WorldWideScience

Sample records for length cdna sequences

  1. The function analysis of full-length cDNA sequence from IRM-2 mouse cDNA library

    International Nuclear Information System (INIS)

    Wang Qin; Liu Xiaoqiu; Xu Chang; Du Liqing; Sun Zhijuan; Wang Yan; Liu Qiang; Song Li; Li Jin; Fan Feiyue

    2013-01-01

    Objective: To identify the function of full-length cDNA sequence from IRM-2 mouse cDNA library. Methods: Full-length cDNA products were amplified by PCR from IRM-2 mouse cDNA library according to twenty-one pieces of expressed sequence tag. The expression of full-length cDNAs were detected after mouse embryonic fibroblasts were exposed to 6.5 Gy γ-ray radiation. And the effect on the growth of radiosensitivity cells AT5B1VA transfected with full-length cDNAs was investigated. Results: The expression of No.4, 5 and 2 full-length cDNAs from IRM-2 mouse were higher than that of parental ICR and 615 mouse after mouse embryonic fibroblasts irradiated with γ-ray radiation. And the survival rate of AT5B1VA cells transfected with No.4, 5 and 2 full-length cDNAs was high. Conclusion: No.4, 5 and 2 full-length cDNAs of IRM-2 mouse are of high radioresistance. (authors)

  2. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas

    2009-03-17

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a model cartilaginous fish genome because of its relatively small genome size (910 Mb). The whole genome of C. milii is being sequenced (first cartilaginous fish genome to be sequenced completely). To characterize the transcriptome of C. milii and to assist in annotating exon-intron boundaries, transcriptional start sites and alternatively spliced transcripts, we are generating full-length cDNA sequences from C. milii.

  3. Characterization of full-length sequenced cDNA inserts (FLIcs from Atlantic salmon (Salmo salar

    Directory of Open Access Journals (Sweden)

    Lunner Sigbjørn

    2009-10-01

    Full Text Available Abstract Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP, the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91% of the transcripts were annotated using Gene Ontology (GO terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS. The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS. This

  4. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    Science.gov (United States)

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

  5. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  6. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  7. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  8. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  9. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  10. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    Science.gov (United States)

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  11. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  12. Full-Length Venom Protein cDNA Sequences from Venom-Derived mRNA: Exploring Compositional Variation and Adaptive Multigene Evolution.

    Science.gov (United States)

    Modahl, Cassandra M; Mackessy, Stephen P

    2016-06-01

    Envenomation of humans by snakes is a complex and continuously evolving medical emergency, and treatment is made that much more difficult by the diverse biochemical composition of many venoms. Venomous snakes and their venoms also provide models for the study of molecular evolutionary processes leading to adaptation and genotype-phenotype relationships. To compare venom complexity and protein sequences, venom gland transcriptomes are assembled, which usually requires the sacrifice of snakes for tissue. However, toxin transcripts are also present in venoms, offering the possibility of obtaining cDNA sequences directly from venom. This study provides evidence that unknown full-length venom protein transcripts can be obtained from the venoms of multiple species from all major venomous snake families. These unknown venom protein cDNAs are obtained by the use of primers designed from conserved signal peptide sequences within each venom protein superfamily. This technique was used to assemble a partial venom gland transcriptome for the Middle American Rattlesnake (Crotalus simus tzabcan) by amplifying sequences for phospholipases A2, serine proteases, C-lectins, and metalloproteinases from within venom. Phospholipase A2 sequences were also recovered from the venoms of several rattlesnakes and an elapid snake (Pseudechis porphyriacus), and three-finger toxin sequences were recovered from multiple rear-fanged snake species, demonstrating that the three major clades of advanced snakes (Elapidae, Viperidae, Colubridae) have stable mRNA present in their venoms. These cDNA sequences from venom were then used to explore potential activities derived from protein sequence similarities and evolutionary histories within these large multigene superfamilies. Venom-derived sequences can also be used to aid in characterizing venoms that lack proteomic profiles and identify sequence characteristics indicating specific envenomation profiles. This approach, requiring only venom, provides

  13. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  14. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  15. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  16. Assessment of adaptive evolution between wheat and rice as deduced from full-length common wheat cDNA sequence data and expression patterns

    Directory of Open Access Journals (Sweden)

    Hayashizaki Yoshihide

    2009-06-01

    Full Text Available Abstract Background Wheat is an allopolyploid plant that harbors a huge, complex genome. Therefore, accumulation of expressed sequence tags (ESTs for wheat is becoming particularly important for functional genomics and molecular breeding. We prepared a comprehensive collection of ESTs from the various tissues that develop during the wheat life cycle and from tissues subjected to stress. We also examined their expression profiles in silico. As full-length cDNAs are indispensable to certify the collected ESTs and annotate the genes in the wheat genome, we performed a systematic survey and sequencing of the full-length cDNA clones. This sequence information is a valuable genetic resource for functional genomics and will enable carrying out comparative genomics in cereals. Results As part of the functional genomics and development of genomic wheat resources, we have generated a collection of full-length cDNAs from common wheat. By grouping the ESTs of recombinant clones randomly selected from the full-length cDNA library, we were able to sequence 6,162 independent clones with high accuracy. About 10% of the clones were wheat-unique genes, without any counterparts within the DNA database. Wheat clones that showed high homology to those of rice were selected in order to investigate their expression patterns in various tissues throughout the wheat life cycle and in response to abiotic-stress treatments. To assess the variability of genes that have evolved differently in wheat and rice, we calculated the substitution rate (Ka/Ks of the counterparts in wheat and rice. Genes that were preferentially expressed in certain tissues or treatments had higher Ka/Ks values than those in other tissues and treatments, which suggests that the genes with the higher variability expressed in these tissues is under adaptive selection. Conclusion We have generated a high-quality full-length cDNA resource for common wheat, which is essential for continuation of the

  17. Gene discovery from Jatropha curcas by sequencing of ESTs from normalized and full-length enriched cDNA library from developing seeds

    Directory of Open Access Journals (Sweden)

    Sugantham Priyanka Annabel

    2010-10-01

    Full Text Available Abstract Background Jatropha curcas L. is promoted as an important non-edible biodiesel crop worldwide. Jatropha oil, which is a triacylglycerol, can be directly blended with petro-diesel or transesterified with methanol and used as biodiesel. Genetic improvement in jatropha is needed to increase the seed yield, oil content, drought and pest resistance, and to modify oil composition so that it becomes a technically and economically preferred source for biodiesel production. However, genetic improvement efforts in jatropha could not take advantage of genetic engineering methods due to lack of cloned genes from this species. To overcome this hurdle, the current gene discovery project was initiated with an objective of isolating as many functional genes as possible from J. curcas by large scale sequencing of expressed sequence tags (ESTs. Results A normalized and full-length enriched cDNA library was constructed from developing seeds of J. curcas. The cDNA library contained about 1 × 106 clones and average insert size of the clones was 2.1 kb. Totally 12,084 ESTs were sequenced to average high quality read length of 576 bp. Contig analysis revealed 2258 contigs and 4751 singletons. Contig size ranged from 2-23 and there were 7333 ESTs in the contigs. This resulted in 7009 unigenes which were annotated by BLASTX. It showed 3982 unigenes with significant similarity to known genes and 2836 unigenes with significant similarity to genes of unknown, hypothetical and putative proteins. The remaining 191 unigenes which did not show similarity with any genes in the public database may encode for unique genes. Functional classification revealed unigenes related to broad range of cellular, molecular and biological functions. Among the 7009 unigenes, 6233 unigenes were identified to be potential full-length genes. Conclusions The high quality normalized cDNA library was constructed from developing seeds of J. curcas for the first time and 7009 unigenes coding

  18. Salmo salar and Esox lucius full-length cDNA sequences reveal changes in evolutionary pressures on a post-tetraploidization genome

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-04-01

    Full Text Available Abstract Background Salmonids are one of the most intensely studied fish, in part due to their economic and environmental importance, and in part due to a recent whole genome duplication in the common ancestor of salmonids. This duplication greatly impacts species diversification, functional specialization, and adaptation. Extensive new genomic resources have recently become available for Atlantic salmon (Salmo salar, but documentation of allelic versus duplicate reference genes remains a major uncertainty in the complete characterization of its genome and its evolution. Results From existing expressed sequence tag (EST resources and three new full-length cDNA libraries, 9,057 reference quality full-length gene insert clones were identified for Atlantic salmon. A further 1,365 reference full-length clones were annotated from 29,221 northern pike (Esox lucius ESTs. Pairwise dN/dS comparisons within each of 408 sets of duplicated salmon genes using northern pike as a diploid out-group show asymmetric relaxation of selection on salmon duplicates. Conclusions 9,057 full-length reference genes were characterized in S. salar and can be used to identify alleles and gene family members. Comparisons of duplicated genes show that while purifying selection is the predominant force acting on both duplicates, consistent with retention of functionality in both copies, some relaxation of pressure on gene duplicates can be identified. In addition, there is evidence that evolution has acted asymmetrically on paralogs, allowing one of the pair to diverge at a faster rate.

  19. Hybrid Sequencing of Full-Length cDNA Transcripts of Stems and Leaves in Dendrobium officinale

    Directory of Open Access Journals (Sweden)

    Liu He

    2017-10-01

    Full Text Available Dendrobium officinale is an extremely valuable orchid used in traditional Chinese medicine, so sought after that it has a higher market value than gold. Although the expression profiles of some genes involved in the polysaccharide synthesis have previously been investigated, little research has been carried out on their alternatively spliced isoforms in D. officinale. In addition, information regarding the translocation of sugars from leaves to stems in D. officinale also remains limited. We analyzed the polysaccharide content of D. officinale leaves and stems, and completed in-depth transcriptome sequencing of these two diverse tissue types using second-generation sequencing (SGS and single-molecule real-time (SMRT sequencing technology. The results of this study yielded a digital inventory of gene and mRNA isoform expressions. A comparative analysis of both transcriptomes uncovered a total of 1414 differentially expressed genes, including 844 that were up-regulated and 570 that were down-regulated in stems. Of these genes, one sugars will eventually be exported transporter (SWEET and one sucrose transporter (SUT are expressed to a greater extent in D. officinale stems than in leaves. Two glycosyltransferase (GT and four cellulose synthase (Ces genes undergo a distinct degree of alternative splicing. In the stems, the content of polysaccharides is twice as much as that in the leaves. The differentially expressed GT and transcription factor (TF genes will be the focus of further study. The genes DoSWEET4 and DoSUT1 are significantly expressed in the stem, and are likely to be involved in sugar loading in the phloem.

  20. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  1. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  2. Construction and evaluation of normalized cDNA libraries enriched with full-length sequences for rapid discovery of new genes from Sisal (Agave sisalana Perr.) different developmental stages.

    Science.gov (United States)

    Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng

    2012-10-12

    To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing.

  3. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  4. Full-length cDNA sequence cloning and analysis of Ghrelin in Cervus nippon%梅花鹿Ghrelin全长cDNA克隆及其序列分析

    Institute of Scientific and Technical Information of China (English)

    张曼; 金鑫; 田巧珍; 刘骄; 王云鹤; 杨银凤

    2017-01-01

    为获得梅花鹿Ghrelin eDNA全序列,以梅花鹿皱胃黏膜上皮组织提取的总RNA为模板,通过RT-PCR和RACE法克隆了梅花鹿皱胃中Ghrelin基因eDNA的全序列.结果表明梅花鹿Ghrelin eDNA序列全长为539 bp,其中5’非翻译区(5'UTR)为46 bp,3'UTR为128 bp,开放阅读框(ORF)为351 bp,该ORF编码116个氨基酸残基.将梅花鹿Ghrelin基因的eDNA与人和其他动物的Ghrelin相比,发现:梅花鹿Ghrelin与驯鹿、山羊、绵羊和牛的同源性达90.4%~99.1%;与恒河猴、人、猪、犬的同源性达76.6%~66.9%;与鸡和野鸽的同源性分别为36.4%和35.4%.研究表明Ghrelin的结构具有明显的种属特异性,因此Ghrelin在反刍动物体内可能有着重要的生理功能.%In order to obtain the full-length cDNA of Ghrelin in Cervus nippon,RT-PCR and RACE methods were used by using total RNA of abomasus tissue in C.nippon as template.The results of sequence analysis revealed a 539 bp length cDNA containing 46 bp 5'-untranslated region (5'UTR),128 bp 3'-untranslated region (3'UTR) and 351 bp open reading frame (ORF) encoding 116 amino acids.The cDNA sequence alignments of C.nippon Ghrelin gene with human and other animals showed that the cDNA sequence homology of C.nippon Ghrelin was 90.4%-99.1% to reindeer,goat,sheep and cattle,66.9%-76.6% with rhesus monkey,human,pig and dog,only 36.4% with chicken and C.livia.These results indicated that the structure of Ghrelin displayed an obvious varietal specificity,suggesting that Ghrelin might play an important physiological function role in ruminants.

  5. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  6. Fiscal 2000 report on result of the full-length cDNA structure analysis; 2000 nendo kanzen cho cDNA kozo kaiseki seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    This paper explains the results of research on full-length cDNA structure analysis for the period from April, 2000 to March, 2001. The outline of human genome sequence was published in June, 2000. In Japan, human gene analysis was such that, as the basic technology of the bio industry, a millennium project was decided in the budget of fiscal 2000. The full-length cDNA structure analysis is the core of the project. The libraries of cDNA were prepared using full-length and more than 4-5kbp-long cDNAs by oligo-capping method. It began from determining partial sequence data at end cDNA, and then, with new clones selected therefrom, full-length human cDNA sequence data were determined. The partial sequence data determined by fiscal 2000 were 1,035,000 clones while the full-length sequence data were 12,144 clones. The sequence data obtained were analyzed by homology search and translated into amino acid coding sequences, with predictions conducted on protein functions. A clustering method was examined that selects new clones from partial sequences. Database was constructed on gene expression profiles and disease-related gene sequence data. (NEDO)

  7. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  8. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  9. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  10. Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning

    International Nuclear Information System (INIS)

    Han, J.H.; Stratowa, C.; Rutter, W.J.

    1987-01-01

    The authors have cloned a full-length putative rat pancreatic lysophospholipase cDNA by an improved mRNA isolation method and cDNA cloning strategy using [ 32 P]-labelled nucleotides. These new methods allow the construction of a cDNA library from the adult rat pancreas in which the majority of recombinant clones contained complete sequences for the corresponding mRNAs. A previously recognized but unidentified long and relatively rare cDNA clone containing the entire sequence from the cap site at the 5' end to the poly(A) tail at the 3' end of the mRNA was isolated by single-step screening of the library. The size, amino acid composition, and the activity of the protein expressed in heterologous cells strongly suggest this mRNA codes for lysophospholipase

  11. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  12. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  13. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu; Harishankar, M.; Dhinakar Raj, G.

    2011-01-01

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine

  14. Complete cDNA sequence coding for human docking protein

    Energy Technology Data Exchange (ETDEWEB)

    Hortsch, M; Labeit, S; Meyer, D I

    1988-01-11

    Docking protein (DP, or SRP receptor) is a rough endoplasmic reticulum (ER)-associated protein essential for the targeting and translocation of nascent polypeptides across this membrane. It specifically interacts with a cytoplasmic ribonucleoprotein complex, the signal recognition particle (SRP). The nucleotide sequence of cDNA encoding the entire human DP and its deduced amino acid sequence are given.

  15. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  16. Cloning, sequencing, and expression of cDNA for human β-glucuronidase

    International Nuclear Information System (INIS)

    Oshima, A.; Kyle, J.W.; Miller, R.D.

    1987-01-01

    The authors report here the cDNA sequence for human placental β-glucuronidase (β-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH 2 -terminal amino acid sequence determined for human spleen β-glucuronidase agreed with that inferred from the DNA sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human β-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human β-glucuronidase, demonstrate the existence of two populations of mRNA for β-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length

  17. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  19. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  20. Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

    Science.gov (United States)

    Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

    2016-08-24

    To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

  1. Cloning and sequence analysis of cDNA coding for rat nucleolar protein C23

    International Nuclear Information System (INIS)

    Ghaffari, S.H.; Olson, M.O.J.

    1986-01-01

    Using synthetic oligonucleotides as primers and probes, the authors have isolated and sequenced cDNA clones encoding protein C23, a putative nucleolus organizer protein. Poly(A + ) RNA was isolated from rat Novikoff hepatoma cells and enriched in C23 mRNA by sucrose density gradient ultracentrifugation. Two deoxyoligonuleotides, a 48- and a 27-mer, were synthesized on the basis of amino acid sequence from the C-terminal half of protein C23 and cDNA sequence data from CHO cell protein. The 48-mer was used a primer for synthesis of cDNA which was then inserted into plasmid pUC9. Transformed bacterial colonies were screened by hybridization with 32 P labeled 27-mer. Two clones among 5000 gave a strong positive signal. Plasmid DNAs from these clones were purified and characterized by blotting and nucleotide sequence analysis. The length of C23 mRNA was estimated to be 3200 bases in a northern blot analysis. The sequence of a 267 b.p. insert shows high homology with the CHO cDNA with only 9 nucleotide differences and an identical amino acid sequence. These studies indicate that this region of the protein is highly conserved

  2. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  3. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  4. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  5. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  9. cDNA sequences of two apolipoproteins from lamprey

    International Nuclear Information System (INIS)

    Pontes, M.; Xu, X.; Graham, D.; Riley, M.; Doolittle, R.F.

    1987-01-01

    The messages for two small but abundant apolipoproteins found in lamprey blood plasma were cloned with the aid of oligonucleotide probes based on amino-terminal sequences. In both cases, numerous clones were identified in a lamprey liver cDNA library, consistent with the great abundance of these proteins in lamprey blood. One of the cDNAs (LAL1) has a coding region of 105 amino acids that corresponds to a 21-residue signal peptide, a putative 8-residue propeptide, and the 76-residue mature protein found in blood. The other cDNA (LAL2) codes for a total of 191 residues, the first 23 of which constitute a signal peptide. The two proteins, which occur in the high-density lipoprotein fraction of ultracentrifuged plasma, have amino acid compositions similar to those of apolipoproteins found in mammalian blood; computer analysis indicates that the sequences are largely helix-permissive. When the sequences were searched against an amino acid sequence data base, rat apolipoprotein IV was the best matching candidate in both cases. Although a reasonable alignment can be made with that sequence and LAL1, definitive assignment of the two lamprey proteins to typical mammalian classes cannot be made at this point

  10. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  11. Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

    Science.gov (United States)

    Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

    2016-10-01

    A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

  12. Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

    International Nuclear Information System (INIS)

    Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.; Goldberg, O.; Soreq, H.

    1987-01-01

    To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from λgt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A) + RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species

  13. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  14. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  15. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming

    2007-06-01

    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  16. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  17. Technology development for gene discovery and full-length sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Marcelo Bento Soares

    2004-07-19

    In previous years, with support from the U.S. Department of Energy, we developed methods for construction of normalized and subtracted cDNA libraries, and constructed hundreds of high-quality libraries for production of Expressed Sequence Tags (ESTs). Our clones were made widely available to the scientific community through the IMAGE Consortium, and millions of ESTs were produced from our libraries either by collaborators or by our own sequencing laboratory at the University of Iowa. During this grant period, we focused on (1) the development of a method for preferential cloning of tissue-specific and/or rare transcripts, (2) its utilization to expedite EST-based gene discovery for the NIH Mouse Brain Molecular Anatomy Project, (3) further development and optimization of a method for construction of full-length-enriched cDNA libraries, and (4) modification of a plasmid vector to maximize efficiency of full-length cDNA sequencing by the transposon-mediated approach. It is noteworthy that the technology developed for preferential cloning of rare mRNAs enabled identification of over 2,000 mouse transcripts differentially expressed in the hippocampus. In addition, the method that we optimized for construction of full-length-enriched cDNA libraries was successfully utilized for the production of approximately fifty libraries from the developing mouse nervous system, from which over 2,500 full-ORF-containing cDNAs have been identified and accurately sequenced in their entirety either by our group or by the NIH-Mammalian Gene Collection Program Sequencing Team.

  18. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  19. Efficient generation of recombinant RNA viruses using targeted recombination-mediated mutagenesis of bacterial artificial chromosomes containing full-length cDNA

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Risager, Peter Christian; Fahnøe, Ulrik

    2013-01-01

    Background Infectious cDNA clones are a prerequisite for directed genetic manipulation of RNA viruses. Here, a strategy to facilitate manipulation and rescue of classical swine fever viruses (CSFVs) from full-length cDNAs present within bacterial artificial chromosomes (BACs) is described....... This strategy allows manipulation of viral cDNA by targeted recombination-mediated mutagenesis within bacteria. Results A new CSFV-BAC (pBeloR26) derived from the Riems vaccine strain has been constructed and subsequently modified in the E2 coding sequence, using the targeted recombination strategy to enable...

  20. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  1. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  2. cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer

    International Nuclear Information System (INIS)

    Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P

    2009-01-01

    Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis

  3. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  4. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  5. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Directory of Open Access Journals (Sweden)

    Alamar Santiago

    2009-09-01

    Full Text Available Abstract Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new

  6. A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

    Science.gov (United States)

    Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

    2009-01-01

    Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an

  7. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  8. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  9. XenDB: Full length cDNA prediction and cross species mapping in Xenopus laevis

    Directory of Open Access Journals (Sweden)

    Giegerich Robert

    2005-09-01

    Full Text Available Abstract Background Research using the model system Xenopus laevis has provided critical insights into the mechanisms of early vertebrate development and cell biology. Large scale sequencing efforts have provided an increasingly important resource for researchers. To provide full advantage of the available sequence, we have analyzed 350,468 Xenopus laevis Expressed Sequence Tags (ESTs both to identify full length protein encoding sequences and to develop a unique database system to support comparative approaches between X. laevis and other model systems. Description Using a suffix array based clustering approach, we have identified 25,971 clusters and 40,877 singleton sequences. Generation of a consensus sequence for each cluster resulted in 31,353 tentative contig and 4,801 singleton sequences. Using both BLASTX and FASTY comparison to five model organisms and the NR protein database, more than 15,000 sequences are predicted to encode full length proteins and these have been matched to publicly available IMAGE clones when available. Each sequence has been compared to the KOG database and ~67% of the sequences have been assigned a putative functional category. Based on sequence homology to mouse and human, putative GO annotations have been determined. Conclusion The results of the analysis have been stored in a publicly available database XenDB http://bibiserv.techfak.uni-bielefeld.de/xendb/. A unique capability of the database is the ability to batch upload cross species queries to identify potential Xenopus homologues and their associated full length clones. Examples are provided including mapping of microarray results and application of 'in silico' analysis. The ability to quickly translate the results of various species into 'Xenopus-centric' information should greatly enhance comparative embryological approaches. Supplementary material can be found at http://bibiserv.techfak.uni-bielefeld.de/xendb/.

  10. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  11. Integrative annotation of 21,037 human genes validated by full-length cDNA clones.

    Directory of Open Access Journals (Sweden)

    Tadashi Imanishi

    2004-06-01

    Full Text Available The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/. It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs, identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA

  12. [Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

    Science.gov (United States)

    Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

    2016-10-01

    To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

  13. Complete amino acid sequence of human intestinal aminopeptidase N as deduced from cloned cDNA

    DEFF Research Database (Denmark)

    Cowell, G M; Kønigshøfer, E; Danielsen, E M

    1988-01-01

    The complete primary structure (967 amino acids) of an intestinal human aminopeptidase N (EC 3.4.11.2) was deduced from the sequence of a cDNA clone. Aminopeptidase N is anchored to the microvillar membrane via an uncleaved signal for membrane insertion. A domain constituting amino acid 250...

  14. cDNA, genomic cloning and sequence analysis of ribosomal protein ...

    African Journals Online (AJOL)

    enoh

    2012-03-13

    Mar 13, 2012 ... cDNA and the genomic sequence of RPS4X were cloned successfully from ... S4 genes plays a role in Turner syndrome; however, this ..... Project of Educational Committee of Sichuan Province ... Molecular biology of the cell.

  15. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  16. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  17. Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

    Science.gov (United States)

    Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2015-02-02

    Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    In order to screen and isolate secondary metabolite biosynthesis related gene, we construct a cDNA library of white flower Salvia miltiorrhiza bge. f.alba. High quality of total RNA was successfully isolated from roots of white flower S. miltiorrhiza using modified CTAB method. Double strand cDNA was cloned into pDNR-LIB ...

  19. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    Science.gov (United States)

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  20. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  1. Use of Non-Normalized, Non-Amplified cDNA for 454-Based RNA Sequencing of Fleshy Melon Fruit

    Directory of Open Access Journals (Sweden)

    Vitaly Portnoy

    2011-03-01

    Full Text Available The melon ( L. fruit is an important crop and model system for the genomic study of both fleshy fruit development and the Cucurbitaceae family. To obtain an accurate representation of the melon fruit transcriptome based on expressed sequence tag (EST abundance in 454-pyrosequencing data, we prepared double-stranded complementary DNA (cDNA of melon without the usual amplification and normalization steps. A purification step was also included to eliminate small fragments. Complementary DNAs were obtained from 14 individual fruit libraries derived from two genotypes, separated into flesh and peel tissues, and sampled throughout fruit development. Pyrosequencing was performed using Genome Sequencer FLX (GS FLX technology, resulting in 1,215,359 reads, with mean length of >200 nucleotides. The global digital expression data was validated by comparative reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR of 40 selected genes and expression patterns were similar for the two methods. The results indicate that high-quality, nonbiased cDNA for next-generation sequencing can be prepared from mature, fleshy fruit, which are notorious for difficulties in ribonucleic acid (RNA preparation.

  2. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas.

    Science.gov (United States)

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na; Wang, Xiao-Tong; Yue, Xi-Qing

    2016-01-01

    The shell of the pearl oyster ( Pinctada fucata ) mainly comprises aragonite whereas that of the Pacific oyster ( Crassostrea gigas ) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  3. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas

    Directory of Open Access Journals (Sweden)

    Xing-Xia Li

    2016-01-01

    Full Text Available The shell of the pearl oyster (Pinctada fucata mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  4. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  5. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    Science.gov (United States)

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  6. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Directory of Open Access Journals (Sweden)

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  7. Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

    Science.gov (United States)

    Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

    2009-07-01

    Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

  8. Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background Microarray analysis and 454 cDNA sequencing were used to investigate a centuries-old problem in regenerative biology: the basis of nerve-dependent limb regeneration in salamanders. Innervated (NR and denervated (DL forelimbs of Mexican axolotls were amputated and transcripts were sampled after 0, 5, and 14 days of regeneration. Results Considerable similarity was observed between NR and DL transcriptional programs at 5 and 14 days post amputation (dpa. Genes with extracellular functions that are critical to wound healing were upregulated while muscle-specific genes were downregulated. Thus, many processes that are regulated during early limb regeneration do not depend upon nerve-derived factors. The majority of the transcriptional differences between NR and DL limbs were correlated with blastema formation; cell numbers increased in NR limbs after 5 dpa and this yielded distinct transcriptional signatures of cell proliferation in NR limbs at 14 dpa. These transcriptional signatures were not observed in DL limbs. Instead, gene expression changes within DL limbs suggest more diverse and protracted wound-healing responses. 454 cDNA sequencing complemented the microarray analysis by providing deeper sampling of transcriptional programs and associated biological processes. Assembly of new 454 cDNA sequences with existing expressed sequence tag (EST contigs from the Ambystoma EST database more than doubled (3935 to 9411 the number of non-redundant human-A. mexicanum orthologous sequences. Conclusion Many new candidate gene sequences were discovered for the first time and these will greatly enable future studies of wound healing, epigenetics, genome stability, and nerve-dependent blastema formation and outgrowth using the axolotl model.

  9. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Science.gov (United States)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  11. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    Science.gov (United States)

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  12. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  13. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  14. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  15. Molecular cloning and sequence analysis of growth hormone cDNA of Neotropical freshwater fish Pacu (Piaractus mesopotamicus

    Directory of Open Access Journals (Sweden)

    Janeth Silva Pinheiro

    2008-01-01

    Full Text Available RT-PCR was used for amplifying Piaractus mesopotamicus growth hormone (GH cDNA obtained from mRNA extracted from pituitary cells. The amplified fragment was cloned and the complete cDNA sequence was determined. The cloned cDNA encompassed a sequence of 543 nucleotides that encoded a polypeptide of 178 amino acids corresponding to mature P. mesopotamicus GH. Comparison with other GH sequences showed a gap of 10 amino acids localized in the N terminus of the putative polypeptide of P. mesopotamicus. This same gap was also observed in other members of the family. Neighbor-joining tree analysis with GH sequences from fishes belonging to different taxonomic groups placed the P. mesopotamicus GH within the Otophysi group. To our knowledge, this is the first GH sequence of a Neotropical characiform fish deposited in GenBank.

  16. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  17. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    International Nuclear Information System (INIS)

    Aris, J.P.; Blobel, G.

    1991-01-01

    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is ∼1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain ∼75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis

  18. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  19. Full-length enriched multistage cDNA library construction covering ...

    African Journals Online (AJOL)

    DR TONUKARI NYEROVWO

    2012-04-10

    Apr 10, 2012 ... Full Length Research Paper. Full-length enriched ... complementary DNA; pfu, plaque-forming unit. ... Chinese-native tree species in Populus section Leuce ... the infected bacteria, 2 ml melted top agar was added, and the.

  20. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  1. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  2. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  3. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  4. Cloning and cDNA sequence of the dihydrolipoamide dehydrogenase component of human α-ketoacid dehydrogenase complexes

    International Nuclear Information System (INIS)

    Pons, G.; Raefsky-Estrin, C.; Carothers, D.J.; Pepin, R.A.; Javed, A.A.; Jesse, B.W.; Ganapathi, M.K.; Samols, D.; Patel, M.S.

    1988-01-01

    cDNA clones comprising the entire coding region for human dihydrolipoamide dehydrogenase have been isolated from a human liver cDNA library. The cDNA sequence of the largest clone consisted of 2082 base pairs and contained a 1527-base open reading frame that encodes a precursor dihydrolipoamide dehydrogenase of 509 amino acid residues. The first 35-amino acid residues of the open reading frame probably correspond to a typical mitochondrial import leader sequence. The predicted amino acid sequence of the mature protein, starting at the residue number 36 of the open reading frame, is almost identical (>98% homology) with the known partial amino acid sequence of the pig heart dihydrolipoamide dehydrogenase. The cDNA clone also contains a 3' untranslated region of 505 bases with an unusual polyadenylylation signal (TATAAA) and a short poly(A) track. By blot-hybridization analysis with the cDNA as probe, two mRNAs, 2.2 and 2.4 kilobases in size, have been detected in human tissues and fibroblasts, whereas only one mRNA (2.4 kilobases) was detected in rat tissues

  5. Purification of MUC1 from Bovine Milk-Fat Globules and Characterization of a Corresponding Full-Length cDNA Clone

    DEFF Research Database (Denmark)

    Pallesen, Lone Tjener; Andersen, Mikkel Holmen; Nielsen, Rune

    2001-01-01

    acid sequences obtained by peptide mapping. The complete amino acid sequence of MUC1 was determined by cloning and sequencing the corresponding bovine mammary gland cDNA, which was shown to encode a protein of 580 amino acid residues comprising a cleavable signal peptide of 22 residues. The deduced...

  6. Blind sequence-length estimation of low-SNR cyclostationary sequences

    CSIR Research Space (South Africa)

    Vlok, JD

    2014-06-01

    Full Text Available Several existing direct-sequence spread spectrum (DSSS) detection and estimation algorithms assume prior knowledge of the symbol period or sequence length, although very few sequence-length estimation techniques are available in the literature...

  7. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  8. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  9. Isolation and sequencing of a cDNA coding for the human DF3 breast carcinoma-associated antigen

    International Nuclear Information System (INIS)

    Siddiqui, J.; Abe, M.; Hayes, D.; Shani, E.; Yunis, E.; Kufe, D.

    1988-01-01

    The murine monoclonal antibody (mAb) DF3 reacts with a high molecular weight glycoprotein detectable in human breast carcinomas. DF3 antigen expression correlates with human breast tumor differentiation, and the detection of a cross-reactive species in human milk has suggested that this antigen might be useful as a marker of differentiated mammary epithelium. To further characterize DF3 antigen expression, the authors have isolated a cDNA clone from a λgt11 library by screening with mAb DF3. The results demonstrate that this 309-base-pair cDNA, designated pDF9.3, codes for the DF3 epitope. Southern blot analyses of EcoRI-digested DNAs from six human tumor cell lines with 32 P-labeled pDF9.3 have revealed a restriction fragment length polymorphism. Variations in size of the alleles detected by pDF9.3 were also identified in Pst I, but not in HindIII, DNA digests. Furthermore, hybridization of 32 P-labeled pDF9.3 with total cellular RNA from each of these cell lines demonstrated either one or two transcripts that varied from 4.1 to 7.1 kilobases in size. The presence of differently sized transcripts detected by pDF9.3 was also found to correspond with the polymorphic expression of DF3 glycoproteins. Nucleotide sequence analysis of pDF9.3 has revealed a highly conserved (G + C)-rich 60-base-pair tandem repeat. These findings suggest that the variation in size of alleles coding for the polymorphic DF3 glycoprotein may represent different numbers of repeats

  10. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  11. Molecular cloning and sequence analysis of hamster CENP-A cDNA

    Directory of Open Access Journals (Sweden)

    Valdivia Manuel M

    2002-05-01

    Full Text Available Abstract Background The centromere is a specialized locus that mediates chromosome movement during mitosis and meiosis. This chromosomal domain comprises a uniquely packaged form of heterochromatin that acts as a nucleus for the assembly of the kinetochore a trilaminar proteinaceous structure on the surface of each chromatid at the primary constriction. Kinetochores mediate interactions with the spindle fibers of the mitotic apparatus. Centromere protein A (CENP-A is a histone H3-like protein specifically located to the inner plate of kinetochore at active centromeres. CENP-A works as a component of specialized nucleosomes at centromeres bound to arrays of repeat satellite DNA. Results We have cloned the hamster homologue of human and mouse CENP-A. The cDNA isolated was found to contain an open reading frame encoding a polypeptide consisting of 129 amino acid residues with a C-terminal histone fold domain highly homologous to those of CENP-A and H3 sequences previously released. However, significant sequence divergence was found at the N-terminal region of hamster CENP-A that is five and eleven residues shorter than those of mouse and human respectively. Further, a human serine 7 residue, a target site for Aurora B kinase phosphorylation involved in the mechanism of cytokinesis, was not found in the hamster protein. A human autoepitope at the N-terminal region of CENP-A described in autoinmune diseases is not conserved in the hamster protein. Conclusions We have cloned the hamster cDNA for the centromeric protein CENP-A. Significant differences on protein sequence were found at the N-terminal tail of hamster CENP-A in comparison with that of human and mouse. Our results show a high degree of evolutionary divergence of kinetochore CENP-A proteins in mammals. This is related to the high diverse nucleotide repeat sequences found at the centromere DNA among species and support a current centromere model for kinetochore function and structural

  12. Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

    Science.gov (United States)

    Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

    2016-02-02

    Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Construction of a full-length cDNA library and analysis of expressed ...

