Three-dimensional Imaging for Large LArTPCs

Energy Technology Data Exchange (ETDEWEB)

Chao, C. [Brookhaven National Lab. (BNL), Upton, NY (United States); Qian, X. [Brookhaven National Lab. (BNL), Upton, NY (United States); Viren, B. [Brookhaven National Lab. (BNL), Upton, NY (United States); Diwan, M. [Brookhaven National Lab. (BNL), Upton, NY (United States)

2017-12-14

High-performance event reconstruction is critical for current and future massive liquid argon time projection chambers (LArTPCs) to realize their full scientic potential. LArTPCs with readout using wire planes provides a limited number of 2D projections. In general, without a pixel-type readout it is challenging to achieve unambiguous 3D event reconstruction. As a remedy, we present a novel 3D imaging method, Wire-Cell, which incorporates the charge and sparsity information in addition to the time and geometry through simple and robust mathematics.

The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

Science.gov (United States)

Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

2013-05-29

Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

Thermographic and microscopic evaluation of LARS knee ligament tearing.

Science.gov (United States)

Pătraşcu, Jenel Marian; Amarandei, Mihaela; Kun, Karla Noemy; Borugă, Ovidiu; Totorean, Alina; Andor, Bogdan; Florescu, Sorin

2014-01-01

Damage to knee articular ligaments causes important functional problems and adversely affects particularly the stability of the knee joint. Several methods were developed in order to repair damage to the anterior cruciate ligament (ACL), which employ autografts, allografts, as well as synthetic ligaments. One such synthetic scaffold, the ligament advanced reinforcement system (LARS) synthetic ligament is made of non-absorbing polyethylene terephthalate fibers whose structure allow tissue ingrowths in the intra-articular part, improving the stability of the joint. The LARS ligament is nowadays widely used in modern knee surgery in the Europe, Canada, China or Japan. This paper evaluates LARS ligament from two perspectives. The first regards a study done by the Orthopedics Clinic II, Timisoara, Romania, which compared results obtained by employing two techniques of ACL repair - the Bone-Tendon-Bone (BTB) or LARS arthroscopic, intra-articular techniques. This study found that patients treated with the BTB technique presented with an IKDC score of 45.82±1.14 units preoperative, with increasing values in the first nine months after each implant post-surgical ligament restoration, reaching an average value of 75.92 ± 2.88 units postoperative. Patients treated with the LARS technique presented with an IKDC score of 43.64 ± 1.11 units preoperative, and a score of 77.32 ± 2.71 units postoperative. The second perspective describes the thermographic and microscopic analysis of an artificial knee ligament tearing or loosening. The objective of the study was to obtain information regarding the design of artificial ligaments in order to expand their lifespan and avoid complications such as recurring synovitis, osteoarthritis and trauma of the knee joint. Thermographic data has shown that tearing begins from the inside out, thus improving the inner design of the ligament would probably enhance its durability. An optical microscope was employed to obtain images of structural

Performance of the LAr scintillation veto of Gerda Phase II

Energy Technology Data Exchange (ETDEWEB)

Wiesinger, Christoph [Physik-Department and Excellence Cluster Universe, Technische Universitaet Muenchen, James-Franck-Strasse, 85748 Garching (Germany); Collaboration: GERDA-Collaboration

2016-07-01

Gerda is an experiment to search for the neutrinoless double beta decay in {sup 76}Ge. Results of Phase I have been published in summer 2013 and Gerda has been upgraded to Phase II. To reach the aspired background index of ∝10{sup -3} cts/(keV.kg.yr) for Phase II active background-suppression techniques are applied, including an active liquid argon (LAr) veto. It has been demonstrated with the LArGe test facility that the detection of argon scintillation light can be used to effectively suppress background events in the germanium detectors, which simultaneously deposit energy in the LAr. The light instrumentation consisting of photomultiplier tubes (PMT) and wavelength-shifting fibers connected to silicon photomultipliers (SiPM) has been installed in Gerda. In this talk the low background design of the LAr veto and its performance during Phase II start-up is reported.

LArSoft: toolkit for simulation, reconstruction and analysis of liquid argon TPC neutrino detectors

Science.gov (United States)

Snider, E. L.; Petrillo, G.

2017-10-01

LArSoft is a set of detector-independent software tools for the simulation, reconstruction and analysis of data from liquid argon (LAr) neutrino experiments The common features of LAr time projection chambers (TPCs) enable sharing of algorithm code across detectors of very different size and configuration. LArSoft is currently used in production simulation and reconstruction by the ArgoNeuT, DUNE, LArlAT, MicroBooNE, and SBND experiments. The software suite offers a wide selection of algorithms and utilities, including those for associated photo-detectors and the handling of auxiliary detectors outside the TPCs. Available algorithms cover the full range of simulation and reconstruction, from raw waveforms to high-level reconstructed objects, event topologies and classification. The common code within LArSoft is contributed by adopting experiments, which also provide detector-specific geometry descriptions, and code for the treatment of electronic signals. LArSoft is also a collaboration of experiments, Fermilab and associated software projects which cooperate in setting requirements, priorities, and schedules. In this talk, we outline the general architecture of the software and the interaction with external libraries and detector-specific code. We also describe the dynamics of LArSoft software development between the contributing experiments, the projects supporting the software infrastructure LArSoft relies on, and the core LArSoft support project.

Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

Science.gov (United States)

Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

2010-10-07

PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

ARIADNE, a Photographic LAr TPC at the CERN Neutrino Platform

CERN Document Server

Mavrokoridis, K; Nessi, M; Roberts, A; Smith, N A; Touramanis, C; CERN. Geneva. SPS and PS Experiments Committee; SPSC

2016-01-01

This letter of intent describes a novel and innovative two-phase LAr TPC with photographic capabilities as an attractive alternative readout method to the currently accepted segmented THGEMs which will require many thousands of charge readout channels for kton-scale two-phase TPCs. These colossal LAr TPCs will be used for the future long-baseline-neutrino-oscillation experiments. Optical readout also presents many other clear advantages over current readout techniques such as ease of scalability, upgrade, installation and maintenance, and cost effectiveness. This technology has already been demonstrated at the Liverpool LAr facility with the photographic capturing of cosmic muon tracks and single gammas using a 40-litre prototype. We have now secured ERC funding to develop this further with the ARIADNE programme. ARIADNE will be a 1-ton two-phase LAr TPC utilizing THGEM and EMCCD camera readouts in order to photograph interactions, allowing for track reconstruction and particle identification. We are request...

Full Spectrum LAR

Science.gov (United States)

2008-01-01

Emerson 901 TOW Under Armor (TUA) weapons system. When reliably operational, the Emerson 901 turret can still provide effective anti-armor fires as...the rear of the LAV-R thus there is no available space to carry ammunition resupplies, food, or under armor ambulance kits. On the other hand, the...the LAR battalion; however, the LAV-EFSS cannot be fired under armor protection or in the direct firing mode. Both the LAV-120 AMS and the LAV-EFSS

ICARUS: An Innovative Large LAR Detector for Neutrino Physics

Science.gov (United States)

Vignoli, C.; Barni, D.; Disdier, J. M.; Rampoldi, D.; Icarus Collaboration

2006-04-01

ICARUS is an international project that foresees the installation of very large LAr detectors inside the Gran Sasso underground laboratory in order to be sensitive to rare phenomena of particle physics. The detection technique is based on the collection of electrons produced by particle interactions in LAr by a matrix of thousands of thin wires. At the moment the project foresees the installation of a 600,000-kg vessel (T600). The total amount of LAr can be expanded in a modular way to masses of the order of 106 kg. The T600 houses two identical 300,000-kg Ar sub-cryostats that are aluminum boxes about 20-m long, 4-m high and 4-m wide. Safety requirements for the underground installation have led to a unique design for the vessels to prevent LAr spillages even in the case of inner cryostat failure. Electrons must drift over meters requiring the development of special gas and liquid Ar purification units to provide an extremely high LAr purity (better then 0.1 ppb). The cooling system has been designed to assure a high thermal uniformity in the detector volume (less than 1-K differential). The cryogenic system associated with the final ICARUS configuration is based on three N2 refrigerators, three 30-m3 tanks and pump driven two-phase N2 forced-flow cooling of the various sub-systems. The T600 was successfully tested in Pavia in 2001 and it is now under installation in Gran Sasso for final operation. The future mass expansion strategy is under investigation.

Gene family size conservation is a good indicator of evolutionary rates.

Science.gov (United States)

Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

2010-08-01

The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

Prevention of diet-induced obesity by safflower oil: insights at the levels of PPARalpha, orexin, and ghrelin gene expression of adipocytes in mice.

Science.gov (United States)

Zhang, Zhong; Li, Qiang; Liu, Fengchen; Sun, Yuqian; Zhang, Jinchao

2010-03-15

The aim of this study was to investigate the prevention of diet-induced obesity by a high safflower oil diet and adipocytic gene expression in mice. Forty 3-week-old C57BL/6 mice were randomly divided into three groups: control group (CON, 5% lard + 5% safflower oil), high lard group (LAR, 45% lard + 5% safflower oil), and high safflower oil group (SAF, 45% safflower oil + 5% lard). After 10 weeks, 10 mice of the LAR group were switched to high safflower oil diet (LAR-SAF). Ten weeks later, glucose tolerance tests were performed by intraperitoneal injection of glucose. Circulating levels of lipid and insulin were measured and white adipose tissues were taken for gene chip and reverse transcriptase-polymerase chain reaction analysis. The LAR group showed higher body weight, adiposity index, insulin, and lipids than the CON group (P<0.05). The body weight in the LAR-SAF group decreased after dietary reversal. The plasma biochemical profiles decreased in the LAR-SAF and SAF groups (P<0.05) compared with those of the LAR group. The blood glucose level of the LAR-SAF group was reduced during intraperitoneal glucose tolerance test compared with that of the LAR group. The LAR-SAF group had lower levels of Orexin and Ghrelin gene expression, whereas the level of PPARalpha gene expression was significantly enhanced compared with that of the LAR group. So, the SAF diet can alter adipocytic adiposity-related gene expression and result in effective amelioration of diet-induced obesity.

The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Baumgarten Andrew

2004-06-01

Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

High-Fat Diet Augments VPAC1 Receptor-Mediated PACAP Action on the Liver, Inducing LAR Expression and Insulin Resistance

Directory of Open Access Journals (Sweden)

Masanori Nakata

2016-01-01

Full Text Available Pituitary adenylate cyclase-activating polypeptide (PACAP acts on multiple processes of glucose and energy metabolism. PACAP potentiates insulin action in adipocytes and insulin release from pancreatic β-cells, thereby enhancing glucose tolerance. Contrary to these effects at organ levels, PACAP null mice exhibit hypersensitivity to insulin. However, this apparent discrepancy remains to be solved. We aimed to clarify the mechanism underlying the antidiabetic phenotype of PACAP null mice. Feeding with high-fat diet (HFD impaired insulin sensitivity and glucose tolerance in wild type mice, whereas these changes were prevented in PACAP null mice. HFD also impaired insulin-induced Akt phosphorylation in the liver in wild type mice, but not in PACAP null mice. Using GeneFishing method, HFD increased the leukocyte common antigen-related (LAR protein tyrosine phosphatase in the liver in wild type mice. Silencing of LAR restored the insulin signaling in the liver of HFD mice. Moreover, the increased LAR expression by HFD was prevented in PACAP null mice. HFD increased the expression of VPAC1 receptor (VPAC1-R, one of three PACAP receptors, in the liver of wild type mice. These data indicate that PACAP-VPAC1-R signaling induces LAR expression and insulin resistance in the liver of HFD mice. Antagonism of VPAC1-R may prevent progression of HFD-induced insulin resistance in the liver, providing a novel antidiabetic strategy.

Influence of LAR and VAR on Para-Aminopyridine Antimalarials Targetting Haematin in Chloroquine-Resistance.

Science.gov (United States)

Warhurst, David C; Craig, John C; Raheem, K Saki

2016-01-01

Antimalarial chloroquine (CQ) prevents haematin detoxication when CQ-base concentrates in the acidic digestive vacuole through protonation of its p-aminopyridine (pAP) basic aromatic nitrogen and sidechain diethyl-N. CQ export through the variant vacuolar membrane export channel, PFCRT, causes CQ-resistance in Plasmodium falciparum but 3-methyl CQ (sontochin SC), des-ethyl amodiaquine (DAQ) and bis 4-aminoquinoline piperaquine (PQ) are still active. This is determined by changes in drug accumulation ratios in parasite lipid (LAR) and in vacuolar water (VAR). Higher LAR may facilitate drug binding to and blocking PFCRT and also aid haematin in lipid to bind drug. LAR for CQ is only 8.3; VAR is 143,482. More hydrophobic SC has LAR 143; VAR remains 68,523. Similarly DAQ with a phenol substituent has LAR of 40.8, with VAR 89,366. In PQ, basicity of each pAP is reduced by distal piperazine N, allowing very high LAR of 973,492, retaining VAR of 104,378. In another bis quinoline, dichlorquinazine (DCQ), also active but clinically unsatisfactory, each pAP retains basicity, being insulated by a 2-carbon chain from a proximal nitrogen of the single linking piperazine. While LAR of 15,488 is still high, the lowest estimate of VAR approaches 4.9 million. DCQ may be expected to be very highly lysosomotropic and therefore potentially hepatotoxic. In 11 pAP antimalarials a quadratic relationship between logLAR and logResistance Index (RI) was confirmed, while log (LAR/VAR) vs logRI for 12 was linear. Both might be used to predict the utility of structural modifications.

Land-Acquisition and Resettlement (LAR Conflicts: A Perspective of Spatial Injustice of Urban Public Resources Allocation

Directory of Open Access Journals (Sweden)

Jinxia Zhu

2018-03-01

Full Text Available Land acquisition and resettlement (LAR is an important step in urban development. As one of the ‘externalities of development’, LAR conflicts have affected social stability and development in rural areas of China. With social conflict research shifting from value identity to resource allocation, few studies have examined the relationship between the spatial injustice of urban public resources and LAR conflict. To mitigate this research gap and formulate effective policies, this study aims to reinterpret the obstacles of LAR conflicts from the perspective of the spatial injustice of urban public facilities allocation in Hangzhou City by examining 195 administrative litigation cases. Spatial accessibility was used for estimating the spatial justice of urban public resources allocation. A classification and regression tree (CART model was applied to identify the advantage and disadvantage factors behind LAR conflict, and explored the logical and structural relationships among these factors. Results showed that a spatial mismatch between the spatial behavior preferences of human activity and the spatial injustice of urban public resources allocation had significantly accelerated LAR conflicts. When the spatial behavior preferences of human activity and spatial distribution of urban public resources correspond to each other pre- and after LAR, basic rights to social space are safeguarded and various groups can equitably share spatial resources. There are no conflicts. Conversely, respondents expressed a high level of dissatisfaction in comparison to their pre-LAR conditions, and LAR conflict undeniably occurs. This approach also proposes some good LAR policies by regulating the spatial injustice of urban public resources allocation associated with LAR with the aim of long-term urban sustainable development for Hangzhou.

File list: His.Lar.50.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.50.AllAg.Larval_brain dm3 Histone Larvae Larval brain SRX1426943,SRX1426945... http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.50.AllAg.Larval_brain.bed ...

File list: His.Lar.10.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.10.AllAg.Larval_brain dm3 Histone Larvae Larval brain SRX1426945,SRX1426943... http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.10.AllAg.Larval_brain.bed ...

File list: His.Lar.20.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.20.AllAg.Larval_brain dm3 Histone Larvae Larval brain SRX1426943,SRX1426945... http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.20.AllAg.Larval_brain.bed ...

LArGe. A liquid argon scintillation veto for GERDA

International Nuclear Information System (INIS)

Heisel, Mark

2011-01-01

LArGe is a GERDA low-background test facility to study novel background suppression methods in a low-background environment, for possible applications in the GERDA experiment. GERDA searches for the neutrinoless double-beta decay in 76 Ge, by operating naked germanium detectors submersed into 65 m 3 of liquid argon. Similarly, LArGe runs Ge-detectors in 1 m 3 (1.4 tons) of liquid argon, which in addition is instrumented with photomultipliers to detect argon scintillation light. The light is used in anti-coincidence with the germanium detectors, to effectively suppress background events that deposit energy in the liquid argon. This work adresses the design, construction, and commissioning of LArGe. The background suppression efficiency has been studied in combination with a pulse shape discrimination (PSD) technique for various sources, which represent characteristic backgrounds to GERDA. Suppression factors of a few times 10 3 have been achieved. First background data of LArGe (without PSD) yield a background index of (0.12-4.6).10 -2 cts/(keV.kg.y) (90% c.l.), which is at the level of the Gerda phase I design goal. Furthermore, for the first time we measure the natural 42 Ar abundance (in parallel to Gerda), and have indication for the 2νββ-decay in natural germanium. (orig.)

