WorldWideScience

Sample records for laccase-natural mediator systems

  1. Laccase/Mediator Systems

    NARCIS (Netherlands)

    Hilgers, Roelant; Vincken, Jean Paul; Gruppen, Harry; Kabel, Mirjam A.

    2018-01-01

    Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it

  2. Automated chromatographic laccase-mediator-system activity assay.

    Science.gov (United States)

    Anders, Nico; Schelden, Maximilian; Roth, Simon; Spiess, Antje C

    2017-08-01

    To study the interaction of laccases, mediators, and substrates in laccase-mediator systems (LMS), an on-line measurement was developed using high performance anion exchange chromatography equipped with a CarboPac™ PA 100 column coupled to pulsed amperometric detection (HPAEC-PAD). The developed method was optimized for overall chromatographic run time (45 to 120 min) and automated sample drawing. As an example, the Trametes versicolor laccase induced oxidation of 1-(3,4-dimethoxyphenyl)-2-(2-methoxyphenoxy)-1,3-dihydroxypropane (adlerol) using 1-hydroxybenzotriazole (HBT) as mediator was measured and analyzed on-line. Since the Au electrode of the PAD detects only hydroxyl group containing substances with a limit of detection being in the milligram/liter range, not all products are measureable. Therefore, this method was applied for the quantification of adlerol, and-based on adlerol conversion-for the quantification of the LMS activity at a specific T. versicolor laccase/HBT ratio. The automated chromatographic activity assay allowed for a defined reaction start of all laccase-mediator-system reactions mixtures, and the LMS reaction progress was automatically monitored for 48 h. The automatization enabled an integrated monitoring overnight and over-weekend and minimized all manual errors such as pipetting of solutions accordingly. The activity of the LMS based on adlerol consumption was determined to 0.47 U/mg protein for a laccase/mediator ratio of 1.75 U laccase/g HBT. In the future, the automated method will allow for a fast screening of combinations of laccases, mediators, and substrates which are efficient for lignin modification. In particular, it allows for a fast and easy quantification of the oxidizing activity of an LMS on a lignin-related substrate which is not covered by typical colorimetric laccase assays. ᅟ.

  3. Laccase/Mediator Systems: Their Reactivity toward Phenolic Lignin Structures.

    Science.gov (United States)

    Hilgers, Roelant; Vincken, Jean-Paul; Gruppen, Harry; Kabel, Mirjam A

    2018-02-05

    Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it remains unclear to what extent the presence of a mediator influences the reactions of the phenolic subunits of lignin. To get more insight in this, UHPLC-MS was used to study the reactions of a phenolic lignin dimer (GBG), initiated by a laccase from Trametes versicolor , alone or in combination with the mediators HBT and ABTS. The role of HBT was negligible, as its oxidation by laccase occurred slowly in comparison to that of GBG. Laccase and laccase/HBT oxidized GBG at a comparable rate, resulting in extensive polymerization of GBG. In contrast, laccase/ABTS converted GBG at a higher rate, as GBG was oxidized both directly by laccase but also by ABTS radical cations, which were rapidly formed by laccase. The laccase/ABTS system resulted in Cα oxidation of GBG and coupling of ABTS to GBG, rather than polymerization of GBG. Based on these results, we propose reaction pathways of phenolic lignin model compounds with laccase/HBT and laccase/ABTS.

  4. Degradation of sulfadimethoxine catalyzed by laccase with soybean meal extract as natural mediator: Mechanism and reaction pathway.

    Science.gov (United States)

    Liang, Shangtao; Luo, Qi; Huang, Qingguo

    2017-08-01

    Natural laccase-mediator systems have been well recognized as an eco-friendly and energy-saving approach in environmental remediation, whose further application is however limited by the high cost of natural mediators and relatively long treatment time span. This study evaluated the water extract of soybean meal, a low-cost compound system, in mediating the laccase catalyzed degradation of a model contaminant of emerging concern, sulfadimethoxine (SDM), and demonstrated it as a promising alternative mediator for soil and water remediation. Removal of 73.3% and 65.6% was achieved in 9 h using soybean meal extract (SBE) as the mediating system for laccase-catalyzed degradation of sulfadimethoxine at the concentration of 1 ppm and 10 ppm, respectively. Further degradation of sulfadimethoxine was observed with multiple SBE additions. Using SBE as mediator increased the 9-h removal of SDM at 1 ppm initial concentration by 52.9%, 49.4%, and 36.3% in comparison to the system mediated by 1-Hydroxybenzotriazole (HBT), p-Coumaric acid (COU) and 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS), respectively. With the detection of stable coupling products formed with radical scavenger (5,5-Dimethyl-1-pyrroline N-oxide, DMPO), three phenolic compounds (vanillin, apocynin, and daidzein) in SBE were confirmed to serve as mediators for Trametes versicolor laccase. Reaction pathways were proposed based on the results of High Resolution Mass Spectrometry. SO 2 excursion happened during SDM transformation, leading to elimination of antimicrobial activity. Therefore, as a natural, phenol rich, and affordable compound system, the future application of SBE in wastewater and soil remediation is worth exploring. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Lignin Biodegradation with Laccase-Mediator Systems

    International Nuclear Information System (INIS)

    Christopher, Lew Paul; Yao, Bin; Ji, Yun

    2014-01-01

    Lignin has a significant and largely unrealized potential as a source for the sustainable production of fuels and bulk high-value chemicals. It can replace fossil-based oil as a renewable feedstock that would bring about socio-economic and environmental benefits in our transition to a biobased economy. The efficient utilization of lignin however requires its depolymerization to low-molecular weight phenolics and aromatics that can then serve as the building blocks for chemical syntheses of high-value products. The ability of laccase to attack and degrade lignin in conjunction with laccase mediators is currently viewed as one of the potential “breakthrough” applications for lignin valorization. Here, we review the recent progress in lignin biodegradation with laccase-mediator systems, and research needs that need to be addressed in this field.

  6. Lignin Biodegradation with Laccase-Mediator Systems

    Energy Technology Data Exchange (ETDEWEB)

    Christopher, Lew Paul, E-mail: lew.christopher@sdsmt.edu [Center for Bioprocessing Research and Development, South Dakota School of Mines & Technology, Rapid City, SD (United States); Department of Civil and Environmental Engineering, South Dakota School of Mines & Technology, Rapid City, SD (United States); Yao, Bin [Center for Bioprocessing Research and Development, South Dakota School of Mines & Technology, Rapid City, SD (United States); Ji, Yun [Department of Chemical Engineering, University of North Dakota, Grand Forks, ND (United States)

    2014-03-31

    Lignin has a significant and largely unrealized potential as a source for the sustainable production of fuels and bulk high-value chemicals. It can replace fossil-based oil as a renewable feedstock that would bring about socio-economic and environmental benefits in our transition to a biobased economy. The efficient utilization of lignin however requires its depolymerization to low-molecular weight phenolics and aromatics that can then serve as the building blocks for chemical syntheses of high-value products. The ability of laccase to attack and degrade lignin in conjunction with laccase mediators is currently viewed as one of the potential “breakthrough” applications for lignin valorization. Here, we review the recent progress in lignin biodegradation with laccase-mediator systems, and research needs that need to be addressed in this field.

  7. Biobleaching chemistry of laccase-mediator systems on high-lignin-content kraft pulps

    International Nuclear Information System (INIS)

    Chakar, F.S.; Ragauskas, A.J.

    2004-01-01

    A high-lignin-content softwood kraft pulp was reacted with laccase in the presence of 1-hydroxybenzotriazole (HBT), N-acetyl-N-phenylhydroxylamine (NHA), and violuric acid (VA). The biodelignification response with violuric acid was superior to both 1-hydroxybenzotriazole and N-acetyl-N-phenylhydroxylamine. NMR analysis of residual lignins isolated before and after the biobleaching treatments revealed that the latter material was highly oxidized and that the magnitude of structural changes was most pronounced with the laccase - violuric acid biobleaching system. An increase in the content of carboxylic acid groups and a decrease in methoxyl groups were noted with all three laccase-mediator systems. The oxidation biobleaching pathway is directed primarily towards noncondensed C5 phenolic lignin functional structures for all three laccase-mediated systems. The laccase - violuric acid system was also reactive towards C5-condensed phenolic lignin structures. (author)

  8. Mediator-assisted decolorization and detoxification of textile dyes/dye mixture by Cyathus bulleri laccase.

    Science.gov (United States)

    Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, T R

    2008-12-01

    Laccase from basidiomycete fungus Cyathus bulleri was evaluated for its ability to decolorize a number of reactive and acidic dyes in the presence of natural and synthetic mediators. The extent of decolorization was monitored at different mediator/dye concentrations and incubation time. Among the synthetic mediators, 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) was effective at low mediator/dye ratios and resulted in 80-95% decolorization at rates that varied from 226 +/- 4 nmol min(-1) mg(-1) for Reactive Orange 1 to 1,333 +/- 15 nmol min(-1) mg(-1) for Reactive Red 198. Other synthetic mediators like 1-hydroxybenzotriazole and violuric acid showed both concentration- and time-dependent increases in percent decolorization. Natural mediators like vanillin, on the other hand, were found to be less effective on all the dyes except Reactive Orange 1. Computed rates of decolorization were about twofold lower than that with ABTS. The laccase-ABTS system also led to nearly 80% decolorization for the simulated dye mixture. No clear correlation between laccase activity on the mediator and its ability to decolorize dyes was found, but pH had a significant effect: Optimum pH for decolorization coincided with the optimum pH for mediator oxidation. The treated samples were also evaluated for toxicity in model microbial systems. The laccase-mediator system appears promising for treatment of textile wastewaters.

  9. Production of a recombinant laccase from Pichia pastoris and biodegradation of chlorpyrifos in a laccase/vanillin system.

    Science.gov (United States)

    Xie, Huifang; Li, Qi; Wang, Minmin; Zhao, Linguo

    2013-06-28

    The recombinant strain P. pastoris GS115-lccC was used to produce laccase with high activity. Factors influencing laccase expression, such as pH, methanol concentration, copper concentration, peptone concentration, shaker rotate speed, and medium volume were investigated. Under the optimal conditions, laccase activity reached 12,344 U/L on day 15. The recombinant enzyme was purified by precipitating and dialyzing to electrophoretic homogeneity, and was estimated to have a molecular mass of about 58 kDa. When guaiacol was the substrate, the laccase showed the highest activity at pH 5.0 and was stable when the pH was 4.5~6.0. The optimal temperature for the laccase to oxidize guaiacol was 60°C, but it was not stable at high temperature. The enzyme could remain stable at 30°C for 5 days. The recombinant laccase was used to degrade chlorpyrifos in several laccase/mediator systems. Among three synthetic mediators (ABTS, HBT, VA) and three natural mediators (vanillin, 2,6-DMP, and guaiacol), vanillin showed the most enhancement on degradation of chlorpyrifos. Both laccase and vanillin were responsible for the degradation of chlorpyrifos. A higher dosage of vanillin may promote a higher level of degradation of chlorpyrifos, and the 2-step addition of vanillin led to 98% chlorpyrifos degradation. The degradation of chlorpyrifos was faster in the L/V system (kobs = 0.151) than that in the buffer solution (kobs = 0.028).