    African Journals Online (AJOL)

    ... in the GenBank databases. Cluster analysis allowed the identification of 61 unique sequences. These genes were classified into six types by Gene Ontology (GO) annotation. The results also indicated that unigenes of C. capsularis have higher homology to Populus trichocarpa, Ricinus communis and Corchorus olitorius.

  14. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  15. Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

    Science.gov (United States)

    Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

  16. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  17. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  18. Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli

    International Nuclear Information System (INIS)

    Satyanarayana, Tatineni; Gowda, Siddarame; Ayllon, Maria A.; Dawson, William O.

    2003-01-01

    The advent of reverse genetics revolutionized the study of positive-stranded RNA viruses that were amenable for cloning as cDNAs into high-copy-number plasmids of Escherichia coli. However, some viruses are inherently refractory to cloning in high-copy-number plasmids due to toxicity of viral sequences to E. coli. We report a strategy that is a compromise between infectivity of the RNA transcripts and toxicity to E. coli effected by introducing frameshift mutations into 'slippery sequences' near the viral 'toxicity sequences' in the viral cDNA. Citrus tristeza virus (CTV) has cDNA sequences that are toxic to E. coli. The original full-length infectious cDNA of CTV and a derivative replicon, CTV-ΔCla, cloned into pUC119, resulted in unusually limited E. coli growth. However, upon sequencing of these cDNAs, an additional uridinylate (U) was found in a stretch of U's between nts 3726 and 3731 that resulted in a change to a reading frame with a stop codon at nt 3734. Yet, in vitro produced RNA transcripts from these clones infected protoplasts, and the resulting progeny virus was repaired. Correction of the frameshift mutation in the CTV cDNA constructs resulted in increased infectivity of in vitro produced RNA transcripts, but also caused a substantial increase of toxicity to E. coli, now requiring 3 days to develop visible colonies. Frameshift mutations created in sequences not suspected to facilitate reading frame shifting and silent mutations introduced into oligo(U) regions resulted in complete loss of infectivity, suggesting that the oligo(U) region facilitated the repair of the frameshift mutation. Additional frameshift mutations introduced into other oligo(U) regions also resulted in transcripts with reduced infectivity similarly to the original clones with the +1 insertion. However, only the frameshift mutations introduced into oligo(U) regions that were near and before the toxicity region improved growth and stability in E. coli. These data demonstrate that

  19. Cloning and Sequencing of Protein Kinase cDNA from Harbor Seal (Phoca vitulina Lymphocytes

    Directory of Open Access Journals (Sweden)

    Jennifer C. C. Neale

    2004-01-01

    Full Text Available Protein kinases (PKs play critical roles in signal transduction and activation of lymphocytes. The identification of PK genes provides a tool for understanding mechanisms of immunotoxic xenobiotics. As part of a larger study investigating persistent organic pollutants in the harbor seal and their possible immunomodulatory actions, we sequenced harbor seal cDNA fragments encoding PKs. The procedure, using degenerate primers based on conserved motifs of human protein tyrosine kinases (PTKs, successfully amplified nine phocid PK gene fragments with high homology to human and rodent orthologs. We identified eight PTKs and one dual (serine/threonine and tyrosine kinase. Among these were several PKs important in early signaling events through the B- and T-cell receptors (FYN, LYN, ITK and SYK and a MAP kinase involved in downstream signal transduction. V-FGR, RET and DDR2 were also expressed. Sequential activation of protein kinases ultimately induces gene transcription leading to the proliferation and differentiation of lymphocytes critical to adaptive immunity. PKs are potential targets of bioactive xenobiotics, including persistent organic pollutants of the marine environment; characterization of these molecules in the harbor seal provides a foundation for further research illuminating mechanisms of action of contaminants speculated to contribute to large-scale die-offs of marine mammals via immunosuppression.

  20. Human liver phosphatase 2A: cDNA and amino acid sequence of two catalytic subunit isotypes

    International Nuclear Information System (INIS)

    Arino, J.; Woon, Chee Wai; Brautigan, D.L.; Miller, T.B. Jr.; Johnson, G.L.

    1988-01-01

    Two cDNA clones were isolated from a human liver library that encode two phosphatase 2A catalytic subunits. The two cDNAs differed in eight amino acids (97% identity) with three nonconservative substitutions. All of the amino acid substitutions were clustered in the amino-terminal domain of the protein. Amino acid sequence of one human liver clone (HL-14) was identical to the rabbit skeletal muscle phosphatase 2A cDNA (with 97% nucleotide identity). The second human liver clone (HL-1) is encoded by a separate gene, and RNA gel blot analysis indicates that both mRNAs are expressed similarly in several human clonal cell lines. Sequence comparison with phosphatase 1 and 2A indicates highly divergent amino acid sequences at the amino and carboxyl termini of the proteins and identifies six highly conserved regions between the two proteins that are predicted to be important for phosphatase enzymatic activity

  1. Ferritin from the Pacific abalone Haliotis discus hannai: Analysis of cDNA sequence, expression, and activity.

    Science.gov (United States)

    Qiu, Reng; Kan, Yunchao; Li, Dandan

    2016-02-01

    Ferritin plays an important role in iron homeostasis due to its ability to bind and sequester large amounts of iron. In this study, the gene encoding a ferritin (HdhFer2) was cloned from Pacific abalone (Haliotis discus hannai). The full-length cDNA of HdhFer2 contains a 5'-UTR of 121 bp, an ORF of 516 bp, and a 3'-UTR of 252 bp with a polyadenylation signal sequence of AATAAA and a poly(A) tail. It also contains a 31 bp iron-responsive element (IRE) in the 5'-UTR position, which is conserved in many ferritins. HdhFer2 consists of 171 amino acid residues with a predicted molecular weight (MW) ∼19.8 kDa and a theoretical isoelectric point (PI) of 4.84. The deduced amino acid sequence of HdhFer2 contains two ferritin iron-binding region signatures (IBRSs). HdhFer2 mRNA was detected in a wide range of tissues and was dominantly expressed in the gill. Infection with the bacterial pathogen Vibrio anguillarum significantly upregulated HdhFer2 expression in a time-dependent manner. Recombinant HdhFer2 (rHdhFer2) purified from Escherichia coli was able to bind ferrous iron in a concentration-dependent manner. In summary, these results suggest that HdhFer2 is a crucial protein in the iron-withholding defense system, and plays an important role in the innate immune response of abalone. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  3. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    Directory of Open Access Journals (Sweden)

    Adam D. Hargreaves

    2015-11-01

    Full Text Available Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete and Sanger-based ESTs (15/29. We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  4. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    Science.gov (United States)

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  5. Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

    Directory of Open Access Journals (Sweden)

    Mika Ohta

    2011-01-01

    Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

  6. The relationship of protein conservation and sequence length

    Directory of Open Access Journals (Sweden)

    Panchenko Anna R

    2002-11-01

    Full Text Available Abstract Background In general, the length of a protein sequence is determined by its function and the wide variance in the lengths of an organism's proteins reflects the diversity of specific functional roles for these proteins. However, additional evolutionary forces that affect the length of a protein may be revealed by studying the length distributions of proteins evolving under weaker functional constraints. Results We performed sequence comparisons to distinguish highly conserved and poorly conserved proteins from the bacterium Escherichia coli, the archaeon Archaeoglobus fulgidus, and the eukaryotes Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. For all organisms studied, the conserved and nonconserved proteins have strikingly different length distributions. The conserved proteins are, on average, longer than the poorly conserved ones, and the length distributions for the poorly conserved proteins have a relatively narrow peak, in contrast to the conserved proteins whose lengths spread over a wider range of values. For the two prokaryotes studied, the poorly conserved proteins approximate the minimal length distribution expected for a diverse range of structural folds. Conclusions There is a relationship between protein conservation and sequence length. For all the organisms studied, there seems to be a significant evolutionary trend favoring shorter proteins in the absence of other, more specific functional constraints.

  7. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  8. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  9. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    International Nuclear Information System (INIS)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E.; Flores, B.M.; Hagen, F.S.

    1990-01-01

    A λgt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically 35 S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface- 125 I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4 degree C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested

  10. cDNA sequence analysis of a 29-kDa cysteine-rich surface antigen of pathogenic Entamoeba histolytica

    Energy Technology Data Exchange (ETDEWEB)

    Torian, B.E.; Stroeher, V.L.; Stamm, W.E. (Univ. of Washington, Seattle (USA)); Flores, B.M. (Louisiana State Univ. Medical Center, New Orleans (USA)); Hagen, F.S. (Zymogenetics Incorporated, Seattle, WA (USA))

    1990-08-01

    A {lambda}gt11 cDNA library was constructed from poly(U)-Spharose-selected Entamoeba histolytica trophozoite RNA in order to clone and identify surface antigens. The library was screened with rabbit polyclonal anti-E. histolytica serum. A 700-base-pair cDNA insert was isolated and the nucleotide sequence was determined. The deduced amino acid sequence of the cDNA revealed a cysteine-rich protein. DNA hybridizations showed that the gene was specific to E. histolytica since the cDNA probe reacted with DNA from four axenic strains of E. histolytica but did not react with DNA from Entamoeba invadens, Acanthamoeba castellanii, or Trichomonas vaginalis. The insert was subcloned into the expression vector pGEX-1 and the protein was expressed as a fusion with the C terminus of glutathione S-transferase. Purified fusion protein was used to generate 22 monoclonal antibodies (mAbs) and a mouse polyclonal antiserum specific for the E. histolytica portion of the fusion protein. A 29-kDa protein was identified as a surface antigen when mAbs were used to immunoprecipitate the antigen from metabolically {sup 35}S-labeled live trophozoites. The surface location of the antigen was corroborated by mAb immunoprecipitation of a 29-kDa protein from surface-{sup 125}I-labeled whole trophozoites as well as by the reaction of mAbs with live trophozoites in an indirect immunofluorescence assay performed at 4{degree}C. Immunoblotting with mAbs demonstrated that the antigen was present on four axenic isolates tested. mAbs recognized epitopes on the 29-kDa native antigen on some but not all clinical isolates tested.

  11. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  12. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-03

    Dec 3, 2008 ... First strand cDNA was synthesized by RT-PCR with Oligo(dT)15 using mRNA isolated ... 4°C. Single colonies were picked into 5 mL BMGY medium for preculture, and incubated ... to fold properly into a native conformation. Without the .... polymorphism is often used in taxonomy, but now, it is being well ...

  13. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    International Nuclear Information System (INIS)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-01-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary λgt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/β-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of 125 I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene

  14. Primary structure of bovine pituitary secretory protein I (chromogranin A) deduced from the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Ahn, T.G.; Cohn, D.V.; Gorr, S.U.; Ornstein, D.L.; Kashdan, M.A.; Levine, M.A.

    1987-07-01

    Secretory protein I (SP-I), also referred to as chromogranin A, is an acidic glycoprotein that has been found in every tissue of endocrine and neuroendocrine origin examined but never in exocrine or epithelial cells. Its co-storage and co-secretion with peptide hormones and neurotransmitters suggest that it has an important endocrine or secretory function. The authors have isolated cDNA clones from a bovine pituitary lambdagt11 expression library using an antiserum to parathyroid SP-I. The largest clone (SP4B) hybridized to a transcript of 2.1 kilobases in RNA from parathyroid, pituitary, and adrenal medulla. Immunoblots of bacterial lysates derived from SP4B lysognes demonstrated specific antibody binding to an SP4B/..beta..-galactosidase fusion protein (160 kDa) with a cDNA-derived component of 46 kDa. Radioimmunoassay of the bacterial lystates with SP-I antiserum yielded parallel displacement curves of /sup 125/I-labeled SP-I by the SP4B lysate and authentic SP-I. SP4B contains a cDNA of 1614 nucleotides that encodes a 449-amino acid protein (calculated mass, 50 kDa). The nucleotide sequences of the pituitary SP-I cDNA and adrenal medullary SP-I cDNAs are nearly identical. Analysis of genomic DNA suggests that pituitary, adrenal, and parathyroid SP-I are products of the same gene.

  15. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  16. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide from the seabuckthorn carpenterworm, Holcocerus hippophaecolus (Lepidoptera: Cossidae).

    Science.gov (United States)

    Li, Juan; Zhou, Jiao; Sun, Rongbo; Zhang, Haolin; Zong, Shixiang; Luo, Youqing; Sheng, Xia; Weng, Qiang

    2013-04-01

    The PBAN (pheromone biosynthesis activating neuropeptide)/pyrokinin peptides comprise a major neuropeptide family characterized by a common FXPRL amide at the C-terminus. These peptides are actively involved in many essential endocrine functions. For the first time, we reported the cDNA cloning and sequence determination of the PBAN from the seabuckthorn carpenterworm, Holcocerus hippophaecolus, by using rapid amplification of cDNA ends. The full-length cDNA of Hh-DH-PBAN contained five peptides: diapause hormone (DH) homolog, α-neuropeptide (NP), β-NP, PBAN, and γ-NP. All of the peptides were amidated at their C-terminus and shared a conserved motif, FXPR (or K) L. Moreover, Hh-DH-PBAN had high homology to the other members of the PBAN peptide family: 56% with Manduca sexta, 66% with Bombyx mori, 77% with Helicoverpa zea, and 47% with Plutella xylostella. Phylogenetic analysis revealed that Hh-DH-PBAN was closely related to PBANs from Noctuidae, demonstrated by the relatively higher similarity compared with H. zea. In addition, real-time quantitative PCR (qRT-PCR) analysis showed that Hh-DH-PBAN mRNA expression peaked in the brain-subesophageal ganglion (Br-SOG) complex, and was also detected at high levels during larval and adult stages. The expression decreased significantly after pupation. These results provided information concerning molecular structure characteristics of Hh-DH-PBAN, whose expression profile suggested that the Hh-DH-PBAN gene might be correlated with larval development and sex pheromone biosynthesis in females of the H. hippophaecolus. 2013 Wiley Periodicals, Inc

  17. Detecting Scareware by Mining Variable Length Instruction Sequences

    OpenAIRE

    Shahzad, Raja Khurram; Lavesson, Niklas

    2011-01-01

    Scareware is a recent type of malicious software that may pose financial and privacy-related threats to novice users. Traditional countermeasures, such as anti-virus software, require regular updates and often lack the capability of detecting novel (unseen) instances. This paper presents a scareware detection method that is based on the application of machine learning algorithms to learn patterns in extracted variable length opcode sequences derived from instruction sequences of binary files....

  18. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  19. Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

    Science.gov (United States)

    Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

    2014-01-01

    High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

  20. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  1. Generation and Analysis of Full-length cDNA Sequences from Elephant Shark (Callorhinchus milii)

    KAUST Repository

    Kodzius, Rimantas; Tay, Boon-Hui; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa

    2009-01-01

    Cartilaginous fishes are the oldest living group of jawed vertebrates and therefore is an important group for understanding the evolution of vertebrate genomes including the human genome. Our laboratory has proposed elephant shark (C. milii) as a

  2. Sequencing, mapping, and analysis of 27,455 maize full-length cDNAs.

    Directory of Open Access Journals (Sweden)

    Carol Soderlund

    2009-11-01

    Full Text Available Full-length cDNA (FLcDNA sequencing establishes the precise primary structure of individual gene transcripts. From two libraries representing 27 B73 tissues and abiotic stress treatments, 27,455 high-quality FLcDNAs were sequenced. The average transcript length was 1.44 kb including 218 bases and 321 bases of 5' and 3' UTR, respectively, with 8.6% of the FLcDNAs encoding predicted proteins of fewer than 100 amino acids. Approximately 94% of the FLcDNAs were stringently mapped to the maize genome. Although nearly two-thirds of this genome is composed of transposable elements (TEs, only 5.6% of the FLcDNAs contained TE sequences in coding or UTR regions. Approximately 7.2% of the FLcDNAs are putative transcription factors, suggesting that rare transcripts are well-enriched in our FLcDNA set. Protein similarity searching identified 1,737 maize transcripts not present in rice, sorghum, Arabidopsis, or poplar annotated genes. A strict FLcDNA assembly generated 24,467 non-redundant sequences, of which 88% have non-maize protein matches. The FLcDNAs were also assembled with 41,759 FLcDNAs in GenBank from other projects, where semi-strict parameters were used to identify 13,368 potentially unique non-redundant sequences from this project. The libraries, ESTs, and FLcDNA sequences produced from this project are publicly available. The annotated EST and FLcDNA assemblies are available through the maize FLcDNA web resource (www.maizecdna.org.

  3. Analysis of xylem formation in pine by cDNA sequencing

    Science.gov (United States)

    Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.; hide

    1998-01-01

    Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.

  4. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    Science.gov (United States)

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  5. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  6. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    KAUST Repository

    Brenner, Sydney; Kodzius, Rimantas; Tan, Yue Ying; Tay, Alice; Tay, Boon-Hui; Venkatesh, Byrappa

    2012-01-01

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the 'oligo-capping' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5'-ESTs and 41,317 3'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for whole

  7. Sequencing and analysis of full-length cDNAs, 5'-ESTs and 3'-ESTs from a cartilaginous fish, the elephant shark (Callorhinchus milii).

    KAUST Repository

    Brenner, Sydney

    2012-10-08

    Cartilaginous fishes are the most ancient group of living jawed vertebrates (gnathostomes) and are, therefore, an important reference group for understanding the evolution of vertebrates. The elephant shark (Callorhinchus milii), a holocephalan cartilaginous fish, has been identified as a model cartilaginous fish genome because of its compact genome (∼910 Mb) and a genome project has been initiated to obtain its whole genome sequence. In this study, we have generated and sequenced full-length enriched cDNA libraries of the elephant shark using the \\'oligo-capping\\' method and Sanger sequencing. A total of 6,778 full-length protein-coding cDNA and 10,701 full-length noncoding cDNA were sequenced from six tissues (gills, intestine, kidney, liver, spleen, and testis) of the elephant shark. Analysis of their polyadenylation signals showed that polyadenylation usage in elephant shark is similar to that in mammals. Furthermore, both coding and noncoding transcripts of the elephant shark use the same proportion of canonical polyadenylation sites. Besides BLASTX searches, protein-coding transcripts were annotated by Gene Ontology, InterPro domain, and KEGG pathway analyses. By comparing elephant shark genes to bony vertebrate genes, we identified several ancient genes present in elephant shark but differentially lost in tetrapods or teleosts. Only ∼6% of elephant shark noncoding cDNA showed similarity to known noncoding RNAs (ncRNAs). The rest are either highly divergent ncRNAs or novel ncRNAs. In addition to full-length transcripts, 30,375 5\\'-ESTs and 41,317 3\\'-ESTs were sequenced and annotated. The clones and transcripts generated in this study are valuable resources for annotating transcription start sites, exon-intron boundaries, and UTRs of genes in the elephant shark genome, and for the functional characterization of protein sequences. These resources will also be useful for annotating genes in other cartilaginous fishes whose genomes have been targeted for

  8. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  9. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  10. Divergence of host range and biological properties between natural isolate and full-length infectious cDNA clone of the Beet mild yellowing virus 2ITB.

    Science.gov (United States)

    Klein, Elodie; Brault, Véronique; Klein, Delphine; Weyens, Guy; Lefèbvre, Marc; Ziegler-Graff, Véronique; Gilmer, David

    2014-01-01

    Plant infection by poleroviruses is restricted to phloem tissues, preventing any classical leaf rub inoculation with viral RNA or virions. Efficient virus inoculation to plants is achieved by viruliferous aphids that acquire the virus by feeding on infected plants. The use of promoter-driven infectious cDNA is an alternative means to infect plants and allows reverse genetic studies to be performed. Using Beet mild yellowing virus isolate 2ITB (BMYV-2ITB), we produced a full-length infectious cDNA clone of the virus (named BMYV-EK) placed under the control of the T7 RNA polymerase and the Cauliflower mosaic virus 35S promoters. Infectivity of the engineered BMYV-EK virus was assayed in different plant species and compared with that of the original virus. We showed that in vitro- or in planta-derived transcripts were infectious in protoplasts and in whole plants. Importantly, the natural aphid vector Myzus persicae efficiently transmitted the viral progeny produced in infected plants. By comparing agroinoculation and aphid infection in a host range assay, we showed that the engineered BMYV-EK virus displayed a similar host range to BMYV-2ITB, except for Nicotiana benthamiana, which proved to be resistant to systemic infection with BMYV-EK. Finally, both the BMYV-EK P0 and the full-length clone were able to strongly interfere with post-transcriptional gene silencing. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  11. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  12. Molecular cloning of chicken metallothionein. Deduction of the complete amino acid sequence and analysis of expression using cloned cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Wei, D; Andrews, G K

    1988-01-25

    A cDNA library was constructed using RNA isolated from the livers of chickens which had been treated with zinc. This library was screened with a RNA probe complementary to mouse metallothionein-I (MT), and eight chicken MT cDNA clones were obtained. All of the cDNA clones contained nucleotide sequences homologous to regions of the longest (375 bp) cDNA clone. The latter contained an open reading frame of 189 bp, and the deduced amino acid sequence indicates a protein of 63 amino acids of which 20 are cysteine residues. Amino acid composition and partial amino acid sequence analyses of purified chicken MT protein agreed with the amino acid composition and sequence deduced from the cloned cDNA. Amino acid sequence comparison establish that chicken MT shares extensive homology with mammalian MTs. Southern blot analysis of chicken DNA indicates that the chicken MT gene is not a part of a large family of related sequences, but rather is likely to be a unique gene sequence. In the chicken liver, levels of chicken MT mRNA were rapidly induced by metals (Cd/sup 2 +/, Zn/sup 2 +/, Cu/sup 2 +/), glucocorticoids and lipopolysaccharide. MT mRNA was present in low levels in embryonic liver and increased to high levels during the first week after hatching before decreasing again to the basal levels found in adult liver. The results of this study establish that MT is highly conserved between birds and mammals and is regulated in the chicken by agents which also regulate expression of mammalian MT genes. However, in contrast to the mammals, the results suggest the existence of a single isoform of MT in the chicken.

  13. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  14. Cloning and sequencing of full-length cDNAs of RNA1 and RNA2 of a Tomato black ring virus isolate from Poland.

    Science.gov (United States)

    Jończyk, M; Le Gall, O; Pałucha, A; Borodynko, N; Pospieszny, H

    2004-04-01

    Full-length cDNA clones corresponding to the RNA1 and RNA2 of the Polish isolate MJ of Tomato black ring virus (TBRV, genus Nepovirus) were obtained using a direct recombination strategy in yeast, and their complete nucleotide sequences were established. RNA1 is 7358 nucleotides and RNA2 is 4633 nucleotides in length, excluding the poly(A) tails. Both RNAs contain a single open reading frame encoding polyproteins of 254 kDa and 149 kDa for RNA1 and RNA2 respectively. Putative cleavage sites were identified, and the relationships between TBRV and related nepoviruses were studied by sequence comparison.

  15. Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

    Science.gov (United States)

    Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

    1991-05-01

    Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

  16. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  17. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  18. Isolation of a cDNA clone complementary to sequences for a 34-kilodalton protein which is a pp60v-src substrate.

    OpenAIRE

    Tomasiewicz, H G; Cook-Deegan, R; Chikaraishi, D M

    1984-01-01

    We have isolated a partial cDNA clone containing sequences complementary to a mRNA encoding a 34- to 36-kilodalton normal chicken cell protein which is a substrate for pp60v-src kinase activity. Using this 34-kilodalton cDNA clone as a probe, we determined that the size of the 34-kilodalton mRNA was 1,100 nucleotides and the level of the 34-kilodalton RNA was the same in various tissues of mature chickens but was significantly higher in chicken embryo fibroblast cells.

  19. Inconsistencies of genome annotations in apicomplexan parasites revealed by 5'-end-one-pass and full-length sequences of oligo-capped cDNAs

    Directory of Open Access Journals (Sweden)

    Sugano Sumio

    2009-07-01

    Full Text Available Abstract Background Apicomplexan parasites are causative agents of various diseases including malaria and have been targets of extensive genomic sequencing. We generated 5'-EST collections for six apicomplexa parasites using our full-length oligo-capping cDNA library method. To improve upon the current genome annotations, as well as to validate the importance for physical cDNA clone resources, we generated a large-scale collection of full-length cDNAs for several apicomplexa parasites. Results In this study, we used a total of 61,056 5'-end-single-pass cDNA sequences from Plasmodium falciparum, P. vivax, P. yoelii, P. berghei, Cryptosporidium parvum, and Toxoplasma gondii. We compared these partially sequenced cDNA sequences with the currently annotated gene models and observed significant inconsistencies between the two datasets. In particular, we found that on average 14% of the exons in the current gene models were not supported by any cDNA evidence, and that 16% of the current gene models may contain at least one mis-annotation and should be re-evaluated. We also identified a large number of transcripts that had been previously unidentified. For 732 cDNAs in T. gondii, the entire sequences were determined in order to evaluate the annotated gene models at the complete full-length transcript level. We found that 41% of the T. gondii gene models contained at least one inconsistency. We also identified and confirmed by RT-PCR 140 previously unidentified transcripts found in the intergenic regions of the current gene annotations. We show that the majority of these discrepancies are due to questionable predictions of one or two extra exons in the upstream or downstream regions of the genes. Conclusion Our data indicates that the current gene models are likely to still be incomplete and have much room for improvement. Our unique full-length cDNA information is especially useful for further refinement of the annotations for the genomes of

  20. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    Science.gov (United States)

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  1. Construction of a normalized full-length cDNA library of cephalopod Amphioctopus fangsiao and development of microsatellite markers

    Science.gov (United States)

    Feng, Yanwei; Liu, Wenfen; Xu, Xin; Yang, Jianmin; Wang, Weijun; Wei, Xiumei; Liu, Xiangquan; Sun, Guohua

    2017-10-01

    Amphioctopus fangsiao is one of the most economically important species and has been considered to be a candidate for aquaculture. In order to facilitate its fine-scale genetic analyses, we constructed a normalized full-length library successfully and developed a set of microsatellite markers in this study. The normalized full-length library had a storage capacity of 6.9×105 independent clones. The recombination efficiency was 95% and the average size of inserted fragments was longer than 1000 bp. A total of 3440 high quality ESTs were obtained, which were assembled into 1803 unigenes. Of these unigenes, 450 (25%) were assigned into 33 Gene Ontology terms, 576 (31.9%) into 153 Kyoto Encyclopedia of Genes and Genomes pathways, and 275 (15.3%) into 22 Clusters of Orthologous Groups. Seventy-six polymorphic microsatellite markers were identified. The number of alleles per locus ranged from 4 to 17, and the observed and expected heterozygosities varied between 0.167 and 0.967 and between 0.326 and 0.944, respectively. Twelve loci were significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction and no linkage disequilibrium was found between different loci. This study provided not only a useful resource for the isolation of the functional genes, but also a set of informative microsatellites for the assessment of population structure and conservation genetics of A. fangsiao.

  2. Human thyroid peroxidase: complete cDNA and protein sequence, chromosome mapping, and identification of two alternately spliced mRNAs

    International Nuclear Information System (INIS)

    Kimura, S.; Kotani, T.; McBride, O.W.; Umeki, K.; Hirai, K.; Nakayama, T.; Ohtaki, S.

    1987-01-01

    Two forms of human thyroid peroxidase cDNAs were isolated from a λgt11 cDNA library, prepared from Graves disease thyroid tissue mRNA, by use of oligonucleotides. The longest complete cDNA, designated phTPO-1, has 3048 nucleotides and an open reading frame consisting of 933 amino acids, which would encode a protein with a molecular weight of 103,026. Five potential asparagine-linked glycosylation sites are found in the deduced amino acid sequence. The second peroxidase cDNA, designated phTPO-2, is almost identical to phTPO-1 beginning 605 base pairs downstream except that it contains 1-base-pair difference and lacks 171 base pairs in the middle of the sequence. This results in a loss of 57 amino acids corresponding to a molecular weight of 6282. Interestingly, this 171-nucleotide sequence has GT and AG at its 5' and 3' boundaries, respectively, that are in good agreement with donor and acceptor splice site consensus sequences. Using specific oligonucleotide probes for the mRNAs derived from the cDNA sequences hTOP-1 and hTOP-2, the authors show that both are expressed in all thyroid tissues examined and the relative level of two mRNAs is different in each sample. The results suggest that two thyroid peroxidase proteins might be generated through alternate splicing of the same gene. By using somatic cell hybrid lines, the thyroid peroxidase gene was mapped to the short arm of human chromosome 2

  3. Full-length sequencing and identification of novel polymorphisms in ...

    Indian Academy of Sciences (India)

    The aim of this work was to sequence the entirecoding region of ACACA gene in Valle del Belice sheep breed to identify polymorphic sites. A total of 51 coding exons of ACACA gene were sequenced in 32 individuals of Valle del Belice sheep breed. Sequencing analysis and alignment of obtained sequences showed the ...

  4. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  5. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  6. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  7. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  8. Human pro. cap alpha. 1)(I) collagen: cDNA sequence for the C-propeptide domain

    Energy Technology Data Exchange (ETDEWEB)

    Maekelae, J K; Raassina, M; Virta, A; Vuorio, E

    1988-01-11

    The authors have previously constructed a cDNA clone pHCAL1, covering most of the C-terminal propeptide domain of human pro..cap alpha..1(I) collagen mRNA,by inserting a 678 bp EcoRI-XhoI fragment of cDNA into pBR322. Since the XhoI/SalI ligation prevented removal of the insert, they used the same strategy to obtain a similar clone in pUC8. RNA was isolated from fetal calvarial bones. The cDNA was digested with EcoRI and XhoI and fractionated on a 1 % agarose gel. Fragments of 650-700 bp were cloned in pUC8 at the polylinker site, which now permits easy removal of the insert. The new clone was named pHCAL1U since the RNA was isolated from another individual. The approach outlined is useful for studies on individual variation which is important to recognize when searching for disease-related mutations in type I collagen.

  9. RiceFOX: a database of Arabidopsis mutant lines overexpressing rice full-length cDNA that contains a wide range of trait information to facilitate analysis of gene function.

    Science.gov (United States)

    Sakurai, Tetsuya; Kondou, Youichi; Akiyama, Kenji; Kurotani, Atsushi; Higuchi, Mieko; Ichikawa, Takanari; Kuroda, Hirofumi; Kusano, Miyako; Mori, Masaki; Saitou, Tsutomu; Sakakibara, Hitoshi; Sugano, Shoji; Suzuki, Makoto; Takahashi, Hideki; Takahashi, Shinya; Takatsuji, Hiroshi; Yokotani, Naoki; Yoshizumi, Takeshi; Saito, Kazuki; Shinozaki, Kazuo; Oda, Kenji; Hirochika, Hirohiko; Matsui, Minami

    2011-02-01

    Identification of gene function is important not only for basic research but also for applied science, especially with regard to improvements in crop production. For rapid and efficient elucidation of useful traits, we developed a system named FOX hunting (Full-length cDNA Over-eXpressor gene hunting) using full-length cDNAs (fl-cDNAs). A heterologous expression approach provides a solution for the high-throughput characterization of gene functions in agricultural plant species. Since fl-cDNAs contain all the information of functional mRNAs and proteins, we introduced rice fl-cDNAs into Arabidopsis plants for systematic gain-of-function mutation. We generated >30,000 independent Arabidopsis transgenic lines expressing rice fl-cDNAs (rice FOX Arabidopsis mutant lines). These rice FOX Arabidopsis lines were screened systematically for various criteria such as morphology, photosynthesis, UV resistance, element composition, plant hormone profile, metabolite profile/fingerprinting, bacterial resistance, and heat and salt tolerance. The information obtained from these screenings was compiled into a database named 'RiceFOX'. This database contains around 18,000 records of rice FOX Arabidopsis lines and allows users to search against all the observed results, ranging from morphological to invisible traits. The number of searchable items is approximately 100; moreover, the rice FOX Arabidopsis lines can be searched by rice and Arabidopsis gene/protein identifiers, sequence similarity to the introduced rice fl-cDNA and traits. The RiceFOX database is available at http://ricefox.psc.riken.jp/.

  10. Direct chromosome-length haplotyping by single-cell sequencing

    NARCIS (Netherlands)

    Porubský, David; Sanders, Ashley D; van Wietmarschen, Niek; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Bevova, Marianna R; Guryev, Victor; Lansdorp, Peter Michael

    Haplotypes are fundamental to fully characterize the diploid genome of an individual, yet methods to directly chart the unique genetic makeup of each parental chromosome are lacking. Here we introduce single-cell DNA template strand sequencing (Strand-seq) as a novel approach to phasing diploid

  11. Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri).

    Science.gov (United States)

    Zheng, Yu; Yun, Chenxia; Wang, Qihui; Smith, Wanli W; Leng, Jing

    2015-02-01

    The tree shrew (Tupaia belangeri) diverges from the primate order (Primates) and is classified as a separate taxonomic group of mammals - Scandentia. It has been suggested that the tree shrew can be used as an animal model for studying human diseases; however, the genomic sequence of the tree shrew is largely unidentified. In the present study, we reported the full-length cDNA sequence of the housekeeping gene, β-actin, in the tree shrew. The amino acid sequence of β-actin in the tree shrew was compared to that of humans and other species; a simple phylogenetic relationship was discovered. Quantitative polymerase chain reaction (qPCR) and western blot analysis further demonstrated that the expression profiles of β-actin, as a general conservative housekeeping gene, in the tree shrew were similar to those in humans, although the expression levels varied among different types of tissue in the tree shrew. Our data provide evidence that the tree shrew has a close phylogenetic association with humans. These findings further enhance the potential that the tree shrew, as a species, may be used as an animal model for studying human disorders.

  12. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  13. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  14. Sequence length variation, indel costs, and congruence in sensitivity analysis

    DEFF Research Database (Denmark)

    Aagesen, Lone; Petersen, Gitte; Seberg, Ole

    2005-01-01

    The behavior of two topological and four character-based congruence measures was explored using different indel treatments in three empirical data sets, each with different alignment difficulties. The analyses were done using direct optimization within a sensitivity analysis framework in which...... the cost of indels was varied. Indels were treated either as a fifth character state, or strings of contiguous gaps were considered single events by using linear affine gap cost. Congruence consistently improved when indels were treated as single events, but no congruence measure appeared as the obviously...... preferable one. However, when combining enough data, all congruence measures clearly tended to select the same alignment cost set as the optimal one. Disagreement among congruence measures was mostly caused by a dominant fragment or a data partition that included all or most of the length variation...