LArGe. A liquid argon scintillation veto for GERDA

Energy Technology Data Exchange (ETDEWEB)

Heisel, Mark

2011-04-13

LArGe is a GERDA low-background test facility to study novel background suppression methods in a low-background environment, for possible applications in the GERDA experiment. GERDA searches for the neutrinoless double-beta decay in {sup 76}Ge, by operating naked germanium detectors submersed into 65 m{sup 3} of liquid argon. Similarly, LArGe runs Ge-detectors in 1 m{sup 3} (1.4 tons) of liquid argon, which in addition is instrumented with photomultipliers to detect argon scintillation light. The light is used in anti-coincidence with the germanium detectors, to effectively suppress background events that deposit energy in the liquid argon. This work adresses the design, construction, and commissioning of LArGe. The background suppression efficiency has been studied in combination with a pulse shape discrimination (PSD) technique for various sources, which represent characteristic backgrounds to GERDA. Suppression factors of a few times 10{sup 3} have been achieved. First background data of LArGe (without PSD) yield a background index of (0.12-4.6).10{sup -2} cts/(keV.kg.y) (90% c.l.), which is at the level of the Gerda phase I design goal. Furthermore, for the first time we measure the natural {sup 42}Ar abundance (in parallel to Gerda), and have indication for the 2{nu}{beta}{beta}-decay in natural germanium. (orig.)

The Liquid Argon Software Toolkit (LArSoft): Goals, Status and Plan

Energy Technology Data Exchange (ETDEWEB)

Pordes, Rush [Fermilab; Snider, Erica [Fermilab

2016-08-17

LArSoft is a toolkit that provides a software infrastructure and algorithms for the simulation, reconstruction and analysis of events in Liquid Argon Time Projection Chambers (LArTPCs). It is used by the ArgoNeuT, LArIAT, MicroBooNE, DUNE (including 35ton prototype and ProtoDUNE) and SBND experiments. The LArSoft collaboration provides an environment for the development, use, and sharing of code across experiments. The ultimate goal is to develop fully automatic processes for reconstruction and analysis of LArTPC events. The toolkit is based on the art framework and has a well-defined architecture to interface to other packages, including to GEANT4 and GENIE simulation software and the Pandora software development kit for pattern recognition. It is designed to facilitate and support the evolution of algorithms including their transition to new computing platforms. The development of the toolkit is driven by the scientific stakeholders involved. The core infrastructure includes standard definitions of types and constants, means to input experiment geometries as well as meta and event- data in several formats, and relevant general utilities. Examples of algorithms experiments have contributed to date are: photon-propagation; particle identification; hit finding, track finding and fitting; electromagnetic shower identification and reconstruction. We report on the status of the toolkit and plans for future work.

File list: ALL.Lar.50.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.50.AllAg.Larval_brain dm3 All antigens Larvae Larval brain SRX1426944,SRX14...26943,SRX1426945,SRX1426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.50.AllAg.Larval_brain.bed ...

File list: ALL.Lar.20.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.20.AllAg.Larval_brain dm3 All antigens Larvae Larval brain SRX1426944,SRX14...26943,SRX1426945,SRX1426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.20.AllAg.Larval_brain.bed ...

File list: ALL.Lar.05.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.05.AllAg.Larval_brain dm3 All antigens Larvae Larval brain SRX1426945,SRX14...26944,SRX1426946,SRX1426943 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.05.AllAg.Larval_brain.bed ...

File list: ALL.Lar.10.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.10.AllAg.Larval_brain dm3 All antigens Larvae Larval brain SRX1426945,SRX14...26944,SRX1426943,SRX1426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.10.AllAg.Larval_brain.bed ...

Interferon induced IFIT family genes in host antiviral defense.

Science.gov (United States)

Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

2013-01-01

Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

Koda = Koda / Ülar Mark, Kariina Kristiina Kaufmann, Kadri Tonto ; kommenteerinud Katrin Koov

Index Scriptorium Estoniae

Mark, Ülar, 1968-

2016-01-01

Minimalistliku vormiga eramu KODA Tallinnas, Järvekalda tee 33. Autorid Ülar Mark, Taavi Jakobson, Hannes Tamjärv, Kalev Ramjalg, Marek Strandberg. Arhitektid Ülar Mark, Kariina Kristiina Kaufmann, Kadri Tonto, Hannes Praks

File list: Oth.Lar.05.daf-12.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.05.daf-12.AllCell ce10 TFs and others daf-12 Larvae SRX146513,SRX065705,SRX...146512,SRX065706,SRX065713,SRX065714 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Oth.Lar.05.daf-12.AllCell.bed ...

File list: Oth.Lar.10.daf-12.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.10.daf-12.AllCell ce10 TFs and others daf-12 Larvae SRX146513,SRX065706,SRX...065705,SRX146512,SRX065713,SRX065714 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Oth.Lar.10.daf-12.AllCell.bed ...

File list: Oth.Lar.50.daf-12.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.50.daf-12.AllCell ce10 TFs and others daf-12 Larvae SRX065714,SRX065713,SRX...146512,SRX065705,SRX146513,SRX065706 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Oth.Lar.50.daf-12.AllCell.bed ...

File list: Oth.Lar.20.daf-12.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.20.daf-12.AllCell ce10 TFs and others daf-12 Larvae SRX146513,SRX146512,SRX...065713,SRX065705,SRX065706,SRX065714 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Oth.Lar.20.daf-12.AllCell.bed ...

Regionaalpoliitika ja arhitektuur / Ülar Mark

Index Scriptorium Estoniae

Mark, Ülar

1999-01-01

Kagu-Eesti Regionaalarengu Programmi raames Eesti Kunstiakadeemia arhitektuurikateedri IV kursuse eriala valikaines 1998/99 tehtud tööst "HyperMobiilne Reaalsus & Kagu Eesti" (juhendajad Ralf Tamm, Ülar Mark). Ühises töös osalesid Tartu Ülikooli geograafiatudengid (juhendaja Rein Ahas). 4 illustratsiooni

File list: Pol.Lar.50.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.50.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.50.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.20.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.20.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.20.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.10.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.10.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.10.RNA_polymerase_III.AllCell.bed ...

File list: Pol.Lar.05.RNA_polymerase_III.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_polymerase_III.AllCell ce10 RNA polymerase RNA polymerase III Larvae... http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_polymerase_III.AllCell.bed ...

Matlab implementation of LASSO, LARS, the elastic net and SPCA

DEFF Research Database (Denmark)

2005-01-01

There are a number of interesting variable selection methods available beside the regular forward selection and stepwise selection methods. Such approaches include LASSO (Least Absolute Shrinkage and Selection Operator), least angle regression (LARS) and elastic net (LARS-EN) regression. There al...... exists a method for calculating principal components with sparse loadings. This software package contains Matlab implementations of these functions. The standard implementations of these functions are available as add-on packages in S-Plus and R....

File list: Pol.Lar.05.RNA_Polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_Polymerase_II.AllCell ce10 RNA polymerase RNA Polymerase II Larvae h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Pol.Lar.05.RNA_Polymerase_II.AllCell.bed ...

Investigation and development of the suppression methods of the {sup 42}K background in LArGe

Energy Technology Data Exchange (ETDEWEB)

Lubashevskiy, Alexey [Max-Planck-Institut fuer Kernphysik, Saupfercheckweg 1, D-69117 Heidelberg (Germany); Collaboration: GERDA-Collaboration

2013-07-01

GERDA is an ultra-low background experiment aimed for the neutrinoless double beta decay search. The search is performed using HPGe detectors operated in liquid argon (LAr). One of the most dangerous backgrounds in GERDA is the background from {sup 42}K which is a daughter isotope of cosmogenically produced {sup 42}Ar. {sup 42}K ions are collected towards to the detector by the electric field of the detector. Estimation of the background contribution and development of the suppression methods were performed in the low background test facility LArGe. For this purpose encapsulated HPGe and bare BEGe detectors were operated in 1m{sup 3} of LAr in the LArGe setup. It is equipped with scintillation veto, so particles which deposit part of their energy in LAr can be detected by 9 PMTs. In order to better understand background and to increase statistics the LAr of LArGe was spiked with specially produced {sup 42}Ar. All these investigations allowed us to estimate background contribution from {sup 42}K and demonstrate the possibility to suppress it in future measurements in GERDA Phase II.

La Medea de Lars von Trier

Directory of Open Access Journals (Sweden)

Iratxe Fresneda Delgado

2013-04-01

Full Text Available El presente artículo analiza el modo en el que Lars von Trier recrea para el cine el estereotipo de Medea. Mediante el análisis fílmico de la película y apoyándose en los estudios culturales, el texto se interroga acerca de la importancia y el poder potencial del cine a la hora recuperar el antiguo mito y demostrar su vigencia. El análisis amplía horizontes para la compresión de los mecanismos que articulan el entramado de significados de la película, donde Von Trier aporta una nueva visión del arquetipo de Medea uniéndola, a la tradición pictórica del Romanticismo. Una influencia que habita en las posteriores obras del director danés, donde el paisaje, la naturaleza, se erige en elemento catalizador de las pulsiones humanas, en su cómplice y testigo.This paper explores the way that Lars von Trier’s film recreates the stereotype of Medea. Using film analysis and based on cultural studies the article asks about the importance and potential power of cinema to recover the ancient myth and show their effects. The analysis expands horizons for the understanding of the mechanisms that link the network of meanings of the film, where the author offers a new vision of Medea's archetype attaching it to the pictorial tradition tied to the Romanticism. An influence that can be seen in the later works of Lars von Trier, where the landscape, the nature, stands as a catalyst of human drives, as his accomplice and witness.

The Caenorhabditis chemoreceptor gene families

OpenAIRE

Robertson Hugh M; Thomas James H

2008-01-01

Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

File list: InP.Lar.10.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.10.AllAg.Larval_brain dm3 Input control Larvae Larval brain SRX1426944,SRX1...426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.10.AllAg.Larval_brain.bed ...

File list: InP.Lar.50.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.50.AllAg.Larval_brain dm3 Input control Larvae Larval brain SRX1426944,SRX1...426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.50.AllAg.Larval_brain.bed ...

File list: InP.Lar.05.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.05.AllAg.Larval_brain dm3 Input control Larvae Larval brain SRX1426944,SRX1...426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.05.AllAg.Larval_brain.bed ...

File list: InP.Lar.20.AllAg.Larval_brain [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.20.AllAg.Larval_brain dm3 Input control Larvae Larval brain SRX1426944,SRX1...426946 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.20.AllAg.Larval_brain.bed ...

File list: InP.Lar.05.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.05.Input_control.AllCell ce10 Input control Input control Larvae SRX331089,...,SRX015099 http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/InP.Lar.05.Input_control.AllCell.bed ...

Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

Directory of Open Access Journals (Sweden)

Wang Bo

2015-01-01

Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

File list: Oth.Lar.50.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.50.AllAg.3rd_instar dm3 TFs and others Larvae 3rd instar SRX318781,SRX31878...5306 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Oth.Lar.50.AllAg.3rd_instar.bed ...

The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

Science.gov (United States)

Karn, Robert C; Laukaitis, Christina M

2012-01-01

Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

File list: Oth.Lar.10.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.10.AllAg.3rd_instar dm3 TFs and others Larvae 3rd instar SRX104963,SRX10497...4971,SRX331403 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Oth.Lar.10.AllAg.3rd_instar.bed ...

File list: Oth.Lar.20.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.20.AllAg.3rd_instar dm3 TFs and others Larvae 3rd instar SRX318781,SRX31878...1403,SRX495243 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Oth.Lar.20.AllAg.3rd_instar.bed ...

File list: Oth.Lar.05.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.05.AllAg.3rd_instar dm3 TFs and others Larvae 3rd instar SRX104964,SRX10496...1403,SRX495243 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Oth.Lar.05.AllAg.3rd_instar.bed ...

File list: InP.Lar.20.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.20.Input_control.AllCell dm3 Input control Input control Larvae SRX040614,S...457599,SRX1426944,SRX1426946,SRX1426948 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.20.Input_control.AllCell.bed ...

File list: His.Lar.05.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.05.AllAg.1st_instar dm3 Histone Larvae 1st instar SRX013088,SRX013009,SRX01...3064,SRX013044,SRX013097 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.05.AllAg.1st_instar.bed ...

File list: Pol.Lar.10.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.10.AllAg.3rd_instar dm3 RNA polymerase Larvae 3rd instar SRX287908,SRX28790...7,SRX013070,SRX013082 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.10.AllAg.3rd_instar.bed ...

File list: His.Lar.20.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.20.AllAg.1st_instar dm3 Histone Larvae 1st instar SRX013009,SRX013088,SRX01...3044,SRX013064,SRX013097 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.20.AllAg.1st_instar.bed ...

File list: Pol.Lar.50.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.50.AllAg.3rd_instar dm3 RNA polymerase Larvae 3rd instar SRX287908,SRX28790...7,SRX013070,SRX013082 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.50.AllAg.3rd_instar.bed ...

File list: ALL.Lar.50.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.50.AllAg.3rd_instar dm3 All antigens Larvae 3rd instar SRX1038029,SRX103803...SRX467060,SRX495306,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.50.AllAg.3rd_instar.bed ...

File list: Pol.Lar.05.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.AllAg.3rd_instar dm3 RNA polymerase Larvae 3rd instar SRX287907,SRX28790...8,SRX013070,SRX013082 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.05.AllAg.3rd_instar.bed ...

File list: His.Lar.50.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.50.AllAg.1st_instar dm3 Histone Larvae 1st instar SRX013009,SRX013088,SRX01...3044,SRX013064,SRX013097 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.50.AllAg.1st_instar.bed ...

File list: His.Lar.10.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.10.AllAg.1st_instar dm3 Histone Larvae 1st instar SRX013088,SRX013064,SRX01...3044,SRX013009,SRX013097 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.10.AllAg.1st_instar.bed ...

File list: Pol.Lar.20.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.20.AllAg.3rd_instar dm3 RNA polymerase Larvae 3rd instar SRX287908,SRX28790...7,SRX013070,SRX013082 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.20.AllAg.3rd_instar.bed ...

Recurrent APC gene mutations in Polish FAP families

Directory of Open Access Journals (Sweden)

Pławski Andrzej

2007-12-01

Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

The IQD gene family in soybean: structure, phylogeny, evolution and expression.

Directory of Open Access Journals (Sweden)

Lin Feng

Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

PlantTribes: a gene and gene family resource for comparative genomics in plants

OpenAIRE

Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

2007-01-01

The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

Directory of Open Access Journals (Sweden)

Taro Tsujimura

2010-12-01

Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

File list: InP.Lar.05.Input_control.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.05.Input_control.AllCell dm3 Input control Input control Larvae SRX645428,S...287678,SRX1426944,SRX1426946,SRX1426948,SRX1426950 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.05.Input_control.AllCell.bed ...

File list: His.Lar.10.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.10.AllAg.2nd_instar dm3 Histone Larvae 2nd instar SRX013087,SRX013015,SRX01...3112,SRX013042,SRX013043,SRX013096 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.10.AllAg.2nd_instar.bed ...

File list: His.Lar.05.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.05.AllAg.2nd_instar dm3 Histone Larvae 2nd instar SRX013087,SRX013096,SRX01...3043,SRX013015,SRX013112,SRX013042 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.05.AllAg.2nd_instar.bed ...

File list: His.Lar.50.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.50.AllAg.2nd_instar dm3 Histone Larvae 2nd instar SRX013015,SRX013042,SRX01...3112,SRX013043,SRX013087,SRX013096 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.50.AllAg.2nd_instar.bed ...

File list: His.Lar.20.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available His.Lar.20.AllAg.2nd_instar dm3 Histone Larvae 2nd instar SRX013015,SRX013042,SRX01...3112,SRX013043,SRX013096,SRX013087 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/His.Lar.20.AllAg.2nd_instar.bed ...

