppression of Wnt signaling induced an impairment of in vivo LTP expression 14 days after lentiviral suspension injection, while overexpression of Wnt3 was associated with a transient enhancement of in vivo LTP magnitude. Both effects were related to the early phase LTP and did not affect LTP maintenance. A loss-of-function study demonstrated decreased initial paired pulse facilitation ratio, β-catenin, and phGSK-3β levels. A gain-of-function study revealed not only an increase in PSD-95, β-catenin, and Cyclin D1 protein levels, but also a reduced phGSK-3β level and enhanced GSK-3β kinase activity. These results suggest a presynaptic dysfunction predominantly underlying LTP impairment while postsynaptic modifications are primarily involved in transient LTP amplification. This study is the first demonstration of the involvement of Wnt/β-catenin signaling in synaptic plasticity regulation in an in vivo LTP model.

  12. A nonintegrative lentiviral vector-based vaccine provides long-term sterile protection against malaria.

    Directory of Open Access Journals (Sweden)

    Frédéric Coutant

    Full Text Available Trials testing the RTS,S candidate malaria vaccine and radiation-attenuated sporozoites (RAS have shown that protective immunity against malaria can be induced and that an effective vaccine is not out of reach. However, longer-term protection and higher protection rates are required to eradicate malaria from the endemic regions. It implies that there is still a need to explore new vaccine strategies. Lentiviral vectors are very potent at inducing strong immunological memory. However their integrative status challenges their safety profile. Eliminating the integration step obviates the risk of insertional oncogenesis. Providing they confer sterile immunity, nonintegrative lentiviral vectors (NILV hold promise as mass pediatric vaccine by meeting high safety standards. In this study, we have assessed the protective efficacy of NILV against malaria in a robust pre-clinical model. Mice were immunized with NILV encoding Plasmodium yoelii Circumsporozoite Protein (Py CSP and challenged with sporozoites one month later. In two independent protective efficacy studies, 50% (37.5-62.5 of the animals were fully protected (p = 0.0072 and p = 0.0008 respectively when compared to naive mice. The remaining mice with detectable parasitized red blood cells exhibited a prolonged patency and reduced parasitemia. Moreover, protection was long-lasting with 42.8% sterile protection six months after the last immunization (p = 0.0042. Post-challenge CD8+ T cells to CSP, in contrast to anti-CSP antibodies, were associated with protection (r = -0.6615 and p = 0.0004 between the frequency of IFN-g secreting specific T cells in spleen and parasitemia. However, while NILV and RAS immunizations elicited comparable immunity to CSP, only RAS conferred 100% of sterile protection. Given that a better protection can be anticipated from a multi-antigen vaccine and an optimized vector design, NILV appear as a promising malaria vaccine.

  13. Inhibition of experimental lung metastasis by systemic lentiviral delivery of kallistatin

    Directory of Open Access Journals (Sweden)

    Chao Julie

    2010-05-01

    Full Text Available Abstract Background Angiogenesis plays an important role in the development and progression of tumors. Kallistatin exerts anti-angiogenic and anti-inflammatory activities that may be effective in inhibiting tumor metastasis. We investigated the antitumor effect of lentivirus-mediated kallistatin gene transfer in a syngeneic murine tumor model. Methods Lentiviral vector encoding kallistatin (LV-Kallistatin was constructed. The expression of kallistatin was verified by enzyme-linked immunosorbent assay (ELISA, and the bioactivity of kallistatin was determined by using cell proliferation, migration, and invasion assays. In addition, antitumor effects of LV-Kallistatin were evaluated by the intravenous injection of virus into tumor-bearing mice. Results The conditioned medium from LV-Kallistatin-treated cells inhibited the migration and proliferation of endothelial cells. Meanwhile, it also reduced the migration and invasion of tumor cells. In the experimental lung metastatic model, tumor-bearing mice receiving LV-Kallistatin had lower tumor nodules and longer survival than those receiving control virus or saline. Moreover, the microvessel densities, the levels of vascular endothelial growth factor (VEGF, tumor necrosis factor (TNF-α, and nuclear factor κB (NF-κB transcriptional activity were reduced in the LV-Kallistatin-treated mice. Conclusion Results of this study showed that systemic administration of lentiviral vectors encoding kallistatin inhibited the growth of metastatic tumor and prolonged the survival of tumor-bearing mice. These results suggest that gene therapy using lentiviruses carrying the kallistatin gene, which exerts anti-angiogenic and anti-inflammatory activities, represents a promising strategy for the treatment of lung cancer.

  14. CHOP THERAPY INDUCED MITOCHONDRIAL REDOX STATE ALTERATION IN NON-HODGKIN'S LYMPHOMA XENOGRAFTS

    Directory of Open Access Journals (Sweden)

    H. N. XU

    2013-04-01

    Full Text Available We are interested in investigating whether cancer therapy may alter the mitochondrial redox state in cancer cells to inhibit their growth and survival. The redox state can be imaged by the redox scanner that collects the fluorescence signals from both the oxidized-flavoproteins (Fp and the reduced form of nicotinamide adenine dinucleotide (NADH in snap-frozen tissues and has been previously employed to study tumor aggressiveness and treatment responses. Here, with the redox scanner we investigated the effects of chemotherapy on mouse xenografts of a human diffuse large B-cell lymphoma cell line (DLCL2. The mice were treated with CHOP therapy, i.e., cyclophosphamide (C + hydroxydoxorubicin (H + Oncovin (O + prednisone (P with CHO administration on day 1 and prednisone administration on days 1–5. The Fp content of the treated group was significantly decreased (p = 0.033 on day 5, and the mitochondrial redox state of the treated group was slightly more reduced than that of the control group (p = 0.048. The decrease of the Fp heterogeneity (measured by the mean standard deviation had a border-line statistical significance (p = 0.071. The result suggests that the mitochondrial metabolism of lymphoma cells was slightly suppressed and the lymphomas became less aggressive after the CHOP therapy.

  15. Lactacystin inhibits 3T3-L1 adipocyte differentiation through induction of CHOP-10 expression

    International Nuclear Information System (INIS)

    Li Xi; Huang Haiyan; Chen Jiegen; Jiang Lin; Liu Honglei; Liu Deguo; Song Tanjing; He Qun; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    Hormonal induction triggers a cascade leading to the expression of CCAAT/enhancer-binding protein(C/EBP)α and peroxisome proliferator-activated receptor (PPAR) γ, C/EBPα, and PPARγ turns on series of adipocyte genes that give rise to the adipocyte phenotype. Previous findings indicate that C/EBPβ, a transcriptional activator of the C/EBPα and PPARγ genes, is rapidly expressed after induction, but lacks DNA-binding activity and therefore cannot activate transcription of the C/EBPα and PPARγ genes early in the differentiation program. Acquisition of DNA-binding activity of C/EBPβ occurs when CHOP-10, a dominant-negative form of C/EBP family members, is down-regulated and becomes hyperphosphorylated as preadipocytes traverse the G 1 -S checkpoint of mitotic clonal expansion. Evidences are presented in this report that lactacystin, a proteasome inhibitor, up-regulated the CHOP-10 expression, blocked the DNA-binding activity of C/EBPβ, and subsequently inhibited MCE as well as adipocyte differentiation

  16. Determination of salt content in various depth of pork chop by electrical impedance spectroscopy

    International Nuclear Information System (INIS)

    Kaltenecker, P; Szöllösi, D; Vozáry, E; Friedrich, L

    2013-01-01

    The salt concentration was determined inside of pork chop both by electrical impedance spectroscopy and by a conventional chemical method (according to Mohr). The pork chop in various depths (4 mm, 10 mm, 20 mm and 25 mm) was punctured with two stainless steel electrodes. The length of electrodes was 60 mm, and they were insulated along the length except 1 cm section on the end, so the measurement of impedance was realized in various depths. The magnitude and phase angle of impedance were measured with a HP 4284A and a HP 4285A LCR meters from 30 Hz up to 1 MHz and from 75 kHz up to 30 MHz frequency range, respectively at 1 V voltage. The distance between the electrodes was 1 cm. The impedance magnitude decreased as the salt concentration increased. The magnitude of open-short corrected impedance values at various frequencies (10 kHz, 100 kHz, 125 kHz, 1.1 MHz and 8 MHz) showed a good correlation with salt content determined by chemical procedure. The electrical impedance spectroscopy seems a prospective method for determination the salt concentration inside the meat in various depths during the curing procedure.

  17. Chopped hemp: Logistics, compaction and financial viability; Logistik, komprimering och ekonomi angaaende hackad hampa

    Energy Technology Data Exchange (ETDEWEB)

    Soederstroem, Yvonne

    2010-05-15

    In this project compaction and logistics experiments were conducted using chopped hemp. The aim was to reduce the hemp to 250 kg/m3, as well as to identify the best possible logistical system for compaction and subsequent transportation to the end-user in terms of cost and environmental impact. The project primarily focused on landowners and power companies. Other stakeholders are industries, universities and other ongoing projects in related fields. These studies have shown that it is possible to compact chopped hemp from a density of 60 kg dm/m3 (0.30 MWh/m3) when harvesting directly into the container, to a density of 202 kg dm/m3 (1.01 MWh/m3) using the baler. The original compaction target was a volumetric weight of 250 kg/m3. It was determined that straw and hemp react similarly to compaction. This project has demonstrated that the transport rig system has the best potential for large-scale use as compared with the alternate systems used. According to our calculations, the transport rig was the most cost-effective system measured in kronor per energy content. In addition, this system is also flexible. From an environmental standpoint, however, the energy balance showed that the container system was slightly superior

  18. Analysis of the first CHOPS pilot for heavy oil production in Kuwait

    Energy Technology Data Exchange (ETDEWEB)

    Sanyal, Tirtharenu; Al-Sammak, Ibrahim [Kuwait Oil Company (Kuwait)

    2011-07-01

    Cold heavy oil production with sand (CHOPS) is a technique for extracting difficult heavy crude oil by simply pumping it out of the sands, often using progressive cavity pumps. This technique was tested in a pilot heavy oil production project at one of the fields in Kuwait. The pilot performance of three wells is presented in this paper as is an analysis of the pilot results, which provide important clues for understanding the reservoir description issues as well as sand production characteristics. This process found an intimate relationship between rock mechanics and the fluid viscosity and flow potential of the formation. The wells seemed to develop an enlarged well bore around them, giving a high negative skin factor. Moreover, the lower viscosity of the oil and absence of any strong directional geomechanical trend could be possible reasons for the absence of wormhole development, which has often been observed in other CHOPS operations. The initial burst of sand production needs to be addressed by optimizing the perforation policy.

  19. Effects of chopping time, meat source and storage temperature on the colour of New Zealand type fresh beef sausages.

    Science.gov (United States)

    Boles, J A; Mikkelsen, V L; Swan, J E

    1998-05-01

    The colour stability of finely chopped fresh sausages made from post-rigor, pre-rigor salt added (1.5% w/w) or pre-rigor no salt added beef mince was evaluated using a Hunter Miniscan (L (∗) a (∗) b (∗)) and sensory colour panel. Batters were chopped for various times and sausages stored at -1.5 °, + 4.0 ° and + 8.0 °C. Regardless of meat source or chopping time, colour stability was greatest at -1.5 °C. Panellists found the colour of all sausages stored at -1.5 °C acceptable for at least six days. Sausages made from unsalted pre-rigor mince had markedly better colour stability than those made from the other meats, especially when stored at 4 °C or 8 °C.

  20. Validation of the Children's Hospital of Philadelphia Retinopathy of Prematurity (CHOP ROP) Model.

    Science.gov (United States)

    Binenbaum, Gil; Ying, Gui-Shuang; Tomlinson, Lauren A

    2017-08-01

    The Children's Hospital of Philadelphia Retinopathy of Prematurity (CHOP ROP) model uses birth weight (BW), gestational age at birth (GA), and weight gain rate to predict the risk of severe retinopathy of prematurity (ROP). In a model development study, it predicted all infants requiring treatment, while greatly reducing the number of examinations compared with current screening guidelines. To validate the CHOP ROP model in a multicenter cohort that is large enough to obtain a precise estimate of the model's sensitivity for treatment-requiring ROP. This investigation was a secondary analysis of data from the Postnatal Growth and Retinopathy of Prematurity (G-ROP) Study. The setting was 30 hospitals in the United States and Canada between January 1, 2006, and June 30, 2012. The dates of analysis were September 28 to October 5, 2015. Participants were premature infants at risk for ROP with a known ROP outcome. Sensitivity for Early Treatment of Retinopathy of Prematurity type 1 ROP and potential reduction in the number of infants requiring examinations. In the primary analysis, the CHOP ROP model was applied weekly to predict the risk of ROP. If the risk was above a cut-point level (high risk), examinations were indicated, while low-risk infants received no examinations. In a secondary analysis, low-risk infants received fewer examinations rather than no examinations. Participants included 7483 premature infants at risk for ROP with a known ROP outcome. Their median BW was 1070 g (range, 310-3000 g), and their median GA was 28 weeks (range, 22-35 weeks). Among them, 3575 (47.8%) were female, and their race/ethnicity was 3615 white (48.3%), 2310 black (30.9%), 233 Asian (3.1%), 93 Pacific Islander (1.2%), and 40 American Indian/Alaskan native (0.5%). The original CHOP ROP model correctly predicted 452 of 459 infants who developed type 1 ROP (sensitivity, 98.5%; 95% CI, 96.9%-99.3%), reducing the number of infants requiring examinations by 34.3% if only high

  1. Extremely decreased release of prostaglandin E-like activity from chopped lung of ethyl linolenate-supplemented rats

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Jensen, B.; Fjalland, B.

    1983-01-01

    Three groups of weanling male rats were reared on a fat-free diet for 13 weeks. One group received only the fat-free diet (FF rats), the other 2 groups received the fat-free diet and a daily supplement of 2 energy% ethyl linoleate ([n-6] rats), or 2 energy% ethyl linolenate ([n-3] rats). The chop......). The chopped lung preparation was used to illustrate an in vitro prostaglandin formation. PGE-like activity was quantified on rat stomach strip. The release of PGE-like activity expressed as ng PGE-equivalent per g lung tissue (mean±SD) was 23±7,...

  2. Lipopolysaccharide preconditioning protects hepatocytes from ischemia/reperfusion injury (IRI through inhibiting ATF4-CHOP pathway in mice.

    Directory of Open Access Journals (Sweden)

    Jianhua Rao

    Full Text Available BACKGROUND: Low-dose lipopolysaccharide (LPS preconditioning-induced liver protection has been demonstrated during ischemia-reperfusion injury (IRI in several organs but has not been sufficiently elucidated underlying causal mechanism. This study investigated the role of low-dose LPS preconditioning on ATF4-CHOP pathway as well as the effects of the pathway on tissue injury and inflammation in a mouse model of liver partial-warm IRI. METHODS: LPS (100 µg/kg/d was injected intraperitoneally two days before ischemia. Hepatic injury was evaluated based on serum alanine aminotransferase levels, histopathology, and caspase-3 activity. The ATF4-CHOP pathway and its related apoptotic molecules were investigated after reperfusion. The role of LPS preconditioning on apoptosis and ATF4-CHOP pathway was examined in vitro. Moreover, the effects of the ATF4-CHOP pathway on apoptosis, Caspase-12, and Caspase-3 were determined with ATF4 small interfering RNA (siRNA. Inflammatory cytokine expression was also checked after reperfusion. Inflammatory cytokines and related signaling pathways were analyzed in vitro in macrophages treated by LPS preconditioning or ATF4 siRNA. RESULTS: LPS preconditioning significantly attenuated liver injury after IRI. As demonstrated by in vitro experiments, LPS preconditioning significantly reduced the upregulation of the ATF4-CHOP pathway and inhibited Caspase-12 and Caspase-3 activation after IRI. Later experiments showed that ATF4 knockdown significantly suppressed CHOP, cleaved caspase-12 and caspase-3 expression, as well as inhibited hepatocellular apoptosis. In addition, in mice pretreated with LPS, TNF-α and IL-6 were inhibited after reperfusion, whereas IL-10 was upregulated. Similarly, low-dose LPS significantly inhibited TNF-α, IL-6, ATF4-CHOP pathway, NF-κB pathway, and ERK1/2 in high-dose LPS-stimulated macrophages, whereas IL-10 and cytokine signaling (SOCS-3 suppressor were induced. Importantly, ATF4 siRNA is

  3. Lentiviral vector mediated modification of mesenchymal stem cells & enhanced survival in an in vitro model of ischaemia.

    LENUS (Irish Health Repository)

    McGinley, Lisa

    2012-01-31

    INTRODUCTION: A combination of gene and cell therapies has the potential to significantly enhance the therapeutic value of mesenchymal stem cells (MSCs). The development of efficient gene delivery methods is essential if MSCs are to be of benefit using such an approach. Achieving high levels of transgene expression for the required period of time, without adversely affecting cell viability and differentiation capacity, is crucial. In the present study, we investigate lentiviral vector-mediated genetic modification of rat bone-marrow derived MSCs and examine any functional effect of such genetic modification in an in vitro model of ischaemia. METHODS: Transduction efficiency and transgene persistence of second and third generation rHIV-1 based lentiviral vectors were tested using reporter gene constructs. Use of the rHIV-pWPT-EF1-alpha-GFP-W vector was optimised in terms of dose, toxicity, cell species, and storage. The in vivo condition of ischaemia was modelled in vitro by separation into its associated constituent parts i.e. hypoxia, serum and glucose deprivation, in which the effect of therapeutic gene over-expression on MSC survival was investigated. RESULTS: The second generation lentiviral vector rHIV-pWPT-EF1-alpha-GFP-W, was the most efficient and provided the most durable transgene expression of the vectors tested. Transduction with this vector did not adversely affect MSC morphology, viability or differentiation potential, and transgene expression levels were unaffected by cryopreservation of transduced cells. Over-expression of HSP70 resulted in enhanced MSC survival and increased resistance to apoptosis in conditions of hypoxia and ischaemia. MSC differentiation capacity was significantly reduced after oxygen deprivation, but was preserved with HSP70 over-expression. CONCLUSIONS: Collectively, these data validate the use of lentiviral vectors for efficient in vitro gene delivery to MSCs and suggest that lentiviral vector transduction can facilitate

  4. Lentiviral vector mediated modification of mesenchymal stem cells & enhanced survival in an in vitro model of ischaemia

    LENUS (Irish Health Repository)

    McGinley, Lisa

    2011-03-07

    Abstract Introduction A combination of gene and cell therapies has the potential to significantly enhance the therapeutic value of mesenchymal stem cells (MSCs). The development of efficient gene delivery methods is essential if MSCs are to be of benefit using such an approach. Achieving high levels of transgene expression for the required period of time, without adversely affecting cell viability and differentiation capacity, is crucial. In the present study, we investigate lentiviral vector-mediated genetic modification of rat bone-marrow derived MSCs and examine any functional effect of such genetic modification in an in vitro model of ischaemia. Methods Transduction efficiency and transgene persistence of second and third generation rHIV-1 based lentiviral vectors were tested using reporter gene constructs. Use of the rHIV-pWPT-EF1-α-GFP-W vector was optimised in terms of dose, toxicity, cell species, and storage. The in vivo condition of ischaemia was modelled in vitro by separation into its associated constituent parts i.e. hypoxia, serum and glucose deprivation, in which the effect of therapeutic gene over-expression on MSC survival was investigated. Results The second generation lentiviral vector rHIV-pWPT-EF1-α-GFP-W, was the most efficient and provided the most durable transgene expression of the vectors tested. Transduction with this vector did not adversely affect MSC morphology, viability or differentiation potential, and transgene expression levels were unaffected by cryopreservation of transduced cells. Over-expression of HSP70 resulted in enhanced MSC survival and increased resistance to apoptosis in conditions of hypoxia and ischaemia. MSC differentiation capacity was significantly reduced after oxygen deprivation, but was preserved with HSP70 over-expression. Conclusions Collectively, these data validate the use of lentiviral vectors for efficient in vitro gene delivery to MSCs and suggest that lentiviral vector transduction can facilitate

  5. Mutational profile and prognostic significance of TP53 in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Xu-Monette, Zijun Y; Wu, Lin; Visco, Carlo

    2012-01-01

    TP53 mutation is an independent marker of poor prognosis in patients with diffuse large B-cell lymphoma (DLBCL) treated with cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone (CHOP) therapy. However, its prognostic value in the rituximab immunochemotherapy era remains undefined. ...... for stratifying R-CHOP-treated patients into distinct prognostic subsets and has significant value in the design of future therapeutic strategies....

  6. Modulator considerations for beam chopping in the low energy beam transport at the SSC Laboratory

    International Nuclear Information System (INIS)

    Anderson, D.; Pappas, G.

    1991-06-01

    Beam chopping in the low energy transport line at the Superconducting Super Collider Laboratory is accomplished using an electrostatic deflection system. LINAC requirements dictate the design of two modulators operating at 10 Hz with rise and fall times (as measured from approximately 10--99%) of ∼100 ns. Design of the first pulser, normally at 10 kV and pulsed to ground potential, utilizes a transformer-coupled diode-clamped solid state circuit to achieve the 2--35 μs pulse width range required. The second pulser, which pulses from ground to approximately 7 kV, relies on a series vacuum tube circuit. The current designs, as well as recent test results and other circuit topologies considered, will be presented. 6 refs

  7. Effect of Different Tumbling Marination Methods and Time on the Water Status and Protein Properties of Prepared Pork Chops

    Directory of Open Access Journals (Sweden)

    Tian Gao

    2015-07-01

    Full Text Available The combined effect of tumbling marination methods (vacuum continuous tumbling marination, CT; vacuum intermittent tumbling marination, IT and effective tumbling time (4, 6, 8, and 10 h on the water status and protein properties of prepared pork chops was investigated. Results showed that regardless of tumbling time, CT method significantly decreased the muscle fiber diameter (MD and significantly increased the total moisture content, product yield, salt soluble proteins (SSP solubility, immobilized water component (p<0.05 compared with IT method. With the effective tumbling time increased from 4 h to 10 h, the fat content and the MD were significantly decreased (p<0.05, whereas the SSP solubility of prepared pork chops increased firstly and then decreased. Besides, an interactive effect between CT method and effective tumbling time was also observed for the chemical composition and proportion of immobilized water (p<0.05. These results demonstrated that CT method of 8 h was the most beneficial for improving the muscle structure and water distribution status, increasing the water-binding capacity and accelerating the marinade efficiency of pork chops; and thus, it should be chosen as the most optimal treatment method for the processing production of prepared pork chops.

  8. Effects of alfalfa hay and its physical form (chopped versus pelleted) on performance of Holstein calves.

    Science.gov (United States)

    Jahani-Moghadam, M; Mahjoubi, E; Hossein Yazdi, M; Cardoso, F C; Drackley, J K

    2015-06-01

    Inclusion of forage and its physical form in starter may affect rumen development, average daily gain (ADG), and dry matter intake (DMI) of dairy calves. To evaluate the effects of forage and its physical form (chopped vs. pelleted) on growth of calves under a high milk feeding regimen, 32 Holstein calves (38.8±1.1kg) were assigned at birth to 1 of 3 treatments in a completely randomized block design. Dietary treatments (% of dry matter) were (1) 100% semi-texturized starter (CON); (2) 90% semi-texturized starter + 10% chopped alfalfa hay (mean particle size=5.4mm) as a total mixed ration (TMR; CH); and (3) 90% semi-texturized starter + 10% pelleted alfalfa (mean=5.8mm) hay as a TMR (PH). Data were subjected to mixed model analysis with contrasts used to evaluate effect of forage inclusion. Calves were weaned at 76 d of age and the experiment finished 2 wk after weaning. Individual milk and solid feed consumption were recorded daily. Solid feed consumption and ADG increased as age increased (effect of week), but neither forage inclusion nor physical form of forage affected these variables pre- or postweaning. Plasma urea N was affected by treatments such that the CON group had a lower concentration than forage-fed groups. Forage inclusion, but not physical form, resulted in increased total protein in plasma. Although days with elevated rectal temperature, fecal score, and general appearance were not affected by dietary treatments, calves fed alfalfa hay during the first month of life had fewer days with respiratory issues, regardless of physical form of hay. We concluded that provision of forage does have some beneficial effects in calves fed large amounts of milk replacer, but pelleted alfalfa hay did not result in any improvement in calf performance or health. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  9. The CHOP postnatal weight gain, birth weight, and gestational age retinopathy of prematurity risk model.

    Science.gov (United States)

    Binenbaum, Gil; Ying, Gui-Shuang; Quinn, Graham E; Huang, Jiayan; Dreiseitl, Stephan; Antigua, Jules; Foroughi, Negar; Abbasi, Soraya

    2012-12-01

    To develop a birth weight (BW), gestational age (GA), and postnatal-weight gain retinopathy of prematurity (ROP) prediction model in a cohort of infants meeting current screening guidelines. Multivariate logistic regression was applied retrospectively to data from infants born with BW less than 1501 g or GA of 30 weeks or less at a single Philadelphia hospital between January 1, 2004, and December 31, 2009. In the model, BW, GA, and daily weight gain rate were used repeatedly each week to predict risk of Early Treatment of Retinopathy of Prematurity type 1 or 2 ROP. If risk was above a cut-point level, examinations would be indicated. Of 524 infants, 20 (4%) had type 1 ROP and received laser treatment; 28 (5%) had type 2 ROP. The model (Children's Hospital of Philadelphia [CHOP]) accurately predicted all infants with type 1 ROP; missed 1 infant with type 2 ROP, who did not require laser treatment; and would have reduced the number of infants requiring examinations by 49%. Raising the cut point to miss one type 1 ROP case would have reduced the need for examinations by 79%. Using daily weight measurements to calculate weight gain rate resulted in slightly higher examination reduction than weekly measurements. The BW-GA-weight gain CHOP ROP model demonstrated accurate ROP risk assessment and a large reduction in the number of ROP examinations compared with current screening guidelines. As a simple logistic equation, it can be calculated by hand or represented as a nomogram for easy clinical use. However, larger studies are needed to achieve a highly precise estimate of sensitivity prior to clinical application.

  10. Robust Lentiviral Gene Delivery But Limited Transduction Capacity of Commonly Used Adeno-Associated Viral Serotypes in Xenotransplanted Human Skin.

    Science.gov (United States)

    Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars

    2015-08-01

    Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.

  11. Breeding of transgenic cattle for human coagulation factor IX by a combination of lentiviral system and cloning.

    Science.gov (United States)

    Monzani, P S; Sangalli, J R; De Bem, T H C; Bressan, F F; Fantinato-Neto, P; Pimentel, J R V; Birgel-Junior, E H; Fontes, A M; Covas, D T; Meirelles, F V

    2013-02-28

    Recombinant coagulation factor IX must be produced in mammalian cells because FIX synthesis involves translational modifications. Human cell culture-based expression of human coagulation factor IX (hFIX) is expensive, and large-scale production capacity is limited. Transgenic animals may greatly increase the yield of therapeutic proteins and reduce costs. In this study, we used a lentiviral system to obtain transgenic cells and somatic cell nuclear transfer (SCNT) to produce transgenic animals. Lentiviral vectors carrying hFIX driven by 3 bovine β-casein promoters were constructed. Bovine epithelial mammary cells were transduced by lentivirus, selected with blasticidin, plated on extracellular matrix, and induced by lactogenic hormones; promoter activity was evaluated by quantitative PCR. Transcriptional activity of the 5.335-kb promoter was 6-fold higher than the 3.392- and 4.279-kb promoters, which did not significantly differ. Transgenic bovine fibroblasts were transduced with lentivirus carrying the 5.335-kb promoter and used as donor cells for SCNT. Cloned transgenic embryo production yielded development rates of 28.4%, similar to previous reports on cloned non-transgenic embryos. The embryos were transferred to recipient cows (N = 21) and 2 births of cloned transgenic cattle were obtained. These results suggest combination of the lentiviral system and cloning may be a good strategy for production of transgenic cattle.

  12. Eliminating HIV-1 Packaging Sequences from Lentiviral Vector Proviruses Enhances Safety and Expedites Gene Transfer for Gene Therapy.

    Science.gov (United States)

    Vink, Conrad A; Counsell, John R; Perocheau, Dany P; Karda, Rajvinder; Buckley, Suzanne M K; Brugman, Martijn H; Galla, Melanie; Schambach, Axel; McKay, Tristan R; Waddington, Simon N; Howe, Steven J

    2017-08-02

    Lentiviral vector genomic RNA requires sequences that partially overlap wild-type HIV-1 gag and env genes for packaging into vector particles. These HIV-1 packaging sequences constitute 19.6% of the wild-type HIV-1 genome and contain functional cis elements that potentially compromise clinical safety. Here, we describe the development of a novel lentiviral vector (LTR1) with a unique genomic structure designed to prevent transfer of HIV-1 packaging sequences to patient cells, thus reducing the total HIV-1 content to just 4.8% of the wild-type genome. This has been achieved by reconfiguring the vector to mediate reverse-transcription with a single strand transfer, instead of the usual two, and in which HIV-1 packaging sequences are not copied. We show that LTR1 vectors offer improved safety in their resistance to remobilization in HIV-1 particles and reduced frequency of splicing into human genes. Following intravenous luciferase vector administration to neonatal mice, LTR1 sustained a higher level of liver transgene expression than an equivalent dose of a standard lentivirus. LTR1 vectors produce reverse-transcription products earlier and start to express transgenes significantly quicker than standard lentiviruses after transduction. Finally, we show that LTR1 is an effective lentiviral gene therapy vector as demonstrated by correction of a mouse hemophilia B model. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  14. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  15. [Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

    Science.gov (United States)

    Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

    2014-03-01

    To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

  16. Safe and Effective Gene Therapy for Murine Wiskott-Aldrich Syndrome Using an Insulated Lentiviral Vector

    Directory of Open Access Journals (Sweden)

    Swati Singh

    2017-03-01

    Full Text Available Wiskott-Aldrich syndrome (WAS is a life-threatening immunodeficiency caused by mutations within the WAS gene. Viral gene therapy to restore WAS protein (WASp expression in hematopoietic cells of patients with WAS has the potential to improve outcomes relative to the current standard of care, allogeneic bone marrow transplantation. However, the development of viral vectors that are both safe and effective has been problematic. While use of viral transcriptional promoters may increase the risk of insertional mutagenesis, cellular promoters may not achieve WASp expression levels necessary for optimal therapeutic effect. Here we evaluate a self-inactivating (SIN lentiviral vector combining a chromatin insulator upstream of a viral MND (MPSV LTR, NCR deleted, dl587 PBS promoter driving WASp expression. Used as a gene therapeutic in Was−/− mice, this vector resulted in stable WASp+ cells in all hematopoietic lineages and rescue of T and B cell defects with a low number of viral integrations per cell, without evidence of insertional mutagenesis in serial bone marrow transplants. In a gene transfer experiment in non-human primates, the insulated MND promoter (driving GFP expression demonstrated long-term polyclonal engraftment of GFP+ cells. These observations demonstrate that the insulated MND promoter safely and efficiently reconstitutes clinically effective WASp expression and should be considered for future WAS therapy.

  17. Lentiviral vector-mediated genetic modification of human neural progenitor cells for ex vivo gene therapy.

    Science.gov (United States)

    Capowski, Elizabeth E; Schneider, Bernard L; Ebert, Allison D; Seehus, Corey R; Szulc, Jolanta; Zufferey, Romain; Aebischer, Patrick; Svendsen, Clive N

    2007-07-30

    Human neural progenitor cells (hNPC) hold great potential as an ex vivo system for delivery of therapeutic proteins to the central nervous system. When cultured as aggregates, termed neurospheres, hNPC are capable of significant in vitro expansion. In the current study, we present a robust method for lentiviral vector-mediated gene delivery into hNPC that maintains the differentiation and proliferative properties of neurosphere cultures while minimizing the amount of viral vector used and controlling the number of insertion sites per population. This method results in long-term, stable expression even after differentiation of the hNPC to neurons and astrocytes and allows for generation of equivalent transgenic populations of hNPC. In addition, the in vitro analysis presented predicts the behavior of transgenic lines in vivo when transplanted into a rodent model of Parkinson's disease. The methods presented provide a powerful tool for assessing the impact of factors such as promoter systems or different transgenes on the therapeutic utility of these cells.

  18. Immune modulation by genetic modification of dendritic cells with lentiviral vectors.

    Science.gov (United States)

    Liechtenstein, Therese; Perez-Janices, Noemi; Bricogne, Christopher; Lanna, Alessio; Dufait, Inès; Goyvaerts, Cleo; Laranga, Roberta; Padella, Antonella; Arce, Frederick; Baratchian, Mehdi; Ramirez, Natalia; Lopez, Natalia; Kochan, Grazyna; Blanco-Luquin, Idoia; Guerrero-Setas, David; Breckpot, Karine; Escors, David

    2013-09-01

    Our work over the past eight years has focused on the use of HIV-1 lentiviral vectors (lentivectors) for the genetic modification of dendritic cells (DCs) to control their functions in immune modulation. DCs are key professional antigen presenting cells which regulate the activity of most effector immune cells, including T, B and NK cells. Their genetic modification provides the means for the development of targeted therapies towards cancer and autoimmune disease. We have been modulating with lentivectors the activity of intracellular signalling pathways and co-stimulation during antigen presentation to T cells, to fine-tune the type and strength of the immune response. In the course of our research, we have found unexpected results such as the surprising immunosuppressive role of anti-viral signalling pathways, and the close link between negative co-stimulation in the immunological synapse and T cell receptor trafficking. Here we review our major findings and put them into context with other published work. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  20. A novel co-crystal structure affords the design of gain-of-function lentiviral integrase mutants in the presence of modified PSIP1/LEDGF/p75.

    Directory of Open Access Journals (Sweden)

    Stephen Hare

    2009-01-01

    Full Text Available Lens epithelium derived growth factor (LEDGF, also known as PC4 and SFRS1 interacting protein 1 (PSIP1 and transcriptional co-activator p75, is the cellular binding partner of lentiviral integrase (IN proteins. LEDGF accounts for the characteristic propensity of Lentivirus to integrate within active transcription units and is required for efficient viral replication. We now present a crystal structure containing the N-terminal and catalytic core domains (NTD and CCD of HIV-2 IN in complex with the IN binding domain (IBD of LEDGF. The structure extends the known IN-LEDGF interface, elucidating primarily charge-charge interactions between the NTD of IN and the IBD. A constellation of acidic residues on the NTD is characteristic of lentiviral INs, and mutations of the positively charged residues on the IBD severely affect interaction with all lentiviral INs tested. We show that the novel NTD-IBD contacts are critical for stimulation of concerted lentiviral DNA integration by LEDGF in vitro and for its function during the early steps of HIV-1 replication. Furthermore, the new structural details enabled us to engineer a mutant of HIV-1 IN that primarily functions only when presented with a complementary LEDGF mutant. These findings provide structural basis for the high affinity lentiviral IN-LEDGF interaction and pave the way for development of LEDGF-based targeting technologies for gene therapy.

  1. Oviduct-Specific Expression of Human Neutrophil Defensin 4 in Lentivirally Generated Transgenic Chickens

    Science.gov (United States)

    Liu, Tongxin; Wu, Hanyu; Cao, Dainan; Li, Qingyuan; Zhang, Yaqiong; Li, Ning; Hu, Xiaoxiang

    2015-01-01

    The expression of oviduct-specific recombinant proteins in transgenic chickens is a promising technology for the production of therapeutic biologics in eggs. In this study, we constructed a lentiviral vector encoding an expression cassette for human neutrophil defensin 4 (HNP4), a compound that displays high activity against Escherichia coli, and produced transgenic chickens that expressed the recombinant HNP4 protein in egg whites. After the antimicrobial activity of the recombinant HNP4 protein was tested at the cellular level, a 2.8-kb ovalbumin promoter was used to drive HNP4 expression specifically in oviduct tissues. From 669 injected eggs, 218 chickens were successfully hatched. Ten G0 roosters, with semens identified as positive for the transgene, were mated with wild-type hens to generate G1 chickens. From 1,274 total offspring, fifteen G1 transgenic chickens were positive for the transgene, which was confirmed by PCR and Southern blotting. The results of the Southern blotting and genome walking indicated that a single copy of the HNP4 gene was integrated into chromosomes 1, 2, 3, 4, 6 and 24 of the chickens. As expected, HNP4 expression was restricted to the oviduct tissues, and the levels of both transcriptional and translational HNP4 expression varied greatly in transgenic chickens with different transgene insertion sites. The amount of HNP4 protein expressed in the eggs of G1 and G2 heterozygous transgenic chickens ranged from 1.65 μg/ml to 10.18 μg/ml. These results indicated that the production of transgenic chickens that expressed HNP4 protein in egg whites was successful. PMID:26020529

  2. Gene transfer to chicks using lentiviral vectors administered via the embryonic chorioallantoic membrane.

    Directory of Open Access Journals (Sweden)

    Gideon Hen

    Full Text Available The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV, into the chorioallantoic membrane (CAM of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP or recombinant alpha-melanocyte-stimulating hormone (α-MSH genes, driven by the cytomegalovirus (CMV promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP nick end labeling (TUNEL assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA, and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides.

  3. Potent and reversible lentiviral vector restriction in murine induced pluripotent stem cells.

    Science.gov (United States)

    Geis, Franziska K; Galla, Melanie; Hoffmann, Dirk; Kuehle, Johannes; Zychlinski, Daniela; Maetzig, Tobias; Schott, Juliane W; Schwarzer, Adrian; Goffinet, Christine; Goff, Stephen P; Schambach, Axel

    2017-05-31

    Retroviral vectors are derived from wild-type retroviruses, can be used to study retrovirus-host interactions and are effective tools in gene and cell therapy. However, numerous cell types are resistant or less permissive to retrovirus infection due to the presence of active defense mechanisms, or the absence of important cellular host co-factors. In contrast to multipotent stem cells, pluripotent stem cells (PSC) have potential to differentiate into all three germ layers. Much remains to be elucidated in the field of anti-viral immunity in stem cells, especially in PSC. In this study, we report that transduction with HIV-1-based, lentiviral vectors (LV) is impaired in murine PSC. Analyses of early retroviral events in induced pluripotent stem cells (iPSC) revealed that the restriction is independent of envelope choice and does not affect reverse transcription, but perturbs nuclear entry and proviral integration. Proteasomal inhibition by MG132 could not circumvent the restriction. However, prevention of cyclophilin A (CypA) binding to the HIV-1 capsid via use of either a CypA inhibitor (cyclosporine A) or CypA-independent capsid mutants improved transduction. In addition, application of higher vector doses also increased transduction. Our data revealed a CypA mediated restriction in iPSC, which was acquired during reprogramming, associated with pluripotency and relieved upon subsequent differentiation. We showed that murine PSC and iPSC are less susceptible to LV. The block observed in iPSC was CypA-dependent and resulted in reduced nuclear entry of viral DNA and proviral integration. Our study helps to improve transduction of murine pluripotent cells with HIV-1-based vectors and contributes to our understanding of retrovirus-host interactions in PSC.

  4. Measles virus envelope pseudotyped lentiviral vectors transduce quiescent human HSCs at an efficiency without precedent.

    Science.gov (United States)

    Lévy, Camille; Amirache, Fouzia; Girard-Gagnepain, Anais; Frecha, Cecilia; Roman-Rodríguez, Francisco J; Bernadin, Ornellie; Costa, Caroline; Nègre, Didier; Gutierrez-Guerrero, Alejandra; Vranckx, Lenard S; Clerc, Isabelle; Taylor, Naomi; Thielecke, Lars; Cornils, Kerstin; Bueren, Juan A; Rio, Paula; Gijsbers, Rik; Cosset, François-Loïc; Verhoeyen, Els

    2017-10-24

    Hematopoietic stem cell (HSC)-based gene therapy trials are now moving toward the use of lentiviral vectors (LVs) with success. However, one challenge in the field remains: efficient transduction of HSCs without compromising their stem cell potential. Here we showed that measles virus glycoprotein-displaying LVs (hemagglutinin and fusion protein LVs [H/F-LVs]) were capable of transducing 100% of early-acting cytokine-stimulated human CD34 + (hCD34 + ) progenitor cells upon a single application. Strikingly, these H/F-LVs also allowed transduction of up to 70% of nonstimulated quiescent hCD34 + cells, whereas conventional vesicular stomatitis virus G (VSV-G)-LVs reached 5% at the most with H/F-LV entry occurring exclusively through the CD46 complement receptor. Importantly, reconstitution of NOD/SCIDγc -/- (NSG) mice with H/F-LV transduced prestimulated or resting hCD34 + cells confirmed these high transduction levels in all myeloid and lymphoid lineages. Remarkably, for resting CD34 + cells, secondary recipients exhibited increasing transduction levels of up to 100%, emphasizing that H/F-LVs efficiently gene-marked HSCs in the resting state. Because H/F-LVs promoted ex vivo gene modification of minimally manipulated CD34 + progenitors that maintained stemness, we assessed their applicability in Fanconi anemia, a bone marrow (BM) failure with chromosomal fragility. Notably, only H/F-LVs efficiently gene-corrected minimally stimulated hCD34 + cells in unfractionated BM from these patients. These H/F-LVs improved HSC gene delivery in the absence of cytokine stimulation while maintaining their stem cell potential. Thus, H/F-LVs will facilitate future clinical applications requiring HSC gene modification, including BM failure syndromes, for which treatment has been very challenging up to now.

  5. Prior Virus Exposure Alters the Long-Term Landscape of Viral Replication during Feline Lentiviral Infection

    Directory of Open Access Journals (Sweden)

    Sue VandeWoude

    2011-10-01

    Full Text Available We developed a feline model of lentiviral cross-species transmission using a puma lentivirus (PLV or FIVPco which infects domestic cats but does not cause disease. Infection with PLV protects cats from CD4+ T-cell decline caused by subsequent infection with virulent feline immunodeficiency virus (FIV. Previous studies implicate innate immune and/or cellular restriction mechanisms for FIV disease attenuation in PLV-infected cats. In this study, we evaluated viral infection and cytokine mRNA transcription in 12 different tissue reservoirs approximately five months post infection. We quantitated tissue proviral load, viral mRNA load and relative transcription of IL-10, IL-12p40 and IFNγ from tissues of cats exposed to FIV, PLV or both viruses and analyzed these parameters using a multivariate statistical approach. The distribution and intensity of FIV infection and IFNγ transcription differed between single and co-infected cats, characterized by higher FIV proviral loads and IFNγ expression in co-infected cat tissues. Variability in FIV mRNA load and IFNγ was significantly more constrained in co-infected versus singly infected cat tissues. Single-infected:co-infected ratios of FIV mRNA load compared to FIV proviral load indicated that active viral transcription was apparently inhibited during co-infection. These results indicate that previous PLV infection increases activation of tissue innate immunity and constrains the ability of FIV to productively infect tissue reservoirs of infection for months, independent of FIV proviral load, supporting a model in which innate immunity and/or modulation of target cell susceptibility play a key role in PLV-induced protection from FIV disease.

  6. Highly efficient retrograde gene transfer into motor neurons by a lentiviral vector pseudotyped with fusion glycoprotein.

    Directory of Open Access Journals (Sweden)

    Miyabi Hirano

    Full Text Available The development of gene therapy techniques to introduce transgenes that promote neuronal survival and protection provides effective therapeutic approaches for neurological and neurodegenerative diseases. Intramuscular injection of adenoviral and adeno-associated viral vectors, as well as lentiviral vectors pseudotyped with rabies virus glycoprotein (RV-G, permits gene delivery into motor neurons in animal models for motor neuron diseases. Recently, we developed a vector with highly efficient retrograde gene transfer (HiRet by pseudotyping a human immunodeficiency virus type 1 (HIV-1-based vector with fusion glycoprotein B type (FuG-B or a variant of FuG-B (FuG-B2, in which the cytoplasmic domain of RV-G was replaced by the corresponding part of vesicular stomatitis virus glycoprotein (VSV-G. We have also developed another vector showing neuron-specific retrograde gene transfer (NeuRet with fusion glycoprotein C type, in which the short C-terminal segment of the extracellular domain and transmembrane/cytoplasmic domains of RV-G was substituted with the corresponding regions of VSV-G. These two vectors afford the high efficiency of retrograde gene transfer into different neuronal populations in the brain. Here we investigated the efficiency of the HiRet (with FuG-B2 and NeuRet vectors for retrograde gene transfer into motor neurons in the spinal cord and hindbrain in mice after intramuscular injection and compared it with the efficiency of the RV-G pseudotype of the HIV-1-based vector. The main highlight of our results is that the HiRet vector shows the most efficient retrograde gene transfer into both spinal cord and hindbrain motor neurons, offering its promising use as a gene therapeutic approach for the treatment of motor neuron diseases.

  7. Mechanical characterization of glass fiber (woven roving/chopped strand mat E-glass fiber) reinforced polyester composites

    Science.gov (United States)

    Bhaskar, V. Vijaya; Srinivas, Kolla

    2017-07-01

    Polymer reinforced composites have been replacing most of the engineering material and their applications become more and more day by day. Polymer composites have been analyzing from past thirty five years for their betterment for adapting more applications. This paper aims at the mechanical properties of polyester reinforced with glass fiber composites. The glass fiber is reinforced with polyester in two forms viz Woven Rovings (WRG) and Chopped Strand Mat (CSMG) E-glass fibers. The composites are fabricated by hand lay-up technique and the composites are cut as per ASTM Standard sizes for corresponding tests like flexural, compression and impact tests, so that flexural strength, compression strength, impact strength and inter laminar shear stress(ILSS) of polymer matrix composites are analyzed. From the tests and further calculations, the polyester composites reinforced with Chopped Strand Mat glass fiber have shown better performance against flexural load, compression load and impact load than that of Woven Roving glass fiber.

