WorldWideScience

Sample records for length polymorphism haplotypes

  1. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  2. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  3. Identification of amplified fragment length polymorphism (AFLP ...

    African Journals Online (AJOL)

    Identification of amplified fragment length polymorphism (AFLP) fragments linked to soybean mosaic virus resistance gene in Glycine soja and conversion to a sequence characterized amplified regions (SCAR) marker for rapid selection.

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  5. MHC haplotype diversity in Persian Arabian horses determined using polymorphic microsatellites.

    Science.gov (United States)

    Sadeghi, R; Moradi-Shahrbabak, Mohammad; Miraei Ashtiani, S R; Miller, D C; Antczak, Douglas F

    2017-11-23

    Previous research on the equine major histocompatibility complex (MHC) demonstrated strong correlations between haplotypes defined by polymorphic intra-MHC microsatellites and haplotypes defined using classical serology. Here, we estimated MHC diversity in a sample of 124 Arabian horses from an endangered strain native to Iran (Persian Asil Arabians), using a validated 10-marker microsatellite panel. In a group of 66 horses related as parent-offspring pairs or half-sibling groups, we defined 51 MHC haplotypes, 49 of which were new. In 47 of the remaining 58 unrelated horses, we could assign one previously identified MHC haplotype, and by default, we gave provisional haplotype status to the remaining constellation of microsatellite alleles. In these horses, we found 21 haplotypes that we had previously defined and 31 provisional haplotypes, two of which had been identified in an earlier study. This gave a total of 78 new MHC haplotypes. The final 11 horses were MHC heterozygotes that we could not phase using information from any of the previously validated or provisional haplotypes. However, we could determine that these horses carried a total of 22 different undefined haplotypes. In the overall population sample, we detected three homozygous horses and one maternally inherited recombinant from 21 informative segregations. Virtually all of the horses tested were MHC heterozygotes, and most unrelated horses (98%) were heterozygous for rare microsatellite-defined haplotypes found less than three times in the sampled horses. This is evidence for a very high level of MHC haplotype variation in the Persian Asil Arabian horse.

  6. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  7. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  8. Polymorphism at expressed DQ and DR loci in five common equine MHC haplotypes.

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A; Antczak, Douglas F

    2017-03-01

    The polymorphism of major histocompatibility complex (MHC) class II DQ and DR genes in five common equine leukocyte antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine bacterial artificial chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next generation sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse.

  9. Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

    2016-01-01

    The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

  10. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Directory of Open Access Journals (Sweden)

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  11. Association between Osteopontin Promoter Gene Polymorphisms and Haplotypes with Risk of Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Balneek Singh Cheema

    2015-06-01

    Full Text Available Background: Osteopontin (OPN C-443T promoter polymorphism has been shown as a genetic risk factor for diabetic nephropathy (DN in type 2 diabetic patients (T2D. Methods: In the present study we investigated the association of three functional promoter gene polymorphisms C-443T, delG-156G, and G-66T and their haplotypes with the risk of DN and estimated Glomerular Filtration Rate (eGFR in Asian Indians T2D patients using Real time PCR based Taqman assay. A total of 1165 T2D patients, belonging to two independently ascertained Indian Asian cohorts, were genotyped for three OPN promoter polymorphisms C-443T (rs11730582, delG-156G (rs17524488 and G-66T (rs28357094. Results: -156G allele and GG genotypes (delG-156G and haplotypes G-C-G and T-C-G (G-66T, C-443T, delG-156G were associated with decreased risk of DN and higher eGFR. Haplotype G-T-delG and T-T-delG (G-66T, C-443T, delG-156G were identified as risk haplotypes, as shown by lower eGFR. Conclusion: This is the first study to report an association of OPN promoter gene polymorphisms; G-66T and delG-156G and their haplotypes with DN in T2D. Our results suggest an association between OPN promoter gene polymorphisms and their haplotypes with DN.

  12. The haplotype of two FSHR polymorphisms in ovarian cancer--a potential role of ethnology in risk modification.

    Science.gov (United States)

    Heubner, Martin; Riemann, Kathrin; Otterbach, Friedrich; Kimmig, Rainer; Kasimir-Bauer, Sabine; Siffert, Winfried; Wimberger, Pauline

    2009-03-01

    The precise role of gonadotropins in the carcinogenesis of epithelial ovarian cancer remains uncertain. Recently, the haplotype of two single nucleotide polymorphisms, Thr307Ala (rs6165) and Asn680Ser (rs6166), has been described as a risk factor for ovarian cancer in Chinese women. In this study we investigated the impact of this haplotype regarding the risk to develop ovarian cancer as well as possible effects upon the clinical course in a Caucasian patient sample. Determination of genotypes in 115 patients with primary epithelial ovarian cancer and 115 age-matched controls was performed by Pyrosequencing for Thr307Ala and by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique for Asn680Ser. Analysis of the genotypes revealed almost complete linkage disequilibrium of both SNPs. The distribution of genotypes was not statistically significant different between ovarian cancer patients and age-matched controls. Clinical parameters such as overall survival, CA12-5 elevation at primary diagnosis, age at diagnosis, FIGO stage, grading, and platinum resistance were not statistically significantly different regarding genotypes. We could not confirm the FSHR Ala307-Ser680 haplotype as a risk factor for epithelial ovarian cancer in Caucasian women. Hence, the modification of tumor risk may be affected by the ethnology of the patient collective. We could not find any associations of clinical parameters or course of the disease with the different genotypes.

  13. Evolutionary history of DLA class II haplotypes in canine diabetes mellitus through single nucleotide polymorphism genotyping.

    Science.gov (United States)

    Seddon, J M; Berggren, K T; Fleeman, L M

    2010-03-01

    Strong linkage disequilibrium (LD) is a characteristic of the major histocompatibility complex (MHC) region, as well as the genome in general in dogs as a consequence of demographic changes with domestication. Disease association studies of MHC haplotypes may be affected by high LD and the resultant shared genetic backgrounds of haplotypes giving associations with linked but non-causative mutations, and also by convergent haplotypes, in which combinations of alleles have arisen independently. This study provides preliminary tools for dog leukocyte antigen (DLA) class II haplotype analysis with 102 single nucleotide polymorphisms (SNPs) identified in 14.6 kb and genotyping of 20 of these SNPs to tag haplotypes in 60 dogs with diabetes mellitus and in 49 non-diabetic dogs. The pattern of LD and analysis of SNP patterns indicated combinations of exon 2 alleles have arisen through both recombination and convergence. For exon 2 haplotypes associated with susceptibility or protection from diabetes mellitus, a region of fixed differences in SNPs across the DQ region was observed, suggesting a region outside exon 2 may be implicated in disease association. Four new DQB1 promoter alleles restricted to diabetic dogs were identified, as well as a substitution difference in the X1 box of the DQB1 promoter that will potentially modify the effect of the protective haplotypes within diabetic dogs.

  14. 4G/5G polymorphism and haplotypes of SERPINE1 in atherosclerotic diseases of coronary arteries.

    Science.gov (United States)

    Koch, Werner; Schrempf, Matthias; Erl, Anna; Mueller, Jakob C; Hoppmann, Petra; Schömig, Albert; Kastrati, Adnan

    2010-06-01

    We assessed the association between common variation at the SERPINE1 (PAI1) locus and myocardial infarction (MI). Haplotype-tagging polymorphisms, including the 4G/5G deletion/insertion polymorphism and seven single nucleotide polymorphisms, were analysed in a German sample containing 3,657 cases with MI and 1,211 controls. The association between the 4G/5G polymorphism and MI was examined in a meta-analysis of data extracted from 32 studies (13,267 cases/14,716 controls). In addition, the relation between the 4G/5G polymorphism and coronary diseases, comprising MI, coronary artery disease, coronary heart disease, or the acute coronary syndrome, was assessed in a combined analysis enclosing 43 studies (17,278 cases/18,039 controls). None of the tagging polymorphisms was associated with MI in the present sample (p 4G allele carriers was 1.02 (95% confidence interval [CI] 0.87-1.19) compared to the 5G5G genotype. None of 13 common (frequency >1.0%) 8-marker haplotypes was related to the risk of MI. In a meta-analysis specifically addressing the association with MI, no elevated risk was found in the carriers of the 4G allele (OR 1.07, 95% CI 0.99-1.16; p = 0.11). A more general combined analysis of coronary diseases showed a marginally increased risk in 4G allele carriers (OR 1.08, 95% CI 1.00-1.16; p = 0.044). In essence, tagging polymorphisms, including the 4G/5G polymorphism, and common haplotypes of the SERPINE1 gene region were not associated with MI in a German sample, and no compelling evidence was obtained for a relationship of the 4G/5G polymorphism to MI and coronary atherosclerosis in a meta-analysis.

  15. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  16. Do polymorphisms and haplotypes of mismatch repair genes modulate risk of sporadic colorectal cancer?

    Czech Academy of Sciences Publication Activity Database

    Tulupová, Elena; Kumar, R.; Hánová, Monika; Slyšková, Jana; Pardini, Barbara; Poláková, Veronika; Naccarati, Alessio; Vodičková, Ludmila; Novotný, J.; Halamková, J.; Hemminki, K.; Vodička, Pavel

    2008-01-01

    Roč. 648, 1-2 (2008), s. 40-45 ISSN 0027-5107 R&D Projects: GA ČR GA310/07/1430 Institutional research plan: CEZ:AV0Z50390512; CEZ:AV0Z50390703 Keywords : DNA mismatch repair * Genetic polymorphism * Haplotype analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.198, year: 2008

  17. Haplotype CGC from XPD, hOGG1 and ITGA2 polymorphisms increases the risk of nasopharyngeal carcinoma in Malaysia.

    Directory of Open Access Journals (Sweden)

    Eng-Zhuan Ban

    Full Text Available 8-oxoG, a common DNA lesion resulting from reactive oxygen species (ROS, has been shown to be associated with cancer initiation. hOGG1 DNA glycosylase is the primary enzyme responsible for excision of 8-oxoG through base excision repair (BER. Integrins are members of a family of cell surface receptors that mediate the cell-cell and extracellular matrix (ECM interactions. Integrins are involved in almost every aspect of carcinogenesis, from cell differentiation, cell proliferation, metastasis to angiogenesis. Loss of ITGA2 expression was associated with enhanced tumor intravasation and metastasis of breast and colon cancer. XPD gene encodes DNA helicase enzyme that is involved in nucleotide excision repair (NER. It is shown in previous research that XPD homozygous wildtype Lys/Lys genotype was associated with higher odds of NPC.We conducted a 1 to N case-control study involving 300 nasopharyngeal carcinoma (NPC cases and 533 controls matched by age, gender and ethnicity to investigate the effect of hOGG1 Ser326Cys, ITGA2 C807T and XPD Lys751Gln polymorphisms on NPC risk. Linkage disequilibrium and haplotype analysis were conducted to explore the association of allele combinations with NPC risk. Restriction fragment length polymorphism (RFLP-PCR was used for DNA genotyping.No significant association was observed between hOGG1 Ser326Cys and ITGA2 C807T polymorphisms with NPC risk after adjustment for age, gender, ethnicity, cigarette smoking, alcohol and salted fish consumption. Lys/Lys genotype of XPD Lys751Gln polymorphism was associated with increased NPC risk (OR = 1.60, 95% CI = 1.06-2.43. Subjects with history of smoking (OR = 1.81, 95% CI = 1.26-2.60, and salted fish consumption before age of 10 (OR = 1.77, 95% CI = 1.30-2.42 were observed to have increased odds of NPC. The odds of developing NPC of CGC haplotype was significantly higher compared to reference AGC haplotype (OR = 2.20, 95% CI = 1.06-4.58.The allele combination of CGC from h

  18. Haplotype CGC from XPD, hOGG1 and ITGA2 polymorphisms increases the risk of nasopharyngeal carcinoma in Malaysia.

    Science.gov (United States)

    Ban, Eng-Zhuan; Lye, Munn-Sann; Chong, Pei Pei; Yap, Yoke-Yeow; Lim, Siew Ying Crystale; Abdul Rahman, Hejar

    2017-01-01

    8-oxoG, a common DNA lesion resulting from reactive oxygen species (ROS), has been shown to be associated with cancer initiation. hOGG1 DNA glycosylase is the primary enzyme responsible for excision of 8-oxoG through base excision repair (BER). Integrins are members of a family of cell surface receptors that mediate the cell-cell and extracellular matrix (ECM) interactions. Integrins are involved in almost every aspect of carcinogenesis, from cell differentiation, cell proliferation, metastasis to angiogenesis. Loss of ITGA2 expression was associated with enhanced tumor intravasation and metastasis of breast and colon cancer. XPD gene encodes DNA helicase enzyme that is involved in nucleotide excision repair (NER). It is shown in previous research that XPD homozygous wildtype Lys/Lys genotype was associated with higher odds of NPC. We conducted a 1 to N case-control study involving 300 nasopharyngeal carcinoma (NPC) cases and 533 controls matched by age, gender and ethnicity to investigate the effect of hOGG1 Ser326Cys, ITGA2 C807T and XPD Lys751Gln polymorphisms on NPC risk. Linkage disequilibrium and haplotype analysis were conducted to explore the association of allele combinations with NPC risk. Restriction fragment length polymorphism (RFLP-PCR) was used for DNA genotyping. No significant association was observed between hOGG1 Ser326Cys and ITGA2 C807T polymorphisms with NPC risk after adjustment for age, gender, ethnicity, cigarette smoking, alcohol and salted fish consumption. Lys/Lys genotype of XPD Lys751Gln polymorphism was associated with increased NPC risk (OR = 1.60, 95% CI = 1.06-2.43). Subjects with history of smoking (OR = 1.81, 95% CI = 1.26-2.60), and salted fish consumption before age of 10 (OR = 1.77, 95% CI = 1.30-2.42) were observed to have increased odds of NPC. The odds of developing NPC of CGC haplotype was significantly higher compared to reference AGC haplotype (OR = 2.20, 95% CI = 1.06-4.58). The allele combination of CGC from hOGG1

  19. [Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

    Science.gov (United States)

    Gu, Ming-liang; Chu, Jia-you

    2007-12-01

    Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

  20. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  1. Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

    Science.gov (United States)

    Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

    1999-07-01

    With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

  2. Melatonin Receptor 1B Gene Polymorphisms, Haplotypes and Susceptibility to Schizophrenia

    Directory of Open Access Journals (Sweden)

    Saravani Ramin

    2017-04-01

    Full Text Available Melatonin has an important role in the regulation of human sleep circadian rhythms. Sleep disturbances commonly exist in schizophrenia (SCZ patients. To begin its performance, melatonin must interact to its receptor. In the present study, Single Nucleotide Polymorphisms (SNPs of melatonin receptor gene 1 B (MTN1B with SCZ development in Iranian population were investigated. The current case-control study was performed on 92 SCZ patients and 92 healthy control (HC subjects. NESTED-PCR and ARMS-PCR modified methods (combination and ARMSPCR method were used on the genotype. The impact of MTN1B rs3781637 (T/C and rs10830963(C/G polymorphism variants on the risk SCZ in the sample of Iranian population was investigated. The findings showed significant association between MTN1B rs10830963(C/G variant and SCZ (OR=2.78, 95%CI=1.25-6.25, P=0.012, GG vs. CC, OR=1.66, 95%CI=1.09-2.51, P=0.021 G vs. C, OR=3.85 95%CI=.89-8.33, P<0.0001, GG vs. CC+CG. There was no association between MTN1B rs3781637 (T/C and SCZ risk. In addition, haplotype analysis revealed that TG and CC haplotype of rs3781637 (T/C and rs10830963 (C/G polymorphisms were associated with SCZ risk (P=0.039 and protective (P<0.0001 effects, respectively. The findings revealed that MTN1B rs10830963 (C/G polymorphism was associated with the risk of SCZ; while another SNP rs3781637 (T/C MTN1B gene did not show any risk/protection association with SCZ. Further studies with larger sample sizes and different ethnicities are required to approve the results.

  3. [Association between CETP polymorphisms and haplotypes with dyslipidemia in Xinjiang Uygur and Kazak residents].

    Science.gov (United States)

    Hu, Y H; Liu, J M; Zhang, M; He, J; Yan, Y Z; Ma, J L; Ma, R L; Guo, H; Rui, D S; Sun, F; Mu, L L; Niu, Q; Ding, Y S; Zhang, J Y; Li, S G; Guo, S X

    2016-08-24

    To explore the relationship between the polymorphisms and haplotypes in the CETP gene and dyslipidemia among Xinjiang Kazak and Uygur residents. A population status survey was performed from 2010 to 2011 in Kashgar Xinjiang Uygur and Kazak residents, stratified cluster sampling method was used to select Uygur, Kazak residents with abnormal blood lipid values (n=367 and 345, respectively) as the dyslipidemia groups, and to select residents with normal lipid values as control group from the same area (n=374 and 390, respectively). SNaPshot technology was applied to detect the DNA of CETP gene rs3764261, rs1800775, rs708272 and rs5882 loci in all selected residents, and linkage disequilibrium analysis and haplotype construction were performed. (1) In Uygur residents, the dyslipidemia risk of rs708272 CT (OR=0.64, 95%CI 0.46-0.91, P=0.01) and TT genotype (OR=0.60, 95%CI 0.40-0.91, P=0.02) was significantly lower than CC genotype. Dyslipidemia risk of rs3764261 GT (OR=0.55, 95%CI 0.40-0.74, P=0.00) and TT genotype (OR=0.47, 95%CI 0.28-0.78, PDyslipidemia risk of the rs1800775 CC genotype was higher than AA genotype (OR=1.79, 95%CI 1.17-2.74, P=0.01). There was no statistical significance in CETP gene of the 4 genotype and allele frequency between the dyslipidemia and normal lipid groups in Kazak residents (all P>0.05). (2) In Uighur residents with dyslipidemia, HDL-C level was significantly higher in rs708272 TT genotype carriers than in CC and CT genotypes (all Pdyslipidemia and haplotype GACA, TATA and TATG will reduce the risk of dyslipidemia, while haplotype GATA, GCCA will increase the risk of dyslipidemia in Uygur residents. The four CETP polymorphisms are not related to the risk of dyslipidemia, but haplotype GCCG is related to increased risk of dyslipidemia in Kazakhs residents.

  4. Polymorphisms and haplotypes in methylenetetrahydrofolate reductase gene and head and neck squamous cell carcinoma risk.

    Science.gov (United States)

    Galbiatti, Ana Lívia Silva; Ruiz, Mariangela Torreglosa; Rodrigues, Juliana Olsen; Raposo, Luiz Sérgio; Maníglia, José Victor; Pavarino, Érika Cristina; Goloni-Bertollo, Eny Maria

    2012-01-01

    Functional polymorphisms in genes encoding enzymes involved in folate metabolism might modulate head and neck carcinoma risk because folate participates in DNA methylation and synthesis. We therefore conducted a case-control study of 853 individuals (322 head and neck cancer cases and 531 non-cancer controls) to investigate associations among MTHFR C677T and MTHFR A1298C polymorphisms and head and neck squamous cell carcinoma risk. Interactions between these two polymorphisms and risk factors and clinical histopathological parameters were also evaluated. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to genotype the polymorphisms and Chi-square test and multiple logistic regression were used for statistical analyses. The variables age≥49 years, male gender, tobacco habits and alcohol consumption, MTHFR 1298 AC or CC genotypes, combined genotypes with two or more polymorphic alleles and 677T and 1298C polymorphic alleles were associated with increased risk for this disease (PA1298C polymorphism was more frequent in patients with oral cavity as primary site (PA1298C polymorphism has higher risk for this disease.

  5. Amplified fragment length polymorphism (AFLP) studies on Indian ...

    African Journals Online (AJOL)

    Jane

    2011-07-11

    Jul 11, 2011 ... Amplified fragment length polymorphism (AFLP) technology was used to reveal the genetic variation in six species of Cycas collected from eleven natural populations. Two sets of primer with 4-selective nucleotides were used in this study and 78% polymorphism was found. The results correlated with.

  6. Amplified restriction fragment length polymorphism in parasite genetics.

    Science.gov (United States)

    Masiga, D K; Tait, A; Turner, C M

    2000-08-01

    The amplified restriction fragment length polymorphism (AFLP) technique is a relatively new method for the analysis of polymorphism that has not yet been widely used in parasitology. In this article, Dan Masiga, Andy Tait and Mike Turner provide a brief introduction to AFLP and illustrate how it can be used in the investigation of marker inheritance in genetic crosses and in the analysis of polymorphism of field populations. They also briefly highlight the strengths and weaknesses of AFLP in comparison with other methods for detecting polymorphism and conclude that AFLP is a very useful addition to the range of techniques available.

  7. A mixed integer linear programming model to reconstruct phylogenies from single nucleotide polymorphism haplotypes under the maximum parsimony criterion.

    Science.gov (United States)

    Catanzaro, Daniele; Ravi, Ramamoorthi; Schwartz, Russell

    2013-01-23

    Phylogeny estimation from aligned haplotype sequences has attracted more and more attention in the recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from medical research, to drug discovery, to epidemiology, to population dynamics. The literature on molecular phylogenetics proposes a number of criteria for selecting a phylogeny from among plausible alternatives. Usually, such criteria can be expressed by means of objective functions, and the phylogenies that optimize them are referred to as optimal. One of the most important estimation criteria is the parsimony which states that the optimal phylogeny T∗for a set H of n haplotype sequences over a common set of variable loci is the one that satisfies the following requirements: (i) it has the shortest length and (ii) it is such that, for each pair of distinct haplotypes hi,hj∈H, the sum of the edge weights belonging to the path from hi to hj in T∗ is not smaller than the observed number of changes between hi and hj. Finding the most parsimonious phylogeny for H involves solving an optimization problem, called the Most Parsimonious Phylogeny Estimation Problem (MPPEP), which is NP-hard in many of its versions. In this article we investigate a recent version of the MPPEP that arises when input data consist of single nucleotide polymorphism haplotypes extracted from a population of individuals on a common genomic region. Specifically, we explore the prospects for improving on the implicit enumeration strategy of implicit enumeration strategy used in previous work using a novel problem formulation and a series of strengthening valid inequalities and preliminary symmetry breaking constraints to more precisely bound the solution space and accelerate implicit enumeration of possible optimal phylogenies. We present the basic formulation and then introduce a series of provable valid constraints to reduce the solution space. We then prove that these

  8. Association of kinase insert domain-containing receptor (KDR gene polymorphism/ haplotypes with recurrent spontaneous abortion and genetic structure

    Directory of Open Access Journals (Sweden)

    Shiva Shahsavari

    2015-12-01

    Full Text Available Background: Recurrent spontaneous abortion is one of the diseases that can lead to physical, psychological, and, economical problems for both individuals and society. Recently a few numbers of genetic polymorphisms in kinase insert domain-containing receptor (KDR gene are examined that can endanger the life of the fetus in pregnant women. Objective: The risk of KDR gene polymorphisms was investigated in Iranian women with idiopathic recurrent spontaneous abortion (RSA. Materials and Methods: A case controlled study was performed. One hundred idiopathic recurrent spontaneous abortion patients with at least two consecutive pregnancy losses before 20 weeks of gestational age with normal karyotypes were included in the study. Also, 100 healthy women with at least one natural pregnancy were studied as control group. Two functional SNPs located in KDR gene; rs1870377 (Q472H, and rs2305948 (V297I as well as one tag SNP in the intron region (rs6838752 were genotyped by using PCR based restriction fragment length polymorphism (PCR-RFLP technique. Haplotype frequency was determined for these three SNPs’ genotypes. Analysis of genetic STRUCTURE and K means clustering were performed to study genetic variation. Results: Functional SNP (rs1870377 was highly linked to tag SNP (rs6838752 (D´ value=0. 214; χ2 = 16.44, p<0. 001. K means clustering showed that k = 8 as the best fit for the optimal number of genetic subgroups in our studied materials. This result was in agreement with Neighbor Joining cluster analysis. Conclusion: In our study, the allele and genotype frequencies were not associated with RSA between patient and control individuals. Inconsistent results in different populations with different allele frequencies among RSA patients and controls may be due to ethnic variation and used sample size.

  9. Novel full-length major histocompatibility complex class I allele discovery and haplotype definition in pig-tailed macaques.

    Science.gov (United States)

    Semler, Matthew R; Wiseman, Roger W; Karl, Julie A; Graham, Michael E; Gieger, Samantha M; O'Connor, David H

    2017-11-13

    Pig-tailed macaques (Macaca nemestrina, Mane) are important models for human immunodeficiency virus (HIV) studies. Their infectability with minimally modified HIV makes them a uniquely valuable animal model to mimic human infection with HIV and progression to acquired immunodeficiency syndrome (AIDS). However, variation in the pig-tailed macaque major histocompatibility complex (MHC) and the impact of individual transcripts on the pathogenesis of HIV and other infectious diseases is understudied compared to that of rhesus and cynomolgus macaques. In this study, we used Pacific Biosciences single-molecule real-time circular consensus sequencing to describe full-length MHC class I (MHC-I) transcripts for 194 pig-tailed macaques from three breeding centers. We then used the full-length sequences to infer Mane-A and Mane-B haplotypes containing groups of MHC-I transcripts that co-segregate due to physical linkage. In total, we characterized full-length open reading frames (ORFs) for 313 Mane-A, Mane-B, and Mane-I sequences that defined 86 Mane-A and 106 Mane-B MHC-I haplotypes. Pacific Biosciences technology allows us to resolve these Mane-A and Mane-B haplotypes to the level of synonymous allelic variants. The newly defined haplotypes and transcript sequences containing full-length ORFs provide an important resource for infectious disease researchers as certain MHC haplotypes have been shown to provide exceptional control of simian immunodeficiency virus (SIV) replication and prevention of AIDS-like disease in nonhuman primates. The increased allelic resolution provided by Pacific Biosciences sequencing also benefits transplant research by allowing researchers to more specifically match haplotypes between donors and recipients to the level of nonsynonymous allelic variation, thus reducing the risk of graft-versus-host disease.

  10. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  11. Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

    Directory of Open Access Journals (Sweden)

    Supachai Ekwattanakit

    2012-01-01

    Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

  12. Association of HLA-G 3'UTR polymorphisms and haplotypes with severe sepsis in a Brazilian population.

    Science.gov (United States)

    Hahn, Eriza Cristina; Zambra, Francis Maria Báo; Kamada, Anselmo Jiro; Delongui, Francieli; Grion, Cíntia Magalhães Carvalho; Reiche, Edna Maria Vissoci; Chies, José Artur Bogo

    2017-11-01

    The human leukocyte antigen G (HLA-G) is a molecule involved in immune system modulation, acting in the maintenance of a state of immune tolerance. Some polymorphisms in the HLA-G gene 3' untranslated region (3'UTR) were associated to distinct levels of HLA-G expression and to sepsis development. In the present study, haplotypes and polymorphisms of the HLA-G 3'UTR were analyzed in Brazilian septic patients. The HLA-G 3'UTR was amplified by PCR, sequenced and eight polymorphisms were genotyped (the 14bp insertion/deletion, +3003T/C, +3010C/G, +3027A/C, +3035C/T, +3142G/C, +3187A/G and+3196C/G) in DNA samples from septic patients (with severe sepsis or septic shock) and controls. The haplotypes were inferred and association tests were performed through Chi square test and binary logistic regression. The+3027AC genotype was associated asa risk factor to sepsis development (OR 3.17, P Bonferroni 0.048). Further, the presence of the UTR-7 haplotype (OR 2.97, P Bonferroni 0.018), and of 14bp-Ins_+3142G_+3187A haplotype (OR 2.39, P Bonferroni 0.045) were associated with sepsis, conferring susceptibility. Our data confirm an important role of HLA-G 3'UTR polymorphisms in the development of severe forms of sepsis (severe sepsis and septic shock). The genotyping of HLA-G genetic variants and haplotypes could be useful as a prediction tool of increased risk to severe sepsis. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  13. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...

  14. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 4. Full-length sequencing and identification of novel polymorphisms in the ACACA gene of Valle del Belice sheep breed. ROSALIA DI GERLANDO SALVATORE MASTRANGELO LINA TORTORICI MARCO TOLONE ANNA MARIA SUTERA MARIA TERESA SARDINA ...

  15. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    Rosalia Di Gerlando

    2017-08-16

    Aug 16, 2017 ... Full-length sequencing and identification of novel polymorphisms in the ACACA gene of Valle del Belice sheep breed. ROSALIA DI GERLANDO, SALVATORE MASTRANGELO, LINA TORTORICI, MARCO TOLONE,. ANNA MARIA SUTERA, MARIA TERESA SARDINA. ∗ and BALDASSARE PORTOLANO.

  16. C4 polymorphism and extended HLA haplotypes in Namibian San and Khoi and in South African Xhosa.

    Science.gov (United States)

    Creemers, P C; du Toit, E D

    1996-02-01

    We studied C4A and C4B polymorphisms and HLA-B and -DR associations in the San, Khoi and Xhosa. C4A and C4B alleles were determined using conventional protein allotyping methods. The C4A*3, C4B*1 haplotype had a high frequency (30-55%) in all populations. The frequency of C4A*3, C4B*Q0 was 7-19%. The C4A*Q0, C4B*1 haplotype was frequent (15%) in the Khoi but very rare in the San (P Xhosa (15%) but rare in the San and Khoi (P Xhosa. C4A alleles A*4, A*45, A*58, A*12, A*14, A*19 and the C4A*3 A*91 duplication were only found in the San/Khoi population group. In the San, fourteen extended haplotypes were found in a relatively high frequency (2-7%). In the Xhosa, one extended haplotype (B42, C4A*12 A*91, C4B*Q0, DR18) was found in a very high frequency (13%) and was characteristic for this group; five other extended haplotypes were found with a low frequency (< 3%).

  17. Polymorphisms and their Haplotype Combinations in the Lysozyme Gene Associated with the Production Traits of a Chinese Native Chicken Breed

    Directory of Open Access Journals (Sweden)

    LJ Yan

    Full Text Available ABSTRACT Animal lysozymes, which have been studied in many of invertebrate and vertebrate species, have been characterized and demonstrated to be immune-associated molecules, digestive enzymes and multifunctional molecules. The purpose of this study was to detect the connection between lysozyme-gene polymorphism and the production traits of a Chinese native chicken breed (Langshan chicken. Four single nucleotide mutation sites were identified: G345A, C1726T, G1836A, A1838G. By the linkage disequilibrium analysis, six haplotypes and 15haplotype combinations were depicted in the studied population. The statistical analysis demonstrated that the SNPs and the haplotype combinations are related to body weight at sixteen weeks of age in Langshan chickens (p<0.05, and those with combined haplotype Hap3-Hap6 (GA-TT-GG-AA presented higher body weight. Our study demonstrated that the SNPs and their haplotype combinations in the lysozyme gene were associated with the chicken production traits, and that SNPs can be used as a molecular marker for chicken marker-assisted selection.

  18. Effects of COLIA1 polymorphisms and haplotypes on perimenopausal bone mass, postmenopausal bone loss and fracture risk

    DEFF Research Database (Denmark)

    González-Bofill, N; Husted, Camilla L.; Harsløf, Torben

    2011-01-01

    mineral density (BMD) and increased bone turnover at menopause and after 10 years of follow-up. Introduction We wanted to investigate whether the -1997G/T, -1663indelT and +1245G/T polymorphisms in the COLIA1 gene are associated with perimenopausal bone mass, early postmenopausal bone loss and interact.......015±0.006 g/cm2 and 0.017±0.006 g/cm2, respectively (pchanges in bone mass and fracture risk and no overall interaction with the effects of hormone therapy could be demonstrated for any of the polymorphisms in COLIA1. Conclusions The -1997G/T polymorphism...... and haplotype 3 are significantly associated with perimenopausal bone mass, and these effects were sustained up to 10 years after menopause. No association between the -1663indelT or +1245G/T polymorphisms and peri- or postmenopausal bone mass could be demonstrated....

  19. Relationship between Genetic Polymorphisms in MTHFR (C677T, A1298C and their Haplotypes) and the Incidence Of Breast Cancer among Jordanian Females--Case-Control Study.

    Science.gov (United States)

    Awwad, Nemah; Yousef, Al-Motassem; Abuhaliema, Ali; Abdalla, Ihab; Yousef, Muhammad

    2015-01-01

    Breast cancer is a major cause of morbidity and mortality in Jordan and worldwide. Abnormality of DNA methylation is a possible mechanism for the development of cancer. Methylenetetrahydrofolate reductase (MTHFR) is involved in DNA methylation. Our aim was to study the association between genetic polymorphisms of MTHFR at two sites (C677T and A1298C) and their haplotypes and the risk of breast cancer among Jordanian females. A case-control study involving 150 breast cancer cases and 150 controls was conducted. Controls were age-matched to cases. Polymerase chain reaction/restriction fragment length polymorphism (PCR-RFLP) technique and sequencing were conducted to determine the genotypes. There was a significant difference in genotype frequency of C677T in the 41-60 year age category [cases: CC (37.4%), CT (49.5%) and TT (13.2%); controls: CC (56.3%), CT (35.6%) and TT (8%), p=0.04; ORTT vs. CC: 2.5, 95% CI: (0.9-6.9); ORat least on T: 2.1, 95%CI: (1.2-3.9)]. There was no significant difference in genotype frequency of A1298C between cases and controls [cases: AA (46.6%), AC (41.8%) and CC (11.6%); controls: AA (43%), AC (47.4%) and CC (9.6%); p=0.6]. There was a significant difference of MTHFR genetic polymorphism haplotypes among breast cancer cases and controls [cases/control: CA: 38.3/45.4%; CC: 28.9/25.2%; TA: 29.2/21; TC: 3.6/8.3; p value=0.01; ORTA vs. CA=1.6; 95% CI (1.1-2.5); p=0.02]. Genetic polymorphism of MTHFR C677T may modulate the risk of breast cancer especially in the 41-60 year age group. Additionally, TA haplotype amends the risk of breast cancer. Future studies with a larger sample size are needed to validate the role of MTHFR genetic polymorphisms in breast cancer.

  20. Correlation of chitinase 3-like 1 single nucleotide polymorphisms and haplotypes with uterine cervical cancer in Taiwanese women.

    Directory of Open Access Journals (Sweden)

    Yue-Shan Lin

    Full Text Available This study aimed to investigate the relationships of chitinase 3-like 1 (CHI3L1 single nucleotide polymorphisms (SNPs and haplotypes with the development of uterine cervical cancer in Taiwanese women. The SNPs frequencies and haplotypes were also correlated with the clinicopathologic variables of cervical cancer, cancer recurrence, and patient survival.Ninety-nine patients with invasive cancer and 61 with pre-cancerous lesions of the uterine cervix were compared to 310 healthy control subjects. Three SNPs rs6691378 (-1371, G/A, rs10399805 (-247, G/A and rs4950928 (-131, C/G in the promoter region, and one SNP rs880633 (+2950, T/C in exon 5 were analyzed by real time polymerase chain reaction and genotyping. The results showed that the mutant homozygous genotype AA of CHI3L1 SNP rs6691378 and AA of rs10399805, and haplotypes AACC and AACT increased the risk of developing pre-cancerous lesions and invasive cancer. The patients with these risk haplotypes had higher than stage I tumors, larger tumors, and vaginal invasion. In logistic regression model, they also tended to have poor survival event [p = 0.078; odds ratio (OR: 2.99, 95% confidence interval (CI: 0.89-10.08] and a higher probability of recurrence event (p = 0.081; OR: 3.07, 95% CI: 0.87-10.81. There was a significant association between the CHI3L1 risk haplotypes and probability of recurrence (p = 0.002; hazard ratio: 6.21, 95% CI: 1.90-20.41, and a marginal association between the risk haplotypes and overall survival (p = 0.051; hazard ratio: 3.76, 95% CI: 0.99-14.29 in the patients with SCC, using Cox proportional hazard model.The CHI3L1 SNPs rs6691378 and rs10399805 and CHI3L1 haplotypes all correlated with the development of cervical pre-cancerous lesions and invasive cancer. The cervical cancer patients with the CHI3L1 haplotypes AACC or AACT had poor clinicopathologic characteristics and poor recurrence and survival events. These risk haplotypes were associated with higher

  1. Paraoxonase 1 (PON1 polymorphisms, haplotypes and activity in predicting cad risk in North-West Indian Punjabis.

    Directory of Open Access Journals (Sweden)

    Nidhi Gupta

    Full Text Available Human serum paraoxonase-1 (PON1 prevents oxidation of low density lipoprotein cholesterol (LDL-C and hydrolyzes the oxidized form, therefore preventing the development of atherosclerosis. The polymorphisms of PON1 gene are known to affect the PON1 activity and thereby coronary artery disease (CAD risk. As studies are lacking in North-West Indian Punjabi's, a distinct ethnic group with high incidence of CAD, we determined PON1 activity, genotypes and haplotypes in this population and correlated them with the risk of CAD.350 angiographically proven (≥ 70% stenosis CAD patients and 300 healthy controls were investigated. PON1 activity was determined towards paraoxon (Paraoxonase; PONase and phenylacetate (Arylesterase; AREase substrates. In addition, genotyping was carried out by using multiplex PCR, allele specific oligonucleotide -PCR and PCR-RFLP methods and haplotyping was determined by PHASE software. The serum PONase and AREase activities were significantly lower in CAD patients as compared to the controls. All studied polymorphisms except L55M had significant effect on PONase activity. However AREase activity was not affected by them. In a logistic regression model, after adjustment for the conventional risk factors for CAD, QR (OR: 2.73 (1.57-4.72 and RR (OR, 16.24 (6.41-41.14 genotypes of Q192R polymorphism and GG (OR: 2.07 (1.02-4.21 genotype of -162A/G polymorphism had significantly higher CAD risk. Haplotypes L-T-G-Q-C (OR: 3.25 (1.72-6.16 and L-T-G-R-G (OR: 2.82 (1.01-7.80 were also significantly associated with CAD.In conclusion this study shows that CAD patients had lower PONase and AREase activities as compared to the controls. The coding Q192R polymorphism, promoter -162A/G polymorphism and L-T-G-Q-C and L-T-G-R-G haplotypes are all independently associated with CAD.

  2. Haplotype analyses of DNA repair gene polymorphisms and their role in ulcerative colitis.

    Directory of Open Access Journals (Sweden)

    Avinash Bardia

    Full Text Available Ulcerative colitis (UC is a major clinical form of inflammatory bowel disease. UC is characterized by mucosal inflammation limited to the colon, always involving the rectum and a variable extent of the more proximal colon in a continuous manner. Genetic variations in DNA repair genes may influence the extent of repair functions, DNA damage, and thus the manifestations of UC. This study thus evaluated the role of polymorphisms of the genes involved in DNA repair mechanisms. A total of 171 patients and 213 controls were included. Genotyping was carried out by ARMS PCR and PCR-RFLP analyses for RAD51, XRCC3 and hMSH2 gene polymorphisms. Allelic and genotypic frequencies were computed in both control & patient groups and data was analyzed using appropriate statistical tests. The frequency of 'A' allele of hMSH2 in the UC group caused statistically significant increased risk for UC compared to controls (OR 1.64, 95% CI 1.16-2.31, p = 0.004. Similarly, the CT genotype of XRCC3 gene was predominant in the UC group and increased the risk for UC by 1.75 fold compared to controls (OR 1.75, 95% CI 1.15-2.67, p = 0.03, further confirming the risk of 'T' allele in UC. The GC genotype frequency of RAD51 gene was significantly increased (p = 0.02 in the UC group (50.3% compared to controls (38%. The GC genotype significantly increased the risk for UC compared to GG genotype by 1.73 fold (OR 1.73, 95% CI 1.14-2.62, p = 0.02 confirming the strong association of 'C' allele with UC. Among the controls, the SNP loci combination of hMSH2:XRCC3 were in perfect linkage. The GTC and ACC haplotypes were found to be predominant in UC than controls with a 2.28 and 2.93 fold significant increase risk of UC.

  3. Characterization of N-acetyltransferase 1 and 2 polymorphisms and haplotype analysis for inflammatory bowel disease and sporadic colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Cobbs Gary A

    2007-05-01

    Full Text Available Abstract Background N-acetyltransferase 1 (NAT1 and 2 (NAT2 are polymorphic isoenzymes responsible for the metabolism of numerous drugs and carcinogens. Acetylation catalyzed by NAT1 and NAT2 are important in metabolic activation of arylamines to electrophilic intermediates that initiate carcinogenesis. Inflammatory bowel diseases (IBD consist of Crohn's disease (CD and ulcerative colitis (UC, both are associated with increased colorectal cancer (CRC risk. We hypothesized that NAT1 and/or NAT2 polymorphisms contribute to the increased cancer evident in IBD. Methods A case control study was performed with 729 Caucasian participants, 123 CRC, 201 CD, 167 UC, 15 IBD dysplasia/cancer and 223 controls. NAT1 and NAT2 genotyping were performed using Taqman based techniques. Eight single nucleotide polymorphisms (SNPs were characterized for NAT1 and 7 SNPs for NAT2. Haplotype frequencies were estimated using an Expectation-Maximization (EM method. Disease groups were compared to a control group for the frequencies at each individual SNP separately. The same groups were compared for the frequencies of NAT1 and NAT2 haplotypes and deduced NAT2 phenotypes. Results No statistically significant differences were found for any comparison. Strong linkage disequilibrium was present among both the NAT1 SNPs and the NAT2 SNPs. Conclusion This study did not demonstrate an association between NAT1 and NAT2 polymorphisms and IBD or sporadic CRC, although power calculations indicate this study had sufficient sample size to detect differences in frequency as small as 0.05 to 0.15 depending on SNP or haplotype.

  4. Variable-length haplotype construction for gene-gene interaction studies

    OpenAIRE

    Assawamakin, Anunchai; Chaiyaratana, Nachol; Limwongse, Chanin; Sinsomros, Saravudh; Yenchitsomanus, Pa-thai; Youngkong, Prakarnkiat

    2013-01-01

    This paper presents a non-parametric classification technique for identifying a candidate bi-allelic genetic marker set that best describes disease susceptibility in gene-gene interaction studies. The developed technique functions by creating a mapping between inferred haplotypes and case/control status. The technique cycles through all possible marker combination models generated from the available marker set where the best interaction model is determined from prediction accuracy and two aux...

  5. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  6. Vascular endothelial growth factor genetic polymorphisms and haplotypes in female patients with bisphosphonate-related osteonecrosis of the jaws.

    Science.gov (United States)

    Arduino, P G; Menegatti, E; Scoletta, M; Battaglio, C; Mozzati, M; Chiecchio, A; Berardi, D; Vandone, A M; Donadio, M; Gandolfo, S; Scully, C; Broccoletti, R

    2011-07-01

    To investigate the polymorphisms of the vascular endothelial growth factor (VEGF) gene in relation to female patients who developed bisphosphonate-related osteonecrosis of the jaws (BRONJ). Test subjects were 30 Italian female patients with BRONJ (Group A). Control subjects were 30 female patients with a history of intravenous bisphosphonate use without any evidence of osteonecrosis (Group B) and 125 unrelated healthy volunteers (Group C). Three single-nucleotide polymorphisms were investigated: -634 G>C, occurring in 5' untranslated region (UTR); +936 C>T, occurring in 3' UTR; and -2578 C>A of the promoter region. The frequency of the VEGF CAC (+936/-2578/-634) haplotype was increased in patients with BRONJ, compared with female disease-negative controls [odds ratio (OR) = 2.76, 95% CI = 1.09-4.94, P = 0.039; corrected P value: P(c) = 0.117], and was also increased compared with female healthy controls (OR = 2.11, 95% CI = 1.14-3.89, P = 0.024; corrected P value: P(c) = 0.072). The CC homozygotes of -634G>C of VEGF gene and AA homozygotes of -2578C>A have also been significantly correlated in female patients who developed BRONJ compared with healthy controls (OR = 2.04, 95% CI = 1.12-3.70, P = 0.008; corrected P value: P(c) = 0.024). These results suggest a possible haplotype effect of VEGF polymorphisms expression in BRONJ Italian female patients. Studies with different and larger populations possibly using TagSNP to represent all haplotypes within the VEGF gene are needed to further delineate the genetic contribution of this gene to BRONJ. © 2011 John Wiley & Sons A/S.

  7. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able...

  8. Single nucleotide polymorphisms of ABCB1 (MDR1) gene and distinct haplotype profile in a West Black African population.

    Science.gov (United States)

    Allabi, Aurel C; Horsmans, Yves; Issaoui, Bouchra; Gala, Jean-Luc

    2005-04-01

    The ABCB1 (MDR1) multidrug transporter plays a key role in determining drug bioavailability. Differences in drug response exist among different ethnic groups. However, until now, no haplotype data are available in a Black African population. Exons 2, 7, 10, 11, 12, 14, 17, 21, 26, and the surrounding intronic regions were sequenced using genomic DNA from 111 Beninese subjects to examine 19 intragenic single nucleotide polymorphisms (SNPs). Linkage disequilibrium analysis and haplotypes were generated using the expectation-maximization algorithm. We identified 12 SNPs, 3 of which were novel: IVS9-57delA, IVS9-8T>A, 1662G>C (exon 14). The most common SNP was IVS14+38A>G. At the MRD1 locus, 53 haplotypes were inferred from the SNP data sets. The 4 SNPs, IVS6+139C>T, IVS9-44A>G, 1236C>T, and 3435C>T, showed strong linkage disequilibrium with each other, confirming the block concept. Moreover, our findings suggest that ABCB1 exonic SNPs are less frequently observed in our population than in African-Americans. Our data are compatible with a close evolutionary relationship in Black Africans from Benin.

  9. Polymorphic HLA-C Receptors Balance the Functional Characteristics of KIR Haplotypes.

    Science.gov (United States)

    Hilton, Hugo G; Guethlein, Lisbeth A; Goyos, Ana; Nemat-Gorgani, Neda; Bushnell, David A; Norman, Paul J; Parham, Peter

    2015-10-01

    The human killer cell Ig-like receptor (KIR) locus comprises two groups of KIR haplotypes, termed A and B. These are present in all human populations but with different relative frequencies, suggesting they have different functional properties that underlie their balancing selection. We studied the genomic organization and functional properties of the alleles of the inhibitory and activating HLA-C receptors encoded by KIR haplotypes. Because every HLA-C allotype functions as a ligand for KIR, the interactions between KIR and HLA-C dominate the HLA class I-mediated regulation of human NK cells. The C2 epitope is recognized by inhibitory KIR2DL1 and activating KIR2DS1, whereas the C1 epitope is recognized by inhibitory KIR2DL2 and KIR2DL3. This study shows that the KIR2DL1, KIR2DS1, and KIR2DL2/3 alleles form distinctive phylogenetic clades that associate with specific KIR haplotypes. KIR A haplotypes are characterized by KIR2DL1 alleles that encode strong inhibitory C2 receptors and KIR2DL3 alleles encoding weak inhibitory C1 receptors. In striking contrast, KIR B haplotypes are characterized by KIR2DL1 alleles that encode weak inhibitory C2 receptors and KIR2DL2 alleles encoding strong inhibitory C1 receptors. The wide-ranging properties of KIR allotypes arise from substitutions throughout the KIR molecule. Such substitutions can influence cell surface expression, as well as the avidity and specificity for HLA-C ligands. Consistent with the crucial role of inhibitory HLA-C receptors in self-recognition, as well as NK cell education and response, most KIR haplotypes have both a functional C1 and C2 receptor, despite the considerable variation that occurs in ligand recognition and surface expression. Copyright © 2015 by The American Association of Immunologists, Inc.