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

International Nuclear Information System (INIS)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-01-01

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

Energy Technology Data Exchange (ETDEWEB)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-09-18

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

Directory of Open Access Journals (Sweden)

Philipp H. Schiffer

2016-08-01

Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

Twentyfourth Podcast - Interview with Lars Holmgaard Christensen

DEFF Research Database (Denmark)

2008-01-01

Every wednesday the Doctoral School of Human Centred Informatics hosts a small research seminar, where PhD students and senior researchers can share and discuss their ongoing work. Today, we bring an interview from spring 2008. On February 27, Lars Holmgaard Christensen presented his paper "Homo...

File list: ALL.Lar.10.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.10.AllAg.1st_instar dm3 All antigens Larvae 1st instar SRX013088,SRX013064,...SRX013044,SRX013009,SRX013072,SRX013097,SRX013055,SRX013056 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.10.AllAg.1st_instar.bed ...

File list: ALL.Lar.50.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.50.AllAg.1st_instar dm3 All antigens Larvae 1st instar SRX013009,SRX013072,...SRX013088,SRX013044,SRX013064,SRX013097,SRX013056,SRX013055 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.50.AllAg.1st_instar.bed ...

File list: ALL.Lar.20.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.20.AllAg.1st_instar dm3 All antigens Larvae 1st instar SRX013009,SRX013072,...SRX013088,SRX013044,SRX013064,SRX013097,SRX013055,SRX013056 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.20.AllAg.1st_instar.bed ...

File list: ALL.Lar.05.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.05.AllAg.3rd_instar dm3 All antigens Larvae 3rd instar SRX104964,SRX104963,...SRX287718,SRX331401,SRX287658,SRX331366,SRX287906,SRX287678 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.05.AllAg.3rd_instar.bed ...

File list: ALL.Lar.10.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.10.AllAg.3rd_instar dm3 All antigens Larvae 3rd instar SRX104963,SRX104968,...SRX287718,SRX022334,SRX104976,SRX467107,SRX013086,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.10.AllAg.3rd_instar.bed ...

File list: ALL.Lar.20.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.20.AllAg.3rd_instar dm3 All antigens Larvae 3rd instar SRX1038029,SRX103803...SRX013082,SRX467107,SRX016173,SRX215499,SRX495243,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.20.AllAg.3rd_instar.bed ...

File list: ALL.Lar.05.AllAg.1st_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.05.AllAg.1st_instar dm3 All antigens Larvae 1st instar SRX013088,SRX013009,...SRX013064,SRX013044,SRX013072,SRX013055,SRX013097,SRX013056 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.05.AllAg.1st_instar.bed ...

File list: Unc.Lar.50.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Unc.Lar.50.AllAg.3rd_instar dm3 Unclassified Larvae 3rd instar SRX1038029,SRX103803...1,SRX1038032,SRX1038030,SRX022335,SRX032124,SRX032123,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Unc.Lar.50.AllAg.3rd_instar.bed ...

The ALMT Gene Family Performs Multiple Functions in Plants

Directory of Open Access Journals (Sweden)

Jie Liu

2018-02-01

Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

Repeat-associated plasticity in the Helicobacter pylori RD gene family.

Science.gov (United States)

Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

2009-11-01

The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

File list: Oth.Lar.20.Adenine_N6-methylation.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Oth.Lar.20.Adenine_N6-methylation.AllCell ce10 TFs and others Adenine N6-methylatio...n Larvae http://dbarchive.biosciencedbc.jp/kyushu-u/ce10/assembled/Oth.Lar.20.Adenine_N6-methylation.AllCell.bed ...

File list: Pol.Lar.05.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.05.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX151962,SRX182775,SRX661503,SRX013070,SRX013072,SRX013113,SRX013082,SRX151961 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.05.RNA_polymerase_II.AllCell.bed ...

File list: Pol.Lar.20.RNA_polymerase_II.AllCell [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Pol.Lar.20.RNA_polymerase_II.AllCell dm3 RNA polymerase RNA polymerase II Larvae SR...SRX661503,SRX026742,SRX013070,SRX013072,SRX182775,SRX151961,SRX013082,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Pol.Lar.20.RNA_polymerase_II.AllCell.bed ...

File list: Unc.Lar.10.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Unc.Lar.10.AllAg.3rd_instar dm3 Unclassified Larvae 3rd instar SRX1038029,SRX103803...1,SRX1038032,SRX1038030,SRX032124,SRX032123,SRX022335,SRX022334,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Unc.Lar.10.AllAg.3rd_instar.bed ...

File list: ALL.Lar.05.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.05.AllAg.2nd_instar dm3 All antigens Larvae 2nd instar SRX013087,SRX013096,...SRX013043,SRX013015,SRX013112,SRX013042,SRX013113,SRX013016,SRX013114 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.05.AllAg.2nd_instar.bed ...

File list: ALL.Lar.50.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.50.AllAg.2nd_instar dm3 All antigens Larvae 2nd instar SRX013015,SRX013042,...SRX013112,SRX013016,SRX013114,SRX013043,SRX013087,SRX013096,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.50.AllAg.2nd_instar.bed ...

File list: ALL.Lar.20.AllAg.2nd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available ALL.Lar.20.AllAg.2nd_instar dm3 All antigens Larvae 2nd instar SRX013015,SRX013042,...SRX013112,SRX013043,SRX013016,SRX013114,SRX013096,SRX013087,SRX013113 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/ALL.Lar.20.AllAg.2nd_instar.bed ...

File list: Unc.Lar.20.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Unc.Lar.20.AllAg.3rd_instar dm3 Unclassified Larvae 3rd instar SRX1038029,SRX103803...1,SRX1038032,SRX1038030,SRX022335,SRX032124,SRX022334,SRX032123,SRX013058 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Unc.Lar.20.AllAg.3rd_instar.bed ...

File list: Unc.Lar.05.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available Unc.Lar.05.AllAg.3rd_instar dm3 Unclassified Larvae 3rd instar SRX1038031,SRX103802...9,SRX1038032,SRX1038030,SRX022335,SRX022334,SRX032124,SRX013058,SRX032123 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/Unc.Lar.05.AllAg.3rd_instar.bed ...

Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

International Nuclear Information System (INIS)

Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

1987-01-01

The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

2007-01-01

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

Samsun’da Ağır Ceza Mahkemesine Yansıyan Cinsel Suçlar

Directory of Open Access Journals (Sweden)

Berna Aydın

2004-04-01

Full Text Available Çalışmamızda cinsel suçların karakteristik özelliklerini belirlemek ve Türk Ceza Kanunu (TCK’nda yapılan değişiklikler çerçevesinde, cinsel suçlarla ilgili ortaya çıkan farklılıkları değerlendirmek amaçlanmıştır. 1999-2003 yılları arasında Samsun 1. Ağır Ceza Mahkemesi’nde karara bağlanmış dava dosyalarına ait karar kartonları incelenerek, cinsel suçlarla ilgili davalar çalışma kapsamına alınmıştır. Mağdurların %9,4’ü erkek iken, sanıkların tümünün erkek olduğu belirlenmiştir. Sanıkların %43,4’lük oranla en sık 21-30 yaş grubunda, mağdurların ise en sık (%31,6 16-18 yaş grubunda olduğu görülmüştür. Yargıya yansıyan cinsel suçlar arasında en sık ırza geçme suçları olduğu belirlenmiştir. Cinsel suçların adli ve tıbbi boyutu ile ilgilenen tıp ve hukuk mensupları, yeni yasal düzenlemeler yanı sıra cinsel suçların karakteristik özellikleri hakkında da bilgi sahibi olmalıdır. Her ilde ve büyük ilçe merkezlerinde cinsel suçlar değerlendirme merkezleri kurulması gerekmektedir. Anahtar kelimeler: Cinsel suçlar, cinsel saldırı, sanık, mağdur, mahkeme kararı

Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

Science.gov (United States)

Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

2014-07-22

Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

Finding Neutrinos in LArTPCs using Convolutional Neural Networks

Science.gov (United States)

Wongjirad, Taritree

2017-09-01

Deep learning algorithms, which have emerged over the last decade, are opening up new ways to analyze data for many particle physics experiments. MicroBooNE, which is a neutrino experiment at Fermilab, has been exploring the use of such algorithms, in particular, convolutional neural networks (CNNS). CNNs are the state-of-the-art method for a large class of problems involving the analysis of images. This makes CNNs an attractive approach for MicroBooNE, whose detector, a liquid argon time projection chamber (LArTPC), produces high-resolution images of particle interactions. In this talk, I will discuss the ways CNNs can be applied to tasks like neutrino interaction detection and particle identification in MicroBooNE and LArTPCs.

Molecular evolution of the major chemosensory gene families in insects.

Science.gov (United States)

Sánchez-Gracia, A; Vieira, F G; Rozas, J

2009-09-01

Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

Brinquedo e educação: na escola e no lar

Directory of Open Access Journals (Sweden)

Edda Bomtempo

Full Text Available Como o artigo mostra, brinquedo, brincar e jogar são considerados de grande importância para o desenvolvimento humano. Os tópicos considerados são: aprender brincando ou brincar para aprender; papéis educacionais dos brinquedos e jogos; os professores e os brinquedos; brinquedos e jogos no lar e na escola; o lar como um lugar divertido. Pais e professores precisam estar informados do valor dos brinquedos, brincadeiras e jogos para o desenvolvimento das crianças e dos adolescentes.

Kui lokaalne saab olla, et jääda globaalselt huvitavaks? / Lars Nittve ; interv. Anna Mustonen

Index Scriptorium Estoniae

Nittve, Lars

2005-01-01

Stockholmi moodsa kunsti muuseumi Moderna Museeti direktor Lars Nittve räägib kaasaegse kunstimuuseumi kogumispoliitika väljakutsetest ja rahvuslikkuse aspektist. Lars Nittve eluloolisi andmeid, lühidalt Moderna Museet'ist

Distonia laríngea respiratória

Directory of Open Access Journals (Sweden)

Lebl Mariana Dantas Aumond

2003-01-01

Full Text Available A distonia laríngea respiratória (DLR é uma desordem rara caracterizada por espasmos da musculatura adutora das pregas vocais durante a fase inalatória da respiração, com manifestação clínica de dispnéia e estridor. O diagnóstico etiológico do estridor laríngeo, entretanto, nem sempre é fácil de ser realizado, principalmente em situações emergenciais, de forma que a DLR pode não ser diagnosticada, o que nos leva a supor ser mais freqüente do que usualmente é descrita. O diagnóstico da DRL requer primeiramente a realização de uma história médica e exames laringológico e neurológico apropriados, com ênfase na verificação da presença de características distônicas e na exclusão de outras etiologias causadoras de movimentos paradoxais de pregas vocais. Muitos tratamentos foram propostos para a DLR, mas nenhum deles apresentou resultados satisfatórios. O uso da Toxina Botulínica do tipo A (Botox® no músculo tireoaritenoídeo tem oferecido melhoras admiráveis, apesar dos poucos casos descritos. Apresentamos dois casos clínicos de pacientes com DLR tratados com Botox® que apresentavam o fechamento glótico inspiratório causado tanto pelos espasmos anômalos dos músculos tireoaritenoídeos, como pela movimentação paradoxal da epiglote. Dentro da classificação proposta por Koufman e Blabock para as distonias laríngeas, inserimos um novo subtipo de DLR caracterizado pela presença de paroxismos de adução de estruturas glóticas e supraglóticas durante a respiração.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

The nitrate transporter (NRT gene family in poplar.

Directory of Open Access Journals (Sweden)

Hua Bai

Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

Directory of Open Access Journals (Sweden)

Parker Nadeene

2004-01-01

Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

Case study of a 15-year-old boy with McCune-Albright syndrome combined with pituitary gigantism: effect of octreotide-long acting release (LAR) and cabergoline therapy.

Science.gov (United States)

Tajima, Toshihiro; Tsubaki, Junko; Ishizu, Katsura; Jo, Wakako; Ishi, Nobuaki; Fujieda, Kenji

2008-07-01

The use of octreotide-LAR and cabergoline therapy has shown great promise in adults with acromegaly; however, the experience in pediatric patients has rarely been reported. We described a clinical course of a 15-year-old boy of McCune-Albright syndrome (MAS) with pituitary gigantism. At the age of 8 years, a growth hormone (GH) and prolactin (PRL) producing pituitary adenoma was diagnosed at our hospital. He also had multiple fibrous dysplasia, so that he was diagnosed as having MAS. The tumor was partially resected, and GNAS1 gene mutation (R201C) was identified in affected tissues. We introduced octreotide to suppress GH secretion (100 mug 2/day s.c). During therapy with octreotide, IGF-1 and GH levels could not be suppressed and the patient frequently complained of nausea from octreotide treatment. Therefore, the therapy was changed to monthly injections of octreotide-LAR at the age of 12.3 years and was partially effective. However, as defect of left visual field worsened due to progressive left optic canal stenosis, he underwent second neurological decompression of the left optic nerve at 13.4 years of age. After surgery, in addition to octreotide-LAR, cabergoline (0.25 mg twice a month) was started. This regimen normalized serum levels of GH and IGF-1; however, he showed impaired glucose tolerance and gallstones at 15.7 years of age. Therefore, the dose of octreotide-LAR was reduced to 10 mg and the dose of cabergoline increased. This case demonstrated the difficulty of treating pituitary gigantism due to MAS. The use of octreotide-LAR and cabergoline should be considered even in pediatric patients; however, adverse events due to octreotide-LAR must be carefully examined.

File list: InP.Lar.50.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.50.AllAg.3rd_instar dm3 Input control Larvae 3rd instar SRX287726,SRX331369...87917,SRX287921,SRX288023,SRX467107,SRX016172,SRX016173 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.50.AllAg.3rd_instar.bed ...

Sosyal Pekiştireçlerin ve Model Davranışlarının, Çocukların Ahlaki Yargılarının Şekillenmesindeki Etkisi (Bandura Örneği)

OpenAIRE

GÜREL, Ramazan

2014-01-01

Bu makale, Bandura'nın 5-11 yaş aralığındaki çocukların ahlaki yargılarının şekillenmesinde model alma ve sosyal pekiştireçlerin etkisini test etmek üzere gerçekleştirdiği araştırmasının ulaştığı sonuçları değerlendirmeyi amaçlamaktadır. Bu doğrultuda makalede, Bandura tarafından üç farklı deney ortamında 5-11 yaşlarındaki çocuklar üzerinde, ahlaki gelişim ve uyum sağlamada sosyal öğrenme, pekiştireçler ve model davranışlarının etkilerine dair gerçekleştirilen deneysel faaliyetlerin uygu...

Memecik Zeytinyağlarının Biyokimyasal Karakterizasyonu

Directory of Open Access Journals (Sweden)

Huri İlyasoğlu

2015-02-01

Full Text Available Zeytinyağı kalitesi botanik ve coğrafi orijin ile ilişkili olduğundan zeytinyağının çeşit ve bölgesel karakte­rizasyonu önem kazanmıştır. Bu çalışmada, ülkemizin ekonomik açıdan en önemli zeytinyağlarından biri­si olan Memecik zeytinyağlarının kalite parametreleri, yağ asitleri, triaçilgliserol ve sterol kompozisyonu, a-tokoferol ve toplam fenolik madde içerikleri, fenolik madde ve aroma profili belirlenmiştir. Analiz edilen zeytinyağı örneklerinin kalite parametreleri, yağ asitleri ve sterol kompozisyonun (kampesterol hariç, Türk Gıda Kodeksi ile uyumlu olduğu saptanmıştır. Memecik zeytinyağlarında tespit edilen başlıca yağ asitleri oleik asit (% 73.37-75.64, palmitik asit (% 11.45-13.84 ve linoleik asittir (% 7.33-8.91. Triolein (% 63.50-68.32, palmitodiolein (% 18.25-25.82 ve dioleolinolein (% 6.01-9.18 zeytinyağı örneklerinde tespit edilen başlıca triaçilgliserollerdir. Sterol kompozisyonu oluşturan başlıca steroller, b-sitosterol (% 80.76-83.00, D5-avenasterol (% 11.02-12.78 ve kampesteroldür (% 4.01-4.97. Memecik çeşidi zeytinyağlarının fenolik madde profilinde, hidroksitirozol, tirozol, ferulik asit, p-kumarik asit, apigenin ve luteolin ve aroma profi­linde hekzanal, hekzanol, E-2-hekzenal, E-2-hekzenol ve Z-3-hekzenol tespit edilmiştir.

Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

Directory of Open Access Journals (Sweden)

Nishida Mutsumi

2007-11-01

Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

File list: InP.Lar.20.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.20.AllAg.3rd_instar dm3 Input control Larvae 3rd instar SRX467108,SRX287726...67103,SRX288024,SRX288023,SRX104976,SRX016172,SRX467107,SRX016173 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.20.AllAg.3rd_instar.bed ...

File list: InP.Lar.10.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.10.AllAg.3rd_instar dm3 Input control Larvae 3rd instar SRX016172,SRX016173...87701,SRX287922,SRX467104,SRX287918,SRX287718,SRX104976,SRX467107 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.10.AllAg.3rd_instar.bed ...

File list: InP.Lar.05.AllAg.3rd_instar [Chip-atlas[Archive

Lifescience Database Archive (English)

Full Text Available InP.Lar.05.AllAg.3rd_instar dm3 Input control Larvae 3rd instar SRX016173,SRX288024...87921,SRX287718,SRX331401,SRX287658,SRX331366,SRX287906,SRX287678 http://dbarchive.biosciencedbc.jp/kyushu-u/dm3/assembled/InP.Lar.05.AllAg.3rd_instar.bed ...

Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

Directory of Open Access Journals (Sweden)

Vanessa Rodrigues Paixão-Côrtes

Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

Evolution of the YABBY gene family in seed plants.

Science.gov (United States)

Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

2016-01-01

Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

Directory of Open Access Journals (Sweden)

Yi-Bing Zhang

Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

Halkın Genetiği Değiştirilmiş Ürünlere/Üretilme Süreçlerine Yönelik Algıları ve Etik İnançları

Directory of Open Access Journals (Sweden)

Özlen Özgen

2014-02-01

Full Text Available Bu araştırmanın amacı, halkın genetiği değiştirilmiş ürünlere ve üretilme süreçlerine yönelik fayda/risk algıları ile etik inançları arasındaki ilişkinin incelenmesidir. Araştırma materyalinin toplanmasında karşılıklı görüşme tekniği kullanılmıştır. Likert tipi cümlelere verilen yanıtlar puanlanmış, geçerlik ve güvenirlik analizi yapılmıştır. Yaş değişkenine bağlı farklılığın belirlenebilmesi için t-testi uygulanmıştır. Bireylerin genetiği değiştirilmiş ürünlere/üretilme süreçlerine bağlı fayda/risk algıları ile etik inançları arasındaki ilişkinin incelenmesi amacı ile Pearson korelasyon analizi yapılmıştır. Bulgular; tüketicilerin genetiği değiştirilmiş ürünlere ilişkin fayda algılarının, genetiği değiştirilmiş ürünlere ve üretilme süreçlerine ilişkin risk algılarının, genetiği değiştirilmiş ürünlere ve üretilme süreçlerine ilişkin etik inançlarının yaşa bağlı olarak değiştiğini göstermektedir. Pearson korelasyon analizi sonucunda p<0.001 düzeyinde anlamlı ilişkiler saptanmıştır.

Developing Light Collection Enhancements and Wire Tensioning Methods for LArTPC Neutrino Detectors

Energy Technology Data Exchange (ETDEWEB)

Spagliardi, Fabio [Univ. of Manchester (United Kingdom)

2017-01-01

Liquid argon Time Projection Chambers (LArTPCs) are becoming widely used as neutrino detectors because of their image-like event reconstruction which enables precision neutrino measurements. They primarily use ionisation charge to reconstruct neutrino events. It has been shown, however, that the scintillation light emitted by liquid argon could be exploited to improve their performance. As the neutrino measurements planned in the near future require large-scale experiments, their construction presents challenges in terms of both charge and light collection. In this dissertation we present solutions developed to improve the performance in both aspects of these detectors. We present a new wire tensioning measurement method that allows a remote measurement of the tension of the large number wires that constitute the TPC anode. We also discuss the development and installation of WLS-compound covered foils for the SBND neutrino detector at Fermilab, which is a technique proposed t o augment light collection in LArTPCs. This included preparing a SBND-like mesh cathode and testing it in the Run III of LArIAT, a test beam detector also located at Fermilab. Finally, we present a study aimed at understanding late scintillation light emitted by recombining positive argon ions using LArIAT data, which could affect large scale surface detectors.

Early evolution of the LIM homeobox gene family

Energy Technology Data Exchange (ETDEWEB)

Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

2010-01-01

LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

Early evolution of the LIM homeobox gene family

Directory of Open Access Journals (Sweden)

Degnan Bernard M

2010-01-01

Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

TreeFam: a curated database of phylogenetic trees of animal gene families

DEFF Research Database (Denmark)

Li, Heng; Coghlan, Avril; Ruan, Jue

2006-01-01

TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

Science.gov (United States)

Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

2011-02-01

  This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

Dead Time in the LAr Calorimeter Front-End Readout

CERN Document Server

Gingrich, D M

2002-01-01

We present readout time, latency, buffering, and dead-time calculations for the switched capacitor array controllers of the LAr calorimeter. The dead time is compared with algorithms for the dead-time generation in the level-1 central trigger processor.

Genetic association analysis of LARS2 with type 2 diabetes

DEFF Research Database (Denmark)

Reiling, E; Jafar-Mohammadi, B; van 't Riet, E

2010-01-01

was to establish the true contribution of this variant and common variants in LARS2 (MAF > 5%) to type 2 diabetes risk. METHODS: We combined genome-wide association data (n = 10,128) from the DIAGRAM consortium with independent data derived from a tagging single nucleotide polymorphism (SNP) approach in Dutch...... individuals (n = 999) and took forward two SNPs of interest to replication in up to 11,163 Dutch participants (rs17637703 and rs952621). In addition, because inspection of genome-wide association study data identified a cluster of low-frequency variants with evidence of type 2 diabetes association, we...... of sequence variants in LARS2 in type 2 diabetes susceptibility, we found no evidence to support previous data indicating a role in type 2 diabetes susceptibility....

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Science.gov (United States)

Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

2015-01-01

"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

Directory of Open Access Journals (Sweden)

Besic Nikola

2008-09-01

Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

Arrival of the last cryostat for the ATLAS LAr calorimeter at CERN

CERN Multimedia

Aleksa, M; Oberlack, H

On Wednesday, 4th June the last cryostat for the ATLAS LAr calorimeter (end-cap A) arrived at CERN and was immediately unloaded from the truck in building 180 (see Figures 1 and 2), where the integration of the LAr calorimeters into their cryostats takes place. The transport from the Italian company SIMIC, where both end-cap calorimeters have been produced took longer than expected due to delays because of the G8 summit. Thanks to the great effort by the CERN Host State office and the French-German steering group that supplies the end-cap cryostat as an in-kind contribution to the LAr collaboration, an exceptional convoy was finally available and the cryostat could make its way to CERN. Fig.1 (left): Truck with the end-cap cryostat. Fig.2 (right): Unloading the cryostat in bldg. 180. Each end-cap cryostat will contain an electromagnetic calorimeter wheel, two wheels of a hadronic calorimeter, and a forward calorimeter. The design of the cryostat as a double vessel structure made of Aluminum fulfills t...

Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

Energy Technology Data Exchange (ETDEWEB)

Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

1994-09-01

Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

The human protein disulfide isomerase gene family

Directory of Open Access Journals (Sweden)

Galligan James J

2012-07-01

Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

ATLAS LAr Calorimeter Performance in LHC Run-2

CERN Document Server

Morgenstern, Stefanie; The ATLAS collaboration

2018-01-01

Liquid-argon (LAr) sampling calorimeters are employed by ATLAS for all electromagnetic calorimetry in the pseudo-rapidity region $\\eta<3.2$, and for hadronic and forward calorimetry in the region from $\\eta=1.5$ to $\\eta=4.9$. In the first LHC run a total luminosity of $27\\,\\mathrm{fb}^{-1}$ has been collected at centre-of-mass energies of $7-8\\,\\mathrm{TeV}$. After detector consolidation during a long shutdown, Run-2 started in 2015 and $86.4\\,\\mathrm{fb}^{-1}$ of data at a centre-of-mass energy of $13\\,\\mathrm{TeV}$ have been recorded. In order to realize the level-1 acceptance rate of $100\\,\\mathrm{kHz}$ in Run-2 data taking, the number of readout samples recorded and used for the energy and the time measurement has been modified from five to four while keeping the expected performance. The well calibrated and highly granular LAr calorimeter reached its design values both in energy measurement as well as in direction resolution. This contribution will give an overview of the detector operation, hardware...

A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

DEFF Research Database (Denmark)

Hansen, Martin A; Nielsen, John E; Retelska, Dorota

2008-01-01

, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

Dichotomy in the NRT gene families of dicots and grass species.

Directory of Open Access Journals (Sweden)

Darren Plett

Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

Science.gov (United States)

Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

2013-01-01

The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

Science.gov (United States)

Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

2016-10-01

Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

Directory of Open Access Journals (Sweden)

Jie Luo

2018-01-01

Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

Mobil reklamlar ve mobil reklam araçlarına yönelik tutumlar

OpenAIRE

Barutçu, Süleyman; Öztürk Göl, Meltem

2009-01-01

Bu çalışmanın amacı, pazarlama bölümü yöneticilerinin dikkatlerini mobil iletişim teknolojilerindeki gelişmelerin sonucu olarak ortaya çıkan mobil pazarlama ve mobil reklam uygulamalarına çekmektir. Çalışmanın kavramsal analiz bölümünde mobil pazarlama, mobil reklamların önemi açıklanmış ve mobil reklam araçları (SMS, MMS ve Bluetooth Reklamları) analiz edilmiştir. Araştırma bölümünde ise mobil telefon kullanıcılarının mobil reklam araçlarına yönelik tutumlarının karşılaştırmalı olarak belirl...

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer

2012-03-29

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

Directory of Open Access Journals (Sweden)

Lawton Jennifer

2012-03-01

Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

2012-01-01

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Directory of Open Access Journals (Sweden)

Petar Petrov

Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

Plant ion channels: gene families, physiology, and functional genomics analyses.

Science.gov (United States)

Ward, John M; Mäser, Pascal; Schroeder, Julian I

2009-01-01

Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

Directory of Open Access Journals (Sweden)

Li Guo

2014-01-01

Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

Novel genetic variants in miR-191 gene and familial ovarian cancer

International Nuclear Information System (INIS)

Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

2010-01-01

Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

Molecular analysis of the NDP gene in two families with Norrie disease.

Science.gov (United States)

Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

2005-04-01

To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

DEFF Research Database (Denmark)

Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

2006-01-01

MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

Science.gov (United States)

Al-Salam, Ahmad; Irwin, David M

2017-06-23

Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

Polymorphism in the interferon-{alpha} gene family

Energy Technology Data Exchange (ETDEWEB)

Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

1996-09-01

A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

msh/Msx gene family in neural development.

Science.gov (United States)

Ramos, Casto; Robert, Benoît

2005-11-01

The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

Science.gov (United States)

Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

2012-01-01

Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

Budget impact of pasireotide LAR for the treatment of acromegaly, a rare endocrine disorder.

Science.gov (United States)

Zhang, J J; Nellesen, D; Ludlam, W H; Neary, M P

2016-01-01

Acromegaly is a rare disorder characterized by the over-production of growth hormone (GH). Patients often experience a range of chronic comorbidities including hypertension, cardiac dysfunction, diabetes, osteoarthropathy, and obstructive sleep apnea. Untreated or inadequately controlled patients incur substantial healthcare costs, while normalization of GH levels may reduce morbidity and mortality rates to be comparable to the general population. To assess the 3-year budget impact of pasireotide LAR on a US managed care health plan following pasireotide LAR availability. Two separate economic models were developed: one from the perspective of an entire health plan and another from the perspective of a pharmacy budget. The total budget impact model includes costs of drug therapies and other costs for treatment, monitoring, management of adverse events, and comorbidities. The pharmacy cost calculator only considers drug costs. The total estimated budget impact associated with the introduction of pasireotide LAR is 0.31 cents ($0.0031) per member per month (PMPM) in the first year, 0.78 cents ($0.0078) in the second year, and 1.42 cents ($0.0142) in the third year following FDA approval. Costs were similar or lower from a pharmacy budget impact perspective. For each patient achieving disease control, cost savings from reduced comorbidities amounted to $10,240 per year. Published data on comorbidities for acromegaly are limited. In the absence of data on acromegaly-related costs for some comorbidities, comorbidity costs for the general population were used (may be under-estimates). The budget impact of pasireotide LAR is expected to be modest, with an expected increase of 1.42 cents PMPM on the total health plan budget in the third year after FDA approval. The efficacy of pasireotide LAR in acromegaly, as demonstrated in head-to-head trials compared with currently available treatment options, is expected to be associated with a reduction of the prevalence of

Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

Science.gov (United States)

Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

2016-01-01

WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

ATLAS LAr Calorimeter Performance in LHC Run-2

CERN Document Server

Morgenstern, Stefanie; The ATLAS collaboration

2018-01-01

Liquid argon (LAr) sampling calorimeters are employed by ATLAS for all electromagnetic calorimetry in the pseudo-rapidity region eta<3.2, and for hadronic and forward calorimetry in the region from eta=1.5 to eta=4.9. In the first LHC run a total luminosity of 27 fb-1 has been collected at c.o.m energies of 7-8 TeV. After detector consolidation during a long shutdown, Run-2 started in 2015 and 86.4fb-1 of data at a c.o.m energy of 13 TeV have been recorded. In order to realize the level-1 acceptance rate of 100 kHz in Run-2 data taking, the number of read-out samples recorded and used for the energy and the time measurement has been modified from five to four while keeping the expected performance. The well calibrated and highly granular LAr Calorimeter reached its design values both in energy measurement as well as in direction resolution. This contribution will give an overview of the detector operation, hardware improvements, changes in the monitoring and data quality procedures, to cope with increased ...

Genome-wide identification of the SWEET gene family in wheat.

Science.gov (United States)

Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

2018-02-05

The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

Directory of Open Access Journals (Sweden)

Walker Angela M

2009-04-01

Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

Identification and characterization of NF-YB family genes in tung tree.

Science.gov (United States)

Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

2015-12-01

The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

Duplications and losses in gene families of rust pathogens highlight putative effectors.

Science.gov (United States)

Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

2014-01-01

Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Genomewide analysis of TCP transcription factor gene family in ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

LAr calorimeter for SCC with a common vacuum bulkhead---a concept to improve hermeticity

International Nuclear Information System (INIS)

Pope, W.L.; Watt, R.D.

1989-11-01

A new concept for a Barrel/Endcap LAr Calorimeter (LAC) is described in which the Barrel and Endcaps are in separate vacuum enclosures but share a common vacuum bulkhead (CVB). We explore 2 possible bulkhead construction types; welded plate sandwich panels, and brazed sandwich panels in which the core is an isotropic cellular solid--foamed aluminum. Gas lines and electric cables from he innermost Drift Chamber pass through radial holes in the core of the sandwich bulkhead. The CVB concept offers the potential to obtain a more hermetic calorimeter with significantly reduced dead material and/or space in the interface region common to conventional design LAr detectors for the SSC with Endcap features. To utilize a common additional steps to remove the Drift Chamber, a large increase in Endcap standby heat leak, and perhaps, new cryogenic safety issues. We find that significant amount of dead mass can be removed from critical regions of the vacuum shells when compared to a promising SSC LAC reference design. It is also shown that the increased standby heat leak of this concept can be easily removed by existing cooling capacity in another large LAr calorimeter. It is further shown that shut-downs need not be appreciably longer. Finally, it is argued that cryogen spill hazards can be avoided if the Endcap's LAr is removed during Drift chamber maintenance shutdowns, and that cryogenic safety is not compromised

The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

Directory of Open Access Journals (Sweden)

Mohammad H Dezfulian

Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Science.gov (United States)

Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

Operation plan for the data 100/LARS terminal system

Science.gov (United States)

Bowen, A. J., Jr.