  8. Effect of gamma irradiation on the B vitamins of pork chops and chicken breasts

    International Nuclear Information System (INIS)

    Fox, J.B. Jr.; Thayer, D.W.; Jenkins, R.K.; Phillips, J.G.; Ackerman, S.A.; Beecher, G.R.; Holden, J.M.; Morrow, F.D.; Quirbach, D.M.

    1989-01-01

    A study was made of the effect of low-dose gamma irradiation on the content of thiamine (B 1 ), riboflavin (B 2 ), niacin, pyridoxine (B 6 ) and cobalamin (B 12 ) in pork chops, and thiamine, riboflavin and niacin in chicken breasts. Over the range of dose and temperature studied (0.49-6.65 kGy from -20 to 20 0 C) it was possible to derive a mathematical expression for predicting losses. A calculation was made of the effect of the loss of thiamine, riboflavin and niacin due to irradiation on overall loss of these vitamins in the American diet. Losses of riboflavin and niacin were of the order of a fraction of a per cent. The calculated loss at 1.0kGy of thiamine in cooked pork was only 1.5%. There were initial increases with radiation doses up to 2-4 kGy in measured concentrations of riboflavin and niacin in pork and chicken. Increases were highly significant, and of concern to the study of radiation effects and the chemical method of determination of these vitamins. (author)

  9. ACCELEROMETERS IN FLOW FIELDS: A STRUCTURAL ANALYSIS OF THE CHOPPED DUMMY INPILE TUBE

    Energy Technology Data Exchange (ETDEWEB)

    Howard, T. K.; Marcum, W. R.; Latimer, G. D.; Weiss, A.; Jones, W. F.; Phillips, A. M.; Woolstenhulme, N.; Holdaway, K.; Campbell, J.

    2016-06-01

    Four tests characterizing the structural response of the Chopped-Dummy In-Pile tube (CDIPT) experiment design were measured in the Hydro-Mechanical Fuel Test Facility (HMFTF). Four different test configurations were tried. These configurations tested the pressure drop and flow impact of various plate configurations and flow control orifices to be used later at different reactor power levels. Accelerometers were placed on the test vehicle and flow simulation housing. A total of five accelerometers were used with one on the top and bottom of the flow simulator and vehicle, and one on the outside of the flow simulator. Data were collected at a series of flow rates for 5 seconds each at an acquisition rate of 2 kHz for a Nyquist frequency of 1 kHz. The data were then analyzed using a Fast Fourier Transform (FFT) algorithm. The results show very coherent vibrations of the CDIPT experiment on the order of 50 Hz in frequency and 0.01 m/s2 in magnitude. The coherent vibrations, although small in magnitude pose a potential design problem if the frequencies coincide with the natural frequency of the fueled plates or test vehicle. The accelerometer data was integrated and combined to create a 3D trace of the experiment during the test. The merits of this data as well as further anomalies and artifacts are also discussed as well as their relation to the instrumentation and experiment design.

  10. Chemical decontamination and melt densification of chop-leach fuel hulls

    International Nuclear Information System (INIS)

    Dillon, R.L.; Griggs, B.; Kemper, R.S.; Nelson, R.G.

    1976-01-01

    This paper reports on decontamination and densification studies of chop-leach fuel hull residues designed to minimize the transuranic element (TRU) contaminated waste stream. Decontamination requirements have been established from studies of TRU element distribution in the fuel hull residues. Effective surface decontamination of Zircaloy requires removal of zirconium oxide corrosion products. Good decontamination factors have been achieved with aqueous solutions following high temperature HF conditioning of oxide films. Molten fluoride salt mixtures are effective decontaminants, but pose problems in metal loss and salt dragout. Molten metal decontamination methods are highly preliminary, but may be required to reduce TRU originating from tramp uranium in Zircaloy. Low melting (1300 0 C) alloy of Zircaloy, stainless steel, and Inconel have been prepared in induction heated graphite crucibles. High quality ingots of Zircaloy-2 have been prepared directly from short sections of descaled fuel clad tubing using the Inductoslag process. This material is readily capable of refabrication. Inductoslag melts have also been prepared from heavily oxidized Zircaloy tubing demonstrating melt densification without prior decontamination is technically feasible. Hydrogen absorption kinetics have been demonstrated with cast Zircaloy-2 and cast Zircaloy-stainless steel-Inconel alloys. Metallic fuel hull residues have been proposed as a storage medium for tritium released from fuel during reprocessing. (author)

  11. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  12. The antimicrobial effects of chopped garlic in ground beef and raw meatball (ciğ köfte).

    Science.gov (United States)

    Aydin, Ali; Bostan, Kamil; Erkan, Mehmet Emin; Bingöl, Bariş

    2007-03-01

    This study was carried out to investigate the antimicrobial effects of chopped garlic in ground beef and raw meatball (çig köfte), which is a traditional food product eaten raw. Fresh minced ground beef and raw meatball batter prepared with traditional methods were separated into groups. Chopped and crushed garlic was added to each batch in order to reach various concentrations from 0% to 10%. The ground beef samples were stored at refrigerator and ambient temperatures. The raw meatball samples were only stored at room temperature. All samples were analyzed in order to determine the microbial counts at the 2(nd), 6(th), 12(th), and 24(th) hours of storage. Garlic addition decreased the microbial growth in some ground beef samples kept either at room temperature or in the refrigerator. However, microbial growth increased in some ground beef samples kept in similar conditions. The difference was found in samples kept in the refrigerator for 24 hours in terms of total aerobic mesophilic bacteria and coliform bacteria when garlic used at 10%. The effects of garlic on the microbial growth of both coliforms and Staphylococcus/Micrococcus in the samples kept at room temperature were increased. The yeast and mold counts in ground beef samples kept in any condition were not affected by garlic addition. However, the addition of garlic to the raw meatball mix decreased the microbial count, in terms of total aerobic mesophilic bacteria and yeast and mold counts, when the garlic was added at 5% or 10% (P meatball caused a permanent decrease in yeast and mold count, unlike in ground beef. The results of this study indicate that the chopped garlic has a slowing-down effect on microbiological growth in ground meat depending on the garlic concentration, but this effect was not at an expected level even at the highest concentration, because potential antimicrobial agents in chopped garlic were probably insufficiently extracted.

  13. Time-Dependent Deformation Modelling for a Chopped-Glass Fiber Composite for Automotive Durability Design Criteria; FINAL

    International Nuclear Information System (INIS)

    Ren, W

    2001-01-01

    Time-dependent deformation behavior of a polymeric composite with chopped-glass-fiber reinforcement was investigated for automotive applications, The material under stress was exposed to representative automobile service environments. Results show that environment has substantial effects on time-dependent deformation behavior of the material. The data were analyzed and experimentally-based models developed for the time-dependent deformation behavior as a basis for automotive structural durability design criteria

  14. Time-Dependent Deformation Modelling for a Chopped-Glass Fiber Composite for Automotive Durability Design Criteria

    Energy Technology Data Exchange (ETDEWEB)

    Ren, W

    2001-08-24

    Time-dependent deformation behavior of a polymeric composite with chopped-glass-fiber reinforcement was investigated for automotive applications, The material under stress was exposed to representative automobile service environments. Results show that environment has substantial effects on time-dependent deformation behavior of the material. The data were analyzed and experimentally-based models developed for the time-dependent deformation behavior as a basis for automotive structural durability design criteria.

  15. Investigation on Stress-Rupture Behavior of a Chopped-Glass-Fiber Composite for Automotive Durability Design Criteria

    Energy Technology Data Exchange (ETDEWEB)

    Ren, W

    2001-08-24

    Practical and inexpensive testing methods were developed to investigate stress-rupture properties of a polymeric composite with chopped glass fiber reinforcement for automotive applications. The material was tested in representative automotive environments to generate experimental data. The results indicate that environments have substantial effects on the stress-rupture behavior. The data were analyzed and developed into stress-rupture design criteria to address one of the durability aspects of the material for automotive structural applications.

  16. FUS-CHOP Promotes Invasion in Myxoid Liposarcoma through a SRC/FAK/RHO/ROCK-Dependent Pathway

    Directory of Open Access Journals (Sweden)

    Juan Tornin

    2018-01-01

    Full Text Available Deregulated SRC/FAK signaling leads to enhanced migration and invasion in many types of tumors. In myxoid and round cell liposarcoma (MRCLS, an adipocytic tumor characterized by the expression of the fusion oncogene FUS-CHOP, SRC have been found as one of the most activated kinases. Here we used a cell-of-origin model of MRCLS and an MRCLS cell line to thoroughly characterize the mechanisms of cell invasion induced by FUS-CHOP using in vitro (3D spheroid invasion assays and in vivo (chicken chorioallantoic membrane model approaches. FUS-CHOP expression activated SRC-FAK signaling and increased the invasive ability of MRCLS cells. In addition, FAK expression was found to significantly correlate with tumor aggressiveness in sarcoma patient samples. The involvement of SRC/FAK activation in FUS-CHOP–mediated invasion was further confirmed using the SRC inhibitor dasatinib, the specific FAK inhibitor PF-573228, and FAK siRNA. Notably, dasatinib and PF573228 could also efficiently block the invasion of cancer stem cell subpopulations. Downstream of SRC/FAK signaling, we found that FUS-CHOP expression increases the levels of the RHO/ROCK downstream effector phospho-MLC2 (T18/S19 and that this activation was prevented by dasatinib or PF573228. Moreover, the ROCK inhibitor RKI-1447 was able to completely abolish invasion in FUS-CHOP–expressing cells. These data uncover the involvement of SRC/FAK/RHO/ROCK signaling axis in FUS-CHOP–mediated invasion, thus providing a rationale for testing inhibitors of this pathway as potential novel antimetastatic agents for MRCLS treatment.

  17. Investigation on Stress-Rupture Behavior of a Chopped-Glass-Fiber Composite for Automotive Durability Design Criteria; FINAL

    International Nuclear Information System (INIS)

    Ren, W

    2001-01-01

    Practical and inexpensive testing methods were developed to investigate stress-rupture properties of a polymeric composite with chopped glass fiber reinforcement for automotive applications. The material was tested in representative automotive environments to generate experimental data. The results indicate that environments have substantial effects on the stress-rupture behavior. The data were analyzed and developed into stress-rupture design criteria to address one of the durability aspects of the material for automotive structural applications

  18. Thermo-Mechanical Properties of Unsaturated Polyester Reinforced with SiliconCarbide Powder And with Chopped Glass Fiber

    Directory of Open Access Journals (Sweden)

    Bushra Hosnie Musa

    2018-02-01

    Full Text Available The work studied the effectoffine silicon carbide (SiC powder with (0,3,5,7wt % on the thermal conductivity and mechanical properties of unsaturated polyester composite in the presence of a fixed amount of chopped glass fiber. The hand lay-up technique was employed to preparethe required samples. Results showed that tensile, impact strength and thermal conductivity increased with increasing the weight fraction of reinforced materials.

  19. [Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

    Science.gov (United States)

    Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

    2013-04-01

    This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

  20. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P

    2006-03-01

    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  1. Lentiviral-mediated transfer of CDNF promotes nerve regeneration and functional recovery after sciatic nerve injury in adult rats

    International Nuclear Information System (INIS)

    Cheng, Lei; Liu, Yi; Zhao, Hua; Zhang, Wen; Guo, Ying-Jun; Nie, Lin

    2013-01-01

    Highlights: •CDNF was successfully transfected by a lentiviral vector into the distal sciatic nerve. •CDNF improved S-100, NF200 expression and nerve regeneration after sciatic injury. •CDNF improved the remyelination and thickness of the regenerated sciatic nerve. •CDNF improved gastrocnemius muscle weight and sciatic functional recovery. -- Abstract: Peripheral nerve injury is often followed by incomplete and unsatisfactory functional recovery and may be associated with sensory and motor impairment of the affected limb. Therefore, a novel method is needed to improve the speed of recovery and the final functional outcome after peripheral nerve injuries. This report investigates the effect of lentiviral-mediated transfer of conserved dopamine neurotrophic factor (CDNF) on regeneration of the rat peripheral nerve in a transection model in vivo. We observed notable overexpression of CDNF protein in the distal sciatic nerve after recombinant CDNF lentiviral vector application. We evaluated sciatic nerve regeneration after surgery using light and electron microscopy and the functional recovery using the sciatic functional index and target muscle weight. HE staining revealed better ordered structured in the CDNF-treated group at 8 weeks post-surgery. Quantitative analysis of immunohistochemistry of NF200 and S-100 in the CDNF group revealed significant improvement of axonal and Schwann cell regeneration compared with the control groups at 4 weeks and 8 weeks after injury. The thickness of the myelination around the axons in the CDNF group was significantly higher than in the control groups at 8 weeks post-surgery. The CDNF group displayed higher muscle weights and significantly increased sciatic nerve index values. Our findings suggest that CDNF gene therapy could provide durable and stable CDNF protein concentration and has the potential to enhance peripheral nerve regeneration, morphological and functional recovery following nerve injury, which suggests a

  2. Lentiviral-mediated transfer of CDNF promotes nerve regeneration and functional recovery after sciatic nerve injury in adult rats

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Lei; Liu, Yi; Zhao, Hua; Zhang, Wen; Guo, Ying-Jun; Nie, Lin, E-mail: chengleiyx@126.com

    2013-10-18

    Highlights: •CDNF was successfully transfected by a lentiviral vector into the distal sciatic nerve. •CDNF improved S-100, NF200 expression and nerve regeneration after sciatic injury. •CDNF improved the remyelination and thickness of the regenerated sciatic nerve. •CDNF improved gastrocnemius muscle weight and sciatic functional recovery. -- Abstract: Peripheral nerve injury is often followed by incomplete and unsatisfactory functional recovery and may be associated with sensory and motor impairment of the affected limb. Therefore, a novel method is needed to improve the speed of recovery and the final functional outcome after peripheral nerve injuries. This report investigates the effect of lentiviral-mediated transfer of conserved dopamine neurotrophic factor (CDNF) on regeneration of the rat peripheral nerve in a transection model in vivo. We observed notable overexpression of CDNF protein in the distal sciatic nerve after recombinant CDNF lentiviral vector application. We evaluated sciatic nerve regeneration after surgery using light and electron microscopy and the functional recovery using the sciatic functional index and target muscle weight. HE staining revealed better ordered structured in the CDNF-treated group at 8 weeks post-surgery. Quantitative analysis of immunohistochemistry of NF200 and S-100 in the CDNF group revealed significant improvement of axonal and Schwann cell regeneration compared with the control groups at 4 weeks and 8 weeks after injury. The thickness of the myelination around the axons in the CDNF group was significantly higher than in the control groups at 8 weeks post-surgery. The CDNF group displayed higher muscle weights and significantly increased sciatic nerve index values. Our findings suggest that CDNF gene therapy could provide durable and stable CDNF protein concentration and has the potential to enhance peripheral nerve regeneration, morphological and functional recovery following nerve injury, which suggests a

  3. Efficient and sustained IGF-1 expression in the adipose tissue-derived stem cells mediated via a lentiviral vector.

    Science.gov (United States)

    Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao

    2015-02-01

    The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.

  4. Efficacy on chopping with lens loop-pad in the small incision extracapsular cataract surgery with intraocular lens implantation

    Directory of Open Access Journals (Sweden)

    Xiao-Ning Peng

    2014-04-01

    Full Text Available AIM: To study the clinical effects of chopping with lens loop-pad in the small incision extracapsular cataract surgery with intraocular lens implantation.METHODS:A total of 75 cases(80 eyes, in which loop-pad and chop knife were performed to chop nucleus before implanting intraocular lens. Visual acuity, postoperative astigmatism degree, intraoperative and postoperative complications were observed. The post-operative follow-up periods ranged from 3 to 12mo.RESULTS: The visual acuity was 0.3-0.5 in 37 eyes and 0.6 or better in 21 eyes at 1d, while was respectively in 43 eyes and in 26 eyes at 1mo. Compared with preoperative astigmatism(0.85±0.29D, there were significant difference at postoperative 1wk(1.75±0.55D(PP>0.05. Intraoperative posterior capsule rupture occurred in 4 eyes, which implantation was successful in 1 eye and 3 eyes was managed viaciliary sulcus. Two eyes had dermatoglyphic pattern edema in corneal endothelium which recovered after about 3d. Two eyes had local patchy opacities which recovered in 2wk. Two eyes had transient high intraocular pressure.CONCLUSION: The surgery is efficient, low cost, easy process and less complications, it is worth to be popularized.

  5. Additional Survival Benefit of Involved-Lesion Radiation Therapy After R-CHOP Chemotherapy in Limited Stage Diffuse Large B-Cell Lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Jeanny [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Il Han, E-mail: ihkim@snu.ac.kr [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Cancer Research Institute, Seoul National University College of Medicine, Seoul (Korea, Republic of); Institute of Radiation Medicine, Medical Research Center, Seoul National University, Seoul (Korea, Republic of); Kim, Byoung Hyuck [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Tae Min; Heo, Dae Seog [Department of Internal Medicine, Seoul National University Hospital, Seoul (Korea, Republic of)

    2015-05-01

    Purpose: The purpose of this study was to evaluate the role of involved-lesion radiation therapy (ILRT) after rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy in limited stage diffuse large B-cell lymphoma (DLBCL) by comparing outcomes of R-CHOP therapy alone with R-CHOP followed by ILRT. Methods and Materials: We identified 198 patients treated with R-CHOP (median, 6 cycles) for pathologically confirmed DLBCL of limited stage from July 2004 to December 2012. Clinical characteristics of these patients were 33% with stage I and 66.7% with stage II; 79.8% were in the low or low-intermediate risk group; 13.6% had B symptoms; 29.8% had bulky tumors (≥7 cm); and 75.3% underwent ≥6 cycles of R-CHOP therapy. RT was given to 43 patients (21.7%) using ILRT technique, which included the prechemotherapy tumor volume with a median margin of 2 cm (median RT dose: 36 Gy). Results: After a median follow-up of 40 months, 3-year progression-free survival (PFS) and overall survival (OS) were 85.8% and 88.9%, respectively. Multivariate analysis showed ≥6 cycles of R-CHOP (PFS, P=.004; OS, P=.004) and ILRT (PFS, P=.021; OS, P=.014) were favorable prognosticators of PFS and OS. A bulky tumor (P=.027) and response to R-CHOP (P=.012) were also found to be independent factors of OS. In subgroup analysis, the effect of ILRT was prominent in patients with a bulky tumor (PFS, P=.014; OS, P=.030) or an elevated level of serum lactate dehydrogenase (LDH; PFS, P=.004; OS, P=.012). Conclusions: Our results suggest that ILRT after R-CHOP therapy improves PFS and OS in patients with limited stage DLBCL, especially in those with bulky disease or an elevated serum LDH level.

  6. Additional survival benefit of involved-lesion radiation therapy after R-CHOP chemotherapy in limited stage diffuse large B-cell lymphoma.

    Science.gov (United States)

    Kwon, Jeanny; Kim, Il Han; Kim, Byoung Hyuck; Kim, Tae Min; Heo, Dae Seog

    2015-05-01

    The purpose of this study was to evaluate the role of involved-lesion radiation therapy (ILRT) after rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) chemotherapy in limited stage diffuse large B-cell lymphoma (DLBCL) by comparing outcomes of R-CHOP therapy alone with R-CHOP followed by ILRT. We identified 198 patients treated with R-CHOP (median, 6 cycles) for pathologically confirmed DLBCL of limited stage from July 2004 to December 2012. Clinical characteristics of these patients were 33% with stage I and 66.7% with stage II; 79.8% were in the low or low-intermediate risk group; 13.6% had B symptoms; 29.8% had bulky tumors (≥ 7 cm); and 75.3% underwent ≥ 6 cycles of R-CHOP therapy. RT was given to 43 patients (21.7%) using ILRT technique, which included the prechemotherapy tumor volume with a median margin of 2 cm (median RT dose: 36 Gy). After a median follow-up of 40 months, 3-year progression-free survival (PFS) and overall survival (OS) were 85.8% and 88.9%, respectively. Multivariate analysis showed ≥ 6 cycles of R-CHOP (PFS, P=.004; OS, P=.004) and ILRT (PFS, P=.021; OS, P=.014) were favorable prognosticators of PFS and OS. A bulky tumor (P=.027) and response to R-CHOP (P=.012) were also found to be independent factors of OS. In subgroup analysis, the effect of ILRT was prominent in patients with a bulky tumor (PFS, P=.014; OS, P=.030) or an elevated level of serum lactate dehydrogenase (LDH; PFS, P=.004; OS, P=.012). Our results suggest that ILRT after R-CHOP therapy improves PFS and OS in patients with limited stage DLBCL, especially in those with bulky disease or an elevated serum LDH level. Copyright © 2015. Published by Elsevier Inc.

  7. Effect of the type of frying culinary fat on volatile compounds isolated in fried pork loin chops by using SPME-GC-MS.

    Science.gov (United States)

    Ramírez, María Rosario; Estévez, Mario; Morcuende, David; Cava, Ramón

    2004-12-15

    The effect of the type of frying culinary fat (olive oil, sunflower oil, butter, and pig lard) on volatile compounds isolated from fried pork loin chops (m. Longissimus dorsi) was measured by SPME-GC-MS. Frying modified the fatty acid composition of lipids from pork loin chops, which tended to be similar to that of the culinary fat used to fry. Volatile compounds formed from the oxidation of fatty acids increased, such as aldehydes, ketones, alcohols, and hydrocarbons. Besides, each culinary fat used modified the volatile profiles in fried meat differently. Sunflower oil-fried pork loin chops presented the highest aldehyde aliphatic content, probably due to their highest content of polyunsaturated acids. Hexanal, the most abundant aldehyde in fried samples, presented the most elevated content in sunflower oil-fried pork loin chops. In addition, these samples presented more heterocyclic compounds from the Maillard reaction than other fried samples. Volatiles detected in olive oil-fried pork loin chops were mainly lipid-derived compounds such as pentan-1-ol, hexanal, hept-2-enal, nonanal, decanal, benzaldehyde, and nonan-2-one. Butter-fried pork loins were abundant in ketones with a high number of carbons (heptan-2-one, nonan-2-one, undecan-2-one, tridecanone, and heptadecan-2-one). Pig lard-fried pork loin chops presented some Strecker aldehydes isolated in only these samples, such as 2-methylbutanal and 3-(methylthio)propanal, and a sulfur compound (dimethyl disulfide) related to Strecker aldehydes.

  8. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  9. Natural host genetic resistance to lentiviral CNS disease: a neuroprotective MHC class I allele in SIV-infected macaques.

    Directory of Open Access Journals (Sweden)

    Joseph L Mankowski

    Full Text Available Human immunodeficiency virus (HIV infection frequently causes neurologic disease even with anti-retroviral treatment. Although associations between MHC class I alleles and acquired immunodeficiency syndrome (AIDS have been reported, the role MHC class I alleles play in restricting development of HIV-induced organ-specific diseases, including neurologic disease, has not been characterized. This study examined the relationship between expression of the MHC class I allele Mane-A*10 and development of lentiviral-induced central nervous system (CNS disease using a well-characterized simian immunodeficiency (SIV/pigtailed macaque model. The risk of developing CNS disease (SIV encephalitis was 2.5 times higher for animals that did not express the MHC class I allele Mane-A*10 (P = 0.002; RR = 2.5. Animals expressing the Mane-A*10 allele had significantly lower amounts of activated macrophages, SIV RNA, and neuronal dysfunction in the CNS than Mane-A*10 negative animals (P<0.001. Mane-A*10 positive animals with the highest CNS viral burdens contained SIV gag escape mutants at the Mane-A*10-restricted KP9 epitope in the CNS whereas wild type KP9 sequences dominated in the brain of Mane-A*10 negative animals with comparable CNS viral burdens. These concordant findings demonstrate that particular MHC class I alleles play major neuroprotective roles in lentiviral-induced CNS disease.

  10. Scalable Electrophysiological Investigation of iPS Cell-Derived Cardiomyocytes Obtained by a Lentiviral Purification Strategy

    Directory of Open Access Journals (Sweden)

    Stephanie Friedrichs

    2015-01-01

    Full Text Available Disease-specific induced pluripotent stem (iPS cells can be generated from patients and differentiated into functional cardiomyocytes for characterization of the disease and for drug screening. In order to obtain pure cardiomyocytes for automated electrophysiological investigation, we here report a novel non-clonal purification strategy by using lentiviral gene transfer of a puromycin resistance gene under the control of a cardiac-specific promoter. We have applied this method to our previous reported wild-type and long QT syndrome 3 (LQTS 3-specific mouse iPS cells and obtained a pure cardiomyocyte population. These cells were investigated by action potential analysis with manual and automatic planar patch clamp technologies, as well as by recording extracellular field potentials using a microelectrode array system. Action potentials and field potentials showed the characteristic prolongation at low heart rates in LQTS 3-specific, but not in wild-type iPS cell-derived cardiomyocytes. Hence, LQTS 3-specific cardiomyocytes can be purified from iPS cells with a lentiviral strategy, maintain the hallmarks of the LQTS 3 disease and can be used for automated electrophysiological characterization and drug screening.

  11. Phenotypic correction of von Willebrand disease type 3 blood-derived endothelial cells with lentiviral vectors expressing von Willebrand factor

    Science.gov (United States)

    De Meyer, Simon F.; Vanhoorelbeke, Karen; Chuah, Marinee K.; Pareyn, Inge; Gillijns, Veerle; Hebbel, Robert P.; Collen, Désiré; Deckmyn, Hans; VandenDriessche, Thierry

    2006-01-01

    Von Willebrand disease (VWD) is an inherited bleeding disorder, caused by quantitative (type 1 and 3) or qualitative (type 2) defects in von Willebrand factor (VWF). Gene therapy is an appealing strategy for treatment of VWD because it is caused by a single gene defect and because VWF is secreted into the circulation, obviating the need for targeting specific organs or tissues. However, development of gene therapy for VWD has been hampered by the considerable length of the VWF cDNA (8.4 kb [kilobase]) and the inherent complexity of the VWF protein that requires extensive posttranslational processing. In this study, a gene-based approach for VWD was developed using lentiviral transduction of blood-outgrowth endothelial cells (BOECs) to express functional VWF. A lentiviral vector encoding complete human VWF was used to transduce BOECs isolated from type 3 VWD dogs resulting in high-transduction efficiencies (95.6% ± 2.2%). Transduced VWD BOECs efficiently expressed functional vector-encoded VWF (4.6 ± 0.4 U/24 hour per 106 cells), with normal binding to GPIbα and collagen and synthesis of a broad range of multimers resulting in phenotypic correction of these cells. These results indicate for the first time that gene therapy of type 3 VWD is feasible and that BOECs are attractive target cells for this purpose. PMID:16478886

  12. Lentiviral gene transfer regenerates hematopoietic stem cells in a mouse model for Mpl-deficient aplastic anemia.

    Science.gov (United States)

    Heckl, Dirk; Wicke, Daniel C; Brugman, Martijn H; Meyer, Johann; Schambach, Axel; Büsche, Guntram; Ballmaier, Matthias; Baum, Christopher; Modlich, Ute

    2011-04-07

    Thpo/Mpl signaling plays an important role in the maintenance of hematopoietic stem cells (HSCs) in addition to its role in megakaryopoiesis. Patients with inactivating mutations in Mpl develop thrombocytopenia and aplastic anemia because of progressive loss of HSCs. Yet, it is unknown whether this loss of HSCs is an irreversible process. In this study, we used the Mpl knockout (Mpl(-/-)) mouse model and expressed Mpl from newly developed lentiviral vectors specifically in the physiologic Mpl target populations, namely, HSCs and megakaryocytes. After validating lineage-specific expression in vivo using lentiviral eGFP reporter vectors, we performed bone marrow transplantation of transduced Mpl(-/-) bone marrow cells into Mpl(-/-) mice. We show that restoration of Mpl expression from transcriptionally targeted vectors prevents lethal adverse reactions of ectopic Mpl expression, replenishes the HSC pool, restores stem cell properties, and corrects platelet production. In some mice, megakaryocyte counts were atypically high, accompanied by bone neo-formation and marrow fibrosis. Gene-corrected Mpl(-/-) cells had increased long-term repopulating potential, with a marked increase in lineage(-)Sca1(+)cKit(+) cells and early progenitor populations in reconstituted mice. Transcriptome analysis of lineage(-)Sca1(+)cKit(+) cells in Mpl-corrected mice showed functional adjustment of genes involved in HSC self-renewal.

  13. Design and development of a chopping and deflecting system for the high current injector at IUAC

    Science.gov (United States)

    Kedia, Sanjay Kumar; Mehta, R.

    2018-05-01

    The Low Energy Beam Transport (LEBT) section of the High Current Injector (HCI) incorporates a Chopping cum Deflecting System (CDS). The CDS comprises of a deflecting system and a pair of slits that will remove dark current and produce time bunched beam of 60 ns at different repetition rates of 4, 2, 1, 0.5, 0.25 and 0.125 MHz. The distinguishing feature of the design is the use of a multi-plate deflecting structure with low capacitance to optimize the electric field, which in turn results in higher efficiency in terms of achievable ion current. To maximize the effective electric field and its uniformity, the gap between the deflecting plates has been varied and a semi-circular contour has been incorporated on the deflecting plates. Due to this the electric field variation is less than ±0.5% within the plate length. The length of deflecting plates was chosen to maximize the transmission efficiency. Since the velocity of the charged particles in the LEBT section is constant, therefore the separation between two successive sets of deflecting plates has been kept constant to match the ions transient time within the gap which is nearly 32 ns. A square pulse has been chosen, instead of a sinusoidal one, to increase the transmission efficiency and to decrease the tailing effect. The loaded capacitance of the structure was kept 90% transmission efficiency with in the bunch length. Various simulation codes like Solid Works, TRACE 3D, CST MWS and homebrew Python codes were used to validate the design.

  14. Utilization of gum tragacanth as bind enhancing agent in extended restructured mutton chops.

    Science.gov (United States)

    Sharma, Heena; Sharma, B D; Talukder, S; Ramasamy, Giriprasad

    2015-03-01

    Use of extenders in meat products is not only health promoting but can also increase the economic worth of the products. Extension of the meat product is generally associated with poor binding and texture. Thus, the present study was envisaged to solve this problem by the incorporation of gum tragacanth (GT) as bind enhancing agent, used at three different levels viz., 0.1, 0.15 and 0.2 % in a pre standardized formulation of extended restructured mutton chops (ERMC), by replacing the lean meat. The products were subjected to analysis for physico-chemical, sensory and textural properties. There was no significant difference (P > 0.05) in any of the physicochemical property parameters of product incorporated with different levels of GT except fat percent and shear force value. Mean scores for binding, texture and overall acceptability of ERMC incorporated with 0.1 % GT recorded significantly higher value (P < 0.05) than control and other treatment products. On the basis of sensory scores and physico-chemical properties, the optimum incorporation level of GT was adjudged as 0.1 %. Hardness and adhesiveness values were significantly higher (P < 0.05) in product with 0.1 % GT level. The product with optimum level of GT was also assessed for water activity (aw) and microbiological characteristics. It was found that treatment as well as control products were quite acceptable up to 15th day of storage period without any marked differences in sensory quality.

  15. Comparison of gemcitabin, cisplatin, and dexamethasone (GDP), CHOP, and CHOPE in the first-line treatment of peripheral T-cell lymphomas.

    Science.gov (United States)

    Jia, Bo; Hu, Shaoxuan; Yang, Jianliang; Zhou, Shengyu; Liu, Peng; Qin, Yan; Gui, Lin; Yang, Sheng; Lin, Hua; Zhang, Changgong; Xing, Puyuan; Wang, Lin; Dong, Mei; Zhou, Liqiang; Sun, Yan; He, Xiaohui; Shi, Yuankai

    2016-10-01

    Optimal chemotherapy regimen for peripheral T-cell lymphomas (PTCL) has not been fully defined. This study aimed to evaluate the optimal chemotherapy regimen in the first-line treatment for PTCL patients. Between 2003 and 2014, 93 consecutive patients with PTCL were enrolled in this study. Of 93 patients, 42 patients received CHOPE, 40 patients with CHOP, and 11 patients with GDP regimen. Response could be evaluated in 88 of 93 patients at the end of primary treatment. The CR rate for patients received CHOP (n = 38), CHOPE (n = 39), and GDP (n = 11) were 28.9, 51.3, and 45.5%, respectively, (P = 0.132) with an ORR of 65.8, 76.9, and 90.9%, respectively, (P = 0.210). The median follow-up time was 17.1 (1.4-108.3) months. Median progression-free survival (PFS) in CHOP (n = 40), CHOPE (n = 42), and GDP (n = 11) groups were 6.0, 15.3, and 9.7 months (P = 0.094) with 1-year PFS of 35.0, 54.8, and 45.5%, respectively, (P = 0.078). One-year OS for patients received CHOP (n = 40), CHOPE (n = 42), and GDP (n = 11) were 65.0, 83.3, and 100%, respectively, (P = 0.013) (CHOP vs CHOPE, P = 0.030; CHOP vs GDP, P = 0.024; CHOPE vs GDP, P = 0.174). CHOPE has a trend to improve CR rate, 1-year PFS and OS compared with CHOP alone. GDP shows promising efficacy which worth further exploration in large cohort studies. Clinical experience presented in this study may serve as reference for future large cohort studies.

  16. Lentiviral-Mediated Gene Therapy in Fanconi Anemia-A Mice Reveals Long-Term Engraftment and Continuous Turnover of Corrected HSCs.

    Science.gov (United States)

    Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred

    2015-01-01

    Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.

  17. Cost-benefit analysis of prophylactic granulocyte colony-stimulating factor during CHOP antineoplastic therapy for non-Hodgkin's lymphoma.

    Science.gov (United States)

    Dranitsaris, G; Altmayer, C; Quirt, I

    1997-06-01

    Several randomised comparative trials have shown that granulocyte colony-stimulating factor (G-CSF) reduces the duration of neutropenia, hospitalisation and intravenous antibacterial use in patients with cancer who are receiving high-dosage antineoplastic therapy. However, one area that has received less attention is the role of G-CSF in standard-dosage antineoplastic regimens. One such treatment that is considered to have a low potential for inducing fever and neutropenia is the CHOP regimen (cyclophosphamide, doxorubicin, vincristine and prednisone) for non-Hodgkin's lymphoma. We conducted a cost-benefit analysis from a societal perspective in order to estimate the net cost or benefit of prophylactic G-CSF in this patient population. This included direct costs for hospitalisation with antibacterial support, as well as indirect societal costs, such as time off work and antineoplastic therapy delays secondary to neutropenia. The findings were then tested by a comprehensive sensitivity analysis. The administration of G-CSF at a dosage of 5 micrograms/kg/day for 11 doses following CHOP resulted in an overall net cost of $Can1257. In the sensitivity analysis, lowering the G-CSF dosage to 2 micrograms/kg/day generated a net benefit of $Can6564, indicating a situation that was cost saving to society. The results of the current study suggest that the use of G-CSF in patients receiving CHOP antineoplastic therapy produces a situation that is close to achieving cost neutrality. However, low-dosage (2 micrograms/kg/day) G-CSF is an economically attractive treatment strategy because it may result in overall savings to society.

  18. Magnolol protects neurons against ischemia injury via the downregulation of p38/MAPK, CHOP and nitrotyrosine

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jiann-Hwa [Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); School of Medicine, Fu-Jen Catholic University, Taipei, Taiwan (China); Department of Emergency Medicine, Cathay General Hospital, Taipei, Taiwan (China); Kuo, Hsing-Chun [Institute of Nursing and Department of Nursing, Chang Gung University of Science and Technology, Taiwan (China); Chronic Diseases and Health Promotion Research Center, CGUST, Taiwan (China); Research Center for Industry of Human Ecology, Chang Gung University of Science and Technology, Taoyuan, Taiwan (China); Lee, Kam-Fai [Department of Pathology, Chang Gung Memorial Hospital at Chiayi, Taiwan (China); Tsai, Tung-Hu, E-mail: thtsai@ym.edu.tw [Institute of Traditional Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Graduate Institute of Acupuncture Science, China Medical University, Taichung, Taiwan (China); Department of Education and Research, Taipei City Hospital, Taipei, Taiwan (China)

    2014-09-15

    Magnolol is isolated from the herb Magnolia officinalis, which has been demonstrated to exert pharmacological effects. Our aim was to investigate whether magnolol is able to act as an anti-inflammatory agent that brings about neuroprotection using a global ischemic stroke model and to determine the mechanisms involved. Rats were treated with and without magnolol after ischemia reperfusion brain injury by occlusion of the two common carotid arteries. The inflammatory cytokine production in serum and the volume of infarction in the brain were measured. The proteins present in the brains obtained from the stroke animal model (SAM) and control animal groups with and without magnolol treatment were compared. Magnolol reduces the total infarcted volume by 15% and 30% at dosages of 10 and 30 mg/kg, respectively, compared to the untreated SAM group. The levels of acute inflammatory cytokines, including interleukin-1 beta, tumor necrosis factor alpha, and interleukin-6 were attenuated by magnolol. Magnolol was also able to suppress the production of nitrotyrosine, 4-hydroxy-2-nonenal (4-HNE), inducible NO synthase (iNOS), various phosphorylated p38 mitogen-activated protein kinases and various C/EBP homologues. Furthermore, this modulation of ischemia injury factors in the SAM model group treated with magnolol seems to result from a suppression of reactive oxygen species production and the upregulation of p-Akt and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings confirm the anti-oxidative properties of magnolol, including the inhibition of ischemic injury to neurons; this protective effect seems to involve changes in the in vivo activity of Akt, GSK3β and NF-κB. - Graphical abstract: Schematic presentation of the signaling pathways involved in magnolol inhibited transient global ischemia brain apoptosis and inflammation in rats. The effect of magnolol on the scavenger of ROS, which inhibits p38 MAPK and CHOP protein inactivation

  19. Efficacy of Flaxseed Flour as Bind Enhancing Agent on the Quality of Extended Restructured Mutton Chops

    Directory of Open Access Journals (Sweden)

    Heena Sharma

    2014-02-01

    Full Text Available Consumers have become very conscious about their nutrition and well being due to changes in their socio-economic lifestyle and rapid urbanization. Therefore, development of technology for production of low cost and functional meat products is urgently required. One such approach is innovative restructuring technology in which binding of meat pieces still remains the main challenge and extension of product is generally associated with poor binding and texture. Thus, the present study was envisaged as an attempt to solve this problem by the incorporation of flaxseed flour (FF as bind enhancing agent. The FF was used at three different levels viz., 0.5%, 1%, and 1.5% to replace lean meat in pre-standardized restructured mutton chops formulation. The products were subjected to analysis for physico-chemical, sensory and textural properties. Cooking yield, moisture percentage and fat percentage increased with increase in the level of incorporation of FF, however, protein percent and pH decreased with increase in the level of incorporation. Shear force value of product incorporated with 1.5% FF was significantly higher (p<0.01 than control and product containing 0.5% FF level. Among the sensory attributes, product with 1% flaxseed flour showed significantly higher values (p<0.05 for general appearance, binding, texture and overall acceptability. Hardness showed significant increasing (p<0.01 values with increasing levels of incorporation of flaxseed flour, however all other parameters of texture profile analysis showed a decreasing trend. On the basis of sensory scores and physico-chemical properties, the optimum incorporation level of FF was adjudged as 1%. Products incorporated with optimum level of flaxseed flour (1% were also assessed for water activity and microbiological quality during the storage period of 15 days. It was found that the extended restructured product could be safely stored under refrigeration (4°C±1°C in low density

  20. Magnolol protects neurons against ischemia injury via the downregulation of p38/MAPK, CHOP and nitrotyrosine

    International Nuclear Information System (INIS)

    Chen, Jiann-Hwa; Kuo, Hsing-Chun; Lee, Kam-Fai; Tsai, Tung-Hu

    2014-01-01

    Magnolol is isolated from the herb Magnolia officinalis, which has been demonstrated to exert pharmacological effects. Our aim was to investigate whether magnolol is able to act as an anti-inflammatory agent that brings about neuroprotection using a global ischemic stroke model and to determine the mechanisms involved. Rats were treated with and without magnolol after ischemia reperfusion brain injury by occlusion of the two common carotid arteries. The inflammatory cytokine production in serum and the volume of infarction in the brain were measured. The proteins present in the brains obtained from the stroke animal model (SAM) and control animal groups with and without magnolol treatment were compared. Magnolol reduces the total infarcted volume by 15% and 30% at dosages of 10 and 30 mg/kg, respectively, compared to the untreated SAM group. The levels of acute inflammatory cytokines, including interleukin-1 beta, tumor necrosis factor alpha, and interleukin-6 were attenuated by magnolol. Magnolol was also able to suppress the production of nitrotyrosine, 4-hydroxy-2-nonenal (4-HNE), inducible NO synthase (iNOS), various phosphorylated p38 mitogen-activated protein kinases and various C/EBP homologues. Furthermore, this modulation of ischemia injury factors in the SAM model group treated with magnolol seems to result from a suppression of reactive oxygen species production and the upregulation of p-Akt and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB). These findings confirm the anti-oxidative properties of magnolol, including the inhibition of ischemic injury to neurons; this protective effect seems to involve changes in the in vivo activity of Akt, GSK3β and NF-κB. - Graphical abstract: Schematic presentation of the signaling pathways involved in magnolol inhibited transient global ischemia brain apoptosis and inflammation in rats. The effect of magnolol on the scavenger of ROS, which inhibits p38 MAPK and CHOP protein inactivation

  1. Construction of a CD147 Lentiviral Expression Vector and Establishment of Its Stably Transfected A549 Cell Line

    Directory of Open Access Journals (Sweden)

    Shaoxing YANG

    2012-12-01

    Full Text Available Background and objective CD147, a type of transmembrane glycoprotein embedded on the surface of tumor cells, can promote tumor invasion and metastasis. This aim of this study is to construct a CD147 lentiviral expression vector, establish its stably transfected A549 cell line, and observe the effect of CD147 on MMP-9 proliferation as well as on the invasive ability of human lung adenocarcinoma cells. Methods Full-length CD147 gene was amplified by real-time polymerase chain reaction (RT-PCR, inserted into a pEGFP vector to construct pEGFP-CD147 and pEGFP vectors, and then transfected into 293FT cells to precede the lentivirus equipment package. Subsequently, we collected the lentivirus venom to infect the A549 cells and establish a stable, overexpressed cell line named A549-CD147. The mRNA expression of MMP-9 was examined by RT-PCR. The proliferation and invasive ability of the human lung cancer cells before and after transfection were examined by the CCK-8 and Transwell methods. Results A CD147 lentiviral expression vector (pEGFP-CD147 was successfully constructed by restrictive enzyme digestion and plasmid sequencing. RT-PCR and Western blot analyses revealed increased mRNA and protein expression of CD147 gene in cells transfected with pEGFP-CD147 compared with the control groups. Therefore, the A549-CD147 cell line was successfully established through the experiment. The mRNA expression of MMP-9 also significantly increased after the upregulation of CD147 expression. Meanwhile, CCK-8 and Transwell assays indicated that the proliferation and invasive ability significantly increased in the A549-CD147 cells. Conclusion A lentiviral CD147 expression vector and its A549 cell line (A549-CD14 were successfully constructed. CD147 overexpression upregulated the protein expression of MMP-9, and strengthened the proliferation and invasive ability of human lung adenocarcinoma cells.

  2. PROPERTIES OF NR AND NR/ENR BASED RUBBER COMPOUNDS REINFORCED WITH CHOPPED AND SIZED CARBON FIBER

    Directory of Open Access Journals (Sweden)

    Bağdagül Karaağaç

    2016-12-01

    Full Text Available High elasticity, mechanical resistance and antivibration characteristics of natural rubber (NR are essential issue in the main area of vehicle tyres and high modulus demanding bearing applications. In this study, especially in bearing applications, where natural rubber modulus properties are limited, natural rubber has been reinforced with chopped and hydrocarbon sized carbon fiber to get improved tensile modulus. Besides, epoxidized natural rubber (ENR, which was produced by chemical modification of natural rubber, blended with NR and the compounds have been reinforced with epoxy sized carbon fiber. NR and NR/ENR based rubber compounds’ rheological, mechanical, and aging properties have been systematically investigated and evaluated.

  3. Electron-beam induced current characterization of back-surface field solar cells using a chopped scanning electron microscope beam

    Science.gov (United States)

    Luke, K. L.; Cheng, L.-J.

    1984-01-01

    A chopped electron beam induced current (EBIC) technique for the chacterization of back-surface field (BSF) solar cells is presented. It is shown that the effective recombination velocity of the low-high junction forming the back-surface field of BSF cells, in addition to the diffusion length and the surface recombination velocity of the surface perpendicular to both the p-n and low-high junctions, can be determined from the data provided by a single EBIC scan. The method for doing so is described and illustrated. Certain experimental considerations taken to enhance the quality of the EBIC data are also discussed.