  10. Polymorphisms and functional haplotype in PADI4: further evidence for contribution on rheumatoid arthritis susceptibility and anti-cyclic citrullinated peptide antibodies in a western Mexican population.

    Science.gov (United States)

    Guzmán-Guzmán, Iris Paola; Reyes-Castillo, Zyanya; Muñoz-Barrios, Salvador; Ruiz-Noa, Yeniley; Martínez-Bonilla, Gloria Esther; Parra-Rojas, Isela; Palafox-Sánchez, Claudia Azucena; Muñoz-Valle, José Francisco

    2015-02-01

    Peptidyl arginine deiminase IV (PADI4) enzyme catalyzes the citrullination of proteins, which are recognized by anti-cyclic citrullinated peptide antibodies (anti-CCP) in rheumatoid arthritis (RA) patients. Here, we determined the association between PADI4 gene polymorphisms and haplotypes with RA susceptibility and clinical characteristics in a western Mexican population. The relationship of PADI4 polymorphisms with anti-CCP and PADI4 mRNA expression was also evaluated. PADI4_89, PADI4_90 and PADI4_92 polymorphisms were individually associated with RA susceptibility. The GTG haplotype was significantly associated with: RA susceptibility; disease onset at ≤ 40 years and anti-CCP antibodies. PADI4 expression was three fold higher in RA patients carrying the susceptibility haplotype (GTG) than in non-susceptibility haplotype carriers (ACC). In conclusion, polymorphisms and functional haplotype (GTG) in PADI4 are associated with RA susceptibility as well as anti-CCP antibodies in a Mexican population. This supports the role of PADI4 early in RA pathogenesis by promoting the generation of citrullinated autoantigens. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  11. Association of RET genetic polymorphisms and haplotypes with papillary thyroid carcinoma in the Portuguese population: a case-control study.

    Directory of Open Access Journals (Sweden)

    Marina Santos

    Full Text Available Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A, L769L (exon 13, rs1800861 T/G, S836S (exon 14, rs1800862 C/T, and S904S (exon 15, rs1800863 C/G. The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC when compared to controls (OR 1.57; 95% CI 1.05-2.35; p = 0.026. The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07-5.91; p = 0.029. No associations were found in follicular thyroid carcinoma (FTC. Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour.

  12. Association of RET Genetic Polymorphisms and Haplotypes with Papillary Thyroid Carcinoma in the Portuguese Population: A Case-Control Study

    Science.gov (United States)

    Santos, Marina; Azevedo, Teresa; Martins, Teresa; Rodrigues, Fernando J.; Lemos, Manuel C.

    2014-01-01

    Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET) proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs) on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A), L769L (exon 13, rs1800861 T/G), S836S (exon 14, rs1800862 C/T), and S904S (exon 15, rs1800863 C/G). The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC) when compared to controls (OR 1.57; 95% CI 1.05–2.35; p = 0.026). The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07–5.91; p = 0.029). No associations were found in follicular thyroid carcinoma (FTC). Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour. PMID:25330015

  13. New chicken Rfp-Y haplotypes on the basis of MHC class II RFLP and MLC analyses

    DEFF Research Database (Denmark)

    Juul-Madsen, H R; Zoorob, R; Auffray, C

    1997-01-01

    New chicken Rfp-Y haplotypes were determined by the use of restriction fragment length polymorphism (RFLP) and mixed lymphocyte culture (MLC) in four different chicken haplotypes, B15, B19, B21, B201. The RFLP polymorphism was mapped to the Rfp-Y system by the use of a subclone (18.1) which maps...

  14. Polymorphic haplotypes on R408BW PKU and normal PAH chromosomes in Quebec and European populations

    Energy Technology Data Exchange (ETDEWEB)

    Byck, S.; Morgan, K.; Scriver, C.R. [McGill Univ., Montreal (Canada)] [and others

    1994-09-01

    The R408W mutation in the phenylalanine hydroxylase gene (PAH) is associated with haplotype 2.3 (RFLP haplotype 2, VNTR 3 of the HindIII system) in most European populations. Another chromosome, first observed in Quebec and then in northwest Europe, carries R408W on haplotype 1.8. The occurrence of the R408W mutation on two different PKU chromosomes could be the result of intragenic recombination, recurrent mutation or gene conversion. In this study, we analyzed both normal and R408W chromosomes carrying 1.8 and 2.3 haplotypes in Quebec and European populations; we used the TCTA{sub (n)} short tandem repeat sequence (STR) at the 5{prime} end of the PAH gene and the HindIII VNTR system at the 3{prime} end of the PAH gene to characterize chromosomes. Fourteen of sixteen R408W chromosomes from {open_quotes}Celtic{close_quotes} families in Quebec and the United Kingdom (UK) harbor a 244 bp STR allele; the remaining two chromosomes, carry a 240 bp or 248bp STR allele. Normal chromosomes (n=18) carry the 240 bp STR allele. R408W chromosomes are different from mutant H1.8 chromosomes; mutant H2.3 carries the 240 bp STR allele (14 of 16 chromosomes) or the 236 allele (2 of 16 chromosomes). The HindIII VNTR comprises variable numbers of 30 bp repeats (cassettes); the repeats also vary in nucleotide sequence. Variation clusters toward the 3{prime} end of cassettes and VNTRs. VNTR 3 alleles on normal H2 (n=9) and mutant R408W H2 (n=19) chromosomes were identical. VNTR 8 alleles on normal H1 chromosomes (n=9) and on R408W H1 chromosomes (n=15) differ by 1 bp substitution near the 3{prime} end of the 6th cassette. In summary, the mutant H1.8 chromosome harboring the R408W mutation has unique features at both the 5{prime} and 3{prime} end of the gene that distinguish it from the mutant H2.3 and normal H1.8 and H2.3 counterparts. The explanation for the occurrence of R408W on two different PAH haplotypes is recurrent mutation affecting the CpG dinucleotide in PAH codon 408.

  15. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Mohamed N. Saad

    2016-01-01

    Full Text Available Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field.

  16. Polymorphism in the upstream regulatory region of DQA1 genes and DRB1, QAP, DQA1, and DQB1 haplotypes in the German population.

    Science.gov (United States)

    Haas, J P; Kimura, A; Andreas, A; Hochberger, M; Keller, E; Brünnler, G; Bettinotti, M P; Nevinny-Stickel, C; Hildebrandt, B; Sierp, G

    1994-01-01

    Polymorphism in the URR of the MHC class II DQA1 gene defines ten different alleles named QAP. Oligotyping for the alleles of DRB1, QAP, DQA1, and DQB1 have been performed in 210 unrelated healthy controls from Germany. Moreover, 83 HTCs from the Tenth IHWS have been tested. Four point loci haplotypes (DRB1, QAP, DQA1, and DQB1) have been analyzed in the unrelated healthy population sample. Computer analysis of the linkage disequilibria leads to the conclusion that QAP alleles are in strong linkage disequilibrium with alleles either the DQA1 or the DRB1 locus. One typical ("common") haplotype was found to be associated with each DRB1 allele in the majority (86%) of the tested persons. Apart from that, 25 other less frequent ("unusual") haplotypes, with an overall frequency of 14% have been defined. Some of these "unusual" MHC class II haplotypes were found to differ only in the regulatory alleles of DQA1 (QAP alleles) while they are identical for the alleles coding for structural elements (DRB1, DQA1, and DQB1). Most of the "unusual" haplotypes were found to carry HLA-DQ6. Assuming that "unusual" (= rare) haplotypes have arisen from "common" (= frequent) haplotypes by point mutation and recombination, we propose the existence of three recombination sites in the MHC DR-DQ region: one between DRB1 and QAP, the second between QAP and DQA1, and the third between DQA1 and DQB1.

  17. Matrix metalloproteinase3 gene promoter polymorphisms and their haplotypes are associated with gastric cancer risk in eastern Indian population.

    Science.gov (United States)

    Dey, Sanjib; Stalin, Sami; Gupta, Arnab; Saha, Debjit; Kesh, Kousik; Swarnakar, Snehasikta

    2012-10-01

    Single nucleotide polymorphisms (SNPs) of matrix metalloproteinase3 (MMP3) promoter in the development and progression of gastric cancer of whole stomach has never been investigated in any population. We conducted a hospital-based case-control study to explore the MMP3 SNPs and their haplotypes with the risk of gastric cancer for the first time in eastern Indian population. A total of 218 gastric cancer patients and 175 healthy controls were genotyped for MMP3-1612 5A/6A (rs3025058) by PCR-RFLP and rechecked 10% by DNA sequencing. MMP3-707 A/G (rs522616) and MMP3-375 C/G (rs617819) were genotyped by DNA sequencing among 209 patients and 154 controls. MMP3-1612 5A6A genotype (P = 0.026, odds ratio (OR) = 1.756, confidence interval (CI) = 1.070-2.883), combined 5A5A and 5A6A genotype (P = 0.015, OR = 1.791, CI = 1.122-2.858) and 5A allele (P = 0.002, OR = 1.75, CI = 1.21-2.53) and; MMP3-707 GG genotype (P = < 0.0001; OR = 9.612; 95% CI = 3.403-27.147), combined GG and AG genotype (P = 0.001, OR = 2.201, CI = 1.385-3.498) and G allele (P = <0.0001, OR = 2.189, CI = 1.582-3.033) conferred significant risk for gastric cancer development. Also, tobacco addicted individuals with combined 5A5A and 5A6A genotype (P = 0.005, OR = 2.952, CI = 1.377-6.327) at -1612 position of MMP3 promoter displayed a higher risk to gastric cancer development. The genotypic combinations of all three MMP3 promoter polymorphisms and their haplotypes with increasing risk allele in a dose-dependent manner showed a potential risk for developing gastric cancer. The analyses suggested that the MMP3-707 G/G and MMP3-1612 5A/6A polymorphisms are potential independent predictors of gastric cancer risk development. Copyright © 2011 Wiley Periodicals, Inc.

  18. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  19. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms: A cross-sectional descriptive study of 13,473 Chinese adult women.

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-11-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited.We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms.In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D' and r values were 0.883 and 0.143, respectively.In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs.

  20. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    Directory of Open Access Journals (Sweden)

    Kim Tae-Ho

    2007-11-01

    Full Text Available Abstract Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63% had been previously identified and 331 (37% were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an

  1. A population association study of vitamin D receptor gene polymorphisms and haplotypes with the risk of systemic lupus erythematosus in a Chinese population.

    Science.gov (United States)

    Chen, Xu-E; Chen, Pu; Chen, Shan-Shan; Lu, Jin; Ma, Ting; Shi, Guang; Zhou, Ya; Li, Ji; Sheng, Liang

    2017-06-01

    The aim of the study is to investigate the association of vitamin D receptor (VDR) gene polymorphism, additional gene-gene interaction, and haplotype combination with systemic lupus erythematosus (SLE) risk. Pairwise linkage disequilibrium (LD) analysis was conducted using SNPstats. The association between four SNPs within VDR gene and SLE risk was investigated by logistic regression. Generalized multifactor dimensionality reduction (GMDR) was used to analyze the interaction among four SNPs. Four SNPs within VDR gene were selected for genotyping in this study, including rs2228570, rs1544410, rs7975232, and rs731236. The T allele of rs2228570 and the G allele of the rs1544410 were associated with increased MM risk, adjusted ORs (95%CI) were 1.61(1.25-2.11) and 1.78 (1.34-2.23), respectively. GMDR analysis suggested a significant two-locus model (P = 0.0010) involving rs1544410 and rs2228570, and in this model, the cross-validation consistency was 10/10, and the testing accuracy was 62.70%. The haplotype analysis indicated that the most common haplotype was rs1544410-A and rs7975232-G haplotype, the frequencies of which were 0.4701 and 0.5467 in case and control group. Haplotype containing the rs1544410-G and rs7975232-T alleles were associated with increased SLE risk, OR (95%CI) = 2.08 (1.47-2.72), P risk.

  2. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC...

  3. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  4. CYP19 Genetic Polymorphism Haplotype AASA Is Associated with a Poor Prognosis in Premenopausal Women with Lymph Node-Negative, Hormone Receptor-Positive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Sung-Hsin Kuo

    2013-01-01

    Full Text Available Given the critical role of CYP19 in estrogen synthesis, we investigated the influence of CYP19 gene polymorphisms on the clinical outcome of lymph node- (LN- negative, hormone receptor- (HR- positive early breast cancers. Genotyping for the CYP19 polymorphisms rs4646 (A/C, rs1065779 (A/C, CYP19 (TTTAn (short allele/long (S/L allele using the 7 TTTA repeat polymorphism as the cut-off, and rs1870050 (A/C was performed on 296 patients with LN-negative, HR-positive breast cancers. All patients received adjuvant hormonal therapy. Associations were examined between these 4 genotypes and 6 common haplotypes of CYP19 and distant disease-free survival (DDFS, disease-free survival (DFS, and overall survival (OS. Patients were divided into the 6 subhaplotypes of CCLA (41.1%, AASA (17.1%, CASA (11.9%, CCLC (8.9%, CCSA (7.5%, AASC (8.9%, and others (4.6%. In premenopausal patients, haplotype AASA was significantly associated with a poor DDFS (adjusted hazard ratio (aHR, 3.3; P=0.001, DFS (aHR, 2.5; P=0.0008, and OS (aHR, 2.9; P=0.0004 after adjusting for age, tumor size, tumor grade, estrogen receptor status, progesterone receptor status, chemotherapy, pathology, adjuvant hormone therapy, menopausal status, and radiotherapy. Furthermore, haplotype AASA remained a negative prognostic factor for premenopausal patients receiving adjuvant chemotherapy in terms of DDFS (aHR, 4.5; P=0.0005, DFS (HR, 3.2; P=0.003, and OS (HR, 6.4; P=0.0009. However, in postmenopausal patients, haplotype AASA was not associated with a poor prognosis, whereas the AASC haplotype was significantly associated with a poor DFS (aHR, 3.1; P=0.03 and OS (aHR, 4.4; P=0.01. Our results indicate that, in patients with LN-negative, HR-positive breast cancers, genetic polymorphism haplotype AASA is associated with poor survival of premenopausal women but does not affect survival of postmenopausal women.

  5. Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent

    International Nuclear Information System (INIS)

    Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N

    2008-01-01

    The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the

  6. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  7. Organelle DNA haplotypes reflect crop-use characteristics and geographic origins of Cannabis sativa.

    Science.gov (United States)

    Gilmore, Simon; Peakall, Rod; Robertson, James

    2007-10-25

    Comparative sequencing of cannabis individuals across 12 chloroplast and mitochondrial DNA loci revealed 7 polymorphic sites, including 5 length variable regions and 2 single nucleotide polymorphisms. Simple PCR assays were developed to assay these polymorphisms, and organelle DNA haplotypes were obtained for 188 cannabis individuals from 76 separate populations, including drug-type, fibre-type and wild populations. The haplotype data were analysed using parsimony, UPGMA and neighbour joining methods. Three haplotype groups were recovered by each analysis method, and these groups are suggestive of the crop-use characteristics and geographical origin of the populations, although not strictly diagnostic. We discuss the relationship between our haplotype data and taxonomic opinions of cannabis, and the implications of organelle DNA haplotyping to forensic investigations of cannabis.

  8. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, J; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  9. Genetic Diversity and Sectional Relationships from an Amplified Fragment Length Polymorphism Analysis of Taiwan Bananas

    OpenAIRE

    Chang, Shu-Fen; Chang, Yueh-Long; Yen, Yung-Fu; Miyajima, Ikuo; Huang, Kuang-Liang

    2017-01-01

    Phylogenetic relationships among 19 Musa species or cultivars were examined through DNA fingerprinting with amplified fragment length polymorphism (AFLP) analysis. The AFLP analysis was performed on the Musa species or cultivars with 21 primer combinations, yielding a total of 6,348 DNA bands, among which 6,113 (96.3%) were polymorphic. M. itinerans var. formosana demonstrated 133 monomorphic bands, which is the most among all samples. Unweighted pair–group method with arithmetic averages was...

  10. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  11. CAG-encoded polyglutamine length polymorphism in the human genome

    Directory of Open Access Journals (Sweden)

    Hayden Michael R

    2007-05-01

    Full Text Available Abstract Background Expansion of polyglutamine-encoding CAG trinucleotide repeats has been identified as the pathogenic mutation in nine different genes associated with neurodegenerative disorders. The majority of individuals clinically diagnosed with spinocerebellar ataxia do not have mutations within known disease genes, and it is likely that additional ataxias or Huntington disease-like disorders will be found to be caused by this common mutational mechanism. We set out to determine the length distributions of CAG-polyglutamine tracts for the entire human genome in a set of healthy individuals in order to characterize the nature of polyglutamine repeat length variation across the human genome, to establish the background against which pathogenic repeat expansions can be detected, and to prioritize candidate genes for repeat expansion disorders. Results We found that repeats, including those in known disease genes, have unique distributions of glutamine tract lengths, as measured by fragment analysis of PCR-amplified repeat regions. This emphasizes the need to characterize each distribution and avoid making generalizations between loci. The best predictors of known disease genes were occurrence of a long CAG-tract uninterrupted by CAA codons in their reference genome sequence, and high glutamine tract length variance in the normal population. We used these parameters to identify eight priority candidate genes for polyglutamine expansion disorders. Twelve CAG-polyglutamine repeats were invariant and these can likely be excluded as candidates. We outline some confusion in the literature about this type of data, difficulties in comparing such data between publications, and its application to studies of disease prevalence in different populations. Analysis of Gene Ontology-based functions of CAG-polyglutamine-containing genes provided a visual framework for interpretation of these genes' functions. All nine known disease genes were involved in DNA

  12. Exon 3-deleted and full-length growth hormone receptor polymorphism frequencies in an Iranian population

    OpenAIRE

    Palizban, A.A.; Radmansorry, M.; Bozorgzad, M.

    2014-01-01

    The functional role of the exon 3 growth hormone receptor (d3GHR) polymorphism in human and its distributions in different populations is not clearly understood. The presence of full length growth hormone (flGHR) is the most important in metabolic risk factors. The aim of this study was to define the frequency distribution of d3GHR/full-length GHR in an Iranian population. The presence of the d3GHR polymorphism in healthy volunteers blood DNA (n=80, male=30 and female=50) was assessed by PCR ...

  13. Androgen Receptor Repeat Length Polymorphism Associated with Male-to-Female Transsexualism

    Science.gov (United States)

    Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J.; Baird, Paul N.; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R.

    2012-01-01

    Background There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor β (ERβ), and aromatase (CYP19) genes. Methods Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERβ gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. Results A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p = .04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERβ genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. Conclusions This study provides evidence that male gender identity might be partly mediated through the androgen receptor. PMID:18962445

  14. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-07-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  15. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  16. Polymorphism of the DQA1 promoter region (QAP) and DRB1, QAP, DQA1, DQB1 haplotypes in systemic lupus erythematosus. SLE Study Group members.

    Science.gov (United States)

    Yao, Z; Kimura, A; Hartung, K; Haas, P J; Volgger, A; Brünnler, G; Bönisch, J; Albert, E D

    1993-01-01

    We have investigated the DNA polymorphism for the DQA1 promoter region (QAP) and HLA-class II DRB1, DQA1, and DQB1 genes in 178 central European patients with Systemic lupus erythematosus (SLE) using polymerase chain reaction and Dig-ddUTP labeled oligonucleotides. Increased frequencies of DRB1*02 and *03 are confirmed by DNA typing. In addition, the frequencies of DQA1*0501, *0102 and DQB1*0201, *0602 alleles are increased in the patients as compared to controls. The strongest association to SLE is found with DRB1*03 and DOB1*0201 alleles (p QAP variants. Increased frequencies of QAP1.2 and QAP4.1 are observed in patients as compared to controls (p QAP variants and DQA1, DRB1 alleles. Certain QAP variants are completely associated with DQA1 and DRB1 alleles, whereas others can combine with different DQA1 and DRB1 alleles. All DRB1*02-positive patients and controls carry QAP1.2, and all DRB1*03-positive patients and controls carry QAP4.1. Conversely, the QAP1.2 variant appears only in DRB1*02 haplotypes, while the QAP4.1 variant can be observed in DRB1*03, *11, and *1303 haplotypes. Based on the strong linkage disequilibria between DRB1-DQA1-DQB1 genes and between DRB1-QAP-DQA1, we have deduced the four-point haplotypes for DRB1-QAP-DQA1-DQB1 in patients and controls. Two haplotypes DRB1*02-QAP1.2-DQA1*0102-DQB1*0602 and DRB1*03-QAP4.1-DQA1*0501-DQB1*0201 are significantly increased in patients as compared to controls (p QAP, DQA1, and DQB1 as well as the investigation of the deduced DRB1-QAP-DQA1-DQB1 haplotypes leads to the conclusion that QAP4.1 and DQA1*0501 on the DR3 haplotypes are probably not involved in SLE susceptibility.(ABSTRACT TRUNCATED AT 400 WORDS)

  17. Transposition rates of Mycobacterium tuberculosis IS6110 restriction fragment length polymorphism patterns

    NARCIS (Netherlands)

    Eilers, Paul H. C.; van Soolingen, Dick; Thi Ngoc Lan, Nguyen; Warren, Rob M.; Borgdorff, Martien W.

    2004-01-01

    To determine the rate at which IS6110 restriction fragment length polymorphism (RFLP) patterns in Mycobacterium tuberculosis change over time, we applied a smooth nonparametric survival model to several data sets, including data from previous publications on the rate of change. The results strongly

  18. Use of Restriction Fragment Length Polymorphism of 18S rRNA ...

    African Journals Online (AJOL)

    The restriction fragment length polymorphism (RFLP) pattern of PCR products obtained was the same for T. brucei subspecies: T.b. brucei and T.b. gambiense but different for other trypanosome species and L. donovani. RFLP analysis was also done with genomic DNA from different trypanosome species, subspecies and ...

  19. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  20. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  1. DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits

    Directory of Open Access Journals (Sweden)

    Stracke Silke

    2010-01-01

    Full Text Available Abstract Background Association mapping is receiving considerable attention in plant genetics for its potential to fine map quantitative trait loci (QTL, validate candidate genes, and identify alleles of interest. In the present study association mapping in barley (Hordeum vulgare L. is investigated by associating DNA polymorphisms with variation in grain quality traits, plant height, and flowering time to gain further understanding of gene functions involved in the control of these traits. We focused on the four loci BLZ1, BLZ2, BPBF and HvGAMYB that play a role in the regulation of B-hordein expression, the major fraction of the barley storage protein. The association was tested in a collection of 224 spring barley accessions using a two-stage mixed model approach. Results Within the sequenced fragments of four candidate genes we observed different levels of nucleotide diversity. The effect of selection on the candidate genes was tested by Tajima's D which revealed significant values for BLZ1, BLZ2, and BPBF in the subset of two-rowed barleys. Pair-wise LD estimates between the detected SNPs within each candidate gene revealed different intra-genic linkage patterns. On the basis of a more extensive examination of genomic regions surrounding the four candidate genes we found a sharp decrease of LD (r2 Significant marker-trait associations between SNP sites within BLZ1 and flowering time, BPBF and crude protein content and BPBF and starch content were detected. Most haplotypes occurred at frequencies BPBF was associated to crude protein content and starch content, BLZ2 showed association to thousand-grain weight and BLZ1 was found to be associated with flowering time and plant height. Conclusions Differences in nucleotide diversity and LD pattern within the candidate genes BLZ1, BLZ2, BPBF, and HvGAMYB reflect the impact of selection on the nucleotide sequence of the four candidate loci. Despite significant associations, the analysed candidate

  2. New chicken Rfp-Y haplotypes on the basis of MHC class II RFLP and MLC analyses

    DEFF Research Database (Denmark)

    Juul-Madsen, H R; Zoorob, R; Auffray, C

    1997-01-01

    New chicken Rfp-Y haplotypes were determined by the use of restriction fragment length polymorphism (RFLP) and mixed lymphocyte culture (MLC) in four different chicken haplotypes, B15, B19, B21, B201. The RFLP polymorphism was mapped to the Rfp-Y system by the use of a subclone (18.1) which maps...... near a polymorphic lectin gene located in the Rfp-Y system and DNA from families with known segregation of the implicated RFLP polymorphism. For the first time it is shown that major histocompatibility complex class II genes in the Rfp-Y system have functional implications. Sequence information...

  3. The diploid origins of allopolyploid rose species studied using single nucleotide polymorphism haplotypes flanking a microsatellite repeat

    NARCIS (Netherlands)

    Zhang, J.; Esselink, G.; Che, D.; Fougère-Danezan, M.; Arens, P.; Smulders, M.J.M.

    2013-01-01

    The taxonomy of the genus Rosa is complex, not least because of hybridisations between species.We aimed to develop a method to connect the diploid Rosa taxa to the allopolyploid taxa to which they contributed, based on the sharing of haplotypes. For this we used an SNPSTR marker, which combines a

  4. Analysis of genetic diversity identified by amplified fragment length polymorphism marker in hybrid wheat.

    Science.gov (United States)

    Ejaz, M; Qidi, Z; Gaisheng, Z; Na, N; Huiyan, Z; Qunzhu, W

    2015-08-07

    Amplified fragment length polymorphism markers were used to assess genetic diversity in 10 male sterile wheat crop lines (hetero-cytoplasm with the same nucleus) in relation to a restorer wheat line. These male sterile lines were evaluated using 64 amplified fragment length polymorphism primer combinations, and 13 primers produced polymorphic bands, generating a total 682 fragments. Of the 682 fragments, 113 were polymorphic. The polymorphic information content and marker index values demonstrated the utility of the primer combinations used in the present study. Unweighted pair group method with arithmetic mean and principal coordinate analysis of the genotypic data revealed clustering of accessions based on genetic relationships, and accessions were separated into 2 groups with their restorer line. Jaccard's similarity coefficient values suggested good variability among the male sterile lines, indicating their utility in breeding programs. The fallouts of analysis of molecular variance showed large within-group population variation, accounting for 77% of variation, while among-group comparison accounted for 23% of the total molecular variation, which was statistically significant. The molecular diversity observed in this study will be useful for selecting appropriate accessions for plant improvement and hybridization through molecular-breeding approaches and for developing suitable conservation strategies.

  5. A haplotype of polymorphisms in ASE-1, RAI and ERCC1 and the effects of tobacco smoking and alcohol consumption on risk of colorectal cancer: a danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Hansen, Rikke D; Sørensen, Mette; Tjønneland, Anne; Overvad, Kim; Wallin, Håkan; Raaschou-Nielsen, Ole; Vogel, Ulla

    2008-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent type of genetic variation in the human genome, and are of interest for the study of susceptibility to and protection from diseases. The haplotype at chromosome 19q13.2-3 encompassing the three SNPs ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn have been associated with risk of breast cancer and lung cancer. Haplotype carriers are defined as the homozygous carriers of RAI IVS1 A4364G A , ERCC1 Asn118Asn T and ASE-1 G-21A G . We aimed to evaluate whether the three polymorphisms and the haplotype are associated to risk of colorectal cancer, and investigated gene-environment associations between the polymorphisms and the haplotype and smoking status at enrolment, smoking duration, average smoking intensity and alcohol consumption, respectively, in relation to risk of colorectal cancer. Associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were examined, as well as gene-environment interaction, in a Danish case-cohort study including 405 cases and a comparison group of 810 persons. Incidence rate ratio (IRR) were estimated by the Cox proportional hazards model stratified according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. No consistent associations between the three individual polymorphisms, the haplotype and risk of colorectal cancer were found. No statistically significant interactions between the genotypes and the lifestyle exposures smoking or alcohol consumption were observed. Our results suggest that the ASE-1 G-21A, RAI IVS1 A4364G and ERCC1 Asn118Asn polymorphisms and the previously identified haplotype are not associated with risk of colorectal cancer. We found no evidence of gene-environment interaction between the three polymorphisms and the haplotype and smoking intensity and alcohol consumption

  6. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  7. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  8. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  9. G16R single nucleotide polymorphism but not haplotypes of the ß2-adrenergic receptor gene alters cardiac output in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin

    2013-01-01

    studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise.......5 (CI, 0.0 -1.0) l/min greater in ACE I/I carriers compared with I/D and D/D subjects (P=0.054). In conclusion, the ADRB2 Arg16 allele in humans is associated with a lower Q¿ both at rest and during exercise, overriding the effects of haplotypes....

  10. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    OpenAIRE

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction pattern...

  11. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...... found by 16S rDNA analysis. The present data support previous observations regarding genetic homogeneity of M. capricolum subsp. capripneumoniae, and confirm the two evolutionary lines of descent found by analysis of 16S rRNA genes....

  12. Association of restriction fragment length polymorphism in alcohol dehydrogenase 2 gene with alcohol induced liver damage.

    OpenAIRE

    Sherman, D I; Ward, R J; Warren-Perry, M; Williams, R; Peters, T J

    1993-01-01

    OBJECTIVE--To investigate the role of genetically determined differences in the enzymes of alcohol metabolism in susceptibility to liver damage from misusing alcohol. DESIGN--Use of pADH36 probe to study PVU II restriction length fragment polymorphism in alcohol dehydrogenase 2 gene in white alcohol misusers and controls. SETTING--Teaching hospital referral centres for liver disease and alcohol misuse. SUBJECTS--45 white alcohol misusers (38 with alcoholic liver disease) and 23 healthy contro...

  13. Suicidal behavior and haplotypes of the dopamine receptor gene (DRD2 and ANKK1 gene polymorphisms in patients with alcohol dependence--preliminary report.

    Directory of Open Access Journals (Sweden)

    Andrzej Jasiewicz

    Full Text Available Suicide is a significant public health issue and a major cause of death throughout the world. According to WHO it accounts for almost 2% of deaths worldwide. The etiology of suicidal behavior is complex but the results of many studies suggest that genetic determinants are of significant importance. In our study,--we have analyzed selected SNPs polymorphisms in the DRD2 and ANKK1 genes in patients with alcohol dependence syndrome (169 Caucasian subjects including a subgroup of individuals (n = 61 who have experienced at least one suicide attempt. The aim of the study was to verify if various haplotypes of selected genes, comprising Taq1A, Taq1B, and Taq1D single nucleotide polymorphisms (SNP, play any role in the development of alcohol dependence and suicidal behavior. The control group comprised 157 unrelated individuals matched for ethnicity, gender,- and age and included no individuals with mental disorders. All subjects were recruited in the North West region of Poland. The study showed that alcohol dependent subjects with a history of at least one suicidal attempt were characterized by a significantly higher frequency of the T-G-A2 haplotype when compared to individuals in whom alcohol dependence was not associated with suicidal behavior (p = 0.006. It appears that studies based on identifying correlation between SNPs is the future for research on genetic risk factors that contribute to the development of alcohol addiction and other associated disorders. To sum up, there is a necessity to perform further research to explain dependencies between the dopaminergic system, alcohol use disorders and suicidal behavior.

  14. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1 in the Xhosa population of South Africa

    Directory of Open Access Journals (Sweden)

    Clifford Jacobs

    2014-06-01

    Full Text Available Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot® multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885, P341L (rs2282143, V519F (rs78899680, and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357, C88R (rs55918055, S189L (rs34104736, G220V (rs36103319, P283L (rs4646277, R287G (rs4646278, G401S (rs34130495, M440I (rs35956182, or G465R (rs34059508. In addition, no variant alleles were observed for A306T (COSM164365, A413V (rs144322387, M420V (rs142448543, I421F (rs139512541, C436F (rs139512541, V501E (rs143175763, or I542V (rs137928512 in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  15. Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa.

    Science.gov (United States)

    Jacobs, Clifford; Pearce, Brendon; Du Plessis, Mornè; Hoosain, Nisreen; Benjeddou, Mongi

    2014-06-01

    Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885), P341L (rs2282143), V519F (rs78899680), and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357), C88R (rs55918055), S189L (rs34104736), G220V (rs36103319), P283L (rs4646277), R287G (rs4646278), G401S (rs34130495), M440I (rs35956182), or G465R (rs34059508). In addition, no variant alleles were observed for A306T (COSM164365), A413V (rs144322387), M420V (rs142448543), I421F (rs139512541), C436F (rs139512541), V501E (rs143175763), or I542V (rs137928512) in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

  16. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  17. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4...... resided in putative NF-kB and Sp1 sites In accordance with. previous studies we detected no variations in the coding regions except for a rare polymorphism that was found in one donor in the last codon of exon 5, which lead to a heterozygous genotype, but no amino acid change. This suggests...

  18. The polymorphism and haplotypes of PIN1 gene are associated with the risk of lung cancer in Southern and Eastern Chinese populations.

    Science.gov (United States)

    Lu, Jiachun; Yang, Lei; Zhao, Hongjun; Liu, Bin; Li, Yinyan; Wu, Hongxia; Li, Qingchu; Zeng, Bohang; Wang, Yunnan; Ji, Weidong; Zhou, Yifeng

    2011-11-01

    Peptidyl-prolyl cis/trans isomerase (PPIase), PIN1, has been found to be a critical catalyst that involves in multiple oncogenic signaling pathways. Recently, several putative functional polymorphisms of the PIN1 gene have been identified to be associated with cancer risk. In this study, we tested the hypothesis that two common polymorphisms, c.-842G>C (rs2233678) and c.-667C>T (rs2233679), in the PIN1 promoter are associated with risk of lung cancer. In two independent case-control studies of 1,559 lung cancer cases and 1,679 controls conducted in Southern and Eastern Chinese population, we found that compared with the most common c.-842GG genotype, the carriers of c.-842C variant genotypes (GC + CC) had a decreased risk of lung cancer (odds ratio [OR] = 0.63, 95% confidence interval [CI] = 0.51-0.78, p = 1.13 × 10(-5) ). Although no association was observed between the c.-667C>T polymorphism and cancer risk, we found that the haplotype "C-C" had a greater protective effect (OR = 0.39, 95% CI = 0.23-0.67, p = 5.03 × 10(-4) ). The stratification analysis showed that the protective role of c.-842C variants was more pronounced in current smokers (p = 4.45 × 10(-5) ), especially in male smokers (p = 6.71 × 10(-6) ) and in those who smoked more than 20 pack-years (p = 2.30 × 10(-5) ) and the c.-842C variant genotypes interacted with smoking status (P(interaction) = 0.019) or pack-years smoked (P(interaction) = 0.008) on reducing cancer risk. Further functional assay revealed that the c.-842C variant allele had a lower transcription activity in luciferase assay and a lower DNA-binding ability with nuclear proteins, and low transcription activity in western blot assay. In conclusions, our data suggest that functional c.-842C variants and haplotype "C-C" in the PIN1 promoter contribute to decreased risk of lung cancer by diminishing the promoter activity, which may be susceptibility biomarkers for lung cancer. © 2011 Wiley Periodicals, Inc.

  19. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  20. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...

  1. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according to th...

  2. Restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene.

    Science.gov (United States)

    Masina, P; Rando, A; Cocozza, S

    1984-10-01

    By Southern blot analysis, a restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene was detected. Two alleles, characterized by 9.7- and 12.4-kb BamHI fragments and by 15.3- and 18.0-kb HindIII fragments, have been detected in a small population of White New Zealand rabbits. The long allele is the most frequent (about 70%). The simultaneous changes in the restriction patterns of the two endonucleases and the constant distance between BamHI and HindIII sites in short and long fragments suggest the possibility that the two alleles arise from a rearrangement phenomenon involving a DNA segment 2.7 kb long. In addition, the presence of the two alleles in individuals genetically unrelated to the White New Zealand breed suggests that this polymorphism is widespread.

  3. Genetic variation in hemp and marijuana (Cannabis sativa L.) according to amplified fragment length polymorphisms.

    Science.gov (United States)

    Datwyler, Shannon L; Weiblen, George D

    2006-03-01

    Cannabis sativa L. (Cannabaceae) is one of the earliest known cultivated plants and is important in the global economy today as a licit and an illicit crop. Molecular markers distinguishing licit and illicit cultivars have forensic utility, but no direct comparison of hemp and marijuana amplified fragment length polymorphism (AFLP) has been made to date. Genetic variation was surveyed in three populations of fiber hemp and a potent cultivar of marijuana using AFLP markers. Ten primer pairs yielded 1206 bands, of which 88% were polymorphic. Eighteen bands represented fixed differences between all fiber populations and the drug cultivar. These markers have practical utility for (1) establishing conspiracy in the cultivation and distribution of marijuana, (2) identifying geographic sources of seized drugs, and (3) discriminating illegal, potent marijuana cultivars from hemp where the cultivation of industrial hemp is permitted.

  4. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  5. Exon 3-deleted and full-length growth hormone receptor polymorphism frequencies in an Iranian population.

    Science.gov (United States)

    Palizban, A A; Radmansorry, M; Bozorgzad, M

    2014-01-01

    The functional role of the exon 3 growth hormone receptor (d3GHR) polymorphism in human and its distributions in different populations is not clearly understood. The presence of full length growth hormone (flGHR) is the most important in metabolic risk factors. The aim of this study was to define the frequency distribution of d3GHR/full-length GHR in an Iranian population. The presence of the d3GHR polymorphism in healthy volunteers blood DNA (n=80, male=30 and female=50) was assessed by PCR using specific primers. The 935-bp and 592-bp fragments indicate the presence of the flGHR and the exon3 deletion of GHR, respectively. The distribution of the GHR genotypes in this study were 31.4% (n=24) for fl/flGHR, 49.7 % (n=41) for fl/d3GHR, and 19.0 % (n=15) for d3/d3GHR. Frequencies of fl allele and d3 allele were 55.4% and 44.4% within whole population, respectively. There was no difference in allels frequencies of GHR in male (fl=0.583, d3=0.417) and female (fl=0.540, d3=0.460) when compared with whole population. The results showed that the frequency of d3/d3GHR isoform was significantly lower than that of the fl/flGHR and d3/flGHR. The frequencies of GHR polymorphisms were likely consistent with previous reports. Our finding is also consistant with Mexican population. The advantage of existence of the d3/d3 rather than fl/flGHR polymorphisms in individuals and in correlation with diseases opens new insights for GH and insilin-like-growth factor-1 (IGF-I) axis.

  6. New insights in HLA-E polymorphism by refined analysis of the full-length gene.

    Science.gov (United States)

    Olieslagers, T I; Voorter, C E M; Groeneweg, M; Xu, Y; Wieten, L; Tilanus, M G J

    2017-03-01

    Human leukocyte antigen (HLA)-E is a non-classical HLA class I molecule that plays a role in both the innate and the adaptive immune response through interaction with receptors on natural killer- and T-cells. The HLA-E gene is characterized by limited polymorphism compared with the classical HLA loci on chromosome 6. At the start of this study, only 13 variable sites had been identified (IPD-IMGT/HLA Database v3.18.0). While most previous studies focused on polymorphism in exons 2 and 3 or specific gene regions, polymorphism in the other exons and introns could influence protein expression and function as well. Studies that investigate extended HLA-E polymorphism are therefore needed to better understand the functional relevance of HLA-E in health and disease. The aim of this study was to examine the variability of the full-length HLA-E gene region in individuals originating from different populations. A total of 7 new HLA-E alleles were identified using full-length HLA-E sequencing of 123 individuals from Asian, Dutch or Hunan Han origin. Furthermore, genome variation analysis of the third phase of the 1000 genomes database showed 107 new variable sites in 2504 individuals originating from 26 different populations. Our study demonstrates that the nucleotide variability of the HLA-E gene is much higher than previously known, albeit in only a limited number of individuals. Overall only 2 variants, HLA-E*01:01 and *01:03, are frequently present worldwide, suggesting that balancing selection is acting on HLA-E. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... to available epidemiological data. We conclude that this amplified fragment length polymorphism fingerprinting method may be a highly effective tool for molecular epidemiological studies of Campylobacter spp....

  8. Genetic variation in an endemic salamander, Salamandra atra, using amplified fragment length polymorphism.

    Science.gov (United States)

    Riberon, Alexandre; Miaud, Claude; Guyetant, R; Taberlet, P

    2004-06-01

    The pattern of genetic differentiation of the endemic alpine salamander, Salamandra atra, has been studied using amplified fragment length polymorphism (AFLP) from 11 populations throughout the range of the two currently recognized subspecies, atra and aurorae. Five different primer combinations produced 706 bands and were analyzed by constructing a phylogenetic tree using NJ and principal component analysis. Significant genetic variation was revealed by AFLP between and within populations but, our results show a lack of genetic structure. AFLP markers seems to be unsuitable to investigate complex and recent diversification.

  9. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  10. Multiple microRNA regulation of lipoprotein lipase gene abolished by 3'UTR polymorphisms in a triglyceride-lowering haplotype harboring p.Ser474Ter.

    Science.gov (United States)

    Caussy, Cyrielle; Charrière, Sybil; Meirhaeghe, Aline; Dallongeville, Jean; Lefai, Etienne; Rome, Sophie; Cuerq, Charlotte; Euthine, Vanessa; Delay, Mireille; Marmontel, Oriane; Di Filippo, Mathilde; Lagarde, Michel; Moulin, Philippe; Marçais, Christophe

    2016-03-01

    Lipoprotein lipase (LPL) is a key enzyme in triglyceride (TG) metabolism. LPL gene single nucleotide polymorphisms (SNPs) are associated with TG concentrations however the functionality of many of these SNPs remains poorly understood. MicroRNAs (miR) exert post-transcriptional down-regulation and their target sequence on the 3'UTR may be altered by SNPs. We therefore investigated whether LPL 3'UTR SNPs could modulate plasma TG concentration through the alteration of miR binding-sites. We performed genetic association studies of LPL 3'UTR SNPs with TG concentrations in 271 type 2 diabetic patients and in general population samples (2997 individuals). A specific LPL haplotype (Hap4) was associated with lower plasma TG concentration (TG-0.18, IC95% [-0.30, -0.07] mmol/L or logTG-0.13, IC95% [-0.18, -0.08], p = 4.77·10(-8)) in the meta-analysis. Hap4 comprises seven 3'UTR SNP minor alleles and p.Ser474Ter (rs328) a well-documented nonsense mutation associated with low TG concentration although by an unknown mechanism so far. Bio-informatic studies identified several putative miRNA binding-sites on the wild-type Hap1 haplotype, lost on Hap4. Functional validation performed in HEK-293T cells using luciferase expression constructs with various LPL 3'UTR allele combinations demonstrated a binding of miR-29, miR-1277 and miR-410 on Hap1, lost on Hap4. This loss of specific miR binding-site in presence of Hap4 was independent of the allelic variation of p.Ser474Ter (rs328). We report the regulation of LPL by the miR-29, miR-1277 and miR-410 that is lost in presence of Hap4, a specific LPL TG-lowering haplotype. Consequently p.Ser474Ter association with TG concentration could be at least partially explained by its strong linkage disequilibrium with these functional 3'UTR SNPs. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  11. Fine definition of the pedigree haplotypes of closely related rice cultivars by means of genome-wide discovery of single-nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Shibaya Taeko

    2010-04-01

    Full Text Available Abstract Background To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. Results The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7× the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67 051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Conclusions Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several

  12. Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

    Science.gov (United States)

    Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

    2011-01-01

    Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

  13. Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

    Directory of Open Access Journals (Sweden)

    Shaowen Tang

    Full Text Available The pathogenic mechanism of anti-tuberculosis (anti-TB drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs of cytochrome P450 2E1(CYP2E1 in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort.A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology.Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644 were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis.Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

  14. Direct endonuclease digestion and multi-analysis of restriction fragment length polymorphisms by microchip electrophoresis.

    Science.gov (United States)

    Akamine, Rie; Yatsushiro, Shouki; Yamamura, Shouhei; Kido, Jun-ichi; Shinohara, Yasuo; Baba, Yoshinobu; Kataoka, Masatoshi

    2009-12-05

    A high-performance multi-analysis system for genotypic mutation by means of restriction fragment length polymorphisms (RFLP) involving endonuclease treatment of PCR-amplified DNA on a microchip and subsequent analysis by microchip electrophoresis for DNA sizing was developed. A Hitachi SV1210 system, with which 12 samples can be analyzed on a plastic chip with good accuracy as to DNA sizing between 25 and 300 bp, was employed for RFLP analysis. We performed RFLP analysis of the ABO genotypes of blood donors for whom the ABO type was known. Six blood samples were analyzed by PCR to amplify two different regions of the genomic DNA, each of the amplified DNAs containing a different nucleotide polymorphism. To analyze the genes at polymorphic sites 261 and 526, restriction endonucleases Kpn I and Ban I were employed, respectively. When an amplified DNA was digested with each endonuclease on a microchip for 20 min, sequential analysis revealed the presence or absence of the respective restriction site. This analysis was performed within 7 min using a 1/10 volume of a DNA sample in comparison with the conventional method, and the estimated DNA size differed from the predicted size by less than 10 bp. The results indicate the potential of microchip electrophoresis for RFLP with on-chip direct endonuclease digestion and sequential analysis, offering high resolution in a short time.

  15. Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China.

    Science.gov (United States)

    Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

    2015-12-16

    We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

  16. Polymorphisms in the LPL and CETP Genes and Haplotype in the ESR1 Gene Are Associated with Metabolic Syndrome in Women from Southwestern Mexico

    Directory of Open Access Journals (Sweden)

    José Ángel Cahua-Pablo

    2015-09-01

    Full Text Available Metabolic syndrome (MetS is a combination of metabolic disorders associated with an increased risk for cardiovascular disease (CVD. Studies in women reported associations between polymorphisms in ESR1, LPL and CETP genes and MetS. Our aim was to evaluate the association between variants in ESR1, LPL and CETP genes with MetS and its components. Four hundred and eighty women were analyzed, anthropometric features and biochemical profiles were evaluated, and genotyping was performed by real-time PCR. We found an association with elevated glucose levels (odds ratio (OR = 2.9; p = 0.013 in carrying the AA genotype of rs1884051 in the ESR1 gene compared with the GG genotype, and the CC genotype of rs328 in the LPL gene was associated with MetS compared to the CG or GG genotype (OR = 2.8; p = 0.04. Moreover, the GA genotype of rs708272 in the CETP gene is associated with MetS compared to the GG or AA genotype (OR = 1.8; p = 0.006. In addition the ACTCCG haplotype in the ESR1 gene is associated with a decrease in the risk of MetS (OR = 0.02; p < 0.001. In conclusion, our results show the involvement of the variants of ESR1, LPL and CETP genes in metabolic events related to MetS or some of its features.