1980-01-01

The Data 100/LARS terminal system provides an interface for processing on the IBM 3031 computer system at Purdue University's Laboratory for Applications of Remote Sensing. The environment in which the system is operated and supported is discussed. The general support responsibilities, procedural mechanisms, and training established for the benefit of the system users are defined.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

Science.gov (United States)

Rawal, H C; Singh, N K; Sharma, T R

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

Directory of Open Access Journals (Sweden)

H. C. Rawal

2013-01-01

Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Readout Electronics for the ATLAS LAr Calorimeter at HL-LHC

CERN Document Server

Chen, H; The ATLAS collaboration

2011-01-01

The ATLAS experiment is one of the two general-purpose detectors designed to study proton-proton collisions (14 TeV in the center of mass) produced at the Large Hadron Collider (LHC) and to explore the full physics potential of the LHC machine at CERN. The ATLAS Liquid Argon (LAr) calorimeters are high precision, high sensitivity and high granularity detectors designed to provide precision measurements of electrons, photons, jets and missing transverse energy. ATLAS (and its LAr Calorimeters) has been operating and collecting p-p collisions at LHC since 2009. The on-detector electronics (front-end) part of the current readout electronics of the calorimeters measures the ionization current signals by means of preamplifiers, shapers and digitizers and then transfers the data to the off-detector electronics (back-end) for further elaboration, via optical links. Only the data selected by the level-1 calorimeter trigger system are transferred, achieving a bandwidth reduction to 1.6 Gbps. The analog trigger sum sig...

Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

Science.gov (United States)

Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

2018-02-16

For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

Genomewide analysis of MATE-type gene family in maize reveals ...

Indian Academy of Sciences (India)

Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

Science.gov (United States)

Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

2016-01-01

WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

Duplications and losses in gene families of rust pathogens highlight putative effectors

Directory of Open Access Journals (Sweden)

Amanda L. Pendleton

2014-06-01

Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

Science.gov (United States)

Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

2014-01-01

Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

DEFF Research Database (Denmark)

Christiansen, Michael W; Gregersen, Per L.

2014-01-01

-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

Altın Fiyatlarının Yapay Sinir Ağları ile Tahmini ve Bir Uygulama

Directory of Open Access Journals (Sweden)

Rıdvan YÜKSEL

2016-03-01

Full Text Available Bu çalışmada altın fiyatlarını yapay sinir ağları ile öngörmek amacıyla, altın fiyatlarını etkileyebileceği düşünülen değişkenler olan Gümüş fiyatları, Brent Petrol fiyatları, ABD doları/ EUR paritesi, EuroNext100 endeksi, Amerika Dow Jones Endeksi, 13 Hafta vadeli ABD bonosu faiz oranı ve ABD TÜFE endeksi kullanılarak modeller kurulmuştur. Yapay sinir ağları ile kurulan modellerden elde edilen tahmin sonuçları, gerçek değerler ile R2, RMSE, MAE ve MAPE (% gibi performans kriterleri hesaplanarak karşılaştırılmıştır. Elde edilen bulgular yapay sinir ağlarının altın fiyatlarının tahmininde başarı ile kullanılabileceğini göstermektedir. Yapılan duyarlılık analizinin sonuçları değerlendirildiğinde altın fiyatlarını etkileyen faktörlerin başında gümüş ve petrol fiyatlarının geldiği tespit edilmiştir.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Directory of Open Access Journals (Sweden)

Behzad Davarniya

Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

Science.gov (United States)

Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

The ACBP gene family in Rhodnius prolixus

DEFF Research Database (Denmark)

Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

2016-01-01

The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

Identification of the 14-3-3 gene family in Rafflesia cantleyi

Science.gov (United States)

Rosli, Khadijah; Wan, Kiew-Lian

2018-04-01

Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

Science.gov (United States)

Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

2017-10-01

The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

Brüssel Euroopa pealinnaks? / Ülar Mark

Index Scriptorium Estoniae

Mark, Ülar, 1968-

2009-01-01

Brüsseli Euroopa kvartali planeerimisvõistlusest, mille peakorraldaja oli Brüsseli pealinna piirkond koos Brüsseli linna ja Euroopa Komisjoniga. Eestist osales žüriis arhitekt Ülar Mark. Meeskonna Atelier Christian de Portzamparc võidutööst ja teiste teise vooru pääsenud nelja meeskonna (JDS / Julien De Smedt Architects, OMA / Office for Metropolitan Architecture, Xaveer De Geyter Architect, Fletcher Priest Architects) töödest

Application of SDSM and LARS-WG for simulating and downscaling of rainfall and temperature

Science.gov (United States)

Hassan, Zulkarnain; Shamsudin, Supiah; Harun, Sobri

2014-04-01

Climate change is believed to have significant impacts on the water basin and region, such as in a runoff and hydrological system. However, impact studies on the water basin and region are difficult, since general circulation models (GCMs), which are widely used to simulate future climate scenarios, do not provide reliable hours of daily series rainfall and temperature for hydrological modeling. There is a technique named as "downscaling techniques", which can derive reliable hour of daily series rainfall and temperature due to climate scenarios from the GCMs output. In this study, statistical downscaling models are used to generate the possible future values of local meteorological variables such as rainfall and temperature in the selected stations in Peninsular of Malaysia. The models are: (1) statistical downscaling model (SDSM) that utilized the regression models and stochastic weather generators and (2) Long Ashton research station weather generator (LARS-WG) that only utilized the stochastic weather generators. The LARS-WG and SDSM models obviously are feasible methods to be used as tools in quantifying effects of climate change condition in a local scale. SDSM yields a better performance compared to LARS-WG, except SDSM is slightly underestimated for the wet and dry spell lengths. Although both models do not provide identical results, the time series generated by both methods indicate a general increasing trend in the mean daily temperature values. Meanwhile, the trend of the daily rainfall is not similar to each other, with SDSM giving a relatively higher change of annual rainfall compared to LARS-WG.

APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

NARCIS (Netherlands)

Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

1997-01-01

Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

Directory of Open Access Journals (Sweden)

Yi Yong-Zhu

2006-08-01

Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

Labores, quitutes e panelas: em busca do lar ideal Handiwork, dainties and pans: searching for the ideal home

Directory of Open Access Journals (Sweden)

Maria Cecília Barreto Amorim Pilla

2008-06-01

Full Text Available A partir do conceito de auto-governo, entendido como um modelo psicológico capaz de garantir o reconhecimento e respeito do próximo, uma valorização de si mesmo, este artigo propõe uma reflexão a respeito da mulher no desempenho do papel de "rainha do lar" no Brasil do início do século XX. Na preparação da casa repousava a valorização de uma conduta controlada da dona-de-casa, que deveria manter o controle sobre tudo e sobre todos, tendo aí a oportunidade de demonstrar sua capacidade de governar a si, seu lar e sua família.This study begins from the concept of self-guidance understood as a psychological model capable to guarantee the recognition and respect of the next one, a self-valorization. It propitiates a reflection regarding the woman in the performance of the paper of "queen of the home" in Brazil of the beginning of the XX century. In the preparation of the house rested the valuation of a controlled behavior of the housewife, that would have to keep the control on everything and all, having there the chance to demonstrate its capacity to govern itself, its home and its family.

The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

Directory of Open Access Journals (Sweden)

Iva Tomalova

Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

Search for intracranial aneurysm susceptibility gene(s using Finnish families

Directory of Open Access Journals (Sweden)

Ryynänen Markku

2002-08-01

Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

Institute of Scientific and Technical Information of China (English)

Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

2007-01-01

The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

Science.gov (United States)

Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

2005-10-01

We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

Natural killer cell receptor genes in the family Equidae: not only Ly49.

Directory of Open Access Journals (Sweden)

Jan Futas

Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

Science.gov (United States)

Futas, Jan; Horin, Petr

2013-01-01

Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

[Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

Science.gov (United States)

Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

2014-01-01

Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

NDP gene mutations in 14 French families with Norrie disease.

Science.gov (United States)

Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

2003-12-01

Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

Science.gov (United States)

Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

2017-01-25

Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

International Nuclear Information System (INIS)

Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

2000-01-01

Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

Evolution of the MAGUK protein gene family in premetazoan lineages

Directory of Open Access Journals (Sweden)

Ruiz-Trillo Iñaki

2010-04-01

Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

Genome-wide analysis of the WRKY gene family in cotton.

Science.gov (United States)

Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

2014-12-01

WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

Genome organization and expression of the rat ACBP gene family

DEFF Research Database (Denmark)

Mandrup, S; Andreasen, P H; Knudsen, J

1993-01-01

pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

Science.gov (United States)

Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

2013-01-01

EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

[Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

Science.gov (United States)

Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

2017-08-10

To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

Peynirlere Kontamine Olan Küflerin Bazı Esansiyel Yağlar ile İnhibisyonu

Directory of Open Access Journals (Sweden)

Sibel Özçakmak

2015-02-01

Full Text Available Küf kontaminasyonu önemli kalite problemlerine ve peynir üreticilerine ekonomik kayıplara neden olmaktadır. Peynirlerden yaygın olarak izole edilen kontamine küf türleri Penicillium commune, P. verrucosum, P. roqueforti, P. palitans, Aspergillus flavus ve Geotrichum candidum olarak belirlenmiştir. Sorbik asit veya bunların tuzları, bozulma etmeni küflerin önlenmesi için peynir yüzeylerine uygulanmaktadır. Bazı sentetik gıda katkılarının kullanımıyla ilgili gıda endüstrisi ve mevzuatı oluşturan kuruluşlar tarafından getirilen kısıtlamalar doğal antimikrobiyel bileşikler üzerine araştırmaların doğmasına neden olmuştur. Bitki ve baharat, gıdaların mikrobiyolojik güvenliğini sağlayan etkili bileşiklere sahiptir. Salvia officinalis (ada çayı, Laurus nobilis (defne, Cinnamomum zeylanicum (tarçın, Thymus vulgaris (kekik, Cymbopogon citratus (limon otu, Origanum vulgare (keklik otu esansiyel yağları, bozulma etmeni küf şorasını inhibe edebilmiştir. Thymol ve karanfil esansiyel yağlarının Çedar peynirinde P. citrinum, Kaşar peynirinde A. flavus; zeytin yaprağı ekstraklarının, Tulum peynirinde A. niger, P. citrinum ve P. roqueforti, beyaz peynirde Mucor rocemosus’un gelişimini inhibe edebildiği bildirilmiştir.

ATLAS LAr Calorimeter Performance and Commissioning for LHC Run-2

CERN Document Server

Spettel, Fabian; The ATLAS collaboration

2015-01-01

The ATLAS detector was designed and built to study proton-proton colli- sions produced at the LHC at centre-of-mass energies up to 14 TeV and in- stantaneous luminosities up to $10^{34} \\text{cm}^{-2} \\text{s}^{-1}$. Liquid argon (LAr) sampling calorimeters are employed for all electromagnetic calorimetry in the pseudorapidity region $|\\eta|<3.2$, and for hadronic calorimetry in the region from $|\\eta|=1.5$ to $|\\eta|=4.9$. In the first LHC run a total luminosity of 27 $\\text{fb}^{-1}$ as been collected at center-of-mass energies of 7-8 TeV with very high operational efficiency of the LAr Calorimeters and excellent performance. The well calibrated and highly granular detector achieved its design values both in energy measurement as well as in direction resolution, which was a main ingredient for the successul discovery of a Higgs boson in the di-photon decay channel. The talk will give an overview of the procedures applied to calibrate the 180.000 read-out channels electronically as well as from using refe...

A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

Science.gov (United States)

Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

2016-03-01

Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

Directory of Open Access Journals (Sweden)

Tran Lan T

2012-08-01

Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

Science.gov (United States)

Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

1995-05-20

Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Common mutations identified in the MLH1 gene in familial Lynch syndrome

Directory of Open Access Journals (Sweden)

Jisha Elias

2017-12-01

In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

The WA105-3x1x1 m3 dual phase LAr-TPC demonstrator

CERN Document Server

Murphy, Sebastien

2016-11-15

The dual phase Liquid Argon Time Projection Chamber (LAr TPC) is the state-of-art technology for neutrino detection thanks to its superb 3D tracking and calorimetry performance. Its main feature is the charge amplification in gas argon which provides excellent signal-to-noise ratio. Electrons produced in the liquid argon are extracted in the gas phase. Here, a readout plane based on Large Electron Multiplier detectors provides amplification of the charges before its collection onto an anode with strip readout. The charge amplification enables constructing fully homoge- nous giant LAr-TPCs with tuneable gain, excellent charge imaging performance and increased sensitivity to low energy events. Following a staged approach the WA105 collaboration is con- structing a dual phase LAr-TPC with an active volume of 3x1x1m3 that will soon be tested with cosmic rays. Its construction and operation aims to test scalable solutions for the crucial aspects of this technology: ultra high argon purity in non-evacuable tank, la...

The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

Science.gov (United States)

Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

2018-05-01

Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

Science.gov (United States)

Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

2010-05-06

Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

Directory of Open Access Journals (Sweden)

Naoki Takata

Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

Directory of Open Access Journals (Sweden)

Yan Liangzhen

2012-11-01

Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

Science.gov (United States)

Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

2018-02-01

WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

Science.gov (United States)

Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

2013-12-01

Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

Science.gov (United States)

Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

2007-01-31

Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

Science.gov (United States)

Deokar, Amit A; Tar'an, Bunyamin

2016-01-01

Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

Massive expansion of the calpain gene family in unicellular eukaryotes

Directory of Open Access Journals (Sweden)

Zhao Sen

2012-09-01

Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

Massive expansion of the calpain gene family in unicellular eukaryotes.

Science.gov (United States)

Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

2012-09-29

Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

Directory of Open Access Journals (Sweden)

kun feng

2016-08-01

Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

Directory of Open Access Journals (Sweden)

Wei Li

2016-04-01

Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

Directory of Open Access Journals (Sweden)

Nordlund Henri R

2005-03-01

Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

Aladağlar da Bitki Formasyonları ve Dağılışları

OpenAIRE

ÜNALDI, Ülkü ESER; TOROĞLU, Emin

2007-01-01

Bulunduğu konum itibariyle Türkiye\\'de yetişme şartlarının bitki gelişimine ve çeşitliliğine uygun koşullar taşıdığı yerlerden biri de Aladağlar\\'dır. Nitekim dağda orman, çalı ve ot formasyonları yer almaktadır. Orman formasyonu kuru ormanlar ve yarı nemli ormanlar olmak üzere ikiye ayrılmaktadır. Kuru ormanlar güney yamaçta 250-1300mler, kuzey yamaçta 1400–2400 mler arasında uzanmaktadır. Kuru ormanların hakim elemanları güney yamaçlarda kızılçam, kuzey yamaçlarda i...

[Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

Science.gov (United States)

Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

2011-12-01

To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

Science.gov (United States)

Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

2017-06-09

Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

Science.gov (United States)

Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

2018-04-01

In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

Science.gov (United States)

Juranić, Martina; Dresselhaus, Thomas

2014-01-01

MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

DEFF Research Database (Denmark)

Davis, Margaret R.; Andersson, Robin; Severin, Jessica

2014-01-01

in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

Genome-wide analysis of the GRAS gene family in Prunus mume.

Science.gov (United States)

Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

2015-02-01

Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

[Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

Science.gov (United States)

Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

2016-08-01

To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

Science.gov (United States)

Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

2016-01-01

Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

Science.gov (United States)

Huang, Qin; Wang, Meiping; Xia, Zongliang

2018-01-01

Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

The sieve element occlusion gene family in dicotyledonous plants.

Science.gov (United States)

Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

2011-01-01

Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

Science.gov (United States)

Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

Science.gov (United States)

Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

2011-11-01

The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

International Nuclear Information System (INIS)

Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

2003-01-01

The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

Nõmme maja "Kergus" : Kerese tn., Tallinn / Ülar Mark, Kalle Komissarov

Index Scriptorium Estoniae

Mark, Ülar

1999-01-01

Kahekorruselise, tänavapoolse pika umbse seinaga eramu projekteeris Arhitektuuribüroo Mark & Tamm, arhitekt Ülar Mark, kaasautor Kalle Komissarov. Konstruktiivne osa: Randväli & Karema Inseneribüroo. Projekt 1997, hoone valmis 1999. Eramu tähenduse ümbermõtestamisest. 13 illustratsiooni: korruste plaanid, välisvaated, sisevaade.Mark & Tamm (arhitektibüroo)

Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

Directory of Open Access Journals (Sweden)

Juergen H Nett

Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

Science.gov (United States)

Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

2018-02-21

Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

Directory of Open Access Journals (Sweden)

Sanambar Sadighi

2017-02-01

Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

Genomewide analysis of TCP transcription factor gene family in ...