  4. Fludarabine-based versus CHOP-like regimens with or without rituximab in patients with previously untreated indolent lymphoma: a retrospective analysis of safety and efficacy

    Directory of Open Access Journals (Sweden)

    Xu XX

    2013-10-01

    Full Text Available Xiao-xiao Xu,1 Bei Yan,2 Zhen-xing Wang,3 Yong Yu,1 Xiao-xiong Wu,2 Yi-zhuo Zhang11Department of Hematology, Tianjin Medical University Cancer Institute and Hospital, Tianjin Key Laboratory of Cancer Prevention and Therapy, Tianjin, 2Department of Hematology, First Affiliated Hospital of Chinese People's Liberation Army General Hospital, Beijing, 3Department of Stomach Oncology, TianJin Medical University Cancer Institute and Hospital, Key Laboratory of Cancer Prevention and Therapy, Tianjin, People's Republic of ChinaAbstract: Fludarabine-based regimens and CHOP (doxorubicin, cyclophosphamide, vincristine, prednisone-like regimens with or without rituximab are the most common treatment modalities for indolent lymphoma. However, there is no clear evidence to date about which chemotherapy regimen should be the proper initial treatment of indolent lymphoma. More recently, the use of fludarabine has raised concerns due to its high number of toxicities, especially hematological toxicity and infectious complications. The present study aimed to retrospectively evaluate both the efficacy and the potential toxicities of the two main regimens (fludarabine-based and CHOP-like regimens in patients with previously untreated indolent lymphoma. Among a total of 107 patients assessed, 54 patients received fludarabine-based regimens (FLU arm and 53 received CHOP or CHOPE (doxorubicin, cyclophosphamide, vincristine, prednisone, or plus etoposide regimens (CHOP arm. The results demonstrated that fludarabine-based regimens could induce significantly improved progression-free survival (PFS compared with CHOP-like regimens. However, the FLU arm showed overall survival, complete response, and overall response rates similar to those of the CHOP arm. Grade 3–4 neutropenia occurred in 42.6% of the FLU arm and 7.5% of the CHOP arm (P 60 years and presentation of grade 3–4 myelosuppression were the independent factors to infection, and the FLU arm had significantly

  5. Randomized Phase II Study of R-CHOP With or Without Bortezomib in Previously Untreated Patients With Non-Germinal Center B-Cell-Like Diffuse Large B-Cell Lymphoma.

    Science.gov (United States)

    Leonard, John P; Kolibaba, Kathryn S; Reeves, James A; Tulpule, Anil; Flinn, Ian W; Kolevska, Tatjana; Robles, Robert; Flowers, Christopher R; Collins, Robert; DiBella, Nicholas J; Papish, Steven W; Venugopal, Parameswaran; Horodner, Andrew; Tabatabai, Amir; Hajdenberg, Julio; Park, Jaehong; Neuwirth, Rachel; Mulligan, George; Suryanarayan, Kaveri; Esseltine, Dixie-Lee; de Vos, Sven

    2017-11-01

    Purpose To evaluate the impact of the addition of bortezomib to rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) on outcomes in previously untreated patients with non-germinal center B-cell-like (non-GCB) diffuse large B-cell lymphoma (DLBCL). Patients and Methods After real-time determination of non-GCB DLBCL using the Hans immunohistochemistry algorithm, 206 patients were randomly assigned (1:1; stratified by International Prognostic Index [IPI] score) to six 21-day cycles of standard R-CHOP alone or R-CHOP plus bortezomib 1.3 mg/m 2 intravenously on days 1 and 4 (VR-CHOP). The primary end point, progression-free survival (PFS), was evaluated in 183 patients with centrally confirmed non-GCB DLBCL who received one or more doses of study drug (91 R-CHOP, 92 VR-CHOP). Results After a median follow-up of 34 months, with 25% (R-CHOP) and 18% (VR-CHOP) of patients having had PFS events, the hazard ratio (HR) for PFS was 0.73 (90% CI, 0.43 to 1.24) with VR-CHOP ( P = .611). Two-year PFS rates were 77.6% with R-CHOP and 82.0% with VR-CHOP; they were 65.1% versus 72.4% in patients with high-intermediate/high IPI (HR, 0.67; 90% CI, 0.34 to 1.29), and 90.0% versus 88.9% (HR, 0.85; 90% CI, 0.35 to 2.10) in patients with low/low-intermediate IPI. Overall response rate with R-CHOP and VR-CHOP was 98% and 96%, respectively. The overall survival HR was 0.75 (90% CI, 0.38 to 1.45); 2-year survival rates were 88.4% and 93.0%, respectively. In the safety population (100 R-CHOP and 101 VR-CHOP patients), grade ≥ 3 adverse events included neutropenia (53% v 49%), thrombocytopenia (13% v 29%), anemia (7% v 15%), leukopenia (26% v 25%), and neuropathy (1% v 5%). Conclusion Outcomes for newly diagnosed, prospectively enrolled patients with non-GCB DLBCL were more favorable than expected with R-CHOP and were not significantly improved by adding bortezomib.

  6. Lentiviral CRISPR/Cas9 vector mediated miR-21 gene editing inhibits the epithelial to mesenchymal transition in ovarian cancer cells.

    Science.gov (United States)

    Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming

    2017-01-01

    CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.

  7. Effects of oil-water mixed frying and pure-oil frying on the quality characteristics of soybean oil and chicken chop

    Directory of Open Access Journals (Sweden)

    Ruixue MA

    2016-01-01

    Full Text Available Abstract The effects of oil-water mixed frying (OWF and pure-oil frying (POF on changes in quality characteristics of soybean oil and chicken chop during six days of frying were comparatively investigated. The results showed that the changes in specific extinction coefficients, p-anisidine value, carbonyl value, viscosity and color of soybean oil were more pronounced in the case of POF, indicating that oil oxidative and polymeric degradation was retarded by OWF. Concerning fat content of chicken chop, lower (p<0.05 values were observed in the last three days in the case of OWF than POF. Meanwhile, OWF led to lower acrylamide formation in chops during the six days. Sensory evaluation showed that OWF provided chops with five attributes similar to those of chops fried by POF on the first day. As frying days increased, the decreases in scores for color, odor, flavor and overall acceptability were less in the case of OWF. In conclusion, OWF could be a worthwhile alternative for retarding oil deterioration and producing healthier and higher quality fried meat products.

  8. Large-scale manufacture and characterization of a lentiviral vector produced for clinical ex vivo gene therapy application.

    Science.gov (United States)

    Merten, Otto-Wilhelm; Charrier, Sabine; Laroudie, Nicolas; Fauchille, Sylvain; Dugué, Céline; Jenny, Christine; Audit, Muriel; Zanta-Boussif, Maria-Antonietta; Chautard, Hélène; Radrizzani, Marina; Vallanti, Giuliana; Naldini, Luigi; Noguiez-Hellin, Patricia; Galy, Anne

    2011-03-01

    From the perspective of a pilot clinical gene therapy trial for Wiskott-Aldrich syndrome (WAS), we implemented a process to produce a lentiviral vector under good manufacturing practices (GMP). The process is based on the transient transfection of 293T cells in Cell Factory stacks, scaled up to harvest 50 liters of viral stock per batch, followed by purification of the vesicular stomatitis virus glycoprotein-pseudotyped particles through several membrane-based and chromatographic steps. The process leads to a 200-fold volume concentration and an approximately 3-log reduction in protein and DNA contaminants. An average yield of 13% of infectious particles was obtained in six full-scale preparations. The final product contained low levels of contaminants such as simian virus 40 large T antigen or E1A sequences originating from producer cells. Titers as high as 2 × 10(9) infectious particles per milliliter were obtained, generating up to 6 × 10(11) infectious particles per batch. The purified WAS vector was biologically active, efficiently expressing the genetic insert in WAS protein-deficient B cell lines and transducing CD34(+) cells. The vector introduced 0.3-1 vector copy per cell on average in CD34(+) cells when used at the concentration of 10(8) infectious particles per milliliter, which is comparable to preclinical preparations. There was no evidence of cellular toxicity. These results show the implementation of large-scale GMP production, purification, and control of advanced HIV-1-derived lentiviral technology. Results obtained with the WAS vector provide the initial manufacturing and quality control benchmarking that should be helpful to further development and clinical applications.

  9. Lentiviral Nef Proteins Utilize PAK2-Mediated Deregulation of Cofilin as a General Strategy To Interfere with Actin Remodeling▿ †

    Science.gov (United States)

    Stolp, Bettina; Abraham, Libin; Rudolph, Jochen M.; Fackler, Oliver T.

    2010-01-01

    Nef is an accessory protein and pathogenicity factor of human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) which elevates virus replication in vivo. We recently described for HIV type 1SF2 (HIV-1SF2) the potent interference of Nef with T-lymphocyte chemotaxis via its association with the cellular kinase PAK2. Mechanistic analysis revealed that this interaction results in deregulation of the actin-severing factor cofilin and thus blocks the chemokine-mediated actin remodeling required for cell motility. However, the efficiency of PAK2 association is highly variable among Nef proteins from different lentiviruses, prompting us to evaluate the conservation of this actin-remodeling/cofilin-deregulating mechanism. Based on the analysis of a total of 17 HIV-1, HIV-2, and SIV Nef proteins, we report here that inhibition of chemokine-induced actin remodeling as well as inactivation of cofilin are strongly conserved activities of lentiviral Nef proteins. Of note, even for Nef variants that display only marginal PAK2 association in vitro, these activities require the integrity of a PAK2 recruitment motif and the presence of endogenous PAK2. Thus, reduced in vitro affinity to PAK2 does not indicate limited functionality of Nef-PAK2 complexes in intact HIV-1 host cells. These results establish hijacking of PAK2 for deregulation of cofilin and inhibition of triggered actin remodeling as a highly conserved function of lentiviral Nef proteins, supporting the notion that PAK2 association may be critical for Nef's activity in vivo. PMID:20147394

  10. Overexpression of thioredoxin in islets transduced by a lentiviral vector prolongs graft survival in autoimmune diabetic NOD mice

    Directory of Open Access Journals (Sweden)

    Sytwu Huey-Kang

    2009-08-01

    Full Text Available Abstract Pancreatic islet transplantation is considered an appropriate treatment to achieve insulin independence in type I diabetic patients. However, islet isolation and transplantation-induced oxidative stress and autoimmune-mediated destruction are still the major obstacles to the long-term survival of graft islets in this potential therapy. To protect islet grafts from inflammatory damage and prolong their survival, we transduced islets with an antioxidative gene thioredoxin (TRX using a lentiviral vector before transplantation. We hypothesized that the overexpression of TRX in islets would prolong islet graft survival when transplanted into diabetic non-obese diabetic (NOD mice. Methods Islets were isolated from NOD mice and transduced with lentivirus carrying TRX (Lt-TRX or enhanced green fluorescence protein (Lt-eGFP, respectively. Transduced islets were transplanted under the left kidney capsule of female diabetic NOD mice, and blood glucose concentration was monitored daily after transplantation. The histology of the islet graft was assessed at the end of the study. The protective effect of TRX on islets was investigated. Results The lentiviral vector effectively transduced islets without altering the glucose-stimulating insulin-secretory function of islets. Overexpression of TRX in islets reduced hydrogen peroxide-induced cytotoxicity in vitro. After transplantation into diabetic NOD mice, euglycemia was maintained for significantly longer in Lt-TRX-transduced islets than in Lt-eGFP-transduced islets; the mean graft survival was 18 vs. 6.5 days (n = 9 and 10, respectively, p Conclusion We successfully transduced the TRX gene into islets and demonstrated that these genetically modified grafts are resistant to inflammatory insult and survived longer in diabetic recipients. Our results further support the concept that the reactive oxygen species (ROS scavenger and antiapoptotic functions of TRX are critical to islet survival after

  11. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  12. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  13. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  15. Consumer visual appraisal and shelf life of leg chops from suckling kids raised with natural milk or milk replacer.

    Science.gov (United States)

    Ripoll, Guillermo; Alcalde, María J; Argüello, Anastasio; Córdoba, María G; Panea, Begoña

    2018-05-01

    The use of milk replacers to feed suckling kids could affect the shelf life and appearance of the meat. Leg chops were evaluated by consumers and the instrumental color was measured. A machine learning algorithm was used to relate them. The aim of this experiment was to study the shelf life of the meat of kids reared with dam's milk or milk replacers and to ascertain which illuminant and instrumental color variables are used by consumers as criteria to evaluate that visual appraisal. Meat from kids reared with milk replacers was more valuable and had a longer shelf life than meat from kids reared with natural milk. Consumers used the color of the whole surface of the leg chop to assess the appearance of meat. Lightness and hue angle were the prime cues used to evaluate the appearance of meat. Illuminant D65 was more useful for relating the visual appraisal with the instrumental color using a machine learning algorithm. The machine learning algorithms showed that the underlying rules used by consumers to evaluate the appearance of suckling kid meat are not at all linear and can be computationally schematized into a simple algorithm. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  16. Activating transcription factor 6 mediates oxidized LDL-induced cholesterol accumulation and apoptosis in macrophages by up-regulating CHOP expression.

    Science.gov (United States)

    Yao, Shutong; Zong, Chuanlong; Zhang, Ying; Sang, Hui; Yang, Mingfeng; Jiao, Peng; Fang, Yongqi; Yang, Nana; Song, Guohua; Qin, Shucun

    2013-01-01

    This study was to explore whether activating transcription factor 6 (ATF6), an important sensor to endoplasmic reticulum (ER) stress, would mediate oxidized low-density lipoprotein (ox-LDL)- induced cholesterol accumulation and apoptosis in cultured macrophages and the underlying molecular mechanisms. Intracellular lipid droplets and total cholesterol levels were assayed by oil red O staining and enzymatic colorimetry, respectively. Cell viability and apoptosis were determined using MTT assay and AnnexinV-FITC apoptosis detection kit, respectively. The nuclear translocation of ATF6 in cells was detected by immunofluorescence analysis. Protein and mRNA levels were examined by Western blot analysis and real time-PCR, respectively. ATF6 siRNA was transfected to RAW264.7 cells by lipofectamin. Exposure of cells to ox-LDL induced glucose-regulated protein 78 (GRP78). C/EBP homologous protein (CHOP), a key-signaling component of ER stress-induced apoptosis, was up-regulated in ox-LDL-treated cells. ATF6, a factor that positively regulates CHOP expression, was activated by ox-LDL in a concentration- and time- dependent manner. The role of the ATF6-mediated ER stress pathway was further confirmed through the siRNA-mediated knockdown of ATF6, which attenuated ox-LDL-induced upregulation of CHOP, cholesterol accumulation and apoptosis in macrophages. In addition, the phosphorylation of double-stranded RNA-activated protein kinase-like endoplasmic reticulum kinase (PERK), another factor that positively regulates CHOP expression, was induced in the presence of ox-LDL, and PERK-specific siRNA also inhibited the ox-LDL-induced upregulation of CHOP and apoptosis in RAW264.7 cells. These results demonstrate that ER stress-related proteins, particularly ATF6 and its downstream molecule CHOP, are involved in ox-LDL-induced cholesterol accumulation and apoptosis in macrophages.

  17. Straight and chopped DC performance data for a General Electric 5BY436A1 DC shunt motor with a General Electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Both straight and chopped dc motor performance data for a General Electric 5BY436A1 motor with a General Electric EV-1 controller is presented in tabular and graphical formats. Effects of motor temperature and operating voltage are also shown. The maximum motor efficiency is approximately 85% at low operating temperatures in the straight dc mode. Chopper efficiency can be assumed to be 95% under all operating conditions. For equal speeds, the motor operated in the chopped mode develops slightly more torque and draws more current than it does in the straight mode.

  18. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  19. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  20. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  1. Survival of Listeria monocytogenes and Salmonella typhimurium and quality attributes of cooked pork chops and cured ham after irradiation

    International Nuclear Information System (INIS)

    Fu, A.H.; Sebranek, J.G.; Murano, E.A.

    1995-01-01

    Cooked pork chops (pumped with salt/polyphosphate brine or untreated) and cured hams were inoculated with Listeria monocytogenes and Salmonella typhimurium. The samples were irradiated at low (0.75 to 0.90 kGy) or medium doses (1.8 to 2.0 kGy), and each dose was delivered at either a low (2.5 M/min conveyor speed) or high (5.4 M/min) dose rate. Low-dose irradiation reduced L. monocytogenes by more than 2 log and S. typhimurium by 1 to 3 log. Pathogen populations and total plate counts (TPC) were reduced to undetectable levels by medium doses. No meat quality attributes were affected, and no dose rate effect was observed. Nitrite reduced (P 0.05) both pathogens and TPC during 7 degrees C storage in ham, especially when combined with low-dose irradiation

  2. Straight and chopped dc performance data for a Prestolite MTC-4001 motor and a general electric EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Performance data on the Prestolite MTC-4001 series wound dc motor and General Electric EV-1 Chopper Controller is supplied for the electric vehicle manufacturer. Data are provided for both straight and chopped dc input to the motor, at 2 motor temperature levels. Testing was done at 6 voltage increments to the motor, and 2 voltage increments to the controller. Data results are presented in both tabular and graphical forms. Tabular information includes motor voltage and current input data, motor speed and torque output data, power data and temperature data. Graphical information includes torque-speed, motor power output-speed, torque-current, and efficiency-speed plots under the various operating conditions. The data resulting from this testing show the speed-torque plots to have the most variance with operating temperature. The maximum motor efficiency is between 76% and 82%, regardless of temperature or mode of operation.

  3. Three Point Bending of Top-Hat Stiffened Chopped Short Fibre Ramie/HDPE Thermoplastic Composite Beam

    Science.gov (United States)

    Hadi, Bambang K.; Nuril, Yogie S.

    2018-04-01

    The use of natural fibre and thermoplastic matrices in composite materials increased significantly during the last decade especially in the automotive industries. Ramie is one of these potential natural fibres. In this paper, a three point bending of top-hat beam made of ramie/HDPE (High-Density-Polyethylene) composites was performed. Top-hat stiffened structures were common structures found in the aerospace industries. Nevertheless, these structures are beginning to be applied in automotive structures in the forms of chassis and bumpers. The ramie/HDPE composite was manufactured using hot-press technique. The temperature was set to be 135°C and the pressure was 6 bars. Chopped short ramie fibre was used, due to good drape ability characteristics. The experiments showed that the beams produced a large non-linearity. Linear Finite Element Analysis was carried out to be compared with the experimental data. The differences are reasonable.

  4. Changes in the positron-electron momentum distribution in GaAs brought about by chopped light

    International Nuclear Information System (INIS)

    Li, S.; Fung, S.; Beling, C.D.; Ling, C.C.

    2001-01-01

    We report on an attempt to observe the EL2→ EL2 * transition in semi-insulating GaAs using Doppler broadening of annihilation radiation spectroscopy. Unlike the original observation of this transition using positron annihilation spectroscopy, the present method has sought to observe the production of EL2 * through a light chopping experiment, where on the half cycle of illumination the EL2 * state is formed and on the second half cycle the EL2 * thermally quenches back to EL2. While results are at a preliminary state we have obtained evidence for the production of EL2 * from the broad-band emission of a Xenon lamp. While calculations suggest that we should be able to see the EL2 * from the IR emission (1.3eV) of GaAs light emitting diodes we have not yet been able to achieve this. Reasons why are discussed. (orig.)

  5. HIV-1 resistance conferred by siRNA cosuppression of CXCR4 and CCR5 coreceptors by a bispecific lentiviral vector

    Directory of Open Access Journals (Sweden)

    Akkina Ramesh

    2005-01-01

    Full Text Available Abstract Background RNA interference (RNAi mediated by small interfering RNAs (siRNAs has proved to be a highly effective gene silencing mechanism with great potential for HIV/AIDS gene therapy. Previous work with siRNAs against cellular coreceptors CXCR4 and CCR5 had shown that down regulation of these surface molecules could prevent HIV-1 entry and confer viral resistance. Since monospecific siRNAs targeting individual coreceptors are inadequate in protecting against both T cell tropic (X4 and monocyte tropic (R5 viral strains simultaneously, bispecific constructs with dual specificity are required. For effective long range therapy, the bispecific constructs need to be stably transduced into HIV-1 target cells via integrating viral vectors. Results To achieve this goal, lentiviral vectors incorporating both CXCR4 and CCR5 siRNAs of short hairpin design were constructed. The CXCR4 siRNA was driven by a U6 promoter whereas the CCR5 siRNA was driven by an H1 promoter. A CMV promoter driven EGFP reporter gene is also incorporated in the bispecific construct. High efficiency transduction into coreceptor expressing Magi and Ghost cell lines with a concomitant down regulation of respective coreceptors was achieved with lentiviral vectors. When the siRNA expressing transduced cells were challenged with X4 and R5 tropic HIV-1, they demonstrated marked viral resistance. HIV-1 resistance was also observed in bispecific lentiviral vector transduced primary PBMCs. Conclusions Both CXCR4 and CCR5 coreceptors could be simultaneously targeted for down regulation by a single combinatorial lentiviral vector incorporating respective anti-coreceptor siRNAs. Stable down regulation of both the coreceptors protects cells against infection by both X4 and R5 tropic HIV-1. Stable down regulation of cellular molecules that aid in HIV-1 infection will be an effective strategy for long range HIV gene therapy.

  6. Impact of Pretreatment Neutrophil Count on Chemotherapy Administration and Toxicity in Dogs with Lymphoma Treated with CHOP Chemotherapy.

    Science.gov (United States)

    Fournier, Q; Serra, J-C; Handel, I; Lawrence, J

    2018-01-01

    Prechemotherapy absolute neutrophil count (ANC) cutoffs are arbitrary and vary across institutions and clinicians. Similarly, subjective guidelines are utilized for the administration of prophylactic antibiotics in neutropenic dogs. To evaluate the impact of various ANC cutoffs on chemotherapy administration in dogs with lymphoma treated with CHOP chemotherapy and to determine whether an association between prechemotherapy ANC and subsequent toxicity exists. The secondary objective was to evaluate a currently used ANC cutoff to indicate prescription of prophylactic antibiotics. Dogs diagnosed with lymphoma treated with CHOP chemotherapy (n = 64). Six hundred and fifteen ANCs were stratified into 6 classes. The 3 ANC cutoffs 1.5 × 10 3 /μL, 2.0 × 10 3 /μL, and 2.5 × 10 3 /μL were assessed. The presence of an association between prechemotherapy ANC class and toxicity was determined. Afebrile neutropenic dogs with ANC ANC cutoff of 1.5 × 10 3 /μL; chemotherapy would not have been administered in 10% and 16% of visits with an ANC cutoff of 2.0 × 10 3 /μL or 2.5 × 10 3 /μL, respectively. There was no association among the 3 lower prechemotherapy ANC classes and toxicity. All dogs with ANC 0.75-1.5 × 10 3 /μL recovered spontaneously without medical intervention. The number of dose delays was minimized with a prechemotherapy ANC cutoff of 1.5 × 10 3 /μL, and the prechemotherapy ANC class 1.5-1.99 × 10 3 /μL was not associated with an increased toxicity. Further investigation of an ANC cutoff near 0.75 × 10 3 /μL in which to prescribe prophylactic antibiotics is indicated. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  7. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Directory of Open Access Journals (Sweden)

    Emanuela Chiarella

    Full Text Available Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6 where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in

  8. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    Science.gov (United States)

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and

  9. Stable lentiviral transformation of CHO cells for the expression of the hemagglutinin H5 of avian influenza virus in suspension culture

    Directory of Open Access Journals (Sweden)

    Alaín González Pose

    2014-09-01

    Full Text Available Avian influenza virus H5N1 has caused extensive damage worldwide among poultry and humans. Effective expression systems are needed for the production of viral proteins required for monitoring this devastating disease. The present study deals with the establishment of a stable expression system for the hemagglutinin H5 (HAH5 of avian influenza virus using CHO cells in suspension culture transduced with a recombinant lentiviral vector. The synthetic gene coding the HAH5 protein was inserted in a lentiviral vector with the aim of performing a stable transduction of CHO cells. After the selection of recombinant clones, the one with the highest expression level was adapted to suspension culture and the HAH5 protein was purified by immunoaffinity chromatography from the culture supernatant. There were no significant differences when this protein, purified or direct from the culture supernatant of CHO or SiHa cells, was utilized in an immunologic assay using positive and negative sera as reference. It was also demonstrated that the HAH5 protein in its purified form is able to bind anti-HAH5 antibodies generated with proper and non-proper folded proteins. The results demonstrate that the CHO cell line stably transduced with a lentiviral vector coding the sequence of the HAH5 protein and cultured in suspension can be a suitable expression system to obtain this protein for diagnostic purpose in a consistent and reliable manner.

  10. The human ankyrin 1 promoter insulator sustains gene expression in a β-globin lentiviral vector in hematopoietic stem cells

    Directory of Open Access Journals (Sweden)

    Zulema Romero

    Full Text Available Lentiviral vectors designed for the treatment of the hemoglobinopathies require the inclusion of regulatory and strong enhancer elements to achieve sufficient expression of the β-globin transgene. Despite the inclusion of these elements, the efficacy of these vectors may be limited by transgene silencing due to the genomic environment surrounding the integration site. Barrier insulators can be used to give more consistent expression and resist silencing even with lower vector copies. Here, the barrier activity of an insulator element from the human ankyrin-1 gene was analyzed in a lentiviral vector carrying an antisickling human β-globin gene. Inclusion of a single copy of the Ankyrin insulator did not affect viral titer, and improved the consistency of expression from the vector in murine erythroleukemia cells. The presence of the Ankyrin insulator element did not change transgene expression in human hematopoietic cells in short-term erythroid culture or in vivo in primary murine transplants. However, analysis in secondary recipients showed that the lentiviral vector with the Ankyrin element preserved transgene expression, whereas expression from the vector lacking the Ankyrin insulator decreased in secondary recipients. These studies demonstrate that the Ankyrin insulator may improve long-term β-globin expression in hematopoietic stem cells for gene therapy of hemoglobinopathies.

  11. Effect of packaging type during postmortem aging and degree of doneness on pork chop sensory traits of loins selected to vary in color and marbling.

    Science.gov (United States)

    Klehm, B J; King, D A; Dilger, A C; Shackelford, S D; Boler, D D

    2018-05-04

    The objective was to determine the interactions between packaging type and degree of doneness on sensory traits of pork loins classified based on the newly proposed USDA quality grades. A total of 144 loins were selected from 2 groups of pigs (lean growth or meat quality production focus) to represent as much variation in visual color and marbling as possible. Selection was achieved with a VQG grading camera. The ventral surface of the loins was evaluated for loin quality traits at 1 d postmortem. At 2 d postmortem loins were sliced into 28-mm-thick chops. Chop within each loin was randomly assigned to either individual vacuum packages or to individual Styrofoam trays and overwrapped in polyvinyl chloride (PVC) oxygen permeable film. Overwrapped PVC packages were then placed in bulk packages and flushed with a gas mixture that contained approximately 0.4% carbon monoxide, 30% carbon dioxide, and 80% nitrogen. Vacuum-packaged chops were aged until 14 d postmortem. Chops packaged in PVC overwrap were aged until 9 d postmortem in the bulk packages, then placed on simulated retail display until 14 d postmortem. Chops from each packaging type were cooked to an internal temperature of either 63 °C or 71 °C for the evaluation of slice shear force (SSF) or for evaluation of tenderness, juiciness, and flavor by a trained panel. Data were analyzed as split-split plot design with production focus of the pigs, proposed USDA quality grade, packaging type, and degree of doneness as fixed effects. While there were main effect differences between production focuses, there were no interactions with production focus. There were also no 3-way (P ≥ 0.19) interactions and only one 2-way interaction among quality grade, packaging type, or degree of doneness. There were no differences in sensory tenderness (P = 0.30), juiciness (P = 0.49), flavor (P = 0.89), SSF (P = 0.13), or cook loss (P = 0.06) among USDA quality grades. There were no differences in sensory tenderness (P = 0

  12. The effect of metformin treatment on endoplasmic reticulum (ER stress induced by status epilepticus (SE via the PERK-eIF2α-CHOP pathway

    Directory of Open Access Journals (Sweden)

    Jing Chen

    2018-02-01

    Full Text Available Status epilepticus (SE is defined as continuous seizure activity lasting more than 5 minutes. It results in neuronal cell death, mediated by endoplasmic reticulum (ER stress response. Previously, metformin demonstrated neuroprotective effects in primary cortical neurons. In this study, we analyzed the effect of metformin on ER stress via the pro-apoptotic protein kinase RNA-like endoplasmic reticulum kinase (PERK-eukaryotic initiation factor 2α (eIF2α-C/EBP homologous protein (CHOP pathway. SE was induced in rats by pentylenetetrazole. Following SE, the rats were treated with salubrinal, GSK2656157, or metformin. In a control group (normal saline SE was not induced. CHOP, eIF2α, and PERK expression was determined by Western blot; apoptosis was analyzed by TUNEL assay. CHOP expression was significantly increased at 6 and 24 hours following SE. At both time points, eIF2α and PERK levels were also increased. At 6 hours, CHOP expression was significantly reduced in salubrinal, GSK2656157 and metformin groups versus SE group. eIF2α and PERK levels were decreased in metformin compared to SE group. eIF2α expression was markedly decreased in salubrinal versus SE group, while PERK expression was markedly reduced in GSK2656157 versus SE group. At 6 and 24 hours, the apoptosis rate was significantly increased in SE versus control group, while it was significantly reduced in salubrinal, GSK2656157, and metformin groups compared to SE group. The apoptosis rate also decreased in salubrinal group at 24 hours, although not to the extent observed in metformin group. Overall, CHOP expression and apoptosis induced by SE in rats were reduced with metformin. Further studies are required to evaluate the clinical relevance of metformin for patients with SE.

  13. Sindbis Virus-Pseudotyped Lentiviral Vectors Carrying VEGFR2-Specific Nanobody for Potential Transductional Targeting of Tumor Vasculature.

    Science.gov (United States)

    Ahani, Roshank; Roohvand, Farzin; Cohan, Reza Ahangari; Etemadzadeh, Mohammad Hossein; Mohajel, Nasir; Behdani, Mahdi; Shahosseini, Zahra; Madani, Navid; Azadmanesh, Kayhan

    2016-11-01

    Introduction of selectivity/specificity into viral-based gene delivery systems, such as lentiviral vectors (LVs), is crucial in their systemic administration for cancer gene therapy. The pivotal role of tumor-associated endothelial cells (TAECs) in tumor angiogenesis and overexpression of vascular endothelial growth factor receptor-2 (VEGFR2 or KDR) in TAECs makes them a potent target in cancer treatment. Herein, we report the development of VEGFR2-targeted LVs pseudotyped with chimeric sindbis virus E2 glycoprotein (cSVE2s). For this purpose, either sequence of a VEGFR2-specific nanobody or its natural ligand (VEGF 121 ) was inserted into the binding site of sindbis virus E2 glycoprotein. In silico modeling data suggested that the inserted targeting motifs were exposed in the context of cSVE2s. Western blot analysis of LVs indicated the incorporation of cSVE2s into viral particles. Capture ELISA demonstrated the specificity/functionality of the incorporated cSVE2s. Transduction of 293/KDR (expressing VEGFR2) or 293T cells (negative control) by constructed LVs followed by fluorescent microscopy and flow cytometric analyses indicated selective transduction of 293/KDR cells (30 %) by both targeting motifs compared to 293T control cells (1-2 %). These results implied similar targeting properties of VEGFR2-specific nanobody compared to the VEGF 121 and indicated the potential for transductional targeting of tumor vasculature by the nanobody displaying LVs.

  14. Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

    Science.gov (United States)

    Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

    2007-01-01

    Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

  15. Phenotypic correction of Fanconi anemia cells in the murine bone marrow after carrier cell mediated delivery of lentiviral vector.

    Science.gov (United States)

    Chakkaramakkil Verghese, Santhosh; Goloviznina, Natalya A; Kurre, Peter

    2016-11-19

    Fanconi anemia (FA) is an autosomal-recessive disorder associated with hematopoietic failure and it is a candidate for hematopoietic stem cell (HSC)-directed gene therapy. However, the characteristically reduced HSC numbers found in FA patients, their ineffective mobilization from the marrow, and re-oxygenation damage during ex vivo manipulation have precluded clinical success using conventional in vitro approaches. We previously demonstrated that lentiviral vector (LV) particles reversibly attach to the cell surface where they gain protection from serum complement neutralization. We reasoned that cellular delivery of LV to the bone marrow niche could avoid detrimental losses during FA HSC mobilization and in vitro modification. Here, we demonstrate that a VSV-G pseudotyped lentivector, carrying the FANCC transgene, can be transmitted from carrier to bystander cells. In cell culture and transplantation models of FA, we further demonstrate that LV carrier cells migrate along SDF-1α gradients and transfer vector particles that stably integrate and phenotypically correct the characteristic DNA alkylator sensitivity in murine and human FA-deficient target bystander cells. Altogether, we demonstrate that cellular homing mechanisms can be harnessed for the functional phenotype correction in murine FA hematopoietic cells.

  16. Phenotypic correction of Fanconi anemia cells in the murine bone marrow after carrier cell mediated delivery of lentiviral vector

    Directory of Open Access Journals (Sweden)

    Santhosh Chakkaramakkil Verghese

    2016-11-01

    Full Text Available Abstract Fanconi anemia (FA is an autosomal-recessive disorder associated with hematopoietic failure and it is a candidate for hematopoietic stem cell (HSC-directed gene therapy. However, the characteristically reduced HSC numbers found in FA patients, their ineffective mobilization from the marrow, and re-oxygenation damage during ex vivo manipulation have precluded clinical success using conventional in vitro approaches. We previously demonstrated that lentiviral vector (LV particles reversibly attach to the cell surface where they gain protection from serum complement neutralization. We reasoned that cellular delivery of LV to the bone marrow niche could avoid detrimental losses during FA HSC mobilization and in vitro modification. Here, we demonstrate that a VSV-G pseudotyped lentivector, carrying the FANCC transgene, can be transmitted from carrier to bystander cells. In cell culture and transplantation models of FA, we further demonstrate that LV carrier cells migrate along SDF-1α gradients and transfer vector particles that stably integrate and phenotypically correct the characteristic DNA alkylator sensitivity in murine and human FA-deficient target bystander cells. Altogether, we demonstrate that cellular homing mechanisms can be harnessed for the functional phenotype correction in murine FA hematopoietic cells.

  17. An adeno-associated viral vector transduces the rat hypothalamus and amygdala more efficient than a lentiviral vector

    Directory of Open Access Journals (Sweden)

    Vreugdenhil Erno

    2010-07-01

    Full Text Available Abstract Background This study compared the transduction efficiencies of an adeno-associated viral (AAV vector, which was pseudotyped with an AAV1 capsid and encoded the green fluorescent protein (GFP, with a lentiviral (LV vector, which was pseudotyped with a VSV-G envelop and encoded the discosoma red fluorescent protein (dsRed, to investigate which viral vector transduced the lateral hypothalamus or the amygdala more efficiently. The LV-dsRed and AAV1-GFP vector were mixed and injected into the lateral hypothalamus or into the amygdala of adult rats. The titers that were injected were 1 × 108 or 1 × 109 genomic copies of AAV1-GFP and 1 × 105 transducing units of LV-dsRed. Results Immunostaining for GFP and dsRed showed that AAV1-GFP transduced significantly more cells than LV-dsRed in both the lateral hypothalamus and the amygdala. In addition, the number of LV particles that were injected can not easily be increased, while the number of AAV1 particles can be increased easily with a factor 100 to 1000. Both viral vectors appear to predominantly transduce neurons. Conclusions This study showed that AAV1 vectors are better tools to overexpress or knockdown genes in the lateral hypothalamus and amygdala of adult rats, since more cells can be transduced with AAV1 than with LV vectors and the titer of AAV1 vectors can easily be increased to transduce the area of interest.

  18. Differentiation of Human Mesenchymal Stem Cells into Insulin Producing Cells by Using A Lentiviral Vector Carrying PDX1.

    Science.gov (United States)

    Allahverdi, Amir; Abroun, Saied; Jafarian, Arefeh; Soleimani, Masoud; Taghikhani, Mohammad; Eskandari, Fatemeh

    2015-01-01

    Type I diabetes is an immunologically-mediated devastation of insulin producing cells (IPCs) in the pancreatic islet. Stem cells that produce β-cells are a new promising tool. Adult stem cells such as mesenchymal stem cells (MSCs) are self renewing multi potent cells showing capabilities to differentiate into ectodermal, mesodermal and endodermal tissues. Pancreatic and duodenal homeobox factor 1 (PDX1) is a master regulator gene required for embryonic development of the pancreas and is crucial for normal pancreatic islets activities in adults. We induced the over-expression of the PDX1 gene in human bone marrow MSCs (BM-MSCs) by Lenti-PDX1 in order to generate IPCs. Next, we examine the ability of the cells by measuring insulin/c-peptide production and INSULIN and PDX1 gene expressions. After transduction, MSCs changed their morphology at day 5 and gradually differentiated into IPCs. INSULIN and PDX1 expressions were confirmed by real time polymerase chain reaction (RT-PCR) and immunostaining. IPC secreted insulin and C-peptide in the media that contained different glucose concentrations. MSCs differentiated into IPCs by genetic manipulation. Our result showed that lentiviral vectors could deliver PDX1 gene to MSCs and induce pancreatic differentiation.

  19. Preclinical correction of human Fanconi anemia complementation group A bone marrow cells using a safety-modified lentiviral vector.

    Science.gov (United States)

    Becker, P S; Taylor, J A; Trobridge, G D; Zhao, X; Beard, B C; Chien, S; Adair, J; Kohn, D B; Wagner, J E; Shimamura, A; Kiem, H-P

    2010-10-01

    One of the major hurdles for the development of gene therapy for Fanconi anemia (FA) is the increased sensitivity of FA stem cells to free radical-induced DNA damage during ex vivo culture and manipulation. To minimize this damage, we have developed a brief transduction procedure for lentivirus vector-mediated transduction of hematopoietic progenitor cells from patients with Fanconi anemia complementation group A (FANCA). The lentiviral vector FancA-sW contains the phosphoglycerate kinase promoter, the FANCA cDNA, and a synthetic, safety-modified woodchuck post transcriptional regulatory element (sW). Bone marrow mononuclear cells or purified CD34(+) cells from patients with FANCA were transduced in an overnight culture on recombinant fibronectin peptide CH-296, in low (5%) oxygen, with the reducing agent, N-acetyl-L-cysteine (NAC), and a combination of growth factors, granulocyte colony-stimulating factor (G-CSF), Flt3 ligand, stem cell factor, and thrombopoietin. Transduced cells plated in methylcellulose in hypoxia with NAC showed increased colony formation compared with 21% oxygen without NAC (Pgene-corrected cells in patients with FANCA.

  20. Towards a clinically relevant lentiviral transduction protocol for primary human CD34 hematopoietic stem/progenitor cells.

    Directory of Open Access Journals (Sweden)

    Michelle Millington

    2009-07-01

    Full Text Available Hematopoietic stem cells (HSC, in particular mobilized peripheral blood stem cells, represent an attractive target for cell and gene therapy. Efficient gene delivery into these target cells without compromising self-renewal and multi-potency is crucial for the success of gene therapy. We investigated factors involved in the ex vivo transduction of CD34(+ HSCs in order to develop a clinically relevant transduction protocol for gene delivery. Specifically sought was a protocol that allows for efficient transduction with minimal ex vivo manipulation without serum or other reagents of animal origin.Using commercially available G-CSF mobilized peripheral blood (PB CD34(+ cells as the most clinically relevant target, we systematically examined factors including the use of serum, cytokine combinations, pre-stimulation time, multiplicity of infection (MOI, transduction duration and the use of spinoculation and/or retronectin. A self-inactivating lentiviral vector (SIN-LV carrying enhanced green fluorescent protein (GFP was used as the gene delivery vehicle. HSCs were monitored for transduction efficiency, surface marker expression and cellular function. We were able to demonstrate that efficient gene transduction can be achieved with minimal ex vivo manipulation while maintaining the cellular function of transduced HSCs without serum or other reagents of animal origin.This study helps to better define factors relevant towards developing a standard clinical protocol for the delivery of SIN-LV into CD34(+ cells.

  1. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  2. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  3. Characterization of complete particles (VSV-G/SIN-GFP) and empty particles (VSV-G/EMPTY) in human immunodeficiency virus type 1-based lentiviral products for gene therapy: potential applications for improvement of product quality and safety.

    Science.gov (United States)

    Zhao, Yuan; Keating, Kenneth; Dolman, Carl; Thorpe, Robin

    2008-05-01

    Lentiviral vectors persist in the host and are therefore ideally suited for long-term gene therapy. To advance the use of lentiviral vectors in humans, improvement of their production, purification, and characterization has become increasingly important and challenging. In addition to cellular contaminants derived from packaging cells, empty particles without therapeutic function are the major impurities that compromise product safety and efficacy. Removal of empty particles is difficult because of their innate similarity in particle size and protein composition to the complete particles. We propose that comparison of the properties of lentiviral products with those of purposely expressed empty particles may reveal potential differences between empty and complete particles. For this, three forms of recombinant lentiviral samples, that is, recombinant vesicular stomatitis virus glycoprotein (VSV-G) proteins, empty particles (VSV-G/Empty), and complete particles (VSV-G/SIN-GFP) carrying viral RNA, were purified by size-exclusion chromatography (SEC). The SEC-purified samples were further analyzed by immunoblotting with six antibodies to examine viral and cellular proteins associated with the particles. This study has demonstrated, for the first time, important differences between VSV-G/Empty particles and complete VSV-G/SIN-GFP particles. Differences include the processing of Gag protein and the inclusion of cellular proteins in the particles. Our findings support the development of improved production, purification, and characterization methods for lentiviral products.

  4. Effective in vivo and ex vivo gene transfer to intestinal mucosa by VSV-G-pseudotyped lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Kasahara Noriyuki

    2010-05-01

    Full Text Available Abstract Background Gene transfer to the gastrointestinal (GI mucosa is a therapeutic strategy which could prove particularly advantageous for treatment of various hereditary and acquired intestinal disorders, including inflammatory bowel disease (IBD, GI infections, and cancer. Methods We evaluated vesicular stomatitis virus glycoprotein envelope (VSV-G-pseudotyped lentiviral vectors (LV for efficacy of gene transfer to both murine rectosigmoid colon in vivo and human colon explants ex vivo. LV encoding beta-galactosidase (LV-β-Gal or firefly-luciferase (LV-fLuc reporter genes were administered by intrarectal instillation in mice, or applied topically for ex vivo transduction of human colorectal explant tissues from normal individuals. Macroscopic and histological evaluations were performed to assess any tissue damage or inflammation. Transduction efficiency and systemic biodistribution were evaluated by real-time quantitative PCR. LV-fLuc expression was evaluated by ex vivo bioluminescence imaging. LV-β-Gal expression and identity of transduced cell types were examined by histochemical and immunofluorescence staining. Results Imaging studies showed positive fLuc signals in murine distal colon; β-Gal-positive cells were found in both murine and human intestinal tissue. In the murine model, β-Gal-positive epithelial and lamina propria cells were found to express cytokeratin, CD45, and CD4. LV-transduced β-Gal-positive cells were also seen in human colorectal explants, consisting mainly of CD45, CD4, and CD11c-positive cells confined to the LP. Conclusions We have demonstrated the feasibility of LV-mediated gene transfer into colonic mucosa. We also identified differential patterns of mucosal gene transfer dependent on whether murine or human tissue was used. Within the limitations of the study, the LV did not appear to induce mucosal damage and were not distributed beyond the distal colon.

  5. Simplified production and concentration of HIV-1-based lentiviral vectors using HYPERFlask vessels and anion exchange membrane chromatography

    Science.gov (United States)

    Kutner, Robert H; Puthli, Sharon; Marino, Michael P; Reiser, Jakob

    2009-01-01

    Background During the past twelve years, lentiviral (LV) vectors have emerged as valuable tools for transgene delivery because of their ability to transduce nondividing cells and their capacity to sustain long-term transgene expression in target cells in vitro and in vivo. However, despite significant progress, the production and concentration of high-titer, high-quality LV vector stocks is still cumbersome and costly. Methods Here we present a simplified protocol for LV vector production on a laboratory scale using HYPERFlask vessels. HYPERFlask vessels are high-yield, high-performance flasks that utilize a multilayered gas permeable growth surface for efficient gas exchange, allowing convenient production of high-titer LV vectors. For subsequent concentration of LV vector stocks produced in this way, we describe a facile protocol involving Mustang Q anion exchange membrane chromatography. Results Our results show that unconcentrated LV vector stocks with titers in excess of 108 transduction units (TU) per ml were obtained using HYPERFlasks and that these titers were higher than those produced in parallel using regular 150-cm2 tissue culture dishes. We also show that up to 500 ml of an unconcentrated LV vector stock prepared using a HYPERFlask vessel could be concentrated using a single Mustang Q Acrodisc with a membrane volume of 0.18 ml. Up to 5.3 × 1010 TU were recovered from a single HYPERFlask vessel. Conclusion The protocol described here is easy to implement and should facilitate high-titer LV vector production for preclinical studies in animal models without the need for multiple tissue culture dishes and ultracentrifugation-based concentration protocols. PMID:19220915

  6. In Vitro Generation of IL-35-expressing Human Wharton's Jelly-derived Mesenchymal Stem Cells Using Lentiviral Vector.

    Science.gov (United States)

    Amari, Afshin; Ebtekar, Massoumeh; Moazzeni, Seyed Mohammad; Soleimani, Masoud; Mohammadi Amirabad, Leila; Tahoori, Mohammad Taher; Massumi, Mohammad

    2015-08-01

    Human Wharton's Jelly-derived Mesenchymal Stem Cells (hWJ-MSCs) are easily available cells without transplant rejection problems or ethical concerns compared to bone-marrow-derived MSCs for prospective clinical applications. These cells display immunosuppressive properties and may be able to play an important role in autoimmune disorders. Regulatory T-cells (Treg) are important to prevent autoimmune disease development. Interleukin 35 (IL-35) induces the proliferation of Treg cell populations and reduces the activity of T helper 17 (Th17) and T helper 1 (Th1) cells, which play a central role in initiation of inflammation and autoimmune disease. Recent studies identified IL-35 as a new inhibitory cytokine required for the suppressive function of Treg cells. We created IL-35-producing hWJ-MSCs as a good vehicle for reduction of inflammation and autoimmune diseases. We isolated hWJ-MSCs based on explant culture. HWJ-MSCs were transduced at MOI=50 (Multiplicity of Infection) with lentiviral particles harboring murine Interleukin 35 (mIL-35). Expression of IL-35 in hWJ-MSCs was quantified by an IL-35 ELISA kit. IL-35 bioactivity was analyzed by inhibiting the proliferation of mouse splenocytes using CFSE cell proliferation kit. Frequency of CD4+CD25+CD127 low/neg Foxp3+ Treg cells was measured by flow cytometry. There was an up to 85% GFP positive transduction rate, and the cells successfully released a high level of mIL-35 protein (750 ng/ml). IL-35 managed to inhibit CD4+ T cell proliferation with PHA, and improved the frequency of Treg cells. Our data suggest that transduced hWJ-MSCs overexpressing IL-35 may provide a useful approach for basic research on gene therapy for autoimmune disorders.