  17. HapCol : Accurate and memory-efficient haplotype assembly from long reads

    NARCIS (Netherlands)

    Pirola, Yuri; Zaccaria, Simone; Dondi, Riccardo; Klau, Gunnar W.; Pisanti, Nadia; Bonizzoni, Paola

    2016-01-01

    Motivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from the advent

  18. HapCol: Accurate and Memory-efficient Haplotype Assembly from Long Reads

    NARCIS (Netherlands)

    Y. Pirola (Yuri); S. Zaccaria (Simone); R. Dondi (Riccardo); G.W. Klau (Gunnar); N. Pisanti (Nadia); P. Bonizzoni (Paola)

    2015-01-01

    htmlabstractMotivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from

  19. A phased SNP-based classification of sickle cell anemia HBB haplotypes.

    Science.gov (United States)

    Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

    2017-08-11

    Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

  20. Rearrangements of the beta-globin gene cluster in apparently typical betaS haplotypes.

    Science.gov (United States)

    Zago, M A; Silva, W A; Gualandro, S; Yokomizu, I K; Araujo, A G; Tavela, M H; Gerard, N; Krishnamoorthy, R; Elion, J

    2001-02-01

    The majority of the chromosomes with the betaS gene have one of the five common haplotypes, designated as Benin, Bantu, Senegal, Cameroon, and Arab-Indian haplotypes. However, 5-10% of the chromosomes have less common haplotypes, usually referred to as atypical haplotypes. We have demonstrated that most atypical haplotypes are generated by recombinations. The present study was carried out in order to explore whether recombination also occurs in chromosomes with the common (or typical) haplotypes. We screened the HS-2 region of the beta-globin gene locus control region (LCR) in 244 sickle cell patients who had typical restriction fragment length polymorphism (RFLP)-defined haplotypes of the betaS-gene cluster. For 14 cases in which the expected and the observed LCR repeat-sequence sizes were discrepant, the analysis was extended to other unexplored polymorphic markers of the bS-globin gene cluster, i.e.: pre-Ggamma framework, pre-Ggamma 6-bp deletion, HS-2 LCR (AT)xR(AT)y and pre-beta(AT)xTy repeats, and the intragenic beta-globin gene framework. In all 14 cases (15 chromosomes) in which the LCR repeat-sequence sizes were discrepant, a recombination involving a typical 3' segment of the betaS globin gene cluster was demonstrated. In most of the cases, the recombination site was located between the beta-globin gene and the betaLCR. Nine cases involving recombination were detected among 156 Brazilian HbS homozygotes and five among 88 African patients homozygotes for the Benin haplotype. INTERPRETATION AND CONCLUSIONS. Thus, 3.1% of apparently typical haplotypes linked to the sickle cell gene involve recombinations similar to those that generate the atypical haplotypes, a finding that reinforces the picture of the beta-globin gene cluster as highly dynamic.

  1. Coccidioides species determination: does sequence analysis agree with restriction fragment length polymorphism?

    Science.gov (United States)

    Johnson, Suzanne M; Carlson, Erin L; Pappagianis, Demosthenes

    2015-06-01

    Fifteen Coccidioides isolates were previously examined for genetic diversity using restriction fragment length polymorphism (RFLP); two fragment patterns were observed. Two isolates demonstrated one banding pattern (designated RFLP group I), while the remaining 13 isolates demonstrated a second pattern (designated RFLP group II). Recently, molecular studies supported the division of the genera Coccidioides into two species: Coccidioides posadasii and Coccidioides immitis. It has been assumed that the species division corresponds to the RFLP grouping. We tested this hypothesis by amplifying the ribosomal DNA internal transcribed spacer region as well as the dioxygenase, serine proteinase, and urease genes from 13 isolates previously examined by RFLP and then sequencing the PCR products. The appropriate species for each isolate was assigned using phylogenetically informative sites. The RFLP grouping agreed with the Coccidioides species assignment for all but one isolate, which may represent a hybrid. In addition, polymorphic sites among the four genes examined were in agreement for species assignment such that analysis of a single gene may be sufficient for species assignment.

  2. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs......RI genomic DNA fragment, and a short, degenerated, oligonucleotide covering the remaining TspRI cohesive ends. Other cohesive ends are covered by a short degenerated oligonucleotide lacking the primer site. The ligation mixture is used as a template for amplification using a single primer corresponding...... for differentiation of the organisms without previous knowledge of their DNA sequence. The usefulness of the method is confirmed by genotyping of 70 previously characterized clinical E. coli isolates. The grouping obtained was identical to the results of REA-PFGE. Versatility of the method is highlighted, i.e. its...

  3. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  4. Restriction fragment length polymorphism typing of infectious bursal disease virus field strains in Turkey.

    Science.gov (United States)

    Sareyyüpoğlu, B; Akan, M

    2006-12-01

    Infectious bursal disease (IBD), also known as Gumboro disease, is a highly contagious, immunosuppressive disease of immature chickens. It is caused by IBD virus (IBDV) and is responsible for major economic losses in the poultry industry worldwide. In this study, 280 bursa samples from 56 commercially reared chicken flocks in Turkey with clinical symptoms of IBD were examined for IBDVs using the reverse transcription (RT)-polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) assay. The assay was conducted on a 743-bp fragment of the VP2 gene with the restriction enzymes BstNI, MboI, and SspI. The results indicate the existence of field isolates with new molecular patterns different from those previously published that may well be unique and specific to geographical regions.

  5. Chronic inflammatory state in sickle cell anemia patients is associated with HBB(*)S haplotype.

    Science.gov (United States)

    Bandeira, Izabel C J; Rocha, Lillianne B S; Barbosa, Maritza C; Elias, Darcielle B D; Querioz, José A N; Freitas, Max Vitor Carioca; Gonçalves, Romélia P

    2014-02-01

    The chronic inflammatory state in sickle cell anemia (SCA) is associated with several factors such as the following: endothelial damage; increased production of reactive oxygen species; hemolysis; increased expression of adhesion molecules by leukocytes, erythrocytes, and platelets; and increased production of proinflammatory cytokines. Genetic characteristics affecting the clinical severity of SCA include variations in the hemoglobin F (HbF) level, coexistence of alpha-thalassemia, and the haplotype associated with the HbS gene. The different haplotypes of SCA are Bantu, Benin, Senegal, Cameroon, and Arab-Indian. These haplotypes are associated with ethnic groups and also based on the geographical origin. Studies have shown that the Bantu haplotype is associated with higher incidence of clinical complications than the other haplotypes and is therefore considered to have the worst prognosis. This study aimed to evaluate the profile of the proinflammatory cytokines interleukin-6, tumor necrosis factor-α, and interleukin-17 in patients with SCA and also to assess the haplotypes associated with beta globin cluster S (HBB(*)S). We analyzed a total of 62 patients who had SCA and had been treated with hydroxyurea; they had received a dose ranging between 15 and 25 (20.0±0.6)mg/kg/day for 6-60 (18±3.4)months; their data were compared with those for 30 normal individuals. The presence of HbS was detected and the haplotypes of the beta S gene cluster were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Our study demonstrated that SCA patients have increased inflammatory profile when compared to the healthy individuals. Further, analysis of the association between the haplotypes and inflammatory profile showed that the levels of IL-6 and TNF-α were greater in subjects with the Bantu/Bantu haplotype than in subjects with the Benin/Benin haplotype. The Bantu/Benin haplotype individuals had lower levels of cytokines than those with

  6. δ-Aminolevulinic Acid Dehydratase Single Nucleotide Polymorphism 2 and Peptide Transporter 2*2 Haplotype May Differentially Mediate Lead Exposure in Male Children

    Science.gov (United States)

    Parisi, Natali; Schaub, Tanner; Gutierrez, Marisela; Ortega, Alma X.

    2011-01-01

    Child low-level lead (Pb) exposure is an unresolved public health problem and an unaddressed child health disparity. Particularly in cases of low-level exposure, source removal can be impossible to accomplish, and the only practical strategy for reducing risk may be primary prevention. Genetic biomarkers of increased neurotoxic risk could help to identify small subgroups of children for early intervention. Previous studies have suggested that, by way of a distinct mechanism, δ-aminolevulinic acid dehydratase single nucleotide polymorphism 2 (ALAD2) and/or peptide transporter 2*2 haplotype (hPEPT2*2) increase Pb blood burden in children. Studies have not yet examined whether sex mediates the effects of genotype on blood Pb burden. Also, previous studies have not included blood iron (Fe) level in their analyses. Blood and cheek cell samples were obtained from 306 minority children, ages 5.1 to 12.9 years. 208Pb and 56Fe levels were determined with inductively coupled plasma–mass spectrometry. General linear model analyses were used to examine differences in Pb blood burden by genotype and sex while controlling for blood Fe level. The sample geometric mean Pb level was 2.75 µg/dl. Pb blood burden was differentially higher in ALAD2 heterozygous boys and hPEPT2*2 homozygous boys. These results suggest that the effect of ALAD2 and hPEPT2*2 on Pb blood burden may be sexually dimorphic. ALAD2 and hPEPT2*2 may be novel biomarkers of health and mental health risks in male children exposed to low levels of Pb. PMID:21327641

  7. Investigating of yeast species in wine fermentation using terminal restriction fragment length polymorphism method.

    Science.gov (United States)

    Sun, Yue; Liu, Yanlin

    2014-04-01

    The objective of this study was to examine the potential of terminal restriction fragment length polymorphism (T-RFLP) in monitoring yeast communities during wine fermentation and to reveal new information on yeast community of Chinese enology. Firstly, terminal restriction fragment (TRF) lengths database was constructed using 32 pure yeast species. Ten of these species were firstly documented. The species except for Candida vini, Issatchenkia orientalis/Candida krusei, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cerevisiae, Saccharomyces kudriarzevii and Zygosaccharomyces bisporus could be distinguished by the T-RFLP targeting 5.8S-ITS rDNA. Moreover, the yeast communities in spontaneous fermentation of Chardonnay and Riesling were identified by T-RFLP and traditional methods, including colony morphology on Wallerstein Nutrient (WLN) medium and 5.8S-ITS-RFLP analysis. The result showed that T-RFLP profiles of the yeast community correlated well with that of the results identified by the traditional methods. The TRFs with the highest intensity and present in all the samples corresponded to Saccharomyces sp. Other species detected by both approaches were Hanseniaspora uvarum, Metschnikowia pulcherrima, Pichia minuta var. minuta, Saccharomycodes ludwigii/Torulaspora delbrueckii and Candida zemplinina. This study revealed that T-RFLP technique is a rapid and useful tool for monitoring the composition of yeast species during wine fermentation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  9. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  10. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...

  11. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards

    2013-06-01

    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  12. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  13. Heterogeneity among Dermatophilus congolensis isolates demonstrated by restriction fragment length polymorphisms.

    Science.gov (United States)

    Faibra, D T

    1993-01-01

    There is evidence of antigenic diversity and of differences in virulence in Dermatophilus congolensis. For the understanding of the epidemiology of dermatophilosis it is important to distinguish between strains of the organism. Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. After restriction enzyme digestion of DNA by BamHI and Southern blotting, a rDNA probe consisting of plasmid pMC5 carrying a 4.8 kb insert of Mycoplasma capricolum DNA coding for the 5S, 23S and part of 16S rRNA allowed to distinguish 6 ribotypes of D. congolensis, based on their hybridized rDNA patterns. Particular ribotypes may be distributed over a wide geographical area. On the other hand, strains belonging to at least 5 different ribotypes may be found in one herd; this may partly explain the lack of success in immunization against dermatophilosis in the field.

  14. Restriction fragment length polymorphism catalog for molecular identification of Japanese Tetranychus spider mites (Acari: Tetranychidae).

    Science.gov (United States)

    Osakabe, Masahiro; Kotsubo, Yu; Tajima, Ryusen; Hinomoto, Norihide

    2008-08-01

    Species identification is a basic issue in biosecurity. Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) is a useful molecular diagnostic tool for species identification. However, the lack of transferability of data has been a serious shortcoming of this method. A RFLP catalog, i.e., a graph of PCR-RFLP patterns expected from sequence data, was devised as a tool to facilitate PCR-RFLP data sharing among laboratories. Twelve species of Tetranychus spider mites have been recorded in Japan to date. In this study, we analyzed DNA sequences of the internal transcribed spacer (ITS) region in nuclear ribosomal DNA of 11 Tetranychus species. For the species identification using PCR-RFLP, we chose six candidates from 131 restriction endonucleases and developed an RFLP catalog of all known Japanese Tetranychus species except Tetranychus neocaledonicus André. The RFLP catalog revealed that most Tetranychus species had diagnostic restriction fragments. The RFLP catalog is transferable and simple molecular diagnostic tool, and it has the ability to add more species and newly found intraspecific variations. Therefore, we believe that the RFLP catalog will contribute to biosecurity as a practical diagnostic tool for species identification of spider mites.

  15. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  16. Using amplified fragment length polymorphism analysis to differentiate isolates of Pasteurella multocida serotype 1

    Science.gov (United States)

    Blehert, D.S.; Jefferson, K.L.; Heisey, D.M.; Samuel, M.D.; Berlowski, B.M.; Shadduck, D.J.

    2008-01-01

    Avian cholera, an infectious disease caused by the bacterium Pasteurella multocida, kills thousands of North American wild waterfowl annually. Pasteurella multocida serotype 1 isolates cultured during a laboratory challenge study of Mallards (Anas platyrhynchos) and collected from wild birds and environmental samples during avian cholera outbreaks were characterized using amplified fragment length polymorphism (AFLP) analysis, a whole-genome DNA fingerprinting technique. Comparison of the AFLP profiles of 53 isolates from the laboratory challenge demonstrated that P. multocida underwent genetic changes during a 3-mo period. Analysis of 120 P. multocida serotype 1 isolates collected from wild birds and environmental samples revealed that isolates were distinguishable from one another based on regional and temporal genetic characteristics. Thus, AFLP analysis had the ability to distinguish P. multocida isolates of the same serotype by detecting spatiotemporal genetic changes and provides a tool to advance the study of avian cholera epidemiology. Further application of AFLP technology to the examination of wild bird avian cholera outbreaks may facilitate more effective management of this disease by providing the potential to investigate correlations between virulence and P. multocida genotypes, to identify affiliations between bird species and bacterial genotypes, and to elucidate the role of specific bird species in disease transmission. ?? Wildlife Disease Association 2008.

  17. Genetic variability of the stable fly assessed on a global scale using amplified fragment length polymorphism.

    Science.gov (United States)

    Kneeland, Kathleen M; Skoda, Steven R; Foster, John E

    2016-10-01

    The stable fly, Stomoxys calcitrans (L.) (Diptera: Muscidae), is a blood-feeding, economically important pest of animals and humans worldwide. Improved management strategies are essential and their development would benefit from studies on genetic diversity of stable flies. Especially if done on a global scale, such research could generate information necessary for the development and application of more efficient control methods. Herein we report on a genetic study of stable flies using amplified fragment length polymorphism, with samples of 10-40 individuals acquired from a total of 25 locations in the Nearctic, Neotropic, Palearctic, Afrotropic and Australasian biogeographical regions. We hypothesized that genetic differentiation would exist across geographical barriers. Although FST (0.33) was moderately high, the GST (0.05; representing genetic diversity between individuals) was very low; Nm values (representing gene flow) were high (9.36). The mismatch distribution and tests of neutrality suggested population expansion, with no genetic differentiation between locations. The analysis of molecular variance (AMOVA) results showed the majority of genetic diversity was within groups. The mantel test showed no correlation between geographic and genetic distance; this strongly supports the AMOVA results. These results suggest that stable flies did not show genetic differentiation but are panmictic, with no evidence of isolation by distance or across geographical barriers. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  18. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  19. Application of PCR-based restriction fragment length polymorphism for the identification of mycobacterial isolates.

    Science.gov (United States)

    Deepa, P; Therese, K L; Madhavan, H N

    2005-05-01

    Conventional identification of mycobacteria is achieved by standard biochemical tests that are time consuming, laborious and is not always conclusive. This study was thus undertaken to standardize a simple, rapid and cost-effective polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) using primers coding for the 16S - 23S rRNA spacer region to identify the mycobacterial isolates to the species level. The PCR with primers targeting the 16S-23S rRNA spacer region was standardized using the standard mycobacterial strains and applied on 51 clinical isolates. The PCR amplified products were subjected to RFLP using the restriction enzymes, Hae III, MspI and BstXI. The results obtained were compared with those of conventional biochemical tests. PCR was sensitive to detect 2.5 pg of H37Rv DNA (370 bp for slow grower mycobacteria) and 1.5 pg of M. fortuitum DNA (450 bp for rapid grower mycobacteria). Based on the PCRRFLP products obtained the 51 mycobacterial isolates were classified into 41 slow growers and 10 rapid growers. Among the 41 slow growers, 40 were identified as M. tuberculosis, one as M. xenopi and 10 rapid growers as M. fortuitum. PCR using primers targeting the 16S-23S rRNA spacer region was a reliable tool for rapid identification of mycobacterial isolates into slow and rapid growers within 4 h of isolation and further speciation by PCR-RFLP within 6-8 h.

  20. Using terminal restriction fragment length polymorphism (T-RFLP) to identify mycorrhizal fungi: a methods review.

    Science.gov (United States)

    Dickie, I A; FitzJohn, R G

    2007-06-01

    Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In this paper, we review the technique as it is used to identify species of mycorrhizal fungi and distinguish two different versions of the technique: peak-profile T-RFLP (the original version) and database T-RFLP. We define database T-RFLP as the use of T-RFLP to identify individual species within samples by comparison of unknown data with a database of known T-RFLP patterns. This application of T-RFLP avoids some of the pitfalls of peak-profile T-RFLP and allows T-RFLP to be applied to polyphyletic functional groups such as ectomycorrhizal fungi. The identification of species using database T-RFLP is subject to several sources of potential error, including (1) random erroneous matches of peaks to species, (2) shared T-RFLP profiles across species, and (3) multiple T-RFLP profiles within a species. A mathematical approximation of the risk of the first type of error as a function of experimental parameters is discussed. Although potentially less accurate than some other methods such as clone libraries, the high throughput of database T-RFLP permits much greater replication and may, therefore, be preferable for many ecological questions, particularly when combined with other techniques such as cloning.

  1. Mycobacterium tuberculosis complex differentiation using gyrB-restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Erica Chimara

    2004-11-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC members are causative agents of human and animal tuberculosis. Differentiation of MTBC members is required for appropriate treatment of individual patients and for epidemiological purposes. Strains from six MTBC species - M. tuberculosis, M. bovis subsp. bovis, M. bovis BCG, M. africanum, M. pinnipedii, and "M. canetti" - were studied using gyrB-restriction fragment length polymorphism (gyrB-RFLP analysis. A table was elaborated, based on observed restriction patterns and published gyrB sequences. To evaluate applicability of gyrB-RFLP at Instituto Adolfo Lutz, São Paulo, Mycobacterial Reference Laboratory, 311 MTBC clinical isolates, previously identified using traditional methods as M. tuberculosis (306, M. bovis (3, and M. bovis BCG (2, were analyzed by gyrB-RFLP. All isolates were correctly identified by the molecular method, but no distinction between M. bovis and M. bovis BCG was obtained. Differentiation of M. tuberculosis and M. bovis is of utmost importance, because they require different treatment schedules. In conclusion, gyrB-RFLP is accurate and easy-to-perform, with potential to reduce time needed for conventional differentiation methods. However, application for epidemiological studies remains limited, because it cannot differentiate M. tuberculosis from M. africanum subtype II, and "M. canetti", M. africanum subtype I from M. pinnipedii, and. M. bovis from M. bovis BCG.

  2. Cystic fibrosis transmembrane regulator haplotypes in households of patients with cystic fibrosis.

    Science.gov (United States)

    Furgeri, Daniela Tenório; Marson, Fernando Augusto Lima; Correia, Cyntia Arivabeni Araújo; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia

    2018-01-30

    Nearly 2000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported. The F508del mutation occurs in approximately 50-65% of patients with cystic fibrosis (CF). However, molecular diagnosis is not always possible. Therefore, silent polymorphisms can be used to label the mutant allele in households of patients with CF. To verify the haplotypes of four polymorphisms at the CFTR locus in households of patients with CF for pre-fertilization, pre-implantation, and prenatal indirect mutation diagnosis to provide better genetic counseling for families and patients with CF and to associate the genotypes/haplotypes with the F508del mutation screening. GATT polymorphism analysis was performed using direct polymerase chain reaction amplification, and the MP6-D9, TUB09 and TUB18 polymorphism analyses were performed using restriction fragment length polymorphism. Nine haplotypes were found in 37 CFTR alleles, and of those, 24 were linked with the F508del mutation and 13 with other CFTR mutations. The 6 (GATT), C (MP6-D9), G (TUB09), and C (TUB18) haplotypes showed the highest prevalence (48%) of the mutant CFTR allele and were linked to the F508del mutation (64%). In 43% of households analyzed, at least one informative polymorphism can be used for the indirect diagnostic test. CFTR polymorphisms are genetic markers that are useful for identifying the mutant CFTR alleles in households of patients with CF when it is not possible to establish the complete CFTR genotype. Moreover, the polymorphisms can be used for indirect CFTR mutation identification in cases of pre-fertilization, pre-implantation and prenatal analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.

    Science.gov (United States)

    Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

    1990-10-01

    Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster

  4. Restriction fragment length polymorphism pattern of Mycobacterium isolates from rodents in infected cattle farms.

    Science.gov (United States)

    Alizadeh, Khatereh; Mosavari, Nader; Nazari, Razieh

    2016-12-01

    Mycobacterium tuberculosis, the etiologic agent of tuberculosis, causes large-scale morbidity and mortality, particularly in developing countries. In recent years, there has been a significant increase in the drug-resistant ability of M. tuberculosis, triggering a major public health crisis. A detailed analysis of the evolution of the mycobacterial genome helps to better understand the genotype-phenotype relationship in this bacterium. Different strain typing methods have already revealed the worldwide diversity of mycobacterial isolates. Therefore, DNA-fingerprinting tools have been developed to improve tuberculosis case detection and control. Molecular typing techniques allow to detect and follow the spread of individual strains of the M. tuberculosis complex (MTC), complementing conventional epidemiological methods. Among these techniques, restriction fragment length polymorphism (RFLP) has been considered the standard method for genotyping of MTC. The aim of this work was to isolate M. tuberculosis from rodents in cattle farms contaminated with MTC located in the city of Booin-Zahra, Iran. A total of 100 samples were collected from the rodents in the contaminated farms and analyzed for the presence of Mycobacterium by growing the samples on Lowenstein-Jensen medium. All isolates were further identified by RFLP and DNA hybridization studies. As much as five samples showed the presence of Mycobacterium and these were subjected to PCR-16SrRNA, PCR-IS6110, and RD Typing (RD1, RD4, RD9, and RD12) methods. Further differentiation was performed with PvuII digestion (RFLP) and DNA hybridization using the polymorphic guanine/cytosine-rich repetitive sequences (PGRS) probe. The PGRS probe results classified two of the isolates as belonging to one cluster, whereas the remaining isolates were classified as belonging to different clusters. An analysis of the obtained genetic pattern and a comparison of these patterns with the genetic pattern of other infected farms allowed

  5. SNP and haplotype analysis reveal IGF2 variants associated with growth traits in Chinese Qinchuan cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Zhan, Zhao-Yang; Li, Xin-Yi; Wu, Sheng-Ru; Sun, Yu-Jia; Xue, Jing; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Jia, Yu-Tang; Chen, Hong

    2014-02-01

    Insulin-like growth factor 2 (IGF2) is a potent cell growth and differentiation factor and is implicated in mammals' growth and development. The objective of this study was to evaluate the effects of the mutations in the bovine IGF2 with growth traits in Chinese Qinchuan cattle. Four single nucleotide polymorphisms (SNPs) were detected of the bovine IGF2 by DNA pool sequencing and forced polymerase chain reaction-restriction fragment length polymorphism (forced PCR-RFLP) methods. We also investigated haplotype structure and linkage disequilibrium (LD) coefficients for four SNPs in 817 individuals representing two main cattle breeds from China. The result of haplotype analysis showed eight different haplotypes and 27 combined genotypes within the study population. The statistical analyses indicated that the four SNPs, combined genotypes and haplotypes are associated with the withers height, body length, chest breadth, chest depth and body weight in Qinchuan cattle population (P growth traits; the heterozygote diplotype was associated with higher growth traits compared to wild-type homozygote. Our results provide evidence that polymorphisms in the IGF2 gene are associated with growth traits, and may be used for marker-assisted selection in beef cattle breeding program.

  6. Mapping Haplotype-haplotype Interactions with Adaptive LASSO

    Directory of Open Access Journals (Sweden)

    Li Ming

    2010-08-01

    Full Text Available Abstract Background The genetic etiology of complex diseases in human has been commonly viewed as a complex process involving both genetic and environmental factors functioning in a complicated manner. Quite often the interactions among genetic variants play major roles in determining the susceptibility of an individual to a particular disease. Statistical methods for modeling interactions underlying complex diseases between single genetic variants (e.g. single nucleotide polymorphisms or SNPs have been extensively studied. Recently, haplotype-based analysis has gained its popularity among genetic association studies. When multiple sequence or haplotype interactions are involved in determining an individual's susceptibility to a disease, it presents daunting challenges in statistical modeling and testing of the interaction effects, largely due to the complicated higher order epistatic complexity. Results In this article, we propose a new strategy in modeling haplotype-haplotype interactions under the penalized logistic regression framework with adaptive L1-penalty. We consider interactions of sequence variants between haplotype blocks. The adaptive L1-penalty allows simultaneous effect estimation and variable selection in a single model. We propose a new parameter estimation method which estimates and selects parameters by the modified Gauss-Seidel method nested within the EM algorithm. Simulation studies show that it has low false positive rate and reasonable power in detecting haplotype interactions. The method is applied to test haplotype interactions involved in mother and offspring genome in a small for gestational age (SGA neonates data set, and significant interactions between different genomes are detected. Conclusions As demonstrated by the simulation studies and real data analysis, the approach developed provides an efficient tool for the modeling and testing of haplotype interactions. The implementation of the method in R codes can be

  7. Distribution of HLA-G extended haplotypes and one HLA-E polymorphism in a large-scale study of mother-child dyads with and without severe preeclampsia and eclampsia

    DEFF Research Database (Denmark)

    Nilsson, L. L.; Djurisic, S; Andersen, A.-M. N.

    2016-01-01

    The etiological pathways and pathogenesis of preeclampsia have rendered difficult to disentangle. Accumulating evidence points toward a maladapted maternal immune system, which may involve aberrant placental expression of immunomodulatory human leukocyte antigen (HLA) class Ib molecules during...... pregnancy. Several studies have shown aberrant or reduced expression of HLA-G in the placenta and in maternal blood in cases of preeclampsia compared with controls. Unlike classical HLA class Ia loci, the nonclassical HLA-G has limited polymorphic variants. Most nucleotide variations are clustered in the 5...... comprehensive performed, investigated the association between the HLA-G 14-bp ins/del (rs66554220) and HLA-E polymorphisms in mother and newborn dyads from pregnancies complicated by severe preeclampsia/eclampsia and from uncomplicated pregnancies. Furthermore, results from extended HLA-G haplotyping...

  8. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  10. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  11. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  12. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  13. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  14. Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

    Science.gov (United States)

    Williams, Shelley Diane

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a

  15. Distribution of HLA-G extended haplotypes and one HLA-E polymorphism in a large-scale study of mother-child dyads with and without severe preeclampsia and eclampsia.

    Science.gov (United States)

    Nilsson, L L; Djurisic, S; Andersen, A-M N; Melbye, M; Bjerre, D; Ferrero-Miliani, L; Hackmon, R; Geraghty, D E; Hviid, T V F

    2016-10-01

    The etiological pathways and pathogenesis of preeclampsia have rendered difficult to disentangle. Accumulating evidence points toward a maladapted maternal immune system, which may involve aberrant placental expression of immunomodulatory human leukocyte antigen (HLA) class Ib molecules during pregnancy. Several studies have shown aberrant or reduced expression of HLA-G in the placenta and in maternal blood in cases of preeclampsia compared with controls. Unlike classical HLA class Ia loci, the nonclassical HLA-G has limited polymorphic variants. Most nucleotide variations are clustered in the 5'-upstream regulatory region (5'URR) and 3'-untranslated regulatory region (3'UTR) of HLA-G and reflect a stringent expressional control. Based on genotyping and full gene sequencing of HLA-G in a large number of cases and controls (n > 900), the present study, which to our knowledge is the largest and most comprehensive performed, investigated the association between the HLA-G 14-bp ins/del (rs66554220) and HLA-E polymorphisms in mother and newborn dyads from pregnancies complicated by severe preeclampsia/eclampsia and from uncomplicated pregnancies. Furthermore, results from extended HLA-G haplotyping in the newborns are presented in order to assess whether a combined contribution of nucleotide variations spanning the 5'URR, coding region, and 3'UTR of HLA-G describes the genetic association with severe preeclampsia more closely. In contrast to earlier findings, the HLA-G 14-bp ins/del polymorphism was not associated with severe preeclampsia. Furthermore, the polymorphism (rs1264457) defining the two nonsynonymous HLA-E alleles, HLA-E*01:01:xx:xx and HLA-E*01:03:xx:xx, were not associated with severe preeclampsia. Finally, no specific HLA-G haplotypes were significantly associated with increased risk of developing severe preeclampsia/eclampsia. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  17. Haplotype-based allele mining in the Japan-MAGIC rice population.

    Science.gov (United States)

    Ogawa, Daisuke; Yamamoto, Eiji; Ohtani, Toshikazu; Kanno, Noriko; Tsunematsu, Hiroshi; Nonoue, Yasunori; Yano, Masahiro; Yamamoto, Toshio; Yonemaru, Jun-Ichi

    2018-03-12

    Multi-parent advanced generation inter-cross (MAGIC) lines have broader genetic variation than bi-parental recombinant inbred lines. Genome-wide association study (GWAS) using high number of DNA polymorphisms such as single-nucleotide polymorphisms (SNPs) is a popular tool for allele mining in MAGIC populations, in which the associations of phenotypes with SNPs are investigated; however, the effects of haplotypes from multiple founders on phenotypes are not considered. Here, we describe an improved method of allele mining using the newly developed Japan-MAGIC (JAM) population, which is derived from eight high-yielding rice cultivars in Japan. To obtain information on the haplotypes in the JAM lines, we predicted the haplotype blocks in the whole chromosomes using 16,345 SNPs identified via genotyping-by-sequencing analysis. Using haplotype-based GWAS, we clearly detected the loci controlling the glutinous endosperm and culm length traits. Information on the alleles of the eight founders, which was based on the effects of mutations revealed by the analysis of next-generation sequencing data, was used to narrow down the candidate genes and reveal the associations between alleles and phenotypes. The haplotype-based allele mining (HAM) proposed in this study is a promising approach to the detection of allelic variation in genes controlling agronomic traits in MAGIC populations.

  18. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  19. Strobe sequence design for haplotype assembly

    Science.gov (United States)

    2011-01-01

    Background Humans are diploid, carrying two copies of each chromosome, one from each parent. Separating the paternal and maternal chromosomes is an important component of genetic analyses such as determining genetic association, inferring evolutionary scenarios, computing recombination rates, and detecting cis-regulatory events. As the pair of chromosomes are mostly identical to each other, linking together of alleles at heterozygous sites is sufficient to phase, or separate the two chromosomes. In Haplotype Assembly, the linking is done by sequenced fragments that overlap two heterozygous sites. While there has been a lot of research on correcting errors to achieve accurate haplotypes via assembly, relatively little work has been done on designing sequencing experiments to get long haplotypes. Here, we describe the different design parameters that can be adjusted with next generation and upcoming sequencing technologies, and study the impact of design choice on the length of the haplotype. Results We show that a number of parameters influence haplotype length, with the most significant one being the advance length (distance between two fragments of a clone). Given technologies like strobe sequencing that allow for large variations in advance lengths, we design and implement a simulated annealing algorithm to sample a large space of distributions over advance-lengths. Extensive simulations on individual genomic sequences suggest that a non-trivial distribution over advance lengths results a 1-2 order of magnitude improvement in median haplotype length. Conclusions Our results suggest that haplotyping of large, biologically important genomic regions is feasible with current technologies. PMID:21342554

  20. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  1. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  2. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  3. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    Science.gov (United States)

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  5. DNA damage in leukocytes of sickle cell anemia patients is associated with hydroxyurea therapy and with HBB*S haplotype.

    Science.gov (United States)

    da Silva Rocha, Lilianne Brito; Dias Elias, Darcielle Bruna; Barbosa, Maritza Cavalcante; Bandeira, Izabel Cristina Justino; Gonçalves, Romélia Pinheiro

    2012-12-12

    Hydroxyurea (HU) is the primary pharmacologic agent for preventing the complications and improving the quality of life of sickle cell anemia (SCA) patients. Although HU has been associated with an increased risk of leukemia in some patients with myeloproliferative disorders, the mutagenic and carcinogenic potential of HU has not been established. This study used the alkaline comet assay to investigate DNA damage in peripheral blood leukocytes from 41 individuals with SCA treated with HU (SCAHU) and from 26 normal individuals. The presence of HbS and the analysis of the haplotypes of the beta S gene cluster were done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The damage index (DI) in the SCAHU group was significantly higher than in controls (p20kg/m(2). No significant influence of mean HU dose was observed on DI (p=0.950). However, individuals who received a mean HU dose≥20mg/kg showed a higher DI than those who received less. Furthermore, an association was observed between DI damage and HBB*S gene haplotypes. DI values for the Bantu/Bantu haplotype was greater when compared to the Benin/Benin haplotype; and the Bantu/Benin haplotype had a DI lower than the Bantu/Bantu haplotype and greater than the Benin/Benin haplotype. Our results show that DNA damage in sickle cell anemia is associated not only with treatment with HU but also with genotype. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...... polymorphism (AFLP). When making genetic trees, all three methods resulted in similar clustering that often corresponded with serotype, although some serotypes displayed more diversity than others. Of the three techniques, MLST was the easiest to interpret and compare between laboratories. Unfortunately...

  7. Involvement of different mechanisms for the association of CAG repeat length polymorphism in androgen receptor gene with prostate cancer

    Science.gov (United States)

    Mao, Xueying; Li, Jie; Xu, Xingxing; Boyd, Lara K; He, Weiyang; Stankiewicz, Elzbieta; Kudahetti, Sakunthala C; Cao, Guangwen; Berney, Daniel; Ren, Guosheng; Gou, Xin; Zhang, Hongwei; Lu, Yong-Jie

    2014-01-01

    While androgen and androgen receptor (AR) activity have been strongly implicated in prostate cancer development and therapy, the influence of the CAG repeat, which is found within the first exon of the AR gene, on prostate carcinogenesis is still unclear. We investigated the differences in the length of the CAG repeat between prostate cancer patients and controls in the Chinese population as well as between TMPRSS2:ERG fusion positive and negative samples. A general association between prostate cancer and either longer or shorter AR CAG repeat length was not observed in the Chinese population. However, our data suggest that certain CAG repeat lengths may increase or decrease prostate cancer risk. Shorter CAG repeat length was also not shown to be associated with a higher induction rate of TMPRSS2 and ERG proximity, an essential step for TMPRSS2:ERG fusion formation. However, samples with a CAG repeat of 17 were found more frequently in the TMPRSS2:ERG fusion positive than negative prostate cancer cases and mediated a higher rate of androgen-induced TMPRSS2 and ERG co-localisation than AR with longer (24) and shorter (15) CAG repeats. This suggests that 17 CAG repeats may be associated with TMPRSS2:ERG fusion positive prostate cancer, but may have a preventive role for prostate cancer in the Chinese population, which has a low TMPRSS2:ERG fusion frequency. This study suggests that different mechanisms for the association of CAG repeat length polymorphism and prostate cancer exist in different ethnic populations. PMID:25520876

  8. A haplotype of polymorphisms in ASE-1, RAI and ERCC1 and the effects of tobacco smoking and alcohol consumption on risk of colorectal cancer: a danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Hansen, Rikke D.; Sørensen, Mette; Tjønneland, Anne

    2008-01-01

    according to gender, and two-sided 95% confidence intervals (CI) and p-values were calculated based on robust estimates of the variance-covariance matrix and Wald's test of the Cox regression parameter. Results No consistent associations between the three individual polymorphisms, the haplotype and risk...

  9. Amyloid structure exhibits polymorphism on multiple length scales in human brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jiliang; Costantino, Isabel; Venugopalan, Nagarajan; Fischetti, Robert F.; Hyman, Bradley; Frosch, Matthew; Gomez-Isla, Teresa; Makowski, Lee

    2016-09-15

    Although aggregation of Aβ amyloid fibrils into plaques in the brain is a hallmark of Alzheimer's Disease (AD), the correlation between amyloid burden and severity of symptoms is weak. One possible reason is that amyloid fibrils are structurally polymorphic and different polymorphs may contribute differentially to disease. However, the occurrence and distribution of amyloid polymorphisms in human brain is poorly documented. Here we seek to fill this knowledge gap by using X-ray microdiffraction of histological sections of human tissue to map the abundance, orientation and structural heterogeneities of amyloid within individual plaques; among proximal plaques and in subjects with distinct clinical histories. A 5 µ x-ray beam was used to generate diffraction data with each pattern arising from a scattering volume of only ~ 450 µ3 , making possible collection of dozens to hundreds of diffraction patterns from a single amyloid plaque. X-ray scattering from these samples exhibited all the properties expected for scattering from amyloid. Amyloid distribution was mapped using the intensity of its signature 4.7 Å reflection which also provided information on the orientation of amyloid fibrils across plaques. Margins of plaques exhibited a greater degree of orientation than cores and orientation around blood vessels frequently appeared tangential. Variation in the structure of Aβ fibrils is reflected in the shape of the 4.7 Å peak which usually appears as a doublet. Variations in this peak correspond to differences between the structure of amyloid within cores of plaques and at their periphery. Examination of tissue from a mismatch case - an individual with high plaque burden but no overt signs of dementia at time of death - revealed a diversity of structure and spatial distribution of amyloid that is distinct from typical AD cases. We demonstrate the existence of structural polymorphisms among amyloid within and among plaques of a single individual and suggest

  10. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  11. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  12. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    International Nuclear Information System (INIS)

    Szafer, F.; Brautbar, C.; Tzfoni, E.

    1987-01-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQβ, DQα, and DRβ cDNA probes. Hybridization with the DQβ probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQα and DRβ probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease

  13. Approximation properties of haplotype tagging

    Directory of Open Access Journals (Sweden)

    Dreiseitl Stephan

    2006-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are locations at which the genomic sequences of population members differ. Since these differences are known to follow patterns, disease association studies are facilitated by identifying SNPs that allow the unique identification of such patterns. This process, known as haplotype tagging, is formulated as a combinatorial optimization problem and analyzed in terms of complexity and approximation properties. Results It is shown that the tagging problem is NP-hard but approximable within 1 + ln((n2 - n/2 for n haplotypes but not approximable within (1 - ε ln(n/2 for any ε > 0 unless NP ⊂ DTIME(nlog log n. A simple, very easily implementable algorithm that exhibits the above upper bound on solution quality is presented. This algorithm has running time O((2m - p + 1 ≤ O(m(n2 - n/2 where p ≤ min(n, m for n haplotypes of size m. As we show that the approximation bound is asymptotically tight, the algorithm presented is optimal with respect to this asymptotic bound. Conclusion The haplotype tagging problem is hard, but approachable with a fast, practical, and surprisingly simple algorithm that cannot be significantly improved upon on a single processor machine. Hence, significant improvement in computatational efforts expended can only be expected if the computational effort is distributed and done in parallel.

  14. Size polymorphism of chicken major histocompatibility complex-encoded B-G molecules is due to length variation in the cytoplasmic heptad repeat region

    DEFF Research Database (Denmark)

    Kaufman, J; Salomonsen, J; Skjødt, K

    1990-01-01

    B-G antigens are cell-surface molecules encoded by a highly polymorphic multigene family located in the chicken major histocompatibility complex (MHC). Rabbit antisera to B-G molecules immunoprecipitate 3-6 bands from iodinated erythrocytes by sodium dodecyl sulfate (SDS) gels under reducing...... conditions. These are all B-G molecules because they all map to the B-G region of the chicken MHC in congenic and recombinant chickens, most are directly recognized by the antisera, most form disulfide-linked dimers, and none bear N-linked carbohydrate. Both apparent homodimers and heterodimers are found......, which bear intrachain disulfide bonds. All 3-6 bands have different mobilities in SDS gels between different haplotypes, ranging from 30 to 55 kDa. This size polymorphism is not affected by glycosidase treatment or addition of protease inhibitors. Partial proteolysis of cell surface-iodinated B-G...

  15. Haplotypes of nine single nucleotide polymorphisms on chromosome 19q13.2-3 associated with susceptibility of lung cancer in a Chinese population

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla Birgitte; Ma, Yegang

    2008-01-01

    To evaluate the joint effect of nine single nucleotide polymorphisms for three DNA repair genes in the region of chromosome 19q13.2-3 on susceptibility of lung cancer in a Chinese population, we conducted a hospital-based case-control study consisting of 247 lung cancer cases and 253 cancer...

  16. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  17. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  18. Genetic differentiation of Octopus minor (Mollusca, Cephalopoda) off the northern coast of China as revealed by amplified fragment length polymorphisms.

    Science.gov (United States)

    Yang, J M; Sun, G H; Zheng, X D; Ren, L H; Wang, W J; Li, G R; Sun, B C

    2015-12-02

    Octopus minor (Sasaki, 1920) is an economically important cephalopod that is found in the northern coastal waters of China. In this study, we investigated genetic differentiation in fishery populations using amplified fragment length polymorphisms (AFLPs). A total of 150 individuals were collected from five locations: Dalian (DL), Yan-tai (YT), Qingdao (QD), Lianyungang (LY), and Zhoushan (ZS), and 243 reproducible bands were amplified using five AFLP primer combinations. The percentage of polymorphic bands ranged from 53.33 to 76.08%. Nei's genetic identity ranged from 0.9139 to 0.9713, and the genetic distance ranged from 0.0291 to 0.0900. A phylogenetic tree was constructed using the unweighted pair group method with arithmetic mean, based on the genetic distance. The DL and YT populations originated from one clade, while the QD, LY, and ZS populations originated from another. The results indicate that the O. minor stock consisted of two genetic populations with an overall significantly analogous FST value (0.1088, P octopus fisheries, so that this marine resource can be conserved for its long-term utilization.

  19. Validation of Simple Sequence Length Polymorphism Regions of Commonly Used Mouse Strains for Marker Assisted Speed Congenics Screening

    Directory of Open Access Journals (Sweden)

    Channabasavaiah B. Gurumurthy

    2015-01-01

    Full Text Available Marker assisted speed congenics technique is commonly used to facilitate backcrossing of mouse strains in nearly half the time it normally takes otherwise. Traditionally, the technique is performed by analyzing PCR amplified regions of simple sequence length polymorphism (SSLP markers between the recipient and donor strains: offspring with the highest number of markers showing the recipient genome across all chromosomes is chosen for the next generation. Although there are well-defined panels of SSLP makers established between certain pairs of mice strains, they are incomplete for most strains. The availability of well-established marker sets for speed congenic screens would enable the scientific community to transfer mutations across strain backgrounds. In this study, we tested the suitability of over 400 SSLP marker sets among 10 mouse strains commonly used for generating genetically engineered models. The panel of markers presented here can readily identify the specified strains and will be quite useful in marker assisted speed congenic screens. Moreover, unlike newer single nucleotide polymorphism (SNP array methods which require sophisticated equipment, the SSLP markers panel described here only uses PCR and agarose gel electrophoresis of amplified products; therefore it can be performed in most research laboratories.

  20. Validation of simple sequence length polymorphism regions of commonly used mouse strains for marker assisted speed congenics screening.

    Science.gov (United States)

    Gurumurthy, Channabasavaiah B; Joshi, Poonam S; Kurz, Scott G; Ohtsuka, Masato; Quadros, Rolen M; Harms, Donald W; Lloyd, K C Kent

    2015-01-01

    Marker assisted speed congenics technique is commonly used to facilitate backcrossing of mouse strains in nearly half the time it normally takes otherwise. Traditionally, the technique is performed by analyzing PCR amplified regions of simple sequence length polymorphism (SSLP) markers between the recipient and donor strains: offspring with the highest number of markers showing the recipient genome across all chromosomes is chosen for the next generation. Although there are well-defined panels of SSLP makers established between certain pairs of mice strains, they are incomplete for most strains. The availability of well-established marker sets for speed congenic screens would enable the scientific community to transfer mutations across strain backgrounds. In this study, we tested the suitability of over 400 SSLP marker sets among 10 mouse strains commonly used for generating genetically engineered models. The panel of markers presented here can readily identify the specified strains and will be quite useful in marker assisted speed congenic screens. Moreover, unlike newer single nucleotide polymorphism (SNP) array methods which require sophisticated equipment, the SSLP markers panel described here only uses PCR and agarose gel electrophoresis of amplified products; therefore it can be performed in most research laboratories.

  1. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  2. A set of highly informative rat simple sequence length polymorphism (SSLP markers and genetically defined rat strains

    Directory of Open Access Journals (Sweden)

    Yamasaki Ken-ichi

    2006-04-01

    Full Text Available Abstract Background The National Bio Resource Project for the Rat in Japan (NBRP-Rat is focusing on collecting, preserving and distributing various rat strains, including spontaneous mutant, transgenic, congenic, and recombinant inbred (RI strains. To evaluate their value as models of human diseases, we are characterizing them using 109 phenotypic parameters, such as clinical measurements, internal anatomy, metabolic parameters, and behavioral tests, as part of the Rat Phenome Project. Here, we report on a set of 357 simple sequence length polymorphism (SSLP markers and 122 rat strains, which were genotyped by the marker set. Results The SSLP markers were selected according to their distribution patterns throughout the whole rat genome with an average spacing of 7.59 Mb. The average number of informative markers between all possible pairs of strains was 259 (72.5% of 357 markers, showing their high degree of polymorphism. From the genetic profile of these rat inbred strains, we constructed a rat family tree to clarify their genetic background. Conclusion These highly informative SSLP markers as well as genetically and phenotypically defined rat strains are useful for designing experiments for quantitative trait loci (QTL analysis and to choose strategies for developing new genetic resources. The data and resources are freely available at the NBRP-Rat web site 1.

  3. Association of Per3 length polymorphism with bipolar I disorder and schizophrenia

    Directory of Open Access Journals (Sweden)

    Karthikeyan R

    2014-12-01

    Full Text Available Ramanujam Karthikeyan,1 Ganapathy Marimuthu,1 Chellamuthu Ramasubramanian,2 Gautham Arunachal,2 Ahmed S BaHammam,3 David Warren Spence,4 Daniel P Cardinali,5 Gregory M Brown,6 Seithikurippu R Pandi-Perumal7 1Department of Animal Behaviour and Physiology, School of Biological Sciences, Madurai Kamaraj University, Madurai, India; 2MS Chellamuthu Trust and Research Foundation, KK Nagar, Madurai, India; 3University Sleep Disorders Center, College of Medicine, National Plan for Science and Technology, King Saud University, Riyadh, Saudi Arabia; 4Independent researcher, Toronto, Ontario, Canada; 5Department of Teaching and Research, Faculty of Medical Sciences, Pontificia Universidad Católica Argentina, Buenos Aires, Argentina; 6Centre for Addiction and Mental Health, University of Toronto, Toronto, Ontario, Canada; 7Center for Healthful Behavior Change (CHBC, Division of Health and Behavior, Department of Population Health, NYU Langone Medical Center, Clinical and Translational Research Institute, New York, New York, USA Background: Sleep–wake disturbances have frequently been reported in bipolar disorder and schizophrenia, and are considered to be caused by an underlying circadian rhythm disorder. The study presented here was designed to investigate the existence of Per3 polymorphism in bipolar disorder type I (BD-I and schizophrenic patients in South India.Methods: Blood samples were collected from 311 BD-I patients, 293 schizophrenia patients, and 346 age- and sex-matched normal controls. Per3 genotyping was performed on DNA by polymerase chain reaction using specific primers.Results: An increased prevalence of five repeat homozygotes was seen in BD-I patients as compared with healthy controls (odds ratio =1.72 [95% confidence interval: 1.08–2.76, P=0.02]. In BD-I patients, the frequency of the five repeat allele was higher (allele frequency =0.41, and that of the four repeat allele lower (allele frequency =0.36 (χ2=4.634; P<0.03 than in

  4. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  5. Differentiation of mixed lactic acid bacteria communities in beverage fermentations using targeted terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Bokulich, Nicholas A; Mills, David A

    2012-08-01

    Lactic acid bacteria (LAB) are an important group of bacteria in beer and wine fermentations both as beneficial organisms and as spoilage agents. However, sensitive, rapid, culture-independent methods for identification and community analyses of LAB in mixed-culture fermentations are limited. We developed a terminal restriction fragment length polymorphism (TRFLP)-based assay for the detection and identification of lactic acid bacteria and Bacilli during wine, beer, and food fermentations. This technique can sensitively discriminate most species of Lactobacillales, and most genera of Bacillales, in mixed culture, as indicated by both bioinformatic predictions and empirical observations. This method was tested on a range of beer and wine fermentations containing mixed LAB communities, demonstrating the efficacy of this technique for discriminating LAB in mixed culture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Using Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis to Assess Microbial Community Structure in Compost Systems

    Science.gov (United States)

    Tiquia, Sonia M.