  15. Transcription profiling of the model cyanobacterium Synechococcus sp. strain PCC 7002 by NextGen (SOLiD™ Sequencing of cDNA

    Directory of Open Access Journals (Sweden)

    Marcus eLudwig

    2011-03-01

    Full Text Available The genome of the unicellular, euryhaline cyanobacterium Synechococcus sp. PCC 7002 encodes about 3200 proteins. Transcripts were detected for nearly all annotated open reading frames by a global transcriptomic analysis by Next-Generation (SOLiDTM sequencing of cDNA. In the cDNA samples sequenced, ~90% of the mapped sequences were derived from the 16S and 23S ribosomal RNAs and ~10% of the sequences were derived from mRNAs. In cells grown photoautotrophically under standard conditions (38 °C, 1% (v/v CO2 in air, 250 µmol photons m-2 s-1, the highest transcript levels (up to 2% of the total mRNA for the most abundantly transcribed genes (e. g., cpcAB, psbA, psaA were generally derived from genes encoding structural components of the photosynthetic apparatus. High light exposure for one hour caused changes in transcript levels for genes encoding proteins of the photosynthetic apparatus, Type-1 NADH dehydrogenase complex and ATP synthase, whereas dark incubation for one hour resulted in a global decrease in transcript levels for photosynthesis-related genes and an increase in transcript levels for genes involved in carbohydrate degradation. Transcript levels for pyruvate kinase and the pyruvate dehydrogenase complex decreased sharply in cells incubated in the dark. Under dark anoxic (fermentative conditions, transcript changes indicated a global decrease in transcripts for respiratory proteins and suggested that cells employ an alternative phosphoenolpyruvate degradation pathway via phosphoenolpyruvate synthase (ppsA and the pyruvate:ferredoxin oxidoreductase (nifJ. Finally, the data suggested that an apparent operon involved in tetrapyrrole biosynthesis and fatty acid desaturation, acsF2-ho2-hemN2-desF, may be regulated by oxygen concentration.

  16. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    NARCIS (Netherlands)

    Vanhoutte, K.J.A.; Eggen, B.J.L.; Janssen, J.J.M.; Stavenga, D.G.

    2002-01-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  17. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana

    NARCIS (Netherlands)

    Vanhoutte, Kürt; Eggen, BJL; Janssen, JJM; Stavenga, DG

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth

  18. Effect of temperature and cycle length on microbial competition in PHB-producing sequencing batch reactor

    NARCIS (Netherlands)

    Jiang, Y.; Marang, L.; Kleerebezem, R.; Muyzer, G.; van Loosdrecht, M.C.M.

    2011-01-01

    The impact of temperature and cycle length on microbial competition between polyhydroxybutyrate (PHB)-producing populations enriched in feast-famine sequencing batch reactors (SBRs) was investigated at temperatures of 20 °C and 30 °C, and in a cycle length range of 1-18 h. In this study, the

  19. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  20. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence

    Energy Technology Data Exchange (ETDEWEB)

    Sztrolovics, R.; Grover, J.; Roughley, P.J. [McGill Univ., Montreal (Canada)] [and others

    1994-10-01

    This report describes the cloning of the 3{prime}-untranslated region of the human fibromodulin cDNA and its use to map the gene. For somatic cell hybrids, the generation of the PCR product was concordant with the presence of chromosome 1 and discordant with the presence of all other chromosomes, confirming that the fibromodulin gene is located within region q32 of chromosome 1. The physical mapping of genes is a critical step in the process of identifying which genes may be responsible for various inherited disorders. Specifically, the mapping of the fibromodulin gene now provides the information necessary to evaluate its potential role in genetic disorders of connective tissues. The analysis of previously reported diseases mapped to chromosome 1 reveals two genes located in the proximity of the fibromodulin locus. These are Usher syndrome type II, a recessive disorder characterized by hearing loss and retinitis pigmentosa, and Van der Woude syndrome, a dominant condition associated with abnormalities such as cleft lip and palate and hyperdontia. The genes for both of these disorders have been projected to be localized to 1q32 of a physical map that integrates available genetic linkage and physical data. However, it seems improbable that either of these disorders, exhibiting restricted tissue involvement, could be linked to the fibromodulin gene, given the wide tissue distribution of the encoded proteoglycan, although it remains possible that the relative importance of the quantity and function of the proteoglycan may avry between tissues. 11 refs., 1 fig.

  1. The algorithm of random length sequences synthesis for frame synchronization of digital television systems

    Directory of Open Access Journals (Sweden)

    Аndriy V. Sadchenko

    2015-12-01

    Full Text Available Digital television systems need to ensure that all digital signals processing operations are performed simultaneously and consistently. Frame synchronization dictated by the need to match phases of transmitter and receiver so that it would be possible to identify the start of a frame. As a frame synchronization signals are often used long length binary sequence with good aperiodic autocorrelation function. Aim: This work is dedicated to the development of the algorithm of random length sequences synthesis. Materials and Methods: The paper provides a comparative analysis of the known sequences, which can be used at present as synchronization ones, revealed their advantages and disadvantages. This work proposes the algorithm for the synthesis of binary synchronization sequences of random length with good autocorrelation properties based on noise generator with a uniform distribution law of probabilities. A "white noise" semiconductor generator is proposed to use as the initial material for the synthesis of binary sequences with desired properties. Results: The statistical analysis of the initial implementations of the "white noise" and synthesized sequences for frame synchronization of digital television is conducted. The comparative analysis of the synthesized sequences with known ones was carried out. The results show the benefits of obtained sequences in compare with known ones. The performed simulations confirm the obtained results. Conclusions: Thus, the search algorithm of binary synchronization sequences with desired autocorrelation properties received. According to this algorithm, the sequence can be longer in length and without length limitations. The received sync sequence can be used for frame synchronization in modern digital communication systems that will increase their efficiency and noise immunity.

  2. On Sequence Lengths of Some Special External Exclusive OR Type LFSR Structures – Study and Analysis

    Directory of Open Access Journals (Sweden)

    A Ahmad

    2014-12-01

    Full Text Available The study of the length of pseudo-random binary sequences generated by Linear- Feedback Shift Registers (LFSRs plays an important role in the design approaches of built-in selftest, cryptosystems, and other applications. However, certain LFSR structures might not be appropriate in some situations. Given that determining the length of generated pseudo-random binary sequence is a complex task, therefore, before using an LFSR structure, it is essential to investigate the length and the properties of the sequence. This paper investigates some conditions and LFSR’s structures, which restrict the pseudo-random binary sequences’ generation to a certain fixed length. The outcomes of this paper are presented in the form of theorems, simulations, and analyses. We believe that these outcomes are of great importance to the designers of built-in self-test equipment, cryptosystems, and other applications such as radar, CDMA, error correction, and Monte Carlo simulation.

  3. Optimal choice of word length when comparing two Markov sequences using a χ 2-statistic.

    Science.gov (United States)

    Bai, Xin; Tang, Kujin; Ren, Jie; Waterman, Michael; Sun, Fengzhu

    2017-10-03

    Alignment-free sequence comparison using counts of word patterns (grams, k-tuples) has become an active research topic due to the large amount of sequence data from the new sequencing technologies. Genome sequences are frequently modelled by Markov chains and the likelihood ratio test or the corresponding approximate χ 2 -statistic has been suggested to compare two sequences. However, it is not known how to best choose the word length k in such studies. We develop an optimal strategy to choose k by maximizing the statistical power of detecting differences between two sequences. Let the orders of the Markov chains for the two sequences be r 1 and r 2 , respectively. We show through both simulations and theoretical studies that the optimal k= max(r 1 ,r 2 )+1 for both long sequences and next generation sequencing (NGS) read data. The orders of the Markov chains may be unknown and several methods have been developed to estimate the orders of Markov chains based on both long sequences and NGS reads. We study the power loss of the statistics when the estimated orders are used. It is shown that the power loss is minimal for some of the estimators of the orders of Markov chains. Our studies provide guidelines on choosing the optimal word length for the comparison of Markov sequences.

  4. On the normalization of the minimum free energy of RNAs by sequence length.

    Directory of Open Access Journals (Sweden)

    Edoardo Trotta

    Full Text Available The minimum free energy (MFE of ribonucleic acids (RNAs increases at an apparent linear rate with sequence length. Simple indices, obtained by dividing the MFE by the number of nucleotides, have been used for a direct comparison of the folding stability of RNAs of various sizes. Although this normalization procedure has been used in several studies, the relationship between normalized MFE and length has not yet been investigated in detail. Here, we demonstrate that the variation of MFE with sequence length is not linear and is significantly biased by the mathematical formula used for the normalization procedure. For this reason, the normalized MFEs strongly decrease as hyperbolic functions of length and produce unreliable results when applied for the comparison of sequences with different sizes. We also propose a simple modification of the normalization formula that corrects the bias enabling the use of the normalized MFE for RNAs longer than 40 nt. Using the new corrected normalized index, we analyzed the folding free energies of different human RNA families showing that most of them present an average MFE density more negative than expected for a typical genomic sequence. Furthermore, we found that a well-defined and restricted range of MFE density characterizes each RNA family, suggesting the use of our corrected normalized index to improve RNA prediction algorithms. Finally, in coding and functional human RNAs the MFE density appears scarcely correlated with sequence length, consistent with a negligible role of thermodynamic stability demands in determining RNA size.

  5. On the normalization of the minimum free energy of RNAs by sequence length.

    Science.gov (United States)

    Trotta, Edoardo

    2014-01-01

    The minimum free energy (MFE) of ribonucleic acids (RNAs) increases at an apparent linear rate with sequence length. Simple indices, obtained by dividing the MFE by the number of nucleotides, have been used for a direct comparison of the folding stability of RNAs of various sizes. Although this normalization procedure has been used in several studies, the relationship between normalized MFE and length has not yet been investigated in detail. Here, we demonstrate that the variation of MFE with sequence length is not linear and is significantly biased by the mathematical formula used for the normalization procedure. For this reason, the normalized MFEs strongly decrease as hyperbolic functions of length and produce unreliable results when applied for the comparison of sequences with different sizes. We also propose a simple modification of the normalization formula that corrects the bias enabling the use of the normalized MFE for RNAs longer than 40 nt. Using the new corrected normalized index, we analyzed the folding free energies of different human RNA families showing that most of them present an average MFE density more negative than expected for a typical genomic sequence. Furthermore, we found that a well-defined and restricted range of MFE density characterizes each RNA family, suggesting the use of our corrected normalized index to improve RNA prediction algorithms. Finally, in coding and functional human RNAs the MFE density appears scarcely correlated with sequence length, consistent with a negligible role of thermodynamic stability demands in determining RNA size.

  6. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    Science.gov (United States)

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  7. Complete cDNA sequence of the preproform of human pregnancy-associated plasma protein-A. Evidence for expression in the brain and induction by cAMP

    DEFF Research Database (Denmark)

    Haaning, Jesper; Oxvig, Claus; Overgaard, Michael Toft

    1996-01-01

    A cDNA that encodes the prepropeptide of pregnancy-associated plasma protein-A (preproPAPP-A), a putative metalloproteinase, has been cloned and sequenced. PAPP-A is synthesized in the placenta as a 1627-residue precursor preproprotein with a putative 22-residue signal peptide and a highly basic...

  8. cDNA sequence and tissue distribution of the mRNA for bovine and murine p11, the S100-related light chain of the protein-tyrosine kinase substrate p36 (calpactin I)

    DEFF Research Database (Denmark)

    Saris, Chris J M; Kristensen, Torsten; D’Eustachio, Peter

    1987-01-01

    We have isolated and sequenced cDNA clones of bovine nd murine pl 1 mRNAs. The nonpolyadenylated mRNAs are predicted to be 614 and 600 nucleotides, respectively. The p l l mRNAs both contain a 291 nucleotide open reading frame, preceded by a 5”untranslated region of 73 nucleotides in bovine p l l m...

  9. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  10. Noise Attenuation Estimation for Maximum Length Sequences in Deconvolution Process of Auditory Evoked Potentials

    Directory of Open Access Journals (Sweden)

    Xian Peng

    2017-01-01

    Full Text Available The use of maximum length sequence (m-sequence has been found beneficial for recovering both linear and nonlinear components at rapid stimulation. Since m-sequence is fully characterized by a primitive polynomial of different orders, the selection of polynomial order can be problematic in practice. Usually, the m-sequence is repetitively delivered in a looped fashion. Ensemble averaging is carried out as the first step and followed by the cross-correlation analysis to deconvolve linear/nonlinear responses. According to the classical noise reduction property based on additive noise model, theoretical equations have been derived in measuring noise attenuation ratios (NARs after the averaging and correlation processes in the present study. A computer simulation experiment was conducted to test the derived equations, and a nonlinear deconvolution experiment was also conducted using order 7 and 9 m-sequences to address this issue with real data. Both theoretical and experimental results show that the NAR is essentially independent of the m-sequence order and is decided by the total length of valid data, as well as stimulation rate. The present study offers a guideline for m-sequence selections, which can be used to estimate required recording time and signal-to-noise ratio in designing m-sequence experiments.

  11. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  12. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development

    Directory of Open Access Journals (Sweden)

    Konstantin A. Tsetsarkin

    2016-08-01

    Full Text Available An arthropod-borne virus, Zika virus (ZIKV, has recently emerged as a major human pathogen. Associated with complications during perinatal development and Guillain-Barré syndrome in adults, ZIKV raises new challenges for understanding the molecular determinants of flavivirus pathogenesis. This underscores the necessity for the development of a reverse genetic system based on an epidemic ZIKV strain. Here, we describe the generation and characterization in cell cultures of an infectious cDNA clone of ZIKV isolated from the 2015 epidemic in Brazil. The cDNA-derived ZIKV replicated efficiently in a variety of cell lines, including those of both neuronal and placental origin. We observed that the growth of cDNA-derived virus was attenuated compared to the growth of the parental isolate in most cell lines, which correlates with substantial differences in sequence heterogeneity between these viruses that were determined by deep-sequencing analysis. Our findings support the role of genetic diversity in maintaining the replicative fitness of viral populations under changing conditions. Moreover, these results indicate that caution should be exercised when interpreting the results of reverse-genetics experiments in attempts to accurately predict the biology of natural viruses. Finally, a Vero cell-adapted cDNA clone of ZIKV was generated that can be used as a convenient platform for studies aimed at the development of ZIKV vaccines and therapeutics.

  13. Whitefly (Bemisia tabaci genome project: analysis of sequenced clones from egg, instar, and adult (viruliferous and non-viruliferous cDNA libraries

    Directory of Open Access Journals (Sweden)

    Czosnek Henryk

    2006-04-01

    Full Text Available Abstract Background The past three decades have witnessed a dramatic increase in interest in the whitefly Bemisia tabaci, owing to its nature as a taxonomically cryptic species, the damage it causes to a large number of herbaceous plants because of its specialized feeding in the phloem, and to its ability to serve as a vector of plant viruses. Among the most important plant viruses to be transmitted by B. tabaci are those in the genus Begomovirus (family, Geminiviridae. Surprisingly, little is known about the genome of this whitefly. The haploid genome size for male B. tabaci has been estimated to be approximately one billion bp by flow cytometry analysis, about five times the size of the fruitfly Drosophila melanogaster. The genes involved in whitefly development, in host range plasticity, and in begomovirus vector specificity and competency, are unknown. Results To address this general shortage of genomic sequence information, we have constructed three cDNA libraries from non-viruliferous whiteflies (eggs, immature instars, and adults and two from adult insects that fed on tomato plants infected by two geminiviruses: Tomato yellow leaf curl virus (TYLCV and Tomato mottle virus (ToMoV. In total, the sequence of 18,976 clones was determined. After quality control, and removal of 5,542 clones of mitochondrial origin 9,110 sequences remained which included 3,843 singletons and 1,017 contigs. Comparisons with public databases indicated that the libraries contained genes involved in cellular and developmental processes. In addition, approximately 1,000 bases aligned with the genome of the B. tabaci endosymbiotic bacterium Candidatus Portiera aleyrodidarum, originating primarily from the egg and instar libraries. Apart from the mitochondrial sequences, the longest and most abundant sequence encodes vitellogenin, which originated from whitefly adult libraries, indicating that much of the gene expression in this insect is directed toward the production

  14. Length and sequence dependence in the association of Huntingtin protein with lipid membranes

    Science.gov (United States)

    Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina

    2013-03-01

    There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.

  15. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  16. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  17. Alignment-free Transcriptomic and Metatranscriptomic Comparison Using Sequencing Signatures with Variable Length Markov Chains.

    Science.gov (United States)

    Liao, Weinan; Ren, Jie; Wang, Kun; Wang, Shun; Zeng, Feng; Wang, Ying; Sun, Fengzhu

    2016-11-23

    The comparison between microbial sequencing data is critical to understand the dynamics of microbial communities. The alignment-based tools analyzing metagenomic datasets require reference sequences and read alignments. The available alignment-free dissimilarity approaches model the background sequences with Fixed Order Markov Chain (FOMC) yielding promising results for the comparison of microbial communities. However, in FOMC, the number of parameters grows exponentially with the increase of the order of Markov Chain (MC). Under a fixed high order of MC, the parameters might not be accurately estimated owing to the limitation of sequencing depth. In our study, we investigate an alternative to FOMC to model background sequences with the data-driven Variable Length Markov Chain (VLMC) in metatranscriptomic data. The VLMC originally designed for long sequences was extended to apply to high-throughput sequencing reads and the strategies to estimate the corresponding parameters were developed. The flexible number of parameters in VLMC avoids estimating the vast number of parameters of high-order MC under limited sequencing depth. Different from the manual selection in FOMC, VLMC determines the MC order adaptively. Several beta diversity measures based on VLMC were applied to compare the bacterial RNA-Seq and metatranscriptomic datasets. Experiments show that VLMC outperforms FOMC to model the background sequences in transcriptomic and metatranscriptomic samples. A software pipeline is available at https://d2vlmc.codeplex.com.

  18. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  19. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    Directory of Open Access Journals (Sweden)

    Ju-Yeon Yoon

    2014-03-01

    Full Text Available Chrysanthemum stunt viroid (CSVd, a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1 were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants.

  20. Construction and characterization of a full-length infectious cDNA clone of foot-and-mouth disease virus strain O/JPN/2010 isolated in Japan in 2010.

    Science.gov (United States)

    Nishi, Tatsuya; Onozato, Hiroyuki; Ohashi, Seiichi; Fukai, Katsuhiko; Yamada, Manabu; Morioka, Kazuki; Kanno, Toru

    2016-06-01

    A full-length infectious cDNA clone of the genome of a foot-and-mouth disease virus isolated from the 2010 epidemic in Japan was constructed and designated pSVL-f02. Transfection of Cos-7 or IBRS-2 cells with this clone allowed the recovery of infectious virus. The recovered virus had the same in vitro characterization as the parental virus with regard to antigenicity in neutralization and indirect immunofluorescence tests, plaque size and one-step growth. Pigs were experimentally infected with the parental virus or the recombinant virus recovered from pSVL-f02 transfected cells. There were no significant differences in clinical signs or antibody responses between the two groups, and virus isolation and viral RNA detection from clinical samples were similar. Virus recovered from transfected cells therefore retained the in vitro characteristics and the in vivo pathogenicity of their parental strain. This cDNA clone should be a valuable tool to analyze determinants of pathogenicity and mechanisms of virus replication, and to develop genetically engineered vaccines against foot-and-mouth disease virus. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Read length and repeat resolution: exploring prokaryote genomes using next-generation sequencing technologies.

    Directory of Open Access Journals (Sweden)

    Matt J Cahill

    Full Text Available BACKGROUND: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. METHODOLOGY/PRINCIPAL FINDINGS: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. CONCLUSIONS: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length.

  2. Read length and repeat resolution: Exploring prokaryote genomes using next-generation sequencing technologies

    KAUST Repository

    Cahill, Matt J.

    2010-07-12

    Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.

  3. Read length and repeat resolution: Exploring prokaryote genomes using next-generation sequencing technologies

    KAUST Repository

    Cahill, Matt J.; Kö ser, Claudio U.; Ross, Nicholas E.; Archer, John A.C.

    2010-01-01

    Background: There are a growing number of next-generation sequencing technologies. At present, the most cost-effective options also produce the shortest reads. However, even for prokaryotes, there is uncertainty concerning the utility of these technologies for the de novo assembly of complete genomes. This reflects an expectation that short reads will be unable to resolve small, but presumably abundant, repeats. Methodology/Principal Findings: Using a simple model of repeat assembly, we develop and test a technique that, for any read length, can estimate the occurrence of unresolvable repeats in a genome, and thus predict the number of gaps that would need to be closed to produce a complete sequence. We apply this technique to 818 prokaryote genome sequences. This provides a quantitative assessment of the relative performance of various lengths. Notably, unpaired reads of only 150nt can reconstruct approximately 50% of the analysed genomes with fewer than 96 repeat-induced gaps. Nonetheless, there is considerable variation amongst prokaryotes. Some genomes can be assembled to near contiguity using very short reads while others require much longer reads. Conclusions: Given the diversity of prokaryote genomes, a sequencing strategy should be tailored to the organism under study. Our results will provide researchers with a practical resource to guide the selection of the appropriate read length. 2010 Cahill et al.

  4. Construction and characterization of cDNA library for IRM-2 mice

    International Nuclear Information System (INIS)

    Wang Qin; Li Jin; Song Li; Liu Qiang; Yue Jingyin; Mu Chuanjie; Tang Weisheng; Fan Feiyue

    2010-01-01

    Objective: To screen and isolate the radioresistance related genes of IRM-2 mice. Methods: cDNA library of IRM-2 mice was constructed by SMART technique. Total RNA was isolated from spleens of IRM-2 male mice. The first-strand cDNA was synthesized by using PowerScript reverse transcriptase, and double-strand cDNA was synthesized and amplified by long PCR. The PCR products were purified, digested with restriction enzyme Sfi I. The ds-cDNA fragment less than 500 bp was fractionated and ligated to the Sfi I-digested pDNR-LIB vector. The ligation mixture was transformed into E. coil DH5 α by electroporation transformation to generate the unamplified cDNA library. The quality of cDNA library was identified by PCR technique. 130 clones from cDNA library were sequenced and compared with GenBank database. Results: The cDNA library contained 2.25 x 10 6 independent clones with an average insert size of 1.2 kb. The ratio of recombination and full-length was 95% and 55%, respectively. 21 pieces of EST sequences from cDNA library were not the same as the known mice genes and registered into GenBank EST database, with registered number DW474856-DW474876. Conclusions: cDNA library of IRM-2 mice has been constructed successfully. 21 pieces of EST implies that radioresistance correlative genes may be in IRM-2 mice, which will lay a foundation for isolating and identifying radioresistance related genes in further study. (authors)

  5. Evidence for a Complex Mosaic Genome Pattern in a Full-length Hepatitis C Virus Sequence

    Directory of Open Access Journals (Sweden)

    R.S. Ross

    2008-01-01

    Full Text Available The genome of the hepatitis C virus (HCV exhibits a high genetic variability. This remarkable heterogeneity is mainly attributed to the gradual accumulation of mutational changes, whereas the contribution of recombination events to the evolution of HCV remains controversial so far. While performing phylogenetic analyses including a large number of sequences deposited in the GenBank, we encountered a full-length HCV sequence (AY651061 that showed evidence for inter-subtype recombination and was, therefore, subjected to a detailed analysis of its molecular structure. The obtained results indicated that AY651061 does not represent a “simple” HCV 1c isolate, but a complex 1a/1c mosaic genome, showing five putative breakpoints in the core to NS3 regions. To our knowledge, this is the first report on a mosaic HCV full- length sequence with multiple breakpoints. The molecular structure of AY651061 is reminiscent of complex homologous recombinant variants occurring among other members of the flaviviridae family, e.g. GB virus C, dengue virus, and Japanese encephalitis virus. Our finding of a mosaic HCV sequence may have important implications for many fields of current HCV research which merit careful consideration.

  6. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  7. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  8. Effect of temperature and cycle length on microbial competition in PHB-producing sequencing batch reactor.

    Science.gov (United States)

    Jiang, Yang; Marang, Leonie; Kleerebezem, Robbert; Muyzer, Gerard; van Loosdrecht, Mark C M

    2011-05-01

    The impact of temperature and cycle length on microbial competition between polyhydroxybutyrate (PHB)-producing populations enriched in feast-famine sequencing batch reactors (SBRs) was investigated at temperatures of 20 °C and 30 °C, and in a cycle length range of 1-18 h. In this study, the microbial community structure of the PHB-producing enrichments was found to be strongly dependent on temperature, but not on cycle length. Zoogloea and Plasticicumulans acidivorans dominated the SBRs operated at 20 °C and 30 °C, respectively. Both enrichments accumulated PHB more than 75% of cell dry weight. Short-term temperature change experiments revealed that P. acidivorans was more temperature sensitive as compared with Zoogloea. This is particularly true for the PHB degradation, resulting in incomplete PHB degradation in P. acidivorans at 20 °C. Incomplete PHB degradation limited biomass growth and allowed Zoogloea to outcompete P. acidivorans. The PHB content at the end of the feast phase correlated well with the cycle length at a constant solid retention time (SRT). These results suggest that to establish enrichment with the capacity to store a high fraction of PHB, the number of cycles per SRT should be minimized independent of the temperature.

  9. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering.

    Science.gov (United States)

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor; Essex, M

    2015-05-01

    To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice.

  10. Evaluation and Adaptation of a Laboratory-Based cDNA Library Preparation Protocol for Retrospective Sequencing of Archived MicroRNAs from up to 35-Year-Old Clinical FFPE Specimens.

    Science.gov (United States)

    Loudig, Olivier; Wang, Tao; Ye, Kenny; Lin, Juan; Wang, Yihong; Ramnauth, Andrew; Liu, Christina; Stark, Azadeh; Chitale, Dhananjay; Greenlee, Robert; Multerer, Deborah; Honda, Stacey; Daida, Yihe; Spencer Feigelson, Heather; Glass, Andrew; Couch, Fergus J; Rohan, Thomas; Ben-Dov, Iddo Z

    2017-03-14

    Formalin-fixed paraffin-embedded (FFPE) specimens, when used in conjunction with patient clinical data history, represent an invaluable resource for molecular studies of cancer. Even though nucleic acids extracted from archived FFPE tissues are degraded, their molecular analysis has become possible. In this study, we optimized a laboratory-based next-generation sequencing barcoded cDNA library preparation protocol for analysis of small RNAs recovered from archived FFPE tissues. Using matched fresh and FFPE specimens, we evaluated the robustness and reproducibility of our optimized approach, as well as its applicability to archived clinical specimens stored for up to 35 years. We then evaluated this cDNA library preparation protocol by performing a miRNA expression analysis of archived breast ductal carcinoma in situ (DCIS) specimens, selected for their relation to the risk of subsequent breast cancer development and obtained from six different institutions. Our analyses identified six miRNAs (miR-29a, miR-221, miR-375, miR-184, miR-363, miR-455-5p) differentially expressed between DCIS lesions from women who subsequently developed an invasive breast cancer (cases) and women who did not develop invasive breast cancer within the same time interval (control). Our thorough evaluation and application of this laboratory-based miRNA sequencing analysis indicates that the preparation of small RNA cDNA libraries can reliably be performed on older, archived, clinically-classified specimens.

  11. Length and repeat-sequence variation in 58 STRs and 94 SNPs in two Spanish populations.

    Science.gov (United States)

    Casals, Ferran; Anglada, Roger; Bonet, Núria; Rasal, Raquel; van der Gaag, Kristiaan J; Hoogenboom, Jerry; Solé-Morata, Neus; Comas, David; Calafell, Francesc

    2017-09-01

    We have genotyped the 58 STRs (27 autosomal, 24 Y-STRs and 7 X-STRs) and 94 autosomal SNPs in Illumina ForenSeq™ Primer Mix A in 88 Spanish Roma (Gypsy) samples and 143 Catalans. Since this platform is based in massive parallel sequencing, we have used simple R scripts to uncover the sequence variation in the repeat region. Thus, we have found, across 58 STRs, 541 length-based alleles, which, after considering repeat-sequence variation, became 804 different alleles. All loci in both populations were in Hardy-Weinberg equilibrium. F ST between both populations was 0.0178 for autosomal SNPs, 0.0146 for autosomal STRs, 0.0101 for X-STRs and 0.1866 for Y-STRs. Combined a priori statistics showed quite large; for instance, pooling all the autosomal loci, the a priori probabilities of discriminating a suspect become 1-(2.3×10 -70 ) and 1-(5.9×10 -73 ), for Roma and Catalans respectively, and the chances of excluding a false father in a trio are 1-(2.6×10 -20 ) and 1-(2.0×10 -21 ). Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Cloning of cDNA sequences of a progestin-regulated mRNA from MCF7 human breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Chalbos, D; Westley, B; Alibert, C; Rochefort, H

    1986-01-24

    A cDNA clone corresponding to an mRNA regulated by the progestin R5020, has been isolated by differential screening of a cDNA library from the MCF7 breast cancer cell line, which contains estrogen and progesterone receptors. This probe hybridized with a single species of poly A + RNA of 8-kb molecular weight as shown by Northern blot analysis and could also be used to total RNA preparation. This recombinant cone hybridized specifically to an mRNA coding for a 250,000 daltons protein when translated in vitro. This protein was identical to the 250 kDa progestin-regulated protein that the authors previously described as shown by immunoprecipitation with specific rabbit polyclonal antibodies. Dose-response curve and specificity studies show that the accumulation of the Pg8 mRNA and that of the 250-kDa protein was increased by 5 to 30-fold following progestin treatment and that this effect was mediated by the progesterone receptor. Time course of induction indicated that the accumulation of mRNA was rapid and preceded that of the protein. This is the first report on a cloned cDNA probe of progestin-regulated mRNA in human cell lines.

  13. Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

    DEFF Research Database (Denmark)

    Christensen, C B; Jørgensen, L; Jensen, A T

    2000-01-01

    Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

  14. A leaf sequencing algorithm to enlarge treatment field length in IMRT

    International Nuclear Information System (INIS)

    Xia Ping; Hwang, Andrew B.; Verhey, Lynn J.

    2002-01-01

    With MLC-based IMRT, the maximum usable field size is often smaller than the maximum field size for conventional treatments. This is due to the constraints of the overtravel distances of MLC leaves and/or jaws. Using a new leaf sequencing algorithm, the usable IMRT field length (perpendicular to the MLC motion) can be mostly made equal to the full length of the MLC field without violating the upper jaw overtravel limit. For any given intensity pattern, a criterion was proposed to assess whether an intensity pattern can be delivered without violation of the jaw position constraints. If the criterion is met, the new algorithm will consider the jaw position constraints during the segmentation for the step and shoot delivery method. The strategy employed by the algorithm is to connect the intensity elements outside the jaw overtravel limits with those inside the jaw overtravel limits. Several methods were used to establish these connections during segmentation by modifying a previously published algorithm (areal algorithm), including changing the intensity level, alternating the leaf-sequencing direction, or limiting the segment field size. The algorithm was tested with 1000 random intensity patterns with dimensions of 21x27 cm2, 800 intensity patterns with higher intensity outside the jaw overtravel limit, and three different types of clinical treatment plans that were undeliverable using a segmentation method from a commercial treatment planning system. The new algorithm achieved a success rate of 100% with these test patterns. For the 1000 random patterns, the new algorithm yields a similar average number of segments of 36.9±2.9 in comparison to 36.6±1.3 when using the areal algorithm. For the 800 patterns with higher intensities outside the jaw overtravel limits, the new algorithm results in an increase of 25% in the average number of segments compared to the areal algorithm. However, the areal algorithm fails to create deliverable segments for 90% of these

  15. Sequence-specific activation of the DNA sensor cGAS by Y-form DNA structures as found in primary HIV-1 cDNA.

    Science.gov (United States)

    Herzner, Anna-Maria; Hagmann, Cristina Amparo; Goldeck, Marion; Wolter, Steven; Kübler, Kirsten; Wittmann, Sabine; Gramberg, Thomas; Andreeva, Liudmila; Hopfner, Karl-Peter; Mertens, Christina; Zillinger, Thomas; Jin, Tengchuan; Xiao, Tsan Sam; Bartok, Eva; Coch, Christoph; Ackermann, Damian; Hornung, Veit; Ludwig, Janos; Barchet, Winfried; Hartmann, Gunther; Schlee, Martin

    2015-10-01

    Cytosolic DNA that emerges during infection with a retrovirus or DNA virus triggers antiviral type I interferon responses. So far, only double-stranded DNA (dsDNA) over 40 base pairs (bp) in length has been considered immunostimulatory. Here we found that unpaired DNA nucleotides flanking short base-paired DNA stretches, as in stem-loop structures of single-stranded DNA (ssDNA) derived from human immunodeficiency virus type 1 (HIV-1), activated the type I interferon-inducing DNA sensor cGAS in a sequence-dependent manner. DNA structures containing unpaired guanosines flanking short (12- to 20-bp) dsDNA (Y-form DNA) were highly stimulatory and specifically enhanced the enzymatic activity of cGAS. Furthermore, we found that primary HIV-1 reverse transcripts represented the predominant viral cytosolic DNA species during early infection of macrophages and that these ssDNAs were highly immunostimulatory. Collectively, our study identifies unpaired guanosines in Y-form DNA as a highly active, minimal cGAS recognition motif that enables detection of HIV-1 ssDNA.

  16. Characterization of the porcine carboxypeptidase E cDNA

    DEFF Research Database (Denmark)

    Hreidarsdôttir, G.E.; Cirera, Susanna; Fredholm, Merete

    2007-01-01

    the sequence of the cDNA for the porcine CPE gene including all the coding region and the 3'-UTR region was generated. Comparisons with bovine, human, mouse, and rat CPE cDNA sequences showed that the coding regions of the gene are highly conserved both at the nucleotide and at the amino acid level. A very low...

  17. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease.

    Science.gov (United States)

    Zhang, Peipei; Liu, Yan; Liu, Wenwen; Cao, Mengji; Massart, Sebastien; Wang, Xifeng

    2017-01-01

    To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV) (most likely pathogens) using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV). The full genome of WLYaV corresponds to 5,772 nucleotides (nt), with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae . Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV), but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP) were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90%) in the family Luteoviridae . Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  18. Identification, Characterization and Full-Length Sequence Analysis of a Novel Polerovirus Associated with Wheat Leaf Yellowing Disease

    Directory of Open Access Journals (Sweden)

    Peipei Zhang

    2017-09-01

    Full Text Available To identify the pathogens responsible for leaf yellowing symptoms on wheat samples collected from Jinan, China, we tested for the presence of three known barley/wheat yellow dwarf viruses (BYDV-GAV, -PAV, WYDV-GPV (most likely pathogens using RT-PCR. A sample that tested negative for the three viruses was selected for small RNA sequencing. Twenty-five million sequences were generated, among which 5% were of viral origin. A novel polerovirus was discovered and temporarily named wheat leaf yellowing-associated virus (WLYaV. The full genome of WLYaV corresponds to 5,772 nucleotides (nt, with six AUG-initiated open reading frames, one non-AUG-initiated open reading frame, and three untranslated regions, showing typical features of the family Luteoviridae. Sequence comparison and phylogenetic analyses suggested that WLYaV had the closest relationship with sugarcane yellow leaf virus (ScYLV, but the identities of full genomic nucleotides and deduced amino acid sequence of coat protein (CP were 64.9 and 86.2%, respectively, below the species demarcation thresholds (90% in the family Luteoviridae. Furthermore, agroinoculation of Nicotiana benthamiana leaves with a cDNA clone of WLYaV caused yellowing symptoms on the plant. Our study adds a new polerovirus that is associated with wheat leaf yellowing disease, which would help to identify and control pathogens of wheat.