  7. Febrile Neutropenia Risk Assessment and Granulocyte-Colony Stimulating Factor Support in Patients with Diffuse Large B Cell Lymphoma Receiving R-CHOP Regimens

    DEFF Research Database (Denmark)

    Salar, Antonio; Haioun, Corinne; Rossi, Francesca Gaia

    2009-01-01

    BACKGROUND: ASCO and EORTC guidelines recommend granulocyte colony-stimulating factor (G-CSF) primary prophylaxis for cancer patients with a ≥20% overall risk of febrile neutropenia (FN), and to support delivery of dose-dense regimens. CHOP-like regimens (with rituximab [R]) are the current...... standard of care for the management of aggressive non-Hodgkin lymphoma (NHL), but they are often associated with significant myelosuppression. Neutropenic events, particularly febrile neutropenia (FN), can be life-threatening and may lead to dose delays or reductions that compromise the efficacy......-CSF primary prophylaxis. Across all cycles, 29% of R-CHOP-21 patients had an unplanned hospitalization, with neutropenia/FN being the main reason. Subsequently, 67% of patients achieved a relative dose intensity (RDI) of ≥90% of their planned treatment (with respect to cyclophosphamide, doxorubicin...

  8. Combined modality therapy of diffuse histology non-Hodgkin's lymphoma with cyclophosphamide, adriamycin, vincristine, prednisone (CHOP) and total body irradiation

    International Nuclear Information System (INIS)

    Weick, J.K.; Antunez, A.; Kraus, T.A.; Fabian, C.J.; Dixon, D.

    1983-01-01

    The combination of cyclophosphamide, adriamycin, vincristine, and prednisone (CHOP) alternating with total body irradiation (TBI) has been shown earlier to be effective therapy in patients with malignant lymphoma who have received prior chemotherapy and/or radiation therapy. A limited institutional pilot study was therefore done by the Southwest Oncology Group between October 1977, and November 1978 to test the benefit of this program in previously untreated persons with Stages 3 and 4 diffuse histology non-Hodgkin's lymphoma. Eleven evaluable patients with the following histologies were treated: 7 poorly differentiated, 2 with histiocytic, 1 with mixed lymphoma and 1 with well-differentiated morphology. Responses were seen in 8/11 patients (6 CR and 2 PR); 5 persons are currently alive and 6 are dead. The median duration of remission is 15 months and the median survival for all patients is 48 months. The therapy was well tolerated with a mean nadir leukocyte count of 3020 x 10 9 /μl (range 1.2 to 5.5) and a mean nadir platelet count of 188 x 10 9 /μl (range 016 to 270). As delivered, this program is capable of producing durable remissions and needs to be verified in a larger series of patients

  9. Effect of Chopped Basalt Fibers on the Mechanical Properties and Microstructure of High Performance Fiber Reinforced Concrete

    Directory of Open Access Journals (Sweden)

    Tehmina Ayub

    2014-01-01

    Full Text Available This paper presents the mechanical properties and the microstructure of the high performance fiber reinforced concrete (HPFRC containing up to 3% volume fraction of chopped Basalt fibers. Three types of the concrete were prepared, out of which, the first type was prepared by utilizing 100% cement content. The other two types of the concrete were prepared by replacing 10% cement content with silica fume and the locally produced metakaolin. Using each concrete type, four mixes were prepared in which Basalt fibers were added in the range of 0–3%; that is, total twelve mixes of the HPFRC concrete were prepared. From each of the twelve concrete mixes, total twelve specimens were cast to determine the mechanical properties of the HPFRC including compressive strength (cube and cylinder, splitting tensile strength, and the flexural strength. In this way, a total of 108 specimens were cast and tested in this study. Test results showed that the addition of the Basalt fibers significantly increased the tensile splitting strength and the flexural strength of the HPFRC, while there was slight improvement in the compressive strength with the addition of Basalt fibers. The microstructure of HPFRC was examined to determine the interfacial transition zone (ITZ between the aggregates and the paste by using field emission scanning electron microscope (FESEM, which showed the improvement of the ITZ due to the addition of the Basalt fibers.

  10. Randomized Trial Comparing R-CHOP Versus High-Dose Sequential Chemotherapy in High-Risk Patients With Diffuse Large B-Cell Lymphomas.

    Science.gov (United States)

    Cortelazzo, Sergio; Tarella, Corrado; Gianni, Alessandro Massimo; Ladetto, Marco; Barbui, Anna Maria; Rossi, Andrea; Gritti, Giuseppe; Corradini, Paolo; Di Nicola, Massimo; Patti, Caterina; Mulé, Antonino; Zanni, Manuela; Zoli, Valerio; Billio, Atto; Piccin, Andrea; Negri, Giovanni; Castellino, Claudia; Di Raimondo, Francesco; Ferreri, Andrés J M; Benedetti, Fabio; La Nasa, Giorgio; Gini, Guido; Trentin, Livio; Frezzato, Maurizio; Flenghi, Leonardo; Falorio, Simona; Chilosi, Marco; Bruna, Riccardo; Tabanelli, Valentina; Pileri, Stefano; Masciulli, Arianna; Delaini, Federica; Boschini, Cristina; Rambaldi, Alessandro

    2016-11-20

    Purpose The benefit of high-dose chemotherapy with autologous stem-cell transplantation (ASCT) as first-line treatment in patients with diffuse large B-cell lymphomas is still a matter of debate. To address this point, we designed a randomized phase III trial to compare rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP)-14 (eight cycles) with rituximab plus high-dose sequential chemotherapy (R-HDS) with ASCT. Patients and Methods From June 2005 to June 2011, 246 high-risk patients with a high-intermediate (56%) or high (44%) International Prognostic Index score were randomly assigned to the R-CHOP or R-HDS arm, and 235 were analyzed by intent to treat. The primary efficacy end point of the study was 3-year event-free survival, and results were analyzed on an intent-to-treat basis. Results Clinical response (complete response, 78% v 76%; partial response, 5% v 9%) and failures (no response, 15% v 11%; and early treatment-related mortality, 2% v 3%) were similar after R-CHOP versus R-HDS, respectively. After a median follow-up of 5 years, the 3-year event-free survival was 62% versus 65% ( P = .83). At 3 years, compared with the R-CHOP arm, the R-HDS arm had better disease-free survival (79% v 91%, respectively; P = .034), but this subsequently vanished because of late-occurring treatment-related deaths. No difference was detected in terms of progression-free survival (65% v 75%, respectively; P = .12), or overall survival (74% v 77%, respectively; P = .64). Significantly higher hematologic toxicity ( P < .001) and more infectious complications ( P < .001) were observed in the R-HDS arm. Conclusion In this study, front-line intensive R-HDS chemotherapy with ASCT did not improve the outcome of high-risk patients with diffuse large B-cell lymphomas.

  11. Expression of CD40 is a positive prognostic factor of diffuse large B-cell lymphoma treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone

    Directory of Open Access Journals (Sweden)

    Song G

    2016-06-01

    Full Text Available Guoqi Song,1 Huiyun Ni,1 Linqing Zou,2 Shukui Wang,3 Fuliang Tian,4 Hong Liu,1 William C Cho5 1Department of Hematology, Affiliated Hospital of Nantong University, Nantong, 2Department of Human Anatomy, Nantong University, Nantong, 3Central Laboratory of Nanjing First Hospital, Nanjing Medical University, Nanjing, 4Maternal and Child Health Hospital of Lianyungang, Lianyungang, Jiangsu, People’s Republic of China; 5Department of Clinical Oncology, Queen Elizabeth Hospital, Kowloon, Hong Kong Objectives: The objective of this study was to investigate the expression level of CD40 and its role in the prognosis of patients with diffuse large B-cell lymphoma (DLBCL who were treated with rituximab-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone.Design and methods: The immunohistochemical expressions of CD40 in 186 well-characterized DLBCL patients were evaluated by tissue microarrays, thereby revealing the relationship of the molecule CD40 with known tumor, patient-related variables, and survival rates.Results: The results showed that CD40 expressions were not statistically different between the germinal center B-cell-like (GCB type and the non-GCB type. We also analyzed the relationships of CD40 expression with overall survival (OS and progression-free survival (PFS in DLBCL patients who were uniformly treated with R-CHOP. A low expression of CD40 compared to high expression is related to poor OS and PFS. Conclusion: Our findings indicate that the CD40 level at onset acts as an independent prognostic predictor of DLBCL patients treated with R-CHOP. Keywords: CD40, diffuse large B-cell lymphoma, R-CHOP, prognostic factor

  12. Construction Of An Optimized Lentiviral Vector Containing Pdx-1 Gene For Transduction Of Stem Cells Towards Gene Therapy Diabetes Type 1

    Directory of Open Access Journals (Sweden)

    S Rahmati

    2013-02-01

    Full Text Available Abstract Background & aim: Nowadays, most of gene therapy protocols are performed by lentiviral vectors. One of the most important factors which is involved in pancreas development and transcription of insulin gene is pancreatic & duodenal homeobox 1 (PDX-1 transcription factor. The goal of this study was to optimize a lentiviral construct, containing pdx-1 gene, to transfect stem cells towards gene therapy of type-1 diabetes. Methods: In this experimental study, first, the pdx-1 gene was multiplied by PCR from pcDNA3.1-pdx-1 and cloned into pTG19-T vector. Then, pdx-1 was subcloned on upstream of IRES-EGFP gene into IRES2-EGFP vector. At the next step, the cloned parts of IRES-EGFP and pdx-1 were isolated and cloned into the lentiviral expression vector pSINTREM in upstream of TRE-CMV gene. After sequencing, final construct was transfected into HEK 293 cells and gene expression of pdx-1 was evaluated using flow cytometry analysis and reverse fluorescent microscopy. Results: Flow cytometry results and inverted fluorescent microscopy observing showed that pdx-1 and GFP genes are expressed in cells transfected with final recombinant construct. Conclusion: Regarding the design of this construct, to ensure long time expression with higher in vivo and in vitro expression efficiency for stem cells and also use of Tet on induced optimized system, it seems that the current construct can be among the best ones to transfect stem cells. Key words: Gene therapy, Diabetes, Stem cells

  13. Subamolide B Isolated from Medicinal Plant Cinnamomum subavenium Induces Cytotoxicity in Human Cutaneous Squamous Cell Carcinoma Cells through Mitochondrial and CHOP-Dependent Cell Death Pathways

    Directory of Open Access Journals (Sweden)

    Shu-Yi Yang

    2013-01-01

    Full Text Available Subamolide B is a butanolide isolated from Cinnamomum subavenium, a medicinal plant traditionally used to treat various ailments including carcinomatous swelling. We herein reported for the first time that subamolide B potently induced cytotoxicity against diverse human skin cancer cell lines while sparing nonmalignant cells. Mechanistic studies on human cutaneous squamous cell carcinoma (SCC cell line SCC12 highlighted the involvement of apoptosis in subamolide B-induced cytotoxicity, as evidenced by the activation of caspases-8, -9, -4, and -3, the increase in annexin V-positive population, and the partial restoration of cell viability by cotreatment with the pan-caspase inhibitor z-VAD-fmk. Additionally, subamolide B evoked cell death pathways mediated by FasL/Fas, mitochondria, and endoplasmic reticulum (ER stress, as supported by subamolide B-induced FasL upregulation, BCL-2 suppression/cytosolic release of cytochrome c, and UPR activation/CHOP upregulation, respectively. Noteworthy, ectopic expression of c-FLIPL or dominant-negative mutant of FADD failed to impair subamolide B-induced cytotoxicity, whereas BCL-2 overexpression or CHOP depletion greatly rescued subamolide B-stimulated cells. Collectively, these results underscored the central role of mitochondrial and CHOP-mediated cell death pathways in subamolide B-induced cytotoxicity. Our findings further implicate the potential of subamolide B for cutaneous SCC therapy or as a lead compound for developing novel chemotherapeutic agents.

  14. Application of the gravimetric method to closing the material balance around the chop-leach cell of a spent-fuel reprocessing plant

    International Nuclear Information System (INIS)

    Fishbone, L.G.

    1985-01-01

    For a spent-fuel reprocessing plant handling commercial light-water-reactor fuel, plutonium accounting is traditionally done for the material balance area (MBA) extending from the input accountability tank to the product accountability tank - the process MBA. Consider an MBA comprising the chop-leach cell, with an inward flow consisting of the intact spent-fuel assemblies and outward flows consisting of leached hulls and dissolver solution. Given knowledge of the original uranium mass in the fuel and a measurement of the uranium-plutonium concentration ratio in the dissolver solution, the gravimetric method can be used to determine the amount of plutonium in the spent-fuel assemblies. A measurement of residual plutonium in the leached hulls would then permit the determination of a plutonium material balance for the chop-leach cell alone, since the volumetrically determined plutonium in the input accountability tank yields the plutonium in the flow leaving the chop-leach cell for the process MBA. The uncertainty in the balance can be estimated given the individual measurement uncertainties

  15. Significance of tumor size and radiation dose to local control in stage I-III diffuse large cell lymphoma treated with CHOP-Bleo and radiation

    International Nuclear Information System (INIS)

    Fuller, Lillian M.; Krasin, Matthew J.; Velasquez, William S.; Allen, Pamela K.; McLaughlin, Peter; Rodriguez, M. Alma; Hagemeister, Fredrick B.; Swan, Forrest; Cabanillas, Fernando; Palmer, Judy L.; Cox, James D.

    1995-01-01

    Purpose: The purpose of this study was to evaluate the possible effect of adjunctive involved field (IF) radiotherapy on long-term local control for patients with Ann Arbor Stage I-III diffuse large cell lymphoma (DLCL) who achieved a complete remission on a combined modality program which included cyclophosphamide, doxorubicin, vincristine, prednisone, and Bleomycin (CHOP-Bleo). Methods and Materials: One hundred and ninety patients with Ann Arbor Stage I-III DLCL were treated with CHOP-Bleo and radiotherapy. Analyses were undertaken to determine (a) response to treatment according to stage, extent of maximum local disease, and irradiation dose either < 40 Gy or ≥ 40 Gy and (b) relapse patterns. Results: A complete remission (CR) was achieved in 162 patients. Among patients who achieved a CR, local control was better for those who received tumor doses of ≥ 40 Gy (97%) than for those who received < 40 Gy (83%) (p = 0.002.) Among those with extensive local disease, the corresponding control rates were 88% and 71%, respectively. A study of distant relapse patterns following a CR showed that the first relapse usually involved an extranodal site. Conclusion: Radiotherapy was an effective adjunctive treatment to CHOP-Bleo for patients with stage I-III DLCL who achieved a CR. Patterns of relapse suggested that total nodal irradiation (TNI) possibly could have benefited a small subset of patients

  16. Resultados facodinámicos del chopping inverso en la cirugía de catarata 2009 Phacodynamic outcomes of the reversed chopping technique in the cataract surgery in 2009

    Directory of Open Access Journals (Sweden)

    Abel Plasencia Blanco

    2011-12-01

    Full Text Available Objetivo: Evaluar los resultados facodinámicos alcanzados con la técnica de cirugía de catarata por facoemulsificación chopping inverso en el Instituto Cubano de Oftalmología “Ramón Pando Ferrer” en 2009. Métodos: Se realizó un estudio descriptivo y prospectivo en 182 pacientes (ojos con diagnóstico de catarata presenil y senil, que aceptaron someterse a la técnica quirúrgica. Los resultados facodinámicos de la técnica se evaluaron según las siguientes variables: dureza del cristalino, mejor agudeza visual con y sin corrección, poder de ultrasonido, tiempo de facoemulsificación, tiempo efectivo de facoemulsificación, densidad de células endoteliales y complicaciones. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas, se aplicó la prueba t de Student para su comparación. Resultados: La agudeza visual con corrección obtenida significó cinco líneas en la escala de Snellen. El tiempo de ultrasonido aplicado estuvo dentro de valores normales en relación con la dureza del núcleo. La pérdida de células endoteliales no fue importante. La complicación operatoria no fue significativa. Conclusión: La técnica se consideró efectiva con resultados muy favorables. Es perfectamente aplicable para todos los grados de dureza de la catarata, evitándose con ella un gran número de complicaciones. Esto le permite al paciente una rápida incorporación a su vida social.Objectives: To assess the phacodynamic outcomes of the reversed chopping phacoemulsification technique applied in cataract surgery at “Ramon Pando Ferrer” Cuban Institute of Ophthalmology between January and December, 2009. Methods: A prospective and descriptive study was performed on 182 patients (eyes diagnosed with pre-senile and senile cataract, who agreed to be operated on with this procedure. The phacodynamic outcomes were evaluated according to the following variables: lens hardness, best visual acuity with

  17. Effects of Vector Backbone and Pseudotype on Lentiviral Vector-mediated Gene Transfer: Studies in Infant ADA-Deficient Mice and Rhesus Monkeys

    Science.gov (United States)

    Carbonaro Sarracino, Denise; Tarantal, Alice F; Lee, C Chang I.; Martinez, Michele; Jin, Xiangyang; Wang, Xiaoyan; Hardee, Cinnamon L; Geiger, Sabine; Kahl, Christoph A; Kohn, Donald B

    2014-01-01

    Systemic delivery of a lentiviral vector carrying a therapeutic gene represents a new treatment for monogenic disease. Previously, we have shown that transfer of the adenosine deaminase (ADA) cDNA in vivo rescues the lethal phenotype and reconstitutes immune function in ADA-deficient mice. In order to translate this approach to ADA-deficient severe combined immune deficiency patients, neonatal ADA-deficient mice and newborn rhesus monkeys were treated with species-matched and mismatched vectors and pseudotypes. We compared gene delivery by the HIV-1-based vector to murine γ-retroviral vectors pseudotyped with vesicular stomatitis virus-glycoprotein or murine retroviral envelopes in ADA-deficient mice. The vesicular stomatitis virus-glycoprotein pseudotyped lentiviral vectors had the highest titer and resulted in the highest vector copy number in multiple tissues, particularly liver and lung. In monkeys, HIV-1 or simian immunodeficiency virus vectors resulted in similar biodistribution in most tissues including bone marrow, spleen, liver, and lung. Simian immunodeficiency virus pseudotyped with the gibbon ape leukemia virus envelope produced 10- to 30-fold lower titers than the vesicular stomatitis virus-glycoprotein pseudotype, but had a similar tissue biodistribution and similar copy number in blood cells. The relative copy numbers achieved in mice and monkeys were similar when adjusted to the administered dose per kg. These results suggest that this approach can be scaled-up to clinical levels for treatment of ADA-deficient severe combined immune deficiency subjects with suboptimal hematopoietic stem cell transplantation options. PMID:24925206

  18. Evaluation of Lentiviral-Mediated Expression of Sodium Iodide Symporter in Anaplastic Thyroid Cancer and the Efficacy of In Vivo Imaging and Therapy

    Directory of Open Access Journals (Sweden)

    Chien-Chih Ke

    2011-01-01

    Full Text Available Anaplastic thyroid carcinoma (ATC is one of the most deadly cancers. With intensive multimodalities of treatment, the survival remains low. ATC is not sensitive to 131I therapy due to loss of sodium iodide symporter (NIS gene expression. We have previously generated a stable human NIS-expressing ATC cell line, ARO, and the ability of iodide accumulation was restored. To make NIS-mediated gene therapy more applicable, this study aimed to establish a lentiviral system for transferring hNIS gene to cells and to evaluate the efficacy of in vitro and in vivo radioiodide accumulation for imaging and therapy. Lentivirus containing hNIS cDNA were produced to transduce ARO cells which do not concentrate iodide. Gene expression, cell function, radioiodide imaging and treatment were evaluated in vitro and in vivo. Results showed that the transduced cells were restored to express hNIS and accumulated higher amount of radioiodide than parental cells. Therapeutic dose of 131I effectively inhibited the tumor growth derived from transduced cells as compared to saline-treated mice. Our results suggest that the lentiviral system efficiently transferred and expressed hNIS gene in ATC cells. The transduced cells showed a promising result of tumor imaging and therapy.

  19. The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

    Science.gov (United States)

    Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

    2012-01-01

    Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

  20. Effects of vector backbone and pseudotype on lentiviral vector-mediated gene transfer: studies in infant ADA-deficient mice and rhesus monkeys.

    Science.gov (United States)

    Carbonaro Sarracino, Denise; Tarantal, Alice F; Lee, C Chang I; Martinez, Michele; Jin, Xiangyang; Wang, Xiaoyan; Hardee, Cinnamon L; Geiger, Sabine; Kahl, Christoph A; Kohn, Donald B

    2014-10-01

    Systemic delivery of a lentiviral vector carrying a therapeutic gene represents a new treatment for monogenic disease. Previously, we have shown that transfer of the adenosine deaminase (ADA) cDNA in vivo rescues the lethal phenotype and reconstitutes immune function in ADA-deficient mice. In order to translate this approach to ADA-deficient severe combined immune deficiency patients, neonatal ADA-deficient mice and newborn rhesus monkeys were treated with species-matched and mismatched vectors and pseudotypes. We compared gene delivery by the HIV-1-based vector to murine γ-retroviral vectors pseudotyped with vesicular stomatitis virus-glycoprotein or murine retroviral envelopes in ADA-deficient mice. The vesicular stomatitis virus-glycoprotein pseudotyped lentiviral vectors had the highest titer and resulted in the highest vector copy number in multiple tissues, particularly liver and lung. In monkeys, HIV-1 or simian immunodeficiency virus vectors resulted in similar biodistribution in most tissues including bone marrow, spleen, liver, and lung. Simian immunodeficiency virus pseudotyped with the gibbon ape leukemia virus envelope produced 10- to 30-fold lower titers than the vesicular stomatitis virus-glycoprotein pseudotype, but had a similar tissue biodistribution and similar copy number in blood cells. The relative copy numbers achieved in mice and monkeys were similar when adjusted to the administered dose per kg. These results suggest that this approach can be scaled-up to clinical levels for treatment of ADA-deficient severe combined immune deficiency subjects with suboptimal hematopoietic stem cell transplantation options.

  1. Prognostic significances of overexpression MYC and/or BCL2 in R-CHOP-treated diffuse large B-cell lymphoma: A Systematic review and meta-analysis.

    Science.gov (United States)

    Li, Lu; Li, Yanyan; Que, Ximei; Gao, Xue; Gao, Qian; Yu, Mingxing; Ma, Kaili; Xi, Yanfeng; Wang, Tong

    2018-04-19

    Numerous studies have investigated the prognostic values of MYC and/or BCL2 protein overexpression in diffuse large B-cell lymphoma (DLBCL). However, the results still demonstrate discrepancies among different studies. We aimed to do a systematic review and meta-analysis on the relationships between overexpression MYC and/or BCL2 and DLBCLs treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP). This study followed the guidelines of PRISMA and Cochrane handbook. The hazard ratios (HRs) for overall survival (OS) were pooled to estimate the main effect size. Twenty studies recruited a total of 5576 patients were available for this meta-analysis. The results showed that MYC (HR = 1.96, 95%CI (confidence interval) = 1.69-2.27)without heterogeneity(I 2  = 17.2%, P = 0.280), BCL2 (HR = 1.65, 95%CI = 1.43-1.89, I 2  = 20.7%, P = 0.234) protein overexpression, and co-overexpression (HR = 2.58, 95%CI = 2.19-3.04, I 2  = 17.2%, P = 0.275) had a poor prognosis in R-CHOP treated DLBCL patients, respectively. The current analysis indicated that MYC and/or BCL2 protein overexpression, and particularly co-overexpression was related to short overall survival in R-CHOP treated DLBCL patients, showing that application of the two new biomarkers can help to better stratify DLBCL patients and guide targeted treatment.

  2. Comparison between Antiemetic Effects of Palonosetron and Granisetron on Chemotherapy-Induced Nausea and Vomiting in Japanese Patients Treated with R-CHOP.

    Science.gov (United States)

    Uchida, Mayako; Mori, Yasuo; Nakamura, Tsutomu; Kato, Koji; Kamezaki, Kenjiro; Takenaka, Katsuto; Shiratsuchi, Motoaki; Kadoyama, Kaori; Miyamoto, Toshihiro; Akashi, Koichi

    2017-01-01

    In the present study, the antiemetic effect of palonosetron, not combined with dexamethasone and aprepitant, on chemotherapy-induced nausea and vomiting was evaluated in patients with malignant lymphoma receiving first-line rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) therapy, and was compared to that of granisetron. A total of 74 patients with non-Hodgkin lymphoma were included in this study (April 2007 to December 2015). Palonosetron (0.75 mg) or granisetron (3 mg) was intravenously administered before R-CHOP therapy. The proportions of patients with complete response (CR) during the overall (0-120 h after the start of R-CHOP therapy), acute (0-24 h) and delayed (24-120 h) phases were evaluated. CR was defined as no vomiting and no use of antiemetic rescue medication. A total of 32 and 42 patients were treated with palonosetron and granisetron, respectively. The CR rate in the palonosetron group was significantly higher than that in the granisetron group during the delayed phase (90.6 and 61.9%, respectively; p=0.007). Logistic regression analysis showed that use of palonosetron improved the CR rate during the delayed phase, compared to use of granisetron. Female sex, age less than 60 years, no habitual alcohol intake, and Eastern Cooperative Oncology Group performance status (ECOG-PS) score of 1 were significant risk factors associated with non-CR. The findings of this study suggested the superiority of palonosetron to granisetron, without accompanying dexamethasone and aprepitant, for chemotherapy-induced nausea and vomiting in patients with malignant lymphoma.

  3. Assessment of different dietary fibers (tomato fiber, beet root fiber, and inulin) for the manufacture of chopped cooked chicken products.

    Science.gov (United States)

    Cava, Ramón; Ladero, Luis; Cantero, V; Rosario Ramírez, M

    2012-04-01

    Three dietary fibers (tomato fiber [TF], beet root fiber [BRF], and inulin) at 3 levels of addition (1%, 2%, and 3%) were assessed for the manufacture of chopped, cooked chicken products and compared with a control product without fiber added. The effect of fiber incorporation on (i) batters, (ii) cooked (30 min at 70 °C), and (iii) cooked and stored (for 10 d at 4 °C) chicken products were studied. The addition of the fiber to chicken meat products reduced the pH of chicken batters in proportional to the level of fiber addition. Fiber incorporation increased water-holding capacity but only the addition of TF reduced cook losses. The color of batters and cooked products was significantly modified by the type and level of fiber added. These changes were more noticeable when TF was added. Texture parameters were affected by the incorporation of TF and BRF; they increased the hardness in proportional to the level of addition. The addition of tomato and BRF to chicken meat products reduced lipid oxidation processes. These changes were dependent on the level of fiber added. The reduction of lipid oxidation processes was more marked in TF meat products than in products with other types of fibers. In contrast, the addition level of inulin increased TBA-RS numbers in chicken meat products. Although the addition of TF increased the redness of the meat products, the use of this fiber was more suitable as it reduced the extent of lipid oxidation processes. INDUSTRIAL APPLICATION: Nowadays, the reduction of fat and the increase of fiber content in meat products is one of the main goals of meat industry. Numerous sources of fiber can be added to the meat products; however, before that it is necessary to study their technological effect on raw and cooked meat products in order to evaluate their suitability for meat products manufacture. In addition, some of them could have beneficial effect on meat products conservation that could also increase their shelf life. © 2012

  4. Carriers of a VEGFA enhancer polymorphism selectively binding CHOP/DDIT3 are predisposed to increased circulating levels of thyroid-stimulating hormone

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Troelsen, Jesper Thorvald; Balslev-Harder, Marie

    2017-01-01

    BACKGROUND: Levels of serum thyroid-stimulating hormone (TSH) indicate thyroid function, because thyroid hormone negatively controls TSH release. Genetic variants in the vascular endothelial growth factor A (VEGFA) gene are associated with TSH levels. The aim of this study was to characterise...... levels (p=0.0014). The SNP rs881858 is located in a binding site for CHOP (C/EBP homology protein) and c/EBPβ (ccaat enhancer binding protein β). Reporter-gene analysis showed increased basal enhancer activity of the rs881858 A-allele versus the G-allele (34.5±9.9% (average±SEM), p=0.0012), while co...

  5. Bullet Design and Fabrication of Dual Mode Pyroelectric Sensor: High Sensitive Energymeter for Nd: YAG Laser and Detector for Chopped He-Ne Laser

    Directory of Open Access Journals (Sweden)

    S. SATAPATHY

    2008-05-01

    Full Text Available Pyroelectric sensor using TGS has been designed and fabricated which can be operated in laser energy meter mode as well as pyroelectric detector mode. The amplifying circuit configuration has very good signal to noise ratio, very high input impedance and low drift. The pyroelectric sensor has been tested using Q-switched Nd: YAG laser and chopped He-Ne laser. The sensitivity of pyroelectric sensor in energymeter mode is 421.7V/J and the voltage responsivity of the pyroelectric sensor is 3.27 V/W in detector mode.

  6. Lentiviral vectors containing mouse Csf1r control elements direct macrophage-restricted expression in multiple species of birds and mammals

    Directory of Open Access Journals (Sweden)

    Clare Pridans

    2014-01-01

    Full Text Available The development of macrophages requires signaling through the lineage-restricted receptor Csf1r. Macrophage-restricted expression of transgenic reporters based upon Csf1r requires the highly conserved Fms-intronic regulatory element (FIRE. We have created a lentiviral construct containing mouse FIRE and promoter. The lentivirus is capable of directing macrophage-restricted reporter gene expression in mouse, rat, human, pig, cow, sheep, and even chicken. Rat bone marrow cells transduced with the lentivirus were capable of differentiating into macrophages expressing the reporter gene in vitro. Macrophage-restricted expression may be desirable for immunization or immune response modulation, and for gene therapy for lysosomal storage diseases and some immunodeficiencies. The small size of the Csf1r transcription control elements will allow the insertion of large “cargo” for applications in gene therapy and vaccine delivery.

  7. Aspects of the epidemiology, research, and control of lentiviral infections of small ruminants and their relevance to Dutch sheep and goat farming.

    Science.gov (United States)

    van Maanen, C; Brinkhof, J M A; Moll, L; Colenbrander, B; Houwers, D J

    2010-08-15

    In 1862, the veterinarian Loman reported the first sheep in The Netherlands with symptoms associated with lentiviral infection, although at the time the symptoms were ascribed to ovine progressive pneumonia. In the following century, similar cases were reported by South African, French, American, and Icelandic researchers. Extensive research into the pathology, aetiology, and epidemiology of this slowly progressive and ultimately fatal disease was initiated in several countries, including the Netherlands. Studies of the causative agents--maedi visna virus (MVV) in sheep and caprine arthritis encephalitis virus (CAEV) in goats, comprising the heterogeneous group of the small ruminant lentiviruses (SRLV)--prompted the development of diagnostic methods and the initiation of disease control programmes in many European countries including the Netherlands, as a pioneer in 1982, and in the U.S.A. and Canada.

  8. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing

    Directory of Open Access Journals (Sweden)

    Pavel I. Ortinski

    2017-06-01

    Full Text Available The CRISPR/Cas9 systems have revolutionized the field of genome editing by providing unprecedented control over gene sequences and gene expression in many species, including humans. Lentiviral vectors (LVs are one of the primary delivery platforms for the CRISPR/Cas9 system due to their ability to accommodate large DNA payloads and sustain robust expression in a wide range of dividing and non-dividing cells. However, long-term expression of LV-delivered Cas9/guide RNA may lead to undesirable off-target effects characterized by non-specific RNA-DNA interactions and off-target DNA cleavages. Integrase-deficient lentiviral vectors (IDLVs present an attractive means for delivery of CRISPR/Cas9 components because: (1 they are capable of transducing a broad range of cells and tissues, (2 have superior packaging capacity compared to other vectors (e.g., adeno-associated viral vectors, and (3 they are expressed transiently and demonstrate very weak integration capability. In this manuscript, we aimed to establish IDLVs as a means for safe and efficient delivery of CRISPR/Cas9. To this end, we developed an all-in-one vector cassette with increased production efficacy and demonstrated that CRISPR/Cas9 delivered by the improved IDLV vectors can mediate rapid and robust gene editing in human embryonic kidney (HEK293T cells and post-mitotic brain neurons in vivo, via transient expression and with higher gene-targeting specificity than the corresponding integrase-competent vectors.

  9. Prognostic Value of the Pretreatment Advanced Lung Cancer Inflammation Index (ALI) in Diffuse Large B Cell Lymphoma Patients Treated with R-CHOP Chemotherapy.

    Science.gov (United States)

    Park, Young Hoon; Yi, Hyeon Gyu; Lee, Moon Hee; Kim, Chul Soo; Lim, Joo Han

    2017-01-01

    The Advanced Lung Cancer Inflammation Index (ALI, body mass index × albumin/neutrophil-to-lymphocyte ratio) has been demonstrated to be a prognostic factor of survival in some solid cancers. We retrospectively investigated the usefulness of the ALI to predict chemotherapy response and survival in 212 patients with diffuse large B cell lymphoma (DLBCL) treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone) chemotherapy. Patients were allocated to a low ALI group (n = 82, 38.7%) or a high ALI group (n = 130, 61.3%) according to an optimal pretreatment ALI cut-off value of 15.5 as determined by receiver operating curve analysis. The low ALI group displayed more adverse clinical characteristics, lower rates of complete remission (54.9 vs. 75.4%, p = 0.008), and poorer 5-year progression-free (PFS, 58.1 vs. 77.3%, p = 0.006) and overall (OS, 64.2 vs. 80.2%, p = 0.008) survival. Multivariate analysis showed that low ALI was found to independently predict shorter PFS and OS. Interestingly, a low ALI reverted to a high ALI during treatment in 58 patients (27.4%), and the 5-year OS of these patients was better than that of patients whose ALI remained low (n = 24, 72.5 vs. 24%, p ALI might be an easily available marker for predicting clinical outcomes in DLBCL patients treated with R-CHOP chemotherapy. © 2017 S. Karger AG, Basel.

  10. The γ-secretase cleavage product of Polycystin-1 regulates TCF and CHOP-mediated transcriptional activation through a p300-dependent mechanism

    Science.gov (United States)

    Merrick, David; Chapin, Hannah; Baggs, Julie E.; Yu, Zhiheng; Somlo, Stefan; Sun, Zhaoxia; Hogenesch, John B.; Caplan, Michael

    2011-01-01

    Summary Mutations in Pkd1, encoding polycystin-1 (PC1), cause Autosomal Dominant Polycystic Kidney Disease (ADPKD). We show that the carboxy-terminal tail (CTT) of PC1 is released by γ-secretase-mediated cleavage and regulates the Wnt and CHOP pathways by binding the transcription factors TCF and CHOP, disrupting their interaction with the common transcriptional co-activator p300. Loss of PC1 causes increased proliferation and apoptosis, while reintroducing PC1-CTT into cultured Pkd1 null cells reestablishes normal growth rate, suppresses apoptosis, and prevents cyst formation. Inhibition of γ-secretase activity impairs the ability of PC1 to suppress growth and apoptosis, and leads to cyst formation in cultured renal epithelial cells. Expression of the PC1-CTT is sufficient to rescue the dorsal body curvature phenotype in zebrafish embryos resulting from either γ-secretase inhibition or suppression of Pkd1 expression. Thus, γ-secretase-dependent release of the PC1-CTT creates a protein fragment whose expression is sufficient to suppress ADPKD-related phenotypes in vitro and in vivo. PMID:22178500

  11. Archaeal community dynamics and abiotic characteristics in a mesophilic anaerobic co-digestion process treating fruit and vegetable processing waste sludge with chopped fresh artichoke waste.

    Science.gov (United States)

    Ros, M; Franke-Whittle, I H; Morales, A B; Insam, H; Ayuso, M; Pascual, J A

    2013-05-01

    This study evaluated the feasibility of obtaining methane in anaerobic digestion (AD) from the waste products generated by the processing of fruit and vegetables. During the first phase (0-55 d) of the AD using sludge from fruit and vegetable processing, an average value of 244±88 L kg(-1) dry matter d(-1)of biogas production was obtained, and methane content reached 65% of the biogas. Co-digestion with chopped fresh artichoke wastes in a second phase (55-71 d) enhanced biogas production, and resulted in an average value of 354±68 L kg(-1) dry matter d(-1), with higher methane content (more than 70%). The archaeal community involved in methane production was studied using the ANAEROCHIP microarray and real-time PCR. Results indicated that species of Methanosaeta and Methanosarcina were important during the AD process. Methanosarcina numbers increased after the addition of chopped fresh artichoke, while Methanosaeta numbers decreased. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Chopped basalt fibres: A new perspective in reinforcing poly(lactic acid to produce injection moulded engineering composites from renewable and natural resources

    Directory of Open Access Journals (Sweden)

    P. Tamas

    2013-02-01

    Full Text Available This paper focuses on the reinforcing of Poly(lactic acid with chopped basalt fibres by using silane treated and untreated basalt fibres. Composite materials with 5–10–15–20–30–40 wt% basalt fibre contents were prepared from silane sized basalt fibres using extrusion, and injection moulding, while composites with 5–10–15 wt% basalt fibre contents were also prepared by using untreated basalt fibres as control. The properties of the injection moulded composites were extensively examined by using quasi-static (tensile, three-point bending and dynamic mechanical tests (notched and unnotched Charpy impact tests, dynamic mechanical analysis (DMA, differential scanning calorimetry (DSC, heat deflection temperature (HDT analysis, dimensional stability test, as well as melt flow index (MFI analysis and scanning electron microscopic (SEM observations. It was found that silane treated chopped basalt fibres are much more effective in reinforcing Poly(lactic acid than natural fibres; although basalt fibres are not biodegradable but they are still considered as natural (can be found in nature in the form of volcanic rocks and biologically inert. It is demonstrated in this paper that by using basalt fibre reinforcement, a renewable and natural resource based composite can be produced by injection moulding with excellent mechanical properties suitable even for engineering applications. Finally it was shown that by using adequate drying of the materials, composites with higher mechanical properties can be achieved compared to literature data.

  13. The amount of food ingested in a single meal by rainbow trout offered chopped herring, dry and wet diets

    Science.gov (United States)

    Ruohonen; Grove; McIlroy

    1997-07-01

    Two-year-old 1·5-kg rainbow trout were held in cages and conditioned by feeding either on low-fat chopped herring (H trout) or dry pellets (P trout) for 15 weeks. Their satiation amounts were then determined under standard conditions. On a wet weight basis H trout ate 2·5-3·5 times more food than P trout; this was sufficient to compensate for the high water content of herring and thereby maintain the dry matter intake. When P trout were offered herring (PH trout) they consumed more food than when offered dry pellets but not as much as H trout. Stomach capacity restricted the intake and their dry matter intake was reduced by c. 40%. When H trout were offered dry pellets (HP trout) they adjusted their intake immediately close to the level of P trout although their larger stomachs could have accommodated more than twice this volume of dry food. The return of appetite after a satiation meal was almost linear with time. Appetite increased at c. 556 mg g-1 body weight h-1 for H trout and at 142 mg g-1 bw h-1 for P trout. The return of appetite in PH trout was significantly slower (c. 370 mg g-1 bw h-1) than in H trout; the previous dietary history of the PH trout limited their capacity to process larger volumes of wet food in a single meal. Fish offered dry diet (P and HP trout) had similar rates of appetite return despite their previous feeding history suggesting that the property of the dry feed itself might limit meal size. The total gastric emptying time of diets of similar dry matter content (with and without large amounts of water) was similar, but the delay time before gastric emptying starts tended to be longer for dry diets. Dry pellets appear to impose a demand for water that prolongs the gastric delay. This water demand is met partly by drinking since the trout fed on dry pellets drank significantly more (436±189 mg kg-1 h-1) than unfed and herring-fed trout which drank little or not at all (65±113 and 70±66 mg kg-1 h-1 respectively). Dietary water

  14. TRB3 reverses chemotherapy resistance and mediates crosstalk between endoplasmic reticulum stress and AKT signaling pathways in MHCC97H human hepatocellular carcinoma cells.

    Science.gov (United States)

    Li, Yang; Zhu, Danxi; Hou, Lidan; Hu, Bin; Xu, Min; Meng, Xiangjun

    2018-01-01

    Tribbles homolog 3 (TRB3), a type of pseudokinase that contains a consensus serine/threonine kinase catalytic core structure, is upregulated in hepatocellular carcinoma. However, the effect of TRB3 expression in hepatocellular carcinoma and the molecular mechanisms underlying TRB3-mediated effects on tumorigenesis in hepatocellular carcinoma have not been fully elucidated. The present study focused on the effect of TRB3 expression in MHCC97H hepatocellular carcinoma cells and investigated the underlying molecular mechanisms in MHCC97H cells. In the present study, it was revealed that TRB3 was significantly overexpressed in the MHCC97H hepatocellular carcinoma cell compared with L-02 normal hepatic cells. Under endoplasmic reticulum (ER) stress induced by thapsigargin and tunicamycin, the levels of TRB3, CCAAT/enhancer binding protein homologous protein (CHOP), protein kinase B (AKT) and phosphorylated (p)AKT expression were upregulated. Furthermore, when the expression of TRB3 was silenced by short hairpin (sh)RNA, the survival of MHCC97H hepatocellular carcinoma cells was increased. Notably, following transduction with lentiviral containing TRB3-shRNA, cell survival also increased after treatment with chemotherapy drug cisplatin. The present study demonstrated that knockdown of CHOP by shRNA was able to reduce TRB3 expression, and the knockdown of TRB3 markedly increased the level of pAKT. TRB3 was overexpressed in MHCC97H hepatocellular carcinoma cells, particularly under endoplasmic reticulum stress. Knockdown of TRB3 was able to increase cell survival. Therefore, TRB3 expression may induce apoptosis and reverse resistance to chemotherapy in MHCC97H hepatic carcinoma cells. The present study suggests that TRB3 is a key molecule that mediates the crosstalk between ER stress and AKT signal pathways. Furthermore, the present study may provide further insight into the cancer biology of hepatocellular carcinoma and the development of anticancer drugs targeting the ER

  15. DNMT1 is predictive of survival and associated with Ki-67 expression in R-CHOP-treated diffuse large B-cell lymphomas

    DEFF Research Database (Denmark)

    Loo, Suet Kee; Ch'ng, Ewe Seng; Lawrie, Charles H

    2017-01-01

    .9%) with higher expression in germinal centre B-cell-like (GCB)-DLBCL subtype. Low and negative DNMT1 expression (20% cut-off, n = 33/230, 14.3%) was predictive of worse overall survival (OS; p p ...DNMT1 is a target of approved anti-cancer drugs including decitabine. However, the prognostic value of DNMT1 protein expression in R-CHOP-treated diffuse large B-cell lymphomas (DLBCLs) remains unexplored. Here we showed that DNMT1 was expressed in the majority of DLBCL cases (n = 209/230, 90......% did not achieve 5-year OS and PFS, respectively, indicating that DNMT1 positive patients showed considerably heterogeneous outcomes. Moreover, DNMT1 was frequently expressed in mitotic cells and significantly correlated with Ki-67 or BCL6 expression (r = 0.60 or 0.44, respectively; p

  16. Patients with diffuse large B-cell lymphoma of germinal center origin with BCL2 translocations have poor outcome, irrespective of MYC status: a report from an International DLBCL rituximab-CHOP Consortium Program Study.

    NARCIS (Netherlands)

    Visco, C.; Tzankov, A.; Xu-Monette, Z.Y.; Miranda, R.N.; Tai, Y.C.; Li, Y.; Liu, W.M.; d'Amore, E.S.; Li, Y.O.; Montes-Moreno, S.; Dybkaer, K.; Chiu, A.; Orazi, A.; Zu, Y.; Bhagat, G.; Wang, H.Y.; Dunphy, C.H.; His, E.D.; Zhao, X.F.; Choi, W.W.; Krieken, J.H.J.M. van; Huang, Q.; Ai, W.; O'Neill, S.; Ponzoni, M.; Ferreri, A.J.; Kahl, B.S.; Winter, J.N.; Go, R.S.; Dirnhofer, S.; Piris, M.A.; Moller, M.B.; Wu, L.; Medeiros, L.J.; Young, K.H.

    2013-01-01

    Diffuse large B-cell lymphoma can be classified by gene expression profiling into germinal center and activated B-cell subtypes with different prognoses after rituximab-CHOP. The importance of previously recognized prognostic markers, such as Bcl-2 protein expression and BCL2 gene abnormalities, has

  17. 9 CFR 319.105 - “Ham patties,” “Chopped ham,” “Pressed ham,” “Spiced ham,” and similar products.

    Science.gov (United States)

    2010-01-01

    ... MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Cured Meats, Unsmoked and Smoked § 319.105 “Ham patties,” “Chopped ham... of cured pork product Minimum meat PFF percentage 1 Product name and qualifying statements “Ham...

  18. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  19. 3-Bromopyruvate enhances TRAIL-induced apoptosis in human nasopharyngeal carcinoma cells through CHOP-dependent upregulation of TRAIL-R2.