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified genes is a widely used fingerprinting technique in composting systems. This analysis is based on the restriction endonuclease digestion of fluorescently end-labeled PCR products. The digested product is mixed with a DNA size standard, itself labeled with a distinct fluorescent dye, and the fragments are then separated by capillary or gel electrophoresis using an automated sequencer. Upon analysis, only the terminal end-labeled restriction fragments are detected. An electropherogram is produced, which shows a profile of compost microbial community as a series of peaks of varying height. This technique has also been effectively used in the exploration of complex microbial environments and in the study of bacterial, archaeal, and eukaryal populations in natural habitats.

  7. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    Science.gov (United States)

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history.

  8. Assessment of association between variants and haplotypes of the IGF2 gene in beef cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Jing; Zhan, Zhao-Yang; Cao, Xiu-Kai; Sun, Yu-Jia; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-10-10

    Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation. The aim of this study was to examine the association of the IGF2 polymorphism with growth traits in beef cattle breed. Four single nucleotide polymorphisms (SNPs: 1-4) were identified in the bovine IGF2 by sequencing pooled DNA samples (Pool-Seq) and forced polymerase chain reaction-restriction fragment length polymorphism (Forced PCR-RFLP) methods. The result of haplotype analysis of four SNPs showed that eight haplotypes and eighteen combined genotypes were revealed, and the linkage disequilibrium and evolutionary relationship were assessed in 1522 individuals representing four purebred cattle breeds from China. The statistical analyses indicated that the 4 SNPs and 18 combined genotypes or haplotypes are associated with the body weight at 18 and 24 months in Jiaxian cattle population (Pgrowth traits, and may be used for marker-assisted selection in beef cattle breeding program. © 2013.

  9. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  10. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes...

  11. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  12. "PolyMin": software for identification of the minimum number of polymorphisms required for haplotype and genotype differentiation

    DEFF Research Database (Denmark)

    Frei, Ursala K; Wollenweber, Bernd; Lübberstedt, Thomas

    2009-01-01

    Background: Analysis of allelic variation for relevant genes and monitoring chromosome segment transmission during selection are important approaches in plant breeding and ecology. To minimize the number of required molecular markers for this purpose is crucial due to cost and time constraints...... this information from available allele sequence data, resulting in an errorprone multi-step process of data handling. Results: PolyMin, a computer program combining the detection of a minimum set of single nucleotide polymorphisms (SNPs) and/or insertions/deletions (INDELs) necessary for allele differentiation...

  13. Extended HLA-D region haplotype associated with celiac disease

    Energy Technology Data Exchange (ETDEWEB)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II ..beta..-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this ..beta..-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP ..beta..-chain. This celiac disease-associated HLA-DP ..beta..-chain gene was flanked by HLA-DP ..cap alpha..-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DP..cap alpha..-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP ..cap alpha..- and ..beta..-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion.

  14. Extended HLA-D region haplotype associated with celiac disease

    International Nuclear Information System (INIS)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II β-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this β-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP β-chain. This celiac disease-associated HLA-DP β-chain gene was flanked by HLA-DP α-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DPα-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP α- and β-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion

  15. Unique Allelic eQTL Clusters in Human MHC Haplotypes.

    Science.gov (United States)

    Lam, Tze Hau; Shen, Meixin; Tay, Matthew Zirui; Ren, Ee Chee

    2017-08-07

    The control of gene regulation within the major histocompatibility complex (MHC) remains poorly understood, despite several expression quantitative trait loci (eQTL) studies revealing an association of MHC gene expression with independent tag-single nucleotide polymorphisms (SNPs). MHC haplotype variation may exert a greater effect on gene expression phenotype than specific single variants. To explore the effect of MHC haplotype sequence diversity on gene expression phenotypes across the MHC, we examined the MHC transcriptomic landscape at haplotype-specific resolution for three prominent MHC haplotypes (A2-B46-DR9, A33-B58-DR3, and A1-B8-DR3) derived from MHC-homozygous B-lymphoblastoid cell lines (B-LCLs). We demonstrate that MHC-wide gene expression patterns are dictated by underlying haplotypes, and identify 36 differentially expressed genes. By mapping these haplotype sequence variations to known eQTL, we provide evidence that unique allelic combinations of eQTL, embedded within haplotypes, are correlated with the level of expression of 17 genes. Interestingly, the influence of haplotype sequence on gene expression is not homogenous across the MHC. We show that haplotype sequence polymorphisms within or proximate to HLA-A, HLA-C, C4A, and HLA-DRB regions exert haplotype-specific gene regulatory effects, whereas the expression of genes in other parts of the MHC region are not affected by the haplotype sequence. Overall, we demonstrate that MHC haplotype sequence diversity can impact phenotypic outcome via the alteration of transcriptional variability, indicating that a haplotype-based approach is fundamental for the assessment of trait associations in the MHC. Copyright © 2017 Lam et al.

  16. Restriction fragment length polymorphism in calpain (CAPN2 gene in crossbred cattle

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Cassiano Lara

    2012-12-01

    using the restriction enzyme HhaI. The meat tenderness analysis was evaluated in Longissimus dorsi by Warner-Bratzler Shear Forcer. The data of shear force (SF were analyzed by model that included genotype effect (AA, AB, BB, genetic group and, as a covariate, the age at slaughter. The allele A, considered the most favorable for meat tenderization, was more frequent in Angus x Nelore (AxN than Red Angus x Nelore (RxA, whose frequencies were 0,4697 and 0,3975, respectively. Significant effects were observed (p<0.05 of genetic group and genotype in FC. The average value of FC estimated for RxN was 32.24%, significantly (p<0.05 lesser that of AxN. All the averages of FC estimated for the genotypes AA, AB and BB, in two genetic groups differed (p<0.05 and were, respectively, 3.74, 5.43 and 7.43 in AxN and 2.64, 4.21 and 5.32 in RxN. The results obtained show that such polymorphism can assist the identification of animals for meat quality in crossbred Bos taurus taurus x Bos taurus indicus.

  17. Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils.

    Science.gov (United States)

    Edel-Hermann, Véronique; Dreumont, Christiane; Pérez-Piqueres, Ana; Steinberg, Christian

    2004-03-01

    Monitoring the structure and dynamics of fungal communities in soils under agricultural and environmental disturbances is currently a challenge. In this study, a terminal restriction fragment length polymorphism (T-RFLP) fingerprinting method was developed for the rapid comparison of fungal community structures. The terminal restriction fragment polymorphism of different regions of the small-subunit (SSU) ribosomal RNA (rRNA) gene was simulated by sequence comparison using 10 restriction enzymes, and analyzed among three different soils using fungal-specific primers. Polymerase chain reaction amplification of the 3' end of the SSU rRNA gene with the primer nu-SSU-0817-5' and with the fluorescently labelled primer nu-SSU-1536-3', and digestion of the amplicons with AluI and MboI were found to be optimal and were used in a standardized T-RFLP procedure. Both the number and the intensity of terminal restriction fragments detected by capillary gel electrophoresis were integrated in correspondence analyses. Three soils with contrasting physicochemical properties were differentiated according to the structure of their fungal communities. Assessment of the impact on the fungal community structure of the amendment of two soils with compost or manure confirmed the reproducibility and the sensitivity of the method. Shifts in the community structure were detected between non-amended and amended soil samples. In both soils, the shift differed with the organic amendment applied. In addition, the fungal community structures of the two soils were affected in a different way by the same organic amendment. The fingerprinting method provides a rapid tool to investigate the effect of various perturbations on the fungal communities in soils.

  18. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping ba...

  19. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  20. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  1. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  2. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  3. On the power to detect differences between male and female mutation rates for Duchenne muscular dystrophy, using classical segregation analysis and restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Karel, E.R.; te Meerman, G J; Ten Kate, L P

    The power to detect departures from the theoretical proportion of new mutants in X-linked lethal disorders has been analyzed for several types of segregation analysis, including methods based on completely linked restriction fragment length polymorphisms. It is shown that all methods require large

  4. XRCC1 gene polymorphisms and risk of ameloblastoma.

    Science.gov (United States)

    Yanatatsaneejit, Pattamawadee; Boonsuwan, Titiporn; Mutirangura, Apiwat; Kitkumthorn, Nakarin

    2013-06-01

    Ameloblastoma is a common benign odontogenic tumour with inherently aggressive behaviour. Genetic susceptibility of single nucleotide polymorphism (SNP) can likely predict ameloblastoma at risk patients but this data remains limited. Here, we studied XRCC1 polymorphism as a risk factor for ameloblastoma. Eighty-two ameloblastoma samples and blood from 140 healthy controls were used to perform polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for XRCC1 at codons 194, 280 and 399, and confirmed by sequence analysis. Compare to healthy control, a significant increase was noted in the occurrence of polymorphism at codon 194 and 399 in ameloblastoma patients. At codon 194, tryptophan encoded by T, was the susceptibility allele showed an ODD ratio of (95% CI)=1.62 (1.05-2.48), p=0.027. At codon 399, glycine encoded by A was the susceptibility allele showing ODD ratio of (95% CI)=1.83 (1.19-2.84), p=0.005. Moreover at codon 399, we found AG as the susceptibility genotype (2.06 (1.14-3.72), p=0.015). However, we did not find any significant increase in polymorphic occurrence in ameloblastoma patients at codon 280. For haplotype analysis of 3 codons, we found GGC as protective haplotype, and AGT as the risk haplotype. Our data suggest that polymorphism at codons 194 and 399, likely contributes to the risk of developing ameloblastoma. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Amplified fragment length polymorphism analysis to assess crossover interference and homozygosity in gynogenetic diploid Pacific abalone (Haliotis discus hannai).

    Science.gov (United States)

    Nie, H-T; Li, Q; Kong, L-F

    2014-06-01

    Recombination analysis in gynogenetic diploids is a powerful tool for assessing the degree of inbreeding, investigating crossover events and understanding chiasma interference during meiosis. To estimate the marker-centromere recombination rate, the inheritance pattern of 654 amplified fragment length polymorphism (AFLP) markers was examined in the 72-h veliger larvae of two meiogynogenetic diploid families in the Pacific abalone (Haliotis discus hannai). The second-division segregation frequency (y) of the AFLP loci ranged from 0.00 to 0.96, with 23.9% of loci showing y-values higher than 0.67, evidencing the existence of interference. The average recombination frequency across the 654 AFLP loci was 0.45, allowing estimation of the fixation index of 0.55, indicating that meiotic gynogenesis could provide an effective means of rapid inbreeding in the Pacific abalone. The AFLP loci have a small proportion (4.4%) of y-values greater than 0.90, suggesting that a relatively low or intermediate degree of chiasma interference occurred in the abalone chromosomes. The information obtained in this study will enhance our understanding of the abalone genome and will be useful for genetic studies in the species. © 2014 Stichting International Foundation for Animal Genetics.

  6. Selection criteria for scoring amplified fragment length polymorphisms (AFLPs) positively affect the reliability of population genetic parameter estimates.

    Science.gov (United States)

    Herrmann, Doris; Poncet, Bénédicte N; Manel, Stéphanie; Rioux, Delphine; Gielly, Ludovic; Taberlet, Pierre; Gugerli, Felix

    2010-04-01

    A reliable data set is a fundamental prerequisite for consistent results and conclusions in population genetic studies. However, marker scoring of genetic fingerprints such as amplified fragment length polymorphisms (AFLPs) is a highly subjective procedure, inducing inconsistencies owing to personal or laboratory-specific criteria. We applied two alternative marker selection algorithms, the newly developed script scanAFLP and the recently published AFLPScore, to a large AFLP genome scan to test how population genetic parameters and error rates were affected. These results were confronted with replicated random selections of marker subsets. We show that the newly developed marker selection criteria reduced the mismatch error rate and had a notable influence on estimates of genetic diversity and differentiation. Both effects are likely to influence biological inference. For example, genetic diversity (HS) was 29% lower while genetic differentiation (FST) was 8% higher when applying scanAFLP compared with AFLPScore. Likewise, random selections of markers resulted in substantial deviations of population genetic parameters compared with the data sets including specific selection criteria. These randomly selected marker sets showed surprisingly low variance among replicates. We conclude that stringent marker selection and phenotype calling reduces noise in the data set while retaining patterns of population genetic structure.

  7. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  8. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  9. Amplified fragment length polymorphism used to investigate genetic variability of the stable fly (Diptera: Muscidae) across North America.

    Science.gov (United States)

    Kneeland, K M; Skoda, S R; Foster, J E

    2013-09-01

    The stable fly, Stomoxys calcitrans (L.), is a cosmopolitan pest of livestock and humans. The pestiferous nature and painful bite cause stress to cattle and other animals. The stress and resulting avoidance behaviors manifest as reductions in weight gain or milk production in cattle; estimated annual economic loss in the United States exceeds US$2 billion. Understanding the population genetics of stable flies could provide information on their population dynamics, origins of outbreaks, and geographical patterns of insecticide resistance, resulting in a tactical advantage for developing management strategies. Previous studies, mostly on a local scale, reported a high level of gene flow between locations. Here, we report results wherein amplified fragment length polymorphism was used to determine genetic diversity of stable fly samples consisting of 11-40 individuals from 12 locations representing the United States, Canada, and Panama. The Analysis of Molecular Variance showed that the majority of genetic diversity was within groups; very little was among groups. The F(ST) and G(ST) values were low ( 1.0). The tests of neutrality suggested population expansion, and no genetic differentiation was found between locations. These results show that stable flies have a high level of gene flow on a continental scale, with limited isolation owing to distance or geographical barriers.

  10. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    Energy Technology Data Exchange (ETDEWEB)

    Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  11. Prevalence of Trichomonas spp. in domestic pigeons in Shandong Province, China, and genotyping by restriction fragment length polymorphism.

    Science.gov (United States)

    Jiang, Xiyue; Sun, Jingjing; Wang, Fangkun; Li, Hongmei; Zhao, Xiaomin

    2016-05-01

    Oropharyngeal swabs (n = 609) were collected randomly from 80,000 domestic pigeons (Columba livia domestica) on five pigeon farms and at one pigeon slaughterhouse in Shandong Province, China, from September 2012 to July 2013. Trichomonas spp. were detected in 206/609 (33.8%) samples. The prevalence was 14.9-31.1%, depending on different levels of sanitation and management, and was 4.8% in nestling pigeons, 13.6% in breeding pigeons and 35.2% in adolescent pigeons. Trichomonas gallinae genotypes A and B, and Trichomonas tenax-like isolates were identified by PCR-restriction fragment length polymorphism (RFLP) analysis and sequencing of the 5.8S rDNA-internal transcribed spacer (ITS) regions. RFLP analysis with the restriction enzyme BsiEI generated different RFLP band patterns between T. gallinae and T.tenax-like isolates. When BsiEI RFLP analysis was combined with HaeIII RFLP analysis, all infection types of T. gallinae and T.tenax-like isolates could be identified. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  13. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  14. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  15. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  16. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  17. Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.

    Science.gov (United States)

    Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

    2009-06-01

    Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene.

  18. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  19. Molecular differentiation of Angiostrongylus costaricensis, A. cantonensis, and A. vasorum by polymerase chain reaction- restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2003-01-01

    Full Text Available Angiostrongylus cantonensis, A. costaricensis, and A. vasorum are etiologic agents of human parasitic diseases. Their identification, at present, is only possible by examining the adult worm after a 40-day period following infection of vertebrate hosts with the third-stage larvae. In order to obtain a diagnostic tool to differentiate larvae and adult worm from the three referred species, polymerase chain reaction-restriction fragment length polymorphism was carried out. The rDNA second internal transcribed spacer (ITS2 and mtDNA cytochrome oxidase I regions were amplified, followed by digestion of fragments with the restriction enzymes RsaI, HapII, AluI, HaeIII, DdeI and ClaI. The enzymes RsaI and ClaI exhibited the most discriminating profiles for the differentiation of the regions COI of mtDNA and ITS2 of rDNA respectively. The methodology using such regions proved to be efficient for the specific differentiation of the three species of Angiostrongylus under study.

  20. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  1. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    Energy Technology Data Exchange (ETDEWEB)

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  2. Haplotype identification and detection of mitochondrial DNA heteroplasmy in Varroa destructor mites using ARMS and PCR-RFLP methods.

    Science.gov (United States)

    Gajić, Bojan; Stevanović, Jevrosima; Radulović, Željko; Kulišić, Zoran; Vejnović, Branislav; Glavinić, Uroš; Stanimirović, Zoran

    2016-11-01

    In the present study, amplification refractory mutation system (ARMS) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were used for identification of recently described Serbia 1 (S1) and Peshter 1 (P1) mitochondrial haplotypes of Varroa destructor. Based on single nucleotide polymorphisms (SNPs) within cytochrome oxidase 1 (cox1) and cytochrome b (cytb) gene sequences, a total of 64 adult V. destructor females were analyzed from locations where the S1 and P1 haplotypes had been detected previously. Results of haplotype identification obtained by ARMS and PCR-RFLP methods were completely consistent with the sequencing data. Furthermore, in some analyzed samples the occurrence of site heteroplasmy at haplotype-defining sites was detected, as it was confirmed by double peaks in the sequence chromatograms. Neither mites with simultaneous nucleotide variability, nor those with combined SNP and heteroplasmy in cox1 and cytb were found. Given that this is the first occurrence of site heteroplasmy in V. destructor, the origin of this phenomenon and possible specific traits of heteroplasmic mites have yet to be determined.

  3. Identification and genetic effect of haplotype in the bovine BMP7 gene.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-12-15

    Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (Pgrowth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

  4. Genetic relationship and diversity in a sesame (Sesamum indicum L. germplasm collection using amplified fragment length polymorphism (AFLP

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2006-02-01

    Full Text Available Abstract Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia, and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP. Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA. This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres

  5. Genetic relationship and diversity in a sesame (Sesamum indicum L.) germplasm collection using amplified fragment length polymorphism (AFLP)

    Science.gov (United States)

    Laurentin, Hernán E; Karlovsky, Petr

    2006-01-01

    Background Sesame is an important oil crop in tropical and subtropical areas. Despite its nutritional value and historic and cultural importance, the research on sesame has been scarce, particularly as far as its genetic diversity is concerned. The aims of the present study were to clarify genetic relationships among 32 sesame accessions from the Venezuelan Germplasm Collection, which represents genotypes from five diversity centres (India, Africa, China-Korea-Japan, Central Asia and Western Asia), and to determine the association between geographical origin and genetic diversity using amplified fragment length polymorphism (AFLP). Results Large genetic variability was found within the germplasm collection. A total of 457 AFLP markers were recorded, 93 % of them being polymorphic. The Jaccard similarity coefficient ranged from 0.38 to 0.85 between pairs of accessions. The UPGMA dendrogram grouped 25 of 32 accessions in two robust clusters, but it has not revealed any association between genotype and geographical origin. Indian, African and Chinese-Korean-Japanese accessions were distributed throughout the dendrogram. A similar pattern was obtained using principal coordinates analysis. Genetic diversity studies considering five groups of accessions according to the geographic origin detected that only 20 % of the total diversity was due to diversity among groups using Nei's coefficient of population differentiation. Similarly, only 5% of the total diversity was attributed to differences among groups by the analysis of molecular variance (AMOVA). This small but significant difference was explained by the fact that the Central Asia group had a lower genetic variation than the other diversity centres studied. Conclusion We found that our sesame collection was genetically very variable and did not show an association between geographical origin and AFLP patterns. This result suggests that there was considerable gene flow among diversity centres. Future germplasm

  6. Influence of βS-Globin Haplotypes and Hydroxyurea on Arginase I Levels in Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    J. A. Moreira

    2016-01-01

    Full Text Available Introduction. Sickle cell disease (SCD is characterized by hemoglobin S homozygosity, leading to hemolysis and vasoocclusion. The hemolysis releases arginase I, an enzyme that decreases the bioavailability of nitric oxide, worsening the symptoms. The different SCD haplotypes are related to clinical symptoms and varied hemoglobin F (HbF concentration. The aim of this study was to evaluate the impact of the βS gene haplotypes and HbF concentration on arginase I levels in SCD patients. Methods. Fifty SCD adult patients were enrolled in the study and 20 blood donors composed the control group. Arginase I was measured by ELISA. The βS haplotypes were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. Statistical analyses were performed with GraphPad Prism program and the significance level was p<0.05. Results. Significant increase was observed in the arginase I levels in SCD patients compared to the control group (p<0.0001. The comparison between the levels of arginase I in three haplotypes groups showed a difference between the Bantu/Bantu × Bantu/Benin groups; Bantu/Bantu × Benin/Benin, independent of HU dosage. An inverse correlation with the arginase I levels and HbF concentration was observed. Conclusion. The results support the hypothesis that arginase I is associated with HbF concentration, also measured indirectly by the association with haplotypes.

  7. Close correlation between restriction fragment length polymorphism of the L-MYC gene and metastasis of human lung cancer to the lymph nodes and other organs

    International Nuclear Information System (INIS)

    Kawashima, Kazuko; Shikama, Hiroshi; Imoto, Kazuhiko; Izawa, Mitsuo; Nishimura, Susumu; Naruke, Tsuguo; Okabayashi, Kenzo

    1988-01-01

    Restriction length fragment polymorphism of the L-MYC gene was examined in DNAs from lung cancer tissues and normal tissues of 51 Japanese patients with lung cancer. In individual patients, no difference was seen between the restriction length fragments of the two alleles of L-MYC [6-kilobase (kb)] and 10-kb fragments in EcoRI digests in lung cancer tissues and normal tissues. But a striking correlation was found between the restriction length fragment polymorphism pattern of L-MYC and the extent of metastasis, particularly to the lymph nodes at the time of surgery: Patients with only the L band (10 kb) had few lymph node metastatic lesions, whereas patients with either the S band (6 kb) or the S and L bands almost always had lymph node metastatic lesion. A similar correlation was found between the presence of the S band and metastases to other organs. This correlation was particularly marked in cases of adenocarcinoma. These results indicate a clear genetic influence on metastases and a consequent poor prognosis for certain patients of lung cancer; L-MYC restriction length fragment polymorphism is thus shown to be a useful marker for predicting the metastatic potential of human lung cancer

  8. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  9. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  10. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  11. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  12. Haplotype Diversity at Sub1 Locus and Allelic Distribution Among Rice Varieties of Tide and Flood Prone Areas of South-East Asia

    Directory of Open Access Journals (Sweden)

    A.S.M. Masuduzzaman

    2017-07-01

    Full Text Available Single nucleotide polymorphisms and restriction digestion-based haplotype variations among 160 flood prone rice varieties were analyzed with enzymes Alu I and Cac8 I to generate polymorphisms at Sub1A and Sub1C loci (conferring submergence tolerance, respectively. Haplotype associated with phenotype was used to study the haplotype variations at Sub1A and Sub1C loci and to determine their functional influence on submergence tolerance and stem elongation. Three patterns at Sub1A locus, Sub1A0 (null allele, Sub1A1 (does not cut and Sub1A2 (one SNP, and four patterns at Sub1C locus, Sub1C1, Sub1C2, Sub1C3 and Sub1C4, were generated. Both tolerant Sub1A1 and intolerant Sub1A2 had the same length, but the difference was presence of a restriction site in the Sub1A2, but absent at the Sub1A1. Further, two types of polymorphism were detected at the Sub1C, one included major length polymorphisms (165, 170 and 175 bp and the other was a single restriction site at different position. Eight haplotypes (different combinations of the two loci, A1C1, A1C2, A1C4, A2C2, A2C4, A0C2, A0C3 and A0C4, were detected among 160 varieties. Haplotype A1C1 was comparatively more related to haplotypes A1C2 and A1C4, having the same Sub1A allele, and these haplotypes were found only in Bangladeshi, Sri Lankan and Indian varieties. Most tolerant varieties in A1C1 haplotype showed slow elongation, having tolerant specific Sub1A1 and Sub1C1 alleles. Further, the varieties Madabaru and Kottamali (A2C2 also showed moderate level of tolerance without Sub1A1 allele. These varieties were different with FR13A and also suspected to carry different novel tolerant genes at other loci. These materials could be used for hybridization with Sub1 varieties for pyramiding additional tolerant specific alleles into a single genotype for improving submergence tolerance in rice.

  13. Telomere Length Polymorphisms: A Potential Factor Underlying Increased Risk of Prostate Cancer in African American Men and Familial Prostate Cancer. Addendum

    Science.gov (United States)

    2009-12-01

    assessed in biopsies, polymorphisms in genes involved in inflammation and response to infection , and presence of antibodies against infectious...A.M., Lillemoe, K.D., Schulick, R., Hruban, R.H., Maitra, A., Argani, P. Telomere length variation in biliary tract metaplasia, dysplasia, and...Meeker AK. Dual-label centromere and telomere FISH identifies human, rat, and mouse cell contribution to Multispecies recombinant urogenital sinus

  14. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  15. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis. Part 1: Fungal field study

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Tor P. Schultz; Susan V. Dieh

    2012-01-01

    The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. Field stakes, treated with 0.25 and 0.37 % ACQ-C, 0.1 and 0.25 % CTN, 2 % BHT alone, 0.1 and 0.25 % CTN...

  16. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    Science.gov (United States)

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  17. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  18. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  19. Endothelial nitric oxide synthase polymorphisms and adaptation of parasympathetic modulation to exercise training.

    Science.gov (United States)

    Silva, Bruno M; Neves, Fabricia J; Negrão, Marcelo V; Alves, Cleber R; Dias, Rodrigo G; Alves, Guilherme B; Pereira, Alexandre C; Rondon, Maria U; Krieger, José E; Negrão, Carlos E; DA Nóbrega, Antonio Claudio Lucas

    2011-09-01

    There is a large interindividual variation in the parasympathetic adaptation induced by aerobic exercise training, which may be partially attributed to genetic polymorphisms. Therefore, we investigated the association among three polymorphisms in the endothelial nitric oxide gene (-786T>C, 4b4a, and 894G>T), analyzed individually and as haplotypes, and the parasympathetic adaptation induced by exercise training. Eighty healthy males, age 20-35 yr, were genotyped by polymerase chain reaction-restriction fragment length polymorphism analysis, and haplotypes were inferred using the software PHASE 2.1. Autonomic modulation (i.e., HR variability and spontaneous baroreflex sensitivity) and peak oxygen consumption (VO(2peak)) were measured before and after training (running, moderate to severe intensity, three times per week, 60 min·day(-1), during 18 wk). Training increased VO(2peak) (P baroreflex sensitivity after training (change: wild type (-786TT) = 2% ± 89% vs polymorphic (-786TC/CC) = -28% ± 60%, median ± quartile range, P = 0.03), and parasympathetic modulation was marginally reduced in subjects with the 894T polymorphic allele (change: wild type (894GG) = 8% ± 67% vs polymorphic (894GT/TT) = -18% ± 59%, median ± quartile range, P = 0.06). Furthermore, parasympathetic modulation percent change was different between the haplotypes containing wild-type alleles (-786T/4b/894G) and polymorphic alleles at positions -786 and 894 (-786C/4b/894T) (-6% ± 56% vs -41% ± 50%, median ± quartile range, P = 0.04). The polymorphic allele at position -786 and the haplotype containing polymorphic alleles at positions -786 and 894 in the endothelial nitric oxide gene were associated with decreased parasympathetic modulation after exercise training.

  20. Prion gene haplotypes of U.S. cattle

    Directory of Open Access Journals (Sweden)

    Harhay Gregory P

    2006-11-01

    Full Text Available Abstract Background Bovine spongiform encephalopathy (BSE is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD and haplotype networks within the bovine prion gene (PRNP is important for 1 testing rare or common PRNP variation for an association with BSE and 2 interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb. PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb. Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle.

  1. RESEARCH ARTICLE Analysis of polymorphisms and selective ...

    Indian Academy of Sciences (India)

    2017-01-27

    Jan 27, 2017 ... collected in Keningau, haplotypes K2, K9, K10, K11, K12, K13 and K14 were exclusively from Kudat while haplotypes K6 and K8 were found only from Kota Kinabalu. Haplotypes K4, K5 and K7 consisted of samples from all the three regions, indicating similar patterns of polymorphism from the different.

  2. CCR5 Haplotypes Influence HCV Serostatus in Caucasian Intravenous Drug Users

    Science.gov (United States)

    Huik, Kristi; Avi, Radko; Carrillo, Andrew; Harper, Nathan; Pauskar, Merit; Sadam, Maarja; Karki, Tõnis; Krispin, Tõnu; Kongo, Ulvi-Kaire; Jermilova, Tatiana; Rüütel, Kristi; Talu, Ave; Abel-Ollo, Katri; Uusküla, Anneli; Ahuja, Sunil K.; He, Weijing; Lutsar, Irja

    2013-01-01

    Background Up to 90% HIV-1 positive intravenous drug users (IDUs) are co-infected with HCV. Although best recognized for its function as a major co-receptor for cell entry of HIV, CC chemokine receptor 5 (CCR5) has also been implicated in the pathogenesis of HCV infection. Here, we investigated whether CCR5 haplotypes influence HIV-1 and HCV seropositivity among 373 Caucasian IDUs from Estonia. Methods Of these IDUs, 56% and 44% were HIV and HCV seropositive, respectively, and 47% were coinfected. 500 blood donors seronegative for HIV and HCV were also evaluated. CCR5 haplotypes (HHA to HHG*2) were derived after genotyping nine CCR2–CCR5 polymorphisms. The association between CCR5 haplotypes with HIV and/or HCV seropositivity was determined using logistic regression analysis. Co-variates included in the models were length of intravenous drug use, HBV serostatus and copy number of CCL3L1, the gene encoding the most potent HIV-suppressive chemokine and ligand for CCR5. Results Compared to IDUs seronegative for both HCV and HIV (HCV−/HIV-), IDUs who were HCV+/HIV- and HCV+/HIV+were 92% and 82%, respectively, less likely to possess the CCR5-HHG*1 haplotype, after controlling for co-variates (Padjusted = 1.89×10−4 and 0.003, respectively). This association was mostly due to subjects bearing the CCR5 HHE and HHG*1 haplotype pairs. Approximately 25% andHIV- IDUs and HCV−/HIV- blood donors, respectively, possessed the HHE/HHG*1 genotype. Conclusions Our findings suggest that HHG*1-bearing CCR5 genotypes influence HCV seropositivity in a group of Caucasian IDUs. PMID:23936229

  3. HLA-G 3' UTR haplotypes and HIV vertical transmission.

    Science.gov (United States)

    Segat, Ludovica; Catamo, Eulalia; Fabris, Annalisa; Padovan, Lara; Morgutti, Marcello; Crovella, Sergio

    2009-09-10

    We evaluated the possible association of human leukocyte antigen-G (HLA-G) 3777G>C and 14-bp deletion/insertion (D/I) polymorphisms haplotypes and combined genotypes with perinatal HIV transmission in Brazilian children. The 3777G>C polymorphism alone has no effect on HIV vertical transmission but, when linked with the D allele, exerts a positive role in the protection. Indeed, we identified the DC HLA-G haplotype as significantly associated with a protective effect towards HIV vertical transmission.

  4. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  5. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  6. Heme oxygenase-1 promoter polymorphisms and risk of spina bifida.

    Science.gov (United States)

    Fujioka, Kazumichi; Yang, Wei; Wallenstein, Matthew B; Zhao, Hui; Wong, Ronald J; Stevenson, David K; Shaw, Gary M

    2015-09-01

    Spina bifida is the most common form of neural tube defects (NTDs). Etiologies of NTDs are multifactorial, and oxidative stress is believed to play a key role in NTD development. Heme oxygenase (HO), the rate-limiting enzyme in heme degradation, has multiple protective properties including mediating antioxidant processes, making it an ideal candidate for study. The inducible HO isoform (HO-1) has two functional genetic polymorphisms: (GT)n dinucleotide repeats and A(-413)T SNP (rs2071746), both of which can affect its promoter activity. However, no study has investigated a possible association between HO-1 genetic polymorphisms and risk of NTDs. This case-control study included 152 spina bifida cases (all myelomeningoceles) and 148 non-malformed controls obtained from the California Birth Defects Monitoring Program reflecting births during 1990 to 1999. Genetic polymorphisms were determined by polymerase chain reaction and amplified fragment length polymorphisms/restriction fragment length polymorphisms using genomic DNA extracted from archived newborn blood spots. Genotype and haplotype frequencies of two HO-1 promoter polymorphisms between cases and controls were compared. For (GT)n dinucleotide repeat lengths and the A(-413)T SNP, no significant differences in allele frequencies or genotypes were found. Linkage disequilibrium was observed between the HO-1 polymorphisms (D': 0.833); however, haplotype analyses did not show increased risk of spina bifida overall or by race/ethnicity. Although, an association was not found between HO-1 polymorphisms and risk of spina bifida, we speculate that the combined effect of low HO-1 expression and exposures to known environmental oxidative stressors (low folate status or diabetes), may overwhelm antioxidant defenses and increase risk of NTDs and warrants further study. © 2015 Wiley Periodicals, Inc.

  7. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Chuen Yang Chua

    2017-09-05

    . Analysis of DNA sequence revealed that most of the nucleotide polymorphisms were synonymous and concentrated in domain I of PkAMA-1. Forteen haplotypes were identified based on amino acid variations and haplotype ...

  8. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  10. Polymorphism of the Flap Endonuclease 1 Gene in Keratoconus and Fuchs Endothelial Corneal Dystrophy

    Directory of Open Access Journals (Sweden)

    Katarzyna A. Wojcik

    2014-08-01

    Full Text Available Oxidative stress is implicated in the pathogenesis of many diseases, including serious ocular diseases, keratoconus (KC and Fuchs endothelial corneal dystrophy (FECD. Flap endonuclease 1 (FEN1 plays an important role in the repair of oxidative DNA damage in the base excision repair pathway. We determined the association between two single nucleotide polymorphisms (SNPs, c.–441G>A (rs174538 and g.61564299G>T (rs4246215, in the FEN1 gene and the occurrence of KC and FECD. This study involved 279 patients with KC, 225 patients with FECD and 322 control individuals. Polymerase chain reaction (PCR and length polymorphism restriction fragment analysis (RFLP were applied. The T/T genotype of the g.61564299G>T polymorphism was associated with an increased occurrence of KC and FECD. There was no association between the c.–441G>A polymorphism and either disease. However, the GG haplotype of both polymorphisms was observed more frequently and the GT haplotype less frequently in the KC group than the control. The AG haplotype was associated with increased FECD occurrence. Our findings suggest that the g.61564299G>T and c.–441G>A polymorphisms in the FEN1 gene may modulate the risk of keratoconus and Fuchs endothelial corneal dystrophy.

  11. Annexin A5 Promoter Haplotype M2 Is Not a Risk Factor for Recurrent Pregnancy Loss in Northern Europe

    DEFF Research Database (Denmark)

    Nagirnaja, Liina; Nõmmemees, Diana; Rull, Kristiina

    2015-01-01

    and recurrent pregnancy loss (RPL), however with inconclusive results. STUDY SUBJECTS AND METHODS: A retrospective case-control study combining resequencing and restriction fragment length polymorphism (RFLP) analysis was undertaken in 313 women with unexplained RPL and 214 fertile women from Estonia...... compared to controls both in Estonia (8.1% vs 15.2%, respectively) and Denmark (9.7% vs 12.6%). The high M2 prevalence in fertile controls was consistent with estimations for European and East Asian populations (9.6%-16.0%). CONCLUSIONS: This study cautions to consider the M2 haplotype as a deterministic...

  12. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism...... analysis. The method was used to compare ORF 1 sequences of two divergent European-type PRRSV strains. Our results indicated that the structural and replicase parts of these two strains had evolved at overall similar rates....

  13. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  14. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  15. Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

    Science.gov (United States)

    Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

    2017-08-01

    Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

  16. Telomere length is associated with ACE I/D polymorphism in hypertensive patients with left ventricular hypertrophy

    DEFF Research Database (Denmark)

    Fyhrquist, Frej; Eriksson, Anders; Saijonmaa, Outi

    2013-01-01

    and association of telomere length with cardiovascular risk is affected by ACE (I/D) genotype. METHODS: We measured leucocyte telomere length (LTL) by Southern blot and analysed ACE I/D genotypes in 1249 subjects with hypertension and left ventricular hypertrophy (LVH). We examined interactions of ACE I...

  17. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    Directory of Open Access Journals (Sweden)

    Tyson Jess

    2012-12-01

    Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  18. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  19. Common SNP-Based Haplotype Analysis of the 4p16.3 Huntington Disease Gene Region

    Science.gov (United States)

    Lee, Jong-Min; Gillis, Tammy; Mysore, Jayalakshmi Srinidhi; Ramos, Eliana Marisa; Myers, Richard H.; Hayden, Michael R.; Morrison, Patrick J.; Nance, Martha; Ross, Christopher A.; Margolis, Russell L.; Squitieri, Ferdinando; Griguoli, Annamaria; Di Donato, Stefano; Gomez-Tortosa, Estrella; Ayuso, Carmen; Suchowersky, Oksana; Trent, Ronald J.; McCusker, Elizabeth; Novelletto, Andrea; Frontali, Marina; Jones, Randi; Ashizawa, Tetsuo; Frank, Samuel; Saint-Hilaire, Marie-Helene; Hersch, Steven M.; Rosas, Herminia D.; Lucente, Diane; Harrison, Madaline B.; Zanko, Andrea; Abramson, Ruth K.; Marder, Karen; Sequeiros, Jorge; MacDonald, Marcy E.; Gusella, James F.

    2012-01-01

    Age at the onset of motor symptoms in Huntington disease (HD) is determined largely by the length of a CAG repeat expansion in HTT but is also influenced by other genetic factors. We tested whether common genetic variation near the mutation site is associated with differences in the distribution of expanded CAG alleles or age at the onset of motor symptoms. To define disease-associated single-nucleotide polymorphisms (SNPs), we compared 4p16.3 SNPs in HD subjects with population controls in a case:control strategy, which revealed that the strongest signals occurred at a great distance from the HD mutation as a result of “synthetic association” with SNP alleles that are of low frequency in population controls. Detailed analysis delineated a prominent ancestral haplotype that accounted for ∼50% of HD chromosomes and extended to at least 938 kb on about half of these. Together, the seven most abundant haplotypes accounted for ∼83% of HD chromosomes. Neither the extended shared haplotype nor the individual local HTT haplotypes were associated with altered CAG-repeat length distribution or residual age at the onset of motor symptoms, arguing against modification of these disease features by common cis-regulatory elements. Similarly, the 11 most frequent control haplotypes showed no trans-modifier effect on age at the onset of motor symptoms. Our results argue against common local regulatory variation as a factor influencing HD pathogenesis, suggesting that genetic modifiers be sought elsewhere in the genome. They also indicate that genome-wide association analysis with a small number of cases can be effective for regional localization of genetic defects, even when a founder effect accounts for only a fraction of the disorder. PMID:22387017

  20. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  1. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    Science.gov (United States)

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by

  2. Common ataxia telangiectasia mutated haplotypes and risk of breast cancer: a nested case–control study

    International Nuclear Information System (INIS)

    Tamimi, Rulla M; Hankinson, Susan E; Spiegelman, Donna; Kraft, Peter; Colditz, Graham A; Hunter, David J

    2004-01-01

    The ataxia telangiectasia mutated (ATM) gene is a tumor suppressor gene with functions in cell cycle arrest, apoptosis, and repair of DNA double-strand breaks. Based on family studies, women heterozygous for mutations in the ATM gene are reported to have a fourfold to fivefold increased risk of breast cancer compared with noncarriers of the mutations, although not all studies have confirmed this association. Haplotype analysis has been suggested as an efficient method for investigating the role of common variation in the ATM gene and breast cancer. Five biallelic haplotype tagging single nucleotide polymorphisms are estimated to capture 99% of the haplotype diversity in Caucasian populations. We conducted a nested case–control study of breast cancer within the Nurses' Health Study cohort to address the role of common ATM haplotypes and breast cancer. Cases and controls were genotyped for five haplotype tagging single nucleotide polymorphisms. Haplotypes were predicted for 1309 cases and 1761 controls for which genotype information was available. Six unique haplotypes were predicted in this study, five of which occur at a frequency of 5% or greater. The overall distribution of haplotypes was not significantly different between cases and controls (χ 2 = 3.43, five degrees of freedom, P = 0.63). There was no evidence that common haplotypes of ATM are associated with breast cancer risk. Extensive single nucleotide polymorphism detection using the entire genomic sequence of ATM will be necessary to rule out less common variation in ATM and sporadic breast cancer risk

  3. A Unique Primer with an Inosine Chain at the 5'-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method.

    Directory of Open Access Journals (Sweden)

    Hideki Shojo

    Full Text Available Polymerase chain reaction-amplified product length polymorphism (PCR-APLP is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3'-terminus of each primer. To use this method at least two allele-specific primers and one "counter-primer", which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3'-terminus, and another primer should have a few non-complementary flaps at the 5'-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5'-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method.

  4. The association between methylenetetrahydrofolate reductase polymorphism and promoter methylation in proximal colon cancer.

    Science.gov (United States)

    Oyama, Kaeko; Kawakami, Kazuyuki; Maeda, Kazuya; Ishiguro, Kaname; Watanabe, Go

    2004-01-01

    Methylenetetrahydrofolate reductase (MTHFR) plays a critical role in folate metabolism, which is an important pathway of the methyl donor for DNA methylation. The MTHFR gene has genetic variants (C667T and A1298C), which cause reduced enzyme activity. Impaired folate metabolism by these genetic variants of MTHFR could change the methylation pattern of DNA including promoter hypermethylation, which has been frequently observed in cancer. In this study, we compared the MTHFR genotypes and haplotype to the features of colorectal cancer focusing on the promoter methylation of tumor DNA. Genomic DNA was isolated from 194 colorectal cancer tissues and subjected to MTHFR genotyping by PCR-based restriction fragment length polymorphism analysis. The MTHFR haplotype was determined by combination of C667T and A1298C genotype and classified into 2 groups, high (H-haplotype) or low (L-haplotype) enzymatic activity of MTHFR. The methylation level of tumor suppressor genes (CDKN2A, hMLH1, ARF and TIMP3) was measured by a fluorescence-based, real-time methylation specific PCR method. There was no significant association of the clinicopathological features with either C667T genotype, A1298C genotype or haplotype of MTHFR. The methylation level of CDKN2A was higher in cancer with the L-haplotype of MTHFR than in that with the H-haplotype when cancers of proximal origin were considered (p=0.029). hMLH1 methylation also tended to be higher in proximal colon cancers of MTHFR L-haplotype (p=0.059). In addition, the proximal colon cancers showing CpG island methylator phenotype (CIMP) were significantly more frequent in L-haplotype than in H-haplotype. These results suggest that the haplotype with low enzymatic activity of MTHFR is linked with promoter hypermethylation and consequently modifies the risk of CIMP(+) proximal colon cancer development in the Japanese people. The relationship between MTHFR polymorphism and DNA methylation in the Japanese is contrary to the previous results

  5. Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

    Science.gov (United States)

    Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

    2016-01-01

    We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

  6. Association of LRP5 haplotypes with osteoporosis in Mexican women.

    Science.gov (United States)

    Falcón-Ramírez, Edith; Casas-Avila, Leonora; Cerda-Flores, Ricardo M; Castro-Hernández, Clementina; Rubio-Lightbourn, Julieta; Velázquez-Cruz, Rafael; Diez-G, Pilar; Peñaloza-Espinosa, Rosenda; Valdés-Flores, Margarita

    2013-03-01

    Osteoporosis is a common health problem in Mexico, so it is essential to investigate the status of different gene polymorphisms that could serve as genetic susceptibility markers in the Mexican population. Genes with a role in bone metabolism are excellent candidates for association studies. In this study were determined the allelic and genotypic frequencies of four polymorphic markers (C/T rs3736228, G/A rs4988321, T/C rs627174 and T/C rs901824) in the low-density lipoprotein receptor-related protein 5 gene (LRP5) and their association with osteoporosis in 100 pos-menopausal osteoporotic Mexican women and their controls, using real time-PCR and TaqMan probes. Only the G/A polymorphism (rs4988321, Val667Met) showed significant differences (p = 0.039) when genotype frequencies were compared. However, when the haplotypes of these four polymorphisms were analyzed, interesting associations became evident. The CGTT haplotype showed significant association with low risk of osteoporosis (OR 0.629; p = 0.007; [95 % CI, 0.448-0.884]), whereas the TACT haplotype was significantly associated with a higher risk of osteoporosis (OR 7.965; p = 0.006; [95 % CI, 1.557-54.775]). Our results supported the association of LRP5 with osteoporosis and showed the potential value of LRP5 haplotypes to identify risk of osteoporosis in Mexican population.

  7. Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

    Science.gov (United States)

    Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

    2018-05-01

    Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

  8. Fitchi: haplotype genealogy graphs based on the Fitch algorithm.

    Science.gov (United States)

    Matschiner, Michael

    2016-04-15

    : In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. RET variants and haplotype analysis in a cohort of Czech patients with Hirschsprung disease.

    Directory of Open Access Journals (Sweden)

    Eliska Vaclavikova

    Full Text Available Hirschsprung disease (HSCR is a congenital aganglionosis of myenteric and submucosal plexuses in variable length of the intestine. This study investigated the influence and a possible modifying function of RET proto-oncogene's single nucleotide polymorphisms (SNPs and haplotypes in the development and phenotype of the disease in Czech patients. Genotyping of 14 SNPs was performed using TaqMan Genotyping Assays and direct sequencing. The frequencies of SNPs and generated haplotypes were statistically evaluated using chi-square test and the association with the risk of HSCR was estimated by odds ratio. SNP analysis revealed significant differences in frequencies of 11 polymorphic RET variants between 162 HSCR patients and 205 unaffected controls. Particularly variant alleles of rs1864410, rs2435357, rs2506004 (intron 1, rs1800858 (exon 2, rs1800861 (exon 13, and rs2565200 (intron 19 were strongly associated with increased risk of HSCR (p<0.00000 and were over-represented in males vs. females. Conversely, variant alleles of rs1800860, rs1799939 and rs1800863 (exons 7, 11, 15 had a protective role. The haploblock comprising variants in intron 1 and exon 2 was constructed. It represented a high risk of HSCR, however, the influence of other variants was also found after pruning from effect of this haploblock. Clustering patients according to genotype status in haploblock revealed a strong co-segregation with several SNPs and pointed out the differences between long and short form of HSCR. This study involved a large number of SNPs along the entire RET proto-oncogene with demonstration of their risk/protective role also in haplotype and diplotype analysis in the Czech population. The influence of some variant alleles on the aggressiveness of the disease and their role in gender manifestation differences was found. These data contribute to worldwide knowledge of the genetics of HSCR.