  19. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    Directory of Open Access Journals (Sweden)

    Rachel Caldwell

    2015-01-01

    Full Text Available There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length.

  20. Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

    1997-12-01

    A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

  1. GenEST, a powerful bidirectional link between cDNA sequence data and gene expression profiles generated by cDNA-AFLP

    NARCIS (Netherlands)

    Qin Ling,; Prins, P.; Jones, J.T.; Popeijus, H.; Smant, G.; Bakker, J.; Helder, J.

    2001-01-01

    The release of vast quantities of DNA sequence data by large-scale genome and expressed sequence tag (EST) projects underlines the necessity for the development of efficient and inexpensive ways to link sequence databases with temporal and spatial expression profiles. Here we demonstrate the power

  2. Fiscal 1998 achievement report. Industrial technology research and development project. (Strategic human cDNA genome application technology development); 1998 nendo senryakuteki hito cDNA genome oyo gijutsu kaihatsu seika hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)

  3. Three human alcohol dehydrogenase subunits: cDNA structure and molecular and evolutionary divergence

    International Nuclear Information System (INIS)

    Ikuta, T.; Szeto, S.; Yoshida, A.

    1986-01-01

    Class I human alcohol dehydrogenase (ADH; alcohol:NAD + oxidoreductase, EC 1.1.1.1) consists of several homo- and heterodimers of α, β, and γ subunits that are governed by the ADH1, ADH2, and ADH3 loci. The authors previously cloned a full length of cDNA for the β subunit, and the complete sequence of 374 amino acid residues was established. cDNAs for the α and γ subunits were cloned and characterized. A human liver cDNA library, constructed in phage λgt11, was screened by using a synthetic oligonucleotide probe that was matched to the γ but not to the β sequence. Clone pUCADHγ21 and clone pUCADHα15L differed from β cDNA with respect to restriction sites and hybridization with the nucleotide probe. Clone pUCADHγ21 contained an insertion of 1.5 kilobase pairs (kbp) and encodes 374 amino acid residues compatible with the reported amino acid sequence of the γ subunit. Clone pUCADHα15L contained an insertion of 2.4 kbp and included nucleotide sequences that encode 374 amino acid residues for another subunit, the γ subunit. In addition, this clone contained the sequences that encode the COOH-terminal part of the β subunit at its extended 5' region. The amino acid sequences and coding regions of the cDNAs of the three subunits are very similar. A high degree of resemblance is observed also in their 3' noncoding regions. However, distinctive differences exist in the vicinity of the Zn-binding cysteine residue at position 46. Based on the cDNA sequences and the deduced amino acid sequences of the three subunits, their structural and evolutionary relationships are discussed

  4. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  5. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  6. Molecular cloning of lupin leghemoglobin cDNA

    DEFF Research Database (Denmark)

    Konieczny, A; Jensen, E O; Marcker, K A

    1987-01-01

    Poly(A)+ RNA isolated from root nodules of yellow lupin (Lupinus luteus, var. Ventus) has been used as a template for the construction of a cDNA library. The ds cDNA was synthesized and inserted into the Hind III site of plasmid pBR 322 using synthetic Hind III linkers. Clones containing sequences...... specific for nodules were selected by differential colony hybridization using 32P-labeled cDNA synthesized either from nodule poly(A)+ RNA or from poly(A)+ RNA of uninfected root as probes. Among the recombinant plasmids, the cDNA gene for leghemoglobin was identified. The protein structure derived from...... its nucleotide sequence was consistent with known amino acid sequence of lupin Lb II. The cloned lupin Lb cDNA hybridized to poly(A)+ RNA from nodules only, which is in accordance with the general concept, that leghemoglobin is expressed exclusively in nodules. Udgivelsesdato: 1987-null...

  7. Display of a Maize cDNA library on baculovirus infected insect cells

    Directory of Open Access Journals (Sweden)

    Jones Ian M

    2008-08-01

    Full Text Available Abstract Background Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. Results We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 × 105 independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1, was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. Conclusion The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  8. Characterization of gonadotrophin-releasing hormone precursor cDNA in the Old World mole-rat Cryptomys hottentotus pretoriae: high degree of identity with the New World guinea pig sequence.

    Science.gov (United States)

    Kalamatianos, T; du Toit, L; Hrabovszky, E; Kalló, I; Marsh, P J; Bennett, N C; Coen, C W

    2005-05-01

    Regulation of pituitary gonadotrophins by the decapeptide gonadotrophin-releasing hormone 1 (GnRH1) is crucial for the development and maintenance of reproductive functions. A common amino acid sequence for this decapeptide, designated as 'mammalian' GnRH, has been identified in all mammals thus far investigated with the exception of the guinea pig, in which there are two amino acid substitutions. Among hystricognath rodents, the members of the family Bathyergidae regulate reproduction in response to diverse cues. Thus, highveld mole-rats (Cryptomys hottentotus pretoriae) are social bathyergids in which breeding is restricted to a particular season in the dominant female, but continuously suppressed in subordinate colony members. Elucidation of reproductive control in these animals will be facilitated by characterization of their GnRH1 gene. A partial sequence of GnRH1 precursor cDNA was isolated and characterized. Comparative analysis revealed the highest degree of identity (86%) to guinea pig GnRH1 precursor mRNA. Nevertheless, the deduced amino acid sequence of the mole-rat decapeptide is identical to the 'mammalian' sequence rather than that of guinea pigs. Successful detection of GnRH1-synthesizing neurones using either a guinea pig GnRH1 riboprobe or an antibody against the 'mammalian' decapeptide is consistent with the guinea pig-like sequence for the precursor and the classic 'mammalian' form for the decapeptide. The high degree of identity in the GnRH1 precursor sequence between this Old World mole-rat and the New World guinea pig is consistent with the theory that caviomorphs and phiomorphs originated from a common ancestral line in the Palaeocene to mid Eocene, some 63-45 million years ago.

  9. Visual artificial grammar learning by rhesus macaques (Macaca mulatta): exploring the role of grammar complexity and sequence length.

    Science.gov (United States)

    Heimbauer, Lisa A; Conway, Christopher M; Christiansen, Morten H; Beran, Michael J; Owren, Michael J

    2018-03-01

    Humans and nonhuman primates can learn about the organization of stimuli in the environment using implicit sequential pattern learning capabilities. However, most previous artificial grammar learning studies with nonhuman primates have involved relatively simple grammars and short input sequences. The goal in the current experiments was to assess the learning capabilities of monkeys on an artificial grammar-learning task that was more complex than most others previously used with nonhumans. Three experiments were conducted using a joystick-based, symmetrical-response serial reaction time task in which two monkeys were exposed to grammar-generated sequences at sequence lengths of four in Experiment 1, six in Experiment 2, and eight in Experiment 3. Over time, the monkeys came to respond faster to the sequences generated from the artificial grammar compared to random versions. In a subsequent generalization phase, subjects generalized their knowledge to novel sequences, responding significantly faster to novel instances of sequences produced using the familiar grammar compared to those constructed using an unfamiliar grammar. These results reveal that rhesus monkeys can learn and generalize the statistical structure inherent in an artificial grammar that is as complex as some used with humans, for sequences up to eight items long. These findings are discussed in relation to whether or not rhesus macaques and other primate species possess implicit sequence learning abilities that are similar to those that humans draw upon to learn natural language grammar.

  10. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  12. Characteristics of MHC class I genes in house sparrows Passer domesticus as revealed by long cDNA transcripts and amplicon sequencing.

    Science.gov (United States)

    Karlsson, Maria; Westerdahl, Helena

    2013-08-01

    In birds the major histocompatibility complex (MHC) organization differs both among and within orders; chickens Gallus gallus of the order Galliformes have a simple arrangement, while many songbirds of the order Passeriformes have a more complex arrangement with larger numbers of MHC class I and II genes. Chicken MHC genes are found at two independent loci, classical MHC-B and non-classical MHC-Y, whereas non-classical MHC genes are yet to be verified in passerines. Here we characterize MHC class I transcripts (α1 to α3 domain) and perform amplicon sequencing using a next-generation sequencing technique on exon 3 from house sparrow Passer domesticus (a passerine) families. Then we use phylogenetic, selection, and segregation analyses to gain a better understanding of the MHC class I organization. Trees based on the α1 and α2 domain revealed a distinct cluster with short terminal branches for transcripts with a 6-bp deletion. Interestingly, this cluster was not seen in the tree based on the α3 domain. 21 exon 3 sequences were verified in a single individual and the average numbers within an individual were nine and five for sequences with and without a 6-bp deletion, respectively. All individuals had exon 3 sequences with and without a 6-bp deletion. The sequences with a 6-bp deletion have many characteristics in common with non-classical MHC, e.g., highly conserved amino acid positions were substituted compared with the other alleles, low nucleotide diversity and just a single site was subject to positive selection. However, these alleles also have characteristics that suggest they could be classical, e.g., complete linkage and absence of a distinct cluster in a tree based on the α3 domain. Thus, we cannot determine for certain whether or not the alleles with a 6-bp deletion are non-classical based on our present data. Further analyses on segregation patterns of these alleles in combination with dating the 6-bp deletion through MHC characterization across the

  13. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  14. Magnetic nanoparticle imaging by random and maximum length sequences of inhomogeneous activation fields.

    Science.gov (United States)

    Baumgarten, Daniel; Eichardt, Roland; Crevecoeur, Guillaume; Supriyanto, Eko; Haueisen, Jens

    2013-01-01

    Biomedical applications of magnetic nanoparticles require a precise knowledge of their biodistribution. From multi-channel magnetorelaxometry measurements, this distribution can be determined by means of inverse methods. It was recently shown that the combination of sequential inhomogeneous excitation fields in these measurements is favorable regarding the reconstruction accuracy when compared to homogeneous activation . In this paper, approaches for the determination of activation sequences for these measurements are investigated. Therefor, consecutive activation of single coils, random activation patterns and families of m-sequences are examined in computer simulations involving a sample measurement setup and compared with respect to the relative condition number of the system matrix. We obtain that the values of this condition number decrease with larger number of measurement samples for all approaches. Random sequences and m-sequences reveal similar results with a significant reduction of the required number of samples. We conclude that the application of pseudo-random sequences for sequential activation in the magnetorelaxometry imaging of magnetic nanoparticles considerably reduces the number of required sequences while preserving the relevant measurement information.

  15. cDNA library information - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Dicty_cDB cDNA library information Data detail Data name cDNA library information DOI 10.189...s Data item Description cDNA library name Names of cDNA libraries (AF, AH, CF, CH, FC, FC-IC, FCL, SF, SH, S...(C) 5) sexually fusion-competent KAX3 cells (Gamete phase) (F) cDNA library construction method How to construct cDNA library...dir) 2) Full-length cDNA libraries (oligocapped method)(fl) 3) Gamete-specific subtraction library (sub) cDNA library... construction protocol Link to the webpage describing the protocol for generating cDNA library Size

  16. Full-length mRNA sequencing uncovers a widespread coupling between transcription initiation and mRNA processing.

    Science.gov (United States)

    Anvar, Seyed Yahya; Allard, Guy; Tseng, Elizabeth; Sheynkman, Gloria M; de Klerk, Eleonora; Vermaat, Martijn; Yin, Raymund H; Johansson, Hans E; Ariyurek, Yavuz; den Dunnen, Johan T; Turner, Stephen W; 't Hoen, Peter A C

    2018-03-29

    The multifaceted control of gene expression requires tight coordination of regulatory mechanisms at transcriptional and post-transcriptional level. Here, we studied the interdependence of transcription initiation, splicing and polyadenylation events on single mRNA molecules by full-length mRNA sequencing. In MCF-7 breast cancer cells, we find 2700 genes with interdependent alternative transcription initiation, splicing and polyadenylation events, both in proximal and distant parts of mRNA molecules, including examples of coupling between transcription start sites and polyadenylation sites. The analysis of three human primary tissues (brain, heart and liver) reveals similar patterns of interdependency between transcription initiation and mRNA processing events. We predict thousands of novel open reading frames from full-length mRNA sequences and obtained evidence for their translation by shotgun proteomics. The mapping database rescues 358 previously unassigned peptides and improves the assignment of others. By recognizing sample-specific amino-acid changes and novel splicing patterns, full-length mRNA sequencing improves proteogenomics analysis of MCF-7 cells. Our findings demonstrate that our understanding of transcriptome complexity is far from complete and provides a basis to reveal largely unresolved mechanisms that coordinate transcription initiation and mRNA processing.

  17. The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

    NARCIS (Netherlands)

    Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

    2002-01-01

    The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

  18. Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

    Science.gov (United States)

    Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

    2015-05-01

    Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

  19. Cloning the human lysozyme cDNA: Inverted Alu repeat in the mRNA and in situ hybridization for macrophages and Paneth cells

    International Nuclear Information System (INIS)

    Chung, L.P.; Keshav, S.; Gordon, S.

    1988-01-01

    Lysozyme is a major secretory product of human and rodent macrophages and a useful marker for myelomonocytic cells. Based on the known human lysozyme amino acid sequence, oligonucleotides were synthesized and used as probes to screen a phorbol 12-myristate 13-acetate-treated U937 cDNA library. A full-length human lysozyme cDNA clone, pHL-2, was obtained and characterized. Sequence analysis shows that human lysozyme, like chicken lysozyme, has in 18-amino-acid-long signal peptide, but unlike the chicken lysozyme cDNA, the human lysozyme cDNA has a >1-kilobase-long 3' nontranslated sequence. Interestingly, within this 3' region, an inverted repeat of the Alu family of repetitive sequences was discovered. In RNA blot analyses, DNA probes prepared from pHL-2 can be used to detect lysozyme mRNA not only from human but also from mouse and rat. Moreover, by in situ hybridization, complementary RNA transcripts have been used as probes to detect lysozyme mRNA in mouse macrophages and Paneth cells. This human lysozyme cDNA clone is therefore likely to be a useful molecular probe for studying macrophage distribution and gene expression

  20. Giardia telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop length and sequence on the folding topology.

    Science.gov (United States)

    Hu, Lanying; Lim, Kah Wai; Bouaziz, Serge; Phan, Anh Tuân

    2009-11-25

    Recently, it has been shown that in K(+) solution the human telomeric sequence d[TAGGG(TTAGGG)(3)] forms a (3 + 1) intramolecular G-quadruplex, while the Bombyx mori telomeric sequence d[TAGG(TTAGG)(3)], which differs from the human counterpart only by one G deletion in each repeat, forms a chair-type intramolecular G-quadruplex, indicating an effect of G-tract length on the folding topology of G-quadruplexes. To explore the effect of loop length and sequence on the folding topology of G-quadruplexes, here we examine the structure of the four-repeat Giardia telomeric sequence d[TAGGG(TAGGG)(3)], which differs from the human counterpart only by one T deletion within the non-G linker in each repeat. We show by NMR that this sequence forms two different intramolecular G-quadruplexes in K(+) solution. The first one is a novel basket-type antiparallel-stranded G-quadruplex containing two G-tetrads, a G x (A-G) triad, and two A x T base pairs; the three loops are consecutively edgewise-diagonal-edgewise. The second one is a propeller-type parallel-stranded G-quadruplex involving three G-tetrads; the three loops are all double-chain-reversal. Recurrence of several structural elements in the observed structures suggests a "cut and paste" principle for the design and prediction of G-quadruplex topologies, for which different elements could be extracted from one G-quadruplex and inserted into another.

  1. [Whole cDNA sequence cloning and expression of chicken L-FABP gene and its relationship with lipid deposition of hybrid chickens].

    Science.gov (United States)

    Yu, Ying; Wang, Dong; Sun, Dong-Xiao; Xu, Gui-Yun; Li, Jun-Ying; Zhang, Yuan

    2011-07-01

    Liver fatty acid-binding protein (L-FABP) is closely related to intracellular transportation and deposition of lipids. A positive differential displayed fragment was found in the liver tissue among Silkie (CC), CAU-brown chicken (CD), and their reciprocal hybrids (CD and DC) at 8 weeks-old using differential display RT-PCR techniques (DDRT-PCR). Through recycling, sequencing, and alignment analysis, the fragment was identified as chicken liver fatty acid-binding protein gene (L-FABP, GenBank accession number AY321365). Reverse Northern dot blot and semi-quantitative RT-PCR revealed that the avian L-FABP gene was over-expressed in the liver tissue of the reciprocal hybrids (CD and DC) compared to their parental lines (CC and DD), which was consistent with the fact that higher abdomen fat weight and wider inter-muscular fat width observed in the reciprocal hybrids. Considering the higher expression of L-FABP may contribute to the increased lipid deposition in the hybrid chickens, the functional study of avian L-FABP is warranted in future.

  2. US Medical Student Performance on the NBME Subject Examination in Internal Medicine: Do Clerkship Sequence and Clerkship Length Matter?

    Science.gov (United States)

    Ouyang, Wenli; Cuddy, Monica M; Swanson, David B

    2015-09-01

    Prior to graduation, US medical students are required to complete clinical clerkship rotations, most commonly in the specialty areas of family medicine, internal medicine, obstetrics and gynecology (ob/gyn), pediatrics, psychiatry, and surgery. Within a school, the sequence in which students complete these clerkships varies. In addition, the length of these rotations varies, both within a school for different clerkships and between schools for the same clerkship. The present study investigated the effects of clerkship sequence and length on performance on the National Board of Medical Examiner's subject examination in internal medicine. The study sample included 16,091 students from 67 US Liaison Committee on Medical Education (LCME)-accredited medical schools who graduated in 2012 or 2013. Student-level measures included first-attempt internal medicine subject examination scores, first-attempt USMLE Step 1 scores, and five dichotomous variables capturing whether or not students completed rotations in family medicine, ob/gyn, pediatrics, psychiatry, and surgery prior to taking the internal medicine rotation. School-level measures included clerkship length and average Step 1 score. Multilevel models with students nested in schools were estimated with internal medicine subject examination scores as the dependent measure. Step 1 scores and the five dichotomous variables were treated as student-level predictors. Internal medicine clerkship length and average Step 1 score were used to predict school-to-school variation in average internal medicine subject examination scores. Completion of rotations in surgery, pediatrics and family medicine prior to taking the internal medicine examination significantly improved scores, with the largest benefit observed for surgery (coefficient = 1.58 points; p value internal medicine subject examination performance. At the school level, longer internal medicine clerkships were associated with higher scores on the internal medicine

  3. Sequence-length variation of mtDNA HVS-I C-stretch in Chinese ethnic groups.

    Science.gov (United States)

    Chen, Feng; Dang, Yong-hui; Yan, Chun-xia; Liu, Yan-ling; Deng, Ya-jun; Fulton, David J R; Chen, Teng

    2009-10-01

    The purpose of this study was to investigate mitochondrial DNA (mtDNA) hypervariable segment-I (HVS-I) C-stretch variations and explore the significance of these variations in forensic and population genetics studies. The C-stretch sequence variation was studied in 919 unrelated individuals from 8 Chinese ethnic groups using both direct and clone sequencing approaches. Thirty eight C-stretch haplotypes were identified, and some novel and population specific haplotypes were also detected. The C-stretch genetic diversity (GD) values were relatively high, and probability (P) values were low. Additionally, C-stretch length heteroplasmy was observed in approximately 9% of individuals studied. There was a significant correlation (r=-0.961, Ppopulations. The results from the Fst and dA genetic distance matrix, neighbor-joining tree, and principal component map also suggest that C-stretch could be used as a reliable genetic marker in population genetics.

  4. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    Science.gov (United States)

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  5. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  6. Biological phosphorus and nitrogen removal in sequencing batch reactors: effects of cycle length, dissolved oxygen concentration and influent particulate matter.

    Science.gov (United States)

    Ginige, Maneesha P; Kayaalp, Ahmet S; Cheng, Ka Yu; Wylie, Jason; Kaksonen, Anna H

    2013-01-01

    Removal of phosphorus (P) and nitrogen (N) from municipal wastewaters is required to mitigate eutrophication of receiving water bodies. While most treatment plants achieve good N removal using influent carbon (C), the use of influent C to facilitate enhanced biological phosphorus removal (EBPR) is poorly explored. A number of operational parameters can facilitate optimum use of influent C and this study investigated the effects of cycle length, dissolved oxygen (DO) concentration during aerobic period and influent solids on biological P and N removal in sequencing batch reactors (SRBs) using municipal wastewaters. Increasing cycle length from 3 to 6 h increased P removal efficiency, which was attributed to larger portion of N being removed via nitrite pathway and more biodegradable organic C becoming available for EBPR. Further increasing cycle length from 6 to 8 h decreased P removal efficiencies as the demand for biodegradable organic C for denitrification increased as a result of complete nitrification. Decreasing DO concentration in the aerobic period from 2 to 0.8 mg L(-1) increased P removal efficiency but decreased nitrification rates possibly due to oxygen limitation. Further, sedimented wastewater was proved to be a better influent stream than non-sedimented wastewater possibility due to the detrimental effect of particulate matter on biological nutrient removal.

  7. Growth hormone and prolactin in Andrias davidianus: cDNA cloning, tissue distribution and phylogenetic analysis.

    Science.gov (United States)

    Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran

    2010-01-15

    The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.

  8. (+)-(10R)-Germacrene A synthase from goldenrod, Solidago canadensis; cDNA isolation, bacterial expression and functional analysis.

    Science.gov (United States)

    Prosser, Ian; Phillips, Andy L; Gittings, Simon; Lewis, Mervyn J; Hooper, Antony M; Pickett, John A; Beale, Michael H

    2002-08-01

    Profiling of sesquiterpene hydrocarbons in extracts of goldenrod, Solidago canadensis, by GC-MS revealed the presence of both enantiomers of germacrene D and lesser amounts of germacrene A, alpha-humulene, and beta-caryophyllene. A similarity-based cloning strategy using degenerate oligonucleotide primers, based on conserved amino acid sequences in known plant sesquiterpene synthases and RT-PCR, resulted in the isolation of a full length sesquiterpene synthase cDNA. Functional expression of the cDNA in E. coli, as an N-terminal thioredoxin fusion protein using the pET32b vector yielded an enzyme that was readily purified by nickel-chelate affinity chromatography. Chiral GC-MS analysis of products from of (3)H- and (2)H-labelled farnesyl diphosphate identified the enzyme as (+)-(10R)-germacrene A synthase. Sequence analysis and molecular modelling was used to compare this enzyme with the mechanistically related epi-aristolochene synthase from tobacco.

  9. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  10. 中国驯鹿生长素(ghrelin)全长cDNA的克隆及序列分析%Cloning and analysis of the full-length cDNA of China reindeer ghrelin

    Institute of Scientific and Technical Information of China (English)

    杨银凤; 余兴邦; 王冠玉; 都格尔斯仁; 包花尔; 徐斯日古楞

    2014-01-01

    采用cDNA末端快速扩增技术(rapid amplification of cDNA ends,RACE),在本课题组已获得的驯鹿ghrelincDNA的部分片段的基础上进行3'和5'RACE.结果成功克隆出驯鹿ghrelin cDNA的3 '和5 '末端序列,从而得到604 bp的驯鹿ghrelin cDNA全序列.其中包含57 bp 5'非翻译区(UTR)、405 bp的开放读码框(ORF)、128 bp的3'UTR和poly(A)14.405 bp的ORF编码134个氨基酸残基的前原ghrelin(preproghrelin),其中包含41个氨基酸残基的N末端信号肽,27个氨基酸残基的成熟肽及66个氨基酸残基的C末端肽.序列同源性比较显示驯鹿ghrelincDNA与山羊、绵羊和牛的同源性分别是92.0%、90.8%和89.5%;与猪和人的同源性分别是69.5%和65.2%;与鸡的同源性仅为33.8%.表明ghrelin的结构具有明显的种属特异性.驯鹿Ghrelin cDNA全序列的获得为进一步研究其生理作用奠定了基础.

  11. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  12. Cdna cloning and expression analyses of the isoflavone reductase-like gene of dendrobium officinale

    International Nuclear Information System (INIS)

    Qian, X.; Xu, S.Z.

    2015-01-01

    The full length of the isoflavone reductase-like gene (IRL) cDNA of Dendrobium officinale was cloned by using reverse transcription (RT) PCR combined with cDNA library, the IRL function was identified by Bioinformatics and prokaryotic expression analyses, and the IRL expression levels in the organs and tissues of D. officinale plants with different ages were determined by using real-time quantitative PCR (RT-qPCR). The results indicated that the full length of the cDNA of D. officinale IRL, DoIRL, was 1238 bp (accession no. KJ661023). Its open reading frame (ORF) was 930 bp which encoded 309 amino acids with a predicted molecular mass of 34 kDa, the 5 untranslated region (UTR) was 61 bp and the 3 UTR containing a poly (A) tail was 247 bp. The deduced amino acid sequence of DoIRL, DoIRL, was forecast to contain a NAD(P)H-binding motif (GGTGYIG) in the N-terminal region, two conserved N-glycosylation sites, a conserved nitrogen metabolite repression regulator (NmrA) domain and a phenylcoumaran benzylic ether reductase (PCBER) domain, to hold the nearest phylogenetic relationship with the PCBER of Striga asiatica, and to share both 73% identity with the isoflavone reductases-like (IRLs) of Cucumis sativus and Striga asiatica. In Escherichia coli 'BL21' cells, the DoIRL cDNA expression produced a protein band holding the predicted molecular mass of 34 kDa. DoIRL expressed in all organs and tissues of D. officinale plants with different ages at comparatively low levels, and the expression level in the leaves of the two-year-old plants was the highest. (author)

  13. First full-length genome sequence of the polerovirus luffa aphid-borne yellows virus (LABYV) reveals the presence of at least two consensus sequences in an isolate from Thailand.

    Science.gov (United States)

    Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf

    2015-10-01

    Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

  14. Characterization of cDNA for PMT: a Partial Nicotine Biosynthesis-Related Gene Isolated from Indonesian Local Tobacco (Nicotiana tabacum cv. Sindoro1

    Directory of Open Access Journals (Sweden)

    SESANTI BASUKI

    2013-12-01

    Full Text Available Nicotine is the major alkaloid compound in cultivated tobacco (Nicotiana tabacum that could potentially be converted into carcinogenic compound (nor-nicotine. The PMT gene encoding putrescine N-methyltransferase (PMT is one of the two key genes that play a prominent role in nicotine biosynthesis. The aimed of this study was to isolate and characterize the cDNA sequence originated from Indonesian local tobacco cv. Sindoro1 (Ntpmt_Sindoro1. The results showed that the Ntpmt_Sindoro1 was 1124 bp in length. This cDNA fragment encodes for 374 amino acid residues. The predicted polypeptide from the cDNA is a hidrophilic protein, and has a predicted molecular weight of 40.95 kDa. The predicted amino acids sequence also showed high similarity to the PMT gene product Nicotiana sp. available in the GenBank data base. The amino acid sequences also exert conserved residues specifically exhibited only by PMT gene originated from N. tabacum. Clustering analysis revealed that Ntpmt_Sindoro1 belongs to the same clade as the PMT3 gene, a member of the N. tabacum PMT gene family. The Ntpmt_Sindoro1 cDNA sequence covering exon1-exon8 of the PMT gene fragment has been registered in the GenBank data base, under the accession number JX978277.

  15. Construction of C35 gene bait recombinants and T47D cell cDNA library.

    Science.gov (United States)

    Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

    2017-11-20

    C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

  16. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  17. Thousands of primer-free, high-quality, full-length SSU rRNA sequences from all domains of life

    DEFF Research Database (Denmark)

    Karst, Soeren M; Dueholm, Morten S; McIlroy, Simon J

    2016-01-01

    Ribosomal RNA (rRNA) genes are the consensus marker for determination of microbial diversity on the planet, invaluable in studies of evolution and, for the past decade, high-throughput sequencing of variable regions of ribosomal RNA genes has become the backbone of most microbial ecology studies...... (SSU) rRNA genes and synthetic long read sequencing by molecular tagging, to generate primer-free, full-length SSU rRNA gene sequences from all domains of life, with a median raw error rate of 0.17%. We generated thousands of full-length SSU rRNA sequences from five well-studied ecosystems (soil, human...... gut, fresh water, anaerobic digestion, and activated sludge) and obtained sequences covering all domains of life and the majority of all described phyla. Interestingly, 30% of all bacterial operational taxonomic units were novel, compared to the SILVA database (less than 97% similarity...

  18. Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

    Science.gov (United States)

    Mattsson, J G; Ljunggren, E L; Bergström, K

    2001-05-01

    The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

  19. Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

    Science.gov (United States)

    Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

    1992-01-01

    We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

  20. Copolymers of N-cyclohexylacrylamide and n-butyl acrylate: synthesis, characterization, monomer reactivity ratios and mean sequence length

    Directory of Open Access Journals (Sweden)

    2007-06-01

    Full Text Available Copolymerization of N-cyclohexylacrylamide (NCHA and n-butyl acrylate (BA was carried out in dimethylformamide at 55±1°C using azobisisobutyronitrile as a free radical initiator. The copolymers were characterized by 1H-NMR spectroscopy and the copolymer compositions were determined by 1H-NMR analysis. The reactivity ratios of the monomers were determined by both linear and non-linear methods. The reactivity ratios of monomers determined using linear methods like Fineman-Ross (r1 = 0.37 and r2 = 1.77 , Kelen-Tudos (r1 = 0.38 and r2 = 1.77, ext. Kelen-Tudos (r1 = 0.37 and r2 = 1.75 Yezrieler-Brokhina-Roskin (r1 = 0.37 and r2 = 1.77 and non-linear methods like Tidwell-Mortimer (r1 = 0.37 and r2 = 1.76, ProCop (r1 = 0.36 and r2 = 1.82. The Q and e values for NCHA are 0.67 and 0.68 respectively. Mean sequence lengths of copolymers are estimated from r1 and r2 values. It shows that the BA units increases in a linear fashion in the polymer chain as the concentration of BA increases in the monomer feed.

  1. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  2. Genetic characterization of human herpesvirus type 1: Full-length genome sequence of strain obtained from an encephalitis case from India

    Directory of Open Access Journals (Sweden)

    Vijay P Bondre

    2016-01-01

    Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.

  3. Effect of stereochemistry, chain length and sequence pattern on antimicrobial properties of short synthetic β-sheet forming peptide amphiphiles.

    Science.gov (United States)

    Ong, Zhan Yuin; Cheng, Junchi; Huang, Yuan; Xu, Kaijin; Ji, Zhongkang; Fan, Weimin; Yang, Yi Yan

    2014-01-01

    In the face of mounting global antibiotics resistance, the identification and development of membrane-active antimicrobial peptides (AMPs) as an alternative class of antimicrobial agent have gained significant attention. The physical perturbation and disruption of microbial membranes by the AMPs have been proposed to be an effective means to overcome conventional mechanisms of drug resistance. Recently, we have reported the design of a series of short synthetic β-sheet folding peptide amphiphiles comprised of recurring (X1Y1X2Y2)n-NH2 sequences where X: hydrophobic amino acids, Y: cationic amino acids and n: number of repeat units. In efforts to investigate the effects of key parameters including stereochemistry, chain length and sequence pattern on antimicrobial effects, systematic d-amino acid substitutions of the lead peptides (IRIK)2-NH2 (IK8-all L) and (IRVK)3-NH2 (IK12-all L) were performed. It was found that the corresponding D-enantiomers exhibited stronger antimicrobial activities with minimal or no change in hemolytic activities, hence translating very high selectivity indices of 407.0 and >9.8 for IK8-all D and IK12-all D respectively. IK8-all D was also demonstrated to be stable to degradation by broad spectrum proteases trypsin and proteinase K. The membrane disrupting bactericidal properties of IK8-all D effectively prevented drug resistance development and inhibited the growth of various clinically isolated MRSA, VRE, Acinetobacter baumanni, Pseudomonas aeruginosa, Cryptococcus. neoformans and Mycobacterium tuberculosis. Significant reduction in intracellular bacteria counts was also observed following treatment with IK8-all D in the Staphylococcus. aureus infected mouse macrophage cell line RAW264.7 (P < 0.01). These results suggest that the d-amino acids substituted β-sheet forming peptide IK8-all D with its enhanced antimicrobial activities and improved protease stability, is a promising therapeutic candidate with potential to combat

  4. Brain cDNA clone for human cholinesterase

    International Nuclear Information System (INIS)

    McTiernan, C.; Adkins, S.; Chatonnet, A.; Vaughan, T.A.; Bartels, C.F.; Kott, M.; Rosenberry, T.L.; La Du, B.N.; Lockridge, O.

    1987-01-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum. The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase

  5. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  6. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  7. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    Science.gov (United States)

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  8. Full-length genome sequences of five hepatitis C virus isolates representing subtypes 3g, 3h, 3i and 3k, and a unique genotype 3 variant.

    Science.gov (United States)

    Lu, Ling; Li, Chunhua; Yuan, Jie; Lu, Teng; Okamoto, Hiroaki; Murphy, Donald G

    2013-03-01

    We characterized the full-length genomes of five distinct hepatitis C virus (HCV)-3 isolates. These represent the first complete genomes for subtypes 3g and 3h, the second such genomes for 3k and 3i, and of one novel variant presently not assigned to a subtype. Each genome was determined from 18-25 overlapping fragments. They had lengths of 9579-9660 nt and each contained a single ORF encoding 3020-3025 aa. They were isolated from five patients residing in Canada; four were of Asian origin and one was of Somali origin. Phylogenetic analysis using 64 partial NS5B sequences differentiated 10 assigned subtypes, 3a-3i and 3k, and two additional lineages within genotype 3. From the data of this study, HCV-3 full-length sequences are now available for six of the assigned subtypes and one unassigned. Our findings should add insights to HCV evolutionary studies and clinical applications.