  10. Laccase/mediator assisted degradation of triarylmethane dyes in a continuous membrane reactor.

    Science.gov (United States)

    Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

    2009-08-10

    Laccase/mediator systems are important bioremediation agents as the rates of reactions can be enhanced in the presence of the mediators. The decolorization mechanism of two triarylmethane dyes, namely, Basic Green 4 and Acid Violet 17 is reported using Cyathus bulleri laccase. Basic Green 4 was decolorized through N-demethylation by laccase alone, while in mediator assisted reactions, dye breakdown was initiated from oxidation of carbinol form of the dye. Benzaldehyde and N,N-dimethyl aniline were the major end products. With Acid Violet 17, laccase carried out N-deethylation and in mediator assisted reactions, oxidation of the carbinol form of the dye occurred resulting in formation of formyl benzene sulfonic acid, carboxy benzene sulfonic acid and benzene sulfonic acid. Toxicity analysis revealed that Basic Green 4 was toxic and treatment with laccase/mediators resulted in 80-100% detoxification. The treatment of the textile dye solution using laccase and 2,2'-azino-di-(-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was demonstrated in an enzyme membrane reactor. At a hydraulic retention time of 6h, the process was operated for a period of 15 days with nearly 95% decolorization, 10% reduction in flux and 70% recovery of active ABTS.

  11. Laccase mediated transformation of 17β-estradiol in soil

    International Nuclear Information System (INIS)

    Singh, Rashmi; Cabrera, Miguel L.; Radcliffe, David E.; Zhang, Hao; Huang, Qingguo

    2015-01-01

    It is known that 17β-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using 14 C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied 14 C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. - Highlights: • E2 was effectively transformed in soil through reactions mediated by laccase. • The reaction behaviors in soil differ significantly from those in water. • E2 was preferably bound to the humic acids in soil. • Laccase treatment resulted in changes in the structures of the humic acids. - E2 was effectively transformed in soil by preferably binding to the humic acids through reactions mediated by laccase

  12. Direct analysis by time-of-flight secondary ion mass spectrometry reveals action of bacterial laccase-mediator systems on both hardwood and softwood samples.

    Science.gov (United States)

    Goacher, Robyn E; Braham, Erick J; Michienzi, Courtney L; Flick, Robert M; Yakunin, Alexander F; Master, Emma R

    2017-12-29

    The modification and degradation of lignin play a vital role in carbon cycling as well as production of biofuels and bioproducts. The possibility of using bacterial laccases for the oxidation of lignin offers a route to utilize existing industrial protein expression techniques. However, bacterial laccases are most frequently studied on small model compounds that do not capture the complexity of lignocellulosic materials. This work studied the action of laccases from Bacillus subtilis and Salmonella typhimurium (EC 1.10.3.2) on ground wood samples from yellow birch (Betula alleghaniensis) and red spruce (Picea rubens). The ability of bacterial laccases to modify wood can be facilitated by small molecule mediators. Herein, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), gallic acid and sinapic acid mediators were tested. Direct analysis of the wood samples was achieved by time-of-flight secondary ion mass spectrometry (ToF-SIMS), a surface sensitive mass spectrometry technique that has characteristic peaks for H, G and S lignin. The action of the bacterial laccases on both wood samples was demonstrated and revealed a strong mediator influence. The ABTS mediator led to delignification, evident in an overall increase of polysaccharide peaks in the residual solid, along with equal loss of G and S-lignin peaks. The gallic acid mediator demonstrated minimal laccase activity. Meanwhile, the sinapic acid mediator altered the S/G peak ratio consistent with mediator attaching to the wood solids. The current investigation demonstrates the action of bacterial laccase-mediator systems directly on woody materials, and the potential of using ToF-SIMS to uncover the fundamental and applied role of bacterial enzymes in lignocellulose conversion. © 2017 Scandinavian Plant Physiology Society.

  13. Oxygen cathode based on a layer-by-layer self-assembled laccase and osmium redox mediator

    Energy Technology Data Exchange (ETDEWEB)

    Szamocki, R.; Flexer, V. [INQUIMAE-DQIAyQF, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Levin, L.; Forchiasin, F. [Micologia Experimental, Departamento de Biodiversidad y Biologia Experimental. Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Calvo, E.J. [INQUIMAE-DQIAyQF, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina)], E-mail: calvo@qi.fcen.uba.ar

    2009-02-28

    Trametes trogii laccase has been studied as biocatalyst for the oxygen electro-reduction in three different systems: (i) soluble laccase was studied in solution; (ii) an enzyme monolayer was tethered to a gold surface by dithiobis N-succinimidyl propionate (DTSP), with a soluble osmium pyridine-bipyridine redox mediator in both cases. The third case (iii) consisted in the sequential immobilization of laccase and the osmium complex derivatized poly(allylamine) self-assembled layer-by-layer (LbL) on mercaptopropane sulfonate modified gold to produce an all integrated and wired enzymatic oxygen cathode. The polycation was the same osmium complex covalently bound to poly-(ally-lamine) backbone (PAH-Os), the polyanion was the enzyme adsorbed from a solution of a suitable pH so that the protein carries a net negative charge. The adsorption of laccase was studied by monitoring the mass uptake with a quartz crystal microbalance and the oxygen reduction electrocatalysis was studied by linear scan voltammetry. While for the three cases, oxygen electrocatalysis mediated by the osmium complex was observed, for tethered laccase direct electron transfer in the absence of redox mediator was also apparent but no electrocatalysis for the oxygen reduction was recorded in the absence of mediator in solution. For the fully integrated LbL self-assembled laccase and redox mediator (case iii) a catalytic reduction of oxygen could be recorded at different oxygen partial pressures and different electrolyte pH. The tolerance of the reaction to methanol and chloride was also investigated.

  14. Oxygen cathode based on a layer-by-layer self-assembled laccase and osmium redox mediator

    International Nuclear Information System (INIS)

    Szamocki, R.; Flexer, V.; Levin, L.; Forchiasin, F.; Calvo, E.J.

    2009-01-01

    Trametes trogii laccase has been studied as biocatalyst for the oxygen electro-reduction in three different systems: (i) soluble laccase was studied in solution; (ii) an enzyme monolayer was tethered to a gold surface by dithiobis N-succinimidyl propionate (DTSP), with a soluble osmium pyridine-bipyridine redox mediator in both cases. The third case (iii) consisted in the sequential immobilization of laccase and the osmium complex derivatized poly(allylamine) self-assembled layer-by-layer (LbL) on mercaptopropane sulfonate modified gold to produce an all integrated and wired enzymatic oxygen cathode. The polycation was the same osmium complex covalently bound to poly-(ally-lamine) backbone (PAH-Os), the polyanion was the enzyme adsorbed from a solution of a suitable pH so that the protein carries a net negative charge. The adsorption of laccase was studied by monitoring the mass uptake with a quartz crystal microbalance and the oxygen reduction electrocatalysis was studied by linear scan voltammetry. While for the three cases, oxygen electrocatalysis mediated by the osmium complex was observed, for tethered laccase direct electron transfer in the absence of redox mediator was also apparent but no electrocatalysis for the oxygen reduction was recorded in the absence of mediator in solution. For the fully integrated LbL self-assembled laccase and redox mediator (case iii) a catalytic reduction of oxygen could be recorded at different oxygen partial pressures and different electrolyte pH. The tolerance of the reaction to methanol and chloride was also investigated

  15. Engineering and Applications of fungal laccases for organic synthesis

    Directory of Open Access Journals (Sweden)

    Ballesteros Antonio

    2008-11-01

    Full Text Available Abstract Laccases are multi-copper containing oxidases (EC 1.10.3.2, widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed.

  16. Effect of mediator added to modified paste carbon electrodes with immobilized laccase from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Marcelo Silva Ferreira

    2015-05-01

    Full Text Available Carbon paste electrodes based on the immobilization of laccase from Aspergillus oryzae were developed and voltammetric measurements were performed to evaluate the amperometric response. The 2,2′-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid diammonium salt  (ABTS functions as substrate and mediator for the laccase enzyme. Electrodes were modified  in two different conditions: without mediator (EPC/laccase and with mediator (EPC/laccase/ABTS. The addition of ABTS as a mediator increased eight-fold the amperometric response. The electrode was sensitive to pH variation with best response at pH 4.0. Studies on different concentrations of laccase and ABTS at different pH rates revealed that the composition 187 U mL-1 in laccase and 200 µL of ABTS obtained the highest amperometric response. The carbon paste electrode modified with ABTS proved to be a good base for the immobilization of the laccase enzyme. Moreover, it is easy to manufacture and inexpensive to produce a modified electrode with potential application in biosensors.

  17. In silico Analysis for Laccase-mediated Bioremediation of the Emerging Pharmaceutical Pollutants

    Directory of Open Access Journals (Sweden)

    Anjali Singh

    2015-12-01

    Full Text Available Laccases, a copper oxidase enzyme, has been employed for bioremediation of anthropogenic pollutants in the recent past. Laccase has a broad range of substrate specificity which offers the prospect for screening in numerable xenobiotics. The present study was aimed to use protein-ligand docking as a tool for prediction of biodegradation of selected pharmaceutical pollutants. A comparative study was also done to determine the binding efficacy of bacterial and fungal laccase for those selected pollutants. The laccase-pollutant docking was carried out using HEX software. The docking scores of bacterial and fungal laccase for predefined pollutants were comparable to ABTS, a substrate for laccase, which suggested that laccase might be able to degrade emerging pharmaceutical pollutants. The docking analysis approach can be useful in prediction of binding competence of pharmaceutical pollutants with laccase for in situ laccase-mediated bioremediation.

  18. Optimization of Laccase-Aided Chlorine Dioxide Bleaching of Bagasse Pulp

    Directory of Open Access Journals (Sweden)

    Yong Pei

    2015-11-01

    Full Text Available The laccase-mediator system in laccase-aided chlorine dioxide bleaching of bagasse pulp was optimized using response surface methodology (RSM. The effects and interactions of the laccase enzyme dosage, the dosage of the mediator 1-hydroxybenzotriazole (HBT, and the reaction time on the adsorbed organic halogen (AOX content of the wastewater as well as the brightness and kappa number of the pulp were examined. The optimal reaction conditions to achieve a balance of lower AOX content, higher brightness, and lower kappa number were as follows: laccase enzyme dosage of 20.3 U/g, HBT dosage of 1.51%, and reaction time of 154.5 min. Under these conditions, an AOX content of 20.67 mg/L, brightness of 58.94% ISO, and kappa number of 2.71 were observed. These results will offer a favorable option for pulp and paper mills as well as the natural environment and therefore provide a theoretical foundation for the industrial application of laccase in bleaching processes.