  10. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  11. Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus

    Energy Technology Data Exchange (ETDEWEB)

    Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States))

    1992-12-01

    Analysis of mutant PAH chromosomes has identified approximately 60 different single-base substitutions and deletions within the PAH locus. Nearly all of these molecular lesions are in strong linkage disequilibrium with specific RFLP haplotypes in different ethnic populations. Thus, haplotype analysis is not only useful for diagnostic purposes but is proving to be a valuable tool in population genetic studies of the origin and spread of phenylketonuria alleles in human populations. PCR-based methods have been developed to detect six of the eight polymorphic restriction sites used for determination of RFLP haplotypes at the PAH locus. A table of the proposed expanded haplotypes is given.

  12. Copy number variants and VNTR length polymorphisms of the carboxyl-ester lipase (CEL) gene as risk factors in pancreatic cancer.

    Science.gov (United States)

    Dalva, Monica; El Jellas, Khadija; Steine, Solrun J; Johansson, Bente B; Ringdal, Monika; Torsvik, Janniche; Immervoll, Heike; Hoem, Dag; Laemmerhirt, Felix; Simon, Peter; Lerch, Markus M; Johansson, Stefan; Njølstad, Pål R; Weiss, Frank U; Fjeld, Karianne; Molven, Anders

    We have recently described copy number variants (CNVs) of the human carboxyl-ester lipase (CEL) gene, including a recombined deletion allele (CEL-HYB) that is a genetic risk factor for chronic pancreatitis. Associations with pancreatic disease have also been reported for the variable number of tandem repeat (VNTR) region located in CEL exon 11. Here, we examined if CEL CNVs and VNTR length polymorphisms affect the risk for developing pancreatic cancer. CEL CNVs and VNTR were genotyped in a German family with non-alcoholic chronic pancreatitis and pancreatic cancer, in 265 German and 197 Norwegian patients diagnosed with pancreatic adenocarcinoma, and in 882 controls. CNV screening was performed using PCR assays followed by agarose gel electrophoresis whereas VNTR lengths were determined by DNA fragment analysis. The investigated family was CEL-HYB-positive. However, an association of CEL-HYB or a duplication CEL allele with pancreatic cancer was not seen in our two patient cohorts. The frequency of the 23-repeat VNTR allele was borderline significant in Norwegian cases compared to controls (1.2% vs. 0.3%; P = 0.05). For all other VNTR lengths, no statistically significant difference in frequency was observed. Moreover, no association with pancreatic cancer was detected when CEL VNTR lengths were pooled into groups of short, normal or long alleles. We could not demonstrate an association between CEL CNVs and pancreatic cancer. An association is also unlikely for CEL VNTR lengths, although analyses in larger materials are necessary to completely exclude an effect of rare VNTR alleles. Copyright © 2016 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  13. Phenotypic and genetic effects of recessive haplotypes on yield, longevity, and fertility.

    Science.gov (United States)

    Cole, J B; Null, D J; VanRaden, P M

    2016-09-01

    Phenotypes from the August 2015 US national genetic evaluation were used to compute phenotypic effects of 18 recessive haplotypes in Ayrshire (n=1), Brown Swiss (n=5), Holstein (n=10), and Jersey (n=2) cattle on milk, fat, and protein yields, somatic cell score (SCS), single-trait productive life (PL), daughter pregnancy rate (DPR), heifer conception rate (HCR), and cow conception rate (CCR). The haplotypes evaluated were Ayrshire haplotype 1, Brown Swiss haplotypes 1 and 2, spinal dysmyelination, spinal muscular atrophy, Weaver Syndrome, brachyspina, Holstein cholesterol deficiency, Holstein haplotypes 1 to 5, bovine leukocyte adhesion deficiency, complex vertebral malformation, mulefoot (syndactyly), and Jersey haplotypes 1 and 2. When causal variants are unknown and tests are based only on single nucleotide polymorphism haplotypes, it can sometimes be difficult to accurately determine carrier status. For example, 2 Holstein haplotypes for cholesterol deficiency have the same single nucleotide polymorphism genotype, but only one of them carries the causative mutation. Genotyped daughters of carrier bulls included in the analysis ranged from 8 for Weaver Syndrome to 17,869 for Holstein haplotype 3. Lactation records preadjusted for nongenetic factors and direct genomic values (DGV) were used to estimate phenotypic and genetic effects of recessive haplotypes, respectively. We found no phenotypic or genetic differences between carriers and noncarriers of Ayrshire or Brown Swiss defects. Several associations were noted for Holstein haplotypes, including fat and HCR for Holstein haplotype 0 carriers; milk, protein, SCS, PL, and fertility for Holstein haplotype 1; protein, PL, CCR, and HCR for Holstein haplotype 2; milk, protein, and fertility for Holstein haplotype 4; and protein yield and DPR for Holstein haplotype 5. There were no differences among bovine leukocyte adhesion deficiency carriers, but complex vertebral malformation affected fat yield and mulefoot

  14. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Directory of Open Access Journals (Sweden)

    Mohammad Asadzadeh

    Full Text Available Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp, C. orthopsilosis (109 bp, C. metapsilosis (217 bp and L. elongisporus (258 bp were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380 by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study was performed by amplified fragment length polymorphism (AFLP analysis. Phenotypically identified C. parapsilosis isolates (n = 380 were identified as C. parapsilosis sensu stricto (n = 361, C. orthopsilosis (n = 15, C. metapsilosis (n = 1 and L. elongisporus (n = 3 by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1 comprising 11 isolates recovered from 10

  15. HLA-G regulatory haplotypes and implantation outcome in couples who underwent assisted reproduction treatment.

    Science.gov (United States)

    Costa, Cynthia Hernandes; Gelmini, Georgia Fernanda; Wowk, Pryscilla Fanini; Mattar, Sibelle Botogosque; Vargas, Rafael Gustavo; Roxo, Valéria Maria Munhoz Sperandio; Schuffner, Alessandro; Bicalho, Maria da Graça

    2012-09-01

    The role of HLA-G in several clinical conditions related to reproduction has been investigated. Important polymorphisms have been found within the 5'URR and 3'UTR regions of the HLA-G promoter. The aim of the present study was to investigate 16 SNPs in the 5'URR and 14-bp insertion/deletion (ins/del) polymorphism located in the 3'UTR region of the HLA-G gene and its possible association with the implantation outcome in couples who underwent assisted reproduction treatments (ART). The case group was composed of 25 ART couples. Ninety-four couples with two or more term pregnancies composed the control group. Polymorphism haplotype frequencies of the HLA-G were determined for both groups. The Haplotype 5, Haplotype 8 and Haplotype 11 were absolute absence in ART couples. The HLA-G*01:01:02a, HLA-G*01:01:02b alleles and the 14-bp ins polymorphism, Haplotype 2, showed an increased frequency in case women and similar distribution between case and control men. However, this susceptibility haplotype is significantly presented in case women and in couple with failure implantation after treatment, which led us to suggest a maternal effect, associated with this haplotype, once their presence in women is related to a higher number of couples who underwent ART. Copyright © 2012. Published by Elsevier Inc.

  16. Female-only sex-linked amplified fragment length polymorphism markers support ZW/ZZ sex determination in the giant freshwater prawn Macrobrachium rosenbergii.

    Science.gov (United States)

    Jiang, Xue-Hui; Qiu, Gao-Feng

    2013-12-01

    Sex determination mechanisms in many crustacean species are complex and poorly documented. In the giant freshwater prawn, Macrobrachium rosenbergii, a ZW/ZZ sex determination system was previously proposed based on sex ratio data obtained by crosses of sex-reversed females (neomales). To provide molecular evidence for the proposed system, novel sex-linked molecular markers were isolated in this species. Amplified fragment length polymorphism (AFLP) using 64 primer combinations was employed to screen prawn genomes for DNA markers linked with sex loci. Approximately 8400 legible fragments were produced, 13 of which were uniquely identified in female prawns with no indication of corresponding male-specific markers. These AFLP fragments were reamplified, cloned and sequenced, producing two reliable female-specific sequence characterized amplified region (SCAR) markers. Additional individuals from two unrelated geographic populations were used to verify these findings, confirming female-specific amplification of single bands. Detection of internal polymorphic sites was conducted by designing new primer pairs based on these internal fragments. The internal SCAR fragments also displayed specificity in females, indicating high levels of variation between female and male specimens. The distinctive feature of female-linked SCAR markers can be applied for rapid detection of prawn gender. These sex-specific SCAR markers and sex-associated AFLP candidates unique to female specimens support a sex determination system consistent with female heterogamety (ZW) and male homogamety (ZZ). © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  17. Does the Polymorphism in the Length of the Polyalanine Tract of FOXE1 Gene Influence the Risk of Thyroid Dysgenesis Occurrence?

    Directory of Open Access Journals (Sweden)

    Clebson Pantoja Pimentel

    2017-01-01

    Full Text Available Background. Recent data have suggested that polymorphisms in the length of the polyalanine tract (polyA of FOXE1 gene may act as a susceptibility factor for thyroid dysgenesis. The main purpose of this study was to investigate the influence of polyA of FOXE1 gene on the risk of thyroid dysgenesis. Method. A case-control study was conducted in a sample of 90 Brazilian patients with thyroid dysgenesis and 131 controls without family history of thyroid disease. Genomic DNA was isolated from peripheral blood samples and the genotype of each individual was determined by automated sequencing. Results. More than 90% of genotypes found in the group of patients with thyroid dysgenesis and in controls subjects were represented by sizes 14 and 16 polymorphisms in the following combinations: 14/14, 14/16, and 16/16. Genotypes 14/16 and 16/16 were more frequent in the control group, while genotype 14/14 was more frequent in the group of patients with thyroid dysgenesis. There was no difference between agenesis group and control group. Genotype 14/14 when compared to genotypes 14/16 and 16/16A showed an association with thyroid dysgenesis. Conclusion. PolyA of FOXE1 gene alters the risk of thyroid dysgenesis, which may explain in part the etiology of this disease.

  18. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  19. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  20. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  1. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  2. Genetic Characterization of Campylobacter Jejuni and C. coli Isolated From Broilers Using flaA PCR-Restriction Fragment Length Polymorphism Method in Shiraz, Southern Iran.

    Science.gov (United States)

    Khoshbakht, Rahem; Tabatabaei, Mohammad; Hosseinzadeh, Saeid; Shirzad Aski, Hesamaddin; Seifi, Saeed

    2015-05-01

    Thermophilic campylobacters, particularly Campylobacter jejuni and C. coli are the main agents of human campylobacteriosis. Campylobacter contaminated chicken products is the most important source of foodborne gastroenteritis. Evaluation of genetic diversity among Campylobacter population is critical for understanding the epidemiology of this bacterium and developing effective control strategies against Campylobacter infections and other related disorders. The aim of this study was to investigate the polymorphism of thermophilic Campylobacter isolated from broiler fecal samples in Shiraz, southern Iran. Ninety Campylobacter isolates were recovered from broiler feces using enrichment process followed by cultivation method. The isolates were species typing on the basis of polymerase chain reaction (PCR) detection of 16SrRNA and multiplex PCR for determining two thermophilic species. To evaluate strain diversity of thermophilic Campylobacter isolates, flaA PCR-Restriction Fragment Length Polymorphism (RFLP) was performed using DdeI restriction enzyme. All 90 Campylobacter isolates confirmed by m-PCR were successfully typed using flaA-PCR-RFLP. Eleven different types were defined according to flaA-typing method and the RFLP patterns were located at three separate clusters in RFLP image analysis dendrogram. Campylobacter jejuni isolates significantly showed more variety than C. coli isolates. A relatively low genetic diversity existed among C. jejuni and C. coli isolated from broilers in Shiraz, southern Iran. In our knowledge, this was the first report of genetic diversity among broiler originated human pathogen thermophilic campylobacters in Shiraz, southern Iran.

  3. Development of a polymerase chain reaction/restriction fragment length polymorphism method for Saccharomyces cerevisiae and Saccharomyces bayanus identification in enology.

    Science.gov (United States)

    Masneuf, I; Aigle, M; Dubourdieu, D

    1996-05-01

    Several yeast strains of the species Saccharomyces cerevisiae, S. bayanus and S. paradoxus, first identified by hybridization experiments and measurements of DNA/DNA homology, were characterized using polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis of the MET2 gene. There was no exception to the agreement between this method and classical genetic analyses for any of the strains examined, so PCR/RFLP of the MET2 gene is a reliable and fast technique for delimiting S. cerevisiae and S. bayanus. Enological strains classified as S. bayanus, S. chevalieri, and S. capensis gave S. cerevisiae restriction patterns, whereas most S. uvarum strains belong to S. bayanus. Enologists should no longer use the name of S. bayanus for S. cerevisiae Gal strains, and should consider S. bayanus as a distinct species.

  4. Encapsulation dehydration colligative cryoprotective strategies and amplified fragment length polymorphism markers to verify the identity and genetic stability of euglenoids following cryopreservation.

    Science.gov (United States)

    Harding, Keith; Miller, Julia; Timmermann, Hella; Lorenz, Maike; Day, John G; Friedl, Thomas

    2010-01-01

    An encapsulation/dehydration procedure was developed for Euglena gracilis Klebs as a 'model alga' to examine various cryoprotective regimes combined with controlled rate cooling to cryopreserve other Euglenoid taxa. Cryoprotective variables were optimised to enable reproducible growth following a combination of alginate encapsulation, sucrose osmotic dehydration, air desiccation, methanol treatment, cooling to -40 degrees C and plunging into liquid nitrogen (LN). Amplified Fragment Length Polymorphism (AFLP) analysis was adapted to: (i) verify algal identity by discriminating between different Euglenoids and (ii) examine the genetic stability of algal cultures prior to various stages of cryoprotective treatments and following exposure to LN. AFLPs were highly reproducible (> 99%) as reliable diagnostic markers, where a single DNA fragment change accounted for -0.4% of the detectable variation in an AFLP pattern. AFLP changes were detected in cryoprotective treatments following LN exposure. Successive stages of the dehydration and desiccation treatments did not accumulate AFLP changes indicating these are random events.

  5. Genetic Typing of Bovine Viral Diarrhoea Virus (BVDV by Restriction Fragment Length Polymorphism (RFLP and Identification of a New Subtype in Poland

    Directory of Open Access Journals (Sweden)

    Kuta Aleksandra

    2015-04-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis was developed for genetic typing of Polish strains of bovine viral diarrhoea virus (BVDV. The method was applied using 60 BVDV isolates, which included BVDV genotype 1, subtypes a, b, d, e, f, and g, and genotype 2a. RT-PCR products of the 5’untranslated region (5’UTR were digested using three enzymes. Restriction patterns classified the strains into seven groups, each with a specific and different pattern from other subtypes. These findings were confirmed by nucleotide sequencing and phylogenetic analysis. The results suggest that RFLP analysis is a simple, reliable, and fast genotyping method for BVDV strains in comparison with sequencing. This method can distinguish six subtypes of BVDV-1 including a new subtype 1e, identified exclusively by this method, and it allows differentiation of BVDV-1 from BVDV-2 genotype.

  6. Genetic relatedness among Campylobacter jejuni serotyped isolates of diverse origin as determined by numerical analysis of amplified fragment length polymorphism (AFLP) profiles

    DEFF Research Database (Denmark)

    Siemer, B.L.; Harrington, C.S.; Nielsen, E.M.

    2004-01-01

    health. The remaining 30 groups contained isolates from humans, chickens and associated food products, cattle, sheep, turkeys, ostriches and/or dogs. Strains assigned to serotypes 2, 6/7, 11 and 12 formed major clusters at the 77.6% S-level. Most other serotypes did not form homogeneous clusters......Aims: To use amplified fragment length polymorphism (AFLP) analysis to evaluate the genetic relatedness among 254 Campylobacter jejuni reference and field strains of diverse origin representing all defined 'Penner' serotypes for this species. Methods and Results: Field strains (n = 207) from human...... diarrhoea and diverse animal and environmental sources were collected mainly through a National surveillance programme in Denmark and serotyped by use of the established 'Penner' scheme. Genetic relationships among these isolates, and the archetypal serotype reference strains, were assessed by numerical...

  7. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  8. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  9. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A...

  10. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A......Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...

  11. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  12. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    Directory of Open Access Journals (Sweden)

    Camille Ribeyre

    2018-02-01

    Full Text Available Human leukocyte antigen (HLA-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC. Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing, thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a

  13. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    Science.gov (United States)

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  14. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees

    Science.gov (United States)

    Schöning, Caspar

    2017-01-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163

  15. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees.

    Science.gov (United States)

    Wallberg, Andreas; Schöning, Caspar; Webster, Matthew T; Hasselmann, Martin

    2017-05-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies.

  16. Haplotype allelic classes for detecting ongoing positive selection

    Directory of Open Access Journals (Sweden)

    Lefebvre Jean-François

    2010-01-01

    Full Text Available Abstract Background Natural selection eliminates detrimental and favors advantageous phenotypes. This process leaves characteristic signatures in underlying genomic segments that can be recognized through deviations in allelic or haplotypic frequency spectra. To provide an identifiable signature of recent positive selection that can be detected by comparison with the background distribution, we introduced a new way of looking at genomic polymorphisms: haplotype allelic classes. Results The model combines segregating sites and haplotypic information in order to reveal useful data characteristics. We developed a summary statistic, Svd, to compare the distribution of the haplotypes carrying the selected allele with the distribution of the remaining ones. Coalescence simulations are used to study the distributions under standard population models assuming neutrality, demographic scenarios and selection models. To test, in practice, haplotype allelic class performance and the derived statistic in capturing deviation from neutrality due to positive selection, we analyzed haplotypic variation in detail in the locus of lactase persistence in the three HapMap Phase II populations. Conclusions We showed that the Svd statistic is less sensitive than other tests to confounding factors such as demography or recombination. Our approach succeeds in identifying candidate loci, such as the lactase-persistence locus, as targets of strong positive selection and provides a new tool complementary to other tests to study natural selection in genomic data.

  17. [[Length polymorphism of minisatellite repeat B2-VNTR of the bradykinin B2 receptor gene in healthy Russians and in patients with coronary heart disease].

    Science.gov (United States)

    Suchkova, I O; Pavlinova, L I; Larionova, E E; Alenina, N V; Solov'ev, K V; Baranova, T V; Belotserkovskaia, E V; Sasina, L K; Bader, M; Denisenko, A D; Mustafina, O E; Khusnutdinova, E K; Patkin, E L

    2014-01-01

    Bradykinin B2 receptor is involved in many processes, including the regulation of blood pressure and smooth muscle contraction, vasodilation, inflammation, edema, cell proliferation, pain. It is suggested that this receptor may be one of the factors that have cardioprotective and infarct-limiting effects. It is assumed that certain genetic variants in both coding and non-coding regions ofBDKRB2 gene may influence its expression. In the 3'-untranslated region of BDKRB2 exon 3 the minisatellite repeat B2-VNTR is located. B2-VNTR has previously been shown to affect the BDKRB2 mRNA stability. Therefore, it is important to perform the molecular genetic analysis of this minisatellite in patients with different forms of coronary heart disease in order to reveal possible associations between specific B2-VNTR alleles and certain clinical forms of coronary heart disease. In the present study, a comparative analysis of the allele and genotype frequencies of B2-VNTR was carried out in groups of healthy individuals and patients with two clinical forms of coronary heart disease (angina pectoris and myocardial infarction), ethnically Russian. The results of the B2-VNTR length polymorphism analysis indicate that this tandem repeat may be attributed to a class of low polymorphic and non-hypervariable minisatellite. In all analyzed groups we revealed three B2-VNTR alleles, consisting of 43, 38 and 33 repeat units. Alleles of 43 and 33 repeats were major in all investigated groups. No statistically significant differences were found in the B2-VNTR allele and genotype frequencies between men and women in control group, and also between healthy men and men with angina pectoris and myocardial infarction. Thus, B2-VNTR length polymorphism was not associated with these clinical forms of coronary heart disease in Russian men. However, we do not exclude the possibility of association between the B2-VNTR short alleles (38 and 33 repeats) and cardioprotective effects of bradykinin B2 receptor

  18. GSTO1*C/GSTO2*G haplotype is associated with risk of transitional cell carcinoma of urinary bladder.

    Science.gov (United States)

    Djukic, Tatjana; Simic, Tatjana; Radic, Tanja; Matic, Marija; Pljesa-Ercegovac, Marija; Suvakov, Sonja; Coric, Vesna; Pekmezovic, Tatjana; Novakovic, Ivana; Dragicevic, Dejan; Savic-Radojevic, Ana

    2015-04-01

    To clarify the role of genetic polymorphisms of GSTO1 (rs4925) and GSTO2 (rs156697) in individual susceptibility to urinary bladder cancer. Case-control study consisting of 187 patients with histologically confirmed transitional cell carcinoma (TCC) of urinary bladder and 140 age- and gender-matched cancer-free controls was carried out. Genotyping of GSTO1 and GSTO2 was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). We found that carriers of mutant GSTO2*G/G genotype were at increased risk of the development of TCC (OR 2.6, 95% CI 1.2-5.8, p = 0.041), while GSTO1 rs4925 polymorphism was not significantly associated with TCC risk (p = 0.450). According to smoking status, smokers with GSTO2*G/G genotype had significantly higher risk of TCC of urinary bladder (OR 4.3, 95% CI 1.6-11.2, p = 0.003) compared to wild-type carriers with no smoking history. We further analyzed the effects of GSTO1/GSTO2 haplotypes on TCC risk, based on the linkage disequilibrium found for GSTO1 (rs4925) and GSTO2 (rs156697) (D' = 0.309, p = 0.001). The study subjects with GSTO1*C/GSTO2*G (GSTO1 wild-type/GSTO2 mutant) haplotype were at the highest risk of the development of transitional cell carcinoma of urinary bladder (OR 2.8, 95% CI 1.5-5.2, p = 0.002). Our results indicate that GSTO1*C/GSTO2*G haplotype is associated with increased risk of TCC. The modifying effect of GSTO2*G/G genotype on individual susceptibility to TCC is more pronounced, when associated with smoking.

  19. Influence of βS-globin haplotypes and hydroxyurea on tumor necrosis factor-alpha levels in sickle cell anemia.

    Science.gov (United States)

    Laurentino, Marília Rocha; Maia, Pedro Aurio; Barbosa, Maritza Cavalcante; Bandeira, Izabel Cristina Justino; Rocha, Lilianne Brito da Silva; Gonçalves, Romelia Pinheiro

    2014-03-01

    Sickle cell anemia is a chronic inflammatory disease characterized by an increased production of proinflammatory cytokines including tumor necrosis factor-alpha. Hydroxyurea, by decreasing the polymerization of hemoglobin, reduces inflammatory states. The effect of the genetic polymorphisms of sickle cell patients on tumor necrosis factor-alpha levels remains unknown. The aim of this study was to investigate the association of tumor necrosis factor-alpha levels with β-globin haplotypes and the use of hydroxyurea. A cross-sectional study was performed of 67 patients with sickle cell anemia diagnosed at steady-state in a referral hospital in Fortaleza, Ceará, Brazil. A group of 26 healthy individuals was used as control. βS-haplotype analysis was performed by restriction fragment length polymorphism-polymerase chain reaction. The tumor necrosis factor-alpha levels were measured by the enzyme-linked immunosorbent assay test. Laboratory data (complete blood count and fetal hemoglobin) and information regarding the use of hydroxyurea were obtained from medical records. Statistical analysis was performed using R software with the Kruskal-Wallis and Mann-Whitney tests. Statistical significance was established for p-values sickle cell anemia had significantly higher tumor necrosis factor-alpha levels than controls (p-values sickle cell anemia patients who were receiving hydroxyurea treatment than those who were not (p-value = 0.1249). Sickle cell anemia patients with Bantu/n genotype had significantly higher levels than patients with the Bantu/Benin genotype (p-value = 0.0021). In summary, βS-globin haplotypes, but not hydroxyurea therapy, have a role in modulating tumor necrosis factor-alpha levels in sickle cell anemia adults at steady-state. Many previous studies have investigated prognosis and inflammatory states in sickle cell anemia patients, but the discovery that tumor necrosis factor-alpha levels vary according to the genetic polymorphism of the patient is a

  20. A systematic search for SNPs/haplotypes associated with disease phenotypes using a haplotype-based stepwise procedure

    Directory of Open Access Journals (Sweden)

    Andriesen Jessica

    2008-12-01

    Full Text Available Abstract Background Genotyping technologies enable us to genotype multiple Single Nucleotide Polymorphisms (SNPs within selected genes/regions, providing data for haplotype association analysis. While haplotype-based association analysis is powerful for detecting untyped causal alleles in linkage-disequilibrium (LD with neighboring SNPs/haplotypes, the inclusion of extraneous SNPs could reduce its power by increasing the number of haplotypes with each additional SNP. Methods Here, we propose a haplotype-based stepwise procedure (HBSP to eliminate extraneous SNPs. To evaluate its properties, we applied HBSP to both simulated and real data, generated from a study of genetic associations of the bactericidal/permeability-increasing (BPI gene with pulmonary function in a cohort of patients following bone marrow transplantation. Results Under the null hypothesis, use of the HBSP gave results that retained the desired false positive error rates when multiple comparisons were considered. Under various alternative hypotheses, HBSP had adequate power to detect modest genetic associations in case-control studies with 500, 1,000 or 2,000 subjects. In the current application, HBSP led to the identification of two specific SNPs with a positive validation. Conclusion These results demonstrate that HBSP retains the essence of haplotype-based association analysis while improving analytic power by excluding extraneous SNPs. Minimizing the number of SNPs also enables simpler interpretation and more cost-effective applications.

  1. Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

    Science.gov (United States)

    Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

    2010-04-01

    To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

  2. β2-adrenergic receptor gene polymorphisms in normal and asthmatic individuals in the Eastern Province of Saudi Arabia.

    Science.gov (United States)

    Al-Rubaish, Abdullah

    2011-01-01

    Several polymorphisms of the β2-adrenergic receptor (β2-AR) gene have been identified, including the amino acid substitution from arginine (Arg) to glycine (Gly) at codon 16 and from glutamine (Gln) to glutamic acid (Glu) at codon 27. These substitutions affect receptor function and show significantly more agonist-promoted receptor down-regulation than cells expressing the Arg 16/Gln 27 variants. Although the ethnic dependency of this polymorphism has been described in other populations, no studies investigating its relationship to asthma have been conducted in the Saudi population . Therefore, our main objective was to determine the prevalence of these two mutations among patients with asthma in the Eastern Province and in matched healthy controls. A case-control study conducted at a university hospital among Saudi patients. Blood samples were collected from 73 asthmatic patients and from 85 controls, and the β2-AR gene polymorphisms at codon 16 and codon 27 were assessed by restriction fragment length polymorphism. Although a significant difference was observed in genotype frequencies at codon 16 (Arg/Gly) between the asthmatic and normal control subjects (P.68). Using the THESIAS statistical program, no significant association of any haplotype with asthma was found. Our findings indicate a poor association of individual single-nucleotide polymorphisms with asthma. However, further study is required to ascertain the interactions of different haplotypes and the response of patients with different haplotypes to various treatments.

  3. Grouping preprocess for haplotype inference from SNP and CNV data

    International Nuclear Information System (INIS)

    Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato; Kamatani, Naoyuki

    2009-01-01

    The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.

  4. Massively Parallel Haplotyping on Microscopic Beads for the High-Throughput Phase Analysis of Single Molecules

    Science.gov (United States)

    Tiemann-Boege, Irene

    2012-01-01

    In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1∶10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases. PMID:22558329

  5. Analysis of genetic variability in endemic medicinal plants of genus Chlorophytum from the Indian subcontinent using amplified fragment length polymorphism marker.

    Science.gov (United States)

    Patil, Swapnil Mahadeo; Chandanshive, Vishal Vinayak; Tamboli, Asif Shabodin; Adsul, Avinash Asraji; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2015-12-01

    The genus Chlorophytum consists of medicinally important species like Chlorophytum borivilianum, C. tuberosum and C. attenuatum. Uncontrolled harvest of this plant from wild habitat due to its high commercial value made the species of this genus be listed in the Red Data Book of Indian plants as an endangered species. In India, approximately nineteen species of Chlorophytum are found; out of these, only C. borivilianum is cultivated commercially. The objective of this study was to measure genetic diversity, population structure and phylogenetic relationship among the species using Amplified Fragment Length Polymorphisms (AFLP). Fifteen pairs of primer (out of 64 primer pairs screened) were used to analyse the genetic diversity in eighteen species of genus Chlorophytum. Cluster analysis, estimation of the gene flow among the species and of the phylogeographic distribution of this genus were carried out using an AFLP data matrix. A high level of genetic diversity was observed on the basis of the percentage of polymorphic bands (99.91%), Shannon's information index (0.3592) and Nei's gene diversity (0.2085) at species level. Cluster analysis of UPGMA dendrogram, principal component analysis and Bayesian method analysis resolved these species in three different clusters, which was supported by morphological information. The Mantel test (r=0.4432) revealed a significant positive correlation between genetic and geographic distances. The collected data have an important implication in the identification, authentication, and conservation of the species of the genus Chlorophytum. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  6. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  7. Osteoprotegerin Gene (OPG) Polymorphisms Associated with Peri-implantitis Susceptibility in a Chinese Han Population.

    Science.gov (United States)

    Zhou, Jian; Zhao, Yimin

    2016-11-09

    BACKGROUND The aim of this study was to investigate the association between T950C (rs2073617) and G1181C (rs2073618) polymorphisms of the osteoprotegerin gene (OPG) and the susceptibility of peri-implantitis in the Chinese Han population.  MATERIAL AND METHODS 110 patients with peri-implantitis and 116 healthy persons from the Chinese Han population were included in this study using a case-control design; rs2073617 and rs2073618 in OPG were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The linkage disequilibrium (LD) and haplotype analysis were performed with Haploview software. Hardy-Weinberg equilibrium (HWE) was assessed in the control group based on the genotype distributions of OPG polymorphisms. The genotype, allele, and haplotype distribution differences between the case and control groups were analyzed by chi-square test, and the relative risk of PD was expressed by odds ratio (OR) and 95% confidence interval (CI).  RESULTS The study results showed that people carrying the CC genotype of rs2073618 were more likely to have peri-implantitis than GG genotype carriers (OR=2.18, 95% CI=1.03-4.62, p=0.04). In addition, patients with the C allele had 1.47 times the risk of suffering from peri-implantitis (OR=1.47, 95% CI=1.01-2.13, p=0.04), but not rs2073617 polymorphism. The G-C haplotype frequency of rs2073618-rs2073617 in OPG was significantly correlated to the increased susceptibility of peri-implantitis (OR=2.27, 95% CI=1.20-4.30).  CONCLUSIONS OPG rs2073618 polymorphism may be related to the risk of peri-implantitis, but not rs2073617. Moreover, haplotype is also a non-ignorable risk factor.

  8. Functional characterization of genetic polymorphisms identified in the promoter region of the bovine PEPS gene.

    Science.gov (United States)

    Ju, Zhihua; Zheng, Xue; Huang, Jinming; Qi, Chao; Zhang, Yan; Li, Jianbin; Zhong, Jifeng; Wang, Changfa

    2012-06-01

    Peptidase S (PEPS) is a metallopeptidase that cleaves N-terminal residues from proteins and peptides. PEPS is used as a cell maintenance enzyme with critical roles in peptide turnover. The promoter region located upstream of the initiation site plays an important role in regulating gene expression. Polymorphism in the promoter region can alter gene expression and lead to biological changes. In the current study, polymorphisms in the promoter region of the PEPS gene were investigated. Polymerase chain reaction (PCR)-restriction fragment length polymorphism and DNA sequencing methods were used to screen sequence variations in the promoter region of DNA samples from 743 Chinese Holstein cattle. Two polymorphisms (g. -534 T>C and g. -2545 G>A) were identified and eight haplotypes were classified by haplotype analysis. The two genetic polymorphisms and haplotypes were associated with fat percentage and somatic cell score in Chinese Holstein cattle. The results of real-time PCR showed that cow kidneys exhibit the highest PEPS expression level. Moreover, bioinformatics analysis predicted that the single-nucleotide polymorphism g. -534 T>C is located in the core promoter region and in the transcription factor binding sites. The promoter activities of the polymorphism of -543 T>C were measured by luciferase assay in the human kidney epithelial cell line 293T. Transcriptional activity is significantly lower in cell lines transfected with the reporter construct containing 2.5 kb upstream fragments with -543 C than in those with wild-type -543 T. The results indicated that genetic variation at locus -543 influences PEPS promoter activity. The genetic variation in the promoter region of PEPS gene may regulate PEPS gene transcription and might have consequences at a regulatory level.

  9. In Vivo Characterization of Human APOA5 Haplotypes

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey; Fruchart, Jamila; Pennacchio, Len A.

    2006-10-01

    Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allele (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.

  10. ParaHaplo 2.0: a program package for haplotype-estimation and haplotype-based whole-genome association study using parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2010-06-01

    Full Text Available Abstract Background The use of haplotype-based association tests can improve the power of genome-wide association studies. Since the observed genotypes are unordered pairs of alleles, haplotype phase must be inferred. However, estimating haplotype phase is time consuming. When millions of single-nucleotide polymorphisms (SNPs are analyzed in genome-wide association study, faster methods for haplotype estimation are required. Methods We developed a program package for parallel computation of haplotype estimation. Our program package, ParaHaplo 2.0, is intended for use in workstation clusters using the Intel Message Passing Interface (MPI. We compared the performance of our algorithm to that of the regular permutation test on both Japanese in Tokyo, Japan and Han Chinese in Beijing, China of the HapMap dataset. Results Parallel version of ParaHaplo 2.0 can estimate haplotypes 100 times faster than a non-parallel version of the ParaHaplo. Conclusion ParaHaplo 2.0 is an invaluable tool for conducting haplotype-based genome-wide association studies (GWAS. The need for fast haplotype estimation using parallel computing will become increasingly important as the data sizes of such projects continue to increase. The executable binaries and program sources of ParaHaplo are available at the following address: http://en.sourceforge.jp/projects/parallelgwas/releases/

  11. Genetic Diversity of African and Worldwide Strains of Ralstonia solanacearum as Determined by PCR-Restriction Fragment Length Polymorphism Analysis of the hrp Gene Region

    Science.gov (United States)

    Poussier, Stephane; Vandewalle, Peggy; Luisetti, Jacques

    1999-01-01

    The genetic diversity among a worldwide collection of 120 strains of Ralstonia solanacearum was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to R. solanacearum. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters. Each cluster included strains belonging to a single biovar, except for strains of biovars 3 and 4, which could not be separated. However, the biovar 1 strains showed rather extensive diversity since they were distributed into five clusters whereas the biovar 2 and the biovar 3 and 4 strains were gathered into one and two clusters, respectively. PCR-RFLP analysis of the hrp gene region confirmed the results of previous studies which split the species into an “Americanum” division including biovar 1 and 2 strains and an “Asiaticum” division including biovar 3 and 4 strains. However, the present study showed that most of the biovar 1 strains, originating from African countries (Reunion Island, Madagascar, Zimbabwe, and Angola) and being included in a separate cluster, belong to the “Asiaticum” rather than to the “Americanum” division. These African strains could thus have evolved separately from other biovar 1 strains originating from the Americas. PMID:10224018

  12. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  13. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  14. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  15. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  16. Combination of Complement-Dependent Cytotoxicity and Relative Fluorescent Quantification of HLA Length Polymorphisms Facilitates the Detection of a Loss of Heterozygosity

    Directory of Open Access Journals (Sweden)

    Klaus Witter

    2014-01-01

    Full Text Available Loss of heterozygosity (LOH is a common event in malignant cells. In this work we introduce a new approach to identify patients with loss of heterozygosity in the HLA region either at first diagnosis or after HLA mismatched allogeneic HSCT. Diagnosis of LOH requires a high purity of recipient target cells. FACS is time consuming and also frequently prevented by rather nonspecific or unknown immune phenotype. The approach for recipient cell enrichment is based on HLA targeted complement-dependent cytotoxicity (CDC. Relative fluorescent quantification (RFQ analysis of HLA intron length polymorphisms then allows analysis of HLA heterozygosity. The approach is exemplified in recent clinical cases illustrating the detection of an acquired allele loss. As illustrated in one case with DPB1, distinct HLA loci in donor and patient were sufficient for both proof of donor cell removal and evaluation of allele loss in the patient's leukemic cells. Results were confirmed using HLA-B RFQ analysis and leukemia-associated aberrant immunophenotype (LAIP based cell sort. Both results confirmed suspected loss of HLA heterozygosity. Our approach complements or substitutes for FACS-based cell enrichment; hence it may be further developed as novel routine diagnostic tool. This allows rapid recipient cell purification and testing for loss of HLA heterozygosity before and after allogeneic HSCT in easily accessible peripheral blood samples.

  17. AFLPMax: a user-friendly application for computing the optimal number of amplified fragment length polymorphism markers needed in phylogenetic reconstruction.

    Science.gov (United States)

    García-Pereira, M J; Quesada, H; Caballero, A; Carvajal-Rodríguez, A

    2012-05-01

    Amplified fragment length polymorphisms (AFLPs) are widely used for phylogenetic inference especially in non-model species. Frequently, trees obtained with other nuclear or mitochondrial markers or with morphological information need additional resolution, increased branch support, or independent data sources (i.e. unlinked loci). In such cases, the use of AFLPs is a quick and cheap option. Computer simulation has shown that dominant AFLP markers lead to less accurate tree topologies than bi-allelic codominant markers such as SNPs, but this difference becomes negligible for shallow trees when using AFLP data sets that include a sufficiently large number of characters. Thus, determining how many AFLP characters are required to recover a given phylogeny is a key issue regarding the appropriateness of AFLPs for phylogenetic reconstruction. Here, we present a user-friendly, java-based graphical interface, AFLPMax, which executes an automatic pipeline of different programs providing the user with the optimal number of AFLP characters needed to recover a given phylogeny with high accuracy and support. Executables for Windows, linux and MacOS X operating systems, source code and user manual are available from: http://webs.uvigo.es/acraaj/AFLPMax.htm. © 2012 Blackwell Publishing Ltd.

  18. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  19. Application of restriction fragment length polymorphism analysis to simple and rapid genotyping of bovine viral diarrhea virus strains isolated in Japan.

    Science.gov (United States)

    Seki, Yoshihisa; Seimiya, Yukio M; Motokawa, Masato; Yaegashi, Gakuji; Nagai, Makoto; Hayashi, Michiko

    2008-04-01

    The E2 regions of 177 bovine viral diarrhea virus (BVDV) strains isolated in Japan between 1957 and 2006 were analyzed for genotyping. The strains were classified into 8 genotypes (1a, 1b, 1c, 1d, 1e, 1f, So and 2a) based on the phylogenetic analysis. The restriction fragment length polymorphism (RFLP) analysis of the RT-PCR products using 6 selected enzymes (Apo I, Mly I, BstAP I, Pvu II, Ear I, EcoR V) disclosed the cutting patterns classified into 11 groups (I-XI), each of that consisted of strains belonging to a single genotype. Namely, groups-I and -II were composed by genotype-1a strains, groups-III and -IV by 1b strains, and groups-V and -VI by 1c strains. Other groups-VII, -VIII, -IX, -X and -XI comprised genotypes-1d, -1e, -1f, -So and -2a strains, respectively. The results suggest that the RFLP analysis can simply and rapidly differentiate the 8 genotypes of BVDV strains.

  20. [Establishing a new genotyping method of hepatitis B virus by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) to analysis on S region and its application].

    Science.gov (United States)

    Peng, Liang; Ding, Jing-Juan; Zhang, Li-Sha

    2004-08-01

    To establish a new polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method of genotyping HBV using Mbo I, BsTN I, BsmA I, Hpa II and investigate the relationship between genotype and clinical spectrum of hepatitis B. 124 full-genomic HBV sequences and 13 S-genomic sequences were analyzed, genotype specific regions were identified by the restriction enzymes Mbo I, BsTN I, BsmA I, Hpa II. And 176 samples from different kinds of hepatitis B were genotyped by this method. Five samples had been randomly selected and directly sequenced their S gene, to assess the accuracy. In 176 serum samples of patients with hepatitis B from Guizhou area, genotype B and C were found in 56.8% and 43.2% respectively. The proportions of genotype B and C in ASC were 40.0% and 15.7% (chi-square = 12.16, P < 0.005); and they were 31.6% and 14.0% in CHB (chi-square = 7.88, P < 0.005). Genotyping HBV, based on S gene RFLP seems to be highly sensitive, differential and accurate and could be used in large-scale surveys. HBV genotype B and C are existed in Guizhou area.

  1. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  2. Application of amplified fragment length polymorphism fingerprinting for taxonomy and identification of the soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi.

    Science.gov (United States)

    Avrova, Anna O; Hyman, Lizbeth J; Toth, Rachel L; Toth, Ian K

    2002-04-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (clusters 1 to 4) resulted. Cluster 1 contained Erwinia carotovora subsp. carotovora (subclusters 1a and 1b) and Erwinia carotovora subsp. odorifera (subcluster 1c) strains, while cluster 2 contained Erwinia carotovora subsp. atroseptica (subcluster 2a) and Erwinia carotovora subsp. betavasculorum (subcluster 2b) strains. Clusters 3 and 4 contained Erwinia carotovora subsp. wasabiae and E. chrysanthemi strains, respectively. While E. carotovora subsp. carotovora and E. chrysanthemi showed a high level of molecular diversity (23 to 38% mean similarity), E. carotovora subsp. odorifera, E. carotovora subsp. betavasculorum, E. carotovora subsp. atroseptica, and E. carotovora subsp. wasabiae showed considerably less (56 to 76% mean similarity), which may reflect their limited geographical distributions and/or host ranges. The species- and subspecies-specific banding profiles generated from the AFLPs allowed rapid identification of unknown isolates and the potential for future development of diagnostics. AFLP fingerprinting was also found to be more differentiating than other techniques for typing the soft rot erwinias and was applicable to all strain types, including different serogroups.

  3. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  4. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  5. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  6. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  7. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  8. Genotyping of infectious bursal disease virus strains by restriction fragment length polymorphism analysis of the VP1, VP2, and VP3 genes.

    Science.gov (United States)

    Gomes, A D; Abreu, J T; Redondo, R A F; Martins, N R S; Resende, J S; Resende, M

    2005-12-01

    SUMMARY. This study aimed to genotype infectious bursal disease virus (IBDV) isolates from the Minas Gerais state poultry industry. RNA was extracted from bursae obtained from field cases without passage or commercial vaccines. Genetic subtyping of IBDV isolates and vaccine strains was carried out by the reverse transcriptase-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis. A 588-bp fragment in the VP1 gene, an 847-bp fragment in the VP2 gene, and a 320-bp fragment in the VP3 gene were amplified by PCR and digested with restriction enzymes PstI and ScaI (VP1); BamHI, BstEII, and PstI (VP2); and NcoI, ScaI, and XbaI (VP3). Our work shows that complementing the clinical history of the outbreaks with RT-PCR followed by RFLP analysis using PstI for VP1, BamHI for VP2, and XbaI for VP3 allowed an accurate classification of a causative agent as a very virulent IBDV.

  9. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  10. Use of PCR-restriction fragment length polymorphism analysis to identify the main new world Leishmania species and analyze their taxonomic properties and polymorphism by application of the assay to clinical samples.

    Science.gov (United States)

    Rotureau, Brice; Ravel, Christophe; Couppié, Pierre; Pratlong, Francine; Nacher, Mathieu; Dedet, Jean-Pierre; Carme, Bernard

    2006-02-01

    At least 13 characterized Leishmania species are known to infect humans in South America. Five of these parasites are transmitted in the sylvatic ecotopes of the whole French Guianan territory and responsible for cutaneous leishmaniasis. For the diagnosis of cutaneous leishmaniasis, restriction fragment length polymorphism (RFLP) analyses have shown promising results. Thus, the end of the small subunit and internal transcribed spacer 1 of the rRNA genes were sequenced and targeted by PCR-RFLP analysis in the 10 main New World (NW) Leishmania species from the two subgenera. Then, the procedure was tested on 40 samples from patients with cutaneous leishmaniasis, and its results were compared with those of conventional methods. (i) The results of this simple genus-specific method were in agreement with those of previous isoenzyme analyses. (ii) This method distinguished the most medically relevant Leishmania species with only one enzyme (RsaI). (iii) This method could be performed directly on human biopsy specimens (sensitivity of 85.7%). Performing NW Leishmania species typing rapidly and easily in the field constitutes a very valuable improvement for detection of Leishmania spp. Revealing great diversity with several enzymes, this method could also be useful for taxonomic, ecological, and epidemiological studies in space and time.

  11. Mapping of HLA- DQ haplotypes in a group of Danish patients with celiac disease

    DEFF Research Database (Denmark)

    Lund, Flemming; Hermansen, Mette N; Pedersen, Merete F

    2015-01-01

    BACKGROUND: A cost-effective identification of HLA- DQ risk haplotypes using the single nucleotide polymorphism (SNP) technique has recently been applied in the diagnosis of celiac disease (CD) in four European populations. The objective of the study was to map risk HLA- DQ haplotypes in a group...... of Danish CD patients using the SNP technique. METHODS: Cohort A: Among 65 patients with gastrointestinal symptoms we compared the HLA- DQ2 and HLA- DQ8 risk haplotypes obtained by the SNP technique (method 1) with results based on a sequence specific primer amplification technique (method 2......) and a technique used in an assay from BioDiagene (method 3). Cohort B: 128 patients with histologically verified CD were tested for CD risk haplotypes (method 1). Patients with negative results were further tested for sub-haplotypes of HLA- DQ2 (methods 2 and 3). RESULTS: Cohort A: The three applied methods...

  12. Haplotypes in the Dystrophin DNA Segment Point to a Mosaic Origin of Modern Human Diversity

    OpenAIRE

    Ziętkiewicz, Ewa; Yotova, Vania; Gehl, Dominik; Wambach, Tina; Arrieta, Isabel; Batzer, Mark; Cole, David E.C.; Hechtman, Peter; Kaplan, Feige; Modiano, David; Moisan, Jean-Paul; Michalski, Roman; Labuda, Damian

    2003-01-01

    Although Africa has played a central role in human evolutionary history, certain studies have suggested that not all contemporary human genetic diversity is of recent African origin. We investigated 35 simple polymorphic sites and one Tn microsatellite in an 8-kb segment of the dystrophin gene. We found 86 haplotypes in 1,343 chromosomes from around the world. Although a classical out-of-Africa topology was observed in trees based on the variant frequencies, the tree of haplotype sequences re...

  13. Genome-wide development and deployment of informative intron-spanning and intron-length polymorphism markers for genomics-assisted breeding applications in chickpea.