Indian Academy of Sciences (India)

2014-12-09

Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

Science.gov (United States)

Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

2015-12-01

Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

Directory of Open Access Journals (Sweden)

Glen Peter

2009-12-01

Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

Science.gov (United States)

Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

2013-04-01

Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

Science.gov (United States)

Shastry, B S; Trese, M T

2000-01-01

Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

The claudin gene family: expression in normal and neoplastic tissues

International Nuclear Information System (INIS)

Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

2006-01-01

The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

Genome-wide identification and expression analysis of the WRKY gene family in cassava

Directory of Open Access Journals (Sweden)

Yunxie eWei

2016-02-01

Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

Science.gov (United States)

Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

2016-01-01

The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

Directory of Open Access Journals (Sweden)

LISTYA UTAMI KARMAWAN

2009-03-01

Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

FGF: A web tool for Fishing Gene Family in a whole genome database

DEFF Research Database (Denmark)

Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

2007-01-01

to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

Diverse roles of ERECTA family genes in plant development.

Science.gov (United States)

Shpak, Elena D

2013-12-01

Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

Directory of Open Access Journals (Sweden)

Atanassova Rossitza

2010-11-01

Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

Science.gov (United States)

Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

2013-02-01

Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

Directory of Open Access Journals (Sweden)

Preeti Arya

Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

Science.gov (United States)

Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

2014-01-01

Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

Molecular study of the perforin gene in familial hematological malignancies

Directory of Open Access Journals (Sweden)

El Abed Rim

2011-09-01

Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

Electron Attenuation Measurement using Cosmic Ray Muons at the MicroBooNE LArTPC

Energy Technology Data Exchange (ETDEWEB)

Meddage, Varuna [Kansas State U., Manhattan

2017-10-01

The MicroBooNE experiment at Fermilab uses liquid argon time projection chamber (LArTPC) technology to study neutrino interactions in argon. A fundamental requirement for LArTPCs is to achieve and maintain a low level of electronegative contaminants in the liquid to minimize the capture of drifting ionization electrons. The attenuation time for the drifting electrons should be long compared to the maximum drift time, so that the signals from particle tracks that generate ionization electrons with long drift paths can be detected efficiently. In this talk we present MicroBooNE measurement of electron attenuation using cosmic ray muons. The result yields a minimum electron 1/e lifetime of 18 ms under typical operating conditions, which is long compared to the maximum drift time of 2.3 ms.

Evolution of the defensin-like gene family in grass genomes

Indian Academy of Sciences (India)

that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

Directory of Open Access Journals (Sweden)

Jie Chen

2014-03-01

Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

Science.gov (United States)

Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

2014-06-01

Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

A comprehensive family-based replication study of schizophrenia genes

DEFF Research Database (Denmark)

Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

2013-01-01

 768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

OpenAIRE

Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

DEFF Research Database (Denmark)

Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

2013-01-01

Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

Small Mutations of the DMD Gene in Taiwanese Families

Directory of Open Access Journals (Sweden)

Hsiao-Lin Hwa

2008-06-01

Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

Directory of Open Access Journals (Sweden)

Bowerman Bruce

2009-08-01

Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

Histogramming in the LATOME-firmware for the Phase-1 upgrade of the ATLAS LAr calorimeter readout

Energy Technology Data Exchange (ETDEWEB)

Horn, Philipp; Hentges, Rainer; Straessner, Arno [Institut fuer Kern- und Teilchenphysik, Dresden (Germany)

2016-07-01

Due to the increased luminosity and the higher effective event rate after the phase 1 upgrade the ATLAS LAr detector needs new trigger electronics. The so-called LATOME-Board was designed as a LAr Digital Processing Blade (LPDB) to reconstruct the energy deposited by the particles and is an important part of the read out system. A prototype has already been build and the firmware for the on-board FPGA is under development. The insertion of a histogram-builder in this device gives the unique opportunity to look at untriggered data. This talk provides an insight in the LATOME-firmware and shows the different possibilities to implement the histogram-builder.

Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

Czech Academy of Sciences Publication Activity Database

Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

2007-01-01

Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

GDNF gene is associated with tourette syndrome in a family study.

Science.gov (United States)

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

2015-07-01

Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

GDNF Gene Is Associated With Tourette Syndrome in a Family Study

Science.gov (United States)

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

2016-01-01

Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

Directory of Open Access Journals (Sweden)

S. Pamela K. Shiao

2018-02-01

Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

[The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

Science.gov (United States)

Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

2014-12-01

To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

Science.gov (United States)

Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

2003-01-01

Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

Gene screening in a Chinese family with Marfan syndrome

Directory of Open Access Journals (Sweden)

Wen-Jiao Xia

2016-05-01

Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

Science.gov (United States)

Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

2018-03-01

The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

Science.gov (United States)

He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

2017-08-23

The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

[PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

Science.gov (United States)

Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

2016-12-07

Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

Science.gov (United States)

Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

2018-04-01

Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

Lichenised and Lichenicolous Fungi of Aladağlar National Park (Niğde, Kayseri and Adana Provinces) in Turkey

OpenAIRE

HALICI, Mehmet Gökhan; AKSOY, Ahmet

2014-01-01

Three hundred and two lichenised fungi taxa belonging to 90 genera and 45 lichenicolous fungi taxa belonging to 24 genera are reported from Aladağlar National Park. Of these, 290 lichenised fungi taxa and 21 lichenicolous fungi taxa are reported for the first time from Aladağlar National Park. Nine species of lichenised fungi, namely Arthopyrenia fraxini A.Massal., Aspicilia obscurata (Fr.) Arnold, Cephalophysis leucospila (Anzi) H.Kilias & Scheid., Chaenotheca ferruginea (Turner ex S...

Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

Science.gov (United States)

Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

2017-01-01

Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

Directory of Open Access Journals (Sweden)

Srivastava Satish

2003-07-01

Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

Science.gov (United States)

Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

1997-04-01

Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

International Nuclear Information System (INIS)

Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

2007-01-01

Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

[Analysis of gene mutation in a Chinese family with Norrie disease].

Science.gov (United States)

Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

2012-09-01

To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

Science.gov (United States)

Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

2016-10-03

The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

Uneventful octreotide LAR therapy throughout three pregnancies, with favorable delivery and anthropometric measures for each newborn: a case report

Directory of Open Access Journals (Sweden)

Naccache Deeb

2011-08-01

Full Text Available Abstract Introduction The safety of octreotide use, in its short-acting preparation, in pregnancy is still unclear. This report provides the first documentation of uneventful octreotide LAR use during three pregnancies in a woman with bronchial carcinoid-associated adrenocorticotropic hormone-dependent Cushing's syndrome. Case presentation A 25-year-old Arabic woman presented to our emergency department with rapid onset of headache, flaring acne and hirsutism, facial puffiness, weight gain and paroxysmal myopathy, and paranoiac thoughts of rape and sexual intimidation. After undergoing surgical removal of a mass by left lower lung lobectomy, her residual lung disease medical therapy failed. Chronic octreotide LAR injections were initiated as indicated by a positive octreoscan. Follow-up revealed a long-lasting positive response to octreotide. Avidity of octreotide to somatostatin receptor sub-type 2 was later confirmed by a positive somatostatin receptor sub-type 2 in the resected tumor specimen. Against our instructions, the patient had three spontaneous pregnancies leading to delivery of three full-term healthy children while her octreotide LAR therapy continued. Conclusion This case adds more data supporting the potential for the safe use of octreotide and the feasibility of octreotide LAR use during pregnancy, making compliance with the patient's preference not to withdraw octreotide therapy as soon as her pregnancy is confirmed a thoughtful option.

"It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

Science.gov (United States)

Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

2015-05-01

Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

Science.gov (United States)

Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

2015-11-24

Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

A CULPA É DA MULHER: O Anticristo, de Lars von Trier

Directory of Open Access Journals (Sweden)

João Nunes Silva

2016-08-01

Full Text Available RESUMO O Anticristo, filme de Lars von Trier, lançado em 2009, mostra o desespero de um casal ao perder seu único filho. Extremamente polêmico e repleto de referências bíblicas - a começar pelo título -, é um filme que choca pelo incessante desespero de uma mãe em luto que parece carregar o peso do mundo em sua condição de mulher. A proposta deste artigo é fazer uma análise deste filme iluminando a culpa cristã historicamente atribuída à mulher e seus desdobramentos imediatos, como o feminicídio.   PALAVRAS-CHAVE: Análise Fílmica; Cristianismo; Feminicídio; O Anticristo.   ABSTRACT Antichrist, film of Lars von Trier, released on 2009, shows the the despair of a couple to lose their only son. Extremely controversial and fraught with biblical references - beginning with the title -, it’s a film that shocked the unyielding despair a bereaved mother that seems to carry the weight of the world on his wife's condition. The purpose of this paper is to analyze of this film illuminating the christian guilt historically attributed to the woman and their immediate consequences, like the feminicide.   KEYWORDS: Filmic Analysis; Christianity; Feminicide; Antichrist.     RESUMEN Anticristo, pelicula de Lars von Trier, lanzada em 2009, muestra el desespero de una pareja cuando pierde su único hijo. Extremadamente polémica y llena de referencias bíblicas - empezando con el título -, es una película que sorprende al inquebrantable desesperación de una madre em luto que parece cargar el peso del mundo por ser mujer. El objetivo de este artículo es analizar esta película iluminando la culpa cristiana históricamente asignada a las mujeres y sus consecuencias inmediatas, como el feminicidio.   PALABRAS CLAVE: Análisis fílmica; Cristianismo; Feminicidio; Anticristo.

Increasing the efficiency of photon collection in LArTPCs: the ARAPUCA light trap

Science.gov (United States)

Cancelo, G.; Cavanna, F.; Escobar, C. O.; Kemp, E.; Machado, A. A.; Para, A.; Segreto, E.; Totani, D.; Warner, D.

2018-03-01

The Liquid Argon Time Projection Chambers (LArTPCs) are a choice for the next generation of large neutrino detectors due to their optimal performance in particle tracking and calorimetry. The detection of Argon scintillation light plays a crucial role in the event reconstruction as well as the time reference for non-beam physics such as supernovae neutrino detection and baryon number violation studies. In this contribution, we present the current R&D work on the ARAPUCA (Argon R&D Advanced Program at UNICAMP), a light trap device to enhance Ar scintillation light collection and thus the overall performance of LArTPCs. The ARAPUCA working principle is based on a suitable combination of dichroic filters and wavelength shifters to achieve a high efficiency in light collection. We discuss the operational principles, the last results of laboratory tests and the application of the ARAPUCA as the alternative photon detection system in the protoDUNE detector.

R&D Studies of the ATLAS LAr Calorimeter Readout Electronics for super-LHC

CERN Document Server

Chen, H

2010-01-01

The ATLAS Liquid Argon (LAr) calorimeters are high precision, high sensitivity and high granularity detectors, total about 180,000 signals are digitized and processed real-time on detector, to provide energy and time deposited in each detector element at every occurrence of the L1-trigger. A luminosity upgrade (x10) of the LHC will occur ~2017, the current readout electronics will have to be upgraded to sustain the higher radiation levels. A completely innovative readout scheme is being developed. The front-end readout will send out data continuously at each bunch crossing through high speed radiation resistant optical links, the data will be processed real-time with the possibility of implementing trigger algorithms. This article is an overview of the R&D activities and architectural studies the ATLAS LAr collaboration is developing: front-end analog and mixed-signal ASIC design, radiation resistance optical-links in SOS, high-speed back-end processing units based on FPGA architectures and power supply d...

Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

Science.gov (United States)

Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

2015-11-27

Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

International Nuclear Information System (INIS)

Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

2015-01-01

Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

2015-11-27

Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

Fluid Flow Patterns During Production from Gas Hydrates in the Laboratory compared to Field Settings: LARS vs. Mallik

Science.gov (United States)

Strauch, B.; Heeschen, K. U.; Priegnitz, M.; Abendroth, S.; Spangenberg, E.; Thaler, J.; Schicks, J. M.

2015-12-01

The GFZ's LArge Reservoir Simulator LARS allows for the simulation of the 2008 Mallik gas hydrate production test and the comparison of fluid flow patterns and their driving forces. Do we see the gas flow pattern described for Mallik [Uddin, M. et al., J. Can. Petrol Tech, 50, 70-89, 2011] in a pilot scale test? If so, what are the driving forces? LARS has a network of temperature sensors and an electric resistivity tomography (ERT) enabling a good spatial resolution of gas hydrate occurrences, water and gas distribution, and changes in temperature in the sample. A gas flow meter and a water trap record fluid flow patterns and a backpressure valve has controlled the depressurization equivalent to the three pressure stages (7.0 - 5.0 - 4.2 MPa) applied in the Mallik field test. The environmental temperature (284 K) and confining pressure (13 MPa) have been constant. The depressurization induced immediate endothermic gas hydrate dissociation until re-establishment of the stability conditions by a consequent temperature decrease. Slight gas hydrate dissociation continued at the top and upper lateral border due to the constant heat input from the environment. Here transport pathways were short and permeability higher due to lower gas hydrate saturation. At pressures of 7.0 and 5.0 MPa the LARS tests showed high water flow rates and short irregular spikes of gas production. The gas flow patterns at 4.2 MPa and 3.0MPa resembled those of the Mallik test. In LARS the initial gas surges overlap with times of hydrate instability while water content and lengths of pathways had increased. Water production was at a minimum. A rapidly formed continuous gas phase caused the initial gas surges and only after gas hydrate dissociation decreased to a minimum the single gas bubbles get trapped before slowly coalescing again. In LARS, where pathways were short and no additional water was added, a transport of microbubbles is unlikely to cause a gas surge as suggested for Mallik.

A space vehicle rotating with a uniform angu- lar velocity about a ...

Indian Academy of Sciences (India)

IAS Admin

A space vehicle rotating with a uniform angu- lar velocity about a vertical axis fixed to it is falling freely vertically downwards, say, with its engine shut off. It carries two astronauts inside it. One astronaut throws a tiny tool towards the other astronaut. The motion of the tiny tool with reference to a rotating frame rigidly fixed.

Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

OpenAIRE

Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

2013-01-01

EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

FGF: A web tool for Fishing Gene Family in a whole genome database

DEFF Research Database (Denmark)

Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

2007-01-01

Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

Research and Development for a Free-Running Readout System for the ATLAS LAr Calorimeters at the High Luminosity LHC

CERN Document Server

AUTHOR|(SzGeCERN)758889; The ATLAS collaboration

2016-01-01

The ATLAS Liquid Argon (LAr) Calorimeters were designed and built to measure electromagnetic and hadronic energy in proton-proton collisions produced at the Large Hadron Collider (LHC) at centre-of-mass energies up to \\SI{14}{\\tera\\electronvolt} and instantaneous luminosities up to \\SI{d34}{\\per\\centi\\meter\\squared\\per\\second}. The High Luminosity LHC (HL-LHC) programme is now developed for up to 5-7 times the design luminosity, with the goal of accumulating an integrated luminosity of \\SI{3000}{\\per\\femto\\barn}. In the HL-LHC phase, the increased radiation levels require a replacement of the front-end (FE) electronics of the LAr Calorimeters. Furthermore, the ATLAS trigger system is foreseen to increase the trigger accept rate and the trigger latency which requires a larger data volume to be buffered. Therefore, the LAr Calorimeter read-out will be exchanged with a new FE and a high bandwidth back-end (BE) system for receiving data from all \

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

Energy Technology Data Exchange (ETDEWEB)

Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

2012-07-13

Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

International Nuclear Information System (INIS)

Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

2012-01-01

Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

Science.gov (United States)

Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

2015-01-01

To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

Science.gov (United States)

Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

2015-11-01

The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

Science.gov (United States)

Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

2017-11-01

Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

DarkSide-20k: A 20 Tonne Two-Phase LAr TPC for Direct Dark Matter Detection at LNGS

Energy Technology Data Exchange (ETDEWEB)

Aalseth, C.E.; et al.