  19. Natural and recombinant fungal laccases for paper pulp bleaching

    NARCIS (Netherlands)

    Sigoillot, C.; Record, E.; Belle, V.; Robert, J.L.; Levasseur, A.; Punt, P.J.; Hondel, C.A.M.J.J. van den; Fournel, A.; Sigoillot, J.C.; Asther, M.

    2004-01-01

    Three laccases, a natural form and two recombinant forms obtained from two different expression hosts, were characterized and compared for paper pulp bleaching. Laccase from Pycnoporus cinnabarinus, a well known lignolytic fungus, was selected as a reference for this study. The corresponding

  20. Degradation of anthracene by laccase of Trametes versicolor in the presence of different mediator compounds.

    Science.gov (United States)

    Johannes, C; Majcherczyk, A; Hüttermann, A

    1996-10-01

    Laccase of Trametes versicolor was generally able to oxidize anthracene in vitro. After 72 h incubation about 35% of the anthracene was transformed stoichiometrically to 9,10-anthraquinone. Transformation of anthracene increased rapidly in the presence of different mediators that readily generate stable radicals: 2,2'-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and 1-hydroxybenzotriazole. For the reaction, the presence of both the laccase and the mediator was necessary. In the presence of 0.005 mM 1-hydroxybenzotriazole this conversion had removed 47% of the anthracene after 72 h; 75% of the substrate was oxidized during this period when ABTS (1 mM) was used as mediator. In contrast to reactions without or with only low concentrations of a mediator, there was a discrepancy between the disappearance of anthracene and the formation of 9,10-anthraquinone in mediator-forced reactions. Coupling-products of mediators with anthracene degradation products were found. Anthracene disappeared nearly completely after incubation for 72 h with laccase in a 0.1 mM solution of 1-hydroxybenzotriazole and was transformed to 9,10-anthraquinone in about 80% yield; 90% of the substrate was transformed in the presence of ABTS (2.0 mM) resulting again in 80% quinone. Phenothiazine was not effective in this system.

  1. Radical Scavenging by Acetone: A New Perspective to Understand Laccase/ABTS Inactivation and to Recover Redox Mediator.

    Science.gov (United States)

    Liu, Hao; Zhou, Pandeng; Wu, Xing; Sun, Jianliang; Chen, Shicheng

    2015-11-04

    The biosynthetic utilization of laccase/mediator system is problematic because the use of organic cosolvent causes significant inhibition of laccase activity. This work explored how the organic cosolvent impacts on the laccase catalytic capacity towards 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) in aqueous solution. Effects of acetone on the kinetic constants of laccase were determined and the results showed Km and Vmax varied exponentially with increasing acetone content. Acetone as well as some other cosolvents could transform ABTS radicals into its reductive form. The content of acetone in media significantly affected the radical scavenging rates. Up to 95% of the oxidized ABTS was successfully recovered in 80% (v/v) acetone in 60 min. This allows ABTS recycles at least six times with 70%-75% of active radicals recovered after each cycle. This solvent-based recovery strategy may help improve the economic feasibility of laccase/ABTS system in biosynthesis.

  2. ABTS-Modified Silica Nanoparticles as Laccase Mediators for Decolorization of Indigo Carmine Dye

    Directory of Open Access Journals (Sweden)

    Youxun Liu

    2015-01-01

    Full Text Available Efficient reuse and regeneration of spent mediators are highly desired for many of the laccases’ biotechnology applications. This investigation demonstrates that a redox mediator 2,2′-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid (ABTS covalently attached to silica nanoparticles (SNPs effectively mediated dye decolorization catalyzed by laccase. Characteristics of ABTS-modified silica nanoparticles (ABTS-SNPs were researched by scanning electron microscopy and Fourier-transformed infrared spectroscopy. When ABTS and ABTS-SNPs were used as laccase mediators, the decolorization yields of 96 and 95% were, respectively, obtained for indigo carmine dye. The results suggest that ABTS immobilized on SNPs can be used as laccase mediators as they retain almost the same efficiency as the free ABTS. The oxidized ABTS-SNPs were regenerated by their reduction reaction with ascorbic acid. Decolorization efficiency of regenerated ABTS-SNPs and their initial forms were found to be almost equivalent. Six reuse cycles for spent ABTS-SNPs were run for the treatment of indigo carmine, providing decolorization yields of 96–77%. Compared with free mediator, the immobilized mediators have the advantage of being easily recovered, regenerated, and reused making the whole process environmentally friendly.

  3. Stable ABTS Immobilized in the MIL-100(Fe) Metal-Organic Framework as an Efficient Mediator for Laccase-Catalyzed Decolorization.

    Science.gov (United States)

    Liu, Youxun; Geng, Yuanyuan; Yan, Mingyang; Huang, Juan

    2017-06-02

    The successful encapsulation of 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), a well-known laccase mediator, within a mesoporous metal-organic framework sample (i.e., MIL-100(Fe)) was achieved using a one-pot hydrothermal synthetic method. The as-prepared ABTS@MIL-100(Fe) was characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), Fourier transform infrared (FT-IR) spectroscopy, nitrogen sorption, and cyclic voltammetry (CV). Our ABTS@MIL-100(Fe)-based electrode exhibited an excellent electrochemical response, indicating that MIL-100(Fe) provides an appropriate microenvironment for the immobilization and electroactivity of ABTS molecules. ABTS@MIL-100(Fe) was then evaluated as an immobilized laccase mediator for dye removal using indigo carmine (IC) as a model dye. Through the application of laccase in combination with a free (ABTS) or immobilized (ABTS@MIL-100(Fe)) mediator, decolorization yields of 95% and 94%, respectively, were obtained for IC after 50 min. In addition, following seven reuse cycles of ABTS@MIL-100(Fe) for dye treatment, a decolorization yield of 74% was obtained. Dye decolorization occurred through the breakdown of the chromophoric group by the Laccase/ABTS@MIL-100(Fe) system, and a catalytic mechanism was proposed. We therefore expect that the stability, reusability, and validity of ABTS@MIL-100(Fe) as a laccase mediator potentially render it a promising tool for dye removal, in addition to reducing the high running costs and potential toxicity associated with synthetic mediators.

  4. Prediction and optimization of the laccase-mediated synthesis of the antimicrobial compound iodine (I2).

    Science.gov (United States)

    Schubert, M; Fey, A; Ihssen, J; Civardi, C; Schwarze, F W M R; Mourad, S

    2015-01-10

    An artificial neural network (ANN) and genetic algorithm (GA) were applied to improve the laccase-mediated oxidation of iodide (I(-)) to elemental iodine (I2). Biosynthesis of iodine (I2) was studied with a 5-level-4-factor central composite design (CCD). The generated ANN network was mathematically evaluated by several statistical indices and revealed better results than a classical quadratic response surface (RS) model. Determination of the relative significance of model input parameters, ranking the process parameters in order of importance (pH>laccase>mediator>iodide), was performed by sensitivity analysis. ANN-GA methodology was used to optimize the input space of the neural network model to find optimal settings for the laccase-mediated synthesis of iodine. ANN-GA optimized parameters resulted in a 9.9% increase in the conversion rate. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.

    Science.gov (United States)

    Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa

    2011-11-01

    The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Fungal Laccases Degradation of Endocrine Disrupting Compounds

    Directory of Open Access Journals (Sweden)

    Gemma Macellaro

    2014-01-01

    Full Text Available Over the past decades, water pollution by trace organic compounds (ng/L has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs. EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads.

  7. The development of CotA mediator cocktail system for dyes decolorization.

    Science.gov (United States)

    Luo, S; Xie, T; Liu, Z; Sun, F; Wang, G

    2018-05-01

    The increasing use of dyes leads to serious environmental concerns, it is significant to explore eco-friendly and economic approaches for dye decolorization. This study aimed to develop mediator cocktail (AS and ABTS) for enhancing the capability of laccase-mediator system in the removal of dyes. By mediator screening, the mediators of ABTS and AS (ABTS, 2, 2'-azino-bis-(3-ethylbenzothiazo-thiazoline-6-sulphonic acid); AS, acetosyringone) were combined for dyes decolorization. The Box-Behnken Design and response surface analysis was performed to optimize experiment conditions. Comparing the CotA-ABTS-AS cocktail system with CotA-single mediator system showed that the coupling of ABTS and AS could increase the decolorization rate 15 times higher, save a third of the cost and shorten the reaction time by 50%. In addition, our studies revealed that sequential oxidation may occur in CotA-ABTS-AS system. Compared with CotA laccase-single mediator system, the CotA-ABTS-AS cocktail system showed advantages including higher efficiency, lower cost and shorter reaction time. This was the first report on the dyes decolorization by laccase mediator cocktail system. These results paved the curb for the application of laccase mediator system in various industrial processes. © 2018 The Society for Applied Microbiology.

  8. A Sequential Combination of Laccase Pretreatment and Enzymatic Hydrolysis for Glucose Production from Furfural Residues

    Directory of Open Access Journals (Sweden)

    Hailong Yu

    2014-06-01

    Full Text Available Furfural residues (FRs were pretreated with laccase or a laccase-mediator (1-hydroxybenzotriazole, HBT system to produce fermentable sugar for bioethanol production. Compared to laccase-only pretreatment, laccase-mediator pretreatment dissolved more lignin. Approximately 10.5% of the initially present lignin was removed when FRs were treated with a laccase loading of 100 U/g of dry substrate in 1% (w/w HBT at 48 °C for 24 h in an acetate buffer (pH 4.8. The enzymatic saccharification process was carried out by a combined laccase or laccase-mediator pretreatment without washing of the treated solids. The results showed that active laccase had a negative effect on the rate and yield of enzymatic hydrolysis. Laccase-oxidized HBT seriously reduced glucose yield. However, non-oxidized HBT increased glucose yield when laccase was deactivated at 121 °C for 20 min prior to enzymatic hydrolysis. The highest glucose yield, 80.9%, was obtained from the substrate pretreated with 100 U/g of dry substrate laccase and 1% (w/w HBT at 48 °C for 24 h in an acetate buffer (pH 4.8. Furthermore, the structures of FRs before and after laccase-mediator pretreatment were characterized by scanning electron microscopy (SEM and Fourier Transform Infrared spectroscopy (FT-IR.