    Science.gov (United States)

    Can, Zhou; Lele, Song; Zhirui, Zhang; Qiong, Pan; Yuzhong, Chen; Lingling, Liu; Surong, Zhao; Yiming, Sun; Pei, Zhang; Chenchen, Jiang; Liu, Hao

    2017-08-01

    Past reports have shown that the sensitivity of cancer cells to TRAIL-induced apoptosis is related to their expression of TRAIL-death receptors on the cell surface. However, the level of TRAIL-death receptors expression on cancer cells is always low. Our previous research showed that nasopharyngeal carcinoma (NPC) cells have a poor sensitivity to low doses of TRAIL. Here, we evaluated combined treatment with the energy inhibitor 3-bromopyruvate (3BP) and TRAIL as a method to produce an increased apoptotic response in NPC cells. The results showed that 3BP and TRAIL together produced higher cytotoxicity and increased TRAIL-R2 expression in NPC cells compared with the effects of either 3BP or TRAIL alone. These findings led us to hypothesize that 3BP may sensitize NPC cells to TRAIL. 3BP is a metabolic blocker that inhibits hexokinase II activity, suppresses ATP production, and induces endoplasmic reticulum (ER) stress. Our results showed that 3BP also activated AMP-activated protein kinase, which we found to play an important role in the induction of ER stress by 3BP. Furthermore, the induction of TRAIL-R2 expression and the sensitization of the NPC cells to TRAIL by 3BP were reduced when we inhibited the expression of CHOP. Taken together, our results showed that a low dose of 3BP sensitized NPC cells to TRAIL-induced apoptosis by the upregulation of CHOP, which was mediated by the activation of AMP-activated protein kinase and ER stress. The results showed that 3BP is a promising candidate agent for enhancing the therapeutic response to TRAIL in NPC.

  20. P38 MAPK expression and activation predicts failure of response to CHOP in patients with Diffuse Large B-Cell Lymphoma

    International Nuclear Information System (INIS)

    Vega, Gabriel G.; Avilés-Salas, Alejandro; Chalapud, J. Ramón; Martinez-Paniagua, Melisa; Pelayo, Rosana; Mayani, Héctor; Hernandez-Pando, Rogelio; Martinez-Maza, Otoniel; Huerta-Yepez, Sara; Bonavida, Benjamin; Vega, Mario I.

    2015-01-01

    The p38 MAPK is constitutively activated in B-NHL cell lines and regulates chemoresistance. Accordingly, we hypothesized that activated p38 MAPK may be associated with the in vivo unresponsiveness to chemotherapy in B-NHL patients. Tissue microarrays generated from eighty untreated patients with Diffused Large B Cell Lymphoma (DLBCL) were examined by immunohistochemistry for the expression of p38 and phospho p38 (p-p38) MAPK. In addition, both Bcl-2 and NF-κB expressions were determined. Kaplan Meier analysis was assessed. Tumor tissues expressed p38 MAPK (82 %) and p-p38 MAPK (30 %). Both p38 and p-p38 MAPK expressions correlated with the high score performance status. A significant correlation was found between the expression p-p38 and poor response to CHOP. The five year median follow-up FFS was 81 % for p38 − and 34 % for p38 + and for OS was 83 % for p38 − and 47 % for p38 + . The p-p38 + tissues expressed Bcl-2 and 90 % of p-p38 − where Bcl-2 − . The coexpression of p-p38 and Bcl-2 correlated with pool EFS and OS. There was no correlation between the expression of p-p38 and the expression of NF-κB. The findings revealed, for the first time, that a subset of patients with DLBCL and whose tumors expressed high p-p38 MAPK responded poorly to CHOP therapy and had poor EFS and OS. The expression of p38, p-p38, Bcl2 and the ABC subtype are significant risk factors both p38 and p-p38 expressions remain independent prognostic factors. The online version of this article (doi:10.1186/s12885-015-1778-8) contains supplementary material, which is available to authorized users

  1. Analysis of the microbiota of refrigerated chopped parsley after treatments with a coating containing enterocin AS-48 or by high-hydrostatic pressure.

    Science.gov (United States)

    Grande Burgos, María José; López Aguayo, María Del Carmen; Pérez Pulido, Rubén; Galvez, Antonio; Lucas, Rosario

    2017-09-01

    Parsley can be implicated in foodborne illness, yet chopped parsley is used as an ingredient or garnish for multiple dishes. The aim of the present study was to determine the effect of two different treatments on the bacterial diversity of parsley: (i) coating with a pectin-EDTA solution containing the circular bacteriocin enterocin AS-48, and (ii) treatment by high hydrostatic pressure (HHP) at 600MPa for 8min. Control and treated parsley were stored in trays at 5°C for 10days. Both treatments reduced viable counts by 3.7 log cycles and retarded growth of survivors during storage. The bacterial diversity of the chopped parsley was studied by high throughput sequencing (Illumina Miseq). Bacterial diversity of control samples mainly consists of Proteobacteria (96.87%) belonging to genera Pseudomonas (69.12%), Rheinheimera (8.56%) and Pantoea (6.91%) among others. During storage, the relative abundance of Bacteroidetes (mainly Flavobacterium and Sphingobacterium) increased to 26.66%. Application of the pectin-bacteriocin-EDTA coating reduced the relative abundance of Proteobacteria (63.75%) and increased that of Firmicutes (34.70%). However, the relative abundances of certain groups such as Salmonella, Shigella and Acinetobacter increased at early storage times. Late storage was characterized by an increase in the relative abundance of Proteobacteria, mainly Pseudomonas. Upon application of HHP treatment, the relative abundance of Proteobacteria was reduced (85.88%) while Actinobacteria increased (8.01%). During early storage of HHP-treated samples, the relative abundance of Firmicutes increased. Potentially-pathogenic bacteria (Shigella) only increased in relative abundance by the end of storage. Results of the present study indicate that the two treatments had different effects on the bacterial diversity of parsley. The HHP treatment provided a safer product, since no potentially-pathogenic bacteria were detected until the end of the storage period. Copyright

  2. Real world data on young patients with high-risk diffuse large B-cell lymphoma treated with R-CHOP or R-CHOEP - MYC, BCL2 and BCL6 as prognostic biomarkers.

    Directory of Open Access Journals (Sweden)

    Mette Ølgod Pedersen

    Full Text Available Double expression of MYC and BCL2 proteins (DE and double-hit MYC+BCL2/BCL6 translocations (DH were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL by the 2016 revision of the World Health Organization classification of lymphoid neoplasms. Whether this applies to the subgroup of young patients with high risk DLBCL is not known. We previously found that in a uniform retrospective population-based cohort of patients aged 18-60 years with high-risk DLBCL, the addition of etoposide to R-CHOP chemotherapy (R-CHOEP resulted in improved survival mainly in patients with germinal center B-cell like (GCB immunophenotype. The aim of this study was to investigate the prognostic and predictive value of DE and DH in this patient cohort.Data on all young Danish patients diagnosed with de novo high-risk DLBCL 2004-2008 and treated with R-CHOP or R-CHOEP were obtained from the Danish Lymphoma database (n = 159. Tumor samples were available from 103 patients. MYC and BCL2 proteins were analyzed with quantitative immunohistochemistry (IHC using different cut off values. MYC-, BCL2- and BCL6-translocations were examined with fluorescent in situ hybridization (FISH.DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS in patients treated with R-CHOP but not R-CHOEP (p<0.001, also after exclusion of patients with DH. A predictive effect of DE for response (PFS to R-CHOEP vs. R-CHOP was almost significant (p = 0.07. DH was not prognostic in this patient cohort.In young patients with high-risk DLBCL, treatment with R-CHOEP may overcome the negative prognostic impact of DE observed in patients treated with R-CHOP.

  3. Reliable and inexpensive expression of large, tagged, exogenous proteins in murine bone marrow-derived macrophages using a second generation lentiviral system

    Directory of Open Access Journals (Sweden)

    Matthew R. Miller

    2015-08-01

    Full Text Available Over the past two decades, researchers have struggled to efficiently express foreign DNA in primary macrophages, impeding research progress. The applications of lipofection, electroporation, microinjection, and viral-mediated transfer typically result in disruptions in macrophage differentiation and function, low expression levels of exogenous proteins, limited efficiency and high cell mortality. In this report, after extensive optimization, we present a method of expressing large tagged proteins at high efficiency, consistency, and low cost using lentiviral infection. This method utilizes laboratory-propagated second generation plasmids to produce efficient virus that can be stored for later use. The expression of proteins up to 150 kDa in size is achieved in 30–70% of cells while maintaining normal macrophage differentiation and morphology as determined by fluorescence microscopy and Western blot analysis. This manuscript delineates the reagents and methods used to produce lentivirus to express exogenous DNA in murine bone marrow-derived macrophages sufficient for single cell microscopy as well as functional assays requiring large numbers of murine bone marrow-derived macrophages.

  4. Efficient Transduction of Feline Neural Progenitor Cells for Delivery of Glial Cell Line-Derived Neurotrophic Factor Using a Feline Immunodeficiency Virus-Based Lentiviral Construct

    Directory of Open Access Journals (Sweden)

    X. Joann You

    2011-01-01

    Full Text Available Work has shown that stem cell transplantation can rescue or replace neurons in models of retinal degenerative disease. Neural progenitor cells (NPCs modified to overexpress neurotrophic factors are one means of providing sustained delivery of therapeutic gene products in vivo. To develop a nonrodent animal model of this therapeutic strategy, we previously derived NPCs from the fetal cat brain (cNPCs. Here we use bicistronic feline lentiviral vectors to transduce cNPCs with glial cell-derived neurotrophic factor (GDNF together with a GFP reporter gene. Transduction efficacy is assessed, together with transgene expression level and stability during induction of cellular differentiation, together with the influence of GDNF transduction on growth and gene expression profile. We show that GDNF overexpressing cNPCs expand in vitro, coexpress GFP, and secrete high levels of GDNF protein—before and after differentiation—all qualities advantageous for use as a cell-based approach in feline models of neural degenerative disease.

  5. Lentiviral-mediated targeted NF-kappaB blockade in dorsal spinal cord glia attenuates sciatic nerve injury-induced neuropathic pain in the rat.

    Science.gov (United States)

    Meunier, Alice; Latrémolière, Alban; Dominguez, Elisa; Mauborgne, Annie; Philippe, Stéphanie; Hamon, Michel; Mallet, Jacques; Benoliel, Jean-Jacques; Pohl, Michel

    2007-04-01

    Neuropathic pain developing after peripheral nerve injury is associated with altered neuronal and glial cell functions in the spinal cord. Activated glia produces algogenic mediators, exacerbating pain. Among the different intracellular pathways possibly involved in the modified glial function, the nuclear factor kappaB (NF-kappaB) system is of particular interest, as numerous genes encoding inflammation- and pain-related molecules are controlled by this transcription factor. NF-kappaB is a pleiotropic factor also involved in central nervous system homeostasy. To study its role in chronic pain, it is thus essential to inhibit the NF-kappaB pathway selectively in activated spinal glial cells. Here, we show that when restricted to spinal cord and targeted to glial cells, lentiviral vector-mediated delivery of NF-kappaB super- repressor IkappaBalpha resulted in an inhibition of the NF-kappaB pathway activated in the rat spinal cord after sciatic nerve injury (chronic constriction injury, CCI). Concomitantly, IkappaBalpha overproduction prevented the enhanced expression of interleukin-6 and of inducible nitric oxide synthase associated with chronic constriction injury and resulted in prolonged antihyperalgesic and antiallodynic effects. These data show that targeted blockade of NF-kappaB activity in spinal glia efficiently alleviates pain behavior in CCI rats, demonstrating the active participation of the glial NF-kappaB pathway in the development of neuropathic pain after peripheral nerve injury.

  6. Lentiviral-mediated Targeted NF-κB Blockade in Dorsal Spinal Cord Glia Attenuates Sciatic Nerve Injury-induced Neuropathic Pain in the Rat.

    Science.gov (United States)

    Meunier, Alice; Latrémolière, Alban; Dominguez, Elisa; Mauborgne, Annie; Philippe, Stéphanie; Hamon, Michel; Mallet, Jacques; Benoliel, Jean-Jacques; Pohl, Michel

    2007-04-01

    Neuropathic pain developing after peripheral nerve injury is associated with altered neuronal and glial cell functions in the spinal cord. Activated glia produces algogenic mediators, exacerbating pain. Among the different intracellular pathways possibly involved in the modified glial function, the nuclear factor κB (NF-κB) system is of particular interest, as numerous genes encoding inflammation- and pain-related molecules are controlled by this transcription factor. NF-κB is a pleiotropic factor also involved in central nervous system homeostasy. To study its role in chronic pain, it is thus essential to inhibit the NF-κB pathway selectively in activated spinal glial cells. Here, we show that when restricted to spinal cord and targeted to glial cells, lentiviral vector-mediated delivery of NF-κB super- repressor IκBα resulted in an inhibition of the NF-κB pathway activated in the rat spinal cord after sciatic nerve injury (chronic constriction injury, CCI). Concomitantly, IκBα overproduction prevented the enhanced expression of interleukin-6 and of inducible nitric oxide synthase associated with chronic constriction injury and resulted in prolonged antihyperalgesic and antiallodynic effects. These data show that targeted blockade of NF-κB activity in spinal glia efficiently alleviates pain behavior in CCI rats, demonstrating the active participation of the glial NF-κB pathway in the development of neuropathic pain after peripheral nerve injury. Copyright © 2007 The American Society of Gene Therapy. Published by Elsevier Inc. All rights reserved.

  7. Antibody-directed lentiviral gene transduction for live-cell monitoring and selection of human iPS and hES cells.

    Directory of Open Access Journals (Sweden)

    Dai-tze Wu

    Full Text Available The identification of stem cells within a mixed population of cells is a major hurdle for stem cell biology--in particular, in the identification of induced pluripotent stem (iPS cells during the reprogramming process. Based on the selective expression of stem cell surface markers, a method to specifically infect stem cells through antibody-conjugated lentiviral particles has been developed that can deliver both visual markers for live-cell imaging as well as selectable markers to enrich for iPS cells. Antibodies recognizing SSEA4 and CD24 mediated the selective infection of the iPS cells over the parental human fibroblasts, allowing for rapid expansion of these cells by puromycin selection. Adaptation of the vector allows for the selective marking of human embryonic stem (hES cells for their removal from a population of differentiated cells. This method has the benefit that it not only identifies stem cells, but that specific genes, including positive and negative selection markers, regulatory genes or miRNA can be delivered to the targeted stem cells. The ability to specifically target gene delivery to human pluripotent stem cells has broad applications in tissue engineering and stem cell therapies.

  8. A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

    International Nuclear Information System (INIS)

    Strauss, Bryan E.; Patricio, Juliana Rotelli; Vieira de Carvalho, Anna Carolina; Bajgelman, Marcio C.

    2006-01-01

    We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for this factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis

  9. Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Hiroko Kita-Matsuo

    Full Text Available Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes.Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and alpha-myosin heavy chain (alphaMHC promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function.The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications.

  10. High-throughput screening using pseudotyped lentiviral particles: a strategy for the identification of HIV-1 inhibitors in a cell-based assay.

    Science.gov (United States)

    Garcia, Jean-Michel; Gao, Anhui; He, Pei-Lan; Choi, Joyce; Tang, Wei; Bruzzone, Roberto; Schwartz, Olivier; Naya, Hugo; Nan, Fa-Jun; Li, Jia; Altmeyer, Ralf; Zuo, Jian-Ping

    2009-03-01

    Two decades after its discovery the human immunodeficiency virus (HIV) is still spreading worldwide and killing millions. There are 25 drugs formally approved for HIV currently on the market, but side effects as well as the emergence of HIV strains showing single or multiple resistances to current drug-therapy are causes for concern. Furthermore, these drugs target only 4 steps of the viral cycle, hence the urgent need for new drugs and also new targets. In order to tackle this problem, we have devised a cell-based assay using lentiviral particles to look for post-entry inhibitors of HIV-1. We report here the assay development, validation as well as confirmation of the hits using both wild-type and drug-resistant HIV-1 viruses. The screening was performed on an original library, rich in natural compounds and pure molecules from Traditional Chinese Medicine pharmacopoeia, which had never been screened for anti-HIV activity. The identified hits belong to four chemical sub-families that appear to be all non-nucleoside reverse transcriptase inhibitors (NNRTIs). Secondary tests with live viruses showed that there was good agreement with pseudotyped particles, confirming the validity of this approach for high-throughput drug screens. This assay will be a useful tool that can be easily adapted to screen for inhibitors of viral entry.

  11. Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

    Science.gov (United States)

    Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

    2007-08-01

    Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

  12. A new system for parallel drug screening against multiple-resistant HIV mutants based on lentiviral self-inactivating (SIN vectors and multi-colour analyses

    Directory of Open Access Journals (Sweden)

    Prokofjeva Maria M

    2013-01-01

    Full Text Available Abstract Background Despite progress in the development of combined antiretroviral therapies (cART, HIV infection remains a significant challenge for human health. Current problems of cART include multi-drug-resistant virus variants, long-term toxicity and enormous treatment costs. Therefore, the identification of novel effective drugs is urgently needed. Methods We developed a straightforward screening approach for simultaneously evaluating the sensitivity of multiple HIV gag-pol mutants to antiviral drugs in one assay. Our technique is based on multi-colour lentiviral self-inactivating (SIN LeGO vector technology. Results We demonstrated the successful use of this approach for screening compounds against up to four HIV gag-pol variants (wild-type and three mutants simultaneously. Importantly, the technique was adapted to Biosafety Level 1 conditions by utilising ecotropic pseudotypes. This allowed upscaling to a large-scale screening protocol exploited by pharmaceutical companies in a successful proof-of-concept experiment. Conclusions The technology developed here facilitates fast screening for anti-HIV activity of individual agents from large compound libraries. Although drugs targeting gag-pol variants were used here, our approach permits screening compounds that target several different, key cellular and viral functions of the HIV life-cycle. The modular principle of the method also allows the easy exchange of various mutations in HIV sequences. In conclusion, the methodology presented here provides a valuable new approach for the identification of novel anti-HIV drugs.

  13. In Vivo Knockout of the Vegfa Gene by Lentiviral Delivery of CRISPR/Cas9 in Mouse Retinal Pigment Epithelium Cells

    Directory of Open Access Journals (Sweden)

    Andreas Holmgaard

    2017-12-01

    Full Text Available Virus-based gene therapy by CRISPR/Cas9-mediated genome editing and knockout may provide a new option for treatment of inherited and acquired ocular diseases of the retina. In support of this notion, we show that Streptococcus pyogenes (Sp Cas9, delivered by lentiviral vectors (LVs, can be used in vivo to selectively ablate the vascular endothelial growth factor A (Vegfa gene in mice. By generating LVs encoding SpCas9 targeted to Vegfa, and in parallel the fluorescent eGFP marker protein, we demonstrate robust knockout of Vegfa that leads to a significant reduction of VEGFA protein in transduced cells. Three of the designed single-guide RNAs (sgRNAs induce in vitro indel formation at high frequencies (44%–93%. A single unilateral subretinal injection facilitates RPE-specific localization of the vector and disruption of Vegfa in isolated eGFP+ RPE cells obtained from mice five weeks after LV administration. Notably, sgRNA delivery results in the disruption of Vegfa with an in vivo indel formation efficacy of up to 84%. Sequencing of Vegfa-specific amplicons reveals formation of indels, including 4-bp deletions and 2-bp insertions. Taken together, our data demonstrate the capacity of lentivirus-delivered SpCas9 and sgRNAs as a developing therapeutic path in the treatment of ocular diseases, including age-related macular degeneration.

  14. Pretransplant mobilization with granulocyte colony-stimulating factor improves B-cell reconstitution by lentiviral vector gene therapy in SCID-X1 mice.

    Science.gov (United States)

    Huston, Marshall W; Riegman, Adriaan R A; Yadak, Rana; van Helsdingen, Yvette; de Boer, Helen; van Til, Niek P; Wagemaker, Gerard

    2014-10-01

    Hematopoietic stem cell (HSC) gene therapy is a demonstrated effective treatment for X-linked severe combined immunodeficiency (SCID-X1), but B-cell reconstitution and function has been deficient in many of the gene therapy treated patients. Cytoreductive preconditioning is known to improve HSC engraftment, but in general it is not considered for SCID-X1 since the poor health of most of these patients at diagnosis and the risk of toxicity preclude the conditioning used in standard bone marrow stem cell transplantation. We hypothesized that mobilization of HSC by granulocyte colony-stimulating factor (G-CSF) should create temporary space in bone marrow niches to improve engraftment and thereby B-cell reconstitution. In the present pilot study supplementing our earlier preclinical evaluation (Huston et al., 2011), Il2rg(-/-) mice pretreated with G-CSF were transplanted with wild-type lineage negative (Lin(-)) cells or Il2rg(-/-) Lin(-) cells transduced with therapeutic IL2RG lentiviral vectors. Mice were monitored for reconstitution of lymphocyte populations, level of donor cell chimerism, and antibody responses as compared to 2 Gy total body irradiation (TBI), previously found effective in promoting B-cell reconstitution. The results demonstrate that G-CSF promotes B-cell reconstitution similar to low-dose TBI and provides proof of principle for an alternative approach to improve efficacy of gene therapy in SCID patients without adverse effects associated with cytoreductive conditioning.

  15. Rolado de fachinales y calidad de suelos en el Chaco occidental, Argentina Roller-chopping of shrub-thickets and soil quality in the western Chaco, Argentina

    Directory of Open Access Journals (Sweden)

    Analía Anriquez

    2005-12-01

    significativo de sitio.In the western Chaco region the suitability for cow-calf operations of areas dominated by shrub thickets of Acacia, Celtis and Prosopis ('fachinales' is reduced because of their low carrying capacity and poor accessibility. Our objective was to assess the effect of practices commonly used to increase the standing forage of 'fachinales' on some indicators of soil quality (bulk density, total soil organic carbon, respiration, particulate organic carbon, microbial biomass carbon and dehydrogenase activity at three range sites of the Chaco region: upland, midland and bottom. The treatments applied were roller chopping, roller chopping plus seeding of Panicum maximum cv trichoglume cv Green panic, roller chopping followed by prescribed fire and controls. Bulk density, total soil organic carbon, particulate organic carbon and microbial biomass carbon were not altered by the treatments. A higher dehydrogenase activity was observed in the bottom site, irrespective of treatments, probably due to a greater soil water content. Soil respiration increased in the upland site in all treatments, probably because of the modification of soil microbial activity, attributable to the stimulation produced by the root exudates of green panic, native grasses and forbs that appeared after the treatments. In general, soil quality indicators were not significantly affected by the treatments used, a fact attributed to their 'low' intensity of application. However, there was a significant effect of range site.

  16. Therapeutic trials for a rabbit model of EBV-associated Hemophagocytic Syndrome (HPS): effects of vidarabine or CHOP, and development of Herpesvirus papio (HVP)-negative lymphomas surrounded by HVP-infected lymphoproliferative disease.

    Science.gov (United States)

    Hayashi, K; Joko, H; Koirala, T R; Onoda, S; Jin, Z-S; Munemasa, M; Ohara, N; Oda, W; Tanaka, T; Oka, T; Kondo, E; Yoshino, T; Takahashi, K; Yamada, M; Akagi, T

    2003-10-01

    Epstein-Barr virus-associated hemophagocytic syndrome (EBV-AHS), which is often associated with fatal infectious mononucleosis or T-cell lymphoproliferative diseases (LPD), is a distinct disease characterized by high mortality. Treatment of patients with EBV-AHS has proved challenging. To develop some therapeutic interventions for EBV-AHS, we examined the effectiveness of an antiviral agent (vidarabine) or chemotherapy (CHOP), using a rabbit model for EBV-AHS. Fourteen untreated rabbits were inoculated intravenously with cell-free virions of the EBV-like virus Herpesvirus papio (HVP). All of the rabbits died of HVP-associated (LPD) and hemophagocytic syndrome (HPS) between 21 and 31 days after inoculation. Furthermore, three HVP-infected rabbits treated with vidarabine died between days 23 and 28 after inoculation, and their clinicopathological features were no different from those of untreated rabbits, indicating that this drug is not effective at all to treat HVP-induced rabbit LPD and HPS. Three of the infected rabbits that were treated with one course, with an incomplete set of three courses, or with three full courses of CHOP treatment died of HVP-induced LPD and HPS with a bleeding tendency and/or with opportunistic infections. They died on the 26th, 62nd and 105th day after virus inoculation, respectively. CHOP treatment transiently suppressed the HVP-induced LPD and contributed to the prolonged survival time of two infected rabbits. However, it did not remove all of the HVP-infected cells from the infected rabbits, and residual HVP-infected lymphocytes caused recurrences of rabbit LPD and HPS. The most interesting finding of this experiment was observed in the infected rabbit with the longest survival time of 105 days: HVP-negative lymphomas surrounded by HVP-induced LPD developed in the larynx and ileum of this rabbit, causing an obstruction of the lumen. We concluded that these were not secondary lymphomas caused by CHOP treatment, because no suspicious

  17. Efficient delivery of Cre-recombinase to neurons in vivo and stable transduction of neurons using adeno-associated and lentiviral vectors

    Directory of Open Access Journals (Sweden)

    Sablitzky Fred

    2004-01-01

    Full Text Available Abstract Background Inactivating genes in vivo is an important technique for establishing their function in the adult nervous system. Unfortunately, conventional knockout mice may suffer from several limitations including embryonic or perinatal lethality and the compensatory regulation of other genes. One approach to producing conditional activation or inactivation of genes involves the use of Cre recombinase to remove loxP-flanked segments of DNA. We have studied the effects of delivering Cre to the hippocampus and neocortex of adult mice by injecting replication-deficient adeno-associated virus (AAV and lentiviral (LV vectors into discrete regions of the forebrain. Results Recombinant AAV-Cre, AAV-GFP (green fluorescent protein and LV-Cre-EGFP (enhanced GFP were made with the transgene controlled by the cytomegalovirus promoter. Infecting 293T cells in vitro with AAV-Cre and LV-Cre-EGFP resulted in transduction of most cells as shown by GFP fluorescence and Cre immunoreactivity. Injections of submicrolitre quantities of LV-Cre-EGFP and mixtures of AAV-Cre with AAV-GFP into the neocortex and hippocampus of adult Rosa26 reporter mice resulted in strong Cre and GFP expression in the dentate gyrus and moderate to strong labelling in specific regions of the hippocampus and in the neocortex, mainly in neurons. The pattern of expression of Cre and GFP obtained with AAV and LV vectors was very similar. X-gal staining showed that Cre-mediated recombination had occurred in neurons in the same regions of the brain, starting at 3 days post-injection. No obvious toxic effects of Cre expression were detected even after four weeks post-injection. Conclusion AAV and LV vectors are capable of delivering Cre to neurons in discrete regions of the adult mouse brain and producing recombination.

  18. Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

    Science.gov (United States)

    Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

    2010-04-01

    Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

  19. Striatal modulation of BDNF expression using microRNA124a-expressing lentiviral vectors impairs ethanol-induced conditioned-place preference and voluntary alcohol consumption.

    Science.gov (United States)

    Bahi, Amine; Dreyer, Jean-Luc

    2013-07-01

    Alcohol abuse is a major health, economic and social concern in modern societies, but the exact molecular mechanisms underlying ethanol addiction remain elusive. Recent findings show that small non-coding microRNA (miRNA) signaling contributes to complex behavioral disorders including drug addiction. However, the role of miRNAs in ethanol-induced conditioned-place preference (CPP) and voluntary alcohol consumption has not yet been directly addressed. Here, we assessed the expression profile of miR124a in the dorsal striatum of rats upon ethanol intake. The results show that miR124a was downregulated in the dorso-lateral striatum (DLS) following alcohol drinking. Then, we identified brain-derived neurotrophic factor (BDNF) as a direct target of miR124a. In fact, BDNF mRNA was upregulated following ethanol drinking. We used lentiviral vector (LV) gene transfer technology to further address the role of miR124a and its direct target BDNF in ethanol-induced CPP and alcohol consumption. Results reveal that stereotaxic injection of LV-miR124a in the DLS enhances ethanol-induced CPP as well as voluntary alcohol consumption in a two-bottle choice drinking paradigm. Moreover, miR124a-silencer (LV-siR124a) as well as LV-BDNF infusion in the DLS attenuates ethanol-induced CPP as well as voluntary alcohol consumption. Importantly, LV-miR124a, LV-siR124a and LV-BDNF have no effect on saccharin and quinine intake. Our findings indicate that striatal miR124a and BDNF signaling have crucial roles in alcohol consumption and ethanol conditioned reward. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  20. Straight and chopped dc performance data for a General Electric 5BT 2366C10 motor and an EV-1 controller

    Science.gov (United States)

    Edie, P. C.

    1981-01-01

    Performance data on the General Electric 5BT 2366C10 series wound dc motor and EV-1 Chopper Controller is supplied for the electric vehicle manufacturer. Data is provided for both straight and chopped dc input to the motor, at 2 motor temperature levels. Testing was done at 6 voltage increments to the motor, and 2 voltage increments to the controller. Data results are presented in both tabular and graphical forms. Tabular information includes motor voltage and current input data, motor speed and torque output data, power data and temperature data. Graphical information includes torque-speed, motor power output-speed, torque-current, and efficiency-speed plots under the various operating conditions. The data resulting from this testing shows the speed-torque plots to have the most variance with operating temperature. The maximum motor efficiency is between 86% and 87%, regardless of temperature or mode of operation. When the chopper is utilized, maximum motor efficiency occurs when the chopper duty cycle approaches 100%.

  1. The Glasgow Prognostic Score as a significant predictor of diffuse large B cell lymphoma treated with R-CHOP in China.

    Science.gov (United States)

    Li, Xiaoyang; Zhang, Yunxiang; Zhao, Weili; Liu, Zhao; Shen, Yang; Li, Junmin; Shen, Zhixiang

    2015-01-01

    The Glasgow Prognostic Score (GPS) incorporates C-reactive protein and albumin as clinically useful markers of tumor behavior and shows significant prognostic value in several types of solid tumors. The accuracy of the GPS in predicting outcomes in diffuse large B cell lymphoma (DLBCL) remains unknown. We performed this study to evaluate the prognostic significance of the GPS in DLBCL in China. We retrospectively analyzed 160 patients with newly diagnosed DLBCL at the Shanghai Ruijin Hospital (China). The prognostic value of the GPS was evaluated and compared with that of the International Prognostic Index (IPI) and immunohistochemical subtyping. The GPS was defined as follows: GPS-0, C-reactive protein (CRP) ≤10 mg/L and albumin ≥35 g/L; GPS-1, CRP >10 mg/L or albumin L; and GPS-2, CRP >10 mg/L and albumin L. Patients with lower GPS tended to have better outcomes including progression-free survival (PFS, P GPS and high IPI score were independent adverse predictors of OS. Similar to several other tumors, GPS is a reliable predictor of survival outcomes in DLBCL patients treated with R-CHOP therapy. Inflammatory responses are implicated in the progression and survival of patients with DLBCL.

  2. Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Green, Tina M; Jensen, Andreas K; Holst, René

    2016-01-01

    We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...... models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B....... This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs...

  3. Chop Shop and Foreign Parts settle on the fuzzy boundary between fiction and documentary: new representations of New York City in Contemporary Cinema.

    Directory of Open Access Journals (Sweden)

    Fernando Canet

    2013-06-01

    Full Text Available Capturing reality has been a constant aim of different movements throughout the history of the cinema. Historically, this challenge has been taken up by makers of both documentaries and fiction, through hybrid proposals that blended strategies from both fields. Even though these proposals have been ignored by traditional film historians, they constitute a persistent tendency from the cinema’s earliest times, as Rhodes and Springer pointed out in their book Docufictions: Essay on the intersection of documentary and fictional filmmaking (2006. There are good examples of these proposals in contemporary cinema that have even won awards at leading international film festivals, including the two movies referred to in this paper: the fictional Chop Shop made by Ramin Bahrani in 2007 and the documentary Foreign Parts by Verena Paravel and J.P. Sniadecki in 2010. Both movies try to portray the same reality in the form of the little known Willets Point (Queens, New York City. Both films aim to show the truth behind the reality portrayed by its inhabitants in real life situations. The main goal of this paper is to reveal their manner of doing this and to show how both movies, even though belonging to different genres, share the same strategies to such an extent that their images could be interchangeable.

  4. The regulation of cellular apoptosis by the ROS-triggered PERK/EIF2α/chop pathway plays a vital role in bisphenol A-induced male reproductive toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Yin, Li [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Dai, Yanlin [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Medical Laboratory Technology Department, Chuxiong Medical College, Yunnan 675005 (China); Cui, Zhihong; Jiang, Xiao; Liu, Wenbin; Han, Fei; Lin, Ao; Cao, Jia [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China); Liu, Jinyi, E-mail: jinyiliutmmu@163.com [Institute of Toxicology, College of Preventive Medicine, Third Military Medical University, Chongqing 400038 (China)

    2017-01-01

    Bisphenol A (2,2-bis(4-hydroxyphenyl)propane, BPA) is ubiquitous in the environment, wildlife, and humans. Evidence from past studies suggests that BPA is associated with decreased semen quality. However, the molecular basis for the adverse effect of BPA on male reproductive toxicity remains unclear. We evaluated the effect of BPA on mouse spermatocytes GC-2 cells and adult mice, and we explored the potential mechanism of its action. The results showed that BPA inhibited cell proliferation and increased the apoptosis rate. The testes from BPA-treated mice showed fewer spermatogenic cells and sperm in the seminiferous tubules. In addition, BPA caused reactive oxygen species (ROS) accumulation. Previous study has verified that mitochondrion was the organelle affected by the BPA-triggered ROS accumulation. We found that BPA induced damage to the endoplasmic reticulum (ER) in addition to mitochondria, and most ER stress-related proteins were activated in cellular and animal models. Knocking down of the PERK/EIF2α/chop pathway, one of the ER stress pathways, partially recovered the BPA-induced cell apoptosis. In addition, an ROS scavenger attenuated the expression of the PERK/EIF2α/chop pathway-related proteins. Taken together, these data suggested that the ROS regulated PERK/EIF2α/chop pathway played a vital role in BPA-induced male reproductive toxicity. - Highlights: • BPA exposure caused the damage of the endoplasmic reticulum. • BPA exposure activated ER stress related proteins in male reproductive system. • ROS regulated PERK/EIF2α/chop pathway played a vital role in BPA-induced toxicity.

  5. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  6. Ku70 acetylation and modulation of c-Myc/ATF4/CHOP signaling axis by SIRT1 inhibition lead to sensitization of HepG2 cells to TRAIL through induction of DR5 and down-regulation of c-FLIP

    DEFF Research Database (Denmark)

    Kim, Mi-Ju; Hong, Kyung-Soo; Kim, Hak-Bong

    2013-01-01

    In this study, we investigated the role of c-Myc/ATF4/CHOP signaling pathway in sensitization of human hepatoma HepG2 cells to TRAIL. Knockdown of SIRT1 or treatment with SIRT1 inhibitor caused the up-regulation of DR5 and down-regulation of c-FLIP through modulation of c-Myc/ATF4/CHOP pathway, a...

  7. R-hyper-CVAD versus R-CHOP/cytarabine with high-dose therapy and autologous haematopoietic stem cell support in fit patients with mantle cell lymphoma: 20 years of single-center experience.

    Science.gov (United States)

    Widmer, Fabienne; Balabanov, Stefan; Soldini, Davide; Samaras, Panagiotis; Gerber, Bernhard; Manz, Markus G; Goede, Jeroen S

    2018-02-01

    Standard of care for untreated mantle cell lymphoma (MCL) is still debated. At the University Hospital Zurich, advanced MCL in physically fit patients is treated either with rituximab plus cyclophosphamide, doxorubicin, vincristine and prednisone induction followed by consolidating high-dose chemotherapy and autologous stem cell support (R-CHOP/HD-ASCT), or with rituximab plus fractionated cyclophosphamide, vincristine, doxorubicin and dexamethasone alternating with high-dose methotrexate-cytarabine (R-hyper-CVAD/MTX-AraC) without consolidating HD-ASCT upon physicians' and patients' choice. We retrospectively analysed the outcome and therapy tolerance in patients with MCL treated with R-CHOP/HD-ASCT or R-hyper-CVAD/MTX-AraC at the University Hospital Zurich between January 1996 and January 2016. Forty-three patients were included; 29 patients received R-CHOP/HD-ASCT and 14 patients R-hyper-CVAD/MTX-AraC. Mean age at diagnosis was 54.4 years (range 38-68 years). Thirty-five patients (81.4%) completed the entire first-line therapy (n = 24 in the R-CHOP/HD-ASCT group, n = 11 in the R-hyper-CVAD group). Of those, all patients responded and 97% achieved a complete remission (CR). With a mean follow-up of 5.7 years 10-year progression-free survival (PFS) for all patients was 32% and overall survival (OS) was 76%, with no difference between the two therapy groups. Complication-induced hospitalisation rate, haematological toxicity and economic burden were significantly higher in the R-hyper-CVAD therapy group. In contrast, quality of life and global health state were better in the R-hyper-CVAD therapy group. Both first-line therapies showed similar outcome with a median OS longer than 10 years. Due to significantly lower haematological toxicity and lower economic burden, we recommend R-CHOP/HD-ASCT as first-line therapy in fit adult patients with advanced MCL.

  8. Intravenous delivery of HIV-based lentiviral vectors preferentially transduces F4/80+ and Ly-6C+ cells in spleen, important target cells in autoimmune arthritis.

    Directory of Open Access Journals (Sweden)

    Ben T van den Brand

    Full Text Available Antigen presenting cells (APCs play an important role in arthritis and APC specific gene therapeutic targeting will enable intracellular modulation of cell activity. Viral mediated overexpression is a potent approach to achieve adequate transgene expression levels and lentivirus (LV is useful for sustained expression in target cells. Therefore, we studied the feasibility of lentiviral mediated targeting of APCs in experimental arthritis. Third generation VSV-G pseudotyped self-inactivating (SIN-LV were injected intravenously and spleen cells were analyzed with flow cytometry for green fluorescent protein (GFP transgene expression and cell surface markers. Collagen-induced arthritis (CIA was induced by immunization with bovine collagen type II in complete Freund's adjuvant. Effect on inflammation was monitored macroscopically and T-cell subsets in spleen were analyzed by flow cytometry. Synovium from arthritic knee joints were analyzed for proinflammatory cytokine expression. Lentiviruses injected via the tail vein preferentially infected the spleen and transduction peaks at day 10. A dose escalating study showed that 8% of all spleen cells were targeted and further analysis showed that predominantly Ly6C+ and F4/80+ cells in spleen were targeted by the LV. To study the feasibility of blocking TAK1-dependent pathways by this approach, a catalytically inactive mutant of TAK1 (TAK1-K63W was overexpressed during CIA. LV-TAK1-K63W significantly reduced incidence and arthritis severity macroscopically. Further histological analysis showed a significant decrease in bone erosion in LV-TAK1-K63W treated animals. Moreover, systemic Th17 levels were decreased by LV-TAK1-K63W treatment in addition to diminished IL-6 and KC production in inflamed synovium. In conclusion, systemically delivered LV efficiently targets monocytes and macrophages in spleen that are involved in autoimmune arthritis. Moreover, this study confirms efficacy of TAK1 targeting in

  9. Comparison of Human Sodium/Iodide Symporter (hNIS) Gene Expressions between Lentiviral and Adenoviral Vectors in Rat Mesenchymal Stem Cells

    Energy Technology Data Exchange (ETDEWEB)

    Park, So Yeon; Lee, Won Woo; Kim, Hyun Joo; Chung, June Key; Kim, Sang Eun [Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Sung Jin; Lee, Heui Ran [Medical Research Center, Seoul National University, Seoul (Korea, Republic of)

    2008-10-15

    Quantitative comparison of transgene expression within stem cells between lentivirus and adenovirusmediated delivery systems has not been reported. Here, we evaluated the human sodium iodide symporter (hNIS) gene expression in rat mesenchymal stem cell (rMSC) transduced by lentivirus or adenovirus, and compared the hNIS expression quantitatively between the two delivery systems. Lentiviral-mediated hNIS expressing rMSC (lenti-hNIS-rMSC) was constructed by cloning hNIS gene into pLenti6/UbC/V5-DEST (Invitrogen) to obtain pLenti-hNIS, transducing rMSC with the pLenti-hNIS, and selecting with blasticidin for 3 weeks. Recombinant adenovirus expressing hNIS gene (Rad-hNIS) was produced by homologous recombination and transduction efficiency of Rad-hNIS into rMSC evaluated by Rad-GFP was 19.1{+-}4.7%, 54.0{+-}6.4%, 85.7{+-}8.7%, and 98.4{+-}1.3% at MOI 1, 5, 20, and 100, respectively. The hNIS expressions in lenti-hNIS-rMSC or adeno-hNIS-rMSC were assessed by immunocytochemistry, western blot, and I-125 uptake. Immunocytochemistry and western blot analyses revealed that hNIS expressions in lenti-hNIS-rMSC were greater than those in adeno-hNIS-rMSC at MOI 20 but lower than at MOI 50. However in vitro I-125 uptake test demonstrated that iodide uptake in lenti-hNIS-rMSC (29,704{+-}6,659 picomole/10{sup 6} cells) was greater than that in adeno-hNIS-rMSC at MOI 100 (6,168{+-}2,134 picomole/10{sup 6} cells). Despite lower amount of expressed protein, hNIS function in rMSC was greater by lentivirus than by adenovirus mediated expression. Stem cell tracking using hNIS as a reporter gene should be conducted in consideration of relative vector efficiency for transgene expression.

  10. Comparison of Human Sodium/Iodide Symporter (hNIS) Gene Expressions between Lentiviral and Adenoviral Vectors in Rat Mesenchymal Stem Cells

    International Nuclear Information System (INIS)

    Park, So Yeon; Lee, Won Woo; Kim, Hyun Joo; Chung, June Key; Kim, Sang Eun; Kim, Sung Jin; Lee, Heui Ran

    2008-01-01

    Quantitative comparison of transgene expression within stem cells between lentivirus and adenovirusmediated delivery systems has not been reported. Here, we evaluated the human sodium iodide symporter (hNIS) gene expression in rat mesenchymal stem cell (rMSC) transduced by lentivirus or adenovirus, and compared the hNIS expression quantitatively between the two delivery systems. Lentiviral-mediated hNIS expressing rMSC (lenti-hNIS-rMSC) was constructed by cloning hNIS gene into pLenti6/UbC/V5-DEST (Invitrogen) to obtain pLenti-hNIS, transducing rMSC with the pLenti-hNIS, and selecting with blasticidin for 3 weeks. Recombinant adenovirus expressing hNIS gene (Rad-hNIS) was produced by homologous recombination and transduction efficiency of Rad-hNIS into rMSC evaluated by Rad-GFP was 19.1±4.7%, 54.0±6.4%, 85.7±8.7%, and 98.4±1.3% at MOI 1, 5, 20, and 100, respectively. The hNIS expressions in lenti-hNIS-rMSC or adeno-hNIS-rMSC were assessed by immunocytochemistry, western blot, and I-125 uptake. Immunocytochemistry and western blot analyses revealed that hNIS expressions in lenti-hNIS-rMSC were greater than those in adeno-hNIS-rMSC at MOI 20 but lower than at MOI 50. However in vitro I-125 uptake test demonstrated that iodide uptake in lenti-hNIS-rMSC (29,704±6,659 picomole/10 6 cells) was greater than that in adeno-hNIS-rMSC at MOI 100 (6,168±2,134 picomole/10 6 cells). Despite lower amount of expressed protein, hNIS function in rMSC was greater by lentivirus than by adenovirus mediated expression. Stem cell tracking using hNIS as a reporter gene should be conducted in consideration of relative vector efficiency for transgene expression

  11. A lentiviral sponge for miR-101 regulates RanBP9 expression and amyloid precursor protein metabolism in hippocampal neurons

    Directory of Open Access Journals (Sweden)

    Christian eBarbato

    2014-02-01

    Full Text Available Neurodegeneration associated with amyloid β (Aβ peptide accumulation, synaptic loss, and memory impairment are pathophysiological features of Alzheimer's disease (AD. Numerous microRNAs regulate amyloid precursor protein (APP expression and metabolism. We previously reported that miR-101 is a negative regulator of APP expression in cultured hippocampal neurons. In this study, a search for predicted APP metabolism-associated miR-101 targets led to the identification of a conserved miR-101 binding site within the 3’ untranslated region (UTR of the mRNA encoding Ran-binding protein 9 (RanBP9. RanBP9 increases APP processing by β-amyloid converting enzyme 1 (BACE1, secretion of soluble APPβ (sAPPβ, and generation of Aβ. MiR-101 significantly reduced reporter gene expression when co-transfected with a RanBP9 3'-UTR reporter construct, while site-directed mutagenesis of the predicted miR-101 target site eliminated the reporter response. To investigate the effect of stable inhibition of miR-101 both in vitro and in vivo, a microRNA sponge was developed to bind miR-101 and derepress its targets. Four tandem bulged miR-101 responsive elements (REs, located downstream of the enhanced green fluorescence protein (EGFP open reading frame and driven by the synapsin promoter, were placed in a lentiviral vector to create the pLSyn-miR-101 sponge. Delivery of the sponge to primary hippocampal neurons significantly increased both APP and RanBP9 expression, as well as sAPPβ levels in the conditioned medium. Importantly, silencing of endogenous RanBP9 reduced sAPPβ levels in miR-101 sponge-containing hippocampal cultures, indicating that miR-101 inhibition may increase amyloidogenic processing of APP by RanBP9. Lastly, the impact of miR-101 on its targets was demonstrated in vivo by intrahippocampal injection of the pLSyn-miR-101 sponge into C57BL6 mice. This study thus provides the basis for studying the consequences of long-term miR-101 inhibition on

  12. Comparison of human sodium iodide symporter (hNIS) gene expression between lentiviral and adenoviral vectors in rat mesenchymal stem cell

    International Nuclear Information System (INIS)

    Park, So Yeon; Lee, Won Woo; Kim, Sung Jin; Lee, Heui Ran; Kim, Hyun Joo; Chung, June Key; Kim, Sang Eun

    2007-01-01

    Quantitative comparison of transgene expression within stem cells between lentivirus and adenovirus-mediated delivery systems has not been done. Here, we evaluated the human sodium iodide symporter (hNIS) gene expression in rat mesenchymal stem cell (rMSC) transduced by lentivirus or adenovirus, and compared the hNIS expression quantitatively between the two delivery systems. Lentiviral-mediated stably hNIS expressing rMSC (lenti-hNIS-rMSC) was constructed by cloning the hNIS gene into pLenti6/UbC/V5-DEST (Invitrogen) to obtain pLenti-hNIS, transducing rMSC with the pLenti-hNIS, and selecting with blasticidin for 3 weeks. Recombinant adenovirus expressing hNIS gene (Rad-hNIS) was produced by homologous recombination and Rad-hNIS transduced rMSC (adeno-hNIS-rMSC) was evaluated for the hNIS expression 48 hours post infection at MOI 1, 5, 20, 50, and 100. The hNIS expression in lenti-hNIS-rMSC or adeno-hNIS-rMSC was assessed by immunocytochemistry, western blot, and I-125 uptake. Immunocytochemistry using mono-clonal anti-hNIS antibody revealed that intensity of hNIS immunoreactivity in lenti-hNIS-rMSC was greater than that in adeno-hNIS-rMSC at MOl 20 but lower than that at MOl 50. Western blot analysis also showed that lenti-hNIS-rMSC was intermediate between adeno-hNIS-rMSCs at MOl 20 and 50 in hNIS expression. However in vitro I-125 uptake test demonstrated that iodide uptake in lenti-hNIS-rMSC (297046659 picomole/106 cells) was greater than that in adeno-hNIS-rMSC at MOI 100 (61682134 picomole/106 cells). These results suggest that lentivirus mediated hNIS expression is greater in terms of hNIS function but lower in terms of hNIS protein amount than adenovirus mediated hNIS expression 48 hours post infection. Stem cell tracking using hNIS as a reporter gene should be conducted in consideration of relative viral efficiency of transgene expression

  13. Expression of Myc, but not pSTAT3, is an adverse prognostic factor for diffuse large B-cell lymphoma treated with epratuzumab/R-CHOP.