    Science.gov (United States)

    Srivastava, Rishi; Bajaj, Deepak; Sayal, Yogesh K; Meher, Prabina K; Upadhyaya, Hari D; Kumar, Rajendra; Tripathi, Shailesh; Bharadwaj, Chellapilla; Rao, Atmakuri R; Parida, Swarup K

    2016-11-01

    The discovery and large-scale genotyping of informative gene-based markers is essential for rapid delineation of genes/QTLs governing stress tolerance and yield component traits in order to drive genetic enhancement in chickpea. A genome-wide 119169 and 110491 ISM (intron-spanning markers) from 23129 desi and 20386 kabuli protein-coding genes and 7454 in silico InDel (insertion-deletion) (1-45-bp)-based ILP (intron-length polymorphism) markers from 3283 genes were developed that were structurally and functionally annotated on eight chromosomes and unanchored scaffolds of chickpea. A much higher amplification efficiency (83%) and intra-specific polymorphic potential (86%) detected by these markers than that of other sequence-based genetic markers among desi and kabuli chickpea accessions was apparent even by a cost-effective agarose gel-based assay. The genome-wide physically mapped 1718 ILP markers assayed a wider level of functional genetic diversity (19-81%) and well-defined phylogenetics among domesticated chickpea accessions. The gene-derived 1424 ILP markers were anchored on a high-density (inter-marker distance: 0.65cM) desi intra-specific genetic linkage map/functional transcript map (ICC 4958×ICC 2263) of chickpea. This reference genetic map identified six major genomic regions harbouring six robust QTLs mapped on five chromosomes, which explained 11-23% seed weight trait variation (7.6-10.5 LOD) in chickpea. The integration of high-resolution QTL mapping with differential expression profiling detected six including one potential serine carboxypeptidase gene with ILP markers (linked tightly to the major seed weight QTLs) exhibiting seed-specific expression as well as pronounced up-regulation especially in seeds of high (ICC 4958) as compared to low (ICC 2263) seed weight mapping parental accessions. The marker information generated in the present study was made publicly accessible through a user-friendly web-resource, "Chickpea ISM-ILP Marker Database

  14. Program death 1 (PD1) haplotyping in patients with breast carcinoma.

    Science.gov (United States)

    Haghshenas, Mohammad Reza; Naeimi, Sirous; Talei, Abdolrasoul; Ghaderi, Abbas; Erfani, Nasrollah

    2011-08-01

    Located on chromosome 2q37.3, the programmed death 1 (PD1) gene encodes for PD-1 (also known as CD279), a negative co-stimulator in the immune system. PD-1 renders potent inhibitory effects on T and B lymphocytes as well as monocyte responses. Expression of PD-1 ligands by tumor cells has been reported to contribute in immune system evasion. We aimed, in current study, to investigate the association of two single nucleotide polymorphisms in PD1 gene, +7146 G to A (PD-1.3) and +7785 C to T (PD-1.5 or +872), with susceptibility and/or progression of breast carcinoma. Four hundred forty-three women with breast cancer and 328 age-sex match healthy donors were recruited in present study. Genotyping was performed using Nested polymerase chain reaction-restriction fragment length polymorphisms. Arlequin software package was used to check for the Hardy-Weinberg equilibration and to determine the haplotypes. Results revealed no significant differences in the frequencies of genotypes and alleles at PD-1.3 (P=0.252 and 0.279 for genotypes and alleles, respectively) and PD-1.5 positions (P=0.522 and 0.278 for genotypes and alleles, respectively). Four haplotypes were observed among populations with no differences in the frequency between patients and controls. Our results also revealed no association between PD1 genotypes and tumor stage, tumor size, tumor grade, lymph node involvement, vascular invasion, distant metastasis, and Nottingham prognostic index. Present data do not confirm association of PD-1.3 (+7146) G/A and PD-1.5 (+7785 or +872) C/T genetic markers with susceptibility of Iranians to breast cancer.

  15. Analysis of HLA-DRB1,DQA1,DQB1 haplotypes in Sardinian centenarians

    Science.gov (United States)

    Scola, Letizia; Lio, Domenico; Candore, Giuseppina; Forte, Giusi I.; Crivello, Antonio; Colonna-Romano, Giuseppina; Pes, Mario G.; Carru, Ciriaco; Ferrucci, Luigi; Deiana, Luca; Baggio, Giovannella; Franceschi, Claudio; Caruso, Calogero

    2009-01-01

    Some genetic determinants of longevity might reside in those polymorphisms for the immune system genes that regulate immune responses. Many longevity association studies focused their attention on HLA (the human MHC) polymorphisms, but discordant results have been obtained. Sardinians are a relatively isolate population and represent a suitable population for association studies. Some HLA-DR and DQ alleles form very stable haplotypes with a strong linkage disequilibrium. In a previous study on Sardinian centenarians we have suggested that HLA-DRB1∗15 allele might be marginally associated to longevity. HLA-DR,DQ haplotypes are in strong linkage disequilibrium and well conserved playing a role in the association to diseases. Hence, we have evaluated, by amplification refractory mutation system/polymerase chain reaction (ARMS-PCR) the HLADQA1 and HLA-DQB1 allele frequencies in 123 centenarians and 92 controls from Sardinia to assess whether the association to HLA-DRB1∗15 allele may be due to the other genes involved in the HLA-DR,DQ haplotypes. The frequencies of HLA-DQA1,DQB1 haplotypes were not significantly modified in centenarians. Nevertheless by evaluating the frequency of DRB1∗15 linked haplotypes, we observed a not significant increase in centenarians of HLA-DQA1∗01,DQB1∗05 and HLA-DQA1∗01,DQB1∗06 haplotypes. These data suggest that these haplotypes might have a role in determining life span expectancy and longevity. PMID:17714903

  16. Effects of the number of markers per haplotype and clustering of haplotypes on the accuracy of QTL mapping and prediction of genomic breeding values

    Directory of Open Access Journals (Sweden)

    Schrooten Chris

    2009-01-01

    Full Text Available Abstract The aim of this paper was to compare the effect of haplotype definition on the precision of QTL-mapping and on the accuracy of predicted genomic breeding values. In a multiple QTL model using identity-by-descent (IBD probabilities between haplotypes, various haplotype definitions were tested i.e. including 2, 6, 12 or 20 marker alleles and clustering base haplotypes related with an IBD probability of > 0.55, 0.75 or 0.95. Simulated data contained 1100 animals with known genotypes and phenotypes and 1000 animals with known genotypes and unknown phenotypes. Genomes comprising 3 Morgan were simulated and contained 74 polymorphic QTL and 383 polymorphic SNP markers with an average r2 value of 0.14 between adjacent markers. The total number of haplotypes decreased up to 50% when the window size was increased from two to 20 markers and decreased by at least 50% when haplotypes related with an IBD probability of > 0.55 instead of > 0.95 were clustered. An intermediate window size led to more precise QTL mapping. Window size and clustering had a limited effect on the accuracy of predicted total breeding values, ranging from 0.79 to 0.81. Our conclusion is that different optimal window sizes should be used in QTL-mapping versus genome-wide breeding value prediction.

  17. Development and utility of cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLPs) linked to the Fom-2 fusarium wilt resistance gene in melon (Cucumis melo L.).

    Science.gov (United States)

    Zheng, X Y; Wolff, D W; Baudracco-Arnas, S; Pitrat, M

    1999-08-01

    Fusarium wilt, caused by Fusarium oxysporum Schlecht f. sp. melonis Snyder & Hans, is a worldwide soil-borne disease of melon (Cucumis melo L.). Resistance to races 0 and 1 of Fusarium wilt is conditioned by the dominant gene Fom-2. To facilitate marker-assisted backcrossing with selection for Fusarium wilt resistance, we developed cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLP) markers by converting RAPD markers E07 (a 1.25-kb band) and G17 (a 1.05-kb band), respectively. The RAPD-PCR polymorphic fragments from the susceptible line 'Vedrantais' were cloned and sequenced in order to construct primers that would amplify only the target fragment. The derived primers, E07SCAR-1/E07SCAR-2 from E07 and G17SCAR-1/G17SCAR-2 from G17, yielded a single 1.25-kb fragment (designated SCE07) and a 1.05-kb fragment (designated SCG17) (the same as RAPD markers E07 and G17), respectively, from both resistant and susceptible melon lines, thus demonstrating locus-specific associated primers. Potential CAPS markers were first revealed by comparing sequence data between fragments amplified from resistant (PI 161375) and susceptible ('Vedrantais') lines and were then confirmed by electrophoresis of restriction endonuclease digestion products. Twelve restriction endonucleases were evaluated for their potential use as CAPS markers within the SCE07 fragment. Three (BclI, MspI, and BssSI) yielded ideal CAPS markers and were subsequently subjected to extensive testing using an additional 88 diverse melon cultigens, 93 and 119 F(2) individuals from crosses of 'Vedrantais' x PI 161375 and 'Ananas Yokneam'×MR-1 respectively, and 17 families from a backcross BC(1)S(1) population derived from the breeding line 'MD8654' as a resistance source. BclI- and MspI-CAPS are susceptible-linked markers, whereas the BssSI-CAPS is a resistant-linked marker. The CAPS markers that resulted from double digestion by BclI and BssSI are co-dominant. Results

  18. High-resolution haplotype block structure in the cattle genome

    Directory of Open Access Journals (Sweden)

    Choi Jungwoo

    2009-04-01

    Full Text Available Abstract Background The Bovine HapMap Consortium has generated assay panels to genotype ~30,000 single nucleotide polymorphisms (SNPs from 501 animals sampled from 19 worldwide taurine and indicine breeds, plus two outgroup species (Anoa and Water Buffalo. Within the larger set of SNPs we targeted 101 high density regions spanning up to 7.6 Mb with an average density of approximately one SNP per 4 kb, and characterized the linkage disequilibrium (LD and haplotype block structure within individual breeds and groups of breeds in relation to their geographic origin and use. Results From the 101 targeted high-density regions on bovine chromosomes 6, 14, and 25, between 57 and 95% of the SNPs were informative in the individual breeds. The regions of high LD extend up to ~100 kb and the size of haplotype blocks ranges between 30 bases and 75 kb (10.3 kb average. On the scale from 1–100 kb the extent of LD and haplotype block structure in cattle has high similarity to humans. The estimation of effective population sizes over the previous 10,000 generations conforms to two main events in cattle history: the initiation of cattle domestication (~12,000 years ago, and the intensification of population isolation and current population bottleneck that breeds have experienced worldwide within the last ~700 years. Haplotype block density correlation, block boundary discordances, and haplotype sharing analyses were consistent in revealing unexpected similarities between some beef and dairy breeds, making them non-differentiable. Clustering techniques permitted grouping of breeds into different clades given their similarities and dissimilarities in genetic structure. Conclusion This work presents the first high-resolution analysis of haplotype block structure in worldwide cattle samples. Several novel results were obtained. First, cattle and human share a high similarity in LD and haplotype block structure on the scale of 1–100 kb. Second, unexpected

  19. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  20. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  1. Fluorescent amplified fragment length polymorphism (FAFLP genotyping demonstrates the role of biofilm-producing methicillin-resistant periocular Staphylococcus epidermidis strains in postoperative endophthalmitis

    Directory of Open Access Journals (Sweden)

    Hasnain Seyed E

    2006-01-01

    Full Text Available Abstract Background An observational case series was used to study the virulence characteristics and genotypes of paired Staphylococcus epidermidis isolates cultured from intraocular samples and from periocular environment of patients with postcataract surgery endophthalmitis. Methods Eight S. epidermidis isolates were obtained from three patients (2 from patients #1 and 2 and 4 from patient #3 whose vitreous and/or anterior chamber (AC specimens and preoperative lid/conjunctiva samples were culture positive. Cultures were identified by API-Staph phenotypic identification system and genotypically characterized by Fluorescent Amplified Fragment Length Polymorphism (FAFLP and checked for their antimicrobial susceptibility. The isolates were tested for biofilm-production and methicillin-resistance (MR by PCR amplification of icaAB and mecA gene respectively. Results Four out of eight S. epidermidis strains showed multiple drug resistance (MDR. All the eight strains were PCR positive for mecA gene whereas seven out of eight strains were positive for icaAB genes. In all three patients FAFLP typing established vitreous isolates of S. epidermidis strains to be indistinguishable from the strains isolated from the patient's conjunctival swabs. However, from patient number three there was one isolate (1030b from lid swab, which appeared to be nonpathogenic and ancestral having minor but significant differences from other three strains from the same patient. This strain also lacked icaAB gene. In silico analysis indicated possible evolution of other strains from this strain in the patient. Conclusion Methicillin-resistant biofilm positive S. epidermidis strains colonizing the conjunctiva and eyelid were responsible for postoperative endophthalmitis (POE.

  2. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  3. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene.

    Science.gov (United States)

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species.

  4. Molecular identification of Mycobacterium tuberculosis complex by region of differentiation-typing and polymerase chain reaction-restriction fragment length polymorphism method.

    Science.gov (United States)

    Mirzaki, Seydeh Zeinab; Mosavari, Nader; Nazari, Razieh; Akbarian, Morteza

    2016-12-01

    Tuberculosis (TB) is one of the most common zoonotic infectious diseases in the world. Identification of Mycobacterium isolates is essential for proper treatment of TB. The aim of this study was to identify Mycobacterium isolates collected from TB patients in Alborz Province, Iran, by region of differentiation (RD)-typing. Fifty samples from tuberculosis patients were cultured in pyruvate and glycerinated Lowenstein-Jensen medium. DNA was extracted from the isolates by the van Solingen method and subjected to polymerase chain reaction (PCR)-16SrRNA, PCR-IS6110, and RD-typing with primers RD1, RD4, RD9, and RD12, respectively. Out of 50 isolates, only one isolate appeared negative in IS6110-PCR and was considered nontuberculosis complex. The remaining isolates gave PCR products of approximately 543bp, 245bp, 146bp, 172bp, 235bp, and 369bp with 16s-rRNA, IS6110-PCR, RD-1, RD-4, RD-9, and RD-12 PCR, respectively. PCR-restriction fragment length polymorphism of oxyR pseudogene confirmed the results. All isolates except one from Alborz Province appeared positive for Mycobacterium tuberculosis. Based on the obtained results, all isolates except one were identified as M. tuberculosis. The only negative isolate appeared 93% and 97% similar to Nocardia or Mycobacterium sp. (Mycobacterium neoaurum), respectively, based on sequencing and alignment of 16s-rRNA and hsp65. Accurate identification of Mycobacterium isolates is of utmost importance for proper and immediate treatment of TB patients. In this study, RD-typing appeared to be a suitable method for correct identification of M. tuberculosis isolates. Copyright © 2016.

  5. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  6. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  8. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  9. Brazilian Angiostrongylus cantonensis haplotypes, ac8 and ac9, have two different biological and morphological profiles

    Directory of Open Access Journals (Sweden)

    Tainá CC Monte

    2014-12-01

    Full Text Available Angiostrongylus cantonensis is the etiologic agent of eosinophilic meningoencephalitis in humans. Cases have been recorded in many parts of the world, including Brazil. The aim of this study was to compare the differences in the biology and morphology of two different Brazilian haplotypes of A. : ac8 and ac9. A significantly larger number of L1 larvae eliminated in the faeces of rodents at the beginning of the patent period was observed for ac9 haplotype and compared to the total of L1 larvae eliminated, there was a significant difference between the two haplotypes. The ac9 haplotype showed a significant difference in the proportion of female and male specimens (0.6:1, but the same was not observed for ac8 (1.2:1. The morphometric analysis showed that male and female specimens isolated from ac8 haplotype were significantly larger with respect to body length, oesophagus length, spicule length (male and distance from the anus to the rear end (female compared to specimens from ac9. The morphological analysis by light microscopy showed little variation in the level of bifurcations at the lateral rays in the right lobe of the copulatory bursa between the two haplotypes. The biological, morphological and morphometric variations observed between the two haplotypes agree with the observed variation at the molecular level using the cytochrome oxidase subunit I marker and reinforce the possible influence of geographical isolation on the development of these haplotypes.

  10. Brazilian Angiostrongylus cantonensis haplotypes, ac8 and ac9, have two different biological and morphological profiles.

    Science.gov (United States)

    Monte, Tainá C C; Gentile, Rosana; Garcia, Juberlan; Mota, Ester; Santos, Jeannie N; Maldonado Júnior, Arnaldo

    2014-12-01

    Angiostrongylus cantonensis is the etiologic agent of eosinophilic meningoencephalitis in humans. Cases have been recorded in many parts of the world, including Brazil. The aim of this study was to compare the differences in the biology and morphology of two different Brazilian haplotypes of A. cantonensis: ac8 and ac9. A significantly larger number of L1 larvae eliminated in the faeces of rodents at the beginning of the patent period was observed for ac9 haplotype and compared to the total of L1 larvae eliminated, there was a significant difference between the two haplotypes. The ac9 haplotype showed a significant difference in the proportion of female and male specimens (0.6:1), but the same was not observed for ac8 (1.2:1). The morphometric analysis showed that male and female specimens isolated from ac8 haplotype were significantly larger with respect to body length, oesophagus length, spicule length (male) and distance from the anus to the rear end (female) compared to specimens from ac9. The morphological analysis by light microscopy showed little variation in the level of bifurcations at the lateral rays in the right lobe of the copulatory bursa between the two haplotypes. The biological, morphological and morphometric variations observed between the two haplotypes agree with the observed variation at the molecular level using the cytochrome oxidase subunit I marker and reinforce the possible influence of geographical isolation on the development of these haplotypes.

  11. The role of matrix metalloproteinase-2 promoter polymorphisms in coronary artery disease and myocardial infarction.

    Science.gov (United States)

    Alp, Ebru; Menevse, Sevda; Tulmac, Murat; Yilmaz, Akin; Yalcin, Ridvan; Cengel, Atiye

    2011-04-01

    The matrix metalloproteinase (MMP) family are key enzymes involved in the breakdown of the extracellular matrix in normal physiological processes, including tissue remodeling, and disease processes, such as arthritis and metastasis. The promoter polymorphism in the MMP2 gene may be responsible for multiple diseases related to extracellular matrix degradation. Therefore, we aimed to investigate the relationship between genotypes or haplotypes of -1575 G/A, -1306 C/T, -790 T/G, and -735 C/T promoter polymorphisms and coronary artery disease (CAD) with or without myocardial infarction (MI) history. This study included 298 patients with angiographically confirmed CAD and 299 age matched controls. Genomic DNA was isolated from whole blood and genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism method. No significant associations were found between -1575 G/A, -1306 C/T, and -790 T/G polymorphisms and CAD with or without MI history. However, the frequency of the -735 TT genotype was significantly lower in the controls than in the patients with MI alone when compared with the CC genotype (p=0.021). Only the distribution of the ACGC haplotype in CAD patients exhibited a significant difference than that in controls (phistory in the Turkish population. Further case-control studies in CAD development might be contributed to clarify the role of these polymorphisms.

  12. PADI4 Haplotypes in Association with RA Mexican Patients, a New Prospect for Antigen Modulation

    Directory of Open Access Journals (Sweden)

    Maria Guadalupe Zavala-Cerna

    2013-01-01

    Full Text Available Peptidyl arginine deiminase IV (PAD 4 is the responsible enzyme for a posttranslational modification called citrullination, originating the antigenic determinant recognized by anti-cyclic citrullinated peptide antibodies (ACPA. Four SNPs (single nucleotide polymorphisms have been described in PADI4 gene to form a susceptibility haplotype for rheumatoid arthritis (RA; nevertheless, results in association studies appear contradictory in different populations. The aim of the study was to analyze if the presence of three SNPs in PADI4 gene susceptibility haplotype (GTG is associated with ACPA positivity in patients with RA. This was a cross-sectional study that included 86 RA patients and 98 healthy controls. Polymorphisms PADI4_89, PADI4_90, and PADI4_92 in the PADI4 gene were genotyped. The susceptibility haplotype (GTG was more frequent in RA patients; interestingly, we found a new haplotype associated with RA with a higher frequency (GTC. There were no associations between polymorphisms and high scores in Spanish HAQ-DI and DAS-28, but we did find an association between RARBIS index and PADI4_89, PADI4_90 polymorphisms. We could not confirm an association between susceptibility haplotype presence and ACPA positivity. Further evidence about proteomic expression of this gene will determine its participation in antigenic generation and autoimmunity.

  13. Detection of Haplotypes Associated with Prenatal Death in Dairy Cattle and Identification of Deleterious Mutations in GART, SHBG and SLC37A2

    Science.gov (United States)

    Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

    2013-01-01

    The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392

  14. Lack of association between urotensin-II (UTS2 gene polymorphisms (Thr21Met and Ser89Asn and migraine

    Directory of Open Access Journals (Sweden)

    Betül Ozan

    2017-08-01

    Full Text Available Migraine is a common neurovascular brain disorder with heterogeneous clinical presentation, including recurrent headache attacks. The pathophysiology of migraine is complex, and a number of genomic regions have been associated with the development of migraine. In this study, we analyzed the allele and genotype frequencies of the urotensin-II gene (UTS2 polymorphisms, Thr21Met and Ser89Asn, among Turkish patients with migraine. A total of 146 patients with migraine (14 with aura [MA group] and 132 without aura [MO group] were genotyped for Thr21Met and Ser89Asn polymorphisms and compared with 154 age- and sex-matched healthy controls. The UTS2 gene polymorphisms were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. No significant differences were observed in allele and genotype frequencies for Thr21Met and Ser89Asn polymorphisms between the patients with migraine and control group. Similarly, we did not observe significant differences in allele and genotype frequencies between MA and MO and control group. Moreover, the haplotype analysis showed no association between UTS2 gene haplotypes (MN, MS, TN, and TS and migraine. In summary, Thr21Met and Ser89Asn polymorphisms of the UTS2 gene are not risk factors for migraine in our sample of Turkish migraine patients.

  15. CYP1B1 gene polymorphisms correlate with an increased risk of urinary bladder cancer in India.

    Science.gov (United States)

    Sankhwar, Monica; Sankhwar, Satya Narayan; Abhishek, Amar; Gupta, Nishi; Rajender, Singh

    2016-04-01

    The urinary bladder is the target of several toxic compounds, which makes the bladder more prone to cancer. Cytochrome P450 1B1 enzyme is present in tumor tissues and metabolizes the polyaromatic carcinogens and activates several procarcinogens that cause DNA damage. We examined the functional single-nucleotide polymorphisms in the CYP1B1 gene to study their association with the urinary bladder cancer. We recruited 234 cases of pure urothelial and 258 bladder cancer-free control samples from the individuals visiting the clinic for various investigations. We genotyped 4 CYP1B1 single-nucleotide polymorphisms using the polymerase chain reaction-restriction fragment length polymorphism analysis. The genotype data were analyzed by the Chi-square test. Haplotypes were constructed to evaluate the joint effect of the 4 polymorphisms. Overall, 3 polymorphisms-rs10012, rs150799650, and rs1056827 (odds ratio [OR] = 2.34, CI: 1.59-3.45, Pbladder cancer. Haplotype analysis suggested GTTC, GTTG, and ATGC to be the risk factors for bladder cancer. Overall, 3 polymorphisms, rs10012, rs1056827, and rs150799650 in the CYP1B1 gene correlate with urinary bladder cancer significantly in the Indo-European population of Uttar Pradesh, India. Further investigations in other populations are advised. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Aberrant DNA methylation of the P16, MGMT, and hMLH1 genes in combination with the methylenetetrahydrofolate reductase C677T genetic polymorphism and folate intake in gastric cancer.

    Science.gov (United States)

    Lin, J; Zeng, R M; Li, R N; Cao, W H

    2014-03-24

    Epidemiological studies have indicated that folate metabolism is correlated with increased risk of gastric cancer. Since methylenetetrahydrofolate reductase (MTHFR) is an important enzyme involved in folate metabolism, in this study, we examined whether polymorphisms and haplotypes of MTHFR are correlated with the risk of gastric cancer. The polymorphisms MTHFR C677T and MTHFR A1298C were genotyped by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) analysis in 285 patients and 570 healthy controls. Association analyses based on binary logistic regression were conducted to determine the odds ratio (OR) and its 95% confidence interval (95%CI) for each genotype. The MTHFR 677TT genotype was significantly related with a reduced risk of gastric cancer (OR = 0.60, 95%CI = 0.39-0.92) compared to the CC genotype. Similarly, the MTHFR 1298CC genotype was significantly associated with a decreased risk of cancer (OR = 0.52, 95%CI = 0.32- 0.81). Haplotype analysis showed that the TC haplotype was associated with a reduced risk of gastric cancer compared to the most common haplotype, CA (OR = 0.28, 95%CI = 0.12-0.60). Our results suggest that the MTHFR C677T and MTHFR A1298C polymorphisms are related to gastric cancer susceptibility in the Chinese population.

  17. Genetics of chloroquine-resistant malaria: a haplotypic view

    Directory of Open Access Journals (Sweden)

    Gauri Awasthi

    2013-12-01

    Full Text Available The development and rapid spread of chloroquine resistance (CQR in Plasmodium falciparum have triggered the identification of several genetic target(s in the P. falciparum genome. In particular, mutations in the Pfcrt gene, specifically, K76T and mutations in three other amino acids in the region adjoining K76 (residues 72, 74, 75 and 76, are considered to be highly related to CQR. These various mutations form several different haplotypes and Pfcrt gene polymorphisms and the global distribution of the different CQR- Pfcrt haplotypes in endemic and non-endemic regions of P. falciparum malaria have been the subject of extensive study. Despite the fact that the Pfcrt gene is considered to be the primary CQR gene in P. falciparum , several studies have suggested that this may not be the case. Furthermore, there is a poor correlation between the evolutionary implications of the Pfcrt haplotypes and the inferred migration of CQR P. falciparum based on CQR epidemiological surveillance data. The present paper aims to clarify the existing knowledge on the genetic basis of the different CQR- Pfcrt haplotypes that are prevalent in worldwide populations based on the published literature and to analyse the data to generate hypotheses on the genetics and evolution of CQR malaria.

  18. Complete MHC Haplotype Sequencing for Common Disease Gene Mapping

    Science.gov (United States)

    Stewart, C. Andrew; Horton, Roger; Allcock, Richard J.N.; Ashurst, Jennifer L.; Atrazhev, Alexey M.; Coggill, Penny; Dunham, Ian; Forbes, Simon; Halls, Karen; Howson, Joanna M.M.; Humphray, Sean J.; Hunt, Sarah; Mungall, Andrew J.; Osoegawa, Kazutoyo; Palmer, Sophie; Roberts, Anne N.; Rogers, Jane; Sims, Sarah; Wang, Yu; Wilming, Laurens G.; Elliott, John F.; de Jong, Pieter J.; Sawcer, Stephen; Todd, John A.; Trowsdale, John; Beck, Stephan

    2004-01-01

    The future systematic mapping of variants that confer susceptibility to common diseases requires the construction of a fully informative polymorphism map. Ideally, every base pair of the genome would be sequenced in many individuals. Here, we report 4.75 Mb of contiguous sequence for each of two common haplotypes of the major histocompatibility complex (MHC), to which susceptibility to >100 diseases has been mapped. The autoimmune disease-associated-haplotypes HLA-A3-B7-Cw7-DR15 and HLA-A1-B8-Cw7-DR3 were sequenced in their entirety through a bacterial artificial chromosome (BAC) cloning strategy using the consanguineous cell lines PGF and COX, respectively. The two sequences were annotated to encompass all described splice variants of expressed genes. We defined the complete variation content of the two haplotypes, revealing >18,000 variations between them. Average SNP densities ranged from less than one SNP per kilobase to >60. Acquisition of complete and accurate sequence data over polymorphic regions such as the MHC from large-insert cloned DNA provides a definitive resource for the construction of informative genetic maps, and avoids the limitation of chromosome regions that are refractory to PCR amplification. PMID:15140828

  19. Inducible nitric oxide synthase haplotype associated with migraine and aura.

    Science.gov (United States)

    de O S Mansur, Thiago; Gonçalves, Flavia M; Martins-Oliveira, Alisson; Speciali, Jose G; Dach, Fabiola; Lacchini, Riccardo; Tanus-Santos, Jose E

    2012-05-01

    Migraine is a complex neurological disorder with a clear neurogenic inflammatory component apparently including enhanced nitric oxide (NO) formation. Excessive NO amounts possibly contributing to migraine are derived from increased expression and activity of inducible NO synthase (iNOS). We tested the hypothesis that two functional, clinically relevant iNOS genetic polymorphisms (C(-1026)A-rs2779249 and G2087A-rs2297518) are associated with migraine with or without aura. We studied 142 healthy women without migraine (control group) and 200 women with migraine divided into two groups: 148 with migraine without aura (MWA) and 52 with aura (MA). Genotypes were determined by real-time polymerase chain reaction using the Taqman(®) allele discrimination assays. The PHASE 2.1 software was used to estimate the haplotypes. The A allele for the G2087A polymorphism was more commonly found in the MA group than in the MWA group (28 vs. 18%; P 0.05). The haplotype combining both A alleles for the two polymorphisms was more commonly found in the MA group than in the control group or in the MWA group (19 vs. 10 or 8%; P = 0.0245 or 0.0027, respectively). Our findings indicate that the G2087A and the C(-1026)A polymorphism in the iNOS gene affect the susceptibility to migraine with aura when their effects are combined within haplotypes, whereas the G2087A affects the susceptibility to aura in migraine patients. These finding may have therapeutic implications when examining the effects of selective iNOS inhibitors.

  20. Use of mgc2-polymerase chain reaction-restriction fragment length polymorphism for rapid differentiation between field isolates and vaccine strains of Mycoplasma gallisepticum in Israel.

    Science.gov (United States)

    Lysnyansky, Inna; Garcia, Maricarmen; Levisohn, Sharon

    2005-06-01

    Increasing use of Mycoplasma gallisepticum (MG) live vaccines has led to a need for a rapid test for differentiation of MG field strains from the live vaccine strains ts-11 and 6/85. We examined the differentiating potential of diagnostic polymerase chain reaction (PCR) primers targeted to the gene mgc2, encoding a cytadherence-related surface protein uniquely present in MG. The mgc2-PCR diagnostic primers are specific for MG in tests of all avian mycoplasmas or bacteria present in the chicken trachea and are sensitive enough to readily detect MG in tracheal swabs from field outbreaks. Differentiation of vaccine strain ts-11 was based on identification of restriction enzyme sites in the 300-base-pair (bp) mgc2-PCR amplicon present in ts-11 and missing in MG isolates from field outbreaks in Israel. Restriction sites for the enzymes HaeII and SfaN1 were identified in the amplified region in strain ts-11 and were not found in 28 field isolates of MG, comprising a representative cross section of all the MG isolates from the period 1997-2003. In practice, differential diagnosis of MG is achieved within 1 day of submission of tracheal swab samples by mgc2-PCR amplification and restriction of the amplicon with HaeII, giving a 270-bp fragment for ts-11 or no restriction for other MG strains tested. Application of the mgc2-PCR-restriction fragment length polymorphism (mgc2-PCR-RFLP) assay enabled differential diagnosis of both components of a mixture of ts-11 and non-ts-11 DNA, detecting the field strain in the presence of a large excess of ts-11. The test was successfully applied in vivo for monitoring vaccinates in a ts-11 vaccine trial. In principle, the test may also be used to identify the 6/85 vaccine strain, which yields a 237-bp product, readily differentiated from the approximately 300-bp PCR product of all other strains tested. Further testing of field isolates will be necessary to determine the applicability of this test in the United States and other countries.

  1. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  2. Nucleotide-binding oligomerization domain containing 1 (NOD1 haplotypes and single nucleotide polymorphisms modify susceptibility to inflammatory bowel diseases in a New Zealand caucasian population: a case-control study

    Directory of Open Access Journals (Sweden)

    Barclay Murray L

    2009-03-01

    Full Text Available Abstract Background The nucleotide-binding oligomerization domain containing 1 (NOD1 gene encodes a pattern recognition receptor that senses pathogens, leading to downstream responses characteristic of innate immunity. We investigated the role of NOD1 single nucleotide polymorphisms (SNPs on IBD risk in a New Zealand Caucasian population, and studied Nod1 expression in response to bacterial invasion in the Caco2 cell line. Findings DNA samples from 388 Crohn's disease (CD, 405 ulcerative colitis (UC, 27 indeterminate colitis patients and 201 randomly selected controls, from Canterbury, New Zealand were screened for 3 common SNPs in NOD1, using the MassARRAY® iPLEX Gold assay. Transcriptional activation of the protein produced by NOD1 (Nod1 was studied after infection of Caco2 cells with Escherichia coli LF82. Carrying the rs2075818 G allele decreased the risk of CD (OR = 0.66, 95% CI = 0.50–0.88, p Conclusion The NOD1 gene is important in signalling invasion of colonic cells by pathogenic bacteria, indicative of its' key role in innate immunity. Carrying specific SNPs in this gene significantly modifies the risk of CD and/or UC in a New Zealand Caucasian population.

  3. Endothelial Nitric Oxide Synthase Haplotypes Are Associated with Preeclampsia in Maya Mestizo Women

    Science.gov (United States)

    Díaz-Olguín, Lizbeth; Coral-Vázquez, Ramón Mauricio; Canto-Cetina, Thelma; Canizales-Quinteros, Samuel; Ramírez Regalado, Belem; Fernández, Genny; Canto, Patricia

    2011-01-01

    Preeclampsia is a specific disease of pregnancy and believed to have a genetic component. The aim of this study was to investigate if three polymorphisms in eNOS or their haplotypes are associated with preeclampsia in Maya mestizo women. A case-control study was performed where 127 preeclamptic patients and 263 controls were included. Genotyped and haplotypes for the -768T→C, intron 4 variants, Glu298Asp of eNOS were determined by PCR and real-time PCR allelic discrimination. Logistic regression analysis with adjustment for age and body mass index (BMI) was used to test for associations between genotype and preeclampsia under recessive, codominant and dominant models. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r2, and haplotype analysis was conducted. Women homozygous for the Asp298 allele showed an association of preeclampsia. In addition, analysis of the haplotype frequencies revealed that the -786C-4b-Asp298 haplotype was significantly more frequent in preeclamptic patients than in controls (0.143 vs. 0.041, respectively; OR = 3.01; 95% CI = 1.74–5.23; P = 2.9 × 10−4). Despite the Asp298 genotype in a recessive model associated with the presence of preeclampsia in Maya mestizo women, we believe that in this population the -786C-4b-Asp298 haplotype is a better genetic marker. PMID:21897002

  4. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    Energy Technology Data Exchange (ETDEWEB)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

  5. No association between polymorphisms in the BDNF gene and age at onset in Huntington disease

    Directory of Open Access Journals (Sweden)

    Kraus Peter H

    2006-11-01

    Full Text Available Abstract Background Recent evidence suggests that brain-derived neurotrophic factor (BDNF is an attractive candidate for modifying age at onset (AO in Huntington disease (HD. In particular, the functional Val66Met polymorphism appeared to exert a significant effect. Here we evaluate BDNF variability with respect to AO of HD using markers that represent the entire locus. Methods Five selected tagging polymorphisms were genotyped across a 65 kb region comprising the BDNF gene in a well established cohort of 250 unrelated German HD patients. Results Addition of BDNF genotype variations or one of the marker haplotypes to the effect of CAG repeat lengths did not affect the variance of the AO. Conclusion We were unable to verify a recently reported association between the functional Val66Met polymorphism in the BDNF gene and AO in HD. From our findings, we conclude that neither sequence variations in nor near the gene contribute significantly to the variance of AO.

  6. The prevalence of the platelet glycoprotein VI polymorphisms in patients with sticky platelet syndrome and ischemic stroke.

    Science.gov (United States)

    Kubisz, Peter; Ivanková, Jela; Škereňová, Mária; Staško, Ján; Hollý, Pavol

    2012-11-01

    The aim of the study was to evaluate the genetic variability of the GP6 gene in patients with sticky platelet syndrome (SPS), a disorder characterized by platelet hyperaggregability, and thus to identify the genetic changes of the glycoprotein VI with possible relation to the platelet hyperaggregability. Seventy-one patients with SPS, clinically manifested as ischemic stroke, and 77 controls without SPS and with negative personal history of thromboembolic events were involved. SPS was diagnosed by platelet aggregometry (PACKS-4 aggregometer, Helena Laboratories) according to the method and criteria described by Mammen and Bick. Seven single-nucleotide polymorphisms (SNPs) of the GP6 gene (rs1654410, rs1671153, rs1654419, rs11669150, rs1613662, rs12610286, and rs1654431) were evaluated with the use of restriction-fragment-length polymorphism analysis. All allele and genotype frequencies were comparable between both SPS patients and the control group with no statistically significant differences. The haplotype analysis showed a higher occurrence of the one major haplotype (TTGTGA, 0.228 vs. 0.174; odds ratio (OR) 1.421; confidence interval (CI) 0.799-2.526) and two minor haplotypes (CGATAA, 0,026 vs. 0,006; OR 4.117; CI 0.443-38.25; TTGTGG, 0.018 vs. 0.009; OR 2.107; CI 0.259-17.12) in patients with SPS. None of haplotype differences was statistically significant. However, both the allele G of SNP rs12610286 (P = 0.029; OR 2.411; CI 1.134-5.123) and one major haplotype (TTGTGA; P = 0.012; OR 2.749; CI 1.223-6.174) were found significantly more frequent in patients with SPS type I in comparison with controls. Our results, especially higher occurrence of four haplotypes in SPS patients, can support an idea that variability of the GP6 gene may be associated with the platelet hyperaggregability in SPS.

  7. Inferring demographic history from a spectrum of shared haplotype lengths

    DEFF Research Database (Denmark)

    Harris, Kelley; Nielsen, Rasmus

    2013-01-01

    There has been much recent excitement about the use of genetics to elucidate ancestral history and demography. Whole genome data from humans and other species are revealing complex stories of divergence and admixture that were left undiscovered by previous smaller data sets. A central challenge i...

  8. Plasmodium falciparum isolates from Angola show the StctVMNT haplotype in the pfcrt gene

    Science.gov (United States)

    2010-01-01

    Background Effective treatment remains a mainstay of malaria control, but it is unfortunately strongly compromised by drug resistance, particularly in Plasmodium falciparum, the most important human malaria parasite. Although P. falciparum chemoresistance is well recognized all over the world, limited data are available on the distribution and prevalence of pfcrt and pfmdr1 haplotypes that mediate resistance to commonly used drugs and that show distinct geographic differences. Methods Plasmodium falciparum-infected blood samples collected in 2007 at four municipalities of Luanda, Angola, were genotyped using PCR and direct DNA sequencing. Single nucleotide polymorphisms in the P. falciparum pfcrt and pfmdr1 genes were assessed and haplotype prevalences were determined. Results and Discussion The most prevalent pfcrt haplotype was StctVMNT (representing amino acids at codons 72-76). This result was unexpected, since the StctVMNT haplotype has previously been seen mainly in parasites from South America and India. The CVIET, CVMNT and CVINT drug-resistance haplotypes were also found, and one previously undescribed haplotype (CVMDT) was detected. Regarding pfmdr1, the most prevalent haplotype was YEYSNVD (representing amino acids at codons 86, 130, 184, 1034, 1042, 1109 and 1246). Wild haplotypes for pfcrt and pfmdr1 were uncommon; 3% of field isolates harbored wild type pfcrt (CVMNK), whereas 21% had wild type pfmdr1 (NEYSNVD). The observed predominance of the StctVMNT haplotype in Angola could be a result of frequent travel between Brazil and Angola citizens in the context of selective pressure of heavy CQ use. Conclusions The high prevalence of the pfcrt SVMNT haplotype and the pfmdr1 86Y mutation confirm high-level chloroquine resistance and might suggest reduced efficacy of amodiaquine in Angola. Further studies must be encouraged to examine the in vitro sensitivity of pfcrt SVMNT parasites to artesunate and amodiaquine for better conclusive data. PMID:20565881

  9. Detecting structure of haplotypes and local ancestry

    Science.gov (United States)

    We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

  10. Haplotypes of catechol-O-methyltransferase modulate intelligence-related brain white matter integrity.

    Science.gov (United States)

    Liu, Bing; Li, Jun; Yu, Chunshui; Li, Yonghui; Liu, Yong; Song, Ming; Fan, Ming; Li, Kuncheng; Jiang, Tianzi

    2010-03-01

    Twin studies have indicated a common genetic origin for intelligence and for variations in brain morphology. Our previous diffusion tensor imaging studies found an association between intelligence and white matter integrity of specific brain regions or tracts. However, specific genetic determinants of the white matter integrity of these brain regions and tracts are still unclear. In this study, we assess whether and how catechol-O-methyltransferase (COMT) gene polymorphisms affect brain white matter integrity. We genotyped twelve single nucleotide polymorphisms (SNPs) within the COMT gene and performed haplotype analyses on data from 79 healthy subjects. Our subjects had the same three major COMT haplotypes (termed the HPS, APS and LPS haplotypes) as previous studies have reported as regulating significantly different levels of enzymatic activity and dopamine. We used the mean fractional anisotropy (FA) values from four regions and five tracts of interest to assess the effect of COMT polymorphisms, including the well-studied val158met SNP and the three main haplotypes that we had identified, on intelligence-related white matter integrity. We identified an association between the mean FA values of two regions in the bilateral prefrontal lobes and the COMT haplotypes, rather than between them and val158met. The haplotype-FA value associations modulated nonlinearly and fit an inverted U-model. Our findings suggest that COMT haplotypes can nonlinearly modulate the intelligence-related white matter integrity of the prefrontal lobes by more significantly influencing prefrontal dopamine variations than does val158met. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  11. WhatsHap: Haplotype Assembly for Future-Generation Sequencing Reads

    NARCIS (Netherlands)

    M.D. Patterson (Murray); T. Marschall (Tobias); N. Pisanti (Nadia); L.J.J. van Iersel (Leo); L. Stougie (Leen); G.W. Klau (Gunnar); A. Schönhuth (Alexander)

    2014-01-01

    htmlabstractThe human genome is diploid, that is each of its chromosomes comes in two copies. This requires to phase the single nucleotide polymorphisms (SNPs), that is, to assign them to the two copies, beyond just detecting them. The resulting haplotypes, lists of SNPs belonging to each copy, are

  12. WhatsHap: Haplotype Assembly for Future-Generation Sequencing Reads

    NARCIS (Netherlands)

    Patterson, M.; Marschall, T.; Pisanti, N.; van Iersel, L.J.J.; Stougie, L.; Klau, G.W.; Schoenhuth, A.

    2014-01-01

    The human genome is diploid, that is each of its chromosomes comes in two copies. This requires to phase the single nucleotide polymorphisms (SNPs), that is, to assign them to the two copies, beyond just detecting them. The resulting haplotypes, lists of SNPs belonging to each copy, are crucial for

  13. Endothelial Nitric Oxide Synthase Haplotypes Are Associated with Preeclampsia in Maya Mestizo Women

    Directory of Open Access Journals (Sweden)

    Lizbeth Díaz-Olguín

    2011-01-01

    Full Text Available Preeclampsia is a specific disease of pregnancy and believed to have a genetic component. The aim of this study was to investigate if three polymorphisms in eNOS or their haplotypes are associated with preeclampsia in Maya mestizo women.

  14. Association of phospholipase A2 receptor 1 polymorphisms with idiopathic membranous nephropathy in Chinese patients in Taiwan

    Directory of Open Access Journals (Sweden)

    Liao Wen-Ling

    2010-10-01

    Full Text Available Abstract Background Idiopathic membranous nephropathy (IMN is one of the most common forms of autoimmune nephritic syndrome in adults. The purpose of this study is to evaluate whether polymorphisms of PLA2R1 affect the development of IMN. Methods Taiwanese-Chinese individuals (129 patients with IMN and 106 healthy controls were enrolled in this study. The selected single nucleotide polymorphisms (SNPs in PLA2R1 were genotyped by real-time polymerase chain reaction using TaqMan fluorescent probes, and were further confirmed by polymerase chain reaction-restriction fragment length polymorphism. The roles of the SNPs in disease progression were analyzed. Results Genotype distribution was significantly different between patients with IMN and controls for PLA2R1 SNP rs35771982 (p = 0.015. The frequency of G allele at rs35771982 was significantly higher in patients with IMN as compared with controls (p = 0.005. In addition, haplotypes of PLA2R1 may be used to predict the risk of IMN (p = 0.004. Haplotype H1 plays a role in an increased risk of IMN while haplotype H3 plays a protective role against this disease. None of these polymorphisms showed a significant and independent influence on the progression of IMN and the risk of end-stage renal failure and death (ESRF/death. High disease progression in patients having C/T genotype at rs6757188 and C/G genotype at rs35771982 were associated with a low rate of remission. Conclusions Our results provide new evidence that genetic polymorphisms of PLA2R1 may be the underlying cause of IMN, and the polymorphisms revealed by this study warrant further investigation.

  15. Multi-drug resistance-1 gene polymorphisms in nephrotic syndrome: impact on susceptibility and response to steroids.

    Science.gov (United States)

    Youssef, Doaa M; Attia, Tarek A; El-Shal, Amal S; Abduelometty, Fawzya A

    2013-11-10

    Role of multidrug resistance-1 (MDR-1) gene polymorphisms has not been clarified in nephrotic syndrome (NS). Additionally, researchers studied several genetic polymorphisms to explain their influence on different patients' responses to steroid; however the data were inconsistent. Therefore, we aimed to investigate the association of MDR-1 gene polymorphisms [C1236T, G2677T/A, C3435T] and haplotypes with susceptibility to childhood nephrotic syndrome, and whether they influence steroid response. We detected MDR-1 gene polymorphisms using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) in 138 NS patients and 140 age and sex matched healthy children. The frequencies of MDR1 G2677T/A GT, GA, TT+AA genotypes or T allele, MDR1 C3435T TT genotype, and T allele genotype frequencies were significantly increased in NS group. While no significant differences were observed in distributions of C1236T genotypes or allele between NS patients and healthy children. Moreover, steroid non-responder NS patients had significantly higher frequencies of MDR1 G2677T/A GT, GA, and TT+AA genotypes than steroid responsive NS patients. We observed also that NS patients with age less than 6 years old had increased frequencies of MDR1 G2677T/A GT, GA, TT+AA genotypes or T allele MDR1 C3435T CT, TT genotypes and T allele. Interestingly the frequency of the TGC haplotype of MDR1 was lower in the initial steroid responders than in non-responders NS patients. On the contrary, there were no any association between the MDR1 haplotypes with NS susceptibility and they did not influence renal pathological findings. Our data suggested that MDR1 C3435T or G2677T/A gene polymorphisms are risk factors of increased susceptibility, earlier onset of NS, and steroid resistance. © 2013 Elsevier B.V. All rights reserved.