  9. Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27.

    Science.gov (United States)

    Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

    2015-01-01

    Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by LC MS/MS analysis. The method led to very effective (90%) laccase immobilization and also imparted significant stability to the enzyme (more than 70% after 5 months of storage at 4°C). In batch decolorization, 90-95% decolorization was achieved of the simulated dye effluent for up to 10-20 cycles. Continuous decolorization in a packed bed bioreactor led to nearly 90% decolorization for up to 5 days. The immobilized laccase was also effective in decolorization and degradation of Acid Red 27 in the presence of a mediator. Four products of degradation were identified by LC-MS/MS analysis. The immobilized laccase in PVA-nitrate was concluded to be an effective agent in treatment of textile dye effluents.

  10. Bioprospecting and biotechnological applications of fungal laccase.

    Science.gov (United States)

    Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar

    2016-06-01

    Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.

  11. Laccase catalyzed grafting of-N-OH type mediators to lignin via radical-radical coupling

    DEFF Research Database (Denmark)

    Munk, Line; Punt, A. M.; Kabel, M. A.

    2017-01-01

    Lignin is an underexploited resource in biomass refining. Laccases (EC 1.10.3.2) catalyze oxidation of phenolic hydroxyls using O2 as electron acceptor and may facilitate lignin modification in the presence of mediators. This study assessed the reactivity of four different synthetic mediators...... better than HBT (1-hydroxybenzotriazole). Three different mechanisms are suggested to explain the grafting of HPI and HBT, all involving radical-radical coupling to produce covalent bonding to lignin. Lignin from exhaustive cellulase treatment of wheat straw was more susceptible to grafting than beech...... organosolv lignin with the relative abundance of grafting being 35% vs. 11% for HPI and 5% vs. 1% for HBT on these lignin substrates. The data imply that lignin can be functionalized via laccase catalysis with-N-OH type mediators....

  12. Laccase catalyzed grafting of-N-OH type mediators to lignin via radical-radical coupling

    NARCIS (Netherlands)

    Munk, L.; Punt, A.M.; Kabel, M.A.; Meyer, A.S.

    2017-01-01

    Lignin is an underexploited resource in biomass refining. Laccases (EC 1.10.3.2) catalyze oxidation of phenolic hydroxyls using O2 as electron acceptor and may facilitate lignin modification in the presence of mediators. This study assessed the reactivity of four different synthetic mediators by

  13. Laccase-mediator catalyzed conversion of model lignin compounds

    Science.gov (United States)

    Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...

  14. Phenolics as Mediators to Accelerate the Enzymatically Initialized Oxidation of Laccase-Mediator-Systems for the Production of Medium Density Fiberboards

    Directory of Open Access Journals (Sweden)

    Alexander Kirsch

    2016-07-01

    Full Text Available Crude oil as a non-renewable resource is creating new challenges in many industrial sectors. Unsteady costs of crude oil at present and expected increases in the future are due to its limited availability as a finite resource, and these costs negatively impact the industry for wood-based panels, which use petrochemical resins in binding agents. Furthermore, wood panels that are conventionally bonded using urea formaldehyde diffuse formaldehyde into the surrounding air. To achieve independence from petrochemical products and harmful formaldehyde emissions, alternatives for their substitution are in demand. An alternative approach is the enzymatic activation of lignin located on the surface of thermomechanical pulp (TMP fibers. The present study shows the results of internal bond strength (DIN EN 319 1993, modulus of rupture (DIN EN 310 1993, and thickness swelling (EN 317 2003 of medium-density fiberboards (MDF bonded with laccase-mediator-system (LMS. Caffeic acid (CA, 4-hydoxy benzoic acid (HBA, and vanillic alcohol (VAl were used as mediators. The physical and technological properties of MDF, such as internal bond strength, modulus of rupture, and thickness swelling, mostly fulfilled the European standards.

  15. Laccase from Pycnoporus cinnabarinus and phenolic compounds: can the efficiency of an enzyme mediator for delignifying kenaf pulp be predicted?

    Science.gov (United States)

    Andreu, Glòria; Vidal, Teresa

    2013-03-01

    In this work, kenaf pulp was delignified by using laccase in combination with various redox mediators and the efficiency of the different laccase–mediator systems assessed in terms of the changes in pulp properties after bleaching. The oxidative ability of the individual mediators used (acetosyringone, syringaldehyde, p-coumaric acid, vanillin and actovanillone) and the laccase–mediator systems was determined by monitoring the oxidation–reduction potential (ORP) during process. The results confirmed the production of phenoxy radicals of variable reactivity and stressed the significant role of lignin structure in the enzymatic process. Although changes in ORP were correlated with the oxidative ability of the mediators, pulp properties as determined after the bleaching stage were also influenced by condensation and grafting reactions. As shown here, ORP measurements provide a first estimation of the delignification efficiency of a laccase–mediator system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Visible-Light-Driven Oxidation of Organic Substrates with Dioxygen Mediated by a [Ru(bpy)3 ](2+) /Laccase System.

    Science.gov (United States)

    Schneider, Ludovic; Mekmouche, Yasmina; Rousselot-Pailley, Pierre; Simaan, A Jalila; Robert, Viviane; Réglier, Marius; Aukauloo, Ally; Tron, Thierry

    2015-09-21

    Oxidation reactions are highly important chemical transformations that still require harsh reaction conditions and stoichiometric amounts of chemical oxidants that are often toxic. To circumvent these issues, olefins oxidation is achieved in mild conditions upon irradiation of an aqueous solution of the complex [Ru(bpy)3 ](2+) and the enzyme laccase. Epoxide formation is coupled to the light-driven reduction of O2 by [Ru(bpy)3 ](2+) /laccase system. The reactivity can be explained by dioxygen acting both as an oxidative agent and as renewable electron acceptor, avoiding the use of a sacrificial electron acceptor. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A high effective NADH-ferricyanide dehydrogenase coupled with laccase for NAD(+) regeneration.

    Science.gov (United States)

    Wang, Jizhong; Yang, Chengli; Chen, Xing; Bao, Bingxin; Zhang, Xuan; Li, Dali; Du, Xingfan; Shi, Ruofu; Yang, Junfang; Zhu, Ronghui

    2016-08-01

    To find an efficient and cheap system for NAD(+) regeneration A NADH-ferricyanide dehydrogenase was obtained from an isolate of Escherichia coli. Optimal activity of the NADH dehydrogenase was at 45 °C and pH 7.5, with a K m value for NADH of 10 μM. By combining the NADH dehydrogenase, potassium ferricyanide and laccase, a bi-enzyme system for NAD(+) regeneration was established. The system is attractive in that the O2 consumed by laccase is from air and the sole byproduct of the reaction is water. During the reaction process, 10 mM NAD(+) was transformed from NADH in less than 2 h under the condition of 0.5 U NADH dehydrogenase, 0.5 U laccase, 0.1 mM potassium ferricyanide at pH 5.6, 30 °C CONCLUSION: The bi-enzyme system employed the NADH-ferricyanide dehydrogenase and laccase as catalysts, and potassium ferricyanide as redox mediator, is a promising alternative for NAD(+) regeneration.

  18. Multicomponent kinetic analysis and theoretical studies on the phenolic intermediates in the oxidation of eugenol and isoeugenol catalyzed by laccase.

    Science.gov (United States)

    Qi, Yan-Bing; Wang, Xiao-Lei; Shi, Ting; Liu, Shuchang; Xu, Zhen-Hao; Li, Xiqing; Shi, Xuling; Xu, Ping; Zhao, Yi-Lei

    2015-11-28

    Laccase catalyzes the oxidation of natural phenols and thereby is believed to initialize reactions in lignification and delignification. Numerous phenolic mediators have also been applied in laccase-mediator systems. However, reaction details after the primary O-H rupture of phenols remain obscure. In this work two types of isomeric phenols, EUG (eugenol) and ISO (trans-/cis-isoeugenol), were used as chemical probes to explore the enzymatic reaction pathways, with the combined methods of time-resolved UV-Vis absorption spectra, MCR-ALS, HPLC-MS, and quantum mechanical (QM) calculations. It has been found that the EUG-consuming rate is linear to its concentration, while the ISO not. Besides, an o-methoxy quinone methide intermediate, (E/Z)-4-allylidene-2-methoxycyclohexa-2,5-dienone, was evidenced in the case of EUG with the UV-Vis measurement, mass spectra and TD-DFT calculations; in contrast, an ISO-generating phenoxyl radical, a (E/Z)-2-methoxy-4-(prop-1-en-1-yl) phenoxyl radical, was identified in the case of ISO. Furthermore, QM calculations indicated that the EUG-generating phenoxyl radical (an O-centered radical) can easily transform into an allylic radical (a C-centered radical) by hydrogen atom transfer (HAT) with a calculated activation enthalpy of 5.3 kcal mol(-1) and then be fast oxidized to the observed eugenol quinone methide, rather than an O-radical alkene addition with barriers above 12.8 kcal mol(-1). In contrast, the ISO-generating phenoxyl radical directly undergoes a radical coupling (RC) process, with a barrier of 4.8 kcal mol(-1), while the HAT isomerization between O- and C-centered radicals has a higher reaction barrier of 8.0 kcal mol(-1). The electronic conjugation of the benzyl-type radical and the aromatic allylic radical leads to differentiation of the two pathways. These results imply that competitive reaction pathways exist for the nascent reactive intermediates generated in the laccase-catalyzed oxidation of natural phenols, which is

  19. Production of cellobionate from cellulose using an engineered Neurospora crassa strain with laccase and redox mediator addition

    Science.gov (United States)

    We report a novel production process for cellobionic acid from cellulose using an engineered fungal strain with the exogenous addition of laccase and a redox mediator. A previously engineered strain of Neurospora crassa (F5'ace-1'cre-1'ndvB) was shown to produce cellobionate directly from cellulose ...

  20. Electron Beam-Induced Immobilization of Laccase on Porous Supports for Waste Water Treatment Applications

    Directory of Open Access Journals (Sweden)

    Elham Jahangiri

    2014-08-01

    Full Text Available The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a “green” water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA. Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state.

  1. Catalytic efficiency of natural and synthetic compounds used as laccase-mediators in oxidising veratryl alcohol and a kraft lignin, estimated by electrochemical analysis

    International Nuclear Information System (INIS)

    Gonzalez Arzola, K.; Arevalo, M.C.; Falcon, M.A.