    Science.gov (United States)

    Gupta, Mamta; Maurer, Matthew J; Wellik, Linda E; Law, Mark E; Han, Jing Jing; Ozsan, Nazan; Micallef, Ivana N; Dogan, Ahmet; Witzig, Thomas E

    2012-11-22

    STAT3 regulates cell growth by up-regulating downstream targets, such as Myc. The frequency of phosphorylated STAT3 (pSTAT3) and Myc expression and their prognostic relevance is unknown within diffuse large B-cell lymphoma (DLBCL) germinal center B-cell (GCB) and non-GCB subtypes. pSTAT3 and Myc were studied by immunohistochemistry (IHC) on tumors from 40 DLBCL patients uniformly treated on a clinical trial of epratuzumab/rituximab-CHOP. A total of 35% of cases were pSTAT3-positive, and pSTAT3 positivity was more frequent in the non-GCB (P = .06) type but did not correlate with event-free survival (EFS). Myc expression was observed in 50% of cases and was more frequent in non-GCB type (P = .07). Myc-positive cases had inferior EFS in all patients, including the GCB and pSTAT3-positive cases, were more likely to express Myc (P = .06). Myc translocations involving the major breakpoint regions were found in 10% (3 of 29) of cases, and all 3 cases were GCB and had an inferior EFS (P = .09). pSTAT3, but not Myc expression, was correlated with elevated pretreatment serum cytokines, such as IL-10 (P = .05), G-CSF (P = .03), and TNF-α (P = .04). pSTAT3 IHC in DLBCL tumors has the potential to identify patients for STAT3 pathway-directed therapy; Myc IHC is a potential marker for inferior EFS in GCB patients.

  14. Effects of chopping, and soaking in water, hydrochloric acidic and calcium hydroxide solutions on the nutritional value of Acacia villosa for goats

    International Nuclear Information System (INIS)

    Wina, E.; Tangendjaja, B.; Susana, I.W.R.

    2005-01-01

    Acacia villosa, a thornless shrub legume, has potential as a feed supplement for ruminants if anti-nutritional factors, especially tannins, can be overcome. The effects of chopping and soaking the leaves on the amounts of tannin in the extracting solution and that left in the recovered leaves were studied. The tannin and non-tannin phenolics were solubilized in the extracting solution and the amount was increased with the soaking time. Soaking in calcium hydroxide solution, hydrochloric acid or water removed 41-76% of tannin and total phenolics removed from the recovered leaves. Soaking of the leaves also removed fermentable materials and reduced the gas production. In the first of two digestibility experiments, three groups of goats received one of these diets, those were: (1) sugar cane tops: unsoaked Acacia leaves (7:3), (2) sugar cane tops: water soaked Acacia leaves (7:3) and (3) sugar cane tops: water soaked Acacia leaves (7:3) + 100 g/day of cassava flour. Live weight of goats was measured every 2 weeks and a large increase in average daily gain was obtained for goats fed diet containing water soaked leaves and cassava flour (71 g/day) compared to those fed diet containing unsoaked leaves and water soaked leaves (38.9 and 44.7 g/day, respectively) (P 0.05) found in intake or digestibility between unsoaked and soaked leaves. In conclusion, soaking reduced tannin in Acacia leaves, improved digestibility and intake of Acacia leaves. In the presence of cassava flour, soaking improved average daily gain. Diets supplemented with water soaked Acacia leaves probably also need an energy supplement and cassava flour is one of the feed ingredients that is satisfactory. (author)

  15. Double transduction of a Cre/LoxP lentiviral vector: a simple method to generate kidney cell-specific knockdown mice.

    Science.gov (United States)

    Nam, Bo Young; Kim, Dong Ki; Park, Jung Tak; Kang, Hye-Young; Paeng, Jisun; Kim, Seonghun; Park, Jimin; Um, Jae Eun; Oh, Hyung Jung; Han, Seung Hyeok; Yoo, Tae-Hyun; Kang, Shin-Wook

    2015-12-15

    In a lentivirus-based gene delivery system, the incorporated gene is continuously expressed for a long time. In this study, we devised a simple way to knock down a specific gene in a kidney cell-specific pattern in adult mice by lentivirus-assisted transfer of short hairpin RNA (shRNA). Kidney collecting duct (CD)-specific aquaporin-3 (AQP3)-knockdown mice were generated by consecutive injection of Hoxb7-Cre-expressing lentivirus (LV-Hoxb7 Cre) and loxP-AQP3 shRNA-expressing lentivirus (LV-loxP shAQP3) in adult C57BL6/J mice. LV-Hoxb7 Cre was designed to express mCherry, while LV-loxP shAQP3 was designed with a floxed enhanced green fluorescent protein (EGFP)-tagged stop sequence, and thus EGFP would be expressed only in the absence of Cre recombination. In mice treated with LV-Hoxb7 Cre alone, mCherry protein expression, which indicates the presence of Cre recombinase, occurred only in CD cells. However, LV-loxP shAQP3 injection alone resulted in an increase in EGFP expression in all kidney cells, indicating the transcription of the floxed region. When LV-Hoxb7 Cre and LV-loxP shAQP3 were sequentially transduced, EGFP expression was attenuated while mCherry expression was sustained in CD cells, demonstrating a CD cell-specific recombination of the floxed region. AQP3 expression in mice injected with LV-Hoxb7 Cre or LV-loxP shAQP3 alone did not differ, but consecutive injection of LV-Hoxb7 Cre and LV-loxP shAQP3 significantly reduced AQP3 expression in CD cells. However, the expression levels of AQP3 were not altered in other cell types. Double transduction of Cre- and loxP-based lentivirus can easily generate kidney cell-specific knockdown mice, and this method might be applicable to other species. Copyright © 2015 the American Physiological Society.

  16. Partial Correction of Psoriasis upon Genetic Knock-Down of Human TNF-α by Lentivirus-Encoded shRNAs in a Xenograft Mouse Model

    DEFF Research Database (Denmark)

    Jakobsen, Maria; Stenderup, Karin; Rosada, Cecilia

    samples treated with irrelevant shRNAs, were selected and cloned into lentiviral vectors. The lentiviral vectors expressing TNF- shRNAs were used to transduce HEK-293 cells and verify vector-derived knock-down of stable TNF- expression in vitro. The most efficient TNF- -directed shRNA, which in cell lines...

  17. Chopped filter for nuclear spectroscopy

    International Nuclear Information System (INIS)

    Koyama, J.

    1980-12-01

    Some of the theoretical and practical factors affecting the energy resolution of a spectrometry system are considered, specially those related to t he signal-to-noise ratio, and a time-variant filter with the transfer function of the theoretical optimum filter, during its active time, is proposed. A prototype has been tested and experimental results are presented. (Author) [pt

  18. Effects of chopping, and soaking in water, hydrochloric acidic and calcium hydroxide solutions on the nutritional value of Acacia villosa for goats

    Energy Technology Data Exchange (ETDEWEB)

    Wina, E. [Research Institute for Animal Production, Bogor (Indonesia)]. E-mail: winabudi@yahoo.com; Tangendjaja, B.; Susana, I.W.R. [Research Institute for Animal Production, Bogor (Indonesia)

    2005-08-19

    Acacia villosa, a thornless shrub legume, has potential as a feed supplement for ruminants if anti-nutritional factors, especially tannins, can be overcome. The effects of chopping and soaking the leaves on the amounts of tannin in the extracting solution and that left in the recovered leaves were studied. The tannin and non-tannin phenolics were solubilized in the extracting solution and the amount was increased with the soaking time. Soaking in calcium hydroxide solution, hydrochloric acid or water removed 41-76% of tannin and total phenolics removed from the recovered leaves. Soaking of the leaves also removed fermentable materials and reduced the gas production. In the first of two digestibility experiments, three groups of goats received one of these diets, those were: (1) sugar cane tops: unsoaked Acacia leaves (7:3), (2) sugar cane tops: water soaked Acacia leaves (7:3) and (3) sugar cane tops: water soaked Acacia leaves (7:3) + 100 g/day of cassava flour. Live weight of goats was measured every 2 weeks and a large increase in average daily gain was obtained for goats fed diet containing water soaked leaves and cassava flour (71 g/day) compared to those fed diet containing unsoaked leaves and water soaked leaves (38.9 and 44.7 g/day, respectively) (P < 0.05). In the second digestibility experiment, the three diets were: (1) sugar cane tops: unsoaked Acacia (7:3), (2) sugar cane tops water soaked Acacia (7:3), (3) sugar cane tops: calcium hydroxide soaked Acacia (7:3). A supplement of 100 g/day of cassava flour was added to each of these three diets. In both digestibility experiments, soaking improved intake and digestibility of Acacia leaves, and cassava flour increased the intake, but when all the diets contained cassava flour, there was no significant difference (P > 0.05) found in intake or digestibility between unsoaked and soaked leaves. In conclusion, soaking reduced tannin in Acacia leaves, improved digestibility and intake of Acacia leaves. In the

  19. Determining optimum age of Holstein dairy calves when adding chopped alfalfa hay to meal starter diets based on measures of growth and performance.

    Science.gov (United States)

    Hosseini, S M; Ghorbani, G R; Rezamand, P; Khorvash, M

    2016-04-01

    The present study was conducted to determine the optimum age of Holstein dairy calves for an effective inclusion of alfalfa hay (AH) in starter feed on performance, apparent digestibility and feeding behavior. A total of 40 Holstein dairy calves (20 female and 20 male) were used in a completely randomized design in which calves were randomly assigned to one of four different dietary treatments including control (CON) calves fed starter feed without any forage and three treatments consisting of the same starter feed plus 15% chopped AH fed when calves were at the 2nd (AH2), 4th (AH4) or 6th (AH6) week of age. Calves were individually housed and bedded with sand that was replaced every other day. Feed and water were available ad libitum throughout the experiment. Calves were fed milk at 10% of birth BW twice daily until d 57. The study concluded when calves were 73 days old. Starter intake was recorded daily and BW was measured weekly. Data were analyzed as a complete randomized design by MIXED procedures of SAS. Results demonstrate that calves receiving AH treatments numerically consumed more starter feed (0.62 v. 0.78, 0.71 and 0.65 kg/day for CON, AH2, AH4 and AH6, respectively) and had greater average daily gain (ADG) compared with CON (0.48 v. 0.57, 0.49 and 0.49 kg/day for CON, AH2, AH4 and AH6), although the significant difference was observed only between AH2 and CON. Among AH treatments, calves in AH2 had better performance than AH6 in several cases including starter intake, ADG. No detectable differences were observed, however, in apparent dry matter, organic matter or CP digestibility among treatments. Ruminal pH and NH3 concentrations, measured on weeks 4, 6, 8 and 10, were lower for calves fed CON compared with other treatments, with ammonia concentrations decreasing over time. Calves in the AH treatments spent more time eating and ruminating compared with CON. Calves fed CON, however, spent more time on laying down compared with other treatments

  20. Real world data on young patients with high-risk diffuse large B-cell lymphoma treated with R-CHOP or R-CHOEP - MYC, BCL2 and BCL6 as prognostic biomarkers

    DEFF Research Database (Denmark)

    Pedersen, Mette Ølgod; Gang, Anne Ortved; Brown, Peter

    2017-01-01

    BACKGROUND: Double expression of MYC and BCL2 proteins (DE) and double-hit MYC+BCL2/BCL6 translocations (DH) were established as important biomarkers in patients with diffuse large B-cell lymphoma (DLBCL) by the 2016 revision of the World Health Organization classification of lymphoid neoplasms...... in situ hybridization (FISH). RESULTS: DE with MYC>75% and BCL2>85% was an independent negative prognostic marker of progression free survival (PFS) in patients treated with R-CHOP but not R-CHOEP (peffect of DE for response (PFS) to R...

  1. Resultados de la cirugía de cataratas por la técnica de facoemulsificación Results of cataract surgery using quick chop phacoemulsification

    Directory of Open Access Journals (Sweden)

    Luis Curbelo Cunill

    2007-12-01

    Full Text Available La catarata, en la mayoría de los casos, se considera una causa remediable de disminución de agudeza visual. A través del tiempo se han conseguido mejoras tecnológicas que hacen que la cirugía de catarata sea relativamente fácil, segura y la rehabilitación visual usualmente exitosa sobre todo cuando esta se acompaña de implante de lente intraocular. Varias alternativas para dividir el núcleo del cristalino surgieron desde entonces, pero pocas son realmente necesarias. Este trabajo tiene como objetivo describir los resultados funcionales y anatómicos alcanzados con la técnica de facoemulsificación con quick chop, las edades de los pacientes, la agudeza visual corregida preoperatoria y posoperatoria, el astigmatismo preoperatorio y posoperatorio, la microscopia endotelial preoperatorio y posoperatoria, el tiempo de ultrasonido aplicado y las complicaciones presentadas. Realizamos un estudio descriptivo, prospectivo, de corte transversal, en 146 pacientes (ojos operados entre enero de 2004 y enero de 2006 en el Centro de Microcirugía Ocular del Instituto Cubano de Oftalmología “Ramón Pando Ferrer” El universo de trabajo lo constituyeron todos los pacientes con diagnóstico de catarata presenil y senil que cumplían con los criterios de selección y que aceptaron someterse a la técnica quirúrgica señalada. Con el fin de evaluar la eficacia de la técnica, se analizaron como variables: edad, sexo, agudeza visual con corrección (AVCC, y cilindro refractivo, así como microscopia endotelial, tiempo de ultrasonido, y complicaciones más frecuentes. Estos datos se analizaron a través de tablas de contingencia con frecuencias absolutas y relativas además con medias; se utilizó la prueba t de Student para compararlos. Se encontró que la catarata predominó en el sexo masculino en mayores de 60 años, la agudeza visual con corrección obtenida como promedio fue mejor que en el preoperatorio, el cilindro refractivo apenas se

  2. Cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) in the treatment of stage IE/IIE extranodal natural killer/T cell lymphoma, nasal type: 13-year follow-up in 135 patients.

    Science.gov (United States)

    Wang, Liang; Xia, Zhong-jun; Huang, Hui-qiang; Lu, Yue; Zhang, Yu-jing

    2012-11-01

    We conducted a retrospective study of 135 patients of stage IE/IIE extranodal natural killer/T cell lymphoma, nasal type (ENKTL) treated with CHOP as induction chemotherapy to find some valuable prognostic factors and analyze the usefulness of International Prognostic Index (IPI) and Korean Prognostic Index (KPI) in predicting prognosis. Most of the patients were in the low-risk group (IPI score 0-1). Complete remission (CR) after induction chemotherapy was achieved in 31.8 % of the patients, which increased to 69.6 % after radiotherapy. The 2-, 5-, and 10-year overall survival (OS) rates were 60, 48, and 43 %, respectively. Patients with better performance status (ECOG 0-1), normal serum LDH level, without local invasiveness, low KPI scores, and IPI score of 0 had significantly better overall survival (P KPI score systems should be improved further to classify patients into different groups, and should be validated in larger prospective trials. Due to the multi-drug resistance mechanism of ENKTL, CHOP is no longer the state of art and novel drugs should be incorporated into future treatments.

  3. Increasing physically effective fiber content of dairy cow diets through forage proportion versus forage chop length: chewing and ruminal pH.

    Science.gov (United States)

    Yang, W Z; Beauchemin, K A

    2009-04-01

    A study was conducted to evaluate whether the risk of acidosis in dairy cows can be lowered by increasing the physically effective fiber (peNDF) concentration of the diet, either through increased theoretical chop length of alfalfa silage or higher proportion of forage in the diet. The experiment was designed as a replicated 4 x 4 Latin square using 8 ruminally cannulated lactating dairy cows. Treatments were arranged in a 2 x 2 factorial design; 2 forage particle lengths (FPL) of alfalfa silage (short and long) were combined with low (35:65) and high (60:40) forage:concentrate (F:C) ratios [dry matter (DM) basis]. Dietary peNDF concentration (DM basis) was determined from the sum of the proportion of dietary DM retained either on the 2 sieves (8 and 19 mm) or on the 3 sieves (1.18, 8, and 19 mm) of the Penn State Particle Separator multiplied by the neutral detergent fiber concentration of the diet. The dietary peNDF concentrations were altered by changing the F:C or the FPL, and ranged from 10.7 to 17.5% using 2 sieves, or from 23.1 to 28.2% using 3 sieves. Intake of peNDF was increased by increasing FPL but not by increasing F:C ratio because of the reduction of DM intake at the higher F:C ratio. Chewing activity, including number of chews and chewing time, increased with increasing F:C ratio or FPL. Mean ruminal pH was elevated by 0.4 and 0.2 units with increasing F:C ratio and FPL, respectively. Lowering the F:C ratio decreased the duration that ruminal pH was below 5.8 (1.2 vs. 8 h/d). Increased F:C ratio or FPL reduced ruminal volatile fatty acids concentration from 137 to 122 or from 133 to 126 mM, respectively, whereas acetate:propionate ratio was increased from 2.55 to 3.46 with increasing F:C ratio. Dietary peNDF concentration measured using 2 sieves was correlated to chewing time (r = 0.57) and mean ruminal pH (r = 0.75), whereas dietary peNDF concentration measured using 3 sieves was correlated to mean ruminal pH (r = 0.83) and negatively correlated to

  4. Effect of ensiling time and exogenous protease addition to whole-plant corn silage of various hybrids, maturities, and chop lengths on nitrogen fractions and ruminal in vitro starch digestibility.

    Science.gov (United States)

    Ferraretto, L F; Crump, P M; Shaver, R D

    2015-12-01

    The objective of this study was to evaluate the effects of ensiling time and exogenous protease addition on soluble CP (% of CP), ammonia-N (% of N), and ruminal in vitro starch digestibility (ivSD) of whole-plant corn silage (WPCS) from 3 hybrids, 2 maturities, and 2 chop lengths. Samples from 3 nonisogenic hybrids [brown midrib containing the bm3 gene mutation (BM3), dual-purpose (DP), or floury-leafy (LFY)] at 2 harvest maturities [2/3 kernel milk line (early) or 7d later (late)] with 2 theoretical lengths of cut settings (0.64 or 1.95cm) on a forage harvester were collected at harvest, treated with or without exogenous protease, and ensiled in triplicate in vacuum heat-sealed plastic bags for 0, 30, 60, 120, and 240d. Thus, the experiment consisted of 120 treatments (3 hybrids × 2 maturities × 2 chop lengths × 2 protease treatments × 5 time points) and 360 mini-silos (3 replications per treatment). Vitreousness, measured by dissection on unfermented kernels on the day of harvest, averaged 66.8, 65.0, and 59.0% for BM3, DP, and LFY, respectively. A protease × maturity interaction was observed with protease increasing ivSD in late but not early maturity. Ensiling time × hybrid interactions were observed for ammonia-N and soluble CP concentrations with greater values for FLY than other hybrids only after 120d of ensiling. Ensiling time × hybrid or protease × hybrid interactions were not observed for ivSD. Measurements of ivSD were greatest for FLY and lowest for BM3. Length of the ensiling period did not attenuate negative effects of kernel vitreousness or maturity on ivSD in WPCS. Results suggest that the dosage of exogenous protease addition used in the present study may reduce but not overcome the negative effects of maturity on ivSD in WPCS. No interactions between chop length and ensiling time or exogenous protease addition were observed for ivSD. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Intra-patient variability of FDG standardized uptake values in mediastinal blood pool, liver, and myocardium during R-CHOP chemotherapy in patients with diffuse large B- cell lymphoma

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Soo Jeong; Yi, Hyun Kyung; Lim, Chae Hong; Cho, Young Seok; Choi, Joon Young; Choe, Yeam Seong; Lee, Kyung Han; Moon, Seung Hwan [Dept. of Nuclear Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul (Korea, Republic of)

    2016-12-15

    {sup 18}F-fluorodeoxyglucose (FDG) PET/CT is useful for staging and evaluating treatment response in patients with diffuse large B-cell lymphoma (DLBCL). A five-point scale model using the mediastinal blood pool (MBP) and liver as references is a recommended method for interpreting treatment response. We evaluated the variability in standardized uptake values (SUVs) of the MBP, liver, and myocardium during chemotherapy in patients with DLBCL. We analyzed 60 patients with DLBCL who received rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisolone (R-CHOP) treatment and underwent baseline, interim, and final FDG PET/CT scans. The FDG uptakes of lymphoma lesions, MBP, liver, and myocardium were assessed, and changes in the MBP and liver SUV and possible associated factors were evaluated. The SUV of the liver did not change significantly during the chemotherapy. However, the SUV{sub mean} of MBP showed a significant change though the difference was small (p = 0.019). SUV{sub mean} of MBP and liver at baseline and interim scans was significantly lower in patients with advanced Ann Arbor stage on diagnosis. The SUV{sub mean} of the MBP and liver was negatively correlated with the volumetric index of lymphoma lesions in baseline scans (r = -0.547, p < 0.001; r = -0.502, p < 0.001). Positive myocardial FDG uptake was more frequently observed in interim and final scans than in the baseline scan, but there was no significant association between the MBP and liver uptake and myocardial uptake. The SUV of the liver was not significantly changed during R-CHOP chemotherapy in patients with DLBCL, whereas the MBP SUV of the interim scan decreased slightly. However, the SUV of the reference organs may be affected by tumor burden, and this should be considered when assessing follow-up scans. Although myocardial FDG uptake was more frequently observed after R-CHOP chemotherapy, it did not affect the SUV of the MBP and liver.

  6. The conditions for use of reed canary grass briquettes and chopped reed canary grass in small heating plants; Foerutsaettningar foer anvaendning av roerflensbriketter och hackad roerflen i mindre vaermecentraler

    Energy Technology Data Exchange (ETDEWEB)

    Paulrud, Susanne; Davidsson, Kent; Holmgren, Magnus A. (Swedish National Testing and Research Inst., Boraas (Sweden)); Hedman, Henry; Oehman, Rikard; Leffler, Joel (ETC, Piteaa (Sweden))

    2010-09-15

    The aim of this study was to test fuel blends of briquettes and chopped reed canary grass in three existing heating plants (50 kW - 500 kW) and elucidate the requirements for good performance and low emissions. In addition, the study investigated production of reed canary grass briquettes using a Polish screw press developed for straw. Some tests with a bale shredder were also undertaken. The screw press technique is of interest for reed canary grass because it is a simple technique, easy to handle, developed for small scale production, and for straw. The test with reed canary grass in this study showed that the technique worked well but that further adjustments and a longer test period are needed in order to achieve higher bulk density and mechanical strength. The test with chopped reed canary grass shows that a system with a forage harvester is slightly more effective than baling and cutting in a bale shredder. The study concluded that few existing heating plants of size 50 kW-1 MW that currently use wood fuels will be able to use reed canary grass without adjustment, conversion or replacement of the combustion equipment. Reed canary grass has 15-20 times higher ash content than wood briquettes and 2-3 times higher ash content than forest residue; the combustion equipment must be able to handle these properties. The boiler must be equipped with a continuously operating ashing system and it must be possible to move the ash bed mechanically. There is a risk of high content of unburned matter if the residence time in the boiler is too short, due to the structure and low bulk density of the reed canary grass ash. Using a blend of wood briquettes and reed canary briquettes results in lower ash content, but also affects the ash chemistry and tends to lower the initial ash fusion temperature compared to using 100 % reed canary grass. Blending chopped reed canary grass and wood chips in an existing small scale heating plant also requires measures to achieve an even fuel

  7. Identification of residues within the African swine fever virus DP71L protein required for dephosphorylation of translation initiation factor eIF2α and inhibiting activation of pro-apoptotic CHOP

    Energy Technology Data Exchange (ETDEWEB)

    Barber, Claire; Netherton, Chris; Goatley, Lynnette [The Pirbright Institute, Ash Road, Pirbright, Woking, Surrey GU24 0NF (United Kingdom); Moon, Alice; Goodbourn, Steve [Institute for Infection and Immunity, St. George' s, University of London, London SW17 0RE (United Kingdom); Dixon, Linda, E-mail: linda.dixon@pirbright.ac.uk [The Pirbright Institute, Ash Road, Pirbright, Woking, Surrey GU24 0NF (United Kingdom)

    2017-04-15

    The African swine fever virus DP71L protein recruits protein phosphatase 1 (PP1) to dephosphorylate the translation initiation factor 2α (eIF2α) and avoid shut-off of global protein synthesis and downstream activation of the pro-apoptotic factor CHOP. Residues V16 and F18A were critical for binding of DP71L to PP1. Mutation of this PP1 binding motif or deletion of residues between 52 and 66 reduced the ability of DP71L to cause dephosphorylation of eIF2α and inhibit CHOP induction. The residues LSAVL, between 57 and 61, were also required. PP1 was co-precipitated with wild type DP71L and the mutant lacking residues 52- 66 or the LSAVL motif, but not with the PP1 binding motif mutant. The residues in the LSAVL motif play a critical role in DP71L function but do not interfere with binding to PP1. Instead we propose these residues are important for DP71L binding to eIF2α. - Highlights: •The African swine fever virus DP71L protein recruits protein phosphatase 1 (PP1) to dephosphorylate translation initiation factor eIF2α (eIF2α). •The residues V{sup 16}, F{sup 18} of DP71L are required for binding to the α, β and γ isoforms of PP1 and for DP71L function. •The sequence LSAVL downstream from the PP1 binding site (residues 57–61) are also important for DP71L function. •DP71L mutants of the LSAVL sequence retain ability to co-precipitate with PP1 showing these sequences have a different role to PP1 binding.

  8. A salvage chemotherapy of R-P-IMVP16/CBDCA consisting of rituximab, methylprednisolone, ifosfamide, methotrexate, etoposide, and carboplatin for patients with diffuse large B cell lymphoma who had previously received R-CHOP therapy as first-line chemotherapy.

    Science.gov (United States)

    Matsumoto, Takuro; Hara, Takeshi; Shibata, Yuhei; Nakamura, Nobuhiko; Nakamura, Hiroshi; Ninomiya, Soranobu; Kitagawa, Junichi; Kanemura, Nobuhiro; Goto, Naoe; Kito, Yusuke; Kasahara, Senji; Yamada, Toshiki; Sawada, Michio; Miyazaki, Tatsuhiko; Takami, Tsuyoshi; Takeuchi, Tamotsu; Moriwaki, Hisataka; Tsurumi, Hisashi

    2017-09-01

    We have reported the efficacy of the salvage chemotherapy P-IMVP16/CBDCA for patients with diffuse large B cell lymphoma (DLBCL) who had previously received CHOP before the availability of rituximab (R). Here, we confirmed the efficacy of R combined with P-IMVP16/CBDCA as a salvage chemotherapy for patients with DLBCL, who had previously received R-CHOP. We retrospectively analysed 59 patients with relapse or refractory DLBCL (38 male patients and 21 female patients) presenting between June 2004 and June 2013. The patients received R 375 mg/m 2 on day 1, methylprednisolone 1000 mg/body for 3 days (from day 3 to day 5), ifosfamide 1000 mg/m 2 for 5 days (from day 3 to day 7), methotrexate 30 mg/m 2 on day 5 and day 12, etoposide 80 mg/m 2 for 3 days (from day 3 to day 5), and carboplatin 300 mg/m 2 on day 3 every 21 days. Patients aged 70 years or older were given 75% of the standard dose. The overall response rate (complete response + partial response) was 64.4%. The 2-year overall survival rate was 55.3%. The 2-year progression free survival rate was 34.7%. The 2-year overall survival rate was 61.5% for the relapse patients, and 15.6% for the refractory patients (p effects were mild and tolerable. The R-P-IMVP-16/CBDCA regimen displayed a significant activity in relapsed DLBCL, with acceptable toxicity, and should be considered a candidate for salvage chemotherapy. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  9. Kaempferol Sensitizes Human Ovarian Cancer Cells-OVCAR-3 and SKOV-3 to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL)-Induced Apoptosis via JNK/ERK-CHOP Pathway and Up-Regulation of Death Receptors 4 and 5.

    Science.gov (United States)

    Zhao, Yingmei; Tian, Binqiang; Wang, Yong; Ding, Haiying

    2017-10-26

    BACKGROUND Ovarian cancer is the most common gynecological malignancies in women, with high mortality rates worldwide. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a member of the tumor necrosis factor (TNF) superfamily which preferentially induces apoptosis of cancer cells. However, acquired resistance to TRAIL hampers its therapeutic application. Identification of compounds that sensitize cancer cells to TRAIL is vital in combating resistance to TRAIL. The effect of kaempferol, a flavonoid enhancing TRAIL-induced apoptosis in ovarian cancer cells, was investigated in this study. MATERIAL AND METHODS The cytotoxic effects of TRAIL (25 ng/mL) and kaempferol (20-100 µM) on human ovarian cancer cells OVCAR-3 and SKOV-3 were assessed. Effect of kaempferol on the expression patterns of cell survival proteins (Bcl-xL, Bcl-2, survivin, XIAP, c-FLIP) and apoptotic proteins (caspase-3, caspase-8, caspase-9, Bax) were studied. The influence of kaempferol on expression of DR4 and DR5 death receptors on the cell surface and protein and mRNA levels was also analyzed. Apoptosis following silencing of DR5 and CHOP by small interfering RNA (siRNA), and activation of MAP kinases were analyzed as well. RESULTS Kaempferol enhanced apoptosis and drastically up-regulated DR4, DR5, CHOP, JNK, ERK1/2, p38 and apoptotic protein expression with decline in the expression of anti-apoptotic proteins. Further transfection with siRNA specific to CHOP and DR5 indicated the involvement of CHOP in DR5 up-regulation and also the contribution of DR5 in kaempferol-enhanced TRAIL-induced apoptosis. CONCLUSIONS Kaempferol sensitized ovarian cancer cells to TRAIL-induced apoptosis via up-regulation of DR4 and DR5 through ERK/JNK/CHOP pathways.

  10. Epidemiological studies on salmonella in a certain area ("Walcheren project") III. The presence of salmonella in man, insects, seagulls and in foods, chopping-block scrapings from butcher's shops, effluent of sewage treatment plants and drains of butcher's shops.

    Science.gov (United States)

    Edel, W; van Schothorst, M; van Leusden, F M; Kampelmacher, E H

    1978-12-01

    For a period of three months in a relatively small area (Walcheren), various materials (meat and meat products, insects, seagull droppings, chopping-block scrapings from butcher's shops, effluent of sewage treatment plants, drains from butcher's shops and stools of patients) were examined again for the presence of Salmonella as a continuation of previous investigations. As had been the case in previous studies, S. typhimurium (27.5%), S. panama (22.2%) and S. brandenburg (9.2%) were the three most frequently isolated serotypes. The three most frequently isolated phage types of S. typhimurium were II 505 (62.1%) II 502 (5.3%) and I 650 (4.2%). The serotypes and phage types were present in almost all the materials examined which again emphasizes the fact that there are contamination cycles of Salmonella. These studies show that the route of contamination divides in the butcher's shops. Salmonella organisms carried with the meat from the slaughter-house find their way into the drains on the one hand, and through meat and meat products, to the consumer on the other. Moreover, the high degree of contamination of effluent is not in accordance with the small number of cases of salmonellosis in man.

  11. Direct lentiviral-cyclooxygenase 2 application to the tendon-bone interface promotes osteointegration and enhances return of the pull-out tensile strength of the tendon graft in a rat model of biceps tenodesis.

    Directory of Open Access Journals (Sweden)

    Charles H Rundle

    Full Text Available This study sought to determine if direct application of the lentiviral (LV-cyclooxygenase 2 (COX2 vector to the tendon-bone interface would promote osteointegration of the tendon graft in a rat model of biceps tenodesis. The LV-COX2 gene transfer strategy was chosen for investigation because a similar COX2 gene transfer strategy promoted bony bridging of the fracture gap during bone repair, which involves similar histologic transitions that occur in osteointegration. Briefly, a 1.14-mm diameter tunnel was drilled in the mid-groove of the humerus of adult Fischer 344 rats. The LV-COX2 or βgal control vector was applied directly into the bone tunnel and onto the end of the tendon graft, which was then pulled into the bone tunnel. A poly-L-lactide pin was press-fitted into the tunnel as interference fixation. Animals were sacrificed at 3, 5, or 8 weeks for histology analysis of osteointegration. The LV-COX2 gene transfer strategy enhanced neo-chondrogenesis at the tendon-bone interface but with only marginal effect on de novo bone formation. The tendon-bone interface of the LV-COX2-treated tenodesis showed the well-defined tendon-to-fibrocartilage-to-bone histologic transitions that are indicative of osteointegration of the tendon graft. The LV-COX2 in vivo gene transfer strategy also significantly enhanced angiogenesis at the tendon-bone interface. To determine if the increased osteointegration was translated into an improved pull-out mechanical strength property, the pull-out tensile strength of the LV-COX2-treated tendon grafts was determined with a pull-out mechanical testing assay. The LV-COX2 strategy yielded a significant improvement in the return of the pull-out strength of the tendon graft after 8 weeks. In conclusion, the COX2-based in vivo gene transfer strategy enhanced angiogenesis, osteointegration and improved return of the pull-out strength of the tendon graft. Thus, this strategy has great potential to be developed into an

  12. Biogasification of plant waste chopping. Kasvijaetesilpun biokaasutus

    Energy Technology Data Exchange (ETDEWEB)

    Tenhunen, E.J.; Peltonen, P.

    1987-01-01

    The literature on biogasification of plant biomasses is reviewed. So far it is possible to calculate, the energy potential of Finnish plant-based biomasses is 7.3 petajoules per year. Biomasses not included are, for example, weakly decomposed surface peat and the utilizable part of tree biomass. In laboratory experiments, the decomposition of three plant biomasses, namely, potato haulm, tops of sugarbeet, and tops of jerusalem artichoke, was followed in 35 degrees Celsius. The total dry matter content of the masses in the beginning of the digestion was 20 per cent, the dry matter percentage of inoculum was 0.7 per cent, and in parts of experiments, the dry matter percentage of cattle manure or pig slurry was 19.3 per cent. The plant biomasses were dried before digestion to attain uniform dry matter conditions for the 1 liter bottles. Only potato haulm was really digested without manure addition. For potato haulm and jerusalem artichoke tops, pig slurry addition gave the best results; for sugarbeet tops, cattle manure supported the digestion of plant biomass. Next project combines composting and biogasification of plant biomass in a greenhouse system.

  13. Brazil's Petrobras chops 1992 capital budget

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper reports that Brazil's state owned Petroleos Brasileiro SA has slashed its 1992 capital budget by more than half for lack of adequate cash flow. Petrobras Pres. Benedicto Moreira last week disclosed the cut, to $1.4 billion from $2.9 billion earmarked earlier, citing cash flow problems stemming from heavy subsidies for domestic products. Petrobras Association of Engineers (Aepet) disputes the latest amount, claiming without elaboration the state company actually is cutting the current budget to $1 billion. At either level, the severe budget cut bodes ill for Petrobras plans to boost domestic production by a net 300,000 b/d to 1 million b/d by 1995, an ambitious program that calls for outlays of $18 billion

  14. Mephedrone, new kid for the chop?

    Science.gov (United States)

    Winstock, Adam R; Mitcheson, Luke R; Deluca, Paolo; Davey, Zoe; Corazza, Ornella; Schifano, Fabrizio

    2011-01-01

    Mephedrone (4-methylmethcathinone) is a novel synthetic stimulant drug that has recently become popular in the United Kingdom and elsewhere in Europe. It has a short history of human consumption and little is known about its prevalence and pattern of use. This study aimed to obtain preliminary data on its use and effects among dance drug users in the United Kingdom.   Cross-sectional anonymous online survey of mephedrone recruited as part of larger study exploring patterns of drug use among those associated with the dance music scene. Setting  UK-based dance music and clubbing website. A total of 947 ever users of mephedrone recruited as part of a wider study on dance drug use patterns. Assessment of demographics, ever and current drug use and patterns and selected effects following use of mephedrone. A total of 947 (41.3%) of 2295 participants reported ever having used mephedrone. Mephedrone was the sixth most frequently used drug in the last month after tobacco, alcohol, cannabis, cocaine and 3,4-methylenedioxymethamphetamine (MDMA). Users were typically younger (P < 0.001) and male (P < 0.01); 15.1% reported using weekly or more frequently; 49.5% reported using between 0.5 and 1 g during a typical session; 69.5% reported that intranasal use was the most common route of use. Intranasal use was associated with increased abuse liability; 54.6% of those who have also used cocaine reported that the quality of the high obtained with mephedrone was better, with those using intranasally being significantly more likely than those who took the drug orally to report that mephedrone was more addictive (P < 0.02) and more risky (P < 0.02) than cocaine. Route of use was unrelated to any stimulant-related adverse effect apart from palpitations (P < 0.005). Mephedrone appears to be used primarily intranasally and to have comparable abuse potential to cocaine, with more than half those who use both reporting that mephedrone gives a better quality high. © 2010 The Authors, Addiction © 2010 Society for the Study of Addiction.

  15. Alteraciones en el endotelio corneal después de la facoemulsificación por técnica de pre chop versus extracción tunelizada esclerocorneal del cristalino Alterations of the corneal endothelium after prechop phacoemulsification versus tunnelized scleracorneal extraction of the crystalline

    Directory of Open Access Journals (Sweden)

    Belkys Rodríguez Suárez

    2012-12-01

    Full Text Available Objetivo: evaluar los cambios endoteliales y resultados visuales en los ojos de pacientes con diagnóstico de catarata senil, operados por técnica de facoemulsificación por pre chop o extracción extracapsular del cristalino por túnel esclerocorneal. Métodos: se realizó un estudio descriptivo y prospectivo de 100 pacientes (ojos atendidos en el Instituto Cubano de Oftalmología "Ramón Pando Ferrer", de septiembre a diciembre de 2010. La mitad fueron operados por facoemulsificación y el resto por túnel esclerocorneal. Se analizaron las variables: mejor agudeza visual corregida y sin corrección, dureza del cristalino, conteo celular endotelial, hexagonalidad, coeficiente de variabilidad, astigmatismo medio inducido y tiempo efectivo de ultrasonido. Resultados: la pérdida celular endotelial en el grupo de facoemulsificación fue de 9,8 % y en el de extracción tunelizada, de 6,8 %. La hexagonalidad promedio posoperatoria fue mejor en el grupo de facoemulsificación (53 %. El coeficiente de variabilidad promedio preoperatorio disminuyó de 0,32 a 0,28 en el grupo de facoemulsificación. En este grupo el astigmatismo resultante fue de 1,35 D y el tiempo efectivo de facoemulsificación estuvo por debajo de los 2 minutos. En ambos grupos la mejor agudeza visual preoperatoria sin corrección promedio fue de 0,29 y mejoró a 0,56 en la extracción por túnel esclerocorneal y a 0,8 en la facoemulsificación. Conclusiones: la facoemulsificación por pre chop, constituye una buena opción en la cirugía de catarata. Las alteraciones endoteliales que provoca son similares a las de la extracción tunelizada, con ventaja sobre esta en la visión sin cristales por la menor inducción de astigmatismo.Objective: to evaluate the endothelial changes occurred and the visual results achieved in the eyes of patients diagnosed with senile cataract, who were operated on either by the prechop phacoemulsification technique or by the extracapsular extraction of

  16. The Role of Skp2 in the Prostate Tumorigenesis Following Rb and p53 Loss

    Science.gov (United States)

    2015-12-01

    Cancer center seminar, departmental weekly working in progress and journal club give me opportunities to developmental presentation skills and group...Einstein Gene therapy Core, lentivirus vectors expressing p27, p53, or shRNAs from Einstein shRNA Core facility. Lentiviral helper constructs were...inhibitors. We further show that GC B cells and T cells use different mechanisms to regulate their p27 protein levels, and propose a T helper cell

  17. Experiment list: SRX189411 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available ction=Pleura|Tissue Diagnosis=Adenocarcinoma 382984730,0.6,16.2,7193 GSM1008581: Duke DnaseSeq MCF-7 CTCF shRNA knock... cell lineage=ectoderm || cell sex=F || treatment=CTCF_shRNA_knockdown || treatme...nt description=CTCF (CCCTC-binding factor) transcript levels were knocked down in cells using lentiviral tra...to select for cells containing the retroviral construct. By western blot, CTCF protein levels in the knockdo

  18. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  19. Preferential lentiviral targeting of astrocytes in the central nervous system.

    Directory of Open Access Journals (Sweden)

    Michael Fassler

    Full Text Available The ability to visualize and genetically manipulate specific cell populations of the central nervous system (CNS is fundamental to a better understanding of brain functions at the cellular and molecular levels. Tools to selectively target cells of the CNS include molecular genetics, imaging, and use of transgenic animals. However, these approaches are technically challenging, time consuming, and difficult to control. Viral-mediated targeting of cells in the CNS can be highly beneficial for studying and treating neurodegenerative diseases. Yet, despite specific marking of numerous cell types in the CNS, in vivo selective targeting of astrocytes has not been optimized. In this study, preferential targeting of astrocytes in the CNS was demonstrated using engineered lentiviruses that were pseudotyped with a modified Sindbis envelope and displayed anti-GLAST IgG on their surfaces as an attachment moiety. Viral tropism for astrocytes was initially verified in vitro in primary mixed glia cultures. When injected into the brains of mice, lentiviruses that displayed GLAST IgG on their surface, exhibited preferential astrocyte targeting, compared to pseudotyped lentiviruses that did not incorporate any IgG or that expressed a control isotype IgG. Overall, this approach is highly flexible and can be exploited to selectively target astrocytes or other cell types of the CNS. As such, it can open a window to visualize and genetically manipulate astrocytes or other cells of the CNS as means of research and treatment.

  20. Detection and control of lentiviral infections in sheep and goats

    NARCIS (Netherlands)

    Brinkhof, J.M.A.

    2009-01-01

    Infections caused by the small ruminant lentiviruses (SRLV) of sheep (maedi visna virus) and goats (caprine arthritis encephalitis virus) are a serious economical threat to small ruminant farming particularly in the more intensive settings like dairy farms. Revenue is ultimately negatively

  1. Construction and Screening of a Lentiviral Secretome Library.

    Science.gov (United States)

    Liu, Tao; Jia, Panpan; Ma, Huailei; Reed, Sean A; Luo, Xiaozhou; Larman, H Benjamin; Schultz, Peter G

    2017-06-22

    Over 2,000 human proteins are predicted to be secreted, but the biological function of the many of these proteins is still unknown. Moreover, a number of these proteins may act as new therapeutic agents or be targets for the development of therapeutic antibodies. To further explore the extracellular proteome, we have developed a secretome-enriched open reading frame (ORF) library that can be readily screened for autocrine activity in cell-based phenotypic or reporter assays. Next-generation sequencing (NGS) and database analysis predict that the library contains approximately 900 ORFs encoding known secreted proteins (accounting for 77.8% of the library), as well as genes encoding potentially unknown secreted proteins. In a proof-of-principle study, human TF-1 cells were screened for proliferative factors, and the known cytokine GMCSF was identified as a dominant hit. This library offers a relatively low-cost and straightforward approach for functional autocrine screens of secreted proteins. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Beam-chopping system for LNS superconducting cyclotron

    International Nuclear Information System (INIS)

    Calabretta, L.; Caruso, A.; Raia, G.; Sparta, A.; Zappala, E.; Zingale, A.; Khemka, P.; Wei, C.Y.