2017-07-25

Building on the successful experience in operating the DarkSide-50 detector, the DarkSide Collaboration is going to construct DarkSide-20k, a direct WIMP search detector using a two-phase Liquid Argon Time Projection Chamber (LArTPC) with an active (fiducial) mass of 23 t (20 t). The DarkSide-20k LArTPC will be deployed within a shield/veto with a spherical Liquid Scintillator Veto (LSV) inside a cylindrical Water Cherenkov Veto (WCV). Operation of DarkSide-50 demonstrated a major reduction in the dominant $^{39}$Ar background when using argon extracted from an underground source, before applying pulse shape analysis. Data from DarkSide-50, in combination with MC simulation and analytical modeling, shows that a rejection factor for discrimination between electron and nuclear recoils of $\\gt3\\times10^9$ is achievable. This, along with the use of the veto system, is the key to unlocking the path to large LArTPC detector masses, while maintaining an "instrumental background-free" experiment, an experiment in which less than 0.1 events (other than $\

Search for anomalies in the neutrino sector with muon spectrometers and large LArTPC imaging detectors at CERN

CERN Document Server

Antonello, A.; Baibussinov, B.; Bilokon, H.; Boffelli, F.; Bonesini, M.; Calligarich, E.; Canci, N.; Centro, S.; Cesana, A.; Cieslik, K.; Cline, D.B.; Cocco, A.G.; Dequal, D.; Dermenev, A.; Dolfini, R.; De Gerone, M.; Dussoni, S.; Farnese, C.; Fava, A.; Ferrari, A.; Fiorillo, G.; Garvey, G.T.; Gatti, F.; Gibin, D.; Gninenko, S.; Guber, F.; Guglielmi, A.; Haranczyk, M.; Holeczek, J.; Ivashkin, A.; Kirsanov, M.; Kisiel, J.; Kochanek, I.; Kurepin, A.; Lagoda, J.; Lucchini, G.; Louis, W.C.; Mania, S.; Mannocchi, G.; Marchini, S.; Matveev, V.; Menegolli, A.; Meng, G.; Mills, G.B.; Montanari, C.; Nicoletto, M.; Otwinowski, S.; Palczewki, T.J.; Passardi, G.; Perfetto, F.; Picchi, P.; Pietropaolo, F.; Plonski, P.; Rappoldi, A.; Raselli, G.L.; Rossella, M.; Rubbia, C.; Sala, P.; Scaramelli, A.; Segreto, E.; Stefan, D.; Stepaniak, J.; Sulej, R.; Suvorova, O.; Terrani, M.; Tlisov, D.; Van de Water, R.G.; Trinchero, G.; Turcato, M.; Varanini, F.; Ventura, S.; Vignoli, C.; Wang, H.G.; Yang, X.; Zani, A.; Zaremba, K; Benettoni, M.; Bernardini, P.; Bertolin, A.; Brugnera, R.; Calabrese, M.; Cecchetti, A.; Cecchini, S.; Collazuol, G.; Creti, P.; Corso, F.Dal; Del Prete, A.; De Mitri, I.; De Robertis, G.; De Serio, M.; Esposti, L.Degli; Di Ferdinando, D.; Dore, U.; Dusini, S.; Fabbricatore, P.; Fanin, C.; Fini, R.A.; Fiore, G.; Garfagnini, A.; Giacomelli, G.; Giacomelli, R.; Guandalini, C.; Guerzoni, M.; Kose, U.; Laurenti, G.; Laveder, M.; Lippi, I.; Loddo, F.; Longhin, A.; Loverre, P.; Mancarella, G.; Mandrioli, G.; Margiotta, A.; Marsella, G.; Mauri, N.; Medinaceli, E.; Mengucci, A.; Mezzetto, M.; Michinelli, R.; Muciaccia, M.T.; Orecchini, D.; Paoloni, A.; Papadia, G.; Pastore, A.; Patrizii, L.; Pozzato, M.; Rosa, G.; Sahnounm, Z.; Simone, S.; Sioli, M.; Sirri, G.; Spurio, M.; Stanco, L.; Surdo, A.; Tenti, M.; Togo, V.; Ventura, M.; Zago, M.

2012-01-01

A new experiment with an intense ~2 GeV neutrino beam at CERN SPS is proposed in order to definitely clarify the possible existence of additional neutrino states, as pointed out by neutrino calibration source experiments, reactor and accelerator experiments and measure the corresponding oscillation parameters. The experiment is based on two identical LAr-TPCs complemented by magnetized spectrometers detecting electron and muon neutrino events at Far and Near positions, 1600 m and 300 m from the proton target, respectively. The ICARUS T600 detector, the largest LAr-TPC ever built with a size of about 600 ton of imaging mass, now running in the LNGS underground laboratory, will be moved at the CERN Far position. An additional 1/4 of the T600 detector (T150) will be constructed and located in the Near position. Two large area spectrometers will be placed downstream of the two LAr-TPC detectors to perform charge identification and muon momentum measurements from sub-GeV to several GeV energy range, greatly comple...

Mutation analysis of the adenomatous polyposis coli (APC) gene in Danish patients with familial adenomatous polyposis (FAP)

DEFF Research Database (Denmark)

Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen

2004-01-01

Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...

Identification of the trehalose-6-phosphate synthase gene family in ...

Indian Academy of Sciences (India)

2015-03-04

Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

Phylogenetic analysis of the MS4A and TMEM176 gene families.

Directory of Open Access Journals (Sweden)

Jonathan Zuccolo

2010-02-01

Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

Expression of REG family genes in human inflammatory bowel diseases and its regulation

Directory of Open Access Journals (Sweden)

Chikatsugu Tsuchida

2017-12-01

Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

Geometrik Yapıların İnşasında Pergel ve Çizgecin Kullanımı

OpenAIRE

Erduran, Ayten; Yeşildere, Sibel

2010-01-01

Bu yapıda üç matematik öğretinin pergel ve çizgeçmenin geometrik yapıları süreçleri incelenmektedir. Öğretmenlerin geometri yapı yapımı ve ilgili dersleri video kamera ile kaydedilmiş ve derslerdeki öğretmen-öğrenci-araç üçlüsü arasındaki etkileşim incelenmiştir. Ders Kitaplığı içeren öğretmenlerle görüşmeler yapıldı. Çalışmada üç matematik öğretmeninin pergel ve çizgeci geometrik yapılar yapı mühendisliği. Araştırma pergel ve çizgeçle geometrik yapıların inşasına ezbere bir anlayışla öğretme...

Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

Directory of Open Access Journals (Sweden)

Qing XU

2018-01-01

Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

Directory of Open Access Journals (Sweden)

Sergey Yegorov

Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

Genome-wide identification and characterization of the SBP-box gene family in Petunia.

Science.gov (United States)

Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

2018-03-12

SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

Dlx homeobox gene family expression in osteoclasts.

Science.gov (United States)

Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

2010-06-01

Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

Directory of Open Access Journals (Sweden)

Yong Guo

Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

Science.gov (United States)

Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

2014-10-01

MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

Directory of Open Access Journals (Sweden)

Rocio Toro

Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

International Nuclear Information System (INIS)

Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

2010-01-01

Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

Energy Technology Data Exchange (ETDEWEB)

Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

2010-10-01

Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

Science.gov (United States)

Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

1993-10-01

Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

Directory of Open Access Journals (Sweden)

Sierra M Li

Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

[Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

Science.gov (United States)

Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

2015-05-01

The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

Directory of Open Access Journals (Sweden)

Daniel Menendez

2011-03-01

Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

Science.gov (United States)

Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

2017-11-01

Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

Directory of Open Access Journals (Sweden)

Xiaoyan Huang

2017-01-01

Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

Directory of Open Access Journals (Sweden)

Eliane Evanovich

2016-01-01

Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

Science.gov (United States)

Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2013-07-25

The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

Complexity of rice Hsp100 gene family: lessons from rice genome ...

Indian Academy of Sciences (India)

Madhu Sudhan

2007-03-29

Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

Science.gov (United States)

Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

2011-03-28

A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Neurexin gene family variants as risk factors for autism spectrum disorder.

Science.gov (United States)

Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

2018-01-01

Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

Genetic diversity of bitter taste receptor gene family in Sichuan

Indian Academy of Sciences (India)

Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

NARCIS (Netherlands)

Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

DEFF Research Database (Denmark)

Hu, H; Haas, S A; Chelly, J

2016-01-01

X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

Directory of Open Access Journals (Sweden)

Carolina eRípodas

2015-01-01

Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

Science.gov (United States)

Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

2014-04-18

The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Experimental observation of an extremely high electron lifetime with the ICARUS-T600 LAr-TPC

CERN Document Server

Antonello, M; Benetti, P; Boffelli, F; Bubak, A; Calligarich, E; Centro, S; Cesana, A; Cieslik, K; Cline, D B; Cocco, A G; Dabrowska, A; Dermenev, A; Dolfini, R; Falcone, A; Farnese, C; Fava, A; Ferrari, A; Fiorillo, G; Gibin, D; Gninenko, S; Guglielmi, A; Haranczyk, M; Holeczek, J; Kirsanov, M; Kisiel, J; Kochanek, I; Lagoda, J; Mania, S; Menegolli, A; Meng, G; Montanari, C; Otwinowski, S; Picchi, P; Pietropaolo, F; Plonski, P; Rappoldi, A; Raselli, G L; Rossella, M; Rubbia, C; Sala, P; Scaramelli, A; Segreto, E; Sergiampietri, F; Stefan, D; Sulej, R; Szarska, M; Terrani, M; Torti, M; Varanini, F; Ventura, S; Vignoli, C; Wang, H; Yang, X; Zalewska, A; Zani, A; Zaremba, K

2014-01-01

The ICARUS T600 detector, the largest liquid Argon Time Projection Chamber (LAr-TPC) realized after many years of RD activities, was installed and successfully operated for 3 years at the INFN Gran Sasso underground Laboratory. One of the most important issues was the need of an extremely low residual electronegative impurity content in the liquid Argon, in order to transport the free electrons created by the ionizing particles with a very small attenuation along the drift path. The solutions adopted for the Argon re-circulation and purification systems have permitted to reach impressive results in terms of Argon purity and a free electron lifetime exceeding 15 ms, corresponding to about 20 parts per trillion of equivalent O2 contamination, a milestone for any future project involving LAr-TPC's and the development of higher detector mass scales.

Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

Directory of Open Access Journals (Sweden)

Ashutosh ePandey

2016-02-01

Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

Identification of wild soybean (Glycine soja) TIFY family genes and their expression profiling analysis under bicarbonate stress.

Science.gov (United States)

Zhu, Dan; Bai, Xi; Luo, Xiao; Chen, Qin; Cai, Hua; Ji, Wei; Zhu, Yanming

2013-02-01

Wild soybean (Glycine soja L. G07256) exhibits a greater adaptability to soil bicarbonate stress than cultivated soybean, and recent discoveries show that TIFY family genes are involved in the response to several abiotic stresses. A genomic and transcriptomic analysis of all TIFY genes in G. soja, compared with G. max, will provide insight into the function of this gene family in plant bicarbonate stress response. This article identified and characterized 34 TIFY genes in G. soja. Sequence analyses indicated that most GsTIFY proteins had two conserved domains: TIFY and Jas. Phylogenetic analyses suggested that these GsTIFY genes could be classified into two groups. A clustering analysis of all GsTIFY transcript expression profiles from bicarbonate stress treated G. soja showed that there were five different transcript patterns in leaves and six different transcript patterns in roots when the GsTIFY family responds to bicarbonate stress. Moreover, the expression level changes of all TIFY genes in cultivated soybean, treated with bicarbonate stress, were also verified. The expression comparison analysis of TIFYs between wild and cultivated soybeans confirmed that, different from the cultivated soybean, GsTIFY (10a, 10b, 10c, 10d, 10e, 10f, 11a, and 11b) were dramatically up-regulated at the early stage of stress, while GsTIFY 1c and 2b were significantly up-regulated at the later period of stress. The frequently stress responsive and diverse expression profiles of the GsTIFY gene family suggests that this family may play important roles in plant environmental stress responses and adaptation.

[Genome-wide identification and expression analysis of the WRKY gene family in peach].

Science.gov (United States)

Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

2016-03-01

The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

Genome-wide identification and expression analysis of the CIPK gene family in cassava

Directory of Open Access Journals (Sweden)

Wei eHu

2015-10-01

Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

Internet and Its Contributions to Library Services Internet: Kütüphane Hizmetlerine Katkıları

Directory of Open Access Journals (Sweden)

Yaşar Çelik

1995-06-01

Full Text Available This paper examines the major Internet services such as email, telnet and ftp and describes various information discovery and retrieval tools such as gopher, WAIS, and WWW. It also discusses the contributions of the Internet to library and information services. Bu makalede elektronik posta, telnet ve ftp gibi belli başlı Internet hizmetleri tanıtılmış, çeşitli bilgi keşfetme ve erişim araçları (gopher, WAIS, WWW açıklanmıştır. İnternet'in kütüphane hizmetlerine katkıları kısaca tartışılmıştır.

Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

Science.gov (United States)

Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

2012-06-06

As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

LArGe: active background suppression using argon scintillation for the GERDA 0νββ-experiment

International Nuclear Information System (INIS)

Agostini, M.; Budjas, D.; Schoenert, S.; Barnabe-Heider, M.; Cattadori, C.; Gangapshev, A.; Gusev, K.; Heisel, M.; Smolnikov, A.; Junker, M.; Klimenko, A.; Lubashevskiy, A.; Pelczar, K.; Zuzel, G.

2015-01-01

LArGe is a GERDA low-background test facility to study novel background suppression methods in a low-background environment, for future application in the GERDA experiment. Similar to GERDA, LArGe operates bare germanium detectors submersed into liquid argon (1 m 3 , 1.4tons), which in addition is instrumented with photomultipliers to detect argon scintillation light. The scintillation signals are used in anti-coincidence with the germanium detectors to effectively suppress background events that deposit energy in the liquid argon. The background suppression efficiency was studied in combination with a pulse shape discrimination (PSD) technique using a BEGe detector for various sources, which represent characteristic backgrounds to GERDA. Suppression factors of a few times 10 3 have been achieved. First background data of LArGe with a coaxial HPGe detector (without PSD) yield a background index of (0.12 - 4.6) x 10 -2 cts/(keV kg year) (90 % C.L.), which is at the level of GERDA Phase I. Furthermore, for the first time we monitor the natural 42 Ar abundance (parallel to GERDA), and have indication for the 2νββ-decay in natural germanium. These results show the effectivity of an active liquid argon veto in an ultra-low background environment. As a consequence, the implementation of a liquid argon veto in GERDA Phase II is pursued. (orig.)

LArGe: active background suppression using argon scintillation for the Gerda 0ν β β -experiment

Science.gov (United States)

Agostini, M.; Barnabé-Heider, M.; Budjáš, D.; Cattadori, C.; Gangapshev, A.; Gusev, K.; Heisel, M.; Junker, M.; Klimenko, A.; Lubashevskiy, A.; Pelczar, K.; Schönert, S.; Smolnikov, A.; Zuzel, G.

2015-10-01

LArGe is a Gerda low-background test facility to study novel background suppression methods in a low-background environment, for future application in the Gerda experiment. Similar to Gerda, LArGe operates bare germanium detectors submersed into liquid argon (1 m^3, 1.4 tons), which in addition is instrumented with photomultipliers to detect argon scintillation light. The scintillation signals are used in anti-coincidence with the germanium detectors to effectively suppress background events that deposit energy in the liquid argon. The background suppression efficiency was studied in combination with a pulse shape discrimination (PSD) technique using a BEGe detector for various sources, which represent characteristic backgrounds to Gerda. Suppression factors of a few times 10^3 have been achieved. First background data of LArGe with a coaxial HPGe detector (without PSD) yield a background index of (0.12-4.6)× 10^{-2} cts/(keV kg year) (90 % C.L.), which is at the level of Gerda Phase I. Furthermore, for the first time we monitor the natural ^{42}Ar abundance (parallel to Gerda), and have indication for the 2ν β β -decay in natural germanium. These results show the effectivity of an active liquid argon veto in an ultra-low background environment. As a consequence, the implementation of a liquid argon veto in Gerda Phase II is pursued.