    2009-01-01

    The electrochemical properties of eighteen natural and synthetic compounds commonly used to expand the oxidative capacity of laccases were evaluated in an aqueous buffered medium using cyclic voltammetry. This clarifies which compounds fulfil the requisites to be considered as redox mediators or enhancers. Cyclic voltammetry was also applied as a rapid way to assess the catalytic efficiency (CE) of those compounds which oxidise a non-phenolic lignin model (veratryl alcohol, VA) and a kraft lignin (KL). With the exception of gallic acid and catechol, all assayed compounds were capable of oxidising VA with varying CE. However, only some of them were able to oxidise KL. Although the oxidised forms of HBT and acetovanillone were not electrochemically stable, their reduced forms were quickly regenerated in the presence of VA. They thus act as chemical catalysts. Importantly, HBT and HPI did not attack the KL via the same mechanism as in VA oxidation. Electrochemical evidence suggests that violuric acid oxidises both substrates by an electron transfer mechanism, unlike the other N-OH compounds HBT and HPI. Acetovanillone was found to be efficient in oxidising VA and KL, even better than the synthetic mediators TEMPO, violuric acid or ABTS. Most of the compounds produced a generalised increase in the oxidative charge of KL, probably attributed to chain reactions arising between the phenolic and non-phenolic components of this complex molecule

  2. Catalytic efficiency of natural and synthetic compounds used as laccase-mediators in oxidising veratryl alcohol and a kraft lignin, estimated by electrochemical analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez Arzola, K. [Department of Microbiology and Cell Biology, Faculty of Pharmacy, University of La Laguna, 38206 La Laguna, Tenerife (Spain); Arevalo, M.C. [Department of Physical Chemistry, Faculty of Chemistry, University of La Laguna, 38206 La Laguna, Tenerife (Spain)], E-mail: carevalo@ull.es; Falcon, M.A. [Department of Microbiology and Cell Biology, Faculty of Pharmacy, University of La Laguna, 38206 La Laguna, Tenerife (Spain)], E-mail: mafalcon@ull.es

    2009-03-30

    The electrochemical properties of eighteen natural and synthetic compounds commonly used to expand the oxidative capacity of laccases were evaluated in an aqueous buffered medium using cyclic voltammetry. This clarifies which compounds fulfil the requisites to be considered as redox mediators or enhancers. Cyclic voltammetry was also applied as a rapid way to assess the catalytic efficiency (CE) of those compounds which oxidise a non-phenolic lignin model (veratryl alcohol, VA) and a kraft lignin (KL). With the exception of gallic acid and catechol, all assayed compounds were capable of oxidising VA with varying CE. However, only some of them were able to oxidise KL. Although the oxidised forms of HBT and acetovanillone were not electrochemically stable, their reduced forms were quickly regenerated in the presence of VA. They thus act as chemical catalysts. Importantly, HBT and HPI did not attack the KL via the same mechanism as in VA oxidation. Electrochemical evidence suggests that violuric acid oxidises both substrates by an electron transfer mechanism, unlike the other N-OH compounds HBT and HPI. Acetovanillone was found to be efficient in oxidising VA and KL, even better than the synthetic mediators TEMPO, violuric acid or ABTS. Most of the compounds produced a generalised increase in the oxidative charge of KL, probably attributed to chain reactions arising between the phenolic and non-phenolic components of this complex molecule.

  3. In silico analysis of Pycnoporus cinnabarinus laccase active site with toxic industrial dyes.

    Science.gov (United States)

    Prasad, Nirmal K; Vindal, Vaibhav; Narayana, Siva Lakshmi; Ramakrishna, V; Kunal, Swaraj Priyaranjan; Srinivas, M

    2012-05-01

    Laccases belong to multicopper oxidases, a widespread class of enzymes implicated in many oxidative functions in various industrial oxidative processes like production of fine chemicals to bioremediation of contaminated soil and water. In order to understand the mechanisms of substrate binding and interaction between substrates and Pycnoporus cinnabarinus laccase, a homology model was generated. The resulted model was further validated and used for docking studies with toxic industrial dyes- acid blue 74, reactive black 5 and reactive blue 19. Interactions of chemical mediators with the laccase was also examined. The docking analysis showed that the active site always cannot accommodate the dye molecules, due to constricted nature of the active site pocket and steric hindrance of the residues whereas mediators are relatively small and can easily be accommodated into the active site pocket, which, thereafter leads to the productive binding. The binding properties of these compounds along with identification of critical active site residues can be used for further site-directed mutagenesis experiments in order to identify their role in activity and substrate specificity, ultimately leading to improved mutants for degradation of these toxic compounds.

  4. Evaluation of fungal laccase immobilized on natural nanostructured bacterial cellulose

    Directory of Open Access Journals (Sweden)

    Lin eChen

    2015-11-01

    Full Text Available The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled 7 times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors.

  5. Bacterial laccase: recent update on production, properties and industrial applications.

    Science.gov (United States)

    Chauhan, Prakram Singh; Goradia, Bindi; Saxena, Arunika

    2017-10-01

    Laccases (benzenediol: oxygen oxidoreductase, EC 1.10.3.2) are multi-copper enzymes which catalyze the oxidation of a wide range of phenolic and non-phenolic aromatic compounds in the presence or absence of a mediator. Till date, laccases have mostly been isolated from fungi and plants, whereas laccase from bacteria has not been well studied. Bacterial laccases have several unique properties that are not characteristics of fungal laccases such as stability at high temperature and high pH. Bacteria produce these enzymes either extracellularly or intracellularly and their activity is in a wide range of temperature and pH. It has application in pulp biobleaching, bioremediation, textile dye decolorization, pollutant degradation, biosensors, etc. Hence, comprehensive information including sources, production conditions, characterization, cloning and biotechnological applications is needed for the effective understanding and application of these enzymes at the industrial level. The present review provides exhaustive information of bacterial laccases reported till date.

  6. Effect Of Metal Ions On Triphenylmethane Dye Decolorization By Laccase From Trametes Versicolor

    Directory of Open Access Journals (Sweden)

    Chmelová Daniela

    2015-12-01

    Full Text Available The aim of this study was investigate the influence of different metal ions on laccase activity and triphenylmethane dye decolorization by laccase from white-rot fungus Trametes versicolor. Laccase activity was inhibited by monovalent ions (Li+, Na+, K+ and Ag+ but the presence of divalent ions increased laccase activity at the concentration of 10 mmol/l. The effect of metal ions on decolorization of triphenylmethane dyes with different structures namely Bromochlorophenol Blue, Bromophenol Blue, Bromocresol Blue and Phenol Red was tested. The presence of metal ions (Na+, K+, Mg2+, Ca2+, Ba2+, Mn2+, Zn2+ slightly decreased triphenylmethane dye decolorization by laccase from T. versicolor except Na+ and Mg2+, which caused the increase of decolorization for all tested dyes. Decolorization of selected dyes showed that the presence of low-molecular-weight compounds is necessary for effective decolorization. Hydroxybenzotriazole (HBT is the most frequently used. Although HBT belongs to most frequently used redox mediator and generally increase decolorization efficiency, so its presence decreased decolorization percentage of Bromophenol Blue and Bromochlorophenol Blue, the influence of metal ions to dye decolorization by laccase has the similar course with or without presence of redox mediator HBT.

  7. Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27

    OpenAIRE

    Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy

    2015-01-01

    Background Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. Methods In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by ...

  8. A three-enzyme-system to degrade curcumin to natural vanillin.

    Science.gov (United States)

    Esparan, Vida; Krings, Ulrich; Struch, Marlene; Berger, Ralf G

    2015-04-14

    The symmetrical structure of curcumin includes two 4-hydroxy-3-methoxyphenyl substructures. Laccase catalyzed formation of a phenol radical, radical migration and oxygen insertion at the benzylic positions can result in the formation of vanillin. As vanillin itself is a preferred phenolic substrate of laccases, the formation of vanillin oligomers and polymers is inevitable, once vanillin becomes liberated. To decelerate the oligomerization, one of the phenolic hydroxyl groups was protected via acetylation. Monoacetyl curcumin with an approximate molar yield of 49% was the major acetylation product, when a lipase from Candida antarctica (CAL) was used. In the second step, monoacetyl curcumin was incubated with purified laccases of various basidiomycete fungi in a biphasic system (diethyl ether/aqueous buffer). A laccase from Funalia trogii (LccFtr) resulted in a high conversion (46% molar yield of curcumin monoacetate) to vanillin acetate. The non-protected vanillin moiety reacted to a mixture of higher molecular products. In the third step, the protecting group was removed from vanillin acetate using a feruloyl esterase from Pleurotus eryngii (PeFaeA) (68% molar yield). Alignment of the amino acid sequences indicated that high potential laccases performed better in this mediator and cofactor-free reaction.

  9. STUDIES ON XYLANASE AND LACCASE ENZYMATIC PREBLEACHING TO REDUCE CHLORINE-BASED CHEMICALS DURING CEH AND ECF BLEACHING

    Directory of Open Access Journals (Sweden)

    Vasanta V. Thakur,

    2012-02-01

    Full Text Available The biobleaching efficiency of xylanase and laccase enzymes was studied on kraft pulps from wood and nonwood based raw materials employed in the Indian paper industry. Treatment of these pulps with xylanase enzyme could result in improved properties, showing 2.0% ISO gain in pulp brightness and/or reducing the demand of chlorine-based bleach chemicals by up to 15% with simultaneous reduction of 20 to 25% in AOX generation in bleach effluents. Further, mill-scale trial results revealed that enzymatic prebleaching can be successfully employed with xylanases to reach the same bleach boosting efficacy. Laccase bleaching was also studied on hardwood pulp at a pH around 8.0, where most of the pulp mills in India are operating, in contrast to earlier studies on laccase enzyme bleaching, which were conducted at acidic pHs, i.e. 4.0 to 5.0. In case of laccase bleaching, interesting results were found wherein a bleach-boosting effect was observed even at pH 8.0. Further studies carried out with HOBT as mediator in comparison to the commonly used and expensive ABTS laccase mediator system (LMS resulted in improvement of the bleaching efficiency with reduction in demand of chlorine dioxide by more than 35%. Potential for further reduction was indicated by the brightness gain, when compared with a control using the DE(pD bleach sequence.

  10. Plants increase laccase activity in soil with long-term elevated CO2 legacy

    DEFF Research Database (Denmark)

    Partavian, Asrin; Mikkelsen, Teis Nørgaard; Vestergård, Mette

    2015-01-01

    [CO2] stimulate laccase activity. We incubated soil exposed to seven years of elevated or ambient field [CO2] in ambient or elevated [CO2] chambers for six months either with or without plants (Deschampsia flexuosa). Elevated chamber [CO2] increased D. flexuosa production and belowground respiration....... Interestingly, plants also grew larger in soil with an elevated [CO2] legacy. Plants stimulated soil microbial biomass, belowground respiration and laccase activity, and the plant-induced laccase stimulation was particularly apparent in soil exposed to long-term elevated [CO2] in the field, whereas laccase......Actively growing plants can stimulate mineralization of recalcitrant soil organic matter (SOM), and increased atmospheric [CO2] can further enhance such plant-mediated SOM degradation. Laccases are central for recalcitrant SOM decomposition, and we therefore hypothesized that plants and elevated...