  16. Diverticulitis and Crohn's disease have distinct but overlapping tumor necrosis superfamily 15 haplotypes.

    Science.gov (United States)

    Connelly, Tara M; Choi, Christine S; Berg, Arthur S; Harris, Leonard; Coble, Joel; Koltun, Walter A

    2017-06-15

    Diverticulitis (DD) and Crohn's disease (CD) have overlapping features including bowel structuring, inflammation, and infection. Tumor necrosis superfamily 15 (TNFSF15) is an immunoregulatory, anti-angiogenic gene. CD has been previously associated with a haplotype of five TNFSF15 single-nucleotide polymorphism alleles: rs3810936 (G allele), rs6478108 (A), rs6478109 (G), rs7848647 (G), and rs7869487 (A). We aimed to determine the TNFSF15 risk haplotype for DD versus controls with a subgroup analysis of youthful DD patients (aged ≤55 y) versus older controls (aged ≥55 y). A total of 148 diverticulitis patients (90 aged ≤55 y) and 200 controls (87 aged ≥55 y) were genotyped using our custom-designed Illumina Veracode microarray chip. Genotypes from rs3810936, rs6478108, rs6478109, rs7848647, rs7869487 and two additional TNFSF15 single nucleotide polymorphisms, rs3810936 and rs11554257, were analyzed. PHASE version 2.1, R with HaploStats and the Broad Institute's Haploview program were used for statistics and imputed haplotype frequency. Permutation corrected for multiple comparisons. The CD GAGGA haplotype was significantly associated with diverticulitis (P = 0.03) in the all DD versus all controls comparison. A second haplotype, rs6478108 (A), rs6478109 (G), rs7869487 (A), and rs4263839 (G), was also associated with DD in this cohort (P = 0.025). A third haplotype rs6478108 (A), rs6478109 (G), rs7848647 (G) and rs7869487 (A), rs4263839 (G) was demonstrated in the DD 55 comparison (P = 0.045). Distinct but overlapping TNFSF15 haplotypes were demonstrated in diverticulitis patients versus healthy controls when compared with the known Crohn's risk haplotype suggesting similar but distinct genetic predispositions. This study strengthens the role for a genetic predisposition to diverticulitis that involves the TNFSF15 gene. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Influence of ?S-globin haplotypes and hydroxyurea on tumor necrosis factor-alpha levels in sickle cell anemia

    Directory of Open Access Journals (Sweden)

    Marília Rocha Laurentino

    2014-04-01

    Full Text Available Background: Sickle cell anemia is a chronic inflammatory disease characterized by an increased production of proinflammatory cytokines including tumor necrosis factor-alpha. Hydroxyurea, by decreasing the polymerization of hemoglobin, reduces inflammatory states. The effect of the genetic polymorphisms of sickle cell patients on tumor necrosis factor-alpha levels remains unknown. Objective: The aim of this study was to investigate the association of tumor necrosis factor-alpha levels with β-globin haplotypes and the use of hydroxyurea. Methods: A cross-sectional study was performed of 67 patients with sickle cell anemia diagnosed at steady-state in a referral hospital in Fortaleza, Ceará, Brazil. A group of 26 healthy individuals was used as control. βS-haplotype analysis was performed by restriction fragment length polymorphism-polymerase chain reaction. The tumor necrosis factor-alpha levels were measured by the enzyme-linked immunosorbent assay test. Laboratory data (complete blood count and fetal hemoglobin and information regarding the use of hydroxyurea were obtained from medical records. Statistical analysis was performed using R software with the Kruskal-Wallis and Mann-Whitney tests. Statistical significance was established for p-values < 0.05 for all analyses. Results: The mean age of the participants was 35.48 years. Patients with sickle cell anemia had significantly higher tumor necrosis factor-alpha levels than controls (p-values < 0.0001. Tumor necrosis factor-alpha levels were lower in sickle cell anemia patients who were receiving hydroxyurea treatment than those who were not (p-value = 0.1249. Sickle cell anemia patients with Bantu/n genotype had significantly higher levels than patients with the Bantu/Benin genotype (p-value = 0.0021. Conclusion: In summary, βS-globin haplotypes, but not hydroxyurea therapy, have a role in modulating tumor necrosis factor-alpha levels in sickle cell anemia adults at steady-state. Many

  18. A Genome-Wide Association Study for Agronomic Traits in Soybean Using SNP Markers and SNP-Based Haplotype Analysis.

    Directory of Open Access Journals (Sweden)

    Rodrigo Iván Contreras-Soto

    Full Text Available Mapping quantitative trait loci through the use of linkage disequilibrium (LD in populations of unrelated individuals provides a valuable approach for dissecting the genetic basis of complex traits in soybean (Glycine max. The haplotype-based genome-wide association study (GWAS has now been proposed as a complementary approach to intensify benefits from LD, which enable to assess the genetic determinants of agronomic traits. In this study a GWAS was undertaken to identify genomic regions that control 100-seed weight (SW, plant height (PH and seed yield (SY in a soybean association mapping panel using single nucleotide polymorphism (SNP markers and haplotype information. The soybean cultivars (N = 169 were field-evaluated across four locations of southern Brazil. The genome-wide haplotype association analysis (941 haplotypes identified eleven, seventeen and fifty-nine SNP-based haplotypes significantly associated with SY, SW and PH, respectively. Although most marker-trait associations were environment and trait specific, stable haplotype associations were identified for SY and SW across environments (i.e., haplotypes Gm12_Hap12. The haplotype block 42 on Chr19 (Gm19_Hap42 was confirmed to be associated with PH in two environments. These findings enable us to refine the breeding strategy for tropical soybean, which confirm that haplotype-based GWAS can provide new insights on the genetic determinants that are not captured by the single-marker approach.

  19. Methylenetetrahydrofolate reductase C677T and A1298C polymorphism and susceptibility to acute lymphoblastic leukemia in a cohort of Egyptian children.

    Science.gov (United States)

    Mosaad, Youssef M; Abousamra, Nashwa K; Elashery, Rasha; Fawzy, Iman M; Eldein, Omar A Sharaf; Sherief, Doaa M; El Azab, Hend M M

    2015-01-01

    This case-control study was planned to investigate the possible role of methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms as a risk factor for the development of acute lymphoblastic leukemia (ALL) in a cohort of Egyptian children. Typing of MTHFR C677T and A1298C polymorphisms was done using restriction fragment length polymorphism (RFLP) for 100 children with ALL and 100 age- and sex-matched healthy controls. No significant differences were found between patients with ALL and controls for the frequency of MTHFR C677T and A1298C alleles, genotypes, combined genotypes or haplotypes. The C677T and A1298C genotype frequency was different from that in Korean and Chinese populations (p 0.5). Our findings suggest that MTHFR C677T and A1298C polymorphisms are unlikely to affect the development of childhood ALL in an Egyptian population from Delta.

  20. Distribution of QPY and RAH haplotypes of granzyme B gene in distinct Brazilian populations

    Directory of Open Access Journals (Sweden)

    Fernanda Bernadelli Garcia

    2012-08-01

    Full Text Available INTRODUCTION: The cytolysis mediated by granules is one of the most important effector functions of cytotoxic T lymphocytes and natural killer cells. Recently, three single nucleotide polymorphisms (SNPs were identified at exons 2, 3, and 5 of the granzyme B gene, resulting in a haplotype in which three amino acids of mature protein Q48P88Y245 are changed to R48A88H245, which leads to loss of cytotoxic activity of the protein. In this study, we evaluated the frequency of these polymorphisms in Brazilian populations. METHODS: We evaluated the frequency of these polymorphisms in Brazilian ethnic groups (white, Afro-Brazilian, and Asian by sequencing these regions. RESULTS: The allelic and genotypic frequencies of SNP 2364A/G at exon 2 in Afro-Brazilian individuals (42.3% and 17.3% were significantly higher when compared with those in whites and Asians (p < 0.0001 and p = 0.0007, respectively. The polymorphisms 2933C/G and 4243C/T also were more frequent in Afro-Brazilians but without any significant difference regarding the other groups. The Afro-Brazilian group presented greater diversity of haplotypes, and the RAH haplotype seemed to be more frequent in this group (25%, followed by the whites (20.7% and by the Asians (11.9%, similar to the frequency presented in the literature. CONCLUSIONS: There is a higher frequency of polymorphisms in Afro-Brazilians, and the RAH haplotype was more frequent in these individuals. We believe that further studies should aim to investigate the correlation of this haplotype with diseases related to immunity mediated by cytotoxic lymphocytes, and if this correlation is confirmed, novel treatment strategies might be elaborated.

  1. Differential fine-tuning of gene expression regulation in coffee leaves by CcDREB1D promoter haplotypes under water deficit.

    Science.gov (United States)

    Alves, Gabriel Sergio Costa; Torres, Luana Ferreira; Déchamp, Eveline; Breitler, Jean-Christophe; Joët, Thierry; Gatineau, Frédéric; Andrade, Alan Carvalho; Bertrand, Benoît; Marraccini, Pierre; Etienne, Hervé

    2017-05-17

    Despite the importance of the DREB1D gene (also known as CBF4) in plant responses to water deficit and cold stress, studies analysing its regulation by transgenic approaches are lacking. In the current work, a functional study of three CcDREB1D promoter haplotypes (named HP15, HP16 and HP17) isolated from drought-tolerant and drought-sensitive clones of Coffea canephora was carried out in plants of C. arabica stably transformed by Agrobacterium tumefaciens by analysing their ability to regulate the expression of the uidA reporter gene in response to water deficit mimicked by polyethylene glycol (-2.0 MPa) and low relative humidity treatments. A deletion analysis of their corresponding 5'-upstream regions revealed increased specificity of β-glucuronidase activity in the polyethylene glycol and low relative humidity treatments, with high expression in leaf mesophyll and guard cells in full-length constructs. RT-qPCR assays also revealed that the HP16 haplotype (specific to clone tolerant to water deficit) had stronger and earlier activity compared with the HP15 and HP17 haplotypes. As most of the cis-regulatory elements involved in ABA-dependent and -independent networks, tissue specificity and light regulation are common to these haplotypes, we propose that their organization, as well as the nucleic acid polymorphisms present outside these boxes, may play a role in modulating activities of DREB1D promoters in guard cells. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  2. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil

    Directory of Open Access Journals (Sweden)

    Wellington dos Santos Silva

    2010-01-01

    Full Text Available Five restriction site polymorphisms in the β-globin gene cluster (HincII-5'ε, HindIII-Gγ, HindIII-ªγ, HincII-'ψβ1 and HincII-3''ψβ1 were analyzed in three populations (n = 114 from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+----,3(----+,4(-+--+and6(-++-+onthe βA chromosomes were the most common, and two haplotypes, 9 (-++++and 14 (++--+, were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16 had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin and CAR (Central African Republic, with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  3. β-globin haplotypes in normal and hemoglobinopathic individuals from Reconcavo Baiano, State of Bahia, Brazil.

    Science.gov (United States)

    Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe

    2010-07-01

    Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.

  4. Genetic and molecular characterization of three novel S-haplotypes in sour cherry (Prunus cerasus L.).

    Science.gov (United States)

    Tsukamoto, Tatsuya; Potter, Daniel; Tao, Ryutaro; Vieira, Cristina P; Vieira, Jorge; Iezzoni, Amy F

    2008-01-01

    Tetraploid sour cherry (Prunus cerasus L.) exhibits gametophytic self-incompatibility (GSI) whereby the specificity of self-pollen rejection is controlled by alleles of the stylar and pollen specificity genes, S-RNase and SFB (S haplotype-specific F-box protein gene), respectively. As sour cherry selections can be either self-compatible (SC) or self-incompatible (SI), polyploidy per se does not result in SC. Instead the genotype-dependent loss of SI in sour cherry is due to the accumulation of non-functional S-haplotypes. The presence of two or more non-functional S-haplotypes within sour cherry 2x pollen renders that pollen SC. Two new S-haplotypes from sour cherry, S(33) and S(34), that are presumed to be contributed by the P. fruticosa species parent, the complete S-RNase and SFB sequences of a third S-haplotype, S(35), plus the presence of two previously identified sweet cherry S-haplotypes, S(14) and S(16) are described here. Genetic segregation data demonstrated that the S(16)-, S(33)-, S(34)-, and S(35)-haplotypes present in sour cherry are fully functional. This result is consistent with our previous finding that 'hetero-allelic' pollen is incompatible in sour cherry. Phylogenetic analyses of the SFB and S-RNase sequences from available Prunus species reveal that the relationships among S-haplotypes show no correspondence to known organismal relationships at any taxonomic level within Prunus, indicating that polymorphisms at the S-locus have been maintained throughout the evolution of the genus. Furthermore, the phylogenetic relationships among SFB sequences are generally incongruent with those among S-RNase sequences for the same S-haplotypes. Hypotheses compatible with these results are discussed.

  5. An ancestral haplotype of the human PERIOD2 gene associates with reduced sensitivity to light-induced melatonin suppression.

    Directory of Open Access Journals (Sweden)

    Tokiho Akiyama

    Full Text Available Humans show various responses to the environmental stimulus in individual levels as "physiological variations." However, it has been unclear if these are caused by genetic variations. In this study, we examined the association between the physiological variation of response to light-stimulus and genetic polymorphisms. We collected physiological data from 43 subjects, including light-induced melatonin suppression, and performed haplotype analyses on the clock genes, PER2 and PER3, exhibiting geographical differentiation of allele frequencies. Among the haplotypes of PER3, no significant difference in light sensitivity was found. However, three common haplotypes of PER2 accounted for more than 96% of the chromosomes in subjects, and 1 of those 3 had a significantly low-sensitive response to light-stimulus (P < 0.05. The homozygote of the low-sensitive PER2 haplotype showed significantly lower percentages of melatonin suppression (P < 0.05, and the heterozygotes of the haplotypes varied their ratios, indicating that the physiological variation for light-sensitivity is evidently related to the PER2 polymorphism. Compared with global haplotype frequencies, the haplotype with a low-sensitive response was more frequent in Africans than in non-Africans, and came to the root in the phylogenetic tree, suggesting that the low light-sensitive haplotype is the ancestral type, whereas the other haplotypes with high sensitivity to light are the derived types. Hence, we speculate that the high light-sensitive haplotypes have spread throughout the world after the Out-of-Africa migration of modern humans.

  6. Different patterns of evolution in the centromeric and telomeric regions of group A and B haplotypes of the human killer cell Ig-like receptor locus.

    Directory of Open Access Journals (Sweden)

    Chul-Woo Pyo

    Full Text Available The fast evolving human KIR gene family encodes variable lymphocyte receptors specific for polymorphic HLA class I determinants. Nucleotide sequences for 24 representative human KIR haplotypes were determined. With three previously defined haplotypes, this gave a set of 12 group A and 15 group B haplotypes for assessment of KIR variation. The seven gene-content haplotypes are all combinations of four centromeric and two telomeric motifs. 2DL5, 2DS5 and 2DS3 can be present in centromeric and telomeric locations. With one exception, haplotypes having identical gene content differed in their combinations of KIR alleles. Sequence diversity varied between haplotype groups and between centromeric and telomeric halves of the KIR locus. The most variable A haplotype genes are in the telomeric half, whereas the most variable genes characterizing B haplotypes are in the centromeric half. Of the highly polymorphic genes, only the 3DL3 framework gene exhibits a similar diversity when carried by A and B haplotypes. Phylogenetic analysis and divergence time estimates, point to the centromeric gene-content motifs that distinguish A and B haplotypes having emerged ~6 million years ago, contemporaneously with the separation of human and chimpanzee ancestors. In contrast, the telomeric motifs that distinguish A and B haplotypes emerged more recently, ~1.7 million years ago, before the emergence of Homo sapiens. Thus the centromeric and telomeric motifs that typify A and B haplotypes have likely been present throughout human evolution. The results suggest the common ancestor of A and B haplotypes combined a B-like centromeric region with an A-like telomeric region.

  7. Elite Haplotypes of a Protein Kinase GeneTaSnRK2.3Associated with Important Agronomic Traits in Common Wheat.

    Science.gov (United States)

    Miao, Lili; Mao, Xinguo; Wang, Jingyi; Liu, Zicheng; Zhang, Bin; Li, Weiyu; Chang, Xiaoping; Reynolds, Matthew; Wang, Zhenhua; Jing, Ruilian

    2017-01-01

    Plant-specific protein kinase SnRK2s play crucial roles in response to various environmental stimuli. TaSnRK2.3 , a SnRK2 member, was involved in the response to multiple abiotic stresses in wheat. To facilitate the use of TaSnRK2.3 in wheat breeding, the three genomic sequences of TaSnRK2.3 , originating from the A, B, and D genomes of hexaploid wheat, were obtained. Sequence polymorphism assays showing 4 and 10 variations were detected at TaSnRK2.3-1A and at TaSnRK2.3-1B , respectively, yet no variation was identified at TaSnRK2.3-1D . Three haplotypes for A genome, and two main haplotypes for B genome of TaSnRK2.3 were identified in 32 genotypes. Functional markers (2.3AM1, 2.3AM2, 2.3BM1, 2.3BM2) were successfully developed to distinguish different haplotypes. Association analysis was performed with the general linear model in TASSEL 2.1. The results showed that both TaSnRK2.3-1A and TaSnRK2.3-1B were significantly associated with plant height (PH), length of peduncle and penultimate node, as well as 1,000-grain weight (TGW) under different environments. Additionally, TaSnRK2.3-1B was significantly associated with stem water-soluble carbohydrates at flowering and mid-grain filling stages. Hap -1A-1 had higher TGW and lower PH; Hap -1B-1 had higher TGW and stem water-soluble carbohydrates, as well as lower PH, thus the two haplotypes were considered as elite haplotypes. Geographic distribution and allelic frequencies indicated that the two preferred haplotypes Hap -1A-1 and Hap -1B-1 were positively selected in the process of Chinese wheat breeding. These results could be valuable for genetic improvement and germplasm enhancement using molecular marker assisted selection in wheat breeding.

  8. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  9. FCRL3 gene polymorphisms confer autoimmunity risk for allergic rhinitis in a Chinese Han population.

    Directory of Open Access Journals (Sweden)

    Zheng Gu

    Full Text Available Heredity and environmental exposures may contribute to a predisposition to allergic rhinitis (AR. Autoimmunity may also involve into this pathologic process. FCRL3 (Fc receptor-like 3 gene, a novel immunoregulatory gene, has recently been reported to play a role in autoimmune diseases.This study was performed to evaluate the potential association of FCRL3 polymorphisms with AR in a Chinese Han population.Five single-nucleotide polymorphisms of FCRL3, rs945635, rs3761959, rs7522061, rs10489678 and rs7528684 were genotyped in 540 AR patients and 600 healthy controls using a PCR-restriction fragment length polymorphism assay. Allele, genotype and haplotype frequencies were compared between patients and controls using the χ2 test. The online software platform SHEsis was used to analyze their haplotypes.This study identified three strong risk SNPs rs7528684, rs10489678, rs7522061 and one weak risk SNP rs945635 of FCRL3 in Chinese Han AR patients. For rs7528684, a significantly increased prevalence of the AA genotype and A allele in AR patients was recorded. The frequency of the GG genotype and G allele of rs10489678 was markedly higher in AR patients than those in controls. For rs7522061, a higher frequency of the TT genotype, and a lower frequency of the CT genotype were found in AR patients. Concerning rs945635, a lower frequency of the CC genotype, and a higher frequency of G allele were observed in AR patients. According to the analysis of the three strong positive SNPs, the haplotype of AGT increased significantly in AR cases (AR = 38.8%, Controls = 24.3%, P = 8.29 × 10(-14, OR [95% CI] 1.978 [1.652~2.368].This study found a significant association between the SNPs in FCRL3 gene and AR in Chinese Han patients. The results suggest these gene polymorphisms might be the autoimmunity risk for AR.

  10. Interferon regulatory factor 5 gene polymorphism in Egyptian children with systemic lupus erythematosus.

    Science.gov (United States)

    Hammad, A; Mossad, Y M; Nasef, N; Eid, R

    2017-07-01

    Background Increased expression of interferon-inducible genes is implicated in the pathogenesis of systemic lupus erythematosus (SLE). Interferon regulatory factor 5 (IRF5) is one of the transcription factors regulating interferon and was proved to be implicated in the pathogenesis of SLE in different populations. Objectives The objective of this study was to investigate the correlation between polymorphisms of the IRF5 gene and SLE susceptibility in a cohort of Egyptian children and to investigate their association with clinico-pathological features, especially lupus nephritis. Subjects and methods Typing of interferon regulatory factor 5 rs10954213, rs2004640 and rs2280714 polymorphisms were done using polymerase chain reaction-restriction fragment length polymorphism for 100 children with SLE and 100 matched healthy controls. Results Children with SLE had more frequent T allele and TT genotype of rs2004640 ( P c  = 0.003 and 0.024, respectively) compared to controls. Patients with nephritis had more frequent T allele of rs2004640 compared to controls ( P c  = 0.003). However the allele and genotype frequencies of the three studied polymorphisms did not show any difference in patients with nephritis in comparison to those without nephritis. Haplotype GTA of rs10954213, rs2004640 and rs2280714, respectively, was more frequent in lupus patients in comparison to controls ( p = 0.01) while the haplotype GGG was more frequent in controls than lupus patients ( p = 0.011). Conclusion The rs2004640 T allele and TT genotype and GTA haplotype of rs rs10954213, rs2004640, and rs2280714, respectively, can be considered as risk factors for the development of SLE. The presence of the rs2004640 T allele increases the risk of nephritis development in Egyptian children with SLE.

  11. Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

    Science.gov (United States)

    Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

    2018-04-01

    HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. HLA class II linkage disequilibrium and haplotype evolution in the Cayapa Indians of Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Trachtenberg, E.A.; Erlich, H.A. [Roche Molecular Systems, Alameda, CA (United States); Klitz, W. [Univ. of California, Berkeley, CA (United States)] [and others

    1995-08-01

    DNA-based typing of the HLA class II loci in a sample of the Cayapa Indians of Ecuador reveals several lines of evidence that selection has operated to maintain and to diversify the existing level of polymorphism in the class II region. As has been noticed for other Native American groups, the overall level of polymorphism at the DRB1, DQA1, DQB1, and DPB1 loci is reduced relative to that found in other human populations. Nonetheless, the relative eveness in the distribution of allele frequencies at each of the four loci points to the role of balancing selection in the maintenance of the polymorphism. The DQA1 and DQB1 loci, in particular, have near-maximum departures from the neutrality model, which suggests that balancing selection has been especially strong in these cases. Several novel DQA1-DQB1 haplotypes and the discovery of a new DRB1 allele demonstrate an evolutionary tendency favoring the diversification of class II alleles and haplotypes. The recombination interval between the centromeric DPB1 locus and the other class II loci will, in the absence of other forces such as selection, reduce disequilibrium across this region. However, nearly all common alleles were found to be part of DR-DP haplotypes in strong disequilibrium, consistent with the recent action of selection acting on these haplotypes in the Cayapa. 50 refs., 3 figs., 3 tabs.

  13. Haplotype and linkage disequilibrium analysis of the CRMP1 and EVC genes.

    Science.gov (United States)

    Sivakumaran, Theru A; Lesperance, Marci M

    2004-11-01

    In this report, we present the haplotype and linkage disequilibrium (LD) pattern in the Collapsin Response Mediator Protein 1 (CRMP1) and Ellis-van Creveld syndrome (EVC) gene region. We genotyped eight different single nucleotide polymorphisms (SNPs) in the CRMP1 and EVC genes in 90 control individuals of diverse ethnicity. The minor allele frequencies ranged from 3.3-49.4%, with most having a frequency >25%. A total of 37 haplotypes were derived from these eight polymorphisms, with only one haplotype having a frequency >10%. Pairwise LD analysis showed a weak but significant LD between markers located about 243 kb apart in this region. The LD was significant between markers spaced about 208 kb apart in EVC, whereas no LD was found between a pair of markers located about 5 kb apart in CRMP1. However, in general, LD correlated with the distance between loci. The CRMP1 and EVC genes are located near WFS1, the Wolfram syndrome type 1 gene, in which mutations also cause low frequency sensorineural hearing loss (LFSNHL). The haplotypes obtained from these polymorphisms will be useful to track the segregation of phenotypes in families with Ellis-van Creveld syndrome, Weyers acrodental dysostosis, LFSNHL and Wolfram syndrome type 1.

  14. Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA

    Directory of Open Access Journals (Sweden)

    Nidia Gutiérrez-López

    2016-04-01

    Full Text Available Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations and genetic origin (based on a previous study. We identified six polymorphic sites, including five insertion/deletion (indels types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038. Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80 with 10 and 12 haplotypes, respectively. The common haplotype (H1 for both networks included cacao trees from all geographic locations (geographic approach and four genetic groups (genetic approach. This common haplotype (ancient derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0 and SAMOVA (FST = 0.04393 results. One population (Mazatán showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding.

  15. Association of vitamin D receptor gene polymorphisms with polycystic ovary syndrome among Indian women

    Directory of Open Access Journals (Sweden)

    Shilpi Dasgupta

    2015-01-01

    Full Text Available Background & objectives: The Vitamin-D receptor (VDR regulates vitamin D levels and calcium metabolism in the body and these are known to be associated with endocrine dysfunctions, insulin resistance and type-2 diabetes in polycystic ovarian syndrome (PCOS. Studies on VDR polymorphisms among PCOS women are sparse. We undertook this study to investigate the association pattern of VDR polymorphisms (Cdx2, Fok1, Apa1 and Taq1 with PCOS among Indian women. Methods: For the present study, 250 women with PCOS and 250 normal healthy control women were selected from Hyderabad city, Telangana, India. The four VDR polymorphisms were genotyped and analysed using ASM-PCR (allele specific multiple PCR and PCR-RFLP (restriction fragment length polymorphism. Results: The genotype and allele frequency distributions of only Cdx2 showed significant difference between the PCOS cases and control women, indicating protective role of this SNP against PCOS phenotype. However, significant association was observed between VDR genotypes and some of the PCOS specific clinical/biochemical traits. For example, Fok1 showed a significant genotypic difference for the presence of infertility and Cdx2 genotpes showed association with testosterone levels. Further, the two haplotypes, ACCA and ACTA, were found to be significantly associated with PCOS indicating haplotype specific risk. Interpretation & conclusions: Although VDR polymorphisms have not shown significant association with PCOS, in view of functional significance of the SNPs considered, one cannot yet rule out the possibility of their association with PCOS. Further, specifically designed studies on large cohorts are required to conclusively establish the role of VDR polymorphisms in PCOS, particularly including data on vitamin D levels.

  16. Assembly and analysis of 100 full MHC haplotypes from the Danish population

    DEFF Research Database (Denmark)

    Jensen, Jacob M.; Villesen, Palle; Friborg, Rune M.

    2017-01-01

    Genes in the major histocompatibility complex (MHC, also known as HLA) play a critical role in the immune response and variation within the extended 4-Mb region shows association with major risks of many diseases. Yet, deciphering the underlying causes of these associations is difficult because...... the MHC is the most polymorphic region of the genome with a complex linkage disequilibrium structure. Here, we reconstruct full MHC haplotypes from de novo assembled trios without relying on a reference genome and perform evolutionary analyses. We report 100 full MHC haplotypes and call a large set...

  17. Longer telomere length in peripheral white blood cells is associated with risk of lung cancer and the rs2736100 (CLPTM1L-TERT polymorphism in a prospective cohort study among women in China.

    Directory of Open Access Journals (Sweden)

    Qing Lan

    Full Text Available A recent genome-wide association study of lung cancer among never-smoking females in Asia demonstrated that the rs2736100 polymorphism in the TERT-CLPTM1L locus on chromosome 5p15.33 was strongly and significantly associated with risk of adenocarcinoma of the lung. The telomerase gene TERT is a reverse transcriptase that is critical for telomere replication and stabilization by controlling telomere length. We previously found that longer telomere length measured in peripheral white blood cell DNA was associated with increased risk of lung cancer in a prospective cohort study of smoking males in Finland. To follow up on this finding, we carried out a nested case-control study of 215 female lung cancer cases and 215 female controls, 94% of whom were never-smokers, in the prospective Shanghai Women's Health Study cohort. There was a dose-response relationship between tertiles of telomere length and risk of lung cancer (odds ratio (OR, 95% confidence interval [CI]: 1.0, 1.4 [0.8-2.5], and 2.2 [1.2-4.0], respectively; P trend = 0.003. Further, the association was unchanged by the length of time from blood collection to case diagnosis. In addition, the rs2736100 G allele, which we previously have shown to be associated with risk of lung cancer in this cohort, was significantly associated with longer telomere length in these same study subjects (P trend = 0.030. Our findings suggest that individuals with longer telomere length in peripheral white blood cells may have an increased risk of lung cancer, but require replication in additional prospective cohorts and populations.

  18. Bayesian genomic selection: the effect of haplotype lenghts and priors

    DEFF Research Database (Denmark)

    Villumsen, Trine Michelle; Janss, Luc

    2009-01-01

    Breeding values for animals with marker data are estimated using a genomic selection approach where data is analyzed using Bayesian multi-marker association models. Fourteen model scenarios with varying haplotype lengths, hyper parameter and prior distributions were compared to find the scenario...... expected to give the most correct genomic estimated breeding values for animals with marker information only. Five-fold cross validation was performed to assess the ability of models to estimate breeding values for animals in generation 3. In each of the five subsets, 20% of phenotypic records...... well. Correlations were 0.77-0.89 and predicted breeding values were biased. In addition the models seemed to over fit the genomic part of the variation. Highest correlations and most unbiased results were obtained when SNP markers were joined into haplotypes. Especially the scenarios with 5-SNP...

  19. The association of the JAK2 46/1 haplotype with non-splanchnic venous thrombosis.

    Science.gov (United States)

    Zerjavic, Katja; Zagradisnik, Boris; Lokar, Lidija; Krasevac, Marjana G; Vokac, Nadja K

    2013-08-01

    The inherited JAK2 46/1 haplotype is strongly associated with the development of myeloproliferative neoplasms (MPNs), and its increased frequency has also been reported in splanchnic venous thrombosis (SVT). In the present study, the role of the JAK2 46/1 haplotype in non-splanchnic venous thrombosis (non-SVT) was investigated. We genotyped 438 patients with non-SVT, 226 patients with MPNs and 459 healthy controls for three single nucleotide polymorphisms (SNPs) which tag the JAK2 46/1 haplotype (rs12342421 G>C, rs12343867 T>C and rs10974944 C>G). We found statistically significant association of the rs12342421 GC+CC genotypes (OR=1.40; p=0.023) and the rs12343867 TC+CC genotypes (OR=1.83; p=7.02 x 10(-5)) with non-SVT. We also found that the CC haplotype of these two SNPs was associated with an increased risk of the disease (OR=1.68; p=0.009). Stratification analysis indicated that the observed association of the JAK2 46/1 haplotype with non-SVT was probably largely free of confounding effect of thrombophilic risk factors. In addition, we established a strong association of SNPs rs12342421 and rs10974944 and their CG haplotype with MPNs and with JAK2 V617F-positive MPNs. This study provides statistical evidence that SNPs rs12342421 and rs12343867 are associated with an increased risk of non-SVT. Consistently, haplotypes of the SNPs were also associated with non-SVT risk, suggesting that inherited genetic variation in the JAK2 gene may play a role in the pathogenesis of non-SVT. Furthermore, the reported associations of the JAK2 46/1 haplotype with MPNs as well as with the occurrence of the JAK2 V617F mutation in MPNs were confirmed. © 2013.

  20. Genetic analysis of completely sequenced disease-associated MHC haplotypes identifies shuffling of segments in recent human history.

    Directory of Open Access Journals (Sweden)

    James A Traherne

    2006-01-01

    Full Text Available The major histocompatibility complex (MHC is recognised as one of the most important genetic regions in relation to common human disease. Advancement in identification of MHC genes that confer susceptibility to disease requires greater knowledge of sequence variation across the complex. Highly duplicated and polymorphic regions of the human genome such as the MHC are, however, somewhat refractory to some whole-genome analysis methods. To address this issue, we are employing a bacterial artificial chromosome (BAC cloning strategy to sequence entire MHC haplotypes from consanguineous cell lines as part of the MHC Haplotype Project. Here we present 4.25 Mb of the human haplotype QBL (HLA-A26-B18-Cw5-DR3-DQ2 and compare it with the MHC reference haplotype and with a second haplotype, COX (HLA-A1-B8-Cw7-DR3-DQ2, that shares the same HLA-DRB1, -DQA1, and -DQB1 alleles. We have defined the complete gene, splice variant, and sequence variation contents of all three haplotypes, comprising over 259 annotated loci and over 20,000 single nucleotide polymorphisms (SNPs. Certain coding sequences vary significantly between different haplotypes, making them candidates for functional and disease-association studies. Analysis of the two DR3 haplotypes allowed delineation of the shared sequence between two HLA class II-related haplotypes differing in disease associations and the identification of at least one of the sites that mediated the original recombination event. The levels of variation across the MHC were similar to those seen for other HLA-disparate haplotypes, except for a 158-kb segment that contained the HLA-DRB1, -DQA1, and -DQB1 genes and showed very limited polymorphism compatible with identity-by-descent and relatively recent common ancestry (<3,400 generations. These results indicate that the differential disease associations of these two DR3 haplotypes are due to sequence variation outside this central 158-kb segment, and that shuffling of

  1. Interleukin-10 haplotypes in Celiac Disease in the Spanish population.

    Science.gov (United States)

    Núñez, Concepción; Alecsandru, Diana; Varadé, Jezabel; Polanco, Isabel; Maluenda, Carlos; Fernández-Arquero, Miguel; de la Concha, Emilio G; Urcelay, Elena; Martínez, Alfonso

    2006-03-31

    Celiac disease (CD) is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10) is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs) and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02) status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  2. Interleukin-10 haplotypes in Celiac Disease in the Spanish population

    Directory of Open Access Journals (Sweden)

    Fernández-Arquero Miguel

    2006-03-01

    Full Text Available Abstract Background Celiac disease (CD is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10 is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. Methods A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. Results No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02 status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. Conclusion The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  3. Estimating haplotype effects for survival data

    DEFF Research Database (Denmark)

    Scheike, Thomas; Martinussen, Torben; Silver, J

    2010-01-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplo...

  4. Haplotype block structure and its applications to association studies: power and study designs.

    Science.gov (United States)

    Zhang, Kui; Calabrese, Peter; Nordborg, Magnus; Sun, Fengzhu

    2002-12-01

    Recent studies have shown that the human genome has a haplotype block structure, such that it can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of single-nucleotide polymorphisms (SNPs), referred to as "tag SNPs," can be used to distinguish a large fraction of the haplotypes. These tag SNPs can potentially be extremely useful for association studies, in that it may not be necessary to genotype all SNPs; however, this depends on how much power is lost. Here we develop a simulation study to quantitatively assess the power loss for a variety of study designs, including case-control designs and case-parental control designs. First, a number of data sets containing case-parental or case-control samples are generated on the basis of a disease model. Second, a small fraction of case and control individuals in each data set are genotyped at all the loci, and a dynamic programming algorithm is used to determine the haplotype blocks and the tag SNPs based on the genotypes of the sampled individuals. Third, the statistical power of tests was evaluated on the basis of three kinds of data: (1) all of the SNPs and the corresponding haplotypes, (2) the tag SNPs and the corresponding haplotypes, and (3) the same number of randomly chosen SNPs as the number of tag SNPs and the corresponding haplotypes. We study the power of different association tests with a variety of disease models and block-partitioning criteria. Our study indicates that the genotyping efforts can be significantly reduced by the tag SNPs, without much loss of power. Depending on the specific haplotype block-partitioning algorithm and the disease model, when the identified tag SNPs are only 25% of all the SNPs, the power is reduced by only 4%, on average, compared with a power loss of approximately 12% when the same number of randomly chosen SNPs is used in a two-locus haplotype analysis. When the identified tag SNPs are approximately 14% of all the SNPs, the

  5. Novel harmful recessive haplotypes identified for fertility traits in Nordic Holstein cattle

    DEFF Research Database (Denmark)

    Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen

    2013-01-01

    Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die....... A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions...... carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele...

  6. Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

    Science.gov (United States)

    Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

    2009-09-01

    Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

  7. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    OpenAIRE

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length ...

  8. Oestrogen receptor α gene haplotype and postmenopausal breast cancer risk: a case control study

    International Nuclear Information System (INIS)

    Wedrén, Sara; Stiger, Fredrik; Persson, Ingemar; Baron, John; Weiderpass, Elisabete; Lovmar, Lovisa; Humphreys, Keith; Magnusson, Cecilia; Melhus, Håkan; Syvänen, Ann-Christine; Kindmark, Andreas; Landegren, Ulf; Fermér, Maria Lagerström

    2004-01-01

    Oestrogen receptor α, which mediates the effect of oestrogen in target tissues, is genetically polymorphic. Because breast cancer development is dependent on oestrogenic influence, we have investigated whether polymorphisms in the oestrogen receptor α gene (ESR1) are associated with breast cancer risk. We genotyped breast cancer cases and age-matched population controls for one microsatellite marker and four single-nucleotide polymorphisms (SNPs) in ESR1. The numbers of genotyped cases and controls for each marker were as follows: TA n , 1514 cases and 1514 controls; c.454-397C → T, 1557 cases and 1512 controls; c.454-351A → G, 1556 cases and 1512 controls; c.729C → T, 1562 cases and 1513 controls; c.975C → G, 1562 cases and 1513 controls. Using logistic regression models, we calculated odds ratios (ORs) and 95% confidence intervals (CIs). Haplotype effects were estimated in an exploratory analysis, using expectation-maximisation algorithms for case-control study data. There were no compelling associations between single polymorphic loci and breast cancer risk. In haplotype analyses, a common haplotype of the c.454-351A → G or c.454-397C → T and c.975C → G SNPs appeared to be associated with an increased risk for ductal breast cancer: one copy of the c.454-351A → G and c.975C → G haplotype entailed an OR of 1.19 (95% CI 1.06–1.33) and two copies with an OR of 1.42 (95% CI 1.15–1.77), compared with no copies, under a model of multiplicative penetrance. The association with the c.454-397C → T and c.975C → G haplotypes was similar. Our data indicated that these haplotypes were more influential in women with a high body mass index. Adjustment for multiple comparisons rendered the associations statistically non-significant. We found suggestions of an association between common haplotypes in ESR1 and the risk for ductal breast cancer that is stronger in heavy women

  9. Lack of association between dopamine-β hydroxylase gene and a history of suicide attempt in schizophrenia: comparison of molecular and statistical haplotype analyses.

    Science.gov (United States)

    Howe, Aaron S; Leung, Tiffany; Bani-Fatemi, Ali; Souza, Renan; Tampakeras, Maria; Zai, Clement; Kennedy, James L; Strauss, John; De Luca, Vincenzo

    2014-06-01

    In the present study, we examined whether there was an association between dopamine-β hydroxylase (DBH) promoter polymorphisms (a 5'-ins/del and a GTn repeats) and a history of suicide attempt in 223 chronic schizophrenia individuals using statistical and molecular analyses. Within the genetic association study design, we compared the statistical haplotype phase with the molecular phase produced by the amplicon size analysis. The two DBH polymorphisms were analysed using the Applied Biosystem 3130 and the statistical analyses were carried out using UNPHASED v.3.1.5 and PHASE v.2.1.1 to determine the haplotype frequencies and infer the phase in each patient. Then, DBH polymorphisms were incorporated into the Haploscore analysis to test the association with a history of suicide attempt. In our sample, 62 individuals had a history of suicide attempt. There was no association between DBH polymorphisms and a history of suicide attempt across the different analytical strategies applied. There was no significant difference between the haplotype frequencies produced by the amplicon size analysis and statistical analytical strategies. However, some of the haplotype pairs inferred in the PHASE analysis were inconsistent with the molecular haplotype size measured by the ABI 3130. The amplicon size analysis proved to be the most accurate method using the haplotype as a possible genetic marker for future testing. Although the results were not significant, further molecular analyses of the DBH gene and other candidate genes can clarify the utility of the molecular phase in psychiatric genetics and personalized medicine.

  10. 'Length'at Length

    Indian Academy of Sciences (India)

    Admin

    He was interested to know how `large' is the set of numbers x for which the series is convergent. Here large refers to its length. But his set is not in the class ♢. Here is another problem discussed by Borel. Consider .... have an infinite collection of pairs of new shoes and want to choose one shoe from each pair. We have an ...

  11. Glucose-6-phosphate dehydrogenase mutations and haplotypes in Mexican Mestizos.

    Science.gov (United States)

    Arámbula, E; Aguilar L, J C; Vaca, G

    2000-08-01

    In a screening for glucose-6-phosphate dehydrogenase (G-6-PD) deficiency in 1985 unrelated male subjects from the general population (Groups A and B) belonging to four states of the Pacific coast, 21 G-6-PD-deficient subjects were detected. Screening for mutations at the G-6-PD gene by PCR-restriction enzyme in these 21 G-6-PD-deficient subjects as well as in 14 G-6-PD-deficient patients with hemolytic anemia belonging to several states of Mexico showed two common G-6-PD variants: G-6-PD A-(202A/376G) (19 cases) and G-6-PD A-(376G/968C) (9 cases). In 7 individuals the mutations responsible for the enzyme deficiency remain to be determined. Furthermore, four silent polymorphic sites at the G-6-PD gene (PvuII, PstI, 1311, and NlaIII) were investigated in the 28 individuals with G-6-PD A- variants and in 137 G-6-PD normal subjects. As expected, only 10 different haplotypes were observed. To date, in our project aiming to determine the molecular basis of G-6-PD deficiency in Mexico, 60 unrelated G-6-PD-deficient Mexican males-25 in previous studies and 35 in the present work-have been studied. More than 75% of these individuals are from states of the Pacific coast (Sinaloa, Nayarit, Jalisco, Michoacán, Guerrero, Oaxaca, and Chiapas). The results show that although G-6-PD deficiency is heterogeneous at the DNA level in Mexico, only three polymorphic variants have been observed: G-6-PD A-(202A/376G) (36 cases), G-6-PD A-(376G/968C) (13 cases), and G-6-PD Seattle(844C) (2 cases). G-6-PD A- variants are relatively distributed homogeneously and both variants explain 82% of the overall prevalence of G-6-PD deficiency. The variant G-6-PD A-(202A/376G) represents 73% of the G-6-PD A- alleles. Our data also show that the variant G-6-PD A-(376G/968C)-which has been observed in Mexico in the context of two different haplotypes-is more common than previously supposed. The three polymorphic variants that we observed in Mexico are on the same haplotypes as found in subjects from

  12. Sequence variation of bovine mitochondrial ND-5 between haplotypes of composite and Hereford Breeds of beef cattle

    Directory of Open Access Journals (Sweden)

    SUTARNO

    2002-07-01

    Full Text Available The aims of the study were to: Investigate polymorphisms in the ND-5 region of bovine mitochondrial DNA in the composite and purebred Hereford herds from the Wokalup selection experiment, sequencing and compare the sequences between haplotypes and published sequence from Genebank. A total of 194 Hereford and 235 composite breed cattle from Wokalup Research Station were used in this study. The mitochondrial DNA was extracted using Wizard genomic DNA purification system from Promega. ND-5 fragment of mitochondrial DNA was amplified using PCR and continued with RFLP. Each haplotypes were sequenced. PCR products of each haplotype were cloned into pCR II, transformed, colonies selection, plasmid DNA extraction continued with cycle sequencing. Polymorphisms were found in both breeds of cattle in ND-5 region of mitochondrial DNA by PCR-RFLP analysis. Sequencing analysis confirmed the RFLPs data.

  13. Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

    Directory of Open Access Journals (Sweden)

    Yaya Kassogue

    2015-10-01

    Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

  14. Identification of polymorphisms in the RNase3 gene and the association with allergic rhinitis.

    Science.gov (United States)

    Kang, Inhong; An, Xue-hua; Oh, Yeon-Kyun; Lee, Sang Heon; Jung, Ha Min; Chae, Soo-Cheon; Lee, Jae Hoon

    2010-03-01

    Eosinophil cationic protein (ECP), a potent cytotoxic molecule, is released by activated eosinophils. ECP has been suggested to be involved in tissue remodeling of allergic diseases. The ECP (RNase3) gene is a candidate gene in atopic diseases. RNase3 polymorphisms have been reported to have an association with atopy. We determined whether polymorphisms in the RNase3 gene are associated with allergic rhinitis in a Korean population. The Taqman assay, restriction fragment length polymorphism (PCR-RFLP), and high-resolution melt (HRM) were used for genotyping. Three single nucleotide polymorphisms (SNPs; g.-550A>G, g.371G>C, and g.499G>C) were identified. The genotype of the SNPs was analyzed in patients with allergic rhinitis and controls without allergic rhinitis. The genotype and allele frequencies were compared between both groups. The genotype frequencies of the g.-550A>G and g.371G>C SNPs were not significantly different between patients with allergic rhinitis and controls (P > 0.05). However, in patients with allergic rhinitis, the genotype and allele frequencies of the g.499G>C SNP of RNase 3 were significantly different from those of the control group (P associated with allergic rhinitis (P = 0.048), while the G-G-G haplotype was negatively associated with allergic rhinitis (P = 0.004). Our study suggests that RNase3 polymorphisms are potentially associated with susceptibility to allergic rhinitis.

  15. Genetic Diversity, Natural Selection and Haplotype Grouping of Plasmodium knowlesi Gamma Protein Region II (PkγRII): Comparison with the Duffy Binding Protein (PkDBPαRII).

    Science.gov (United States)

    Fong, Mun Yik; Rashdi, Sarah A A; Yusof, Ruhani; Lau, Yee Ling

    2016-01-01

    , and high inter-population genetic differentiation (FST index). The main differences between PkγRII and PkDBPαRII include length polymorphism and no departure from neutrality (as measured by Tajima's D statistics) in the PkγRII. Despite the biological difference between PkγRII and PkDBPαRII, both generally have similar genetic diversity level, natural selection, geographical haplotype clustering and inter-population genetic differentiation index.

  16. Characterisation of the genomic architecture of human chromosome 17q and evaluation of different methods for haplotype block definition

    Directory of Open Access Journals (Sweden)

    Ollier William

    2005-04-01

    Full Text Available Abstract Background The selection of markers in association studies can be informed through the use of haplotype blocks. Recent reports have determined the genomic architecture of chromosomal segments through different haplotype block definitions based on linkage disequilibrium (LD measures or haplotype diversity criteria. The relative applicability of distinct block definitions to association studies, however, remains unclear. We compared different block definitions in 6.1 Mb of chromosome 17q in 189 unrelated healthy individuals. Using 137 single nucleotide polymorphisms (SNPs, at a median spacing of 15.5 kb, we constructed haplotype block maps using published methods and additional methods we have developed. Haplotype tagging SNPs (htSNPs were identified for each map. Results Blocks were found to be shorter and coverage of the region limited with methods based on LD measures, compared to the method based on haplotype diversity. Although the distribution of blocks was highly variable, the number of SNPs that needed to be typed in order to capture the maximum number of haplotypes was consistent. Conclusion For the marker spacing used in this study, choice of block definition is not important when used as an initial screen of the region to identify htSNPs. However, choice of block definition has consequences for the downstream interpretation of association study results.

  17. Interactions between Serotonin Transporter Gene Haplotypes and Quality of Mothers' Parenting Predict the Development of Children's Noncompliance

    Science.gov (United States)

    Sulik, Michael J.; Eisenberg, Nancy; Lemery-Chalfant, Kathryn; Spinrad, Tracy L.; Silva, Kassondra M.; Eggum, Natalie D.; Betkowski, Jennifer A.; Kupfer, Anne; Smith, Cynthia L.; Gaertner, Bridget; Stover, Daryn A.; Verrelli, Brian C.

    2012-01-01

    The LPR and STin2 polymorphisms of the serotonin transporter gene (SLC6A4) were combined into haplotypes that, together with quality of maternal parenting, were used to predict initial levels and linear change in children's (N = 138) noncompliance and aggression from age 18-54 months. Quality of mothers' parenting behavior was observed when…

  18. HLA haplotypes in primary sclerosing cholangitis patients of admixed and non-European ancestry.

    Science.gov (United States)

    Henriksen, E K K; Viken, M K; Wittig, M; Holm, K; Folseraas, T; Mucha, S; Melum, E; Hov, J R; Lazaridis, K N; Juran, B D; Chazouillères, O; Färkkilä, M; Gotthardt, D N; Invernizzi, P; Carbone, M; Hirschfield, G M; Rushbrook, S M; Goode, E; Ponsioen, C Y; Weersma, R K; Eksteen, B; Yimam, K K; Gordon, S C; Goldberg, D; Yu, L; Bowlus, C L; Franke, A; Lie, B A; Karlsen, T H

    2017-10-01

    Primary sclerosing cholangitis (PSC) is strongly associated with several human leukocyte antigen (HLA) haplotypes. Due to extensive linkage disequilibrium and multiple polymorphic candidate genes in the HLA complex, identifying the alleles responsible for these associations has proven difficult. We aimed to evaluate whether studying populations of admixed or non-European descent could help in defining the causative HLA alleles. When assessing haplotypes carrying HLA-DRB1*13:01 (hypothesized to specifically increase the susceptibility to chronic cholangitis), we observed that every haplotype in the Scandinavian PSC population carried HLA-DQB1*06:03. In contrast, only 65% of HLA-DRB1*13:01 haplotypes in an admixed/non-European PSC population carried this allele, suggesting that further assessments of the PSC-associated haplotype HLA-DRB1*13:01-DQA1*01:03-DQB1*06:03 in admixed or multi-ethnic populations could aid in identifying the causative allele. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Haplotypes in the dystrophin DNA segment point to a mosaic origin of modern human diversity.