  9. Radioactive cDNA microarray in neurospsychiatry

    International Nuclear Information System (INIS)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon

    2003-01-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  10. Radioactive cDNA microarray in neurospsychiatry

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Jae Gol; Shin, Kyung Ho; Lee, Min Soo; Kim, Meyoung Kon [Korea University Medical School, Seoul (Korea, Republic of)

    2003-02-01

    Microarray technology allows the simultaneous analysis of gene expression patterns of thousands of genes, in a systematic fashion, under a similar set of experimental conditions, thus making the data highly comparable. In some cases arrays are used simply as a primary screen leading to downstream molecular characterization of individual gene candidates. In other cases, the goal of expression profiling is to begin to identify complex regulatory networks underlying developmental processes and disease states. Microarrays were originally used with cell lines or other simple model systems. More recently, microarrays have been used in the analysis of more complex biological tissues including neural systems and the brain. The application of cDNA arrays in neuropsychiatry has lagged behind other fields for a number of reasons. These include a requirement for a large amount of input probe RNA in fluorescent-glass based array systems and the cellular complexity introduced by multicellular brain and neural tissues. An additional factor that impacts the general use of microarrays in neuropsychiatry is the lack of availability of sequenced clone sets from model systems. While human cDNA clones have been widely available, high quality rat, mouse, and drosophilae, among others are just becoming widely available. A final factor in the application of cDNA microarrays in neuropsychiatry is cost of commercial arrays. As academic microarray facilitates become more commonplace custom made arrays will become more widely available at a lower cost allowing more widespread applications. In summary, microarray technology is rapidly having an impact on many areas of biomedical research. Radioisotope-nylon based microarrays offer alternatives that may in some cases be more sensitive, flexible, inexpensive, and universal as compared to other array formats, such as fluorescent-glass arrays. In some situations of limited RNA or exotic species, radioactive membrane microarrays may be the most

  11. An improved method for RNA isolation and cDNA library construction from immature seeds of Jatropha curcas L

    Directory of Open Access Journals (Sweden)

    Kaur Jatinder

    2010-05-01

    Full Text Available Abstract Background RNA quality and quantity is sometimes unsuitable for cDNA library construction, from plant seeds rich in oil, polysaccharides and other secondary metabolites. Seeds of jatropha (Jatropha curcas L. are rich in fatty acids/lipids, storage proteins, polysaccharides, and a number of other secondary metabolites that could either bind and/or co-precipitate with RNA, making it unsuitable for downstream applications. Existing RNA isolation methods and commercial kits often fail to deliver high-quality total RNA from immature jatropha seeds for poly(A+ RNA purification and cDNA synthesis. Findings A protocol has been developed for isolating good quality total RNA from immature jatropha seeds, whereby a combination of the CTAB based RNA extraction method and a silica column of a commercial plant RNA extraction kit is used. The extraction time was reduced from two days to about 3 hours and the RNA was suitable for poly(A+ RNA purification, cDNA synthesis, cDNA library construction, RT-PCR, and Northern hybridization. Based on sequence information from selected clones and amplified PCR product, the cDNA library seems to be a good source of full-length jatropha genes. The method was equally effective for isolating RNA from mustard and rice seeds. Conclusions This is a simple CTAB + silica column method to extract high quality RNA from oil rich immature jatropha seeds that is suitable for several downstream applications. This method takes less time for RNA extraction and is equally effective for other tissues where the quality and quantity of RNA is highly interfered by the presence of fatty acids, polysaccharides and polyphenols.

  12. cDNA library construction of two human Demodexspecies.

    Science.gov (United States)

    Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

    2017-06-01

    The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

  13. Full-length genomic sequence of hepatitis B virus genotype C2 isolated from a native Brazilian patient

    Directory of Open Access Journals (Sweden)

    Mónica Viviana Alvarado-Mora

    2011-06-01

    Full Text Available The hepatitis B virus (HBV is among the leading causes of chronic hepatitis, cirrhosis and hepatocellular carcinoma. In Brazil, genotype A is the most frequent, followed by genotypes D and F. Genotypes B and C are found in Brazil exclusively among Asian patients and their descendants. The aim of this study was to sequence the entire HBV genome of a Caucasian patient infected with HBV/C2 and to infer the origin of the virus based on sequencing analysis. The sequence of this Brazilian isolate was grouped with four other sequences described in China. The sequence of this patient is the first complete genome of HBV/C2 reported in Brazil.

  14. Murine protein H is comprised of 20 repeating units, 61 amino acids in length

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Tack, B F

    1986-01-01

    A cDNA library constructed from size-selected (greater than 28 S) poly(A)+ RNA isolated from the livers of C57B10. WR mice was screened by using a 249-base-pair (bp) cDNA fragment encoding 83 amino acid residues of human protein H as a probe. Of 120,000 transformants screened, 30 hybridized......, 448 bp of 3'-untranslated sequence, and a polyadenylylated tail of undetermined length. Murine pre-protein H was deduced to consist of an 18-amino acid signal peptide and 1216 residues of H-protein sequence. Murine H was composed of 20 repetitive units, each about 61 amino acid residues in length...

  15. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  16. Cloning and sequence analysis of serine proteinase of Gloydius ussuriensis venom gland

    International Nuclear Information System (INIS)

    Sun Dejun; Liu Shanshan; Yang Chunwei; Zhao Yizhuo; Chang Shufang; Yan Weiqun

    2005-01-01

    Objective: To construct a cDNA library by using mRNA from Gloydius ussuriensis (G. Ussuriensis) venom gland, to clone and analyze serine proteinase gene from the cDNA library. Methods: Total RNA was isolated from venom gland of G. ussuriensis, mRNA was purified by using mRNA isolation Kit. The whole length cDNA was synthesized by means of smart cDNA synthesis strategy, and amplified by long distance PCR procedure, lately cDAN was cloned into vector pBluescrip-sk. The recombinant cDNA was transformed into E. coli DH5α. The cDNA of serine proteinase gene in the venom gland of G. ussuriensis was detected and amplified using the in situ hybridization. The cDNA fragment was inserted into pGEMT vector, cloned and its nucleotide sequence was determined. Results: The capacity of cDNA library of venom gland was above 2.3 x 10 6 . Its open reading frame was composed of 702 nucleotides and coded a protein pre-zymogen of 234 amino acids. It contained 12 cysteine residues. The sequence analysis indicated that the deduced amino acid sequence of the cDNA fragment shared high identity with the thrombin-like enzyme genes of other snakes in the GenBank. the query sequence exhibited strong amino acid sequence homology of 85% to the serine proteas of T. gramineus, thrombin-like serine proteinase I of D. acutus and serine protease catroxase II of C. atrox respectively. Based on the amino acid sequences of other thrombin-like enzymes, the catalytic residues and disulfide bridges of this thrombin-like enzyme were deduced as follows: catalytic residues, His 41 , Asp 86 , Ser 180 ; and six disulfide bridges Cys 7 -Cys 139 , Cys 26 -Cys 42 , Cys 74 -Cys 232 , Cys 118 -Cys 186 , Cys 150 -Cys 165 , Cys 176 -Cys 201 . Conclusion: The capacity of cDNA library of venom gland is above 2.3 x 10 6 , overtop the level of 10 5 capicity. The constructed cDNA library of G. ussuriensis venom gland would be helpful platform to detect new target genes and further gene manipulate. The cloned serine

  17. CDNA cloning, characterization and expression of an endosperm-specific barley peroxidase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Welinder, K.G.; Hejgaard, J.

    1991-01-01

    A barley peroxidase (BP 1) of pI ca. 8.5 and M(r) 37000 has been purified from mature barley grains. Using antibodies towards peroxidase BP 1, a cDNA clone (pcR7) was isolated from cDNA expression library. The nucleotide sequence of pcR7 gave a derived amino acid sequence identical to the 158 C...

  18. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  19. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  20. Characterization of a pollen-specific cDNA clone from Nicotiana tabacum expressed during microgametogenesis and germination.

    Science.gov (United States)

    Weterings, K; Reijnen, W; van Aarssen, R; Kortstee, A; Spijkers, J; van Herpen, M; Schrauwen, J; Wullems, G

    1992-04-01

    This report describes the isolation and characterization of a cDNA clone representing a gene specifically expressed in pollen. A cDNA library was constructed against mRNA from mature pollen of Nicotiana tabacum. It was screened differentially against cDNA from mRNA of leaf and of pollen. One clone, NTPc303, was further characterized. On northern blot this clone hybridizes to a transcript 2100 nucleotides in length. NTPc303 is abundant in pollen. Expression of the corresponding gene is restricted to pollen, because no other generative or vegetative tissue contains transcripts hybridizing to NTPc303. Expression of NTP303 is evolutionarily conserved: homologous transcripts are present in pollen from various plant species. The first NTP303 transcripts are detectable on northern blot at the early bi-nucleate stage and accumulate until the pollen has reached maturity. During germination and pollen tube growth in vitro new NTP303 transcripts appear. This transcription has been proved by northern blots as well as by pulse labelling experiments. Nucleotide sequence analysis revealed that NTPc303 has an open reading frame coding for a predicted protein of 62 kDa. This protein shares homology to ascorbate oxidase and other members of the blue copper oxidase family. A possible function for this clone during pollen germination is discussed.

  1. Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice

    2018-01-01

    Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine...... the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence...... the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies....

  2. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  3. Cloning of the γ-aminobutyric acid (GABA) ρ1 cDNA: A GABA receptor subunit highly expressed in the retina

    International Nuclear Information System (INIS)

    Cutting, G.R.; Lu, Luo; Kasch, L.M.; Montrose-Rafizadeh, C.; Antonarakis, S.E.; Guggino, W.B.; Kazazian, H.H. Jr.; O'Hara, B.F.; Donovan, D.M.; Shimada, Shoichi; Uhl, G.R.

    1991-01-01

    Type A γ-aminobutyric acid (GABA A ) receptors are a family of ligand-gated chloride channels that are the major inhibitory neurotransmitter receptors in the nervous system. Molecular cloning has revealed diversity in the subunits that compose this heterooligomeric receptor, but each previously elucidated subunit displays amino acid similarity in conserved structural elements. The authors have used these highly conserved regions to identify additional members of this family by using the polymerase chain reaction (PCR). One PCR product was used to isolate a full-length cDNA from a human retina cDNA library. The mature protein predicted from this cDNA sequence is 458 amino acids long and displays between 30 and 38% amino acid similarity to the previously identified GABA A subunits. This gene is expressed primarily in the retina but transcripts are also detected in the brain, lung, and thymus. Injection of Xenopus oocytes with RNA transcribed in vitro produces a GABA-responsive chloride conductance and expression of the cDNA in COS cells yields GABA-displaceable muscimol binding. These features are consistent with our identification of a GABA subunit, GABA ρ 1 , with prominent retinal expression that increases the diversity and tissue specificity of this ligand-gated ion-channel receptor family

  4. Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

    Science.gov (United States)

    Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

    2017-02-16

    Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

  5. A cDNA microarray, UniShrimpChip, for identification of genes relevant to testicular development in the black tiger shrimp (Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Klinbunga Sirawut

    2011-04-01

    Full Text Available Abstract Background Poor reproductive maturation in captive male broodstock of the black tiger shrimp (Penaeus monodon is one of the serious problems to the farming industries. Without genome sequence, EST libraries of P. monodon were previously constructed to identify transcripts with important biological functions. In this study, a new version of cDNA microarray, UniShrimpChip, was constructed from the Peneaus monodon EST libraries of 12 tissues, containing 5,568 non-redundant cDNA clones from 10,536 unique cDNA in the P. monodon EST database. UniShrimpChip was used to study testicular development by comparing gene expression levels of wild brooders from the West and East coasts of Thailand and domesticated brooders with different ages (10-, 14-, 18-month-old. Results The overall gene expression patterns from the microarray experiments revealed distinct transcriptomic patterns between the wild and domesticated groups. Moreover, differentially expressed genes from the microarray comparisons were identified, and the expression patterns of eight selected transcripts were subsequently confirmed by reverse-transcriptase quantitative PCR (RT-qPCR. Among these, expression levels of six subunits (CSN2, 4, 5, 6, 7a, and 8 of the COP9 signalosome (CSN gene family in wild and different ages of domesticated brooders were examined by RT-qPCR. Among the six subunits, CSN5 and CSN6 were most highly expressed in wild brooders and least expressed in the 18-month-old domesticated group; therefore, their full-length cDNA sequences were characterized. Conclusions This study is the first report to employ cDNA microarray to study testicular development in the black tiger shrimp. We show that there are obvious differences between the wild and domesticated shrimp at the transcriptomic level. Furthermore, our study is the first to investigate the feasibility that the CSN gene family might have involved in reproduction and development of this economically important

  6. First full length sequences of the S gene of European isolates reveal further diversity among turkey coronaviruses.

    OpenAIRE

    2011-01-01

    Abstract An increasing incidence of enteric disorders clinically evocative of the poult enteritis complex has been observed in turkeys in France since 2003. Using a newly designed real-time RT-PCR assay specific for the nucleocapsid (N) gene of infectious bronchitis virus (IBV) and turkey coronaviruses (TCoV), coronaviruses were identified in 37 % of the intestinal samples collected from diseased turkey flocks. The full length Spike (S) gene of these viruses was amplified, cloned a...

  7. Molecular cloning of cDNA for the human tumor-associated antigen CO-029 and identification of related transmembrane antigens

    International Nuclear Information System (INIS)

    Szala, S.; Kasai, Yasushi; Steplewski, Z.; Rodeck, U.; Koprowski, H.; Linnenbach, A.J.

    1990-01-01

    The human tumor-associated antigen CO-029 is a monoclonal antibody-defined cell surface glycoprotein of 27-34 kDa. By using the high-efficiency COS cell expression system, a full-length cDNA clone for CO-029 was isolated. When transiently expressed in COS cells, the cDNA clone directed the synthesis of an antigen reactive to monoclonal antibody CO-029 in mixed hemadsorption and immunoblot assays. Sequence analysis revealed that CO-029 belongs to a family of cell surface antigens that includes the melanoma-associated antigen ME491, the leukocyte cell surface antigen CD37, and the Sm23 antigen of the parasitic helminth Schistosoma mansoni. CO-029 and ME491 antigen expression and the effect of their corresponding monoclonal antibodies on cell growth were compared in human tumor cell lines of various histologic origins

  8. Molecular cloning and mammalian expression of human beta 2-glycoprotein I cDNA

    DEFF Research Database (Denmark)

    Kristensen, Torsten; Schousboe, Inger; Boel, Espen

    1991-01-01

    Human β2-glycoprotein (β2gpI) cDNA was isolated from a liver cDNA library and sequenced. The cDNA encoded a 19-residue hydrophobic signal peptide followed by the mature β2gpI of 326 amino acid residues. In liver and in the hepatoma cell line HepG2 there are two mRNA species of about 1.4 and 4.3 kb......, respectively, hybridizing specifically with the β2gpI cDNA. Upon isoelectric focusing, recombinant β2gpI obtained from expression of β2gpI cDNA in baby hamster kidney cells showed the same pattern of bands as β2gpI isolated from plasma, and at least 5 polypeptides were visible...

  9. De novo assembly and next-generation sequencing to analyse full-length gene variants from codon-barcoded libraries.

    Science.gov (United States)

    Cho, Namjin; Hwang, Byungjin; Yoon, Jung-ki; Park, Sangun; Lee, Joongoo; Seo, Han Na; Lee, Jeewon; Huh, Sunghoon; Chung, Jinsoo; Bang, Duhee

    2015-09-21

    Interpreting epistatic interactions is crucial for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. Although high resolution mapping of en masse variant libraries renders molecular biologists to address genotype-phenotype relationships, long-read sequencing technology remains indispensable to assess functional relationship between mutations that lie far apart. Here, we introduce JigsawSeq for multiplexed sequence identification of pooled gene variant libraries by combining a codon-based molecular barcoding strategy and de novo assembly of short-read data. We first validate JigsawSeq on small sub-pools and observed high precision and recall at various experimental settings. With extensive simulations, we then apply JigsawSeq to large-scale gene variant libraries to show that our method can be reliably scaled using next-generation sequencing. JigsawSeq may serve as a rapid screening tool for functional genomics and offer the opportunity to explore evolutionary trajectories of protein variants.

  10. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  11. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  12. LZW-Kernel: fast kernel utilizing variable length code blocks from LZW compressors for protein sequence classification.

    Science.gov (United States)

    Filatov, Gleb; Bauwens, Bruno; Kertész-Farkas, Attila

    2018-05-07

    Bioinformatics studies often rely on similarity measures between sequence pairs, which often pose a bottleneck in large-scale sequence analysis. Here, we present a new convolutional kernel function for protein sequences called the LZW-Kernel. It is based on code words identified with the Lempel-Ziv-Welch (LZW) universal text compressor. The LZW-Kernel is an alignment-free method, it is always symmetric, is positive, always provides 1.0 for self-similarity and it can directly be used with Support Vector Machines (SVMs) in classification problems, contrary to normalized compression distance (NCD), which often violates the distance metric properties in practice and requires further techniques to be used with SVMs. The LZW-Kernel is a one-pass algorithm, which makes it particularly plausible for big data applications. Our experimental studies on remote protein homology detection and protein classification tasks reveal that the LZW-Kernel closely approaches the performance of the Local Alignment Kernel (LAK) and the SVM-pairwise method combined with Smith-Waterman (SW) scoring at a fraction of the time. Moreover, the LZW-Kernel outperforms the SVM-pairwise method when combined with BLAST scores, which indicates that the LZW code words might be a better basis for similarity measures than local alignment approximations found with BLAST. In addition, the LZW-Kernel outperforms n-gram based mismatch kernels, hidden Markov model based SAM and Fisher kernel, and protein family based PSI-BLAST, among others. Further advantages include the LZW-Kernel's reliance on a simple idea, its ease of implementation, and its high speed, three times faster than BLAST and several magnitudes faster than SW or LAK in our tests. LZW-Kernel is implemented as a standalone C code and is a free open-source program distributed under GPLv3 license and can be downloaded from https://github.com/kfattila/LZW-Kernel. akerteszfarkas@hse.ru. Supplementary data are available at Bioinformatics Online.

  13. Full-length genome sequence analysis of four subgroup J avian leukosis virus strains isolated from chickens with clinical hemangioma.

    Science.gov (United States)

    Lin, Lulu; Wang, Peikun; Yang, Yongli; Li, Haijuan; Huang, Teng; Wei, Ping

    2017-12-01

    Since 2014, cases of hemangioma associated with avian leukosis virus subgroup J (ALV-J) have been emerging in commercial chickens in Guangxi. In this study, four strains of the subgroup J avian leukosis virus (ALV-J), named GX14HG01, GX14HG04, GX14LT07, and GX14ZS14, were isolated from chickens with clinical hemangioma in 2014 by DF-1 cell culture and then identified with ELISA detection of ALV group specific antigen p27, the detection of subtype specific PCR and indirect immunofluorescence assay (IFA) with ALV-J specific monoclonal antibody. The complete genomes of the isolates were sequenced and it was found that the gag and pol were relatively conservative, while env was variable especially the gp85 gene. Homology analysis of the env gene sequences showed that the env gene of all the four isolates had higher similarities with the hemangioma (HE)-type reference strains than that of the myeloid leukosis (ML)-type strains, and moreover, the HE-type strains' specific deletion of 205-bp sequence covering the rTM and DR1 in 3'UTR fragment was also found in the four isolates. Further analysis on the sequences of subunits of env gene revealed an interesting finding: the gp85 of isolates GX14ZS14 and GX14HG04 had a higher similarity with HPRS-103 and much lower similarity with the HE-type reference strains resulting in GX14ZS14, GX14HG04, and HPRS-103 being clustered in the same branch, while gp37 had higher similarities with the HE-type reference strains when compared to that of HPRS-103, resulted in GX14ZS14, GX14HG04, and HE-type reference strains being clustered in the same branch. The results suggested that isolates GX14ZS14 and GX14HG04 may be the recombinant strains of the foreign strain HPRS-103 with the local epidemic HE-type strains of ALV-J.

  14. The effects of rest interval length manipulation of the first upper-body resistance exercise in sequence on acute performance of subsequent exercises in men and women.

    Science.gov (United States)

    Ratamess, Nicholas A; Chiarello, Christina M; Sacco, Anthony J; Hoffman, Jay R; Faigenbaum, Avery D; Ross, Ryan E; Kang, Jie

    2012-11-01

    The purpose of the present study was to investigate the effects of manipulating rest interval (RI) length of the first upper-body exercise in sequence on subsequent resistance exercise performance. Twenty-two men and women with at least 1 year of resistance training experience performed resistance exercise protocols on 3 occasions in random order. Each protocol consisted of performing 4 barbell upper-body exercises in the same sequence (bench press, incline bench press, shoulder press, and bent-over row) for 3 sets of up to 10 repetitions with 75% of 1 repetition maximum. Bench press RIs were 1, 2, or 3 minutes, whereas other exercises were performed with a standard 2-minute rest interval. The number of repetitions completed, average power, and velocity for each set of each exercise were recorded. Gender differences were observed during the bench press and incline press as women performed significantly (p ≤ 0.05) more repetitions than men during all RIs. The magnitude of decline in velocity and power over 3 sets of the bench press and incline press was significantly higher in men than women. Manipulation of RI length during the bench press did not affect performance of the remaining exercises in men. However, significantly more repetitions were performed by women during the first set of the incline press using 3-minute rest interval than 1-minute rest interval. In men and women, performance of the incline press and shoulder press was compromised compared with baseline performances. Manipulation of RI length of the first exercise affected performance of only the first set of 1 subsequent exercise in women. All RIs led to comparable levels of fatigue in men, indicating that reductions in load are necessary for subsequent exercises performed in sequence that stress similar agonist muscle groups when 10 repetitions are desired.

  15. cDNA cloning and mRNA expression of heat shock protein 70 gene ...

    African Journals Online (AJOL)

    In this study, the full-length heat shock protein 70 of Tegillarca granosa was cloned from cDNA library by rapid amplification of cDNA end (RACE). The open reading frame (ORF) of heat shock protein 70 was 1968 bp, and it encoded a protein of 655 amino acids with a predicted molecular weight of 71.48 kDa and an ...

  16. Complete nucleotide sequences and construction of full-length infectious cDNA clones of Cucumber green mottle virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters

    Science.gov (United States)

    Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with Cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon...

  17. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  18. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  19. Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

    Science.gov (United States)

    Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

    2017-01-01

    Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

  20. Study of canine parvovirus evolution: comparative analysis of full-length VP2 gene sequences from Argentina and international field strains.

    Science.gov (United States)

    Gallo Calderón, Marina; Wilda, Maximiliano; Boado, Lorena; Keller, Leticia; Malirat, Viviana; Iglesias, Marcela; Mattion, Nora; La Torre, Jose

    2012-02-01

    The continuous emergence of new strains of canine parvovirus (CPV), poorly protected by current vaccination, is a concern among breeders, veterinarians, and dog owners around the world. Therefore, the understanding of the genetic variation in emerging CPV strains is crucial for the design of disease control strategies, including vaccines. In this paper, we obtained the sequences of the full-length gene encoding for the main capsid protein (VP2) of 11 canine parvovirus type 2 (CPV-2) Argentine representative field strains, selected from a total of 75 positive samples studied in our laboratory in the last 9 years. A comparative sequence analysis was performed on 9 CPV-2c, one CPV-2a, and one CPV-2b Argentine strains with respect to international strains reported in the GenBank database. In agreement with previous reports, a high degree of identity was found among CPV-2c Argentine strains (99.6-100% and 99.7-100% at nucleotide and amino acid levels, respectively). However, the appearance of a new substitution in the 440 position (T440A) in four CPV-2c Argentine strains obtained after the year 2009 gives support to the variability observed for this position located within the VP2, three-fold spike. This is the first report on the genetic characterization of the full-length VP2 gene of emerging CPV strains in South America and shows that all the Argentine CPV-2c isolates cluster together with European and North American CPV-2c strains.

  1. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  2. Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

    Science.gov (United States)

    Holland, Joseph G; Geiger, Franz M

    2012-06-07

    The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

  3. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng

    2013-11-01

    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  4. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  5. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  6. Comparison of next generation sequencing technologies for transcriptome characterization

    Directory of Open Access Journals (Sweden)

    Soltis Douglas E

    2009-08-01

    Full Text Available Abstract Background We have developed a simulation approach to help determine the optimal mixture of sequencing methods for most complete and cost effective transcriptome sequencing. We compared simulation results for traditional capillary sequencing with "Next Generation" (NG ultra high-throughput technologies. The simulation model was parameterized using mappings of 130,000 cDNA sequence reads to the Arabidopsis genome (NCBI Accession SRA008180.19. We also generated 454-GS20 sequences and de novo assemblies for the basal eudicot California poppy (Eschscholzia californica and the magnoliid avocado (Persea americana using a variety of methods for cDNA synthesis. Results The Arabidopsis reads tagged more than 15,000 genes, including new splice variants and extended UTR regions. Of the total 134,791 reads (13.8 MB, 119,518 (88.7% mapped exactly to known exons, while 1,117 (0.8% mapped to introns, 11,524 (8.6% spanned annotated intron/exon boundaries, and 3,066 (2.3% extended beyond the end of annotated UTRs. Sequence-based inference of relative gene expression levels correlated significantly with microarray data. As expected, NG sequencing of normalized libraries tagged more genes than non-normalized libraries, although non-normalized libraries yielded more full-length cDNA sequences. The Arabidopsis data were used to simulate additional rounds of NG and traditional EST sequencing, and various combinations of each. Our simulations suggest a combination of FLX and Solexa sequencing for optimal transcriptome coverage at modest cost. We have also developed ESTcalc http://fgp.huck.psu.edu/NG_Sims/ngsim.pl, an online webtool, which allows users to explore the results of this study by specifying individualized costs and sequencing characteristics. Conclusion NG sequencing technologies are a highly flexible set of platforms that can be scaled to suit different project goals. In terms of sequence coverage alone, the NG sequencing is a dramatic advance

  7. Factors affecting the duration of nestling period and fledging order in Tengmalm's owl (Aegolius funereus: effect of wing length and hatching sequence.

    Directory of Open Access Journals (Sweden)

    Marek Kouba

    Full Text Available In altricial birds, the nestling period is an important part of the breeding phase because the juveniles may spend quite a long time in the nest, with associated high energy costs for the parents. The length of the nestling period can be variable and its duration may be influenced by both biotic and abiotic factors; however, studies of this have mostly been undertaken on passerine birds. We studied individual duration of nestling period of 98 Tengmalm's owl chicks (Aegolius funereus at 27 nests during five breeding seasons using a camera and chip system and radio-telemetry. We found the nestlings stayed in the nest box for 27 - 38 days from hatching (mean ± SD, 32.4 ± 2.2 days. The individual duration of nestling period was negatively related to wing length, but no formally significant effect was found for body weight, sex, prey availability and/or weather conditions. The fledging sequence of individual nestlings was primarily related to hatching order; no relationship with wing length and/or other factors was found in this case. We suggest the length of wing is the most important measure of body condition and individual quality in Tengmalm's owl young determining the duration of the nestling period. Other differences from passerines (e.g., the lack of effect of weather or prey availability on nestling period are considered likely to be due to different life-history traits, in particular different food habits and nesting sites and greater risk of nest predation among passerines.

  8. Construction of a cDNA library from female adult of Toxocara canis, and analysis of EST and immune-related genes expressions.

    Science.gov (United States)

    Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin

    2011-10-01

    Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.

  9. Telomerase activity and telomere length in the colorectal polyp-carcinoma sequence Actividad de la telomerasa y longitud del telómero en la secuencia pólipo-carcinoma colorrectal

    OpenAIRE

    C. Valls Bautista; C. Piñol Felis; J. M. Reñe Espinet; J. Buenestado García; J. Viñas Salas

    2009-01-01

    Objective: the role of telomerase activity and telomere length in the adenoma-carcinoma sequence of colon carcinogenesis has not been well established. The objective of this study was to determine telomerase activity and telomere length patterns in patients with adenomatous polyps either associated or not with colorectal cancer, as well as the role of telomeric instability in the adenoma-carcinoma sequence. Patients and methods: we included in the study 14 patients who underwent surgery for c...

  10. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  11. The evolutionary rates of HCV estimated with subtype 1a and 1b sequences over the ORF length and in different genomic regions.

    Directory of Open Access Journals (Sweden)

    Manqiong Yuan

    Full Text Available Considerable progress has been made in the HCV evolutionary analysis, since the software BEAST was released. However, prior information, especially the prior evolutionary rate, which plays a critical role in BEAST analysis, is always difficult to ascertain due to various uncertainties. Providing a proper prior HCV evolutionary rate is thus of great importance.176 full-length sequences of HCV subtype 1a and 144 of 1b were assembled by taking into consideration the balance of the sampling dates and the even dispersion in phylogenetic trees. According to the HCV genomic organization and biological functions, each dataset was partitioned into nine genomic regions and two routinely amplified regions. A uniform prior rate was applied to the BEAST analysis for each region and also the entire ORF. All the obtained posterior rates for 1a are of a magnitude of 10(-3 substitutions/site/year and in a bell-shaped distribution. Significantly lower rates were estimated for 1b and some of the rate distribution curves resulted in a one-sided truncation, particularly under the exponential model. This indicates that some of the rates for subtype 1b are less accurate, so they were adjusted by including more sequences to improve the temporal structure.Among the various HCV subtypes and genomic regions, the evolutionary patterns are dissimilar. Therefore, an applied estimation of the HCV epidemic history requires the proper selection of the rate priors, which should match the actual dataset so that they can fit for the subtype, the genomic region and even the length. By referencing the findings here, future evolutionary analysis of the HCV subtype 1a and 1b datasets may become more accurate and hence prove useful for tracing their patterns.

  12. High-resolution T2-weighted MR imaging of the inner ear using a long echo-train-length 3D fast spin-echo sequence

    International Nuclear Information System (INIS)

    Naganawa, S.; Yamakawa, K.; Fukatsu, H.; Ishigaki, T.; Nakashima, T.; Sugimoto, H.; Aoki, I.; Miyazaki, M.; Takai, H.

    1996-01-01

    The purpose of this study was to assess the value of a long echo-train-length 3D fast spin-echo (3D-FSE) sequence in visualizing the inner ear structures. Ten normal ears and 50 patient ears were imaged on a 1.5T MR unit using a head coil. Axial high-resolution T2-weighted images of the inner ear and the internal auditory canal (IAC) were obtained in 15 min. In normal ears the reliability of the visualization for the inner ear structures was evaluated on original images and the targeted maximum intensity projection (MIP) images of the labyrinth. In ten normal ears, 3D surface display (3D) images were also created and compared with MIP images. On the original images the cochlear aqueduct, the vessels in the vicinity of the IAC, and more than three branches of the cranial nerves were visualized in the IAC in all the ears. The visibility of the endolympathic duct was 80%. On the MIP images the visibility of the three semicircular canals, anterior and posterior ampulla, and of more than two turns of the cochlea was 100%. The MIP images and 3D images were almost comparable. The visibility of the endolymphatic duct was 80% in normal ears and 0% in the affected ears of the patients with Meniere's disease (p<0.001). In one patient ear a small intracanalicular tumor was depicted clearly. In conclusion, the long echo train length T2-weighted 3D-FSE sequence enables the detailed visualization of the tiny structures of the inner ear and the IAC within a clinically acceptable scan time. Furthermore, obtaining a high contrast between the soft/bony tissue and the cerebrospinal/endolymph/perilymph fluid would be of significant value in the diagnosis of the pathologic conditions around the labyrinth and the IAC. (orig.)

  13. Heterogeneity of rat tropoelastin mRNA revealed by cDNA cloning

    International Nuclear Information System (INIS)

    Pierce, R.A.; Deak, S.B.; Stolle, C.A.; Boyd, C.D.

    1990-01-01

    A λgt11 library constructed from poly(A+) RNA isolated from aortic tissue of neonatal rats was screened for rat tropoelastin cDNAs. The first, screen, utilizing a human tropoelastin cDNA clone, provided rat tropoelastin cDNAs spanning 2.3 kb of carboxy-terminal coding sequence and extended into the 3'-untranslated region. A subsequent screen using a 5' rat tropoelastin cDNA clone yielded clones extending into the amino-terminal signal sequence coding region. Sequence analysis of these clones has provided the complete derived amino acid sequence of rat tropoelastin and allowed alignment and comparison with published bovine cDNA sequence. While the overall structure of rat tropoelastin is similar to bovine sequence, numerous substitutions, deletions, and insertions demonstrated considerable heterogeneity between species. In particular, the pentapeptide repeat VPGVG, characteristic of all tropoelastins analyzed to date, is replaced in rat tropoelastin by a repeating pentapeptide, IPGVG. The hexapeptide repeat VGVAPG, the bovine elastin receptor binding peptide, is not encoded by rat tropoelastin cDNAs. Variations in coding sequence between rat tropoelastin CDNA clones were also found which may represent mRNA heterogeneity produced by alternative splicing of the rat tropoelastin pre-mRNA

  14. Interferon-gamma up-regulates a unique set of proteins in human keratinocytes. Molecular cloning and expression of the cDNA encoding the RGD-sequence-containing protein IGUP I-5111

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1993-01-01

    AMP (Bt2cAMP), dibutyryl cGMP (Bt2cGMP)] and compounds known to affect keratinocytes [4 beta-phorbol 12-myristate 13-acetate (PMA), retinoic acid, Ca2+, dexamethasone, lipopolysaccharides, foetal calf serum]. Protein IGUP I-5111 was selected for further studies as its level is affected by simian-virus-40......, which migrated with the AMA variant of keratinocyte protein IEF SSP 5111, is novel although it exhibits weak similarity to cytoskeletal proteins. IGUP I-5111 contains the RGD sequence found in many extracellular glycoprotein ligands of the integrin receptor family and it is found at least partially...... in the culture supernatant. Considering the presence of IFN-gamma in psoriatic plaques as well as its putative involvement in the pathophysiology of the disease it was of interest to determine whether the set of proteins was upregulated in these cells. Two-dimensional gel analysis of the protein phenotype of non-cultured...

  15. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    Science.gov (United States)

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  16. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon.

    Science.gov (United States)

    Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin

    2008-08-01

    The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.

  17. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  18. Construction and characterization of the alpha form of a cardiac myosin heavy chain cDNA clone and its developmental expression in the Syrian hamster.

    OpenAIRE

    Liew, C C; Jandreski, M A

    1986-01-01

    A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...

  19. cDNA cloning, expression and immune function analysis of a novel Rac1 gene (AjRac1) in the sea cucumber Apostichopus japonicus.

    Science.gov (United States)

    Li, Kaiquan; Liu, Lin; Shang, Shengnan; Wang, Yi; Zhan, Yaoyao; Song, Jian; Zhang, Xiangxiang; Chang, Yaqing

    2017-10-01

    The ras-related C3 botulinum toxin substrate 1 (Rac1) belongs to Ras homolog (Rho) small GTPases subfamily. As an important molecular switch, Rac1 regulates various processes in the cell, especially in cellular immune response. With attempt to clarify characters and functions of Rac1 in sea cucumbers, full length cDNA of a Rac1 homolog in the sea cucumber Apostichopus japonicus (AjRac1) was cloned by transcriptome database mining and rapid amplification of cDNA ends (RACE) techniques. The open reading frame of AjRac1 is 579 bp encoding a protein with a length of 192 aa. Sequence analysis showed that AjRac1 is highly conserved as compared to those from other eukaryotic species. Phylogenetic analysis revealed that amino acid sequence of AjRac1 closely related to those from Strongylocentrotus purpuratus. Results of expression analysis showed that AjRac1 exhibited a relative high expression in blastula stage, adult coelomocytes and respiratory tree in A. japonicus. The transcription of AjRac1 in adult coelomocytes altered significantly at 4 h- and 12 h-after Vibrio splendidus infection, respectively, which indicated that AjRac1 involved in sea cucumber innate immunity. All data presented in this study will deepen our understanding of characterizations and immunological functions of Rac1 in sea cucumbers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  1. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  2. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  3. Isolation and expression of a pea vicilin cDNA in the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Watson, M D; Lambert, N; Delauney, A; Yarwood, J N; Croy, R R; Gatehouse, J A; Wright, D J; Boulter, D

    1988-01-01

    A cDNA clone containing the complete coding sequence for vicilin from pea (Pisum sativum L.) was isolated. It specifies a 50,000-Mr protein that in pea is neither post-translationally processed nor glycosylated. The cDNA clone was expressed in yeast from a 2 micron plasmid by using the yeast phosphoglycerate kinase promoter and initiator codon. The resultant fusion protein, which contains the first 16 amino acid residues of phosphoglycerate kinase in addition to the vicilin sequence, was puri...