  11. Zinc-Laccase Biofuel Cell

    Directory of Open Access Journals (Sweden)

    Abdul Aziz Ahmad

    2011-12-01

    Full Text Available A zinc-laccase biofuel cell adapting the zinc-air cell design features is investigated. A simple cell design configuration is employed: a membraneless single chamber and a freely suspended laccase in a quasi-neutral buffer electrolyte. The cell is characterised according to its open-circuit voltage, polarization profile, power density plot and discharge capacity at constant current. The biocatalytic role of laccase is evident from the polarization profile and power output plot. Performance comparison between a single chamber and dual chamber cell design is also presented. The biofuel cell possessed an open-circuit voltage of 1.2 V and delivered a maximum power density of 0.9 mW/cm2 at current density of 2.5 mA/cm2. These characteristics are comparable to biofuel cell utilising a much more complex system design.KEY WORDS (keyword:  Biofuel cell, Bioelectrochemical cell, Zinc anode, Laccase and Oxidoreductase.ABSTRAK: Sel bio-bahan api zink-laccase dengan adaptasi daripada ciri-ciri rekabentuk sel zink-udara telah dikaji. Sel dengan konfigurasi rekabentuk yang mudah digunapakai: ruangan tunggal tanpa membran dan laccase diampaikan secara bebas di dalam elektrolit pemampan quasi-neutral. Sel dicirikan berdasarkan voltan litar terbuka, profil polarisasi, plot ketumpatan kuasa dan kapasiti discas pada arus malar. Peranan laccase sebagai bio-pemangkin adalah amat ketara daripada profil polarisasi dan plot ketumpatan kuasa. Perbandingan prestasi di antara sel dengan rekabentuk ruangan tunggal and dwi-ruangan turut diketengahkan. Seperti dijangkakan, sel dengan rekabentuk ruangan tunggal menunjukkan kuasa keluaran yang lebih rendah jika dibandingkan dengan rekabentuk dwi-ruangan kemungkinan disebabkan fenomena cas bocor. Sel bio-bahan api ini mempunyai voltan litar terbuka 1.2 V dan memberikan ketumpatan kuasa maksima 0.9 mW/cm2 pada ketumpatan arus 2.5 mA/cm2. Ciri-ciri ini adalah sebanding dengan sel bio-bahan api yang menggunapakai rekabentuk sel

  12. Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds.

    Directory of Open Access Journals (Sweden)

    Yang Yang

    Full Text Available Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+ and Fe(2+ could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.

  13. Enhancing the laccase production and laccase gene expression in the white-rot fungus Trametes velutina 5930 with great potential for biotechnological applications by different metal ions and aromatic compounds.

    Science.gov (United States)

    Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu

    2013-01-01

    Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.

  14. Inactivation of Laccase by the Attack of As (III) Reaction in Water.

    Science.gov (United States)

    Hu, Jinyuan; Lu, Kun; Dong, Shipeng; Huang, Qingguo; Mao, Liang

    2018-03-06

    Laccase is a multicopper oxidase containing four coppers as reaction sites, including one type 1, one type 2, and two type 3. We here provide the first experimental data showing that As (III) can be effectively removed from water and transformed to As (V) through reactions mediated by laccase with the presence of oxygen. To this end, the As (III) removal, As (V) yields, total protein, active laccase, and copper concentrations in the aqueous phase were determined, respectively. Additionally, electron paramagnetic resonance spectra and UV-vis spectra were applied to probe possible structural changes of the laccase during the reaction. The data offer the first evidence that laccase can be inactivated by As (III) attack thus leading to the release of type 2 copper. The released copper has no reactivity with the As (III). These findings provide new ideas into a significant pathway likely to master the environmental transformation of arsenite, and advance the understanding of laccase inactivation mechanisms, thus providing a foundation for optimization of enzyme-based processes and potential development for removal and remediation of arsenite contamination in the environment.

  15. Laccase-Catalyzed Surface Modification of Thermo-Mechanical Pulp (TMP) for the Production of Wood Fiber Insulation Boards Using Industrial Process Water

    Science.gov (United States)

    Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert

    2015-01-01

    Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652

  16. A Three-Enzyme-System to Degrade Curcumin to Natural Vanillin

    Directory of Open Access Journals (Sweden)

    Vida Esparan

    2015-04-01

    Full Text Available The symmetrical structure of curcumin includes two 4-hydroxy-3-methoxyphenyl substructures. Laccase catalyzed formation of a phenol radical, radical migration and oxygen insertion at the benzylic positions can result in the formation of vanillin. As vanillin itself is a preferred phenolic substrate of laccases, the formation of vanillin oligomers and polymers is inevitable, once vanillin becomes liberated. To decelerate the oligomerization, one of the phenolic hydroxyl groups was protected via acetylation. Monoacetyl curcumin with an approximate molar yield of 49% was the major acetylation product, when a lipase from Candida antarctica (CAL was used. In the second step, monoacetyl curcumin was incubated with purified laccases of various basidiomycete fungi in a biphasic system (diethyl ether/aqueous buffer. A laccase from Funalia trogii (LccFtr resulted in a high conversion (46% molar yield of curcumin monoacetate to vanillin acetate. The non-protected vanillin moiety reacted to a mixture of higher molecular products. In the third step, the protecting group was removed from vanillin acetate using a feruloyl esterase from Pleurotus eryngii (PeFaeA (68% molar yield. Alignment of the amino acid sequences indicated that high potential laccases performed better in this mediator and cofactor-free reaction.

  17. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase.

    Science.gov (United States)

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-10-23

    Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200

  18. Heterologous expression and characterization of a laccase from Laccaria bicolor in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Bo Wang

    2016-01-01

    Full Text Available Synthetic dyes are known to be highly toxic to mammalian cells and mutagenic and carcinogenic to humans and, therefore, should be detoxified and removed from industrial effluents. Different approaches for removal and detoxication are extensively sought. Biochemical methods are considered the most economical and effective method of dye decolourization. In this research, the laccase gene from Laccaria bicolor was modified and expressed in Pichia pastoris. The properties of the recombinant laccase and its ability to degrade synthetic dyes were studied. The laccase activity was optimal at pH 2.2 and 50 °C. Its Km value was 0.187 mmol/L for ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid]. The laccase obtained was shown to decolorize the synthetic dyes, malachite green, crystal violet and orange G, with ABTS as a mediator. These results indicated that the laccase obtained may be used to treat industrial effluents containing artificial dyes.

  19. Kinetics of Adsorbable Organic Halides (AOX Reduction in Laccase-Aided Chlorine Dioxide Bleaching of Bagasse Pulp

    Directory of Open Access Journals (Sweden)

    Xueping Song

    2016-07-01

    Full Text Available This paper presents a kinetic model of the laccase-aided chlorine dioxide bleaching of bagasse pulp. The kinetic model was based on the rate of reduction of adsorbed organic halogen (AOX. The effects of the laccase enzyme dosage, the mediator 1-hydroxybenzotriazole (HBT dosage, and the reaction temperature on the AOX content of the bleaching effluent are discussed. Good fits were obtained for the experimental data obtained from the different laccase enzyme dosages, HBT dosages, and reaction temperatures, indicating the feasibility of the kinetic model as a means of predicting the optimal operation conditions for the laccase-aided chlorine dioxide bleaching of bagasse pulp in the future.

  20. Laccase detoxification mediates the nutritional alliance between leaf-cutting ants and fungus-garden symbionts.

    Science.gov (United States)

    De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J

    2013-01-08

    Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.

  1. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    Directory of Open Access Journals (Sweden)

    Garg Neha

    2012-10-01

    Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was

  2. Screening for novel laccase-producing microbes.

    Science.gov (United States)

    Kiiskinen, L-L; Rättö, M; Kruus, K

    2004-01-01

    To discover novel laccases potential for industrial applications. Fungi were cultivated on solid media containing indicator compounds that enabled the detection of laccases as specific colour reactions. The indicators used were Remazol Brilliant Blue R (RBBR), Poly R-478, guaiacol and tannic acid. The screening work resulted in isolation of 26 positive fungal strains. Liquid cultivations of positive strains confirmed that four efficient laccase producers were found in the screening. Biochemical characteristics of the four novel laccases were typical for fungal laccases in terms of molecular weight, pH optima and pI. The laccases showed good thermal stability at 60 degrees C. Plate-test screening based on polymeric dye compounds, guaiacol and tannic acid is an efficient way to discover novel laccase producers. The results indicated that screening for laccase activity can be performed with guaiacol and RBBR or Poly R-478. Laccases have many potential industrial applications including textile dye decolourization, delignification of pulp and effluent detoxification. It is essential to find novel, efficient enzymes to further develop these applications. This study showed that relatively simple plate test screening method can be used for discovery of novel laccases. Copyright 2004 The Society for Applied Microbiology

  3. Laccase engineering: from rational design to directed evolution.

    Science.gov (United States)

    Mate, Diana M; Alcalde, Miguel

    2015-01-01

    Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Characterization of the laccase-mediated oligomerization of 4-hydroxybenzoic acid

    NARCIS (Netherlands)

    Slagman, S.; Escorihuela Fuentes, J.; Zuilhof, H.; Franssen, M.C.R.

    2016-01-01

    Modifying inert poly(ethersulfone) membranes using laccase has proven to be an environmentally benign and easily applicable process to alter the membrane's surface properties. By this method phenolic acid monomers such as 4-hydroxybenzoic acid are grafted from the membrane surface to make it

  5. Purification of a new isoform of laccase from a Marasmius quercophilus strain isolated from a cork oak litter (Quercus suber L).

    Science.gov (United States)

    Farnet, A M; Criquet, S; Pocachard, E; Gil, G; Ferre, E

    2002-01-01

    A new isoform of laccase from Marasmius quercophilus is described in this study. The strain of this white-rot fungus was isolated for the first time on a cork oak litter. This isoform exhibited certain common properties of laccases (a molecular weight of 65 Kda, an optimum pH of 6.2 with syringaldazine). But this laccase has also particularly novel features: the best activity measured was observed at high temperatures (80 C) and this isoform was not inhibited with EDTA. Furthermore, this induced laccase was able to transform most of the aromatic compounds tested without the addition of mediators to the reaction mixture, and the transformation of certain chlorophenols (2-chlorophenol and 2,4-dichlorophenol) by a laccase isoform from M. quercophilus is reported here for the first time. We also demonstrate the importance of 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) as a mediator since it allowed veratryl alcohol and p-hydroxybenzoic acid transformation. Moreover, new products of transformation were observed using the combination of ABTS with this isoform of laccase.