LArGe: active background suppression using argon scintillation for the GERDA 0νββ-experiment

Energy Technology Data Exchange (ETDEWEB)

Agostini, M.; Budjas, D.; Schoenert, S. [Technische Universitaet Muenchen, Munich (Germany); Barnabe-Heider, M. [Technische Universitaet Muenchen, Munich (Germany); Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Cattadori, C. [Universita degli Studi di Milano, Milan (Italy); INFN, Milan (Italy); Gangapshev, A. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Institut for Nuclear Research, Moscow (Russian Federation); Gusev, K. [Technische Universitaet Muenchen, Munich (Germany); Joint Institut for Nuclear Research, Dubna (Russian Federation); National Research Center Kurchatov Institut, Moscow (Russian Federation); Heisel, M.; Smolnikov, A. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Junker, M. [Laboratori Nazionali del Gran Sasso, Assergi (Italy); Klimenko, A.; Lubashevskiy, A. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Joint Institut for Nuclear Research, Dubna (Russian Federation); Pelczar, K. [Jagellonian University, Cracow (Poland); Zuzel, G. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany); Jagellonian University, Cracow (Poland)

2015-10-15

LArGe is a GERDA low-background test facility to study novel background suppression methods in a low-background environment, for future application in the GERDA experiment. Similar to GERDA, LArGe operates bare germanium detectors submersed into liquid argon (1 m{sup 3}, 1.4tons), which in addition is instrumented with photomultipliers to detect argon scintillation light. The scintillation signals are used in anti-coincidence with the germanium detectors to effectively suppress background events that deposit energy in the liquid argon. The background suppression efficiency was studied in combination with a pulse shape discrimination (PSD) technique using a BEGe detector for various sources, which represent characteristic backgrounds to GERDA. Suppression factors of a few times 10{sup 3} have been achieved. First background data of LArGe with a coaxial HPGe detector (without PSD) yield a background index of (0.12 - 4.6) x 10{sup -2} cts/(keV kg year) (90 % C.L.), which is at the level of GERDA Phase I. Furthermore, for the first time we monitor the natural {sup 42}Ar abundance (parallel to GERDA), and have indication for the 2νββ-decay in natural germanium. These results show the effectivity of an active liquid argon veto in an ultra-low background environment. As a consequence, the implementation of a liquid argon veto in GERDA Phase II is pursued. (orig.)

Development of new readout electronics for the ATLAS LAr Calorimeter at the sLHC

CERN Document Server

Strässner, A

2009-01-01

The readout of the ATLAS Liquid Argon (LAr) calorimeter is a complex multi-channel system to amplify, shape, digitize and process signals of the detector cells. The current on-detector electronics is not designed to sustain the ten times higher radiation levels expected at sLHC in the years beyond 2019/2020, and will be replaced by new electronics with a completely different readout scheme. The future on-detector electronics is planned to send out all data continuously at each bunch crossing, as opposed to the current system which only transfers data at a trigger-accept signal. Multiple high-speed and radiation-resistant optical links will transmit 100 Gb/s per front-end board. The off-detector processing units will not only process the data in real-time and provide digital data buffering, but will also implement trigger algorithms. An overview about the various components necessary to develop such a complex system is given. The current R&D activities and architectural studies of the LAr Calorimeter group...

Research and Development for a Free-Running Readout System for the ATLAS LAr Calorimeters at the High Luminosity LHC

CERN Document Server

Hils, Maximilian; The ATLAS collaboration

2015-01-01

The ATLAS Liquid Argon (LAr) Calorimeters were designed and built to measure electromagnetic and hadronic energy in proton-proton collisions produced at the LHC at centre-of-mass energies up to 14 TeV and instantaneous luminosities up to $10^{34} \\text{cm}^{-2} \\text{s}^{-1}$. The High Luminosity LHC (HL-LHC) programme is now developed for up to 5-7 times the design luminosity, with the goal of accumulating an integrated luminosity of $3000~\\text{fb}^{-1}$. In the HL-LHC phase, the increased radiation levels require a replacement of the front-end electronics of the LAr Calorimeters. Furthermore, the ATLAS trigger system is foreseen to increase the trigger accept rate by a factor 10 to 1 MHz and the trigger latency by a factor of 20 which requires a larger data volume to be buffered. Therefore, the LAr Calorimeter read-out will be exchanged with a new front-end and a high bandwidth back-end system for receiving data from all 186.000 channels at 40 MHz LHC bunch-crossing frequency and for off-detector buffering...

Chromosomal evolution of the PKD1 gene family in primates

Directory of Open Access Journals (Sweden)

Krawczak Michael

2008-09-01

Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

Evaluation of the Performance of ClimGen and LARS-WG models in generating rainfall and temperature time series in rainfed research station of Sisab, Northern Khorasan

Directory of Open Access Journals (Sweden)

najmeh khalili

2016-10-01

Full Text Available Introduction:Many existing results on water and agriculture researches require long-term statistical climate data, while practically; the available collected data in synoptic stations are quite short. Therefore, the required daily climate data should be generated based on the limited available data. For this purpose, weather generators can be used to enlarge the data length. Among the common weather generators, two models are more common: LARS-WG and ClimGen. Different studies have shown that these two models have different results in different regions and climates. Therefore, the output results of these two methods should be validated based on the climate and weather conditions of the study region. Materials and Methods:The Sisab station is 35 KM away from Bojnord city in Northern Khorasan. This station was established in 1366 and afterwards, the meteorological data including precipitation data are regularly collected. Geographical coordination of this station is 37º 25׳ N and 57º 38׳ E, and the elevation is 1359 meter. The climate in this region is dry and cold under Emberge and semi-dry under Demarton Methods. In this research, LARG-WG model, version 5.5, and ClimGen model, version 4.4, were used to generate 500 data sample for precipitation and temperature time series. The performance of these two models, were evaluated using RMSE, MAE, and CD over the 30 years collected data and their corresponding generated data. Also, to compare the statistical similarity of the generated data with the collected data, t-student, F, and X2 tests were used. With these tests, the similarity of 16 statistical characteristics of the generated data and the collected data has been investigated in the level of confidence 95%. Results and Discussion:This study showed that LARS-WG model can better generate precipitation data in terms of statistical error criteria. RMSE and MAE for the generated data by LAR-WG were less than ClimGen model while the CD value of

Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

Directory of Open Access Journals (Sweden)

Serbielle Céline

2012-12-01

Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

Directory of Open Access Journals (Sweden)

Saleha S

2016-06-01

Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

Science.gov (United States)

Ajmal, M; Zafar, S; Hameed, A

2016-01-01

ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

Science.gov (United States)

Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

2016-01-01

The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

Empirical Asset Pricing: Eugene Fama, Lars Peter Hansen, and Robert Shiller

OpenAIRE

Campbell, John Y.

2016-01-01

The Nobel Memorial Prize in Economic Sciences for 2013 was awarded to Eugene Fama, Lars Peter Hansen, and Robert Shiller for their contributions to the empirical study of asset pricing. Some observers have found it hard to understand the common elements of the laureates research, preferring to highlight areas of disagreement among them. This paper argues that empirical asset pricing is a coherent enterprise, which owes much to the laureates seminal contributions, and that important themes in ...

Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

Directory of Open Access Journals (Sweden)

Tianyu Zhou

2015-01-01

Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

Science.gov (United States)

Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

2015-01-01

Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Directory of Open Access Journals (Sweden)

Muhammad I. Ullah

2017-12-01

Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

General and family-specific gene expression responses to viral hemorrhagic septicaemia virus infection in rainbow trout (Oncorhynchus mykiss)

DEFF Research Database (Denmark)

Jørgensen, H. B. H.; Sørensen, P.; Cooper, G. A.

2011-01-01

challenge) and a relatively high susceptibility (18% survival following challenge) trout family that were both split into a group exposed to virus and a non-exposed control group. In total, 939 genes were differentially expressed between infected and non-infected fish (FDR p = 0.05). Five groups of Gene...... Ontology categories were involved in immune-related processes and over-represented in infected fish: (i) stress and defense response, (ii) NFkappaB signal transduction, (iii) response to non-self, (iv) antigen processing and presentation, and (v) proteasome complexes. The first four categories were also...... over-represented among the 642 differentially expressed genes in the low-susceptibility trout family but not among the 556 differentially expressed genes in the high-susceptibility trout family. Expression profiles for most immune genes discussed showed increased transcription from day 3 post...

Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

Science.gov (United States)

Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

2010-01-01

Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

Genome-wide analysis of Aux/IAA gene family in Solanaceae species using tomato as a model.

Science.gov (United States)

Wu, Jian; Peng, Zhen; Liu, Songyu; He, Yanjun; Cheng, Lin; Kong, Fuling; Wang, Jie; Lu, Gang

2012-04-01

Auxin plays key roles in a wide variety of plant activities, including embryo development, leaf formation, phototropism, fruit development and root initiation and development. Auxin/indoleacetic acid (Aux/IAA) genes, encoding short-lived nuclear proteins, are key regulators in the auxin transduction pathway. But how they work is still unknown. In order to conduct a systematic analysis of this gene family in Solanaceae species, a genome-wide search for the homologues of auxin response genes was carried out. Here, 26 and 27 non redundant AUX/IAAs were identified in tomato and potato, respectively. Using tomato as a model, a comprehensive overview of SlIAA gene family is presented, including the gene structures, phylogeny, chromosome locations, conserved motifs and cis-elements in promoter sequences. A phylogenetic tree generated from alignments of the predicted protein sequences of 31 OsIAAs, 29 AtIAAs, 31 ZmIAAs, and 26 SlIAAs revealed that these IAAs were clustered into three major groups and ten subgroups. Among them, seven subgroups were present in both monocot and dicot species, which indicated that the major functional diversification within the IAA family predated the monocot/dicot divergence. In contrast, group C and some other subgroups seemed to be species-specific. Quantitative real-time PCR (qRT-PCR) analysis showed that 19 of the 26 SlIAA genes could be detected in all tomato organs/tissues, however, seven of them were specifically expressed in some of tomato tissues. The transcript abundance of 17 SlIAA genes were increased within a few hours when the seedlings were treated with exogenous IAA. However, those of other six SlIAAs were decreased. The results of stress treatments showed that most SIIAA family genes responded to at least one of the three stress treatments, however, they exhibited diverse expression levels under different abiotic stress conditions in tomato seedlings. SlIAA20, SlIAA21 and SlIAA22 were not significantly influenced by stress

Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.).

Science.gov (United States)

Ma, Jin-Qi; Jian, Hong-Ju; Yang, Bo; Lu, Kun; Zhang, Ao-Xiang; Liu, Pu; Li, Jia-Na

2017-07-15

Growth regulating-factors (GRFs) are plant-specific transcription factors that help regulate plant growth and development. Genome-wide identification and evolutionary analyses of GRF gene families have been performed in Arabidopsis thaliana, Zea mays, Oryza sativa, and Brassica rapa, but a comprehensive analysis of the GRF gene family in oilseed rape (Brassica napus) has not yet been reported. In the current study, we identified 35 members of the BnGRF family in B. napus. We analyzed the chromosomal distribution, phylogenetic relationships (Bayesian Inference and Neighbor Joining method), gene structures, and motifs of the BnGRF family members, as well as the cis-acting regulatory elements in their promoters. We also analyzed the expression patterns of 15 randomly selected BnGRF genes in various tissues and in plant varieties with different harvest indices and gibberellic acid (GA) responses. The expression levels of BnGRFs under GA treatment suggested the presence of possible negative feedback regulation. The evolutionary patterns and expression profiles of BnGRFs uncovered in this study increase our understanding of the important roles played by these genes in oilseed rape. Copyright © 2017. Published by Elsevier B.V.

The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

NARCIS (Netherlands)

Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

1993-01-01

The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

Insights into the Evolution of a Snake Venom Multi-Gene Family from the Genomic Organization of Echis ocellatus SVMP Genes

Directory of Open Access Journals (Sweden)

Libia Sanz

2016-07-01

Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.

Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

Science.gov (United States)

Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

2015-02-01

WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

Science.gov (United States)

Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

2015-09-08

WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

Science.gov (United States)

Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

2017-11-07

The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

The SWEET gene family in Hevea brasiliensis - its evolution and expression compared with four other plant species.

Science.gov (United States)

Sui, Jin-Lei; Xiao, Xiao-Hu; Qi, Ji-Yan; Fang, Yong-Jun; Tang, Chao-Rong

2017-12-01

SWEET proteins play an indispensable role as a sugar efflux transporter in plant development and stress responses. The SWEET genes have previously been characterized in several plants. Here, we present a comprehensive analysis of this gene family in the rubber tree, Hevea brasiliensis . There are 36 members of the SWEET gene family in this species, making it one of the largest families in plant genomes sequenced so far. Structure and phylogeny analyses of these genes in Hevea and in other species demonstrated broad evolutionary conservation. RNA-seq analyses revealed that SWEET2, 16, and 17 might represent the main evolutionary direction of SWEET genes in plants. Our results in Hevea suggested the involvement of HbSWEET1a , 2e , 2f , and 3b in phloem loading, HbSWEET10a and 16b in laticifer sugar transport , and HbSWEET9a in nectary-specific sugar transport. Parallel studies of RNA-seq analyses extended to three other plant species ( Manihot esculenta , Populus trichocarpa , and Arabidopsis thaliana ) produced findings which implicated MeSWEET10a, 3a, and 15b in M. esculenta storage root development, and the involvement of PtSWEET16b and PtSWEET16d in P. trichocarpa xylem development. RT-qPCR results further revealed that HbSWEET10a, 16b, and 1a play important roles in phloem sugar transport. The results from this study provide a foundation not only for further investigation into the functionality of the SWEET gene family in Hevea, especially in its sugar transport for latex production, but also for related studies of this gene family in the plant kingdom.

Lise 1 Biyoloji Dersi Alan Öğrencilerin Canlıların Çeşitliliği ve Sınıflandırılmasıyla ilgili Kavram Yanılgılarının Belirlenmesi ve Kavram Haritası Yardımıyla Değiştirilmesi

OpenAIRE

TÜRKMEN, Lütfullah; ÇARDAK, Osman; DIKMENLI, Musa

2014-01-01

İlk ve orta öğrenim fen bilimleri eğitiminde, öğrencilerin sahip oldukları kavram yanılgılarını değiştirmek için öğretmenler ve fen bilimleri eğitimcileri tarafından farklı öğretim yöntemleri kullanılmaktadır. Kavram yanılgılarını değiştirmek kullanılan en yaygın olan yöntemlerden biri de kavram haritalarıdır. Bu çalışmanın amacı Lise 1. sınıf biyoloji dersi alan öğrencilerin Canlıların çeşitliliği ve sınıflandırılması hakkındaki kavram yanılgılarını değiştirmektir. Bu çalışma biyoloji dersi...

Altındere Vadisi Milli Parkı kullanıcılarının rekreasyonel memnuniyetinin belirlenmesi

Directory of Open Access Journals (Sweden)

Özge Volkan AKSU

2017-07-01

Full Text Available Bu çalışma; Altındere Vadisi Milli Parkı kullanıcılarının rekreasyonel memnuniyetinin belirlenmesi amacı ile 2015 yılı yaz dönemi milli park alanında, 308 yerli kullanıcı ile yapılan anket çalışmalarını kapsamaktadır. Anket soruları ile kullanıcılarının bazı kişisel özellikleri, kullanım tercihleri, katıldıkları rekreasyonel etkinlikler, geliş amaçları, alan tercihleri, genel ve beklenen memnuniyetleri, alan farkındalığı, kullanıcı memnuniyet ve memnuniyetsizlik durumunu etkileyen faktörler ve bu faktörlerle kullanıcıların bazı kişisel özellikleri arasındaki ilişkiler istatistiksel yöntemlerle irdelenmiştir. Sonuç olarak; “milli parkın doğal ve kültürel peyzaj değerleri, görsel kalite”, “alandan aktif olarak yararlanma isteği”, “alandan pasif olarak yararlanma isteği”, “macera ve kendini keşfetme”, “açık hava aktivite olanakları”, “sosyalleşme”,  “ulaşılabilirlik ve alan kullanımı” olarak tanımlanabilecek faktörlerin alandaki kullanıcı memnuniyeti üzerinde etkili olduğu, yine; “planlama-tasarım sorunları”, “donatı elemanı eksikliği, yönetim”, “taşıma kapasitesinin aşılması-kalabalık, gürültü kirliliği”, “çevre-görüntü kirliliği, alt yapı-bakım eksikliği”, “bilgi eksikliği ve yönetim” olarak tanımlanabilecek faktörlerin ise kullanıcı memnuniyetsizliği üzerinde etkili olduğu belirlenmiştir. Kullanıcıların genel memnuniyet ve beklentilerinin karşılanma durumu orta düzeydir. Kullanıcıların memnuniyet faktörlerinin, geldiği yerin milli parka uzaklığı ve eğitim, memnuniyetsizlik faktörlerinin ise geldiği yerin milli parka uzaklığı, cinsiyet ve yaş olarak belirlenen etmenlerden etkilendiği saptanmıştır.