  4. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  5. Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

    Science.gov (United States)

    Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

    2015-12-14

    Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the

  6. Cytomegalovirus sequence variability, amplicon length, and DNase-sensitive non-encapsidated genomes are obstacles to standardization and commutability of plasma viral load results.

    Science.gov (United States)

    Naegele, Klaudia; Lautenschlager, Irmeli; Gosert, Rainer; Loginov, Raisa; Bir, Katia; Helanterä, Ilkka; Schaub, Stefan; Khanna, Nina; Hirsch, Hans H

    2018-04-22

    Cytomegalovirus (CMV) management post-transplantation relies on quantification in blood, but inter-laboratory and inter-assay variability impairs commutability. An international multicenter study demonstrated that variability is mitigated by standardizing plasma volumes, automating DNA extraction and amplification, and calibration to the 1st-CMV-WHO-International-Standard as in the FDA-approved Roche-CAP/CTM-CMV. However, Roche-CAP/CTM-CMV showed under-quantification and false-negative results in a quality assurance program (UK-NEQAS-2014). To evaluate factors contributing to quantification variability of CMV viral load and to develop optimized CMV-UL54-QNAT. The UL54 target of the UK-NEQAS-2014 variant was sequenced and compared to 329 available CMV GenBank sequences. Four Basel-CMV-UL54-QNAT assays of 361 bp, 254 bp, 151 bp, and 95 bp amplicons were developed that only differed in reverse primer positions. The assays were validated using plasmid dilutions, UK-NEQAS-2014 sample, as well as 107 frozen and 69 prospectively collected plasma samples from transplant patients submitted for CMV QNAT, with and without DNase-digestion prior to nucleic acid extraction. Eight of 43 mutations were identified as relevant in the UK-NEQAS-2014 target. All Basel-CMV-UL54 QNATs quantified the UK-NEQAS-2014 but revealed 10-fold increasing CMV loads as amplicon size decreased. The inverse correlation of amplicon size and viral loads was confirmed using 1st-WHO-International-Standard and patient samples. DNase pre-treatment reduced plasma CMV loads by >90% indicating the presence of unprotected CMV genomic DNA. Sequence variability, amplicon length, and non-encapsidated genomes obstruct standardization and commutability of CMV loads needed to develop thresholds for clinical research and management. Besides regular sequence surveys, matrix and extraction standardization, we propose developing reference calibrators using 100 bp amplicons. Copyright © 2018 Elsevier B.V. All

  7. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  8. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  9. Human beta 2 chain of laminin (formerly S chain): cDNA cloning, chromosomal localization, and expression in carcinomas

    DEFF Research Database (Denmark)

    Wewer, U M; Gerecke, D R; Durkin, M E

    1994-01-01

    or other known laminin genes. Immunostaining showed that the beta 2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous beta 1 chain is confined to the subendothelial basement membranes. The beta 2 chain was found in the basement membranes of ovarian carcinomas......Overlapping cDNA clones that encode the full-length human laminin beta 2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature...... beta 2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human beta 2 chain is predicted to have all of the seven structural domains typical of the beta chains of laminin, including the short cysteine-rich alpha region. The amino acid sequence of human beta 2...

  10. BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

    Science.gov (United States)

    Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

    2010-11-01

    A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

  11. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  12. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum) Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Science.gov (United States)

    Xu, Xiaomei; Chao, Juan; Cheng, Xueli; Wang, Rui; Sun, Baojuan; Wang, Hengming; Luo, Shaobo; Xu, Xiaowan; Wu, Tingquan; Li, Ying

    2016-01-01

    Phytophthora root rot caused by Phytophthora capsici (P. capsici) is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS). Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334) and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399) were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3) was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA) and Specific Length Amplified Fragment sequencing (SLAF-seq) provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR) markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away) and P52-11-41 (1.1 cM). A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  13. Subtype-independent near full-length HIV-1 genome sequencing and assembly to be used in large molecular epidemiological studies and clinical management.

    Science.gov (United States)

    Grossmann, Sebastian; Nowak, Piotr; Neogi, Ujjwal

    2015-01-01

    HIV-1 near full-length genome (HIV-NFLG) sequencing from plasma is an attractive multidimensional tool to apply in large-scale population-based molecular epidemiological studies. It also enables genotypic resistance testing (GRT) for all drug target sites allowing effective intervention strategies for control and prevention in high-risk population groups. Thus, the main objective of this study was to develop a simplified subtype-independent, cost- and labour-efficient HIV-NFLG protocol that can be used in clinical management as well as in molecular epidemiological studies. Plasma samples (n=30) were obtained from HIV-1B (n=10), HIV-1C (n=10), CRF01_AE (n=5) and CRF01_AG (n=5) infected individuals with minimum viral load >1120 copies/ml. The amplification was performed with two large amplicons of 5.5 kb and 3.7 kb, sequenced with 17 primers to obtain HIV-NFLG. GRT was validated against ViroSeq™ HIV-1 Genotyping System. After excluding four plasma samples with low-quality RNA, a total of 26 samples were attempted. Among them, NFLG was obtained from 24 (92%) samples with the lowest viral load being 3000 copies/ml. High (>99%) concordance was observed between HIV-NFLG and ViroSeq™ when determining the drug resistance mutations (DRMs). The N384I connection mutation was additionally detected by NFLG in two samples. Our high efficiency subtype-independent HIV-NFLG is a simple and promising approach to be used in large-scale molecular epidemiological studies. It will facilitate the understanding of the HIV-1 pandemic population dynamics and outline effective intervention strategies. Furthermore, it can potentially be applicable in clinical management of drug resistance by evaluating DRMs against all available antiretrovirals in a single assay.

  14. Mapping of a Novel Race Specific Resistance Gene to Phytophthora Root Rot of Pepper (Capsicum annuum Using Bulked Segregant Analysis Combined with Specific Length Amplified Fragment Sequencing Strategy.

    Directory of Open Access Journals (Sweden)

    Xiaomei Xu

    Full Text Available Phytophthora root rot caused by Phytophthora capsici (P. capsici is a serious limitation to pepper production in Southern China, with high temperature and humidity. Mapping PRR resistance genes can provide linked DNA markers for breeding PRR resistant varieties by molecular marker-assisted selection (MAS. Two BC1 populations and an F2 population derived from a cross between P. capsici-resistant accession, Criollo de Morelos 334 (CM334 and P. capsici-susceptible accession, New Mexico Capsicum Accession 10399 (NMCA10399 were used to investigate the genetic characteristics of PRR resistance. PRR resistance to isolate Byl4 (race 3 was controlled by a single dominant gene, PhR10, that was mapped to an interval of 16.39Mb at the end of the long arm of chromosome 10. Integration of bulked segregant analysis (BSA and Specific Length Amplified Fragment sequencing (SLAF-seq provided an efficient genetic mapping strategy. Ten polymorphic Simple Sequence Repeat (SSR markers were found within this region and used to screen the genotypes of 636 BC1 plants, delimiting PhR10 to a 2.57 Mb interval between markers P52-11-21 (1.5 cM away and P52-11-41 (1.1 cM. A total of 163 genes were annotated within this region and 31 were predicted to be associated with disease resistance. PhR10 is a novel race specific gene for PRR, and this paper describes linked SSR markers suitable for marker-assisted selection of PRR resistant varieties, also laying a foundation for cloning the resistance gene.

  15. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  16. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    Science.gov (United States)

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  17. Use of inter-simple sequence repeats and amplified fragment length polymorphisms to analyze genetic relationships among small grain-infecting species of ustilago.

    Science.gov (United States)

    Menzies, J G; Bakkeren, G; Matheson, F; Procunier, J D; Woods, S

    2003-02-01

    ABSTRACT In the smut fungi, few features are available for use as taxonomic criteria (spore size, shape, morphology, germination type, and host range). DNA-based molecular techniques are useful in expanding the traits considered in determining relationships among these fungi. We examined the phylogenetic relationships among seven species of Ustilago (U. avenae, U. bullata, U. hordei, U. kolleri, U. nigra, U. nuda, and U. tritici) using inter-simple sequence repeats (ISSRs) and amplified fragment length polymorphisms (AFLPs) to compare their DNA profiles. Fifty-four isolates of different Ustilago spp. were analyzed using ISSR primers, and 16 isolates of Ustilago were studied using AFLP primers. The variability among isolates within species was low for all species except U. bullata. The isolates of U. bullata, U. nuda, and U. tritici were well separated and our data supports their speciation. U. avenae and U. kolleri isolates did not separate from each other and there was little variability between these species. U. hordei and U. nigra isolates also showed little variability between species, but the isolates from each species grouped together. Our data suggest that U. avenae and U. kolleri are monophyletic and should be considered one species, as should U. hordei and U. nigra.

  18. Production of glycosylated physiologically normal human α1-antitrypsin by mouse fibroblasts modified by insertion of a human α1-antitrypsin cDNA using a retroviral vector

    International Nuclear Information System (INIS)

    Garver, R.I. Jr.; Chytil, A.; Karlsson, S.

    1987-01-01

    α 2 -Antitrypsin (α 1 AT) deficiency is a hereditary disorder characterized by reduced serum levels of α 1 AT, resulting in destruction of the lower respiratory tract by neutrophil elastase. As an approach to augment α 1 AT levels in this disorder with physiologically normal human α 1 AT, the authors have integrated a full-length normal human α 1 AT cDNA into the genome of mouse fibroblasts. To accomplish this, the retroviral vector N2 was modified by inserting the simian virus 40 early promoter followed by the α 1 AT cDNA. Southern analysis demonstrated that the intact cDNA was present in the genome of selected clones of the transfected murine fibroblasts psi2 and infected NIH 3T3. The clones produced three mRNA transcripts containing human α 1 AT sequences, secreted an α 1 AT molecule recognized by an anti-human α 1 AT antibody, with the same molecular mass as normal human α 1 AT and that complexed with and inhibited human neutrophil elastase. The psi2 produced α 1 AT was glycosylated, and when infused intravenously into mice, it had a serum half-life similar to normal α 1 AT purified from human plasma and markedly longer than that of nonglycosylated human α 1 AT cDNA-directed yeast-produced α 1 AT. These studies demonstrate the feasibility of using a retroviral vector to insert the normal human α 1 AT cDNA into non-α 1 AT-producing cells, resulting in the synthesis and secretion of physiologically normal α 1 AT

  19. cDNA cloning of a snake venom metalloproteinase from the eastern diamondback rattlesnake (Crotalus adamanteus), and the expression of its disintegrin domain with anti-platelet effects

    Science.gov (United States)

    Suntravat, Montamas; Jia, Ying; Lucena, Sara E.; Sánchez, Elda E.; Pérez, John C.

    2013-01-01

    A 5′ truncated snake venom metalloproteinase was identified from a cDNA library constructed from venom glands of an eastern diamondback rattlesnake (Crotalus adamanteus). The 5′-rapid amplification of cDNA ends (RACE) was used to obtain the 1865 bp full-length cDNA sequence of a snake venom metalloproteinase (CamVMPII). CamVMPII encodes an open reading frame of 488 amino acids, which includes a signal peptide, a pro-domain, a metalloproteinase domain, a spacer, and an RGD-disintegrin domain. The predicted amino acid sequence of CamVMPII showed a 91%, 90%, 83%, and 82% sequence homology to the P-II class enzymes of C. adamanteus metalloproteinase 2, C. atrox CaVMP-II, Gloydius halys agkistin, and Protobothrops jerdonii jerdonitin, respectively. Disintegrins are potent inhibitors of both platelet aggregation and integrin-dependent cell adhesion. Therefore, the disintegrin domain (Cam-dis) of CamVMPII was amplified by PCR, cloned into a pET-43.1a vector, and expressed in Escherichia coli BL21. Affinity purified recombinantly modified Cam-dis (r-Cam-dis) with a yield of 8.5 mg/L culture medium was cleaved from the fusion tags by enterokinase cleavage. r-Cam-dis was further purified by two-step chromatography consisting of HiTrap™ Benzamidine FF column, followed by Talon Metal affinity column with a final yield of 1 mg/L culture. r-Cam-dis was able to inhibit all three processes of platelet thrombus formation including platelet adhesion with an estimated IC50 of 1 nM, collagen- and ADP-induced platelet aggregation with the estimated IC50s of 18 and 6 nM, respectively, and platelet function on clot retraction. It is a potent anti-platelet inhibitor, which should be further investigated for drug discovery to treat stroke patients or patients with thrombotic disorders. PMID:23313448

  20. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  1. Automation of cDNA Synthesis and Labelling Improves Reproducibility

    Directory of Open Access Journals (Sweden)

    Daniel Klevebring

    2009-01-01

    Full Text Available Background. Several technologies, such as in-depth sequencing and microarrays, enable large-scale interrogation of genomes and transcriptomes. In this study, we asses reproducibility and throughput by moving all laboratory procedures to a robotic workstation, capable of handling superparamagnetic beads. Here, we describe a fully automated procedure for cDNA synthesis and labelling for microarrays, where the purification steps prior to and after labelling are based on precipitation of DNA on carboxylic acid-coated paramagnetic beads. Results. The fully automated procedure allows for samples arrayed on a microtiter plate to be processed in parallel without manual intervention and ensuring high reproducibility. We compare our results to a manual sample preparation procedure and, in addition, use a comprehensive reference dataset to show that the protocol described performs better than similar manual procedures. Conclusions. We demonstrate, in an automated gene expression microarray experiment, a reduced variance between replicates, resulting in an increase in the statistical power to detect differentially expressed genes, thus allowing smaller differences between samples to be identified. This protocol can with minor modifications be used to create cDNA libraries for other applications such as in-depth analysis using next-generation sequencing technologies.

  2. Isolation of cDNA clones coding for human tissue factor: primary structure of the protein and cDNA

    International Nuclear Information System (INIS)

    Spicer, E.K.; Horton, R.; Bloem, L.

    1987-01-01

    Tissue factor is a membrane-bound procoagulant protein that activates the extrinsic pathway of blood coagulation in the presence of factor VII and calcium. λ Phage containing the tissue factor gene were isolated from a human placental cDNA library. The amino acid sequence deduced from the nucleotide sequence of the cDNAs indicates that tissue factor is synthesized as a higher molecular weight precursor with a leader sequence of 32 amino acids, while the mature protein is a single polypeptide chain composed of 263 residues. The derived primary structure of tissue factor has been confirmed by comparison to protein and peptide sequence data. The sequence of the mature protein suggests that there are three distinct domains: extracellular, residues 1-219; hydrophobic, residues 220-242; and cytoplasmic, residues 243-263. Three potential N-linked carbohydrate attachment sites occur in the extracellular domain. The amino acid sequence of tissue factor shows no significant homology with the vitamin K-dependent serine proteases, coagulation cofactors, or any other protein in the National Biomedical Research Foundation sequence data bank (Washington, DC)

  3. cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN)

    DEFF Research Database (Denmark)

    Young, M F; Kerr, J M; Termine, J D

    1990-01-01

    A human osteopontin (OP) cDNA was isolated from a library made from primary cultures of human bone cells. The distribution of osteopontin mRNA in human tissues was investigated by Northern analysis and showed that the human message was predominant in cultures of bone cells and in decidua cells...... osteopontin cDNA indicated that the gene is a single copy with an approximate length of 5.4-8.2 kb....

  4. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  5. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    PRECIOUS

    2009-11-02

    Nov 2, 2009 ... basic machinery of protein synthesis and regulation, but also in various ... The genomic DNA was isolated from Giant Panda muscle tissue according to the ... for 45 s, 72°C for 2 min in the first cycle and the anneal temperature deceased 0.2°C ..... edition, Cold Spring Harbor aboratory Press. Cold Spring ...

  6. cDNA cloning and immunological characterization of the rye grass allergen Lol p I.

    Science.gov (United States)

    Perez, M; Ishioka, G Y; Walker, L E; Chesnut, R W

    1990-09-25

    The complete amino acid sequence of two "isoallergenic" forms of Lol p I, the major rye grass (Lolium perenne) pollen allergen, was deduced from cDNA sequence analysis. cDNA clones isolated from a Lolium perenne pollen library contained an open reading frame coding for a 240-amino acid protein. Comparison of the nucleotide and deduced amino acid sequence of two of these clones revealed four changes at the amino acid level and numerous nucleotide differences. Both clones contained one possible asparagine-linked glycosylation site. Northern blot analysis shows one RNA species of 1.2 kilobases. Based on the complete amino acid sequence of Lol p I, overlapping peptides covering the entire molecule were synthesized. Utilizing these peptides we have identified a determinant within the Lol p I molecule that is recognized by human leukocyte antigen class II-restricted T cells obtained from persons allergic to rye grass pollen.

  7. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  8. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  9. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  10. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  11. Infectious Maize rayado fino virus from Cloned cDNA.

    Science.gov (United States)

    Edwards, Michael C; Weiland, John J; Todd, Jane; Stewart, Lucy R

    2015-06-01

    A full-length cDNA clone was produced from a U.S. isolate of Maize rayado fino virus (MRFV), the type member of the genus Marafivirus within the family Tymoviridae. Infectivity of transcripts derived from cDNA clones was demonstrated by infection of maize plants and protoplasts, as well as by transmission via the known leafhopper vectors Dalbulus maidis and Graminella nigrifrons that transmit the virus in a persistent-propagative manner. Infection of maize plants through vascular puncture inoculation of seed with transcript RNA resulted in the induction of fine stipple stripe symptoms typical of those produced by wild-type MRFV and a frequency of infection comparable with that of the wild type. Northern and Western blotting confirmed the production of MRFV-specific RNAs and proteins in infected plants and protoplasts. An unanticipated increase in subgenomic RNA synthesis over levels in infected plants was observed in protoplasts infected with either wild-type or cloned virus. A conserved cleavage site motif previously demonstrated to function in both Oat blue dwarf virus capsid protein and tymoviral nonstructural protein processing was identified near the amino terminus of the MRFV replicase polyprotein, suggesting that cleavage at this site also may occur.

  12. Norrie disease: linkage analysis using a 4.2-kb RFLP detected by a human ornithine aminotransferase cDNA probe.

    Science.gov (United States)

    Ngo, J T; Bateman, J B; Cortessis, V; Sparkes, R S; Mohandas, T; Inana, G; Spence, M A

    1989-05-01

    Previous study has shown that the usual DNA marker for Norrie disease, the L1.28 probe which identifies the DXS7 locus, can recombine with the disease locus. In this study, we used a human ornithine aminotransferase (OAT) cDNA which detects OAT-related DNA sequences mapped to the same region on the X chromosome as that of the L1.28 probe to investigate the family with Norrie disease who exhibited the recombinational event. When genomic DNA from this family was digested with the PvuII restriction endonuclease, we found a restriction fragment length polymorphism (RFLP) of 4.2 kb in size. This fragment was absent in the affected males and cosegregated with the disease locus; we calculated a lod score of 0.602, at theta = 0.00. No deletion could be detected by chromosomal analysis or on Southern blots with other enzymes. These results suggest that one of the OAT-related sequences on the X chromosome may be in close proximity to the Norrie disease locus and represent the first report which indicates that the OAT cDNA may be useful for the identification of carrier status and/or prenatal diagnosis.

  13. Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

    Science.gov (United States)

    Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

    2017-12-01

    As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

  14. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  15. Isolation of a polyphenol oxidase (PPO) cDNA from artichoke and expression analysis in wounded artichoke heads.

    Science.gov (United States)

    Quarta, Angela; Mita, Giovanni; Durante, Miriana; Arlorio, Marco; De Paolis, Angelo

    2013-07-01

    The polyphenol oxidase (PPO) enzyme, which can catalyze the oxidation of phenolics to quinones, has been reported to be involved in undesirable browning in many plant foods. This phenomenon is particularly severe in artichoke heads wounded during the manufacturing process. A full-length cDNA encoding for a putative polyphenol oxidase (designated as CsPPO) along with a 1432 bp sequence upstream of the starting ATG codon was characterized for the first time from [Cynara cardunculus var. scolymus (L.) Fiori]. The 1764 bp CsPPO sequence encodes a putative protein of 587 amino acids with a calculated molecular mass of 65,327 Da and an isoelectric point of 5.50. Analysis of the promoter region revealed the presence of cis-acting elements, some of which are putatively involved in the response to light and wounds. Expression analysis of the gene in wounded capitula indicated that CsPPO was significantly induced after 48 h, even though the browning process had started earlier. This suggests that the early browning event observed in artichoke heads was not directly related to de novo mRNA synthesis. Finally, we provide the complete gene sequence encoding for polyphenol oxidase and the upstream regulative region in artichoke. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  17. Cloning of low dose radiation induced gene RIG1 by RACE based on non-cloned cDNA library

    International Nuclear Information System (INIS)

    Luo Ying; Sui Jianli; Tie Yi; Zhang Yuanping; Zhou Pingkun; Sun Zhixian

    2001-01-01

    Objective: To obtain full-length cDNA of radiation induced new gene RIG1 based on its EST fragment. Methods: Based on non-cloned cDNA library, enhanced nested RACE PCR and biotin-avidin labelled probe for magnetic bead purification was used to obtain full-length cDNA of RIG1. Results: About 1 kb of 3' end of RIG1 gene was successfully cloned by this set of methods and cloning of RIG1 5' end is proceeding well. Conclusion: The result is consistent with the design of experiment. This set of protocol is useful for cloning of full-length gene based on EST fragment

  18. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  19. Molecular characterization of two isoforms of ZFAND3 cDNA from the Japanese quail and the leopard gecko, and different expression patterns between testis and ovary.

    Science.gov (United States)

    Otake, Shigeo; Endo, Daisuke; Park, Min Kyun

    2011-11-15

    Zing finger AN1-type domain 3 (ZFAND3), also known as testis expressed sequence 27 (Tex27), is a gene found in the mouse testis, but its physiological function is unknown. We identified the full-length sequences of two isoforms (short and long) of ZFAND3 cDNA from Japanese quail and leopard gecko. This is the first cloning of avian and reptilian ZFAND3 cDNA. The two isoforms are generated by alternative polyadenylation in the 3'UTR and have the same ORF sequences encoding identical proteins. There were highly conserved regions in the 3'UTR of the long form near the polyadenylation sites from mammals to amphibians, suggesting that the features for determining the stability of mRNA or translation efficiency differ between isoforms. The deduced amino acid sequence of ZFAND3 has two putative zinc finger domains, an A20-like zinc finger domain at the N-terminal and an AN1-like zinc finger domain at the C-terminal. Sequence analysis revealed an additional exon in the genomic structures of the avian and reptilian ZFAND3 genes which is not present in mammals, amphibians, or fish, and this exon produces additional amino acid residues in the A20-like zinc finger domain. Expression analysis in Japanese quail revealed that the expression level of ZFAND3 mRNA was high in not only the testis but also the ovary, and ZFAND3 mRNA was expressed in both spermatides of the testis and oocytes of the ovary. While the short form mRNA was mainly expressed in the testis, the expression level of the long form mRNA was high in the ovary. These results suggest that ZFAND3 has physiological functions related to germ cell maturation and regulatory mechanisms that differ between the testis and ovary. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Cloning and analysis of the mouse Fanconi anemia group A cDNA and an overlapping penta zinc finger cDNA.

    Science.gov (United States)

    Wong, J C; Alon, N; Norga, K; Kruyt, F A; Youssoufian, H; Buchwald, M

    2000-08-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a model system, we cloned and characterized the mouse homolog of the human FANCA cDNA. The mouse cDNA (Fanca) encodes a 161-kDa protein that shares 65% amino acid sequence identity with human FANCA. Fanca is located at the distal region of mouse chromosome 8 and has a ubiquitous pattern of expression in embryonic and adult tissues. Expression of the mouse cDNA in human FA-A cells restores the cellular drug sensitivity to normal levels. Thus, the expression pattern, protein structure, chromosomal location, and function of FANCA are conserved in the mouse. We also isolated a novel zinc finger protein, Zfp276, which has five C(2)H(2) domains. Interestingly, Zfp276 is situated in the Fanca locus, and the 3'UTR of its cDNA overlaps with the last four exons of Fanca in a tail-to-tail manner. Zfp276 is expressed in the same tissues as Fanca, but does not complement the mitomycin C (MMC)-sensitive phenotype of FA-A cells. The overlapping genomic organization between Zfp276 and Fanca may have relevance to the disease phenotype of FA. Copyright 2000 Academic Press.

  1. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    Science.gov (United States)

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  2. Metagenomic and near full-length 16S rRNA sequence data in support of the phylogenetic analysis of the rumen bacterial community in steers

    Directory of Open Access Journals (Sweden)

    Phillip R. Myer

    2016-09-01

    Full Text Available Amplicon sequencing utilizing next-generation platforms has significantly transformed how research is conducted, specifically microbial ecology. However, primer and sequencing platform biases can confound or change the way scientists interpret these data. The Pacific Biosciences RSII instrument may also preferentially load smaller fragments, which may also be a function of PCR product exhaustion during sequencing. To further examine theses biases, data is provided from 16S rRNA rumen community analyses. Specifically, data from the relative phylum-level abundances for the ruminal bacterial community are provided to determine between-sample variability. Direct sequencing of metagenomic DNA was conducted to circumvent primer-associated biases in 16S rRNA reads and rarefaction curves were generated to demonstrate adequate coverage of each amplicon. PCR products were also subjected to reduced amplification and pooling to reduce the likelihood of PCR product exhaustion during sequencing on the Pacific Biosciences platform. The taxonomic profiles for the relative phylum-level and genus-level abundance of rumen microbiota as a function of PCR pooling for sequencing on the Pacific Biosciences RSII platform were provided. For more information, see “Evaluation of 16S rRNA amplicon sequencing using two next-generation sequencing technologies for phylogenetic analysis of the rumen bacterial community in steers” P.R. Myer, M. Kim, H.C. Freetly, T.P.L. Smith (2016 [1]. Keywords: 16S rRNA gene, MiSeq, Pacific Biosciences, Rumen microbiome

  3. Identification of eukaryotic open reading frames in metagenomic cDNA libraries made from environmental samples.

    Science.gov (United States)

    Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2006-01-01

    Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.

  4. Isolation of an insulin-like growth factor II cDNA with a unique 5' untranslated region from human placenta

    International Nuclear Information System (INIS)

    Shen, Shujane; Daimon, Makoto; Wang, Chunyeh; Ilan, J.; Jansen, M.

    1988-01-01

    Human insulin-like growth factor II (IGF-II) cDNA from a placental library was isolated and sequenced. The 5' untranslated region (5'-UTR) sequence of this cDNA differs completely from that of adult human liver and has considerable base sequence identity to the same region of an IGF-II cDNA of a rat liver cell line, BRL-3A. Human placental poly(A) + RNA was probed with either the 5'-UTR of the isolated human placental IGF-II cDNA or the 5'-UTR of the IGF-II cDNA obtained from adult human liver. No transcripts were detected by using the 5'-UTR of the adult liver IGF-II as the probe. In contrast, three transcripts of 6.0, 3.2, and 2.2 kilobases were detected by using the 5'-UTR of the placental IGF-II cDNA as the probe or the probe from the coding sequence. A fourth IGF-II transcript of 4.9 kilobases presumably containing a 5'-UTR consisting of a base sequence dissimilar to that of either IGF-II 5'-UTR was apparent. Therefore, IGF-II transcripts detected may be products of alternative splicing as their 5'-UTR sequence is contained within the human IGF-II gene or they may be a consequence of alternative promoter utilization in placenta

  5. Transcriptome sequencing of the Microarray Quality Control (MAQC RNA reference samples using next generation sequencing

    Directory of Open Access Journals (Sweden)

    Thierry-Mieg Danielle

    2009-06-01

    Full Text Available Abstract Background Transcriptome sequencing using next-generation sequencing platforms will soon be competing with DNA microarray technologies for global gene expression analysis. As a preliminary evaluation of these promising technologies, we performed deep sequencing of cDNA synthesized from the Microarray Quality Control (MAQC reference RNA samples using Roche's 454 Genome Sequencer FLX. Results We generated more that 3.6 million sequence reads of average length 250 bp for the MAQC A and B samples and introduced a data analysis pipeline for translating cDNA read counts into gene expression levels. Using BLAST, 90% of the reads mapped to the human genome and 64% of the reads mapped to the RefSeq database of well annotated genes with e-values ≤ 10-20. We measured gene expression levels in the A and B samples by counting the numbers of reads that mapped to individual RefSeq genes in multiple sequencing runs to evaluate the MAQC quality metrics for reproducibility, sensitivity, specificity, and accuracy and compared the results with DNA microarrays and Quantitative RT-PCR (QRTPCR from the MAQC studies. In addition, 88% of the reads were successfully aligned directly to the human genome using the AceView alignment programs with an average 90% sequence similarity to identify 137,899 unique exon junctions, including 22,193 new exon junctions not yet contained in the RefSeq database. Conclusion Using the MAQC metrics for evaluating the performance of gene expression platforms, the ExpressSeq results for gene expression levels showed excellent reproducibility, sensitivity, and specificity that improved systematically with increasing shotgun sequencing depth, and quantitative accuracy that was comparable to DNA microarrays and QRTPCR. In addition, a careful mapping of the reads to the genome using the AceView alignment programs shed new light on the complexity of the human transcriptome including the discovery of thousands of new splice variants.

  6. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor

    International Nuclear Information System (INIS)

    Antalis, T.M.; Clark, M.A.; Barnes, T.; Lehrbach, P.R.; Devine, P.L.; Schevzov, G.; Goss, N.H.; Stephens, R.W.; Tolstoshev, P.

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A) + RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the λ P/sub L/ promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated M/sub r/ of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators

  7. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  8. Comparative analysis of protein coding sequences from human, mouse and the domesticated pig

    DEFF Research Database (Denmark)

    Jørgensen, Frank Grønlund; Hobolth, Asger; Hornshøj, Henrik

    2005-01-01

    Background: The availability of abundant sequence data from key model organisms has made large scale studies of mulecular evolution an exciting possibility. Here we use full length cDNA alignments comprising more than 700,000 nucleotides from human, mouse, pig and the Japanese pufferfish Fugu rub...... rubrices in order to investigate 1) the relationships between three major lineages of mammals: rodents, artiodactys and primates, and 2) the rate of evolution and the occurrence of positive Darwinian selection using codon based models of sequence evolution. Results: We provide evidence...

  9. cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

    Science.gov (United States)

    Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

    2013-10-15

    A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

  10. Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

    Science.gov (United States)

    Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

    2014-10-01

    Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  12. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  13. PCR-identification of a Nicotiana plumbaginifolia cDNA homologous to the high-affinity nitrate transporters of the crnA family.

    Science.gov (United States)

    Quesada, A; Krapp, A; Trueman, L J; Daniel-Vedele, F; Fernández, E; Forde, B G; Caboche, M

    1997-05-01

    A family of high-affinity nitrate transporters has been identified in Aspergillus nidulans and Chlamydomonas reinhardtii, and recently homologues of this family have been cloned from a higher plant (barley). Based on six of the peptide sequences most strongly conserved between the barley and C. reinhardtii polypeptides, a set of degenerate primers was designed to permit amplification of the corresponding genes from other plant species. The utility of these primers was demonstrated by RT-PCR with cDNA made from poly(A)+ RNA from barley, C. reinhardtii and Nicotiana plumbaginifolia. A PCR fragment amplified from N. plumbaginifolia was used as probe to isolate a full-length cDNA clone which encodes a protein, NRT2;1Np, that is closely related to the previously isolated crnA homologue from barley. Genomic Southern blots indicated that there are only 1 or 2 members of the Nrt2 gene family in N. plumbaginifolia. Northern blotting showed that the Nrt2 transcripts are most strongly expressed in roots. The effects of external treatments with different N sources showed that the regulation of the Nrt2 gene(s) is very similar to that reported for nitrate reductase and nitrite reductase genes: their expression was strongly induced by nitrate but was repressed when reduced forms of N were supplied to the roots.

  14. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  15. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

    Science.gov (United States)

    Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

    2014-01-25

    Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Cloning and sequencing of growth hormone gene of Iranian Lori Bakhtiari sheep

    Directory of Open Access Journals (Sweden)

    M Dayani-Nia

    2010-05-01

    Full Text Available Growth hormone (GH is a peptide hormone that stimulates growth and cell reproduction in humans and animals. It is a 191-amino acid, single chain polypeptide hormone which is synthesized, stored, and secreted by the somatotroph cells within the lateral wings of the anterior pituitary gland. The goal of this research was to clone and sequence sheep growth hormone of Lori Bakhtiary breed in Iran. For this purpose, RNA was extracted from the pituitary gland of freshly slaughtered sheep and cDNA of growth hormone produced. The T/A cloning technique was used to clone the cDNA of growth hormone and then the synthesized construct was transferred into E. coli as the host. Once the correct recombinants were further confirmed by colony PCR or restriction enzyme digestion, sequencing was done. The sequencing results showed that, the length of sheep growth hormone cDNA was 690 bp fragments. Comparison of sequence of growth hormone inside the synthesized construct with those recorded in Genebank (NCBI, Blast indicated high degrees of similarity between Iranian native sheep and other sheep breeds of the world.

  17. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  18. Consistent errors in first strand cDNA due to random hexamer mispriming.

    Directory of Open Access Journals (Sweden)

    Thomas P van Gurp

    Full Text Available Priming of random hexamers in cDNA synthesis is known to show sequence bias, but in addition it has been suggested recently that mismatches in random hexamer priming could be a cause of mismatches between the original RNA fragment and observed sequence reads. To explore random hexamer mispriming as a potential source of these errors, we analyzed two independently generated RNA-seq datasets of synthetic ERCC spikes for which the reference is known. First strand cDNA synthesized by random hexamer priming on RNA showed consistent position and nucleotide-specific mismatch errors in the first seven nucleotides. The mismatch errors found in both datasets are consistent in distribution and thermodynamically stable mismatches are more common. This strongly indicates that RNA-DNA mispriming of specific random hexamers causes these errors. Due to their consistency and specificity, mispriming errors can have profound implications for downstream applications if not dealt with properly.

  19. Molecular characterization of MHC-DRB cDNA in water buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Soumen Naskar

    2012-01-01

    Full Text Available In the present study, water buffalo MHC (Bubu-DRB cDNA was cloned and characterized. The 1022 base long-amplified cDNA product encompassed a single open reading frame of 801 bases that coded for 266 amino acids. The Bubu-DRB sequence showed maximum homology with the BoLA-DRB3*0101 allele of cattle. A total of seven amino acid residues were found to be unique for the Bubu-DRB sequence. The majority of amino acid substitutions was observed in the β1 domain. Residues associated with important functions were mostly conserved. Water buffalo DRB was phylogenetically closer to goat DRB*A.