  6. Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

    Directory of Open Access Journals (Sweden)

    Ricardo Sposina S. Teixeira

    2010-01-01

    Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.

  7. Enzyme-Catalyzed Oxidation of 17β-Estradiol Using Immobilized Laccase from Trametes versicolor

    Science.gov (United States)

    Cardinal-Watkins, Chantale; Nicell, Jim A.

    2011-01-01

    Many natural and synthetic estrogens are amenable to oxidation through the catalytic action of oxidative enzymes such as the fungal laccase Trametes versicolor. This study focused on characterizing the conversion of estradiol (E2) using laccase that had been immobilized by covalent bonding onto silica beads contained in a bench-scale continuous-flow packed bed reactor. Conversion of E2 accomplished in the reactor declined when the temperature of the system was changed from room temperature to just above freezing at pH 5 as a result of a reduced rate of reaction rather than inactivation of the enzyme. Similarly, conversion increased when the system was brought to warmer temperatures. E2 conversion increased when the pH of the influent to the immobilized laccase reactor was changed from pH 7 to pH 5, but longer-term experiments showed that the enzyme is more stable at pH 7. Results also showed that the immobilized laccase maintained its activity when treating a constant supply of aqueous E2 at a low mean residence time over a 12-hour period and when treating a constant supply of aqueous E2 at a high mean residence time over a period of 9 days. PMID:21869925

  8. Formation of hydroxylated polybrominated diphenyl ethers from laccase-catalyzed oxidation of bromophenols.

    Science.gov (United States)

    Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay

    2015-11-01

    Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Phenol oxidation of petrol refinery wastewater catalyzed by Laccase

    International Nuclear Information System (INIS)

    Vargas, Maria Carolina; Ramirez, Nubia E.

    2002-01-01

    Laccase has been obtained through two different production systems, the first using Pleurotus ostreatus in solid-state fermentation, the second one using Trametes versicolor in submerged culture. Different substrates (by products from yeast, flour and beverage industries) have been evaluated in both systems. Maximum laccase yield with Pleurotus ostreatus (25 u/ml) was obtained in a wheat bran medium. The maximum enzyme concentration level using Trametes versicolor (25 u/ml) was achieved in a submerged system, containing 10% vinasse, 4,5% wheat bran and 0,2% molasses per liter of waste. Culture filtrate extracted from Pleurotus ostreatus was used to remove phenol from wastewater. The enzymatic treatment is effective over a wide pH and temperature range. The Laccase treatment has been successfully used to dephenolize industrial petrol refinery wastewater. The advantage of Laccase dephenolization is that this enzyme uses molecular oxygen as an oxidant

  10. Direct rate assessment of laccase catalysed radical formation in lignin by electron paramagnetic resonance spectroscopy

    DEFF Research Database (Denmark)

    Munk, Line; Andersen, Mogens Larsen; Meyer, Anne S.

    2017-01-01

    Laccases (EC 1.10.3.2) catalyse removal of an electron and a proton from phenolic hydroxyl groups, including phenolic hydroxyls in lignins, to form phenoxy radicals during reduction of O2. We employed electron paramagnetic resonance spectroscopy (EPR) for real time measurement of such catalytic...... to suspensions of the individual lignin samples produced immediate time and enzyme dose dependent increases in intensity in the EPR signal with g-values in the range 2.0047–2.0050 allowing a direct quantitative monitoring of the radical formation and thus allowed laccase enzyme kinetics assessment on lignin...... for the radical formation rate in organosolv lignin was determined by response surface methodology to pH 4.8, 33 °C and pH 5.8, 33 °C for the Tv laccase and the Mt laccase, respectively. The results verify direct radical formation action of fungal laccases on lignin without addition of mediators and the EPR...

  11. Identification and evaluation of bioremediation potential of laccase isoforms produced by Cyathus bulleri on wheat bran.

    Science.gov (United States)

    Vats, Arpita; Mishra, Saroj

    2018-02-15

    Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.

    Science.gov (United States)

    Razak, N N A; Annuar, M S M

    2014-03-01

    Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ∼ 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (ΔT = 40 K) as opposed to fungal biomass (ΔT = 15 K). Comparison of entropy change (ΔS) values indicated metabolism of the dye by the biomass.

  13. Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.

    Science.gov (United States)

    Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo

    2013-01-02

    Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide.

  14. Expression of a thermotolerant laccase from Pycnoporus sanguineus in Trichoderma reesei and its application in the degradation of bisphenol A.

    Science.gov (United States)

    Zhao, Jie; Zeng, Shengquan; Xia, Ying; Xia, Liming

    2018-04-01

    The laccase gene from Pycnoporus sanguineus was cloned and inserted between the strong Pcbh1 promoter and the Tcbh1 terminator from Trichoderma reesei to form the recombinant plasmid pCH-lac. Using Agrobacterium-mediated technique, the pCH-lac was integrated into the chromosomes of T. reesei. Twenty positive transformants were obtained by employing hygromycin B as a selective agent. PCR was used to confirm that the laccase gene was integrated into the chromosomal DNA of T. reesei. Laccase production by recombinant transformants was performed in shaking flasks, and the activity of laccase reached 8.8 IU/mL after 96-h fermentation under a batch process, and 17.7 IU/mL after 144-h fermentation using a fed-batch process. SDS-PAGE analysis of the fermentation broth showed that the molecular mass of the protein was about 68 kDa, almost the same as that of the laccase produced by P. sanguineus, which indicated that laccase was successfully expressed in T. reesei and secreted out of the cells. The laccase produced by the recombinant T. reesei showed good thermal stability, and could degrade the toxic phenolic material bisphenol A efficiently, after 1-h reaction with 0.06 IU/mL laccase and 0.5 mmol/L ABTS as the mediator at 60 °C and pH 4.5, the degradation rate reached 95%, which demonstrated that it had great potential value in treating the household garbage and wastewater containing the bisphenol A. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Preparation of Laccase Immobilized Cryogels and Usage for Decolorization

    Directory of Open Access Journals (Sweden)

    Murat Uygun

    2013-01-01

    Full Text Available Poly(methyl methacrylate-co-glycidyl methacrylate (poly(MMA-co-GMA cryogels were synthesized by radical cryopolymerization technique. Then, laccase enzyme was covalently attached to the cryogel and characterized by using swelling studies and SEM and EDX analyses. Kinetic properties and optimum conditions of the immobilized and free laccase were studied and it was found that of the immobilized laccase was lower than that of free laccase. of the immobilized laccase was increased upon immobilization. Optimum pH was found to be 4.0 for each type of laccase, while optimum temperature was shifted to the warmer region after the immobilization. It was also found that thermal stability of the immobilized laccase was higher than that of free laccase. Immobilized laccase could be used for 10 times successive reuse with no significant decrease in its activity. Also, these laccase immobilized cryogels were successfully used for the decolorization of seven different dyes.

  16. Construction and direct electrochemistry of orientation controlled laccase electrode.

    Science.gov (United States)

    Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong

    2014-03-28

    A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Laccases as palladium oxidases.

    Science.gov (United States)

    Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry

    2015-02-01

    The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.

  18. Evolved α-factor prepro-leaders for directed laccase evolution in Saccharomyces cerevisiae.

    Science.gov (United States)

    Mateljak, Ivan; Tron, Thierry; Alcalde, Miguel

    2017-11-01

    Although the functional expression of fungal laccases in Saccharomyces cerevisiae has proven to be complicated, the replacement of signal peptides appears to be a suitable approach to enhance secretion in directed evolution experiments. In this study, twelve constructs were prepared by fusing native and evolved α-factor prepro-leaders from S. cerevisiae to four different laccases with low-, medium- and high-redox potential (PM1L from basidiomycete PM1; PcL from Pycnoporus cinnabarinus; TspC30L from Trametes sp. strain C30; and MtL from Myceliophthora thermophila). Microcultures of the prepro-leader:laccase fusions were grown in selective expression medium that used galactose as both the sole carbon source and as the inducer of expression so that the secretion and activity were assessed with low- and high-redox potential mediators in a high-throughput screening context. With total activity improvements as high as sevenfold over those obtained with the native α-factor prepro-leader, the evolved prepro-leader from PcL (α PcL ) most strongly enhanced secretion of the high- and medium-redox potential laccases PcL, PM1L and TspC30L in the microtiter format with an expression pattern driven by prepro-leaders in the order α PcL  > α PM 1L  ~ α native . By contrast, the pattern of the low-redox potential MtL was α native  > α PcL  > α PM 1L . When produced in flask with rich medium, the evolved prepro-leaders outperformed the α native signal peptide irrespective of the laccase attached, enhancing secretion over 50-fold. Together, these results highlight the importance of using evolved α-factor prepro-leaders for functional expression of fungal laccases in directed evolution campaigns. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  19. Multiple Reaction Monitoring for quantitative laccase kinetics by LC-MS

    DEFF Research Database (Denmark)

    Perna, Valentina; Agger, Jane W.; Holck, Jesper

    2018-01-01

    as substrates to assess enzyme kinetics by HPLC-MS on two fungal laccases Trametes versicolor laccase, Tv and Ganoderma lucidum laccase, Gl. The method allowed accurate kinetic measurements and detailed insight into the product profiles of both laccases. Both Tv and Gl laccase are active...

  20. Polymerization of Various Lignins via Immobilized Myceliophthora thermophila Laccase (MtL

    Directory of Open Access Journals (Sweden)

    Daniela Huber

    2016-08-01

    Full Text Available Enzymatic polymerization of lignin is an environmentally-friendly and sustainable method that is investigated for its potential in opening-up new applications of one of the most abundant biopolymers on our planet. In this work, the laccase from Myceliophthora thermophila was successfully immobilized onto Accurel MP1000 beads (67% of protein bound to the polymeric carrier and the biocatalyzed oxidation of Kraft lignin (KL and lignosulfonate (LS were carried out. Fluorescence intensity determination, phenol content analysis and size exclusion chromatography were performed in order to elucidate the extent of the polymerization reaction. The collected results show an 8.5-fold decrease of the LS samples’ fluorescence intensity after laccase-mediated oxidation and a 12-fold increase of the weight average molecular weight was obtained.

  1. Exploring the Oxidation of Lignin-Derived Phenols by a Library of Laccase Mutants

    Directory of Open Access Journals (Sweden)

    Isabel Pardo

    2015-09-01

    Full Text Available Saturation mutagenesis was performed over six residues delimiting the substrate binding pocket of a fungal laccase previously engineered in the lab. Mutant libraries were screened using sinapic acid as a model substrate, and those mutants presenting increased activity were selected for exploring the oxidation of lignin-derived phenols. The latter comprised a battery of phenolic compounds of interest due to their use as redox mediators or precursors of added-value products and their biological activity. The new laccase variants were investigated in a multi-screening assay and the structural determinants, at both the substrate and the protein level, for the oxidation of the different phenols are discussed. Laccase activity greatly varied only by changing one or two residues of the enzyme pocket. Our results suggest that once the redox potential threshold is surpassed, the contribution of the residues of the enzymatic pocket for substrate recognition and binding strongly influence the overall rate of the catalytic reaction.