    1999-01-01

    Several experiments which foresee the measurement of time of flight require a bunched beam with a FWHM smaller that 1 ns and a temporal separation from 100 to 200 ns. An H.E. Chopper that achieves this temporal separation between the impulses has been installed along the beam extraction line of the cyclotron. The two electrodes, which deflect the beam and the inductance coil are both under vacuum. The operating frequency range of the LC resonant circuit is from 4.5 to 9 MHz and the maximum design voltage is 70 kV. The chopper selects only the beam bunches which cross the device at peak voltage, one bunch for cycle. A steerer magnet to recover the selected bunches on the beam axis is used. All the tests, measurements and chopper's performance, will be presented. (authors)

  3. Beam-chopping system for LNS superconducting cyclotron

    Energy Technology Data Exchange (ETDEWEB)

    Calabretta, L.; Caruso, A.; Raia, G.; Sparta, A.; Zappala, E.; Zingale, A. [INFN-LNS, Catania (Italy); Khemka, P. [VEEC, Calcutta (India); Wei, C.Y. [Institute of Modern Physics, Lanzhou (China)

    1999-07-01

    Several experiments which foresee the measurement of time of flight require a bunched beam with a FWHM smaller that 1 ns and a temporal separation from 100 to 200 ns. An H.E. Chopper that achieves this temporal separation between the impulses has been installed along the beam extraction line of the cyclotron. The two electrodes, which deflect the beam and the inductance coil are both under vacuum. The operating frequency range of the LC resonant circuit is from 4.5 to 9 MHz and the maximum design voltage is 70 kV. The chopper selects only the beam bunches which cross the device at peak voltage, one bunch for cycle. A steerer magnet to recover the selected bunches on the beam axis is used. All the tests, measurements and chopper's performance, will be presented. (authors)

  4. International trade in meat: the tip of the pork chop.

    Science.gov (United States)

    Galloway, James N; Burke, Marshall; Bradford, G Eric; Naylor, Rosamond; Falcon, Walter; Chapagain, Ashok K; Gaskell, Joanne C; McCullough, Ellen; Mooney, Harold A; Oleson, Kirsten L L; Steinfeld, Henning; Wassenaar, Tom; Smil, Vaclav

    2007-12-01

    This paper provides an original account of global land, water, and nitrogen use in support of industrialized livestock production and trade, with emphasis on two of the fastest-growing sectors, pork and poultry. Our analysis focuses on trade in feed and animal products, using a new model that calculates the amount of "virtual" nitrogen, water, and land used in production but not embedded in the product. We show how key meat-importing countries, such as Japan, benefit from "virtual" trade in land, water, and nitrogen, and how key meat-exporting countries, such as Brazil, provide these resources without accounting for their true environmental cost. Results show that Japan's pig and chicken meat imports embody the virtual equivalent of 50% of Japan's total arable land, and half of Japan's virtual nitrogen total is lost in the US. Trade links with China are responsible for 15% of the virtual nitrogen left behind in Brazil due to feed and meat exports, and 20% of Brazil's area is used to grow soybean exports. The complexity of trade in meat, feed, water, and nitrogen is illustrated by the dual roles of the US and The Netherlands as both importers and exporters of meat. Mitigation of environmental damage from industrialized livestock production and trade depends on a combination of direct-pricing strategies, regulatory approaches, and use of best management practices. Our analysis indicates that increased water- and nitrogen-use efficiency and land conservation resulting from these measures could significantly reduce resource costs.

  5. Biogasification of plant waste choppings. Kasvijaetesilpun biokaasutus; Loppuraportti

    Energy Technology Data Exchange (ETDEWEB)

    Tenhunen, E.J.; Pelkonen, P.

    1987-01-01

    The literature on biogasification of plant bio masses is reviewed. So far it is possible to calculate, the energy potential of Finnish plant-based biomasses is 7.3 petajoules per yr. Biomasses not included are, for example, weakly decomposed surface peat and the utilizable part of tree biomass. In laboratory experiments, the decomposition of three plant materials, namely, potato haulm, tops of sugarbeet, and tops of jerusalem artichoke, was followed in 35 degrees Celsius. The total dry matter content of the masses in the beginning of the digestion was 20 per cent, the dry matter percentage of inoculum 0.7 per cent, and, in parts of experiments, the dry matter percentage of cattle manure or pig slurry was 19.3 per cent. The plant materials were dried before digestion to attain uniform dry matter conditions for the 1 liter bottles.

  6. Supporting mindful eating: InBalance chopping board

    NARCIS (Netherlands)

    Toet, E.N.; Meerbeek, B.W.; Hoonhout, H.C.M.

    2012-01-01

    In our affluent Western society, food is easy to obtain and high calorie food is presented to us everywhere. And apparently hard to resist, since obesity is a growing problem, with an increase in a rangeof health issues attributed to overweight, such as cardiovascular diseases and diabetes. In the

  7. Consumer preferences for pork chops in five Canadian provinces.

    Science.gov (United States)

    Ngapo, T M

    2017-07-01

    The aim of this study is to identify the most important characteristics of fresh pork that determine consumer choice in five Canadian provinces. Within-consumer preference replication and systematic image manipulation in surveying showed differences in strategies for pork choice in lean colour (P<0.001) and marbling (P=0.006). High proportions of Nova Scotians (29%) chose light red pork, Albertans (42%) dark red and Quebecers (29%) non-marbled pork. Overall, the most important choice criteria were fat cover (57% preferred lean, 8% fatty) and lean colour (35% dark red, 18% light red). Marbling and drip were less used, but are important noting that 26% of consumers used three or four characteristics to make their choice. The preferences are readily met by the industry, but unfortunately, preferences for minimal or no marbling and fat cover likely result in a compromised gustative experience for many Canadian consumers. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  8. Compression molding of chopped woven thermoplastic composite flakes

    NARCIS (Netherlands)

    Abdul Rasheed, Mohammed Iqbal

    2016-01-01

    Continuous fiber reinforced composites with high-performance thermoplastic polymer matrices have an enormous potential in terms of performance, production rate, cost efficiency and recyclability. The use of this relatively new class of materials by the aerospace and automotive industry has been

  9. Chemical Burns Following Massage With Chopped Pulsatilla koreana.

    Science.gov (United States)

    Song, Jinkyung; Tae, Sangpil; Joo, Hongsil; Lee, Sang-Yeul; Sung, Kun-Yong

    2017-11-01

    Herbal massage is commonly used for cosmetic and antirheumatic purposes in the Republic of Korea. Cutaneous burns can complicate herbal massages, but this is a very rare occurrence. Pulsatilla koreana, the Korean pasque flower, is a species of the genus Pulsatilla from the Ranunculaceae family. It is a perennial plant native to Korea, where it is used in herbal and folk medicine for its antipyretic, analgesic, anti-inflammatory, astringent, and hemostatic effects. Three cases of burns as a result of herbal massages with Pulsatilla koreana are presented herein to increase public awareness about the adverse effects of products used incorrectly for herbal massage.

  10. Carbon Nanotube Chopped Fiber for Enhanced Properties in Additive Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Menchhofer, Paul A [ORNL; Lindahl, John M [ORNL; JohnsonPhD, DR Joseph E. [Nanocomp Technologies, Inc.

    2016-06-06

    Nanocomp Technologies, Inc. is working with Oak Ridge National Laboratory to develop carbon nanotube (CNT) composite materials and evaluate their use in additive manufacturing (3D printing). The first phase demonstrated feasibility and improvements for carbon nanotube (CNT)- acrylonitrile butadiene styrene (ABS) composite filaments use in additive manufacturing, with potential future work centering on further improvements. By focusing the initial phase on standard processing methods (developed mainly for the incorporation of carbon fibers in ABS) and characterization techniques, a basis of knowledge for the incorporation of CNTs in ABS was learned. The ability to understand the various processing variables is critical to the successful development of these composites. From the degradation effects on ABS (caused by excessive temperatures), to the length of time the ABS is in the melt state, to the order of addition of constituents, and also to the many possible mixing approaches, a workable flow sequence that addresses each processing step is critical to the final material properties. Although this initial phase could not deal with each of these variables in-depth, a future study is recommended that will build on the lessons learned for this effort.

  11. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  12. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  13. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  14. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.

  15. Soil amendment with chopped or ground dry leaves of six species of plants for the control of Meloidogyne javanica in tomato under greenhouse conditions Incorporação ao solo de folhas secas picadas ou moídas de seis espécies de plantas para o controle de Meloidogyne javanica em tomateiro em casa de vegetação

    Directory of Open Access Journals (Sweden)

    Everaldo Antônio Lopes

    2011-06-01

    Full Text Available Greenhouse experiments were conducted to evaluate the effect of soil amendment with chopped (1cm² or ground (1mm sieve dry leaves of assa-peixe (Vernonia polyanthes, lemon-grass (Cymbopogon citratus, eucalyptus (Eucalyptus citriodora, castor (Ricinus communis, mango (Mangifera indica or neem (Azadirachta indica for the control Meloidogyne javanica. Into the soil (Yellow red oxisol of each pot were added leaves (5g kg-1 of soil and 5,000 eggs of the nematode. After seven days, one tomato seedling "Santa Cruz Kada" was transplanted to each pot. The tomato root weight, galls and eggs/root system were determined 60 days after transplant. None of the soil amendments reduced gall or eggs, when applied as leaf pieces. However, all tested plant species reduced the gall number, when they were incorporated into the soil as powder, and maximum nematode suppression occurred in soil amended with neem leaves (61%. The amendment with ground leaves of castor, neem, eucalyptus and lemon-grass reduced the number of eggs, with maximum reduction occurring in soil amended with ground castor leaves (69%, evidencing that these organic amendments can be an alternative for M. javanica control in tomato. Further studies are required under field conditions to confirm the potential of these organic amendments on the control of M. javanica.Experimentos em casa de vegetação foram conduzidos com o objetivo de avaliar o efeito da adição ao solo de folhas secas picadas (1cm² ou trituradas (peneira de 1mm de assa-peixe (Vernonia polyanthes, capim-limão (Cymbopogon citratus, eucalipto (Eucalyptus citriodora, mamona (Ricinus communis, manga (Mangifera indica ou nim (Azadirachta indica para o controle de Meloidogyne javanica. Ao solo de cada vaso (latossolo vermelho-amarelo, foram adicionadas folhas (5g kg-1 de solo e 5.000 ovos do nematoide. Após sete dias, uma muda de tomateiro "Santa Cruz Kada" foi transplantada em cada vaso. O peso das raízes e os números de galhas e

  16. EFECTO DE LA ADICIÓN DE CARRAGENINA KAPPA I.II Y GOMA TARA SOBRE CARACTERÍSTICAS DE CALIDAD DEL JAMÓN DE CERDO PICADO Y COCIDO EFFECT OF THE ADDITION OF KAPPA I.II CARRAGEENAN AND TARA GUM ON QUALITY CHARACTERISTICS OF COOKED AND CHOPPED PORK HAMS

    Directory of Open Access Journals (Sweden)

    Diego Alonso Restrepo Molina

    2010-12-01

    Full Text Available Se evaluaron sinéresis, color y dureza instrumental y, sensorialmente las características de olor, sabor, color y dureza en jamones inyectados, cocidos y picados de cerdo, los cuales se habían elaborado aplicando en la salmuera de inyección una mezcla de hidrocoloides compuesta por carragenina kappa I.II y goma tara en una proporción de 79:21, en niveles del 1% y 1,2%, usando tres repeticiones para el estudio. Los jamones así elaborados se compararon contra un jamón testigo, elaborado sin el uso de estos hidrocoloides. Los valores obtenidos para los atributos, se analizaron mediante un diseño de una sola vía, con 5 repeticiones en el tiempo (0, 10, 20, 28 y 34 días, dando un arreglo factorial. Los resultados muestran que el tratamiento 2 (1,2% presentó la menor liberación de agua y la mayor dureza. No se registró diferencia entre los tratamientos y el testigo para la característica elasticidad. El testigo mostró las mejores características de color, olor y sabor sensoriales. La edad influyó en las características dureza y sinéresis en forma determinante, señalando el período desde el día 15 hasta el día 28 como aquel en que más se agudiza la sinéresis, siendo ésta más notable en el testigo que no contenía hidrocoloide.Characteristics of quality, color, texture and sineresis (instrumental and, odor, flavor, color and hardness (sensory of injected, cooked and chopped pork hams were assessed, which were manufactured using a mix of hydrocolloids in the brine of injection comprised by kappa I.II carrageenan and tara gum in a 79:21 ratio, at levels of 1% and 1.2%, using three replicates for the study; the finished hams were compared with a control ham, manufactured without the use of these hydrocolloids. The values obtained for the attributes, were analyzed through a one way design, with 5 repetitions in time (0, 10, 20, 28 and 34 days, providing a factorial arrangement. The results showed that the treatment 2 (1

  17. [Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

    Science.gov (United States)

    Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

    2013-08-01

    This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

  18. Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

    Directory of Open Access Journals (Sweden)

    John S Cho

    2009-09-01

    Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

  19. [Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

    Science.gov (United States)

    Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

    2018-01-01

    Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

  20. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  1. ESTUDIO PRELIMINAR SOBRE LA INFLUENCIA DE LA CARRAGENINA KAPPA, KAPPA I.II Y GOMA TARA EN LA VISCOSIDAD Y TIXOTROPÍA DE LAS SALMUERAS DE INYECCIÓN PARA JAMONES COCIDOS PICADOS DE CERDO PRELIMINARY STUDY ON THE INFLUENCE OF KAPPA, KAPPA I.II CARRAGEENAN AND TARA GUM IN THE VISCOSITY AND THIXOTROPY OF INJECTION BRINES FOR COOKED CHOPPED HAMS OF PORK

    Directory of Open Access Journals (Sweden)

    Fabio Alexander Molina Cote

    2010-12-01

    Full Text Available El presente estudio determinó el efecto que sobre la viscosidad y la tixotropía de una salmuera de masajeo para jamones picados cocidos de cerdo, tiene la adición de carragenina kappa, carragenina kappa I.II y goma tara, cuando son usadas a un nivel del 1% en la salmuera. Para tal efecto se incorporaron seis mezclas distintas de hidrocoloides provenientes de la carragenina kappa, kappa I.II y goma tara (individualmente, en mezclas binarias y mezclas terciarias, en una salmuera de inyección y masajeo para jamones; a las cuales se les determinó su comportamiento viscoso y tixotrópico a 4 ºC. Los datos obtenidos de índice de tixotropía (máximos, se analizaron mediante un modelo cuadrático derivado de un arreglo de mezclas. Los resultados mostraron que todas las salmueras se comportaron tixotrópicamente, presentando mayor área de histéresis, las mezclas que contenían goma tara. El modelo usado para el índice de tixotropía arrojó, con un nivel de significancia de 0,05, que la relación óptima, es la que contiene la mezcla de carragenina kappa I.II-goma tara (79% y 21%. Adicionalmente, las salmueras que contenían carragenina kappa, carragenina kappa I.II y carragenina kappa-carragenina kappa I.II presentaron menor viscosidad que las mezclas que contenían goma tara.The aim of this study was to determine the thixotropy´s effect of a massage brine in cooked chopped pork hams with addition of kappa, kappa I.II carrageenan, tara gum and their mixtures, when were used at 1% injection level of brine to meat. Six mixtures were evaluated. A protocol for thixotropy measurement adjusted to the conditions of brines used taking in account salinity, pH, temperature and shear stress. Data obtained from thixotropy index (maximum were analyzed with quadratic model derived from blends array. Results showed thixotropic measurement to brines presented a very small area, showing structural changes, but with very fast recovery. It was observed

  2. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    Energy Technology Data Exchange (ETDEWEB)

    Boku, Shuken, E-mail: shuboku@med.hokudai.ac.jp [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Nakagawa, Shin [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takamura, Naoki [Pharmaceutical Laboratories, Dainippon Sumitomo Pharma Co. Ltd., Osaka (Japan); Kato, Akiko [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan); Takebayashi, Minoru [Department of Psychiatry, National Hospital Organization Kure Medical Center, Kure (Japan); Hisaoka-Nakashima, Kazue [Department of Pharmacology, Hiroshima University Graduate School of Biomedical Sciences, Hiroshima (Japan); Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro [Department of Psychiatry, Hokkaido University Graduate School of Medicine, Sapporo (Japan)

    2013-05-17

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis.

  3. GDNF facilitates differentiation of the adult dentate gyrus-derived neural precursor cells into astrocytes via STAT3

    International Nuclear Information System (INIS)

    Boku, Shuken; Nakagawa, Shin; Takamura, Naoki; Kato, Akiko; Takebayashi, Minoru; Hisaoka-Nakashima, Kazue; Omiya, Yuki; Inoue, Takeshi; Kusumi, Ichiro

    2013-01-01

    Highlights: •GDNF has no effect on ADP proliferation and apoptosis. •GDNF increases ADP differentiation into astrocyte. •A specific inhibitor of STAT3 decreases the astrogliogenic effect of GDNF. •STAT3 knockdown by lentiviral shRNA vector also decreases the astrogliogenic effect of GDNF. •GDNF increases the phosphorylation of STAT3. -- Abstract: While the pro-neurogenic actions of antidepressants in the adult hippocampal dentate gyrus (DG) are thought to be one of the mechanisms through which antidepressants exert their therapeutic actions, antidepressants do not increase proliferation of neural precursor cells derived from the adult DG. Because previous studies showed that antidepressants increase the expression and secretion of glial cell line-derived neurotrophic factor (GDNF) in C6 glioma cells derived from rat astrocytes and GDNF increases neurogenesis in adult DG in vivo, we investigated the effects of GDNF on the proliferation, differentiation and apoptosis of cultured neural precursor cells derived from the adult DG. Data showed that GDNF facilitated the differentiation of neural precursor cells into astrocytes but had no effect on their proliferation or apoptosis. Moreover, GDNF increased the phosphorylation of STAT3, and both a specific inhibitor of STAT3 and lentiviral shRNA for STAT3 decreased their differentiation into astrocytes. Taken together, our findings suggest that GDNF facilitates astrogliogenesis from neural precursor cells in adult DG through activating STAT3 and that this action might indirectly affect neurogenesis

  4. REPLACEMENT OF CORN SILAGE BY CHOPPED SUGARCANE PLUS WHOLE COTTONSEED ON RUMINAL PARAMETERS, MICROBIAL PROTEIN PRODUCTION, AND NUTRIENT DIGESTIBILITY IN LACTATING COWS SUBSTITUIÇÃO DE SILAGEM DE MILHO POR CANA-DE-AÇÚCAR E CAROÇO DE ALGODÃO NOS PARÂMETROS RUMINAIS, SÍNTESE DE PROTEÍNA MICROBIANA E UTILIZAÇÃO DOS NUTRIENTES EM VACAS LACTANTES

    Directory of Open Access Journals (Sweden)

    Alexandre Vaz Pires

    2008-04-01

    Full Text Available Five multiparous Holstein cows averaging 525.91 kg BW and 85 days in milk were assigned in a 5 x 5 Latin square to evaluate the effects of corn silage replacement by sugarcane plus whole cottonseed. Cows were cannulated in the rumen and proximal duodenum and were fed a 50:50 concentrate:forage diet (DM basis. Treatments were defined by the replacement of corn silage by chopped sugarcane (whole plant plus whole cottonseed in the following proportions: 100:0 (control; 75:25; 50:50; 25:75; 0:100 in the DM basis. Dry matter intake (DMI of cows fed 100, 75, and 50% corn silage diets was higher (P<0.05 than DMI of cows fed 25 and 0% corn silage. Ruminal degradability and total tract digestibility of neutral detergent fiber and acid detergent fiber were not affected (P>0.05 by treatment diets. Total digestibilities of crude protein in diets containing up to 50% of sugarcane were lower than in diets containing 75 or 100% of sugarcane. Ruminal ammonia concentration decreased (P<0.05 with sugarcane and whole cottonseed inclusion. Concentrations of acetic, propionic and butyric acids as well as total volatile fatty acids concentration were higher (P<0.05 with sugarcane inclusion up to 50% level. Corn silage can be replaced by sugar cane plus whole cottonseed up to 50% level of forage in the diet without negative effect on nutrient utilization by dairy cows producing up to 18 kg milk/day. KEY WORDS: Digestibility, NDF, volatile fatty acid. Utilizaram-se cinco vacas holandesas pluríparas (525,91 kg PV e m

  5. A comprehensive platform for highly multiplexed mammalian functional genetic screens

    Directory of Open Access Journals (Sweden)

    Cheung-Ong Kahlin

    2011-05-01

    Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

  6. Lentviral-mediated RNAi to inhibit target gene expression of the porcine integrin αv subunit, the FMDV receptor, and against FMDV infection in PK-15 cells

    Directory of Open Access Journals (Sweden)

    Lin Tong

    2011-09-01

    Full Text Available Abstract Background shRNA targeting the integrin αv subunit, which is the foot-and-mouth disease virus (FMDV receptor, plays a key role in virus attachment to susceptible cells. We constructed a RNAi lentiviral vector, iαv pLenti6/BLOCK -iT™, which expressed siRNA targeting the FMDV receptor, the porcine integrin αv subunit, on PK-15 cells. We also produced a lentiviral stock, established an iαv-PK-15 cell line, evaluated the gene silencing efficiency of mRNA using real-time qRT-PCR, integrand αv expression by indirect immunofluorescence assay (IIF and cell enzyme linked immunosorbent assays (cell ELISA, and investigated the in vivo inhibitory effect of shRNA on FMDV replication in PK-15 cells. Results Our results indicated successful establishment of the iαv U6 RNAi entry vector and the iαv pLenti6/BLOCK -iT expression vector. The functional titer of obtained virus was 1.0 × 106 TU/mL. To compare with the control and mock group, the iαv-PK-15 group αv mRNA expression rate in group was reduced by 89.5%, whilst IIF and cell ELISA clearly indicated suppression in the experimental group. Thus, iαv-PK-15 cells could reduce virus growth by more than three-fold and there was a > 99% reduction in virus titer when cells were challenged with 102 TCID50 of FMDV. Conclusions Iαv-PK-15 cells were demonstrated as a cell model for anti-FMDV potency testing, and this study suggests that shRNA could be a viable therapeutic approach for controlling the severity of FMD infection and spread.

  7. Identification of short hairpin RNA targeting foot-and-mouth disease virus with transgenic bovine fetal epithelium cells.

    Directory of Open Access Journals (Sweden)

    Hongmei Wang

    Full Text Available BACKGROUND: Although it is known that RNA interference (RNAi targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV, it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. PRINCIPAL FINDING: Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2, VP3 (RNAi-VP3, or VP4 (RNAi-VP4 of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID(50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. CONCLUSION: RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV.

  8. Differentiated neuroprogenitor cells incubated with human or canine adenovirus, or lentiviral vectors have distinct transcriptome profiles.

    Directory of Open Access Journals (Sweden)

    Stefania Piersanti

    Full Text Available Several studies have demonstrated the potential for vector-mediated gene transfer to the brain. Helper-dependent (HD human (HAd and canine (CAV-2 adenovirus, and VSV-G-pseudotyped self-inactivating HIV-1 vectors (LV effectively transduce human brain cells and their toxicity has been partly analysed. However, their effect on the brain homeostasis is far from fully defined, especially because of the complexity of the central nervous system (CNS. With the goal of dissecting the toxicogenomic signatures of the three vectors for human neurons, we transduced a bona fide human neuronal system with HD-HAd, HD-CAV-2 and LV. We analysed the transcriptional response of more than 47,000 transcripts using gene chips. Chip data showed that HD-CAV-2 and LV vectors activated the innate arm of the immune response, including Toll-like receptors and hyaluronan circuits. LV vector also induced an IFN response. Moreover, HD-CAV-2 and LV vectors affected DNA damage pathways--but in opposite directions--suggesting a differential response of the p53 and ATM pathways to the vector genomes. As a general response to the vectors, human neurons activated pro-survival genes and neuron morphogenesis, presumably with the goal of re-establishing homeostasis. These data are complementary to in vivo studies on brain vector toxicity and allow a better understanding of the impact of viral vectors on human neurons, and mechanistic approaches to improve the therapeutic impact of brain-directed gene transfer.

  9. A recombinant lentiviral PDGF-driven mouse model of proneural glioblastoma.

    Science.gov (United States)

    Rahme, Gilbert J; Luikart, Bryan W; Cheng, Chao; Israel, Mark A

    2018-02-19

    Mouse models of glioblastoma (GBM), the most aggressive primary brain tumor, are critical for understanding GBM pathology and can contribute to the preclinical evaluation of therapeutic agents. Platelet-derived growth factor (PDGF) signaling has been implicated in the development and pathogenesis of GBM, specifically the proneural subtype. Although multiple mouse models of PDGF-driven glioma have been described, they require transgenic mice engineered to activate PDGF signaling and/or impair tumor suppressor genes and typically represent lower-grade glioma. We designed recombinant lentiviruses expressing both PDGFB and a short hairpin RNA targeting Cdkn2a to induce gliomagenesis following stereotactic injection into the dentate gyrus of adult immunocompetent mice. We engineered these viruses to coexpress CreERT2 with PDGFB, allowing for deletion of floxed genes specifically in transduced cells, and designed another version of this recombinant lentivirus in which enhanced green fluorescent protein was coexpressed with PDGFB and CreERT2 to visualize transduced cells. The dentate gyrus of injected mice showed hypercellularity one week post-injection and subsequently developed bona fide tumors with the pathologic hallmarks of GBM leading to a median survival of 77 days post-injection. Transcriptomic analysis of these tumors revealed a proneural gene expression signature. Informed by the genetic alterations observed in human GBM, we engineered a novel mouse model of proneural GBM. While reflecting many of the advantages of transgenic mice, this model allows for the facile in vivo testing of gene function in tumor cells and makes possible the rapid production of large numbers of immunocompetent tumor-bearing mice for preclinical testing of therapeutics. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

  10. Vif Proteins from Diverse Primate Lentiviral Lineages Use the Same Binding Site in APOBEC3G

    OpenAIRE

    Letko, Michael; Silvestri, Guido; Hahn, Beatrice H.; Bibollet-Ruche, Frederick; Gokcumen, Omer; Simon, Viviana; Ooms, Marcel

    2013-01-01

    APOBEC3G (A3G) is a cytidine deaminase that restricts human immunodeficiency virus type 1 (HIV-1) and other lentiviruses. Most of these viruses encode a Vif protein that directly binds A3G and leads to its proteasomal degradation. Both Vif proteins of HIV-1 and African green monkey simian immunodeficiency virus (SIVagm) bind residue 128 of A3G. However, this position does not control the A3G degradation by Vif variants derived from HIV-2 and SIVmac, which both originated from SIV of sooty man...

  11. A chimeric measles virus with a lentiviral envelope replicates exclusively in CD4+/CCR5+ cells

    International Nuclear Information System (INIS)

    Mourez, Thomas; Mesel-Lemoine, Mariana; Combredet, Chantal; Najburg, Valerie; Cayet, Nadege; Tangy, Frederic

    2011-01-01

    We generated a replicating chimeric measles virus in which the hemagglutinin and fusion surface glycoproteins were replaced with the gp160 envelope glycoprotein of simian immunodeficiency virus (SIVmac239). Based on a previously cloned live-attenuated Schwarz vaccine strain of measles virus (MV), this chimera was rescued at high titers using reverse genetics in CD4+ target cells. Cytopathic effect consisted in the presence of large cell aggregates evolving to form syncytia, as observed during SIV infection. The morphology of the chimeric virus was identical to that of the parent MV particles. The presence of SIV gp160 as the only envelope protein on chimeric particles surface altered the cell tropism of the new virus from CD46+ to CD4+ cells. Used as an HIV candidate vaccine, this MV/SIVenv chimeric virus would mimic transient HIV-like infection, benefiting both from HIV-like tropism and the capacity of MV to replicate in dendritic cells, macrophages and lymphocytes.

  12. Lentiviral-mediated administration of IL-25 in the CNS induces alternative activation of microglia

    DEFF Research Database (Denmark)

    Maiorino, C; Khorooshi, R; Ruffini, F

    2013-01-01

    Interleukin-25 (IL-25) is the only anti-inflammatory cytokine of the IL-17 family, and it has been shown to be efficacious in inhibiting neuroinflammation. Known for its effects on cells of the adaptive immune system, it has been more recently described to be effective also on cells of the innate...... was partly inhibited and the CNS protected from immune-mediated damage. To our knowledge, this is the first example of M2 shift (alternative activation) induced in vivo on CNS-resident myeloid cells by gene therapy, and may constitute a promising strategy to investigate the potential role of protective...

  13. Genetic modification of human sural nerve segments by a lentiviral vector encoding nerve growth factor

    NARCIS (Netherlands)

    Tannemaat, Martijn R; Boer, Gerard J; Verhaagen, J.; Malessy, Martijn J A

    2007-01-01

    OBJECTIVE: Autologous nerve grafts are used to treat severe peripheral nerve injury, but recovery of nerve function after grafting is rarely complete. Exogenous application of neurotrophic factors may enhance regeneration, but thus far the application of neurotrophic factors has been hampered by

  14. Efficient transduction of neurons using Ross River glycoprotein-pseudotyped lentiviral vectors

    DEFF Research Database (Denmark)

    Jakobsson, J; Nielsen, T Tolstrup; Staflin, K

    2006-01-01

    , including the possibility to establish stable producer cell lines. After injection of RRV-LV expressing green fluorescent protein into different structures in the rat brain we found efficient transduction of both neurons and glial cells. By using two cell-type-specific promoters, neuron-specific enolase...

  15. A lentivirally delivered photoactivatable GFP to assess continuity in the endoplasmic reticulum of neurones and glia

    Czech Academy of Sciences Publication Activity Database

    Jones, V. C.; Rodríguez Arellano, Jose Julio; Verkhratsky, Alexei; Jones, O. T.

    2009-01-01

    Roč. 458, č. 4 (2009), s. 809-818 ISSN 0031-6768 R&D Projects: GA ČR GA305/08/1384 Institutional research plan: CEZ:AV0Z50390512 Keywords : endoplasmic reticulum * calcium store * neurone Subject RIV: FH - Neurology Impact factor: 3.695, year: 2009

  16. Optimization and evaluation of an influenza A (H5) pseudotyped lentiviral particle-based serological assay

    NARCIS (Netherlands)

    Garcia, Jean-Michel; Lagarde, Nadège; Ma, Edward S. K.; de Jong, Menno D.; Peiris, J. S. Malik

    2010-01-01

    BACKGROUND: Novel serological methods provide alternative options for sero-diagnosis, sero-epidemiology and for determining evidence of naturally acquired or vaccine induced immunity. Micro-neutralization tests are currently the gold standard for serological studies of highly pathogenic avian

  17. Lentiviral gene transfer into the dorsal root ganglion of adult rats

    Directory of Open Access Journals (Sweden)

    Park Frank

    2011-08-01

    Full Text Available Abstract Background Lentivector-mediated gene delivery into the dorsal root ganglion (DRG is a promising method for exploring pain pathophysiology and for genetic treatment of chronic neuropathic pain. In this study, a series of modified lentivector particles with different cellular promoters, envelope glycoproteins, and viral accessory proteins were generated to evaluate the requirements for efficient transduction into neuronal cells in vitro and adult rat DRG in vivo. Results In vitro, lentivectors expressing enhanced green fluorescent protein (EGFP under control of the human elongation factor 1α (EF1α promoter and pseudotyped with the conventional vesicular stomatitis virus G protein (VSV-G envelope exhibited the best performance in the transfer of EGFP into an immortalized DRG sensory neuron cell line at low multiplicities of infection (MOIs, and into primary cultured DRG neurons at higher MOIs. In vivo, injection of either first or second-generation EF1α-EGFP lentivectors directly into adult rat DRGs led to transduction rates of 19 ± 9% and 20 ± 8% EGFP-positive DRG neurons, respectively, detected at 4 weeks post injection. Transduced cells included a full range of neuronal phenotypes, including myelinated neurons as well as both non-peptidergic and peptidergic nociceptive unmyelinated neurons. Conclusion VSV-G pseudotyped lentivectors containing the human elongation factor 1α (EF1α-EGFP expression cassette demonstrated relatively efficient transduction to sensory neurons following direct injection into the DRG. These results clearly show the potential of lentivectors as a viable system for delivering target genes into DRGs to explore basic mechanisms of neuropathic pain, with the potential for future clinical use in treating chronic pain.

  18. Multivariate statistical analyses demonstrate unique host immune responses to single and dual lentiviral infection.

    Directory of Open Access Journals (Sweden)

    Sunando Roy

    2009-10-01

    Full Text Available Feline immunodeficiency virus (FIV and human immunodeficiency virus (HIV are recently identified lentiviruses that cause progressive immune decline and ultimately death in infected cats and humans. It is of great interest to understand how to prevent immune system collapse caused by these lentiviruses. We recently described that disease caused by a virulent FIV strain in cats can be attenuated if animals are first infected with a feline immunodeficiency virus derived from a wild cougar. The detailed temporal tracking of cat immunological parameters in response to two viral infections resulted in high-dimensional datasets containing variables that exhibit strong co-variation. Initial analyses of these complex data using univariate statistical techniques did not account for interactions among immunological response variables and therefore potentially obscured significant effects between infection state and immunological parameters.Here, we apply a suite of multivariate statistical tools, including Principal Component Analysis, MANOVA and Linear Discriminant Analysis, to temporal immunological data resulting from FIV superinfection in domestic cats. We investigated the co-variation among immunological responses, the differences in immune parameters among four groups of five cats each (uninfected, single and dual infected animals, and the "immune profiles" that discriminate among them over the first four weeks following superinfection. Dual infected cats mount an immune response by 24 days post superinfection that is characterized by elevated levels of CD8 and CD25 cells and increased expression of IL4 and IFNgamma, and FAS. This profile discriminates dual infected cats from cats infected with FIV alone, which show high IL-10 and lower numbers of CD8 and CD25 cells.Multivariate statistical analyses demonstrate both the dynamic nature of the immune response to FIV single and dual infection and the development of a unique immunological profile in dual infected cats, which are protected from immune decline.

  19. Lentiviral vectors in neurodegenrative disorders - Aspects in gene therapy and disease models

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup

    2009-01-01

    Neurodegenerative disorders remain a complex group of diseases (i.e. Huntington's disease, HD) that are characterized by progressive loss of neurons resulting in movement disorders, cognitive decline, dementia and death. There is no cure for these diseases and treatment relies on symptomatic relief...... expression and escape transgene silencing during differentiation of neural stem cell lines. However, insulator vectors appeared to be impaired in functionality, which has importance for the future use of insulators in viral vectors. Finally, cell based models of HD was constructed to elucidate...

  20. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  1. RNAi Knockdown of Hypoxia-Inducible Factor-1α Decreased the Proliferation, Migration, and Invasion of Hypoxic Hepatocellular Carcinoma Cells.

    Science.gov (United States)

    Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei

    2015-04-01

    The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.

  2. Study of wear mechanism of chopped fiber reinforced epoxy composite filled with graphite and bronze

    Science.gov (United States)

    Patil, Nitinchand; Prasad, Krishna

    2018-04-01

    The combined effect of graphite and sintered bronze with a short glass fiber reinforced epoxy composites was investigated in this work. A pin on disc wear test was carried out to study the wear behaviour and mechanism of the composites. The objective of this work is to develop an alternate friction resistance material for the application of sliding bearing. It was observed that the addition of sintered bronze improved mechanical and thermal stability of the composites as bronze has low contact resistance with graphite and has high thermal conductivity. It was observed from the test results that increased volume percentage of graphite and presence of bronze are play significant role in wear mechanism of the composites. It was observed from the scanning electronic microscopes (SEM) that the abrasive and adhesive wear mechanism was prominent in this study. It was also evident from the result that the frictional force remains stable irrespective of the applied normal load.

  3. NF-kappaB-Mediated Repression of GADD153/CHOP: A Role in Breast Cancer Initiation

    National Research Council Canada - National Science Library

    Nakshatri, Harikrishna

    2004-01-01

    .... p65 overexpressing cells showed hallmarks of epithelial to mesenchymal transition (EMT) including reduced expression of E-cadherin and Occludin and increased expression of Vimentin and stromelysin-1...

  4. ‘Licking the Chops of Memory’: Plotting the Social Sins of Jekyll and Hyde

    Directory of Open Access Journals (Sweden)

    Carolyn W. de la L. Oulton

    2018-03-01

    Full Text Available Dr Jekyll and Mr Hyde is hierarchical in its very title—alphabetically Hyde precedes Jekyll, but Jekyll’s superior education and culture are associated with social status whereas Hyde’s ‘Mr.’ is a courtesy title often hedged in with demonic or animalistic terms. But despite the division insisted on in the title, Jekyll’s wilful complicity in the fate that overtakes him is suggested in a series of clues, ranging from his symbolic association with vivisection to the ostentatious exclusion of a female voice (typically the source of spiritual guidance or inspiration in Victorian fiction. As Hyde engages in an ascending scale of brutal acts, beginning with the assault of a child, the middle-class male peer group attempts to exculpate or protect Jekyll from association with this rebarbative and criminal figure. But following the murder of Sir Danvers Carew, the climactic discovery of Hyde’s body provides the final evidence against Jekyll himself—in rejecting the possibility of religious salvation, he has deliberately chosen the evil that his final statement presents as the ‘assault’ of an ungovernable temptation.

  5. Effect of irradiation on quality of vacuum packed spicy beef chops

    Science.gov (United States)

    To develop an alternative pasteurization process for the spicy beef jerky (SBJ), SBJ was treated with irradiation doses of 0, 0.5, 1.5, 3, 4, 6 and 8 kGy and the sensory attributes, texture properties, drip loss and the protein biological efficiency were studied. The results showed that lightness, d...

  6. Chopped or Long Roughage: What Do Calves Prefer? Using Cross Point Analysis of Double Demand Functions

    DEFF Research Database (Denmark)

    Webb, Laura E.; Jensen, Margit Bak; Engel, Bas

    2014-01-01

    trained to work for roughage rewards from two simultaneously available panels. The cost (number of muzzle presses) required on the panels varied in each session (left panel/right panel): 7/35, 14/28, 21/21, 28/14, 35/7. Demand functions were estimated from the proportion of rewards achieved on one panel...

  7. A study on the chopping and mixing of cotton stalks with soil

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... INTRODUCTION ... porating plant residues into soil reduces the risk of soil ... stalks into soil increases the productivity of the field. ... producers were asked about the total area of their agricultural fields .... are made of forged steel in one piece. ... maintenance works such as thinning, weeding and irrigation.

  8. An Enigmatic Death in Farm Chopping Machine: Is This the Perfect Murder?

    Science.gov (United States)

    Gioia, Sara; Lancia, Massimo; Bacci, Mauro; Suadoni, Fabio

    2015-09-01

    Forensic autopsy, like the other sectors in medicine, has benefited from the technological progress and the creation of multidisciplinary teams to unveil more and more finely planned criminal intents.Forensic pathologists, however, can sometimes deal with very enigmatic cases, meeting so with the limits of their own knowledge. Therefore, in these cases, they must not allow themselves to be pressured by inquiring agencies, remaining instead always faithful to empiric observations.With regard to that, we present a peculiar case of death by shredding inside a grinding machinery. The magistrature consequently opened a dossier for willful murder. Lots of figures were appointed to solve the case and among them is the forensic pathologist. However, a great number of obstacles were put in the investigators' inquiries.Was it a perfect murder?

  9. String Chopping and Time-ordered Products of Linear String-localized Quantum Fields

    Science.gov (United States)

    Cardoso, Lucas T.; Mund, Jens; Várilly, Joseph C.

    2018-03-01

    For a renormalizability proof of perturbative models in the Epstein-Glaser scheme with string-localized quantum fields, one needs to know what freedom one has in the definition of time-ordered products of the interaction Lagrangian. This paper provides a first step in that direction. The basic issue is the presence of an open set of n-tuples of strings which cannot be chronologically ordered. We resolve it by showing that almost all such string configurations can be dissected into finitely many pieces which can indeed be chronologically ordered. This fixes the time-ordered products of linear field factors outside a nullset of string configurations. (The extension across the nullset, as well as the definition of time-ordered products of Wick monomials, will be discussed elsewhere).

  10. Kaempferol induces hepatocellular carcinoma cell death via endoplasmic reticulum stress-CHOP-autophagy signaling pathway

    OpenAIRE

    Guo, Haiqing; Lin, Wei; Zhang, Xiangying; Zhang, Xiaohui; Hu, Zhongjie; Li, Liying; Duan, Zhongping; Zhang, Jing; Ren, Feng

    2017-01-01

    Kaempferol is a flavonoid compound that has gained widespread attention due to its antitumor functions. However, the underlying mechanisms are still not clear. The present study investigated the effect of kaempferol on hepatocellular carcinoma and its underlying mechanisms. Kaempferol induced autophagy in a concentration- and time-dependent manner in HepG2 or Huh7 cells, which was evidenced by the significant increase of autophagy-related genes. Inhibition of autophagy pathway, through 3-meth...

  11. Homocomposites of chopped fluorinated polyethylene fiber with low-density polyethylene matrix

    International Nuclear Information System (INIS)

    Maity, J.; Jacob, C.; Das, C.K.; Alam, S.; Singh, R.P.

    2008-01-01

    Conventional composites are generally prepared by adding reinforcing agent to a matrix and the matrix wherein the reinforcing agents are different in chemical composition with the later having superior mechanical properties. This work presents the preparation and properties of homocomposites consisting of a low-density polyethylene (LDPE) matrix and an ultra high molecular weight polyethylene (UHMWPE) fiber reinforcing phase. Direct fluorination is an important surface modification process by which only a thin upper layer is modified, the bulk properties of the polymer remaining unchanged. In this work, surface fluorination of UHMWPE fiber was done and then fiber characterization was performed. It was observed that after fluorination the fiber surface became rough. Composites were then prepared using both fluorinated and non-fluorinated polyethylene fiber with a low-density polyethylene (LDPE) matrix to prepare single polymer composites. It was found that the thermal stability and mechanical properties were improved for fluorinated fiber composites. X-ray diffraction (XRD) analysis showed that the crystallinity of the composites increased and it is maximum for fluorinated fiber composites. Tensile strength (TS) and modulus also increased while elongation at break (EB) decreased for fiber composites and was a maximum for fluorinated fiber composites. Scanning electron microscopic analysis indicates that that the distribution of fiber into the matrix is homogeneous. It also indicates the better adhesion between the matrix and the reinforcing agent for modified fiber composites. We also did surface fluorination of the prepared composites and base polymer for knowing its application to different fields such as printability wettability, etc. To determine the various properties such as printability, wettability and adhesion properties, contact angle measurement was done. It was observed that the surface energies of surface modified composites and base polymer increases remarkably but the mechanical properties remain almost unchanged

  12. Inactivation of Escherichia coli inoculated onto fresh-cut chopped cabbage using electron-beam processing.

    Science.gov (United States)

    Grasso, Elizabeth M; Uribe-Rendon, Roberto M; Lee, Ken

    2011-01-01

    During the past decade there were more than 50 reported outbreaks involving leafy green vegetables contaminated with foodborne pathogens. Leafy greens, including cabbage, are fresh foods rarely heated before consumption, which enables foodborne illness. The need for improved safety of fresh food drives the demand for nonthermal food processes to decrease the risk of pathogens while maintaining fresh quality. This study examines the efficacy of electron-beam (e-beam) irradiation in decreasing indigenous microflora on fresh-cut cabbage and determines the optimal dosage to pasteurize fresh-cut cabbage inoculated with Escherichia coli K-12. Fresh-cut cabbage (100 g) was inoculated with ∼8 log E. coli K-12 and e-beam irradiated at doses of 0, 1.0, 2.3, or 4.0 kGy. At 2.3 kGy there was 7-log reduction of E. coli K-12 in the fresh-cut cabbage. The D(10)-value for E. coli K-12 in fresh-cut cabbage was 0.564 kGy. E-beam irradiation is thus a viable nonthermal treatment that extends the shelf life and increases the safety of fresh cabbage by reducing or eliminating indigenous microflora and unwanted pathogens.

  13. Effect of Irradiation on Quality of Vacuum-Packed Spicy Beef Chops

    Directory of Open Access Journals (Sweden)

    Liming Zhao

    2017-01-01

    Full Text Available To develop an alternative pasteurization process for the spicy beef jerky (SBJ, it was treated with irradiation doses of 0, 0.5, 1.5, 3, 4, 6, and 8 kGy and the sensory attributes, texture properties, drip loss, and the protein biological efficiency were studied. The results showed that lightness, drip loss, and off-odor of SBJ increased, while the hardness, chewiness, gumminess, color preference, and taste of SBJ decreased with the increase in irradiation dose. This tendency was obvious as the irradiation dose increased to 6 kGy and 8 kGy. The possible reason for these quality changes might be due to the free radicals produced by irradiation. This speculation is supported by the decrease of the content of capsanthin and the increase of the content of TBARS of SBJ with the increase in irradiation dose. The plate counts of treated SBJ indicated that 4 kGy was suitable for pasteurization of SBJ.

  14. TNF-α receptor 1 knockdown in the subfornical organ ameliorates sympathetic excitation and cardiac hemodynamics in heart failure rats.