    Science.gov (United States)

    Zietkiewicz, Ewa; Yotova, Vania; Gehl, Dominik; Wambach, Tina; Arrieta, Isabel; Batzer, Mark; Cole, David E C; Hechtman, Peter; Kaplan, Feige; Modiano, David; Moisan, Jean-Paul; Michalski, Roman; Labuda, Damian

    2003-11-01

    Although Africa has played a central role in human evolutionary history, certain studies have suggested that not all contemporary human genetic diversity is of recent African origin. We investigated 35 simple polymorphic sites and one T(n) microsatellite in an 8-kb segment of the dystrophin gene. We found 86 haplotypes in 1,343 chromosomes from around the world. Although a classical out-of-Africa topology was observed in trees based on the variant frequencies, the tree of haplotype sequences reveals three lineages accounting for present-day diversity. The proportion of new recombinants and the diversity of the T(n) microsatellite were used to estimate the age of haplotype lineages and the time of colonization events. The lineage that underwent the great expansion originated in Africa prior to the Upper Paleolithic (27,000-56,000 years ago). A second group, of structurally distinct haplotypes that occupy a central position on the tree, has never left Africa. The third lineage is represented by the haplotype that lies closest to the root, is virtually absent in Africa, and appears older than the recent out-of-Africa expansion. We propose that this lineage could have left Africa before the expansion (as early as 160,000 years ago) and admixed, outside of Africa, with the expanding lineage. Contemporary human diversity, although dominated by the recently expanded African lineage, thus represents a mosaic of different contributions.

  20. Haplotyping a quantitative trait with a high-density map in experimental crosses.

    Directory of Open Access Journals (Sweden)

    Wei Hou

    Full Text Available BACKGROUND: The ultimate goal of genetic mapping of quantitative trait loci (QTL is the positional cloning of genes involved in any agriculturally or medically important phenotype. However, only a small portion (< or = 1% of the QTL detected have been characterized at the molecular level, despite the report of hundreds of thousands of QTL for different traits and populations. METHODS/RESULTS: We develop a statistical model for detecting and characterizing the nucleotide structure and organization of haplotypes that underlie QTL responsible for a quantitative trait in an F2 pedigree. The discovery of such haplotypes by the new model will facilitate the molecular cloning of a QTL. Our model is founded on population genetic properties of genes that are segregating in a pedigree, constructed with the mixture-based maximum likelihood context and implemented with the EM algorithm. The closed forms have been derived to estimate the linkage and linkage disequilibria among different molecular markers, such as single nucleotide polymorphisms, and quantitative genetic effects of haplotypes constructed by non-alleles of these markers. Results from the analysis of a real example in mouse have validated the usefulness and utilization of the model proposed. CONCLUSION: The model is flexible to be extended to model a complex network of genetic regulation that includes the interactions between different haplotypes and between haplotypes and environments.

  1. Identification of the Mislabeled Breast Cancer Samples by Mitochondrial DNA Haplotyping

    Directory of Open Access Journals (Sweden)

    Xiaogang Chen

    2015-01-01

    Full Text Available The task to identify whether an archival malignant tumor specimen had been mislabeled or interchanged is a challenging one for forensic genetics. The nuclear DNA (nDNA markers were affected by the aberration of tumor cells, so they were not suitable for personal identification when the tumor tissues were tested. In this study, we focused on a new solution - mitochondrial single nucleotide polymorphism (mtSNP haplotyping by a multiplex SNaPshot assay. To validate our strategy of haplotyping with 25 mtSNPs, we analyzed 15 pairs of cancerous/healthy tissues taken from patients with ductal breast carcinoma. The haplotypes of all the fifteen breast cancer tissues were matched with their paired breast tissues. The heteroplasmy at 2 sites, 14783A/G and 16519C/T was observed in one breast tissue, which indicated a mixture of related mitochondrial haplotypes. However, only one haplotype was retained in the paired breast cancer tissue, which could be considered the result of proliferation of tumor subclone. The allele drop-out and allele drop-in were observed when 39 STRs and 20 tri-allelic SNPs of nDNA were applied. Compared to nDNA markers applied, 25 mtSNPs were more stable without interference from aberrance of breast cancer. Also, two cases were presented where the investigation of haplotype with 25 mtSNPs was used to prove the origin of biopsy specimen with breast cancer. The mislabeling of biopsy specimen with breast cancer could be certified in one case but could not be supported in the other case. We highlight the importance of stability of mtSNP haplotype in breast cancer. It was implied that our multiplex SNaPshot assay with 25 mtSNPs was a useful strategy to identify mislabeled breast cancer specimen.

  2. Association between HIV-1 tropism and CCR5 human haplotype E in a Caucasian population.

    Science.gov (United States)

    Huik, Kristi; Avi, Radko; Uibopuu, Helen; Pauskar, Merit; Margus, Tõnu; Karki, Tõnis; Krispin, Tõnu; Kool, Piret; Rüütel, Kristi; Talu, Ave; Abel-Ollo, Katri; Uusküla, Anneli; Carrillo, Andrew; He, Weijing; Ahuja, Sunil K; Lutsar, Irja

    2014-07-01

    The influence of the diversity of CCR5 on HIV susceptibility and disease progression has been clearly demonstrated but how the variability of this gene influences the HIV tropism is poorly understood. We investigated whether CCR5 haplotypes are associated with HIV tropism in a Caucasian population. We evaluated 161 HIV-positive subjects in a cross-sectional study. CCR5 haplotypes were derived after genotyping 9 CCR2-CCR5 polymorphisms. The HIV subtype was determined by phylogenetic analysis using the maximum likelihood method and viral tropism by the genotypic tropism assay (geno2pheno). Associations between CCR5 haplotypes and viral tropism were determined using logistic regression analyses. Samples from 500 blood donors were used to evaluate the representativeness of HIV-positives in terms of CCR5 haplotype distribution. The distribution of CCR5 haplotypes was similar in HIV-positive subjects and blood donors. The majority of viruses (93.8%) belonged to HIV-1 CRF06_cpx; 7.5% were X4, and the remaining were R5 tropic. X4 tropic viruses were over represented among people with CCR5 human haplotype E (HHE) compared with those without this haplotype (13.0% vs 1.4%; P = 0.006). People possessing CCR5 HHE had 11 times increased odds (odds ratio = 11.00; 95% confidence interval: 1.38 to 87.38) of having X4 tropic viruses than those with non-HHE. After adjusting for antiretroviral (ARV) therapy, neither the presence of HHE nor the use of ARV was associated with X4 tropic viruses. Our results suggest that CCR5 HHE and ARV treatment might be associated with the presence of HIV-1 X4 tropic viruses.

  3. B7-H4 gene polymorphisms are associated with sporadic breast cancer in a Chinese Han population

    International Nuclear Information System (INIS)

    Zhang, Jie; Zhang, Mingyan; Jiang, Wei; Wang, Lihong; Fu, Zhenkun; Li, Dalin; Pang, Da; Li, Dianjun

    2009-01-01

    B7-H4, a co-inhibitory molecule of the B7 family, can restrain T cell proliferation, cytokine secretion and the development of cytotoxicity. B7-H4 is expressed in tumor tissues at a higher level than in normal tissues, and has a potential effect to protect tumors from anti-tumor immune responses. This case-control study was carried out to determine the potential influences of B7-H4 gene polymorphisms on the susceptibility and progression of breast cancer in Han women of Northeast China. We genotyped three B7-H4 variants (rs10754339, rs10801935 and rs3738414) and tagged all common haplotypes (frequency greater than or equal to 1%) in a Chinese population consisting of 500 breast cancer cases and 504 control individuals matched for age. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to determine the genotypes. Our data indicated that, compared with the common genotype and allele of each SNP, the rs10754339 AG genotype and G allele showed a significantly increased risk of breast cancer (OR = 1.455, 95% CI 1.119-1.892; OR = 1.325, 95% CI 1.073-1.637, respectively). The rs10801935 CC genotype, the rs3738414 AA genotype and the rs3738414 A allele were associated with a significantly decreased risk of breast cancer (OR = 0.328, 95% CI 0.145-0.739; OR = 0.412, 95% CI 0.203-0.835; OR = 0.698, 95% CI 0.564-0.864, respectively). Additionally, the rs10754339 GG genotype was significantly associated with lymph node metastasis and PR status, and the G allele and the AG genotype were respectively associated with lymph node metastasis and ER status. In haplotype analysis, we observed that compared with the AAG haplotype, the AAA haplotype showed a significantly decreased risk of breast cancer (OR = 0.689, 95% CI 0.539-0.881), but the GAG haplotype was associated with a significantly increased risk of breast cancer (OR = 1.511, 95% CI 1.125-2.031). And the AAA and the GCG haplotypes also respectively have significant influences on

  4. B7-H4 gene polymorphisms are associated with sporadic breast cancer in a Chinese Han population

    Directory of Open Access Journals (Sweden)

    Fu Zhenkun

    2009-11-01

    Full Text Available Abstract Background B7-H4, a co-inhibitory molecule of the B7 family, can restrain T cell proliferation, cytokine secretion and the development of cytotoxicity. B7-H4 is expressed in tumor tissues at a higher level than in normal tissues, and has a potential effect to protect tumors from anti-tumor immune responses. This case-control study was carried out to determine the potential influences of B7-H4 gene polymorphisms on the susceptibility and progression of breast cancer in Han women of Northeast China. Methods We genotyped three B7-H4 variants (rs10754339, rs10801935 and rs3738414 and tagged all common haplotypes (frequency greater than or equal to 1% in a Chinese population consisting of 500 breast cancer cases and 504 control individuals matched for age. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP technique was used to determine the genotypes. Results Our data indicated that, compared with the common genotype and allele of each SNP, the rs10754339 AG genotype and G allele showed a significantly increased risk of breast cancer (OR = 1.455, 95% CI 1.119-1.892; OR = 1.325, 95% CI 1.073-1.637, respectively. The rs10801935 CC genotype, the rs3738414 AA genotype and the rs3738414 A allele were associated with a significantly decreased risk of breast cancer (OR = 0.328, 95% CI 0.145-0.739; OR = 0.412, 95% CI 0.203-0.835; OR = 0.698, 95% CI 0.564-0.864, respectively. Additionally, the rs10754339 GG genotype was significantly associated with lymph node metastasis and PR status, and the G allele and the AG genotype were respectively associated with lymph node metastasis and ER status. In haplotype analysis, we observed that compared with the AAG haplotype, the AAA haplotype showed a significantly decreased risk of breast cancer (OR = 0.689, 95% CI 0.539-0.881, but the GAG haplotype was associated with a significantly increased risk of breast cancer (OR = 1.511, 95% CI 1.125-2.031. And the AAA and the GCG haplotypes

  5. Long tandem repeats as a form of genomic copy number variation: structure and length polymorphism of a chromosome 5p repeat in control and schizophrenia populations

    Science.gov (United States)

    Bruce, Heather A.; Sachs, Nancy A.; Rudnicki, Dobrila D.; Lin, Stephanie G.; Willour, Virginia L.; Cowell, John K.; Conroy, Jeffrey; McQuaid, Devin E.; Rossi, Michael; Gaile, Daniel P; Nowak, Norma J.; Holmes, Susan E.; Sklar, Pamela; Ross, Christopher A.; DeLisi, Lynn E.; Margolis, Russell L.

    2016-01-01

    Objectives Genomic copy number variations (CNVs) are a major form of variation in the human genome and play an etiologic role in several neuropsychiatric diseases. Tandem repeats, particularly with long (> 50bp) repeat units, are a relatively common yet underexplored type of CNV that may significantly contribute to human genomic variation and disease risk. We therefore performed a pilot experiment to explore the potential role of long tandem repeats as risk factors in psychiatric disorders. Methods A bacterial artificial chromosome (BAC)-based array comparative genomic hybridization (aCGH) platform was used to examine CNVs in genomic DNA from 34 probands with schizophrenia or schizoaffective disorder. Results The aCGH screen detected an apparent deletion on 5p15.1 in two probands, caused by the presence in each proband of two low copy number (short) alleles of a tandem repeat that ranges in length from 50 3.4 kb units in the population examined. Short alleles partially segregate with schizophrenia in a small number of families, though linkage was not significant. An association study showed no significant difference in repeat length between 406 schizophrenia cases and 392 controls. Conclusion Though we did not demonstrate a relationship between the 5p15.1 repeat and schizophrenia, our results illustrate that long tandem repeats represent an intriguing type of genetic variation that have not been previously studied in connection with psychiatric illness. aCGH can detect a small subset of these repeats, but systematic investigation will require the development of specific arrays and improved analytic methods. PMID:19672138

  6. An accurate clone-based haplotyping method by overlapping pool sequencing.

    Science.gov (United States)

    Li, Cheng; Cao, Changchang; Tu, Jing; Sun, Xiao

    2016-07-08

    Chromosome-long haplotyping of human genomes is important to identify genetic variants with differing gene expression, in human evolution studies, clinical diagnosis, and other biological and medical fields. Although several methods have realized haplotyping based on sequencing technologies or population statistics, accuracy and cost are factors that prohibit their wide use. Borrowing ideas from group testing theories, we proposed a clone-based haplotyping method by overlapping pool sequencing. The clones from a single individual were pooled combinatorially and then sequenced. According to the distinct pooling pattern for each clone in the overlapping pool sequencing, alleles for the recovered variants could be assigned to their original clones precisely. Subsequently, the clone sequences could be reconstructed by linking these alleles accordingly and assembling them into haplotypes with high accuracy. To verify the utility of our method, we constructed 130 110 clones in silico for the individual NA12878 and simulated the pooling and sequencing process. Ultimately, 99.9% of variants on chromosome 1 that were covered by clones from both parental chromosomes were recovered correctly, and 112 haplotype contigs were assembled with an N50 length of 3.4 Mb and no switch errors. A comparison with current clone-based haplotyping methods indicated our method was more accurate. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  8. HLA Type Inference via Haplotypes Identical by Descent

    Science.gov (United States)

    Setty, Manu N.; Gusev, Alexander; Pe'Er, Itsik

    The Human Leukocyte Antigen (HLA) genes play a major role in adaptive immune response and are used to differentiate self antigens from non self ones. HLA genes are hyper variable with nearly every locus harboring over a dozen alleles. This variation plays an important role in susceptibility to multiple autoimmune diseases and needs to be matched on for organ transplantation. Unfortunately, HLA typing by serological methods is time consuming and expensive compared to high throughput Single Nucleotide Polymorphism (SNP) data. We present a new computational method to infer per-locus HLA types using shared segments Identical By Descent (IBD), inferred from SNP genotype data. IBD information is modeled as graph where shared haplotypes are explored among clusters of individuals with known and unknown HLA types to identify the latter. We analyze performance of the method in a previously typed subset of the HapMap population, achieving accuracy of 96% in HLA-A, 94% in HLA-B, 95% in HLA-C, 77% in HLA-DR1, 93% in HLA-DQA1 and 90% in HLA-DQB1 genes. We compare our method to a tag SNP based approach and demonstrate higher sensitivity and specificity. Our method demonstrates the power of using shared haplotype segments for large-scale imputation at the HLA locus.

  9. Variation analysis and gene annotation of eight MHC haplotypes: the MHC Haplotype Project.

    Science.gov (United States)

    Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J; Almeida, Jeff; Forbes, Simon; Gilbert, James G R; Halls, Karen; Harrow, Jennifer L; Hart, Elizabeth; Howe, Kevin; Jackson, David K; Palmer, Sophie; Roberts, Anne N; Sims, Sarah; Stewart, C Andrew; Traherne, James A; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J; Elliott, John F; Sawcer, Stephen; Todd, John A; Trowsdale, John; Beck, Stephan

    2008-01-01

    The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine.

  10. A CCL5 Haplotype Is Associated with Low Seropositivity Rate of HCV Infection in People Who Inject Drugs.

    Directory of Open Access Journals (Sweden)

    Kristi Huik

    Full Text Available The role of CC chemokine receptor 5 (CCR5 and its ligand CCL5 on the pathogenesis of HIV infection has been well studied but not for HCV infection. Here, we investigated whether CCL5 haplotypes influence HIV and HCV seropositivity among 373 Caucasian people who inject drugs (PWID from Estonia.Study included 373 PWID; 56% were HIV seropositive, 44% HCV seropositive and 47% co-infected. Four CCL5 haplotypes (A-D were derived from three CCL5 polymorphisms (rs2107538/rs2280788/rs2280789 typed by Taqman allelic discrimination assays. The data of CCR5 haplotypes were used from our previous study. The association between CCL5 haplotypes with HIV and/or HCV seropositivity was determined using logistic regression analysis.Possessing CCL5 haplotype D (defined by rs2107538A/rs2280788G/rs2280789C decreased the odds of HCV seropositivity compared to those not possessing it (OR = 0.19; 95% CI 0.09-0.40, which remained significant after adjustment to co-variates (OR = 0.08; 95% CI 0.02-0.29. An association of this haplotype with HIV seropositivity was not found. In step-wise logistic regression with backward elimination CCL5 haplotype D and CCR5 HHG*1 had reduced odds for HCV seropositivity (OR = 0.28 95% CI 0.09-0.92; OR = 0.23 95% CI 0.08-0.68, respectively compared to those who did not possess these haplotypes, respectively.Our results suggest that among PWID CCL5 haplotype D and CCR5 HHG*1 independently protects against HCV. Our findings highlight the importance of CCL5 genetic variability and CCL5-CCR5 axis on the susceptibility to HCV.

  11. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  12. Assessment Of The Polymorphic Sacii And Ddei Sites In The 5 ...

    African Journals Online (AJOL)

    ... our results suggest that in this population the haplotype alone was not associated with prognosis and that other, unknown environmental or genetic, factors may be of relevance. Keywords: Cystatin C, promoter, polymorphism, allele, haplotype. Egyptian Journal of Biochemistry and Molecular Biology Vol. 26 (2) 2008: pp.

  13. Differentiation analysis for estimating individual ancestry from the Tibetan Plateau by an archaic altitude adaptation EPAS1 haplotype among East Asian populations.

    Science.gov (United States)

    Jiang, Li; Peng, Jianxiong; Huang, Meisha; Liu, Jing; Wang, Ling; Ma, Quan; Zhao, Hui; Yang, Xin; Ji, Anquan; Li, Caixia

    2018-02-10

    Tibetans have adapted to the extreme environment of high altitude for hundreds of generations. A highly differentiated 5-SNP (Single Nucleotide Polymorphism) haplotype motif (AGGAA) on a hypoxic pathway gene, EPAS1, is observed in Tibetans and lowlanders. To evaluate the potential usage of the 5-SNP haplotype in ancestry inference for Tibetan or Tibetan-related populations, we analyzed this haplotype in 1053 individuals of 12 Chinese populations residing on the Tibetan Plateau, peripheral regions of Tibet, and plain regions. These data were integrated with the genotypes from the 1000 Genome populations and populations in a previously reported paper for population structure analyses. We found that populations representing highland and lowland groups have different dominant ancestry components. The core Denisovan haplotype (AGGAA) was observed at a frequency of 72.32% in the Tibetan Plateau, with a frequency range from 9.48 to 21.05% in the peripheral regions and Tibetan Plateau carried the archaic haplotype, while < 5% of the Chinese Han people carried the haplotype. Our findings indicate that the 5-SNP haplotype has a special distribution pattern in populations of Tibet and peripheral regions and could be integrated into AISNP (Ancestry Informative Single Nucleotide Polymorphism) panels to enhance ancestry resolution.

  14. Relationship between protein complotypes and DNA variant haplotypes: complotype-RFLP constellations (CRC).

    Science.gov (United States)

    Simon, S; Truedsson, L; Marcus-Bagley, D; Awdeh, Z; Eisenbarth, G S; Brink, S J; Yunis, E J; Alper, C A

    1997-09-15

    From the study of 52 families and 15 homozygous typing cells, 234 MHC complement haplotypes were characterized for features in the DNA of the complotype region: C2/Sst I (2.75, 2.70, 2.65, and 2.40 kb), BF/Taq I (6.6 and 4.5 kb), C4 5'/Bgl II (15 and 4.5 kb), C4 5'/Taq I (7.0, 6.4, 6.0 and 5.4 kb) and C4 3'/Xba I/BamH I (11 and 4 + 7 kb) restriction fragment length polymorphisms (RFLP's), by the presence or absence of C4A, C4B, CYP21A and CYP21B genes and by duplications. Nineteen (of over 1000 theoretically possible) complotype-RFLP constellations (CRC's) were found. The 9 CRC's with two C4 and CYP21 genes were designated A through I. CRC's Bdup and Ddup were like B and D but had duplicated C4B-CYP21B genes. The remaining CRC's had deletions of C4 and/or CYP21 genes and were designated Bdel, Cdel and the like. Individual complement alleles and complotypes were nor randomly distributed among the CRC's. Some complotypes, such as SC01, SC02 and FIC30, were restricted to only 1 CRC; others, such as SC31, FC31, and SC30, were found in several CRC's. Some of the CRC's contained a single complotype, others contained several. Remarkably, there are about 30 CRC-specified complotypes with frequencies of .01 or higher and 14 of .02 or higher. A number of evolutionary origins of complement alleles and complotypes are suggested by the relationships among CRC's. Approximate normal frequencies of the undeleted CRC's were A = .27, B = .19, Bdup = .02, C = .17, D = .07, Ddup = .02, E = .06, F = .05, and G = .02. Thus, CRC's without deletions accounted for 88% of normal complotypes. Since the frequency of Bdel, with a deletion of C4A, was .12, 10 CRC's accounted for all observed normal caucasian MHC haplotypes.

  15. Haplotypes Eco47 III-Nsp I sites frequencies on the IDUA gene in Mexican native population.

    Science.gov (United States)

    Gallegos-Arreola, M P; Sandoval-Ramírez, L; Figuera, L E; Arnaud-López, L; Rivas, F; Mariaud-Schmidt, R P; Zúñiga-González, G M

    2005-01-01

    The frequency of haplotypes of Nsp I-Eco47 III sites, at the IDUA (alpha-L iduronidase) gene, in Huichol, Tarahumara and Mestizo Mexican population is reported. Eco47 III and Nsp I intragenic polymorphisms in IDUA gene are studied in three (Mestizo, Huichol and Tarahumara populations) Mexican groups. Data from normal Australian [Hum. Genet. 90 (1992) 327] individuals were considered for comparative analyses. The genotypes for IDUA Eco47 III and Nsp I sites in Mexicans were in agreement with Hardy-Weinberg equilibrium. Allele frequency distributions for individual sites differed (P < 0.05) except at site B1 in the Huichol group. Haplotype Eco47 III-Nsp I frequency distributions were different in the three Mexican normal groups, and it was also observed when to compared with the normal Australians. This characteristic makes the two IDUA polymorphic sites useful for identification purposes, and these polymorphisms could be included in a PCR based battery of DNA markers.

  16. PP130. ENOS tagging SNP haplotypes in hypertensive disorders of pregnancy.

    Science.gov (United States)

    Sandrim, V; Muniz, L; Luizon, M; Palei, A C; Lacchini, R; Duarte, G; Cavalli, R; Tanus-Santos, J E

    2012-07-01

    Haplotypes formed by polymorphisms (T-786C, rs2070744; a variable number of tandem repeats in intron 4, and Glu298Asp, rs1799983) of eNOS gene were associated previously with gestational hypertension (GH) and preeclampsia (PE). However, no study has explored the tagging SNPs rs743506 and rs7830 in these disorders. The aim of the current study was to compare the distribution of the genotypes and haplotypes formed by the two tagging SNPs or by the five eNOS polymorphisms mentioned among healthy pregnant GH and PE. We recruited 122 HP, 138 GH and 157 PE. Genotypes for the T-786C, the Glu298Asp and rs743506 polymorphisms were determined by Taqmanâ Allele Discrimination assays and fluorescence signals were measured on Chromo 4 Detector (Bio-Rad Laboratories, USA). Genotypes for the VNTR polymorphism in intron 4 and rs7830, however, were determined by PCR and fragment separation by electrophoresis in 8% polyacrylamide gels. Plasma aliquots were analyzed in triplicate for their nitrite content using an ozone-based chemiluminescence assay. The haplotype formed by the most common variants in each polymorphism "T b G A C" was more frequent in PE group compared to HP (P=0.00004), which may be explained by the higher linkage disequilibrium found in PE compared to GH and HP. Conversely, the haplotype "C b G G C" was more frequent in HP compared to PE (P=0.00113), which is supported by previous findings that demonstrated the association of the combination "C b G" with higher level of nitrite (NO marker). Our results suggest a protective effect of the haplotype "C b G G C" against the development of PE. This study was funded by the Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG-Brazil), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP-Brazil). Copyright © 2012. Published by Elsevier B.V.

  17. Characterization of mitochondrial DNA polymorphisms in the Han population in Liaoning Province, Northeast China.

    Science.gov (United States)

    Xu, Feng-Ling; Yao, Jun; Ding, Mei; Shi, Zhang-Sen; Wu, Xue; Zhang, Jing-Jing; Wang, Bao-Jie

    2018-03-01

    This study characterized the genetic variations of mitochondrial DNA (mtDNA) to elucidate the maternal genetic structure of Liaoning Han Chinese. A total of 317 blood samples of unrelated individuals were collected for analysis in Liaoning Province. The mtDNA samples were analyzed using two distinct methods: sequencing of the hypervariable sequences I and II (HVSI and HVSII), and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the coding region. The results indicated a high gene diversity value (0.9997 ± 0.0003), a high polymorphism information content (0.99668) and a random match probability (0.00332). These samples were classified into 305 haplotypes, with 9 shared haplotypes. The most common haplogroup was D4 (12.93%). The principal component analysis map, the phylogenetic tree map, and the genetic distance matrix all indicated that the genetic distance of the Liaoning Han population from the Tibetan group was distant, whereas that from the Miao group was relatively close.

  18. Haplotype diversity generated by ancient recombination-like events in the MHC of Indian rhesus macaques.

    Science.gov (United States)

    Doxiadis, Gaby G M; de Groot, Nanine; Otting, Nel; de Vos-Rouweler, Annemiek J M; Bolijn, Maria J; Heijmans, Corrine M C; de Groot, Natasja G; van der Wiel, Marit K H; Remarque, Edmond J; Vangenot, Christelle; Nunes, José M; Sanchez-Mazas, Alicia; Bontrop, Ronald E

    2013-08-01

    The Mamu-A, Mamu-B, and Mamu-DRB genes of the rhesus macaque show several levels of complexity such as allelic heterogeneity (polymorphism), copy number variation, differential segregation of genes/alleles present on a haplotype (diversity) and transcription level differences. A combination of techniques was implemented to screen a large panel of pedigreed Indian rhesus macaques (1,384 individuals representing the offspring of 137 founding animals) for haplotype diversity in an efficient and inexpensive manner. This approach allowed the definition of 140 haplotypes that display a relatively low degree of region variation as reflected by the presence of only 17 A, 18 B and 22 DRB types, respectively, exhibiting a global linkage disequilibrium comparable to that in humans. This finding contrasts with the situation observed in rhesus macaques from other geographic origins and in cynomolgus monkeys from Indonesia. In these latter populations, nearly every haplotype appears to be characterised by a unique A, B and DRB region. In the Indian population, however, a reshuffling of existing segments generated "new" haplotypes. Since the recombination frequency within the core MHC of the Indian rhesus macaques is relatively low, the various haplotypes were most probably produced by recombination events that accumulated over a long evolutionary time span. This idea is in accord with the notion that Indian rhesus macaques experienced a severe reduction in population during the Pleistocene due to a bottleneck caused by geographic changes. Thus, recombination-like processes appear to be a way to expand a diminished genetic repertoire in an isolated and relatively small founder population.

  19. Estimating haplotype effects for survival data.

    Science.gov (United States)

    Scheike, Thomas H; Martinussen, Torben; Silver, Jeremy D

    2010-09-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplotype effects for survival data. These estimating equations are simple to implement and avoid the use of the EM algorithm, which may be slow in the context of the semiparametric Cox model with incomplete covariate information. These estimating equations also lead to easily computable, direct estimators of standard errors, and thus overcome some of the difficulty in obtaining variance estimators based on the EM algorithm in this setting. We also develop an easily implemented goodness-of-fit procedure for Cox's regression model including haplotype effects. Finally, we apply the procedures presented in this article to investigate possible haplotype effects of the PAF-receptor on cardiovascular events in patients with coronary artery disease, and compare our results to those based on the EM algorithm. © 2009, The International Biometric Society.

  20. Haplotype-based stratification of Huntington's disease.

    Science.gov (United States)

    Chao, Michael J; Gillis, Tammy; Atwal, Ranjit S; Mysore, Jayalakshmi Srinidhi; Arjomand, Jamshid; Harold, Denise; Holmans, Peter; Jones, Lesley; Orth, Michael; Myers, Richard H; Kwak, Seung; Wheeler, Vanessa C; MacDonald, Marcy E; Gusella, James F; Lee, Jong-Min

    2017-11-01

    Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by expansion of a CAG trinucleotide repeat in HTT, resulting in an extended polyglutamine tract in huntingtin. We and others have previously determined that the HD-causing expansion occurs on multiple different haplotype backbones, reflecting more than one ancestral origin of the same type of mutation. In view of the therapeutic potential of mutant allele-specific gene silencing, we have compared and integrated two major systems of HTT haplotype definition, combining data from 74 sequence variants to identify the most frequent disease-associated and control chromosome backbones and revealing that there is potential for additional resolution of HD haplotypes. We have used the large collection of 4078 heterozygous HD subjects analyzed in our recent genome-wide association study of HD age at onset to estimate the frequency of these haplotypes in European subjects, finding that common genetic variation at HTT can distinguish the normal and CAG-expanded chromosomes for more than 95% of European HD individuals. As a resource for the HD research community, we have also determined the haplotypes present in a series of publicly available HD subject-derived fibroblasts, induced pluripotent cells, and embryonic stem cells in order to facilitate efforts to develop inclusive methods of allele-specific HTT silencing applicable to most HD patients. Our data providing genetic guidance for therapeutic gene-based targeting will significantly contribute to the developments of rational treatments and implementation of precision medicine in HD.

  1. Telomere length and depression

    DEFF Research Database (Denmark)

    Wium-Andersen, Marie Kim; Ørsted, David Dynnes; Rode, Line

    2017-01-01

    BACKGROUND: Depression has been cross-sectionally associated with short telomeres as a measure of biological age. However, the direction and nature of the association is currently unclear. AIMS: We examined whether short telomere length is associated with depression cross-sectionally as well...... as prospectively and genetically. METHOD: Telomere length and three polymorphisms, TERT, TERC and OBFC1, were measured in 67 306 individuals aged 20-100 years from the Danish general population and associated with register-based attendance at hospital for depression and purchase of antidepressant medication....... RESULTS: Attendance at hospital for depression was associated with short telomere length cross-sectionally, but not prospectively. Further, purchase of antidepressant medication was not associated with short telomere length cross-sectionally or prospectively. Mean follow-up was 7.6 years (range 0...

  2. Rapid DNA haplotyping using a multiplex heteroduplex approach: Application to Duchenne muscula dystrophy carrier detection

    Energy Technology Data Exchange (ETDEWEB)

    Prior, T.W.; Wenger, G.D.; Moore, J. [Ohio State Univ., Columbus, OH (United States)] [and others

    1994-09-01

    A new strategy has been developed for rapid haplotype analysis. It is based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. The method is simple, rapid, does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using 12 commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. As a result of expanding the number of detectable polymorphisms throughout the dystrophin gene, we show how the method can easily be combined with dinucleotide analysis to improve the accuracy of carrier detection in the nondeletion cases. The technique is also shown to be used as an effective screen for improving carrier detection in several families with deletions. The finding of heterozygosity within the deletion identifies the at-risk female as a noncarrier. Using this method, we have identified and incorporated 3 new dystrophin polymorphisms (one of which in exon 16 is unique to African Americans). The method may be used other genetic diseases when mutations are unknown, or there are few dinucleotide markers in the gene proximity, or for the identification of haplotype backgrounds of mutant alleles.

  3. Common Genetic Variation in the DKK1 Gene is Associated with Hip Axis Length but not with Bone Mineral Density and Bone Turnover Markers in Young Adult Men: Results from the Odense Androgen Study

    DEFF Research Database (Denmark)

    Piters, Elke; Balemans, Wendy; Nielsen, Torben Leo

    2010-01-01

    LRP5 was recently confirmed as an important susceptibility gene for osteoporosis. Our objective was to evaluate the effect of DKK1 polymorphisms on bone mineral density (BMD), hip geometry, and bone turnover. DKK1 is a secreted protein that binds to LRP5/6 receptors and inhibits canonical Wnt...... with hip axis length (HAL), independent of BMD and height. Moreover, the association seemed to be driven by the nonsedentary subgroup (P = 0.004). Haplotype analysis further confirmed the association of rs1569198 with HAL. Furthermore, we obtained indications for interaction between DKK1 and LRP5 genotypes...

  4. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  5. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  6. Most cases of cryptococcal meningitis in HIV-uninfected patients in Vietnam are due to a distinct amplified fragment length polymorphism-defined cluster of Cryptococcus neoformans var. grubii VN1.

    Science.gov (United States)

    Day, Jeremy N; Hoang, Thu N; Duong, Anh V; Hong, Chau T T; Diep, Pham T; Campbell, James I; Sieu, Tran P M; Hien, Tran T; Bui, Tien; Boni, Maciej F; Lalloo, David G; Carter, Dee; Baker, Stephen; Farrar, Jeremy J

    2011-02-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host.

  7. Most Cases of Cryptococcal Meningitis in HIV-Uninfected Patients in Vietnam Are Due to a Distinct Amplified Fragment Length Polymorphism-Defined Cluster of Cryptococcus neoformans var. grubii VN1▿

    Science.gov (United States)

    Day, Jeremy N.; Hoang, Thu N.; Duong, Anh V.; Hong, Chau T. T.; Diep, Pham T.; Campbell, James I.; Sieu, Tran P. M.; Hien, Tran T.; Bui, Tien; Boni, Maciej F.; Lalloo, David G.; Carter, Dee; Baker, Stephen; Farrar, Jeremy J.

    2011-01-01

    Cryptococcal disease most commonly occurs in patients with an underlying immune deficit, most commonly HIV infection, and is due to Cryptococcus neoformans var. grubii. Occasionally disease due to this variety occurs in apparently immunocompetent patients. The relationship between strains infecting immunosuppressed and immunocompetent patients is not clear. Amplified fragment length polymorphism (AFLP) analysis was used to characterize the relationship between strains infecting HIV-infected and uninfected patients. Isolates from 51 HIV-uninfected patients and 100 HIV-infected patients with cryptococcal meningitis were compared. C. neoformans var. grubii VNI was responsible for infections in 73% of HIV-uninfected and 100% of HIV-infected patients. AFLP analysis defined two distinct clusters, VNIγ and VNIδ. The majority (84%) of isolates from HIV-uninfected patients were VNIγ, compared with only 38% of isolates from HIV-infected patients (odds ratio, 8.30; 95% confidence interval [CI], 3.04 to 26.6; P cryptococcal meningitis in Vietnam. The distribution of these clusters differs according to the immune status of the host. PMID:21159929

  8. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  9. Intestinal carriage of Campylobacter jejuni and Campylobacter coli among cattle from South-western Norway and comparative genotyping of bovine and human isolates by amplified-fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Vardund T

    2006-06-01

    Full Text Available Abstract In a survey conducted in 1999–2001, the carriage of thermotolerant Campylobacters in cattle was investigated, and the genetic diversity of C. jejuni within one herd was examined and compared with human isolates. C. jejuni, C. coli and other thermotolerant Campylobacter spp. were isolated from intestinal contents from 26%, 3% and 2% of 804 cattle, respectively. The carriage rate was higher in calves (46% than in adults (29%. Twenty-nine C. jejuni isolates from one herd and 31 human isolates from the study area were genotyped with amplified-fragment length polymorphism (AFLP. Eighty-three % of the bovine isolates fell into three distinct clusters with 95–100% similarity, persistent in the herd for 5–10 months. Among human isolates, 58% showed >90% similarity with bovine isolates. The results show that cattle are a significant and stable reservoir for C. jejuni in the study area. Transmission between individuals within the herd may be sufficient to maintain a steady C. jejuni population independent of environmental influx. The results of this study have provided new information on C. jejuni and C. coli transmission, and also on the carriage in cattle, genotypes stability and similarity between bovine and human isolates.

  10. Reaction of sources of resistance to white mold to microsatellite haplotypes of Sclerotinia sclerotiorum

    Directory of Open Access Journals (Sweden)

    Miller da Silva Lehner

    2016-04-01

    Full Text Available ABSTRACT White mold caused by the fungus Sclerotinia sclerotiorum is the most yield-limiting disease of common bean in Brazil. To date, there has been no commercial cultivar resistant to this disease. In a greenhouse we evaluated white mold resistance sources (Cornell 605, A195 and G122 against eight isolates of S. sclerotiorum from five Brazilian states. A Brazilian cultivar (BRSMG Madrepérola and a susceptible check (Beryl were used as control. Treatments were arranged in factorial combinations (5 × 8 in a completely random design with four replicates. Disease severity was assessed on a rating scale of 1-to-9 together with lesion length, which was used to determine an area under the disease progress curve (AUDPC. Polymorphisms detected in ten microsatellite loci were used to assess variability between the isolates. Each isolate was a distinct haplotype; they formed a genetic tree with two clusters. One cluster was formed by three isolates collected from the states of Minas Gerais and São Paulo (southeastern; the others, by isolates from Paraná, Santa Catarina (southern, Goiás (Mid-western, and again, Minas Gerais. Genotype × isolate interaction was significant. In general, Beryl was more susceptible than BRSMG Madrepérola. Considering the AUDPC and/or the white mold reaction score, Cornell 605 exhibited more physiological resistance than BRSMG Madrepérola to seven isolates, A195 to five isolates, and G122 to two isolates. Our results suggest that Cornell 605 is the best source of resistance to white mold for the southern region, whereas Cornell 605 and A195 are somewhat superior to G122 for the southeastern and mid-western regions.

  11. A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

    Science.gov (United States)

    Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

    2016-01-01

    Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

  12. A class representative model for Pure Parsimony Haplotyping under uncertain data.

    Directory of Open Access Journals (Sweden)

    Daniele Catanzaro

    Full Text Available The Pure Parsimony Haplotyping (PPH problem is a NP-hard combinatorial optimization problem that consists of finding the minimum number of haplotypes necessary to explain a given set of genotypes. PPH has attracted more and more attention in recent years due to its importance in analysis of many fine-scale genetic data. Its application fields range from mapping complex disease genes to inferring population histories, passing through designing drugs, functional genomics and pharmacogenetics. In this article we investigate, for the first time, a recent version of PPH called the Pure Parsimony Haplotype problem under Uncertain Data (PPH-UD. This version mainly arises when the input genotypes are not accurate, i.e., when some single nucleotide polymorphisms are missing or affected by errors. We propose an exact approach to solution of PPH-UD based on an extended version of Catanzaro et al.[1] class representative model for PPH, currently the state-of-the-art integer programming model for PPH. The model is efficient, accurate, compact, polynomial-sized, easy to implement, solvable with any solver for mixed integer programming, and usable in all those cases for which the parsimony criterion is well suited for haplotype estimation.

  13. Beta-globin gene linked DNA haplotypes and frameworks in three South-East Asian populations.

    Science.gov (United States)

    Hundrieser, J; Sanguansermsri, T; Papp, T; Laig, M; Flatz, G

    1988-09-01

    DNA haplotypes and frameworks (numbers in parenthesis) linked to the beta-globin gene were determined by restriction fragment analysis using eight restriction endonucleases on 86 (97) chromosomes bearing the normal beta-globin gene (HBB*A) and 108 (118) chromosomes bearing HBB*E in subjects homozygous for HBB*A or HBB*E from three South-East Asian populations with high HBB*E frequencies (northern Thailand, north-eastern Thailand and Cambodia). A systematic nomenclature for beta-globin gene-linked haplotype characterized by six polymorphic sites is introduced. In all populations, HBB*A occurred preferentially (greater than 80%) in linkage with the haplotype 41 (+----+) and all three frameworks described by Antonarakis et al. (1982). In contrast, almost 80% of the HBB*E genes occurred with the haplotype 27 (-+- ). In northern and north-eastern Thailand, HBB*E was present almost exclusively in frame-work 2; HBB*E in framework 3 (Asian) was limited to the Khmer population of Cambodia, and the frequency of HBB*E-linked framework 3 increased from the west to the east in this country.

  14. Association analysis between rs6184 and rs6180 polymorphisms of growth hormone receptor gene regarding skeletal-facial profile in a Colombian population.

    Science.gov (United States)

    Tobón-Arroyave, Sergio Iván; Jiménez-Arbeláez, Gustavo Adolfo; Alvarado-Gómez, Viviana Andrea; Isaza-Guzmán, Diana María; Flórez-Moreno, Gloria Amparo; Pérez-Cano, María Isabel

    2017-10-20

    There is strong evidence that genetic factors may affect the craniofacial morphology. This study aimed to examine the association between the rs6184 and rs6180 polymorphic variants of the growth hormone receptor (GHR) gene and skeletal-facial profile in a Colombian population. Saliva samples from 306 individuals ranging in age from 15 to 53 (mean 24.33) years were collected. Cephalometric parameters were used to categorize the participants as Class I, Class II, or Class III skeletal-facial profile. The polymerase chain reaction-restriction fragment length polymorphism method was used to identify genotypes of the rs6184 and rs6180 single nucleotide polymorphisms (SNPs). The association of polymorphisms with the skeletal-facial profile was assessed separately and adjusted for confounding using a multivariate binary logistic regression model, alongside with analysis of linkage disequilibrium and haplotype associations. Although individuals carrying the CA genotype of the rs6184 SNP showed both significantly decreased values for ANB angle and increased measures concerning mandibular body length and mandibular length, no significant differences amongst genotype groups of rs6180 SNP were observed. Moreover, chi-square test and logistic regression analysis revealed that the CA genotype of rs6184 SNP and the A-A haplotype were highly associated with Class III skeletal-facial profile. Although these results do not support that rs6180 SNP could be identified as a predictor for skeletal-facial profile, they suggest that the allele A of rs6184 SNP alone or in combination with other SNPs in the GHR gene yields significant horizontal and longitudinal variations of the mandibular morphology and might be a strong/independent prognostic indicator for Class III skeletal-facial profile in the present population. © The Author 2017. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com

  15. Cystathionine β-synthase T833C/844INS68 polymorphism: a family-based study on mentally retarded children

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Jotideb

    2005-12-01

    Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However

  16. Genetic characterization by amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Mariela Vázquez Calderón, Javier O Mijangos-Cortés, Manuel JL Zavala, L Felipe Sánchez Teyer, Adriana M Quiroz, Matilde Margarita G Ortiz, Amilcar Contreras M Fernando, Espadas G Francisco, Gabriela Fuentes Ortiz, Jorge M Santamaría ...

  17. Amplified Fragment Length Polymorphism markers reveal ...

    African Journals Online (AJOL)

    The understanding of between- and within-population genetic variation and its partitioning on the basis of geographic origin is crucial in designing efficient fishing and conservation strategies of populations and/or species. However, for Lake Malawi's cichlid species, such population genetic studies are hampered by a large ...

  18. Amplified fragment length polymorphism (AFLP) and genealogy ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... Pang CY, Du XM, Ma ZY (2006). Evaluation of the introgressed lines and screening for elite germplasm in Gossypium, Chin. Sci. Bull. 51(1):. 304-312. Pieter V, Rene H, Marjo B (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23(21): 4407-4414. Qian SY, Huang JQ, Zhou BL, Peng ...

  19. Amplified fragment length polymorphisms (AFLPs) analysis of ...

    African Journals Online (AJOL)

    The taxonomy of species belonging to Solanum section Solanum (sometimes referred to as the Solanum nigrum complex or black nightshades) is known to be difficult and has resulted in extensive synonymy. Yet, these species play a significant role in nutrition and food security, especially in developing countries.

  20. Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.

    Science.gov (United States)

    Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N

    2017-01-01

    Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast

  1. Musical aptitude is associated with AVPR1A-haplotypes.

    Science.gov (United States)

    Ukkola, Liisa T; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-05-20

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2) = .84; composing h(2) = .40; arranging h(2) = .46; improvising h(2) = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior.

  2. Musical Aptitude Is Associated with AVPR1A-Haplotypes

    Science.gov (United States)

    Ukkola, Liisa T.; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-01-01

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h2 = .84; composing h2 = .40; arranging h2 = .46; improvising h2 = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior. PMID:19461995

  3. Antifolate drug resistance: Novel mutations and haplotype ...

    Indian Academy of Sciences (India)

    A total of 249 fever cases from Arunachal Pradesh, NEIndia, were screened for malaria, and of these, 75 were found to be positive for Plasmodium falciparum. Samples weresequenced and analysed with the help of BioEdit and ClustalW. Three novel point mutations were found in the dhps genewith 10 haplotypes along ...

  4. Association of TAP gene polymorphisms and risk of cervical intraepithelial neoplasia.

    Science.gov (United States)

    Natter, Camilla; Polterauer, Stephan; Rahhal-Schupp, Jasmin; Cacsire Castillo-Tong, Dan; Pils, Sophie; Speiser, Paul; Zeillinger, Robert; Heinze, Georg; Grimm, Christoph

    2013-01-01

    Transporter associated with antigen processing (TAP) is responsible for peptide loading onto class I major histocompatibility complex (MHC-I) molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254) and TAP2 (1135, 1693, and 1993) in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254) had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (P = 0.006; OR 0.5 [0.35-0.84]). Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  5. Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

    Directory of Open Access Journals (Sweden)

    Camilla Natter

    2013-01-01

    Full Text Available Background. Transporter associated with antigen processing (TAP is responsible for peptide loading onto class I major histocompatibility complex (MHC-I molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. Objective. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254 and TAP2 (1135, 1693, and 1993 in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. Results. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254 had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (; OR 0.5 []. Conclusion. Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  6. Genetic polymorphisms in DNA base excision repair gene XRCC1 and the risk of squamous cell carcinoma of the head and neck

    Directory of Open Access Journals (Sweden)

    Pietruszewska Wioletta

    2009-03-01

    Full Text Available Abstract Background The genes of base excision repair (BER pathway have been extensively studied in the association with various human cancers. We performed a case-control study to test the association between two common single nucleotide polymorphisms (SNPs of XRCC1 gene with human head and neck squamous cell carcinoma (HNSCC. Methods The genotype analysis of Arg194Trp and Arg399Gln gene polymorphisms for 92 HNSCC patients and 124 controls of cancer free subjects, in Polish population were performed using the PCR-based restriction fragment length polymorphism (PCR-RFLP with endonuclease MspI. Results No altered risk has been found individually for these SNPs, however haplotypes analysis showed high association with head and neck cancer. The highest frequency, according to wild-type of Arg194Arg and Arg399Arg genotypes, was identified for Arg194Trp-Arg399Arg