  20. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  1. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  2. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  3. Fundamental length and relativistic length

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1988-01-01

    It si noted that the introduction of fundamental length contradicts the conventional representations concerning the contraction of the longitudinal size of fast-moving objects. The use of the concept of relativistic length and the following ''elongation formula'' permits one to solve this problem

  4. CDNA library from the Latex of Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Wilaiwan Chotigeat

    2010-12-01

    Full Text Available Latex from Hevea brasiliensis contains 30-50% (w/w of natural rubber (cis-1,4-polyisoprene, the important rawmaterial for many rubber industries. We have constructed a cDNA library from the latex of H. brasiliensis to investigate theexpressed genes and molecular events in the latex. We analyzed 412 expressed sequence tags (ESTs. More than 90% of theEST clones showed homology to previously described sequences in public databases. Functional classification of the ESTsshowed that the largest category were proteins of unknown function (30.1%, 11.4% of ESTs encoded for rubber synthesisrelatedproteins (RS and 8.5% for defense or stress related proteins (DS. Those with no significant homology to knownsequences (NSH accounted for 8.7%, primary metabolism (PM and gene expression and RNA metabolism were 7.8% and6.6%, respectively. Other categories included, protein synthesis-related proteins (6.6%, chromatin and DNA metabolism(CDM 3.9%, energy metabolism (EM 3.4%, cellular transport (CT 3.2%, cell structure (CS 3.2%, signal transduction (ST2.2%, secondary metabolism (SM 1.7%, protein fate (PF 2.2%, and reproductive proteins (RP 0.7%.

  5. Flame Length

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Flame length was modeled using FlamMap, an interagency fire behavior mapping and analysis program that computes potential fire behavior characteristics. The tool...

  6. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  7. Construction of cDNA libraries from Pseudocercospora fijiensis Morelet infected leaves of the cultivars Calcutta 4 and Niyarma Yik

    Directory of Open Access Journals (Sweden)

    Milady Mendoza-Rodríguez

    2004-01-01

    Full Text Available Molecular studies of plant-pathogen interaction are very important for the identification of gene (s related with the pathogenic process, as well as with the plant resistance. These gene (s could be use for the genetic improvement programs in order to obtain resistant cultivars. The aim of this work was to construct complementary DNA (cDNA libraries from infected leaves with Pseudocercospora fijiensis CCIBP-Pf1 isolated of two banana cultivars (a resistant one Calcutta4 and another one susceptible Niyarma Yik. First-strand cDNA synthesis, was made beginning with one microgram of total RNA by using oligo dT primer and cDNA quality was checked by Polimerase chain reaction (PCR with cytochrome b specific primers. Second-strand cDNA synthesis was performed by using the homopolymeric tailing with dC-BamH I + dT-Not I primer combination. Four cDNA libraries of infected plants at different times of infection with the pathogen were obtained. Forty one clones of one of the libraries of Niyarma Yik were sequenced and the obtained sequences correspond with genes related to fungi. Key words: Banana-Mycosphaerella fijiensis interaction,Black Sigatoka, Musa spp.

  8. Flavonoid Biosynthesis Genes Putatively Identified in the Aromatic Plant Polygonum minus via Expressed Sequences Tag (EST Analysis

    Directory of Open Access Journals (Sweden)

    Zamri Zainal

    2012-02-01

    Full Text Available P. minus is an aromatic plant, the leaf of which is widely used as a food additive and in the perfume industry. The leaf also accumulates secondary metabolites that act as active ingredients such as flavonoid. Due to limited genomic and transcriptomic data, the biosynthetic pathway of flavonoids is currently unclear. Identification of candidate genes involved in the flavonoid biosynthetic pathway will significantly contribute to understanding the biosynthesis of active compounds. We have constructed a standard cDNA library from P. minus leaves, and two normalized full-length enriched cDNA libraries were constructed from stem and root organs in order to create a gene resource for the biosynthesis of secondary metabolites, especially flavonoid biosynthesis. Thus, large‑scale sequencing of P. minus cDNA libraries identified 4196 expressed sequences tags (ESTs which were deposited in dbEST in the National Center of Biotechnology Information (NCBI. From the three constructed cDNA libraries, 11 ESTs encoding seven genes were mapped to the flavonoid biosynthetic pathway. Finally, three flavonoid biosynthetic pathway-related ESTs chalcone synthase, CHS (JG745304, flavonol synthase, FLS (JG705819 and leucoanthocyanidin dioxygenase, LDOX (JG745247 were selected for further examination by quantitative RT-PCR (qRT-PCR in different P. minus organs. Expression was detected in leaf, stem and root. Gene expression studies have been initiated in order to better understand the underlying physiological processes.

  9. Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

    International Nuclear Information System (INIS)

    Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

  10. Monoterpene biosynthesis in lemon (Citrus limon) cDNA isolation and functional analysis of four monoterpene synthases

    NARCIS (Netherlands)

    Lücker, J.; Tamer, El M.K.; Schwab, W.; Verstappen, F.W.A.; Plas, van der L.H.W.; Bouwmeester, H.J.; Verhoeven, H.A.

    2002-01-01

    Citrus limon possesses a high content and large variety of monoterpenoids, especially in the glands of the fruit flavedo. The genes responsible for the production of these monoterpenes have never been isolated. By applying a random sequencing approach to a cDNA library from mRNA isolated from the

  11. Cloning of the human carnitine-acylcarnitine carrier cDNA and identification of the molecular defect in a patient

    NARCIS (Netherlands)

    Huizing, M.; Iacobazzi, V.; IJlst, L.; Savelkoul, P.; Ruitenbeek, W.; van den Heuvel, L.; Indiveri, C.; Smeitink, J.; Trijbels, F.; Wanders, R.; Palmieri, F.

    1997-01-01

    The carnitine-acylcarnitine carrier (CAC) catalyzes the translocation of long-chain fatty acids across the inner mitochondrial membrane. We cloned and sequenced the human CAC cDNA, which has an open reading frame of 903 nucleotides. Northern blot studies revealed different expression levels of CAC

  12. A tobacco cDNA reveals two different transcription patterns in vegetative and reproductive organs

    Directory of Open Access Journals (Sweden)

    I. da Silva

    2002-08-01

    Full Text Available In order to identify genes expressed in the pistil that may have a role in the reproduction process, we have established an expressed sequence tags project to randomly sequence clones from a Nicotiana tabacum stigma/style cDNA library. A cDNA clone (MTL-8 showing high sequence similarity to genes encoding glycine-rich RNA-binding proteins was chosen for further characterization. Based on the extensive identity of MTL-8 to the RGP-1a sequence of N. sylvestris, a primer was defined to extend the 5' sequence of MTL-8 by RT-PCR from stigma/style RNAs. The amplification product was sequenced and it was confirmed that MTL-8 corresponds to an mRNA encoding a glycine-rich RNA-binding protein. Two transcripts of different sizes and expression patterns were identified when the MTL-8 cDNA insert was used as a probe in RNA blots. The largest is 1,100 nucleotides (nt long and markedly predominant in ovaries. The smaller transcript, with 600 nt, is ubiquitous to the vegetative and reproductive organs analyzed (roots, stems, leaves, sepals, petals, stamens, stigmas/styles and ovaries. Plants submitted to stress (wounding, virus infection and ethylene treatment presented an increased level of the 600-nt transcript in leaves, especially after tobacco necrosis virus infection. In contrast, the level of the 1,100-nt transcript seems to be unaffected by the stress conditions tested. Results of Southern blot experiments have suggested that MTL-8 is present in one or two copies in the tobacco genome. Our results suggest that the shorter transcript is related to stress while the larger one is a flower predominant and nonstress-inducible messenger.

  13. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  14. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  15. cDNA structure, genomic organization and expression patterns of ...

    African Journals Online (AJOL)

    Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...

  16. Infectious Maize rayado fino virus from cloned cDNA

    Science.gov (United States)

    Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

  17. Fundamental length

    International Nuclear Information System (INIS)

    Pradhan, T.

    1975-01-01

    The concept of fundamental length was first put forward by Heisenberg from purely dimensional reasons. From a study of the observed masses of the elementary particles known at that time, it is sumrised that this length should be of the order of magnitude 1 approximately 10 -13 cm. It was Heisenberg's belief that introduction of such a fundamental length would eliminate the divergence difficulties from relativistic quantum field theory by cutting off the high energy regions of the 'proper fields'. Since the divergence difficulties arise primarily due to infinite number of degrees of freedom, one simple remedy would be the introduction of a principle that limits these degrees of freedom by removing the effectiveness of the waves with a frequency exceeding a certain limit without destroying the relativistic invariance of the theory. The principle can be stated as follows: It is in principle impossible to invent an experiment of any kind that will permit a distintion between the positions of two particles at rest, the distance between which is below a certain limit. A more elegant way of introducing fundamental length into quantum theory is through commutation relations between two position operators. In quantum field theory such as quantum electrodynamics, it can be introduced through the commutation relation between two interpolating photon fields (vector potentials). (K.B.)

  18. Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell.

    Science.gov (United States)

    Chuang, Pan; Shoichiro, Ishizaki; Yuji, Nagashima; Jialong, Gao; Shugo, Watabe

    2018-02-01

    In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C) on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article "Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei " (Chuang et al., 2017) [1].

  19. Data on internal cDNA amplification and color changes of the proteins derived from Pacific white leg shrimp shell

    Directory of Open Access Journals (Sweden)

    Pan Chuang

    2018-02-01

    Full Text Available In this article, we report original data on the designation of the primers for full-length cDNA amplification and the internal cDNA amplification of red color-related pigment-binding protein derived from shrimp shell. Data on the color shifts of different soluble proteins under 100 °C 10 min heat treatment and the effects of heating temperatures (from 30 to 100 °C on the color changes of crude water-soluble proteins are also included in this report. For further details and experimental findings please refer to the article “Isolation and cDNA cloning of a novel red color-related pigment-binding protein derived from the shell of shrimp, Litopenaeus vannamei” (Chuang et al., 2017 [1].

  20. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  1. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  2. cDNA library Table - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available c00951-005 Description of data contents List of Bombyx mori cDNA libraries. Data file File name: kaiko_cdna_...library.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kaiko-cdna/LATEST/kaiko_cdna_library.zip File size:... 4.8 KB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/kaiko_cdna_l

  3. Novel infectious cDNA clones of hepatitis C virus genotype 3a (strain S52) and 4a (strain ED43): genetic analyses and in vivo pathogenesis studies

    DEFF Research Database (Denmark)

    Gottwein, Judith; Scheel, Troels; Callendret, Benoit

    2010-01-01

    Previously, RNA transcripts of cDNA clones of hepatitis C virus (HCV) genotypes 1a (strains H77, HCV-1, and HC-TN), 1b (HC-J4, Con1, and HCV-N), and 2a (HC-J6 and JFH1) were found to be infectious in chimpanzees. However, only JFH1 was infectious in human hepatoma Huh7 cells. We performed genetic...... analysis of HCV genotype 3a (strain S52) and 4a (strain ED43) prototype strains and generated full-length consensus cDNA clones (pS52 and pED43). Transfection of Huh7.5 cells with RNA transcripts of these clones did not yield cells expressing HCV Core. However, intrahepatic transfection of chimpanzees...... resulted in robust infection with peak HCV RNA titers of approximately 5.5 log(10) international units (IU)/ml. Genomic consensus sequences recovered from serum at the times of peak viral titers were identical to the sequences of the parental plasmids. Both chimpanzees developed acute hepatitis...

  4. 5′ Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice

    Directory of Open Access Journals (Sweden)

    Eric Waltari

    2018-03-01

    Full Text Available Using 5′ rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM, and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  5. 5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

    Science.gov (United States)

    Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

    2018-01-01

    Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

  6. Length and amino acid sequence of peptides substituted for the 5-HT3A receptor M3M4 loop may affect channel expression and desensitization.

    Directory of Open Access Journals (Sweden)

    Nicole K McKinnon

    Full Text Available 5-HT3A receptors are pentameric neurotransmitter-gated ion channels in the Cys-loop receptor family. Each subunit contains an extracellular domain, four transmembrane segments (M1, M2, M3, M4 and a 115 residue intracellular loop between M3 and M4. In contrast, the M3M4 loop in prokaryotic homologues is <15 residues. To investigate the limits of M3M4 loop length and composition on channel function we replaced the 5-HT3A M3M4 loop with two to seven alanine residues (5-HT3A-A(n = 2-7. Mutants were expressed in Xenopus laevis oocytes and characterized using two electrode voltage clamp recording. All mutants were functional. The 5-HT EC(50's were at most 5-fold greater than wild-type (WT. The desensitization rate differed significantly among the mutants. Desensitization rates for 5-HT3A-A(2, 5-HT3A-A(4, 5-HT3A-A(6, and 5-HT3A-A(7 were similar to WT. In contrast, 5-HT3A-A(3 and 5-HT3A-A(5 had desensitization rates at least an order of magnitude faster than WT. The one Ala loop construct, 5-HT3A-A(1, entered a non-functional state from which it did not recover after the first 5-HT application. These results suggest that the large M3M4 loop of eukaryotic Cys-loop channels is not required for receptor assembly or function. However, loop length and amino acid composition can effect channel expression and desensitization. We infer that the cytoplasmic ends of the M3 and M4 segments may undergo conformational changes during channel gating and desensitization and/or the loop may influence the position and mobility of these segments as they undergo gating-induced conformational changes. Altering structure or conformational mobility of the cytoplasmic ends of M3 and M4 may be the basis by which phosphorylation or protein binding to the cytoplasmic loop alters channel function.

  7. Use of homologous recombination in yeast to create chimeric bovine viral diarrhea virus cDNA clones

    Directory of Open Access Journals (Sweden)

    Sandra Arenhart

    Full Text Available Abstract The open reading frame of a Brazilian bovine viral diarrhea virus (BVDV strain, IBSP4ncp, was recombined with the untranslated regions of the reference NADL strain by homologous recombination in Saccharomyces cerevisiae, resulting in chimeric full-length cDNA clones of BVDV (chi-NADL/IBSP4ncp#2 and chi-NADL/IBSP4ncp#3. The recombinant clones were successfully recovered, resulting in viable viruses, having the kinetics of replication, focus size, and morphology similar to those of the parental virus, IBSP4ncp. In addition, the chimeric viruses remained stable for at least 10 passages in cell culture, maintaining their replication efficiency unaltered. Nucleotide sequencing revealed a few point mutations; nevertheless, the phenotype of the rescued viruses was nearly identical to that of the parental virus in all experiments. Thus, genetic stability of the chimeric clones and their phenotypic similarity to the parental virus confirm the ability of the yeast-based homologous recombination to maintain characteristics of the parental virus from which the recombinant viruses were derived. The data also support possible use of the yeast system for the manipulation of the BVDV genome.

  8. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  9. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  10. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    Science.gov (United States)

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  11. A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

    Science.gov (United States)

    Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

    2011-11-25

    Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

  12. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  13. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  14. RNA substrate length as an indicator of exosome interactions in vivo [version 2; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Clémentine Delan-Forino

    2017-07-01

    Full Text Available Background: The exosome complex plays key roles in RNA processing and degradation in Eukaryotes and Archaea. Outstanding structural studies identified multiple pathways for RNA substrates into the exosome in vitro, but identifying the pathway followed by individual RNA species in vivo remains challenging. Methods: We attempted to address this question using RNase protection. In vivo RNA-protein crosslinking (CRAC was applied to the exosome component Rrp44/Dis3, which has both endonuclease and exonuclease activity. During CRAC, the exosome was purified under native conditions and subjected to RNase digestion, prior to protein denaturation and cDNA cloning. The resulting high-throughput sequence reads were stratified by length of the cDNA sequence. This should reflect RNA fragment lengths, and therefore the RNA region that was protected by exosome binding. We anticipated major read lengths of ~30nt and ~10nt, reflecting the “central channel” and “direct access” routes to the Rrp44 exonuclease active site observed in vitro. Results: Unexpectedly, no clear peak was observed at 30nt, whereas a broad peak was seen around 20nt. The expected ~10nt peak was seen, and showed strong elevation in strains lacking exonuclease activity. Unexpectedly, this peak was suppressed by point mutations in the Rrp44 endonuclease active site. This indicates that the short fragments are degraded by the exonuclease activity of Rrp44, but also suggests that at least some may be generated by endonuclease activity. Conclusions: The absence of 30nt protected fragments may reflect obligatory binding of cofactors at the entrance to the exosome central channel in vivo. The presence of ~20nt fragments apparently indicates an access route not yet reported from in vitro studies. Confident mapping of 10nt reads is challenging, but they are clearly derived from a subset of exosome targets. In particular, pre-rRNA species, which are major exosome targets, are strongly

  15. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    International Nuclear Information System (INIS)

    Chen, J.; Varner, J.E.

    1985-01-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

  16. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  17. cDNA cloning and expression analysis of two distinct Sox8 genes in Paramisgurnus dabryanus (Cypriniformes).

    Science.gov (United States)

    Xia, Xiaohua; Zhao, Jie; Du, Qiyan; Chang, Zhongjie

    2010-08-01

    The Sox9 gene attracts a lot of attention because of its connection with gonadal development and differentiation. However, Sox8, belonging to the same subgroup SoxE, has rarely been studied. To investigate the function as well as the evolutionary origin of SOXE subgroup, we amplified the genomic DNA of Paramisgurnus dabryanu using a pair of degenerate primers. Using rapid amplification of the cDNA ends (RACE), it was discovered that P. dabryanu has two duplicates: Sox8a and Sox8b. Each has an intron of different length in the conserved HMG-box region. The overall sequence similarity of the deduced amino acid of PdSox8a and PdSox8b was 46.26%, and only two amino acids changed in the HMG-box. This is the first evidence showing that there are two distinct duplications of Sox8 genes in Cypriniformes. Southern blot analysis showed only one hybrid band, with lengths 7.4 or 9.2 kb. Both semi-quantitative RT-PCR and real-time quantitative PCR assay displayed that both PdSox8a and PdSox8b are downregulated during early embryonic development. In adult tissues, the two Sox8 genes expressed ubiquitously, and expression levels are particularly high in the gonads and brain. In gonads, both PdSox8a and PdSox8b are expressed at a higher level in the tesis than in the ovary. PdSox8a and PdSox8b may have functional overlaps and are essential for the neuronal development and differentiation of gonads.

  18. cDNA cloning of porcine brain prolyl endopeptidase and identification of the active-site seryl residue

    Energy Technology Data Exchange (ETDEWEB)

    Rennex, D.; Hemmings, B.A.; Hofsteenge, J.; Stone, S.R. (Friedrich Miescher-Institut, Basel (Switzerland))

    1991-02-26

    Prolyl endopeptidase is a cytoplasmic serine protease. The enzyme was purified from porcine kidney, and oligonucleotides based on peptide sequences from this protein were used to isolate a cDNA clone from a porcine brain library. This clone contained the complete coding sequence of prolyl endopeptidase and encoded a polypeptide with a molecular mass of 80751 Da. The deduced amino acid sequence of prolyl endopeptidase showed no sequence homology with other known serine proteases. ({sup 3}H)Diisopropyl fluorophosphate was used to identify the active-site serine of prolyl endopeptidase. One labeled peptide was isolated and sequenced. The sequence surrounding the active-site serine was Asn-Gly-Gly-Ser-Asn-Gly-Gly. This sequence is different from the active-site sequences of other known serine proteases. This difference and the lack of overall homology with the known families of serine proteases suggest that prolyl endopeptidase represents a new type of serine protease.

  19. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  20. analysis of a normalized full-length cDNA library from the pinewood

    African Journals Online (AJOL)

    SAM

    2014-08-13

    Aug 13, 2014 ... With a disulfide as acceptor. 3 ... Acting on paired donors, with incorporation or reduction of molecular oxygen. 4 ... Acting on peptide bonds (peptidases). 12 ... Acting on carbon-nitrogen bonds, other than peptide bonds. 3.

  1. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  2. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  3. Telomerase activity and telomere length in the colorectal polyp-carcinoma sequence Actividad de la telomerasa y longitud del telómero en la secuencia pólipo-carcinoma colorrectal

    Directory of Open Access Journals (Sweden)

    C. Valls Bautista

    2009-03-01

    Full Text Available Objective: the role of telomerase activity and telomere length in the adenoma-carcinoma sequence of colon carcinogenesis has not been well established. The objective of this study was to determine telomerase activity and telomere length patterns in patients with adenomatous polyps either associated or not with colorectal cancer, as well as the role of telomeric instability in the adenoma-carcinoma sequence. Patients and methods: we included in the study 14 patients who underwent surgery for colorectal cancer and/or polyps. In 6 of these patients fresh samples of tumor tissue, polyps, and normal mucosa were obtained; in the 8 remaining cases, we collected only polyps and normal mucosa. We used the fluorescent-telomeric repeat amplification protocol assay (TRAP-F to determine telomerase activity and telomere length using Southern-blot testing. Results: telomerase activity was detected in 86% of polyps and 50% of associated normal mucosa. Mean telomerase activity in polyp tissue was 5.85; in the normal mucosa it was 0.58 TPG. Mean telomere length was 6.78 Kbp and 7.78, respectively. Polyps in patients without synchronous cancer had a telomerase activity that was significantly higher (9.4 than in those with cancer (1.1. Conclusions: telomerase activity increases in the colorectal adenoma-carcinoma sequence, concurrently with a decrease in telomere length. The presence of synchronous cancer modifies telomerase activity in polyps.Objetivo: el papel de la actividad de la telomerasa y la longitud del telómero en la secuencia adenoma-carcinoma de la carcinogénesis colónica no ha sido bien establecido. El objetivo fue determinar el comportamiento de la actividad de la telomerasa y la longitud del telómero en pacientes con pólipos adenomatosos asociados o no a cáncer colorrectal y conocer el papel de la inestabilidad telomérica en la secuencia adenoma-carcinoma. Pacientes y métodos: se estudiaron 14 pacientes intervenidos de cáncer colorrectal y

  4. Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

    Directory of Open Access Journals (Sweden)

    Yang Jie

    2017-01-01

    Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

  5. Cloning of the cDNA for murine von Willebrand factor and identification of orthologous genes reveals the extent of conservation among diverse species.

    Science.gov (United States)

    Chitta, Mohan S; Duhé, Roy J; Kermode, John C

    2007-05-01

    Interaction of von Willebrand factor (VWF) with circulating platelets promotes hemostasis when a blood vessel is injured. The A1 domain of VWF is responsible for the initial interaction with platelets and is well conserved among species. Knowledge of the cDNA and genomic DNA sequences for human VWF allowed us to predict the cDNA sequence for murine VWF in silico and amplify its entire coding region by RT-PCR. The murine VWF cDNA has an open reading frame of 8,442 bp, encoding a protein of 2,813 amino acid residues with 83% identity to human pre-pro-VWF. The same strategy was used to predict in silico the cDNA sequence for the ortholog of VWF in a further six species. Many of these predictions diverged substantially from the putative Reference Sequences derived by ab initio methods. Our predicted sequences indicated that the VWF gene has a conserved structure of 52 exons in all seven mammalian species examined, as well as in the chicken. There is a minor structural variation in the pufferfish Takifugu rubripes insofar as the VWF gene in this species has 53 exons. Comparison of the translated amino acid sequences also revealed a high degree of conservation. In particular, the cysteine residues are conserved precisely throughout both the pro-peptide and the mature VWF sequence in all species, with a minor exception in the pufferfish VWF ortholog where two adjacent cysteine residues are omitted. The marked conservation of cysteine residues emphasizes the importance of the intricate pattern of disulfide bonds in governing the structure of pro-VWF and regulating the function of the mature VWF protein. It should also be emphasized that many of the conserved features of the VWF gene and protein were obscured when the comparison among species was based on the putative Reference Sequences instead of our predicted cDNA sequences.

  6. MultiLocus Sequence Analysis- and Amplified Fragment Length Polymorphism-based characterization of xanthomonads associated with bacterial spot of tomato and pepper and their relatedness to Xanthomonas species.

    Science.gov (United States)

    Hamza, A A; Robene-Soustrade, I; Jouen, E; Lefeuvre, P; Chiroleu, F; Fisher-Le Saux, M; Gagnevin, L; Pruvost, O

    2012-05-01

    MultiLocus Sequence Analysis (MLSA) and Amplified Fragment Length Polymorphism (AFLP) were used to measure the genetic relatedness of a comprehensive collection of xanthomonads pathogenic to solaneous hosts to Xanthomonas species. The MLSA scheme was based on partial sequences of four housekeeping genes (atpD, dnaK, efp and gyrB). Globally, MLSA data unambiguously identified strains causing bacterial spot of tomato and pepper at the species level and was consistent with AFLP data. Genetic distances derived from both techniques showed a close relatedness of (i) X. euvesicatoria, X. perforans and X. alfalfae and (ii) X. gardneri and X. cynarae. Maximum likelihood tree topologies derived from each gene portion and the concatenated data set for species in the X. campestris 16S rRNA core (i.e. the species cluster comprising all strains causing bacterial spot of tomato and pepper) were not congruent, consistent with the detection of several putative recombination events in our data sets by several recombination search algorithms. One recombinant region in atpD was identified in most strains of X. euvesicatoria including the type strain. Copyright © 2012 Elsevier GmbH. All rights reserved.

  7. Efficient replication of the in vitro transcripts from cloned cDNA of tomato black ring virus satellite RNA requires the 48K satellite RNA-encoded protein.

    Science.gov (United States)

    Hemmer, O; Oncino, C; Fritsch, C

    1993-06-01

    Tomato black ring virus isolate L supports the multiplication of a large satellite RNA of 1376 nt which has no common features with the two genomic RNAs except for the terminal motif 5' VPg UUGAAAA and a 3' poly(A) tail. The TBRV sat-RNA contains an ORF for a protein of 48K which is translated both in vitro and in vivo. To determine the function of the 48K protein we have studied the effect of different mutations introduced in the ORF of the cDNA clone on the capacity of transcripts to multiply in Chenopodium quinoa plants or protoplasts when inoculated along with the genomic RNAs. Transcripts in which nucleotides have been substituted within the 5' proximal region of the ORF multiplied poorly even when the modification conserved the 48K protein sequence, suggesting that this portion of the ORF contains cis-acting RNA sequences. Transcripts with alterations in the internal region of the ORF retained their multiplication capacity provided the mutation did not destroy the ORF or modify the length of the protein expressed. The absence of multiplication in plants of transcripts unable to express the 48K protein and their inability to replicate in protoplasts suggest strongly that the sat-RNA translation product itself is implicated in the replication of sat-RNA.

  8. Simple, Low-Cost Detection of Candida parapsilosis Complex Isolates and Molecular Fingerprinting of Candida orthopsilosis Strains in Kuwait by ITS Region Sequencing and Amplified Fragment Length Polymorphism Analysis.

    Science.gov (United States)

    Asadzadeh, Mohammad; Ahmad, Suhail; Hagen, Ferry; Meis, Jacques F; Al-Sweih, Noura; Khan, Ziauddin

    2015-01-01

    Candida parapsilosis has now emerged as the second or third most important cause of healthcare-associated Candida infections. Molecular studies have shown that phenotypically identified C. parapsilosis isolates represent a complex of three species, namely, C. parapsilosis, C. orthopsilosis and C. metapsilosis. Lodderomyces elongisporus is another species phenotypically closely related to the C. parapsilosis-complex. The aim of this study was to develop a simple, low cost multiplex (m) PCR assay for species-specific identification of C. parapsilosis complex isolates and to study genetic relatedness of C. orthopsilosis isolates in Kuwait. Species-specific amplicons from C. parapsilosis (171 bp), C. orthopsilosis (109 bp), C. metapsilosis (217 bp) and L. elongisporus (258 bp) were obtained in mPCR. Clinical isolates identified as C. parapsilosis (n = 380) by Vitek2 in Kuwait and an international collection of 27 C. parapsilosis complex and L. elongisporus isolates previously characterized by rDNA sequencing were analyzed to evaluate mPCR. Species-specific PCR and DNA sequencing of internal transcribed spacer (ITS) region of rDNA were performed to validate the results of mPCR. Fingerprinting of 19 clinical C. orthopsilosis isolates (including 4 isolates from a previous study) was performed by amplified fragment length polymorphism (AFLP) analysis. Phenotypically identified C. parapsilosis isolates (n = 380) were identified as C. parapsilosis sensu stricto (n = 361), C. orthopsilosis (n = 15), C. metapsilosis (n = 1) and L. elongisporus (n = 3) by mPCR. The mPCR also accurately detected all epidemiologically unrelated C. parapsilosis complex and L. elongisporus isolates. The 19 C. orthopsilosis isolates obtained from 16 patients were divided into 3 haplotypes based on ITS region sequence data. Seven distinct genotypes were identified among the 19 C. orthopsilosis isolates by AFLP including a dominant genotype (AFLP1) comprising 11 isolates recovered from 10 patients. A

  9. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    International Nuclear Information System (INIS)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

  10. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome

    Science.gov (United States)

    Camargo, Anamaria A.; Samaia, Helena P. B.; Dias-Neto, Emmanuel; Simão, Daniel F.; Migotto, Italo A.; Briones, Marcelo R. S.; Costa, Fernando F.; Aparecida Nagai, Maria; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; Sonati, Maria de Fátima; Tajara, Eloiza H.; Valentini, Sandro R.; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Arnaldi, Liliane A. T.; de Assis, Angela M.; Bengtson, Mário Henrique; Bergamo, Nadia Aparecida; Bombonato, Vanessa; de Camargo, Maria E. R.; Canevari, Renata A.; Carraro, Dirce M.; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Corrêa, Rosana F. R.; Costa, Maria Cristina R.; Curcio, Cyntia; Hokama, Paula O. M.; Ferreira, Ari J. S.; Furuzawa, Gilberto K.; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Krieger, José E.; Leite, Luciana C. C.; Majumder, Paromita; Marins, Mozart; Marques, Everaldo R.; Melo, Analy S. A.; Melo, Monica; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana G.; Prevedel, Aline C.; Rahal, Paula; Rainho, Claudia A.; Reis, Eduardo M. R.; Ribeiro, Marcelo L.; da Rós, Nancy; de Sá, Renata G.; Sales, Magaly M.; Sant'anna, Simone Cristina; dos Santos, Mariana L.; da Silva, Aline M.; da Silva, Neusa P.; Silva, Wilson A.; da Silveira, Rosana A.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Soares, Fernando; Moreira, Eloisa S.; Nunes, Diana N.; Correa, Ricardo G.; Zalcberg, Heloisa; Carvalho, Alex F.; Reis, Luis F. L.; Brentani, Ricardo R.; Simpson, Andrew J. G.; de Souza, Sandro J.

    2001-01-01

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription–PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning. PMID:11593022

  11. The contribution of 700,000 ORF sequence tags to the definition of the human transcriptome.

    Science.gov (United States)

    Camargo, A A; Samaia, H P; Dias-Neto, E; Simão, D F; Migotto, I A; Briones, M R; Costa, F F; Nagai, M A; Verjovski-Almeida, S; Zago, M A; Andrade, L E; Carrer, H; El-Dorry, H F; Espreafico, E M; Habr-Gama, A; Giannella-Neto, D; Goldman, G H; Gruber, A; Hackel, C; Kimura, E T; Maciel, R M; Marie, S K; Martins, E A; Nobrega, M P; Paco-Larson, M L; Pardini, M I; Pereira, G G; Pesquero, J B; Rodrigues, V; Rogatto, S R; da Silva, I D; Sogayar, M C; Sonati, M F; Tajara, E H; Valentini, S R; Alberto, F L; Amaral, M E; Aneas, I; Arnaldi, L A; de Assis, A M; Bengtson, M H; Bergamo, N A; Bombonato, V; de Camargo, M E; Canevari, R A; Carraro, D M; Cerutti, J M; Correa, M L; Correa, R F; Costa, M C; Curcio, C; Hokama, P O; Ferreira, A J; Furuzawa, G K; Gushiken, T; Ho, P L; Kimura, E; Krieger, J E; Leite, L C; Majumder, P; Marins, M; Marques, E R; Melo, A S; Melo, M B; Mestriner, C A; Miracca, E C; Miranda, D C; Nascimento, A L; Nobrega, F G; Ojopi, E P; Pandolfi, J R; Pessoa, L G; Prevedel, A C; Rahal, P; Rainho, C A; Reis, E M; Ribeiro, M L; da Ros, N; de Sa, R G; Sales, M M; Sant'anna, S C; dos Santos, M L; da Silva, A M; da Silva, N P; Silva, W A; da Silveira, R A; Sousa, J F; Stecconi, D; Tsukumo, F; Valente, V; Soares, F; Moreira, E S; Nunes, D N; Correa, R G; Zalcberg, H; Carvalho, A F; Reis, L F; Brentani, R R; Simpson, A J; de Souza, S J; Melo, M

    2001-10-09

    Open reading frame expressed sequences tags (ORESTES) differ from conventional ESTs by providing sequence data from the central protein coding portion of transcripts. We generated a total of 696,745 ORESTES sequences from 24 human tissues and used a subset of the data that correspond to a set of 15,095 full-length mRNAs as a means of assessing the efficiency of the strategy and its potential contribution to the definition of the human transcriptome. We estimate that ORESTES sampled over 80% of all highly and moderately expressed, and between 40% and 50% of rarely expressed, human genes. In our most thoroughly sequenced tissue, the breast, the 130,000 ORESTES generated are derived from transcripts from an estimated 70% of all genes expressed in that tissue, with an equally efficient representation of both highly and poorly expressed genes. In this respect, we find that the capacity of the ORESTES strategy both for gene discovery and shotgun transcript sequence generation significantly exceeds that of conventional ESTs. The distribution of ORESTES is such that many human transcripts are now represented by a scaffold of partial sequences distributed along the length of each gene product. The experimental joining of the scaffold components, by reverse transcription-PCR, represents a direct route to transcript finishing that may represent a useful alternative to full-length cDNA cloning.

  12. RESEARCH ARTICLE Full length sequencing and novel ...

    Indian Academy of Sciences (India)

    Navya

    2016-12-16

    Dec 16, 2016 ... TOLONE, ANNA MARIA SUTERA, MARIA TERESA SARDINA, BALDASSARE ... finding of novel SNPs that might be important in future studies and laid the .... power, precision and quality to assess the relationship between ...

  13. cDNA table - RPD | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available of data contents Results of homology search to cDNA clones in the KOME. Data file File name: rpd_cdna.zip F...ile URL: ftp://ftp.biosciencedbc.jp/archive/rpd/LATEST/rpd_cdna.zip File size: 15 KB Simple search URL http:...//togodb.biosciencedbc.jp/togodb/view/rpd_cdna#en Data acquisition method - Data

  14. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    Science.gov (United States)

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    Science.gov (United States)

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  16. Construction of Agrobacterium tumefaciens-mediated tomato black ring virus infectious cDNA clones.