    Science.gov (United States)

    Yu, Yang; Wei, Shun-Guang; Weiss, Robert M; Felder, Robert B

    2017-10-01

    In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ that lacks an effective blood-brain barrier and senses circulating humors. We hypothesized that the tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) in the SFO contributes to sympathetic excitation and cardiac dysfunction in HF rats. Rats received SFO microinjections of a TNFR1 shRNA or a scrambled shRNA lentiviral vector carrying green fluorescent protein, or vehicle. One week later, some rats were euthanized to confirm the accuracy of the SFO microinjections and the transfection potential of the lentiviral vector. Other rats underwent coronary artery ligation (CL) to induce HF or a sham operation. Four weeks after CL, vehicle- and scrambled shRNA-treated HF rats had significant increases in TNFR1 mRNA and protein, NF-κB activity, and mRNA for inflammatory mediators, RAS components and c-Fos protein in the SFO and downstream in the hypothalamic paraventricular nucleus, along with increased plasma norepinephrine levels and impaired cardiac function, compared with vehicle-treated sham-operated rats. In HF rats treated with TNFR1 shRNA, TNFR1 was reduced in the SFO but not paraventricular nucleus, and the central and peripheral manifestations of HF were ameliorated. In sham-operated rats treated with TNFR1 shRNA, TNFR1 expression was also reduced in the SFO but there were no other effects. These results suggest a key role for TNFR1 in the SFO in the pathophysiology of systolic HF. NEW & NOTEWORTHY Activation of TNF-α receptor 1 in the subfornical organ (SFO) contributes to sympathetic excitation in heart failure rats by increasing inflammation and renin-angiotensin system activity in the SFO and downstream in the hypothalamic

  15. Towards RNAi based therapy of liver diseases : diversity and complexity of shRNA and miRNA processing and functions

    NARCIS (Netherlands)

    Maczuga, Piotr

    2013-01-01

    Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process

  16. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  17. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  18. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  19. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  20. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  1. Perturbations of NAD+ salvage systems impact mitochondrial function and energy homeostasis in mouse myoblasts and intact skeletal muscle

    DEFF Research Database (Denmark)

    Andersen, Marianne Agerholm; Dall, Morten; Jensen, Benjamin Anderschou Holbech

    2018-01-01

    Nicotinamide adenine dinucleotide (NAD+) can be synthesized by nicotinamide phosphoribosyltransferase (NAMPT). We aimed to determine the role of NAMPT for maintaining NAD+ levels, mitochondrial function, and metabolic homeostasis in skeletal muscle cells. We generated stable Nampt knockdown (sh......Nampt KD) C2C12 cells using a shRNA lentiviral approach. Moreover, we applied gene electrotransfer to express cre recombinase in tibialis anterior muscle of floxed Nampt mice. In shNampt KD C2C12 myoblasts, Nampt and NAD+ levels were reduced by 70% and 50%, respectively, and maximal respiratory capacity...... was reduced by 25%. Moreover, anaerobic glycolytic flux increased by 55% and 2-deoxyglucose uptake increased by 25% in shNampt KD cells. Treatment with the NAD+ precursor nicotinamide riboside restored NAD+ levels in shNampt cells and increased maximal respiratory capacity by 18% and 32% in control and sh...

  2. RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

    Science.gov (United States)

    Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

    2013-08-01

    Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

  3. Adaptation of HepG2 cells to a steady-state reduction in the content of protein phosphatase 6 (PP6) catalytic subunit

    Energy Technology Data Exchange (ETDEWEB)

    Boylan, Joan M. [Department of Pediatrics, Brown University and Rhode Island Hospital, Providence, RI (United States); Salomon, Arthur R. [Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI (United States); Department of Chemistry, Brown University, Providence, RI (United States); Tantravahi, Umadevi [Division of Genetics, Department of Pathology, Brown University and Women and Infants Hospital, Providence, RI (United States); Gruppuso, Philip A., E-mail: philip_gruppuso@brown.edu [Department of Pediatrics, Brown University and Rhode Island Hospital, Providence, RI (United States); Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI (United States)

    2015-07-15

    Protein phosphatase 6 (PP6) is a ubiquitous Ser/Thr phosphatase involved in an array of cellular processes. To assess the potential of PP6 as a therapeutic target in liver disorders, we attenuated expression of the PP6 catalytic subunit in HepG2 cells using lentiviral-transduced shRNA. Two PP6 knock-down (PP6KD) cell lines (90% reduction of PP6-C protein content) were studied in depth. Both proliferated at a rate similar to control cells. However, flow cytometry indicated G2/M cell cycle arrest that was accounted for by a shift of the cells from a diploid to tetraploid state. PP6KD cells did not show an increase in apoptosis, nor did they exhibit reduced viability in the presence of bleomycin or taxol. Gene expression analysis by microarray showed attenuated anti-inflammatory signaling. Genes associated with DNA replication were downregulated. Mass spectrometry-based phosphoproteomic analysis yielded 80 phosphopeptides representing 56 proteins that were significantly affected by a stable reduction in PP6-C. Proteins involved in DNA replication, DNA damage repair and pre-mRNA splicing were overrepresented among these. PP6KD cells showed intact mTOR signaling. Our studies demonstrated involvement of PP6 in a diverse set of biological pathways and an adaptive response that may limit the effectiveness of targeting PP6 in liver disorders. - Highlights: • Lentiviral-transduced shRNA was used to generate a stable knockdown of PP6 in HepG2 cells. • Cells adapted to reduced PP6; cell proliferation was unaffected, and cell survival was normal. • However, PP6 knockdown was associated with a transition to a tetraploid state. • Genomic profiling showed downregulated anti-inflammatory signaling and DNA replication. • Phosphoproteomic profiling showed changes in proteins associated with DNA replication and repair.

  4. Adaptation of HepG2 cells to a steady-state reduction in the content of protein phosphatase 6 (PP6) catalytic subunit

    International Nuclear Information System (INIS)

    Boylan, Joan M.; Salomon, Arthur R.; Tantravahi, Umadevi; Gruppuso, Philip A.

    2015-01-01

    Protein phosphatase 6 (PP6) is a ubiquitous Ser/Thr phosphatase involved in an array of cellular processes. To assess the potential of PP6 as a therapeutic target in liver disorders, we attenuated expression of the PP6 catalytic subunit in HepG2 cells using lentiviral-transduced shRNA. Two PP6 knock-down (PP6KD) cell lines (90% reduction of PP6-C protein content) were studied in depth. Both proliferated at a rate similar to control cells. However, flow cytometry indicated G2/M cell cycle arrest that was accounted for by a shift of the cells from a diploid to tetraploid state. PP6KD cells did not show an increase in apoptosis, nor did they exhibit reduced viability in the presence of bleomycin or taxol. Gene expression analysis by microarray showed attenuated anti-inflammatory signaling. Genes associated with DNA replication were downregulated. Mass spectrometry-based phosphoproteomic analysis yielded 80 phosphopeptides representing 56 proteins that were significantly affected by a stable reduction in PP6-C. Proteins involved in DNA replication, DNA damage repair and pre-mRNA splicing were overrepresented among these. PP6KD cells showed intact mTOR signaling. Our studies demonstrated involvement of PP6 in a diverse set of biological pathways and an adaptive response that may limit the effectiveness of targeting PP6 in liver disorders. - Highlights: • Lentiviral-transduced shRNA was used to generate a stable knockdown of PP6 in HepG2 cells. • Cells adapted to reduced PP6; cell proliferation was unaffected, and cell survival was normal. • However, PP6 knockdown was associated with a transition to a tetraploid state. • Genomic profiling showed downregulated anti-inflammatory signaling and DNA replication. • Phosphoproteomic profiling showed changes in proteins associated with DNA replication and repair

  5. Stage dependent expression and tumor suppressive function of FAM134B (JK1) in colon cancer.

    Science.gov (United States)

    Islam, Farhadul; Gopalan, Vinod; Wahab, Riajul; Smith, Robert A; Qiao, Bin; Lam, Alfred King-Yin

    2017-01-01

    The aims of the present study are to investigate sub-cellular location, differential expression in different cancer stages and functional role of FAM134B in colon cancer development. FAM134B expression was studied and quantified at protein and mRNA levels in cell lines using immunocytochemistry, Western blot and real-time PCR. In vitro functional assays and an in vivo xenotransplantation mouse models were used to investigate the molecular role of FAM134B in cancer cell biology in response to FAM134B silencing with shRNA lentiviral particles. FAM134B protein was noted in both cytoplasm and nuclei of cancer cells. In cancer cells derived from stage IV colon cancer, FAM134B expression was remarkably reduced when compared to non-cancer colon cells and cancer cells derived from stage II colon cancer. FAM134B knockdown significantly (P colon cancer cells following lentiviral transfection. Furthermore, FAM134B suppression significantly increased (34-52%; P cancer suppressor gene in colon cancer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

    Science.gov (United States)

    Xu, Xuelian; Xie, Chengzhi; Edwards, Holly; Zhou, Hui; Buck, Steven A; Ge, Yubin

    2011-02-16

    Pediatric acute myeloid leukemia (AML) remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs) have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

  7. Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

    Science.gov (United States)

    Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

    2013-12-23

    This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

  8. MDM2 phenotypic and genotypic profiling, respective to TP53 genetic status, in diffuse large B-cell lymphoma patients treated with rituximab-CHOP immunochemotherapy: a report from the International DLBCL Rituximab-CHOP Consortium Program

    NARCIS (Netherlands)

    Xu-Monette, Z.Y.; Moller, M.B.; Tzankov, A.; Montes-Moreno, S.; Hu, W.; Manyam, G.C.; Kristensen, L.; Fan, L.; Visco, C.; Dybkaer, K.; Chiu, A.; Tam, W.; Zu, Y.; Bhagat, G.; Richards, K.L.; Hsi, E.D.; Choi, W.W.; Krieken, J.H.J.M. van; Huang, Q.; Huh, J.; Ai, W.; Ponzoni, M.; Ferreri, A.J.; Wu, L.; Zhao, X.; Bueso-Ramos, C.E.; Wang, S.A.; Go, R.S.; Li, Y.; Winter, J.N.; Piris, M.A.; Medeiros, L.J.; Young, K.H.

    2013-01-01

    MDM2 is a key negative regulator of the tumor suppressor p53, however, the prognostic significance of MDM2 overexpression in diffuse large B-cell lymphoma (DLBCL) has not been defined convincingly. In a p53 genetically-defined large cohort of de novo DLBCL patients treated with rituximab,

  9. Prognostic Role of Pre–Radiation Therapy {sup 18}F-Fluorodeoxyglucose Positron Emission Tomography for Primary Mediastinal B-Cell Lymphomas Treated with R-CHOP or R-CHOP-Like Chemotherapy Plus Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Filippi, Andrea Riccardo, E-mail: andreariccardo.filippi@unito.it [Department of Oncology, University of Torino, Torino (Italy); Piva, Cristina; Levis, Mario [Department of Oncology, University of Torino, Torino (Italy); Chiappella, Annalisa [Hematology, Città della Salute e della Scienza, Torino (Italy); Caracciolo, Daniele [Hematology, Città della Salute e della Scienza and University of Torino, Torino (Italy); Bellò, Marilena [Nuclear Medicine, Città della Salute e della Scienza, Torino (Italy); Bisi, Gianni [Nuclear Medicine, Città della Salute e della Scienza, Torino (Italy); Department of Medical Sciences, University of Torino, Torino (Italy); Vitolo, Umberto [Hematology, Città della Salute e della Scienza, Torino (Italy); Ricardi, Umberto [Department of Oncology, University of Torino, Torino (Italy)

    2016-07-15

    Purpose: To validate, in a monoinstitutional cohort with extended follow-up, that post–rituximab chemotherapy (R-CT) {sup 18}F-fluorodeoxyglucose positron emission tomography ({sup 18}FDG-PET) is a prognostic factor allowing discrimination of primary mediastinal B-cell lymphoma (PMBCL) patients at higher risk for progression after radiation therapy. Methods and Materials: We analyzed 51 patients, and {sup 18}FDG-PET scans were re-examined evaluating both the Deauville 5-point scale (D5PS) score and the standardized uptake value (SUV) of residual activity, if present. These parameters were then tested by univariate analysis for a potential correlation with progression-free survival (PFS) as the primary study endpoint. Results: Median follow-up time was 51 months (range, 9-153 months). After R-CT, D5PS score was 1 in 10 (19.6%), 2 in 11 (21.6%), 3 in 7 (13.8%), 4 in 17 (33.3%), and 5 in 6 patients (11.7%). Forty-three out of 51 patients (84.3%) had an SUV{sub max} ≤5, and 8 out of 51 (15.7%) had an SUV{sub max} ≥5. Overall, 6 patients experienced progression or relapse: 1 had a D5PS score 2 (with SUV{sub max} ≤5), and 5 had a D5PS score 5 (and SUV{sub max} ≥5). Patients with a D5PS score 5 showed significantly lower PFS rates versus all other scores (log-rank P<.001), as did patients with SUV{sub max} ≥5 when compared with those with SUV{sub max} ≤5 (log-rank P<.001). Conclusions: The present study confirmed the prognostic role of {sup 18}FDG-PET after R-CT, with patients with a D5PS score of 5 and/or an SUV{sub max} ≥5 being at high risk of progression/relapse after RT.

  10. A novel lentiviral scFv display library for rapid optimization and selection of high affinity antibodies.

    Science.gov (United States)

    Qudsia, Sehar; Merugu, Siva B; Mangukiya, Hitesh B; Hema, Negi; Wu, Zhenghua; Li, Dawei

    2018-04-30

    Antibody display libraries have become a popular technique to screen monoclonal antibodies for therapeutic purposes. An important aspect of display technology is to generate an optimization library by changing antibody affinity to antigen through mutagenesis and screening the high affinity antibody. In this study, we report a novel lentivirus display based optimization library antibody in which Agtuzumab scFv is displayed on cell membrane of HEK-293T cells. To generate an optimization library, hotspot mutagenesis was performed to achieve diverse antibody library. Based on sequence analysis of randomly selected clones, library size was estimated approximately to be 1.6 × 10 6 . Lentivirus display vector was used to display scFv antibody on cell surface and flow cytometery was performed to check the antibody affinity to antigen. Membrane bound scFv antibodies were then converted to secreted antibody through cre/loxP recombination. One of the mutant clones, M8 showed higher affinity to antigen in flow cytometery analysis. Further characterization of cellular and secreted scFv through western blot showed that antibody affinity was increased by three fold after mutagenesis. This study shows successful construction of a novel antibody library and suggests that hotspot mutagenesis could prove a useful and rapid optimization tool to generate similar libraries with various degree of antigen affinity. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Targeted, homology-driven gene insertion in stem cells by ZFN-loaded 'all-in-one' lentiviral vectors

    DEFF Research Database (Denmark)

    Cai, Yujia; Laustsen, Anders; Zhou, Yan

    2016-01-01

    -driven mechanism into safe loci. This insertion mechanism is driven by time-restricted exposure of treated cells to ZFNs. We show targeted gene integration in human stem cells, including CD34+ hematopoietic progenitors and induced pluripotent stem cells (iPSCs). Notably, targeted insertions are identified in 89......% of transduced iPSCs. Our findings demonstrate the applicability of nuclease-loaded 'all-in-one' IDLVs for site-directed gene insertion in stem cell based gene therapies....

  12. Lentiviral expression of retinal guanylate cyclase-1 (RetGC1 restores vision in an avian model of childhood blindness.

    Directory of Open Access Journals (Sweden)

    Melissa L Williams

    2006-06-01

    Full Text Available Leber congenital amaurosis (LCA is a genetically heterogeneous group of retinal diseases that cause congenital blindness in infants and children. Mutations in the GUCY2D gene that encodes retinal guanylate cyclase-1 (retGC1 were the first to be linked to this disease group (LCA type 1 [LCA1] and account for 10%-20% of LCA cases. These mutations disrupt synthesis of cGMP in photoreceptor cells, a key second messenger required for function of these cells. The GUCY1*B chicken, which carries a null mutation in the retGC1 gene, is blind at hatching and serves as an animal model for the study of LCA1 pathology and potential treatments in humans.A lentivirus-based gene transfer vector carrying the GUCY2D gene was developed and injected into early-stage GUCY1*B embryos to determine if photoreceptor function and sight could be restored to these animals. Like human LCA1, the avian disease shows early-onset blindness, but there is a window of opportunity for intervention. In both diseases there is a period of photoreceptor cell dysfunction that precedes retinal degeneration. Of seven treated animals, six exhibited sight as evidenced by robust optokinetic and volitional visual behaviors. Electroretinographic responses, absent in untreated animals, were partially restored in treated animals. Morphological analyses indicated there was slowing of the retinal degeneration.Blindness associated with loss of function of retGC1 in the GUCY1*B avian model of LCA1 can be reversed using viral vector-mediated gene transfer. Furthermore, this reversal can be achieved by restoring function to a relatively low percentage of retinal photoreceptors. These results represent a first step toward development of gene therapies for one of the more common forms of childhood blindness.

  13. A PCR-Based Method to Construct Lentiviral Vector Expressing Double Tough Decoy for miRNA Inhibition.

    Directory of Open Access Journals (Sweden)

    Huiling Qiu

    Full Text Available DNA vector-encoded Tough Decoy (TuD miRNA inhibitor is attracting increased attention due to its high efficiency in miRNA suppression. The current methods used to construct TuD vectors are based on synthesizing long oligonucleotides (~90 mer, which have been costly and problematic because of mutations during synthesis. In this study, we report a PCR-based method for the generation of double Tough Decoy (dTuD vector in which only two sets of shorter oligonucleotides (< 60 mer were used. Different approaches were employed to test the inhibitory potency of dTuDs. We demonstrated that dTuD is the most efficient method in miRNA inhibition in vitro and in vivo. Using this method, a mini dTuD library against 88 human miRNAs was constructed and used for a high-throughput screening (HTS of AP-1 pathway-related miRNAs. Seven miRNAs (miR-18b-5p, -101-3p, -148b-3p, -130b-3p, -186-3p, -187-3p and -1324 were identified as candidates involved in AP-1 pathway regulation. This novel method allows for an accurate and cost-effective generation of dTuD miRNA inhibitor, providing a powerful tool for efficient miRNA suppression in vitro and in vivo.

  14. Genetic modification of hematopoietic cells using retroviral and lentiviral vectors: safety considerations for vector design and delivery into target cells.

    Science.gov (United States)

    Dropulic, Boro

    2005-07-01

    The recent development of leukemia in three patients following retroviral vector gene transfer in hematopoietic stem cells, resulting in the death of one patient, has raised safety concerns for the use of integrating gene transfer vectors for human gene therapy. This review discusses these serious adverse events from the perspective of whether restrictions on vector design and vector-modified target cells are warranted at this time. A case is made against presently establishing specific restrictions for vector design and transduced cells; rather, their safety should be ascertained by empiric evaluation in appropriate preclinical models on a case-by-case basis. Such preclinical data, coupled with proper informed patient consent and a risk-benefit ratio analysis, provide the best available prospective evaluation of gene transfer vectors prior to their translation into the clinic.

  15. Utilizing a TLR5-Adjuvanted Cytomegalovirus as a Lentiviral Vaccine in the Nonhuman Primate Model for AIDS.

    Directory of Open Access Journals (Sweden)

    Jesse D Deere

    Full Text Available Despite tremendous progress in our understanding of human immunodeficiency virus (HIV natural history and advances in HIV treatment, there is neither an approved vaccine nor a cure for infection. Here, we describe the development and characterization of a novel replicating vaccine vector utilizing Cytomegalovirus (CMV and a TLR5 adjuvant. After partial truncation of the central, immunodominant hypervariable domain, flagellin (fliC from Salmonella was cloned downstream of a codon optimized gag gene from simian immunodeficiency virus (SIV and transiently expressed in telomerized rhesus fibroblast (TeloRF cells in culture. Lysates generated from these transfected cells induced the tumor necrosis factor alpha (TNF-α, in a mouse macrophage cell line, in a TLR5-dependent manner. The Gag/FliC expression construct was cloned into a bacterial artificial chromosome encoding the rhesus CMV (RhCMV genome, and infectious RhCMV was generated following transfection of TeloRF cells. This virus stably expressed an SIV Gag/FliC fusion protein through four serial passages. Lysates generated from infected cells induced TNF-α in a TLR5-dependent manner. Western blot analysis of infected cell lysates verified expression of a Gag/FliC fusion protein using a SIV p27 capsid monoclonal antibody. Lastly, rhesus macaques inoculated with this novel RhCMV virus demonstrated increased inflammatory responses at the site of inoculation seven days post-infection when compared to the parental RhCMV. These results demonstrate that an artificially constructed replicating RhCMV expressing an SIV Gag/FliC fusion protein is capable of activating TLR5 in a macrophage cell line in vitro and induction of an altered inflammatory response in vivo. Ongoing animals studies are aimed at determining vaccine efficacy, including subsequent challenge with pathogenic SIV.

  16. Hemagglutinin pseudotyped lentiviral particles: characterization of a new method for avian H5N1 influenza sero-diagnosis.

    OpenAIRE

    Nefkens , Isabelle; Garcia , Jean-Michel; Ling , Chu Shui; Lagarde , Nadège; Nicholls , John; Tang , Dong Jiang; Peiris , Malik; Buchy , Philippe; Altmeyer , Ralf

    2007-01-01

    BACKGROUND: Highly pathogenic avian influenza (HPAI) H5N1 has spread globally in birds and infected over 270 humans with an apparently high mortality rate. Serologic studies to determine the extent of asymptomatic H5N1 infection in humans and other mammals and to investigate the immunogenicity of current H5N1 vaccine candidates have been hampered by the biosafety requirements needed for H5N1 micro-neutralization tests. OBJECTIVE: Development of a serodiagnostic tool for highly pathogenic infl...

  17. Therapeutic benefit of lentiviral-mediated neonatal intracerebral gene therapy in a mouse model of globoid cell leukodystrophy

    NARCIS (Netherlands)

    Lattanzi, Annalisa; Salvagno, Camilla; Maderna, Claudio; Benedicenti, Fabrizio; Morena, Francesco; Kulik, Willem; Naldini, Luigi; Montini, Eugenio; Martino, Sabata; Gritti, Angela

    2014-01-01

    Globoid cell leukodystrophy (GLD) is an inherited lysosomal storage disease caused by β-galactocerebrosidase (GALC) deficiency. Gene therapy (GT) should provide rapid, extensive and lifetime GALC supply in central nervous system (CNS) tissues to prevent or halt irreversible neurologic progression.

  18. Extensive characterization of a lentiviral-derived stable cell line expressing rabbit hemorrhagic disease virus VPg protein.

    Science.gov (United States)

    Zhu, Jie; Miao, Qiuhong; Tan, Yonggui; Guo, Huimin; Li, Chuanfeng; Chen, Zongyan; Liu, Guangqing

    2016-11-01

    Rabbit hemorrhagic disease virus (RHDV) is an important member of the caliciviridae family. Currently, no suitable tissue culture system is available for proliferating RHDV, which limits the study of its pathogenesis. To bypass this obstacle, we established a cell line, RK13-VPg, stably expressing the VPg gene with a lentivirus packaging system in this study. In addition, the recently constructed RHDV replicon in our laboratory provided an appropriate model for studying the pathogenesis of RHDV without in vitro RHDV propagation and culture. Using this RHDV replicon and RK13-VPg cell line, we further demonstrated that the presence of VPg protein is essential for efficient translation of an RHDV replicon. Therefore, the RK13-VPg cell line is a powerful tool for studying the replication and translation mechanisms of RHDV. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. 75 FR 82148 - Nutrition Labeling of Single-Ingredient Products and Ground or Chopped Meat and Poultry Products

    Science.gov (United States)

    2010-12-29

    ... organization, members of the regulated industry, trade and professional associations, and a city health... to it during cooking that alter the calories, fat, and protein. For those reasons, the poultry trade... 82154

  20. Cancer Stem Cell Hypothesis for Therapeutic Innovation in Clinical Oncology? Taking the Root Out, Not Chopping the Leaf.

    Science.gov (United States)

    Dzobo, Kevin; Senthebane, Dimakatso Alice; Rowe, Arielle; Thomford, Nicholas Ekow; Mwapagha, Lamech M; Al-Awwad, Nasir; Dandara, Collet; Parker, M Iqbal

    2016-12-01

    Clinical oncology is in need of therapeutic innovation. New hypotheses and concepts for translation of basic research to novel diagnostics and therapeutics are called for. In this context, the cancer stem cell (CSC) hypothesis rests on the premise that tumors comprise tumor cells and a subset of tumor-initiating cells, CSCs, in a quiescent state characterized by slow cell cycling and expression of specific stem cell surface markers with the capability to maintain a tumor in vivo. The CSCs have unlimited self-renewal abilities and propagate tumors through division into asymmetric daughter cells. This differentiation is induced by both genetic and environmental factors. Another characteristic of CSCs is their therapeutic resistance, which is due to their quiescent state and slow dividing. Notably, the CSC phenotype differs greatly between patients and different cancer types. The CSCs may differ genetically and phenotypically and may include primary CSCs and metastatic stem cells circulating within the blood system. Targeting CSCs will require the knowledge of distinct stem cells within the tumor. CSCs can differentiate into nontumorigenic cells and this has been touted as the source of heterogeneity observed in many solid tumors. The latter cannot be fully explained by epigenetic regulation or by the clonal evolution theory. This heterogeneity markedly influences how tumors respond to therapy and prognosis. The present expert review offers an analysis and synthesis of the latest research and concepts on CSCs, with a view to truly disruptive innovation for future diagnostics and therapeutics in clinical oncology.

  1. Comparative study of mineral composition of beef steak and pork chops depending on the thermal preparation method.

    Science.gov (United States)

    Goran, Gheorghe Valentin; Tudoreanu, Liliana; Rotaru, Elena; Crivineanu, Victor

    2016-08-01

    This study focuses on the effects of three different thermal preparation methods (roasting, boiling, and microwave cooking) on the mineral concentrations of beef and pork, as well as on the comparison of mineral levels between these two types of meat. In this study, raw and cooked beef and pork samples were selected and analyzed by ICP-OES in order to determine mineral concentrations. In general, thermal preparation clearly increased mineral concentrations in cooked samples compared to raw meat. The highest mineral concentration was identified in the roasted samples. Trace element concentrations in beef were significantly higher compared to pork. In pork, Na concentration decreased in all samples, suggesting that Na is lost with water. Zn mean content in cooked beef samples registered significant differences compared to pork cooked samples. The percentage of water loss during the microwave thermal preparation for beef samples was higher than the other two treatments. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Rearrangements of MYC gene facilitate risk stratification in diffuse large B-cell lymphoma patients treated with rituximab-CHOP

    DEFF Research Database (Denmark)

    Tzankov, Alexandar; Xu-Monette, Zijun Y; Gerhard, Marc

    2014-01-01

    In order to address the debatable prognostic role of MYC rearrangements in diffuse large B-cell lymphoma patients treated with rituximab, cyclophosphamide, hydroxydaunorubicin, vincristine, and prednisone, we evaluated MYC rearrangements by fluorescence in situ hybridization in 563 cases using...... with the dual-fusion probes, 15 detectable only with the break-apart probes and 20 detectable with both dual-fusion probes and break-apart probes. MYC rearrangements correlated with germinal center B-cell origin (P=0.02), MYC protein expression (P=0.032), and larger tumor mass size (P=0.0003). Patients with MYC...... was prognostically additive. Radiotherapy seemed to diminish the prognostic effects of MYC rearrangements in diffuse large B-cell lymphoma patients since only 2/10 irradiated patients with MYC rearrangements died of/with disease, compared with 16/28 non-irradiated patients with MYC rearrangements. We conclude...

  3. JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis

    DEFF Research Database (Denmark)

    Prause, Michala; Christensen, Dan Ploug; Billestrup, Nils

    2014-01-01

    Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity. Endoplas......Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity....... Endoplasmic reticulum (ER) and oxidative stress are elicited by palmitate and high glucose concentrations further potentiating JNK activity. Our aim was to determine the role of the JNK subtypes JNK1, JNK2 and JNK3 in palmitate and high glucose-induced β-cell apoptosis. We established insulin-producing INS1...... INS1 cells showed increased apoptosis and cleaved caspase 9 and 3 compared to non-sense shRNA expressing control INS1 cells when exposed to palmitate and high glucose associated with increased CHOP expression, ROS formation and Puma mRNA expression. JNK2 shRNA expressing INS1 cells did not affect...

  4. Metformin induces apoptosis through AMPK-dependent inhibition of UPR signaling in ALL lymphoblasts.

    Directory of Open Access Journals (Sweden)

    Gilles M Leclerc

    Full Text Available The outcome of patients with resistant phenotypes of acute lymphoblastic leukemia (ALL or those who relapse remains poor. We investigated the mechanism of cell death induced by metformin in Bp- and T-ALL cell models and primary cells, and show that metformin effectively induces apoptosis in ALL cells. Metformin activated AMPK, down-regulated the unfolded protein response (UPR demonstrated by significant decrease in the main UPR regulator GRP78, and led to UPR-mediated cell death via up-regulation of the ER stress/UPR cell death mediators IRE1α and CHOP. Using shRNA, we demonstrate that metformin-induced apoptosis is AMPK-dependent since AMPK knock-down rescued ALL cells, which correlated with down-regulation of IRE1α and CHOP and restoration of the UPR/GRP78 function. Additionally rapamycin, a known inhibitor of mTOR-dependent protein synthesis, rescued cells from metformin-induced apoptosis and down-regulated CHOP expression. Finally, metformin induced PIM-2 kinase activity and co-treatment of ALL cells with a PIM-1/2 kinase inhibitor plus metformin synergistically increased cell death, suggesting a buffering role for PIM-2 in metformin's cytotoxicity. Similar synergism was seen with agents targeting Akt in combination with metformin, supporting our original postulate that AMPK and Akt exert opposite regulatory roles on UPR activity in ALL. Taken together, our data indicate that metformin induces ALL cell death by triggering ER and proteotoxic stress and simultaneously down-regulating the physiologic UPR response responsible for effectively buffering proteotoxic stress. Our findings provide evidence for a role of metformin in ALL therapy and support strategies targeting synthetic lethal interactions with Akt and PIM kinases as suitable for future consideration for clinical translation in ALL.

  5. Identification of BIRC6 as a novel intervention target for neuroblastoma therapy

    Directory of Open Access Journals (Sweden)

    Lamers Fieke

    2012-07-01

    Full Text Available Abstract Background Neuroblastoma are pediatric tumors of the sympathetic nervous system with a poor prognosis. Apoptosis is often deregulated in cancer cells, but only a few defects in apoptotic routes have been identified in neuroblastoma. Methods Here we investigated genomic aberrations affecting genes of the intrinsic apoptotic pathway in neuroblastoma. We analyzed DNA profiling data (CGH and SNP arrays and mRNA expression data of 31 genes of the intrinsic apoptotic pathway in a dataset of 88 neuroblastoma tumors using the R2 bioinformatic platform (http://r2.amc.nl. BIRC6 was selected for further analysis as a tumor driving gene. Knockdown experiments were performed using BIRC6 lentiviral shRNA and phenotype responses were analyzed by Western blot and MTT-assays. In addition, DIABLO levels and interactions were investigated with immunofluorescence and co-immunoprecipitation. Results We observed frequent gain of the BIRC6 gene on chromosome 2, which resulted in increased mRNA expression. BIRC6 is an inhibitor of apoptosis protein (IAP, that can bind and degrade the cytoplasmic fraction of the pro-apoptotic protein DIABLO. DIABLO mRNA expression was exceptionally high in neuroblastoma but the protein was only detected in the mitochondria. Upon silencing of BIRC6 by shRNA, DIABLO protein levels increased and cells went into apoptosis. Co-immunoprecipitation confirmed direct interaction between DIABLO and BIRC6 in neuroblastoma cell lines. Conclusion Our findings indicate that BIRC6 may have a potential oncogenic role in neuroblastoma by inactivating cytoplasmic DIABLO. BIRC6 inhibition may therefore provide a means for therapeutic intervention in neuroblastoma.

  6. Protective Effect of Klotho against Ischemic Brain Injury Is Associated with Inhibition of RIG-I/NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Hong-Jing Zhou

    2018-01-01

    Full Text Available Aging is the greatest independent risk factor for the occurrence of stroke and poor outcomes, at least partially through progressive increases in oxidative stress and inflammation with advanced age. Klotho is an antiaging gene, the expression of which declines with age. Klotho may protect against neuronal oxidative damage that is induced by glutamate. The present study investigated the effects of Klotho overexpression and knockdown by an intracerebroventricular injection of a lentiviral vector that encoded murine Klotho (LV-KL or rat Klotho short-hairpin RNA (LV-KL shRNA on cerebral ischemia injury and the underlying anti-neuroinflammatory mechanism. The overexpression of Klotho induced by LV-KL significantly improved neurobehavioral deficits and increased the number of live neurons in the hippocampal CA1 and caudate putamen subregions 72 h after cerebral hypoperfusion that was induced by transient bilateral common carotid artery occlusion (2VO in mice. The overexpression of Klotho significantly decreased the immunoreactivity of glial fibrillary acidic protein and ionized calcium binding adaptor molecule-1, the expression of retinoic-acid-inducible gene-I, the nuclear translocation of nuclear factor-κB, and the production of proinflammatory cytokines (tumor necrosis factor α and interleukin-6 in 2VO mice. The knockdown of Klotho mediated by LV-KL shRNA in the brain exacerbated neurological dysfunction and cerebral infarct after 22 h of reperfusion following 2 h middle cerebral artery occlusion in rats. These findings suggest that Klotho itself or enhancers of Klotho may compensate for its aging-related decline, thus providing a promising therapeutic approach for acute ischemic stroke during advanced age.

  7. Inhibition of histone deacetylases 1 and 6 enhances cytarabine-induced apoptosis in pediatric acute myeloid leukemia cells.

    Directory of Open Access Journals (Sweden)

    Xuelian Xu

    Full Text Available BACKGROUND: Pediatric acute myeloid leukemia (AML remains a challenging disease to treat even with intensified cytarabine-based chemotherapy. Histone deacetylases (HDACs have been reported to be promising therapeutic targets for treating AML. However, HDAC family members that are involved in chemotherapy sensitivities remain unknown. In this study, we sought to identify members of the HDAC family that are involved in cytarabine sensitivities, and to select the optimal HDACI that is most efficacious when combined with cytarabine for treating children with AML. METHODOLOGY: Expression profiles of classes I, II, and IV HDACs in 4 pediatric AML cell lines were determined by Western blotting. Inhibition of class I HDACs by different HDACIs was measured post immnunoprecipitation. Individual down-regulation of HDACs in pediatric AML cells was performed with lentiviral shRNA. The effects of cytarabine and HDACIs on apoptosis were determined by flow cytometry analysis. RESULTS: Treatments with structurally diverse HDACIs and HDAC shRNA knockdown experiments revealed that down-regulation of both HDACs 1 and 6 is critical in enhancing cytarabine-induced apoptosis in pediatric AML, at least partly mediated by Bim. However, down-regulation of HDAC2 may negatively impact cytarabine sensitivities in the disease. At clinically achievable concentrations, HDACIs that simultaneously inhibited both HDACs 1 and 6 showed the best anti-leukemic activities and significantly enhanced cytarabine-induced apoptosis. CONCLUSION: Our results further confirm that HDACs are bona fide therapeutic targets for treating pediatric AML and suggest that pan-HDACIs may be more beneficial than isoform-specific drugs.

  8. Identification of BIRC6 as a novel intervention target for neuroblastoma therapy

    International Nuclear Information System (INIS)

    Lamers, Fieke; Molenaar, Jan J; Schild, Linda; Koster, Jan; Speleman, Frank; Øra, Ingrid; Westerhout, Ellen M; Sluis, Peter van; Versteeg, Rogier; Caron, Huib N

    2012-01-01

    Neuroblastoma are pediatric tumors of the sympathetic nervous system with a poor prognosis. Apoptosis is often deregulated in cancer cells, but only a few defects in apoptotic routes have been identified in neuroblastoma. Here we investigated genomic aberrations affecting genes of the intrinsic apoptotic pathway in neuroblastoma. We analyzed DNA profiling data (CGH and SNP arrays) and mRNA expression data of 31 genes of the intrinsic apoptotic pathway in a dataset of 88 neuroblastoma tumors using the R2 bioinformatic platform. BIRC6 was selected for further analysis as a tumor driving gene. Knockdown experiments were performed using BIRC6 lentiviral shRNA and phenotype responses were analyzed by Western blot and MTT-assays. In addition, DIABLO levels and interactions were investigated with immunofluorescence and co-immunoprecipitation. We observed frequent gain of the BIRC6 gene on chromosome 2, which resulted in increased mRNA expression. BIRC6 is an inhibitor of apoptosis protein (IAP), that can bind and degrade the cytoplasmic fraction of the pro-apoptotic protein DIABLO. DIABLO mRNA expression was exceptionally high in neuroblastoma but the protein was only detected in the mitochondria. Upon silencing of BIRC6 by shRNA, DIABLO protein levels increased and cells went into apoptosis. Co-immunoprecipitation confirmed direct interaction between DIABLO and BIRC6 in neuroblastoma cell lines. Our findings indicate that BIRC6 may have a potential oncogenic role in neuroblastoma by inactivating cytoplasmic DIABLO. BIRC6 inhibition may therefore provide a means for therapeutic intervention in neuroblastoma

  9. TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

    Directory of Open Access Journals (Sweden)

    Nikolett Sándor

    2015-10-01

    Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

  10. HBV-Specific shRNA is Capable of Reducing the Formation of Hepatitis B Virus Covalently Closed Circular DNA, but has No Effect on Established Covalently Closed Circular DNA in vitro

    OpenAIRE

    Starkey, Jason L.; Chiari, Estelle F.; Isom, Harriet C.

    2009-01-01

    Hepatitis B virus (HBV) covalently closed circular DNA (CCC DNA) is the source of HBV transcripts and persistence in chronically infected patients. The novel aspect of this study was to determine the effect of RNA interference (RNAi) on HBV CCC DNA when administered prior to establishment of HBV replication or during chronic HBV infection. HBV replication was initiated in HepG2 cells by transduction with HBV baculovirus. Subculture of HBV expressing HepG2 cells at 10 days post-transduction ge...

  11. Intravenous delivery of HIV-based lentiviral vectors preferentially transduces F4/80+ and Ly-6C+ cells in spleen, important target cells in autoimmune arthritis

    NARCIS (Netherlands)

    Brand, B.T. van den; Vermeij, E.A.; Waterborg, C.E.J.; Arntz, O.J.; Kracht, M.; Bennink, M.B.; Berg, W.B. van den; Loo, F.A. van de

    2013-01-01

    Antigen presenting cells (APCs) play an important role in arthritis and APC specific gene therapeutic targeting will enable intracellular modulation of cell activity. Viral mediated overexpression is a potent approach to achieve adequate transgene expression levels and lentivirus (LV) is useful for

  12. Lentiviral Vpx accessory factor targets VprBP/DCAF1 substrate adaptor for cullin 4 E3 ubiquitin ligase to enable macrophage infection.

    Directory of Open Access Journals (Sweden)

    Smita Srivastava

    2008-05-01

    Full Text Available Vpx is a small virion-associated adaptor protein encoded by viruses of the HIV-2/SIVsm lineage of primate lentiviruses that enables these viruses to transduce monocyte-derived cells. This probably reflects the ability of Vpx to overcome an as yet uncharacterized block to an early event in the virus life cycle in these cells, but the underlying mechanism has remained elusive. Using biochemical and proteomic approaches, we have found that Vpx protein of the pathogenic SIVmac 239 strain associates with a ternary protein complex comprising DDB1 and VprBP subunits of Cullin 4-based E3 ubiquitin ligase, and DDA1, which has been implicated in the regulation of E3 catalytic activity, and that Vpx participates in the Cullin 4 E3 complex comprising VprBP. We further demonstrate that the ability of SIVmac as well as HIV-2 Vpx to interact with VprBP and its associated Cullin 4 complex is required for efficient reverse transcription of SIVmac RNA genome in primary macrophages. Strikingly, macrophages in which VprBP levels are depleted by RNA interference resist SIVmac infection. Thus, our observations reveal that Vpx interacts with both catalytic and regulatory components of the ubiquitin proteasome system and demonstrate that these interactions are critical for Vpx ability to enable efficient SIVmac replication in primary macrophages. Furthermore, they identify VprBP/DCAF1 substrate receptor for Cullin 4 E3 ubiquitin ligase and its associated protein complex as immediate downstream effector of Vpx for this function. Together, our findings suggest a model in which Vpx usurps VprBP-associated Cullin 4 ubiquitin ligase to enable efficient reverse transcription and thereby overcome a block to lentivirus replication in monocyte-derived cells, and thus provide novel insights into the underlying molecular mechanism.

  13. Lentiviral Gag assembly analyzed through the functional characterization of chimeric simian immunodeficiency viruses expressing different domains of the feline immunodeficiency virus capsid protein.

    Directory of Open Access Journals (Sweden)

    María J Esteva

    Full Text Available To gain insight into the functional relationship between the capsid (CA domains of the Gag polyproteins of simian and feline immunodeficiency viruses (SIV and FIV, respectively, we constructed chimeric SIVs in which the CA-coding region was partially or totally replaced by the equivalent region of the FIV CA. The phenotypic characterization of the chimeras allowed us to group them into three categories: the chimeric viruses that, while being assembly-competent, exhibit a virion-associated unstable FIV CA; a second group represented only by the chimeric SIV carrying the N-terminal domain (NTD of the FIV CA which proved to be assembly-defective; and a third group constituted by the chimeric viruses that produce virions exhibiting a mature and stable FIV CA protein, and which incorporate the envelope glycoprotein and contain wild-type levels of viral genome RNA and reverse transcriptase. Further analysis of the latter group of chimeric SIVs demonstrated that they are non-infectious due to a post-entry impairment, such as uncoating of the viral core, reverse transcription or nuclear import of the preintegration complex. Furthermore, we show here that the carboxyl-terminus domain (CTD of the FIV CA has an intrinsic ability to dimerize in vitro and form high-molecular-weight oligomers, which, together with our finding that the FIV CA-CTD is sufficient to confer assembly competence to the resulting chimeric SIV Gag polyprotein, provides evidence that the CA-CTD exhibits more functional plasticity than the CA-NTD. Taken together, our results provide relevant information on the biological relationship between the CA proteins of primate and nonprimate lentiviruses.

  14. Efficient delivery of Cre-recombinase to neurons in vivo and stable transduction of neurons using adeno-associated and lentiviral vectors

    NARCIS (Netherlands)

    Ahmed, Bushra Y; Chakravarthy, Sridhara; Eggers, Ruben; Hermens, Wim T J M C; Zhang, Jing Ying; Niclou, Simone P; Levelt, Christiaan; Sablitzky, Fred; Anderson, Patrick N; Lieberman, A Robert; Verhaagen, J.

    2004-01-01

    BACKGROUND: Inactivating genes in vivo is an important technique for establishing their function in the adult nervous system. Unfortunately, conventional knockout mice may suffer from several limitations including embryonic or perinatal lethality and the compensatory regulation of other genes. One

  15. “Marker of Self” CD47 on lentiviral vectors decreases macrophage-mediated clearance and increases delivery to SIRPA-expressing lung carcinoma tumors

    Directory of Open Access Journals (Sweden)

    Nisha G Sosale

    2016-01-01

    Full Text Available Lentiviruses infect many cell types and are now widely used for gene delivery in vitro, but in vivo uptake of these foreign vectors by macrophages is a limitation. Lentivectors are produced here from packaging cells that overexpress “Marker of Self” CD47, which inhibits macrophage uptake of cells when prophagocytic factors are also displayed. Single particle analyses show “hCD47-Lenti” display properly oriented human-CD47 for interactions with the macrophage's inhibitory receptor SIRPA. Macrophages derived from human and NOD/SCID/Il2rg−/− (NSG mice show a SIRPA-dependent decrease in transduction, i.e., transgene expression, by hCD47-Lenti compared to control Lenti. Consistent with known “Self” signaling pathways, macrophage transduction by control Lenti is decreased by drug inhibition of Myosin-II to the same levels as hCD47-Lenti. In contrast, human lung carcinoma cells express SIRPA and use it to enhance transduction by hCD47-Lenti- as illustrated by more efficient gene deletion using CRISPR/Cas9. Intravenous injection of hCD47-Lenti into NSG mice shows hCD47 prolongs circulation, unless a blocking anti-SIRPA is preinjected. In vivo transduction of spleen and liver macrophages also decreases for hCD47-Lenti while transduction of lung carcinoma xenografts increases. hCD47 could be useful when macrophage uptake is limiting on other viral vectors that are emerging in cancer treatments (e.g., Measles glycoprotein-pseudotyped lentivectors and also in targeting various SIRPA-expressing tumors such as glioblastomas.

  16. Lentiviral-mediated expression of polysialic acid in spinal cord and conditioning lesion promote regeneration of sensory axons into spinal cord

    NARCIS (Netherlands)

    Zhang, Yi; Zhang, Xinyu; Wu, Dongsheng; Verhaagen, J.; Richardson, Peter M; Yeh, John; Bo, Xuenong

    2007-01-01

    In adult mammals, sensory axons that regenerate in the dorsal root are unable to grow across the dorsal root entry zone (DREZ) into the spinal cord. In this study we examined whether, by inducing expression of polysialic acid (PSA) (a large carbohydrate attached to molecules on the cell surface), in

  17. Anti-inflammatory effect by lentiviral-mediated overexpression of IL-10 or IL-1 receptor antagonist in rat glial cells and macrophages

    NARCIS (Netherlands)

    van Strien, N.M.; Mercier, D.; Drukarch, B.; Breve, J.J.P.; Poole, S.; Binnekade, R.; Bol, J.G.J.M.; Blits, B.; Verhaagen, J.; van Dam, A.M.W.

    2010-01-01

    Neuroinflammation, as defined by activation of local glial cells and production of various inflammatory mediators, is an important feature of many neurological disorders. Expression of pro-inflammatory mediators produced by glial cells in the central nervous system (CNS) is considered to contribute