    Science.gov (United States)

    Zarzyńska-Nowak, Aleksandra; Ferriol, Inmaculada; Falk, Bryce W; Borodynko-Filas, Natasza; Hasiów-Jaroszewska, Beata

    2017-02-15

    Tomato black ring virus (TBRV, genus Nepovirus) infects a wide range of economically important plants such as tomato, potato, tobacco and cucumber. Here, a successful construction of infectious full-length cDNA clones of the TBRV genomic RNAs (RNA1 and RNA2) is reported for the first time. The engineered constructs consisting of PCR-amplified DNAs were cloned into binary vector pJL89 immediately downstream of a double cauliflower mosaic virus (CaMV) 35S promoter, and upstream of the hepatitis delta virus (HDV) ribozyme and nopaline synthase terminator (NOS). The symptoms induced on plants agroinoculated with both constructs were indistinguishable from those caused by the wild-type virus. The infectivity of obtained clones was verified by reinoculation to Nicotiana tabacum cv. Xanthi, Chenopodium quinoa and Cucumis sativus. The presence of viral particles and RNA was confirmed by electron microscopy and reverse transcription polymerase chain reaction, respectively. Constructed full-length infectious cDNA clones will serve as an excellent tool to study virus-host-vector interactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  18. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  19. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  20. cDNA microarray screening in food safety

    International Nuclear Information System (INIS)

    Roy, Sashwati; Sen, Chandan K.

    2006-01-01

    The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    International Nuclear Information System (INIS)

    Safford, R.; de Silva, J.; Lucas, C.

    1987-01-01

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  2. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  3. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    International Nuclear Information System (INIS)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki; Ohashi, Yuko; Kano-Murakami, Yuriko; Ozeki, Yoshihiro

    1989-01-01

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M r of its subunit was 77,000. The cells converted [ 14 C]-L-phenylalanine into [ 14 C]-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading frame capable of coding for a polypeptide with 707 amino acids (M r 77,137), a 22-bp 5'-noncoding region and a 207-bp 3'-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology

  4. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  5. MOLECULAR CHARACTERIZATION OF ENDOCRINE DISRUPTION IN FISH USING CDNA ARRAYS.

    Science.gov (United States)

    We are developing cDNA macroarrays to measure the induction of gene expression in sheepshead minnows and largemouth bass exposed to anthropogenic chemicals that can mimic the action of endogenous hormones. For sheepshead minnows exposed in aqua, we observed similar genetic profil...

  6. A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

    Science.gov (United States)

    A Bioinformatic Strategy to Rapidly Characterize cDNA LibrariesG. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

  7. NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

    Science.gov (United States)

    Normal Nasal Gene Expression Levels Using cDNA Array Technology. The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

  8. Full-length Dysferlin Transfer by the Hyperactive Sleeping Beauty Transposase Restores Dysferlin-deficient Muscle

    Directory of Open Access Journals (Sweden)

    Helena Escobar

    2016-01-01

    Full Text Available Dysferlin-deficient muscular dystrophy is a progressive disease characterized by muscle weakness and wasting for which there is no treatment. It is caused by mutations in DYSF, a large, multiexonic gene that forms a coding sequence of 6.2 kb. Sleeping Beauty (SB transposon is a nonviral gene transfer vector, already used in clinical trials. The hyperactive SB system consists of a transposon DNA sequence and a transposase protein, SB100X, that can integrate DNA over 10 kb into the target genome. We constructed an SB transposon-based vector to deliver full-length human DYSF cDNA into dysferlin-deficient H2K A/J myoblasts. We demonstrate proper dysferlin expression as well as highly efficient engraftment (>1,100 donor-derived fibers of the engineered myoblasts in the skeletal muscle of dysferlin- and immunodeficient B6. Cg-Dysfprmd Prkdcscid/J (Scid/BLA/J mice. Nonviral gene delivery of full-length human dysferlin into muscle cells, along with a successful and efficient transplantation into skeletal muscle are important advances towards successful gene therapy of dysferlin-deficient muscular dystrophy.

  9. Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Baozhong, E-mail: bmeng@uoguelph.ca [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Venkataraman, Srividhya; Li, Caihong; Wang, Weizhou [Department of Molecular and Cellular Biology, University of Guelph, 50 Stone Road, Guelph, Ontario, Canada N1G2W1 (Canada); Dayan-Glick, Cathy; Mawassi, Munir [The Plant Pathology Department-The Virology Unit, Plant Protection Institute, Agricultural Research Organization, The Volcani Center, Bet-Dagan 50250 (Israel)

    2013-01-20

    Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does not cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.

  10. Cloning of zebrafish activin type IIB receptor (ActRIIB) cDNA and mRNA expression of ActRIIB in embryos and adult tissues.

    Science.gov (United States)

    Garg, R R; Bally-Cuif, L; Lee, S E; Gong, Z; Ni, X; Hew, C L; Peng, C

    1999-07-20

    A full-length cDNA encoding for activin type IIB receptor (ActRIIB) was cloned from zebrafish embryos. It encodes a protein with 509 amino acids consisting of a signal peptide, an extracellular ligand binding domain, a single transmembrane region, and an intracellular kinase domain with predicted serine/threonine specificity. The extracellular domain shows 74-91% sequence identity to human, bovine, mouse, rat, chicken, Xenopus and goldfish activin type IIB receptors, while the transmembrane region and the kinase domain show 67-78% and 82-88% identity to these known activin IIB receptors, respectively. In adult zebrafish, ActRIIB mRNA was detected by RT-PCR in the gonads, as well as in non-reproductive tissues, including the brain, heart and muscle. In situ hybridization on ovarian sections further localized ActRIIB mRNA to cytoplasm of oocytes at different stages of development. Using whole-mount in situ hybridization, ActRIIB mRNA was found to be expressed at all stages of embryogenesis examined, including the sphere, shield, tail bud, and 6-7 somite. These results provide the first evidence that ActRIIB mRNA is widely distributed in fish embryonic and adult tissues. Cloning of zebrafish ActRIIB demonstrates that this receptor is highly conserved during vertebrate evolution and provides a basis for further studies on the role of activin in reproduction and development in lower vertebrates.

  11. Human cDNA clones for an α subunit of G/sub i/ signal-transduction protein

    International Nuclear Information System (INIS)

    Bray, P.; Carter, A.; Guo, V.; Puckett, C.; Kamholz, J.; Spiegel, A.; Nirenberg, M.

    1987-01-01

    Two cDNA clones were obtained from a λgt11 cDNA human brain library that correspond to α/sub i/ subunits of G signal-transduction proteins (where α/sub i/ subunits refer to the α subunits of G proteins that inhibit adenylate cyclase). The nucleotide sequence of human brain α/sub i/ is highly homologous to that of bovine brain α/sub i/ and the predicted amino acid sequences are identical. However, human and bovine brain α/sub i/ cDNAs differ significantly from α/sub i/ cDNAs from human monocytes, rat glioma, and mouse macrophages in amino acid (88% homology) and nucleotide (71-75% homology) sequences. In addition, the nucleotide sequences of the 3' untranslated regions of human and bovine brain α/sub i/ cDNAs differ markedly from the sequences of human monocyte, rat glioma, and mouse macrophage α/sub i/ cDNAs. These results suggest there are at least two classes of α/sub i/ mRNA

  12. Transmembrane-sequence-dependent overexpression and secretion of glycoproteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Schuster, M; Wasserbauer, E; Aversa, G; Jungbauer, A

    2001-02-01

    Protein expression using the secretory pathway in Saccharomyces cerevisiae can lead to high amounts of overexpressed and secreted proteins in culture supernatants in a short period of time. These post-translational modified expression products can be purified up to >90% in a single step. The overexpression and secretion of the transmembrane glycoprotein signaling lymphocytic activation molecule (SLAM) was studied. SLAM belongs to the immunoglobulin superfamily and its engagement results in T-cell expansion and INF-gamma production. The molecule is composed of an extracellular, a single-span transmembrane and a cytoplasmatic domain. The extracellular part may be relevant for stimulation studies in vitro since SLAM is a high-affinity self-ligand. Therefore several fragments of this region have been expressed as Flag-fusions in S. cerevisiae: a full-length fragment containing the transmembrane region and the autologous signal sequence, another without the transmembrane region, and two fragments without the autologous signal sequence with and without the transmembrane region. By molecular cloning, the different deletion mutants of the cDNA encoding the full-length construct have been inserted in a yeast episomal plasmid. Upstream of the cDNA, the alpha-leader sequence of a yeast mating pheromone has been cloned to direct the fusion proteins into the secretory protein maturation pathway. All four fragments were expressed but yield, location, and maturation were highly influenced by the transmembrane domain and the autologous signal sequence. Only the fragment without autologous signal sequence and transmembrane domain could be efficiently secreted. High-mannose glycosylation was analyzed by lectin mapping and digestion with specific glycosidases. After enzyme treatment, a single band product with the theoretical size could be detected and identified as SLAM by a specific monoclonal antibody. The fusion protein concentration in the supernatant was 30 microg/ml. The

  13. Mapping RNA Structure In Vitro with SHAPE Chemistry and Next-Generation Sequencing (SHAPE-Seq).

    Science.gov (United States)

    Watters, Kyle E; Lucks, Julius B

    2016-01-01

    Mapping RNA structure with selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistry has proven to be a versatile method for characterizing RNA structure in a variety of contexts. SHAPE reagents covalently modify RNAs in a structure-dependent manner to create adducts at the 2'-OH group of the ribose backbone at nucleotides that are structurally flexible. The positions of these adducts are detected using reverse transcriptase (RT) primer extension, which stops one nucleotide before the modification, to create a pool of cDNAs whose lengths reflect the location of SHAPE modification. Quantification of the cDNA pools is used to estimate the "reactivity" of each nucleotide in an RNA molecule to the SHAPE reagent. High reactivities indicate nucleotides that are structurally flexible, while low reactivities indicate nucleotides that are inflexible. These SHAPE reactivities can then be used to infer RNA structures by restraining RNA structure prediction algorithms. Here, we provide a state-of-the-art protocol describing how to perform in vitro RNA structure probing with SHAPE chemistry using next-generation sequencing to quantify cDNA pools and estimate reactivities (SHAPE-Seq). The use of next-generation sequencing allows for higher throughput, more consistent data analysis, and multiplexing capabilities. The technique described herein, SHAPE-Seq v2.0, uses a universal reverse transcription priming site that is ligated to the RNA after SHAPE modification. The introduced priming site allows for the structural analysis of an RNA independent of its sequence.

  14. Simultaneous identification of long similar substrings in large sets of sequences

    Directory of Open Access Journals (Sweden)

    Wittig Burghardt

    2007-05-01

    Full Text Available Abstract Background Sequence comparison faces new challenges today, with many complete genomes and large libraries of transcripts known. Gene annotation pipelines match these sequences in order to identify genes and their alternative splice forms. However, the software currently available cannot simultaneously compare sets of sequences as large as necessary especially if errors must be considered. Results We therefore present a new algorithm for the identification of almost perfectly matching substrings in very large sets of sequences. Its implementation, called ClustDB, is considerably faster and can handle 16 times more data than VMATCH, the most memory efficient exact program known today. ClustDB simultaneously generates large sets of exactly matching substrings of a given minimum length as seeds for a novel method of match extension with errors. It generates alignments of maximum length with a considered maximum number of errors within each overlapping window of a given size. Such alignments are not optimal in the usual sense but faster to calculate and often more appropriate than traditional alignments for genomic sequence comparisons, EST and full-length cDNA matching, and genomic sequence assembly. The method is used to check the overlaps and to reveal possible assembly errors for 1377 Medicago truncatula BAC-size sequences published at http://www.medicago.org/genome/assembly_table.php?chr=1. Conclusion The program ClustDB proves that window alignment is an efficient way to find long sequence sections of homogenous alignment quality, as expected in case of random errors, and to detect systematic errors resulting from sequence contaminations. Such inserts are systematically overlooked in long alignments controlled by only tuning penalties for mismatches and gaps. ClustDB is freely available for academic use.

  15. Complete coding sequence of the human raf oncogene and the corresponding structure of the c-raf-1 gene

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, T I; Oppermann, H; Seeburg, P; Kerby, S B; Gunnell, M A; Young, A C; Rapp, U R

    1986-01-24

    The complete 648 amino acid sequence of the human raf oncogene was deduced from the 2977 nucleotide sequence of a fetal liver cDNA. The cDNA has been used to obtain clones which extend the human c-raf-1 locus by an additional 18.9 kb at the 5' end and contain all the remaining coding exons.

  16. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  17. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: Evidence for more than one receptor class

    International Nuclear Information System (INIS)

    Gronwald, R.G.K.; Grant, F.J.; Haldeman, B.A.; Hart, C.E.; O'Hara, P.J.; Hagen, F.S.; Ross, R.; Bowen-Pope, D.F.; Murray, M.J.

    1988-01-01

    The complete nucleotide sequence of a cDNA encoding the human platelet-derived growth factor (PDGF) receptor is presented. The cDNA contains an open reading frame that codes for a protein of 1106 amino acids. Comparison to the mouse PDGF receptor reveals an overall amino acid sequence identity of 86%. This sequence identity rises to 98% in the cytoplasmic split tyrosine kinase domain. RNA blot hybridization analysis of poly(A) + RNA from human dermal fibroblasts detects a major and a minor transcript using the cDNA as a probe. Baby hamster kidney cells, transfected with an expression vector containing the receptor cDNA, express an ∼ 190-kDa cell surface protein that is recognized by an anti-human PDGF receptor antibody. The recombinant PDGF receptor is functional in the transfected baby hamster kidney cells as demonstrated by ligand-induced phosphorylation of the receptor. Binding properties of the recombinant PDGF receptor were also assessed with pure preparations of BB and AB isoforms of PDGF. Unlike human dermal fibroblasts, which bind both isoforms with high affinity, the transfected baby hamster kidney cells bind only the BB isoform of PDGF with high affinity. This observation is consistent with the existence of more than one PDGF receptor class

  18. cDNA and deduced primary structure of basic phospholipase A2 with neurotoxic activity from the venom secretion of the Crotalus durissus collilineatus rattlesnake

    Directory of Open Access Journals (Sweden)

    F.H.R. Fagundes

    2010-03-01

    Full Text Available To illustrate the construction of precursor complementary DNAs, we isolated mRNAs from whole venom samples. After reverse transcription polymerase chain reaction (RT-PCR, we amplified the cDNA coding for a neurotoxic protein, phospholipase A2 D49 (PLA2 D49, from the venom of Crotalus durissus collilineatus (Cdc PLA2. The cDNA encoding Cdc PLA2 from whole venom was sequenced. The deduced amino acid sequence of this cDNA has high overall sequence identity with the group II PLA2 protein family. Cdc PLA2 has 14 cysteine residues capable of forming seven disulfide bonds that characterize this group of PLA2 enzymes. Cdc PLA2 was isolated using conventional Sephadex G75 column chromatography and reverse-phase high performance liquid chromatography (RP-HPLC. The molecular mass was estimated using matrix-assisted laser desorption ionization-time-of-flight (MALDI-TOF mass spectrometry. We tested the neuromuscular blocking activities on chick biventer cervicis neuromuscular tissue. Phylogenetic analysis of Cdc PLA2 showed the existence of two lines of N6-PLA2, denominated F24 and S24. Apparently, the sequences of the New World’s N6-F24-PLA2 are similar to those of the agkistrodotoxin from the Asian genus Gloydius. The sequences of N6-S24-PLA2 are similar to the sequence of trimucrotoxin from the genus Protobothrops, found in the Old World.

  19. The effects of radiation on p53-mutated glioma cells using cDNA microarray technique

    International Nuclear Information System (INIS)

    Ngo, F.Q.H.; Hsiao, Y.-Y.H.

    2003-01-01

    Full text: In this study, we investigated the effects of 10-Gy irradiation on cell-cycle arrest, apoptosis and clonogenic death in the p53-mutated human U138MG (malignant glioblastoma) cell line. In order to evaluate time-dependent events in cellular responses to radiation, we did a time course study by incubating cells ranging from 0.5 to 48 hours after irradiation. Cell-cycle distribution and apoptosis were evaluated by flow cytometry using propidium iodide (PI) and annexin-V plus PI staining. Cell viability and proliferative capacity were studied by colony formation assay. Dual fluorescence cDNA microarray technique was used to examine the differential expression patterns of the irradiated cells. The cDNA microarray chips used contained DNA sequences corresponding to 12,814 human genes. From the flow cytometry data, it can be observed that radiation induced G2/M phase arrest and that late apoptosis was more evident following G2/M arrest. After 36 hours, some cells underwent senescence and the remains continued on with the cell cycle. Microarray analyses revealed changes in the expression of a small number of cell-cycle-related genes (p21, cyclin B1, etc.) and cell-death genes (tumor necrosis factors, DDB2, etc.) suggesting their involvement in radiation-induced cell-cycle arrest and apoptosis. In silico interpretations of the molecular mechanisms responsible for these radiation effects are in progress

  20. Isolation of a cDNA for a Growth Factor of Vascular Endothelial Cells from Human Lung Cancer Cells: Its Identity with Insulin‐like Growth Factor II

    Science.gov (United States)

    Hagiwara, Koichi; Kobayashi, Tatsuo; Tobita, Masato; Kikyo, Nobuaki; Yazaki, Yoshio

    1995-01-01

    We have found growth‐promoting activity for vascular endothelial cells in the conditioned medium of a human lung cancer cell line, T3M‐11. Purification and characterization of the growth‐promoting activity have been carried out using ammonium sulfate precipitation and gel‐exclusion chromatography. The activity migrated as a single peak just after ribonuclease. It did not bind to a heparin affinity column. These results suggest that the activity is not a heparin‐binding growth factor (including fibroblast growth factors) or a vascular endothelial growth factor. To identify the molecule exhibiting the growth‐promoting activity, a cDNA encoding the growth factor was isolated through functional expression cloning in COS‐1 cells from a cDNA library prepared from T3M‐11 cells. The nucleotide sequence encoded by the cDNA proved to be identical with that of insulin‐like growth factor II. PMID:7730145

  1. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

    CSIR Research Space (South Africa)

    Van den Berg, N

    2004-11-01

    Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

  2. Characterization and sequence analysis of cysteine and glycine-rich ...

    African Journals Online (AJOL)

    Primers specific for CSRP3 were designed using known cDNA sequences of Bos taurus published in database with different accession numbers. Polymerase chain reaction (PCR) was performed and products were purified and sequenced. Sequence analysis and alignment were carried out using CLUSTAL W (1.83).

  3. Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

    Science.gov (United States)

    Bujaki, Erika

    2016-01-01

    The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

  4. cDNA - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ontents List of cDNA in locus Data file File name: astra_cdna.zip File URL: ftp://ftp.biosciencedbc.jp/archive/astra/LATEST/astra_cdn...a.zip File size: 3.3 MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/astra_cdna...n, Department of Molecular Genetics, National Institute of Agrobiological Sciences (Kikuchi et al., 2003; ftp://cdna

  5. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  6. Molecular cloning, sequence characterization and expression pattern of Rab18 gene from watermelon (Citrullus lanatus).

    Science.gov (United States)

    Xinli, Xiao; Lei, Peng

    2015-03-04

    The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.

  7. A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

    Science.gov (United States)

    Lassner, M W; Lardizabal, K; Metz, J G

    1996-02-01

    beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

  8. In silico characterization of microsatellites in Eucalyptus spp.: abundance, length variation and transposon associations

    Directory of Open Access Journals (Sweden)

    Edenilson Rabello

    2005-01-01

    Full Text Available This study assessed the abundance of microsatellites, or simple sequence repeats (SSR, in 19 Eucalyptus EST libraries from FORESTs, containing cDNA sequences from five species: E. grandis, E. globulus, E. saligna, E. urophylla and E. camaldulensis. Overall, a total of 11,534 SSRs and 8,447 SSR-containing sequences (25.5% of total ESTs were identified, with an average of 1 SSR/2.5 kb when considering all motifs and 1 SSR/3.1 kb when mononucleotides were not included. Dimeric repeats were the most abundant (41.03%, followed by trimerics (36.11% and monomerics (19.59%. The most frequent motifs were A/T (87.24% for monomerics, AG/CT (94.44% for dimerics, CCG/CGG (37.87% for trimerics, AAGG/CCTT (18.75% for tetramerics, AGAGG/CCTCT (14.04% for pentamerics and ACGGCG/CGCCGT (6.30% for hexamerics. According to sequence length, Class II or potentially variable markers were the most commonly found, followed by Class III. Two sequences presented high similarity to previously published Eucalyptus sequences from the NCBI database, EMBRA_72 and EMBRA_122. Local blastn search for transposons did not reveal the presence of any transposable elements with a cut-off value of 10-50. The large number of microsatellites identified will contribute to the refinement of marker-assisted mapping and to the discovery of novel markers for virtually all genes of economic interest.

  9. Transcriptome sequencing of the blind subterranean mole rat, Spalax galili: Utility and potential for the discovery of novel evolutionary patterns

    KAUST Repository

    Malik, Assaf; Korol, Abraham; Hü bner, Sariel; Hernandez, Alvaro G.; Thimmapuram, Jyothi; Ali, Shahjahan; Glaser, Fabian; Paz, Arnon; Avivi, Aaron; Band, Mark

    2011-01-01

    sequencing of Spalax galili, a chromosomal type of S. ehrenbergi. cDNA pools from muscle and brain tissues isolated from animals exposed to hypoxic and normoxic conditions were sequenced using Sanger, GS FLX, and GS FLX Titanium technologies. Assembly

  10. Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

    Directory of Open Access Journals (Sweden)

    NED A SETAYESH

    2009-01-01

    Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

  11. Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

    Science.gov (United States)

    Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

    1998-08-01

    An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

  12. cDNA cloning and characterization of Type I procollagen alpha1 chain in the skate Raja kenojei.

    Science.gov (United States)

    Hwang, Jae-Ho; Yokoyama, Yoshihiro; Mizuta, Shoshi; Yoshinaka, Reiji

    2006-05-01

    A full-length cDNA of the Type I procollagen alpha1 [pro-alpha1(I)] chain (4388 bp), coding for 1463 amino acid residues in the total length, was determined by RACE PCR using a cDNA library constructed from 4-week embryo of the skate Raja kenojei. The helical region of the skate pro-alpha1(I) chain consisted of 1014 amino acid residues - the same as other fibrillar collagen alpha chains from higher vertebrates. Comparison on denaturation temperatures of Type I collagens from the skate, rainbow trout (Oncorhynchus mykiss) and rat (Rattus norvegicus) revealed that the number of Gly-Pro-Pro and Gly-Gly in the alpha1(I) chains could be directly related to the thermal stability of the helix. The expression property of the skate pro-alpha1(I) chain mRNA and phylogenetic analysis with other vertebrate pro-alpha1(I) chains suggested that skate pro-alpha1(I) chain could be a precursor form of the skate Type I collagen alpha1 chain. The present study is the first evidence for the primary structure of full-length pro-alpha1(I) chain in an elasmobranch.

  13. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  14. ISOLASI cDNA SUCROSE TRANSPORTER (SUT DARI BATANG TANAMAN TEBU (Saccharum officinarum L.

    Directory of Open Access Journals (Sweden)

    - Slameto

    2010-09-01

    Full Text Available Sucrose Transporter (SUT is kind of protein transporter that control in sucrose translocation. Sucrose Transporter is intermediate in translocation of sucrose from apoplasmic to simplasmic. SUT facilitates sucrose transportation from vascular tissues to parenchyma cells toward in node sugarcane stem. This research was purposed to isolate cDNA SUT from sugarcane stem, and cloned in Escherichia coli strain DH5α. Total RNA of sugarcane stem was isolated by single step method, then add with oligo dT in order to obtain the first strand of SUT cDNA then used as template for PCR. The primer used for PCR is 5’ –ggg ctg att gtg gcc atg tc- ‘3 (SUT-F and 5’ –tgc cct ttg tct ccg gaa cc- ‘3 (SUT-R. PCR was programmed as follow denaturation at 94°C for 2 minutes and 30 second, annealing at 54°C for 30 s, extension at 72°C 2 min and 7 min, and storage at 4°C for unlimited, It was for 30 cycles. Complementary DNA SUT from PCR ligalized to pTOPO bunt-end, then it cloned in to E. coli strain DH5α. The cloning resulted then be sequenced in order to observe the homologues with other nucleotides sequences of some plant using BLASTn program in GENE BANK NCBI and the level of homology determined by Genetyx program. The concentrated of total RNA isolated was 5,024 μg/μl, with purity of 1,85. Complementary DNA SUT fragment from PCR with size 2037 bp appropriated to the both of primer was used. Complementary DNA SUT fragment showed by analyzed some of restriction enzyme e.g. EcoRI, PstI and BamHI. Homologues of this cDNA SUT fragment was 100% to SoSUT 2A of sugarcane stem and 84% to OsSUT of rice plant (Casu et al ., 2003.

  15. Assignment of casein kinase 2 alpha sequences to two different human chromosomes

    DEFF Research Database (Denmark)

    Boldyreff, B; Klett, C; Göttert, E

    1992-01-01

    Human casein kinase 2 alpha gene (CK-2-alpha) sequences have been localized within the human genome by in situ hybridization and somatic cell hybrid analysis using a CK-2 alpha cDNA as a probe. By in situ hybridization, the CK-2 alpha cDNA could be assigned to two different loci, one on 11p15.1-ter...

  16. Telomere Length and Mortality

    DEFF Research Database (Denmark)

    Kimura, Masayuki; Hjelmborg, Jacob V B; Gardner, Jeffrey P

    2008-01-01

    Leukocyte telomere length, representing the mean length of all telomeres in leukocytes, is ostensibly a bioindicator of human aging. The authors hypothesized that shorter telomeres might forecast imminent mortality in elderly people better than leukocyte telomere length. They performed mortality...

  17. Gene structure, cDNA characterization and RNAi-based functional analysis of a myeloid differentiation factor 88 homolog in Tenebrio molitor larvae exposed to Staphylococcus aureus infection.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Patnaik, Hongray Howrelia; Seo, Gi Won; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Han, Yeon Soo

    2014-10-01

    Myeloid differentiation factor 88 (MyD88), an intracellular adaptor protein involved in Toll/Toll-like receptor (TLR) signal processing, triggers activation of nuclear factor-kappaB (NF-κB) transcription factors. In the present study, we analyzed the gene structure and biological function of MyD88 in a coleopteran insect, Tenebrio molitor (TmMyD88). The TmMyD88 gene was 1380 bp in length and consisted of five exons and four introns. The 5'-flanking sequence revealed several putative transcription factor binding sites, such as STAT-4, AP-1, cJun, cfos, NF-1 and many heat shock factor binding elements. The cDNA contained a typical death domain, a conservative Toll-like interleukin-1 receptor (TIR) domain, and a C-terminal extension (CTE). The TmMyD88 TIR domain showed three significantly conserved motifs for interacting with the TIR domain of TLRs. TmMyD88 was grouped within the invertebrate cluster of the phylogenetic tree and shared 75% sequence identity with the TIR domain of Tribolium castaneum MyD88. Homology modeling of the TmMyD88 TIR domain revealed five parallel β-strands surrounded by five α-helices that adopted loop conformations to function as an adaptor. TmMyD88 expression was upregulated 7.3- and 4.79-fold after 12 and 6h, respectively, of challenge with Staphylococcus aureus and fungal β-1,3 glucan. Silencing of the TmMyD88 transcript by RNA interference led to reduced resistance of the host to infection by S. aureus. These results indicate that TmMyD88 is required for survival against Staphylococcus infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Molecular cloning and characterization of an α-amylase cDNA highly expressed in major feeding stages of the coffee berry borer, Hypothenemus hampei.

    Science.gov (United States)

    Bezerra, C A; Macedo, L L P; Amorim, T M L; Santos, V O; Fragoso, R R; Lucena, W A; Meneguim, A M; Valencia-Jimenez, A; Engler, G; Silva, M C M; Albuquerque, E V S; Grossi-de-Sa, M F

    2014-12-10

    α-Amylases are common enzymes responsible for hydrolyzing starch. Insect-pests, whose larvae develop in seeds, rely obligatorily on α-amylase activity to digest starch, as their major food source. Considering the relevance of insect α-amylases and the natural α-amylase inhibitors present in seeds to protect from insect damage, we report here the molecular cloning and nucleotide sequence of the full-length AmyHha cDNA of the coffee berry borer, Hypothenemus hampei, a major insect-pest of coffee crops. The AmyHha sequence has 1879 bp, containing a 1458 bp open reading frame, which encodes a predicted protein with 485 amino acid residues, with a predicted molecular mass of 51.2 kDa. The deduced protein showed 55-79% identity to other insect α-amylases, including Anthonomus grandis, Ips typographus and Sitophilus oryzae α-amylases. In depth analysis revealed that the highly conserved three amino acid residues (Asp184, Glu220, and Asp285), which compose the catalytic site are also presented in AmyHha amylase. The AmyHha gene seems to be a single copy in the haploid genome and AmyHha transcription levels were found higher in L2 larvae and adult insects, both corresponding to major feeding phases. Modeling of the AmyHha predicted protein uncovered striking structural similarities to the Tenebrio molitor α-amylase also displaying the same amino acid residues involved in enzyme catalysis (Asp184, Glu220 and Asp285). Since AmyHha gene was mostly transcribed in the intestinal tract of H. hampei larvae, the cognate α-amylase could be considered a high valuable target to coffee bean insect control by biotechnological strategies. Copyright © 2014. Published by Elsevier B.V.

  19. Identification of "pathologs" (disease-related genes from the RIKEN mouse cDNA dataset using human curation plus FACTS, a new biological information extraction system

    Directory of Open Access Journals (Sweden)

    Socha Luis A

    2004-04-01

    Full Text Available Abstract Background A major goal in the post-genomic era is to identify and characterise disease susceptibility genes and to apply this knowledge to disease prevention and treatment. Rodents and humans have remarkably similar genomes and share closely related biochemical, physiological and pathological pathways. In this work we utilised the latest information on the mouse transcriptome as revealed by the RIKEN FANTOM2 project to identify novel human disease-related candidate genes. We define a new term "patholog" to mean a homolog of a human disease-related gene encoding a product (transcript, anti-sense or protein potentially relevant to disease. Rather than just focus on Mendelian inheritance, we applied the analysis to all potential pathologs regardless of their inheritance pattern. Results Bioinformatic analysis and human curation of 60,770 RIKEN full-length mouse cDNA clones produced 2,578 sequences that showed similarity (70–85% identity to known human-disease genes. Using a newly developed biological information extraction and annotation tool (FACTS in parallel with human expert analysis of 17,051 MEDLINE scientific abstracts we identified 182 novel potential pathologs. Of these, 36 were identified by computational tools only, 49 by human expert analysis only and 97 by both methods. These pathologs were related to neoplastic (53%, hereditary (24%, immunological (5%, cardio-vascular (4%, or other (14%, disorders. Conclusions Large scale genome projects continue to produce a vast amount of data with potential application to the study of human disease. For this potential to be realised we need intelligent strategies for data categorisation and the ability to link sequence data with relevant literature. This paper demonstrates the power of combining human expert annotation with FACTS, a newly developed bioinformatics tool, to identify novel pathologs from within large-scale mouse transcript datasets.

  20. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

    International Nuclear Information System (INIS)

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-01-01

    An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

  1. Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

    Science.gov (United States)

    Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

    2017-07-15

    This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

    Science.gov (United States)

    Yi, S Y; Yu, S H; Choi, D

    1999-06-30

    Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

  3. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  4. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  5. Methods to determine the transcriptomes of trypanosomes in mixtures with mammalian cells: the effects of parasite purification and selective cDNA amplification.

    Directory of Open Access Journals (Sweden)

    Julius Mulindwa

    2014-04-01

    Full Text Available Patterns of gene expression in cultured Trypanosoma brucei bloodstream and procyclic forms have been extensively characterized, and some comparisons have been made with trypanosomes grown to high parasitaemias in laboratory rodents. We do not know, however, to what extent these transcriptomes resemble those in infected Tsetse flies - or in humans or cattle, where parasitaemias are substantially lower. For clinical and field samples it is difficult to characterize parasite gene expression because of the large excess of host cell RNA. We have here examined two potential solutions to this problem for bloodstream form trypanosomes, assaying transcriptomes by high throughput cDNA sequencing (RNASeq. We first purified the parasites from blood of infected rats. We found that a red blood cell lysis procedure affected the transcriptome substantially more than purification using a DEAE cellulose column, but that too introduced significant distortions and variability. As an alternative, we specifically amplified parasite sequences from a mixture containing a 1000-fold excess of human RNA. We first purified polyadenylated RNA, then made trypanosome-specific cDNA by priming with a spliced leader primer. Finally, the cDNA was amplified using nested primers. The amplification procedure was able to produce samples in which 20% of sequence reads mapped to the trypanosome genome. Synthesis of the second cDNA strand with a spliced leader primer, followed by amplification, is sufficiently reproducible to allow comparison of different samples so long as they are all treated in the same way. However, SL priming distorted the abundances of the cDNA products and definitely cannot be used, by itself, to measure absolute mRNA levels. The amplification method might be suitable for clinical samples with low parasitaemias, and could also be adapted for other Kinetoplastids and to samples from infected vectors.

  6. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    Science.gov (United States)

    Ares, Manuel

    2014-01-01

    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  7. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  8. Mapping of gene transcripts by nuclease protection assays and cDNA primer extension

    International Nuclear Information System (INIS)

    Calzone, F.J.; Britten, R.J.; Davidson, E.J.

    1987-01-01

    An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements

  9. Purification, reactivity with IgE and cDNA cloning of parvalbumin as the major allergen of mackerels.

    Science.gov (United States)

    Hamada, Y; Tanaka, H; Ishizaki, S; Ishida, M; Nagashima, Y; Shiomi, K

    2003-08-01

    Three species of mackerels (Scomber japonicus, S. australasicus and S. scombrus) are widely consumed and considered to be most frequently involved in incidents of IgE-mediated fish allergy in Japan. In this study, parvalbumin, a possible candidate for the major allergen, was purified from the white muscle of three species of mackerels by gel filtration on Sephadex G-75 and reverse-phase HPLC on TSKgel ODS-120T. All the purified preparations from three species gave a single band of about 11 kDa and were clearly identified as parvalbumins by analyses of their partial amino acid sequences. In ELISA experiments, four of five sera from fish-allergic patients reacted to all the purified parvalbumins, demonstrating that parvalbumin is the major allergen in common with the mackerels. Antigenic cross-reactivity among the mackerel parvalbumins was also established by ELISA inhibition experiments. A cDNA library was constructed from the white muscle of S. japonicus and the cDNA encoding parvalbumin was cloned. The amino acid sequence translated from the nucleotide sequence revealed that the S. japonicus parvalbumin is composed of 108 residues, being a member of beta-type parvalbumins.

  10. Cloning and analysis of the mouse Fanconi anemia group a cDNA and an overlapping penta zinc finger cDNA

    NARCIS (Netherlands)

    Wong, JCY; Alon, N; Norga, K; Kruyt, FAE; Youssoufian, H; Buchwald, M

    2000-01-01

    Despite the cloning of four disease-associated genes for Fanconi anemia (FA), the molecular pathogenesis of FA remains largely unknown. To study FA complementation group A using the mouse as a mode I system, we cloned and characterized the mouse homolog of the human FANCA cDNA, The mouse cDNA

  11. Sequencing and analysis of the Mediterranean amphioxus (Branchiostoma lanceolatum transcriptome.

    Directory of Open Access Journals (Sweden)

    Silvan Oulion

    Full Text Available BACKGROUND: The basally divergent phylogenetic position of amphioxus (Cephalochordata, as well as its conserved morphology, development and gen