  2. Removal of antibiotics in wastewater by enzymatic treatment with fungal laccase - Degradation of compounds does not always eliminate toxicity.

    Science.gov (United States)

    Becker, Dennis; Varela Della Giustina, Saulo; Rodriguez-Mozaz, Sara; Schoevaart, Rob; Barceló, Damià; de Cazes, Matthias; Belleville, Marie-Pierre; Sanchez-Marcano, José; de Gunzburg, Jean; Couillerot, Olivier; Völker, Johannes; Oehlmann, Jörg; Wagner, Martin

    2016-11-01

    In this study, the performance of immobilised laccase (Trametes versicolor) was investigated in combination with the mediator syringaldehyde (SYR) in removing a mixture of 38 antibiotics in an enzymatic membrane reactor (EMR). Antibiotics were spiked in osmosed water at concentrations of 10μg·L(-1) each. Laccase without mediator did not reduce the load of antibiotics significantly. The addition of SYR enhanced the removal: out of the 38 antibiotics, 32 were degraded by >50% after 24h. In addition to chemical analysis, the samples' toxicity was evaluated in two bioassays (a growth inhibition assay and the Microtox assay). Here, the addition of SYR resulted in a time-dependent increase of toxicity in both bioassays. In cooperation with SYR, laccase effectively removes a broad range of antibiotics. However, this enhanced degradation induces unspecific toxicity. If this issue is resolved, enzymatic treatment may be a valuable addition to existing water treatment technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Recovery of laccase from processed Hericium erinaceus (Bull.:Fr) Pers. fruiting bodies in aqueous two-phase system.

    Science.gov (United States)

    Rajagopalu, Devamalini; Show, Pau Loke; Tan, Yee Shin; Muniandy, Sekaran; Sabaratnam, Vikineswary; Ling, Tau Chuan

    2016-09-01

    The feasible use of aqueous two-phase systems (ATPSs) to establish a viable protocol for the recovery of laccase from processed Hericium erinaceus (Bull.:Fr.) Pers. fruiting bodies was evaluated. Cold-stored (4.00±1.00°C) H. erinaceus recorded the highest laccase activities of 2.02±0.04 U/mL among all the processed techniques. The evaluation was carried out in twenty-five ATPSs, which composed of polyethylene glycol (PEG) with various molecular weights and potassium phosphate salt solution to purify the protein from H. erinaceus. Optimum recovery condition was observed in the ATPS which contained 17% (w/w) PEG with a molecular weight of 8000 and 12.2% (w/w) potassium phosphate solution, at a volume ratio (VR) of 1.0. The use of ATPS resulted in one-single primary recovery stage process that produced an overall yield of 99% with a purification factor of 8.03±0.46. The molecular mass of laccases purified from the bottom phase was in the range of 55-66 kDa. The purity of the partitioned laccase was confirmed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Effect of inducers and culturing processes on laccase synthesis in Phanerochaete chrysosporium NCIM 1197 and the constitutive expression of laccase isozymes

    DEFF Research Database (Denmark)

    Manavalan, Arulmani

    2006-01-01

    Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...

  5. Modulating indium doped tin oxide electrode properties for laccase electron transfer enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Diaconu, Mirela [National Institute for Biological Sciences, Centre of Bioanalysis, 296 Spl. Independentei, Bucharest 060031 (Romania); Chira, Ana [National Institute for Biological Sciences, Centre of Bioanalysis, 296 Spl. Independentei, Bucharest 060031 (Romania); Politehnica University of Bucharest, Faculty of Applied Chemistry and Materials Science, 1-7 Polizu Str., 011061 (Romania); Radu, Lucian, E-mail: gl_radu@chim.upb.ro [Politehnica University of Bucharest, Faculty of Applied Chemistry and Materials Science, 1-7 Polizu Str., 011061 (Romania)

    2014-08-28

    Indium doped tin oxide (ITO) electrodes were functionalized with gold nanoparticles (GNPs) and cysteamine monolayer to enhance the heterogeneous electron transfer process of laccase from Trametes versicolor. The assembly of GNP on ITO support was performed through generation of H{sup +} species at the electrode surface by hydroquinone electrooxidation at 0.9 V vs Ag/AgCl. Uniform distribution of gold nanoparticle aggregates on electrode surfaces was confirmed by atomic force microscopy. The size of GNP aggregates was in the range of 200–500 nm. The enhanced charge transfer at the GNP functionalized ITO electrodes was observed by cyclic voltammetry (CV) and electrochemical impedance spectroscopy. Electrocatalytic behavior of laccase immobilized on ITO modified electrode toward oxygen reduction reaction was evaluated using CV in the presence of 2,2′-azino-bis 3-ethylbenzothiazoline-6-sulfuric acid (ABTS). The obtained sigmoidal-shaped voltammograms for ABTS reduction in oxygen saturated buffer solution are characteristic for a catalytic process. The intensity of catalytic current increased linearly with mediator concentration up to 6.2 × 10{sup −4} M. The registered voltammogram in the absence of ABTS mediator clearly showed a significant faradaic current which is the evidence of the interfacial oxygen reduction. - Highlights: • Assembly of gold nanoparticles on indium tin oxide support at positive potentials • Electrochemical and morphological evaluation of the gold nanoparticle layer assembly • Bioelectrocatalytic oxygen reduction on laccase modified electrode.

  6. Gram-scale production of a basidiomycetous laccase in Aspergillus niger.

    Science.gov (United States)

    Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry

    2014-01-01

    We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. Additive effects of CuSO4 and aromatic compounds on laccase production by Pleurotus sajor-caju PS-2001 using sucrose as a carbon source

    Directory of Open Access Journals (Sweden)

    F. Bettin

    2014-06-01

    Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.

  8. Simultaneous production of laccase and decolouration of the diazo dye Reactive Black 5 in a fixed-bed bioreactor

    International Nuclear Information System (INIS)

    Enayatzamir, Kheirghadam; Alikhani, Hossein A.; Rodriguez Couto, Susana

    2009-01-01

    In this paper the production of laccase and the decolouration of the recalcitrant diazo dye Reactive Black 5 (RB5) by the white-rot fungus Trametes pubescens immobilised on stainless steel sponges in a fixed-bed reactor were studied. Laccase production was increased by 10-fold in the presence of RB5 and reached a maximum value of 1025 U/l. Enhanced laccase production in the presence of RB5 in this fungus is an added advantage during biodegradation of RB5-containing effluents. The decolouration of RB5 was due to two processes: dye adsorption onto the fungal mycelium and dye degradation by the laccase enzymes produced by the fungus. RB5 decolouration was performed during four successive batches obtaining high decolouration percentages (74%, 43% and 52% in 24 h for the first, third and four batch, respectively) without addition of redox mediators. Also, the in vitro decolouration of RB5 by the concentrated culture extract, containing mainly laccase, produced in the above bioreactor was studied. The decolouration percentages obtained were considerably lower (around 20% in 24 h) than that attained with the whole culture

  9. Simultaneous production of laccase and decolouration of the diazo dye Reactive Black 5 in a fixed-bed bioreactor

    Energy Technology Data Exchange (ETDEWEB)

    Enayatzamir, Kheirghadam [Department of Chemical Engineering, Rovira i Virgili University, Av. Paisos Catalans 26, 43007 Tarragona (Spain); Department of Soil Science Engineering, University of Tehran, Karaj (Iran, Islamic Republic of); Alikhani, Hossein A. [Department of Soil Science Engineering, University of Tehran, Karaj (Iran, Islamic Republic of); Rodriguez Couto, Susana [Department of Chemical Engineering, Rovira i Virgili University, Av. Paisos Catalans 26, 43007 Tarragona (Spain)], E-mail: susana.rodriguez@urv.cat

    2009-05-15

    In this paper the production of laccase and the decolouration of the recalcitrant diazo dye Reactive Black 5 (RB5) by the white-rot fungus Trametes pubescens immobilised on stainless steel sponges in a fixed-bed reactor were studied. Laccase production was increased by 10-fold in the presence of RB5 and reached a maximum value of 1025 U/l. Enhanced laccase production in the presence of RB5 in this fungus is an added advantage during biodegradation of RB5-containing effluents. The decolouration of RB5 was due to two processes: dye adsorption onto the fungal mycelium and dye degradation by the laccase enzymes produced by the fungus. RB5 decolouration was performed during four successive batches obtaining high decolouration percentages (74%, 43% and 52% in 24 h for the first, third and four batch, respectively) without addition of redox mediators. Also, the in vitro decolouration of RB5 by the concentrated culture extract, containing mainly laccase, produced in the above bioreactor was studied. The decolouration percentages obtained were considerably lower (around 20% in 24 h) than that attained with the whole culture.

  10. Laccase-catalyzed oxidation and intramolecular cyclization of dopamine: A new method for selective determination of dopamine with laccase/carbon nanotube-based electrochemical biosensors

    International Nuclear Information System (INIS)

    Xiang, Ling; Lin, Yuqing; Yu, Ping; Su, Lei; Mao, Lanqun

    2007-01-01

    This study demonstrates a new electrochemical method for the selective determination of dopamine (DA) with the coexistence of ascorbic acid (AA) and 3,4-dihydroxyphenylacetic acid (DOPAC) with laccase/multi-walled carbon nanotube (MWNT)-based biosensors prepared by cross-linking laccase into MWNT layer confined onto glassy carbon electrodes. The method described here is essentially based on the chemical reaction properties of DA including oxidation, intramolecular cyclization and disproportionation reactions to finally give 5,6-dihydroxyindoline quinone and on the uses of the two-electron and two-proton reduction of the formed 5,6-dihydroxyindoline quinone to constitute a method for the selective determination of DA at a negative potential that is totally separated from those for the redox processes of AA and DOPAC. Instead of the ECE reactions of DA with the first oxidation of DA being driven electrochemically, laccase is used here as the biocatalyst to drive the first oxidation of DA into its quinone form and thus initialize the sequential reactions of DA finally into 5,6-dihydroxyindoline quinone. In addition, laccase also catalyzes the oxidation of AA and DOPAC into electroinactive species with the concomitant reduction of O 2 . As a consequence, a combinational exploitation of the chemical properties inherent in DA and the multifunctional catalytic properties of laccase as well as the excellent electrochemical properties of carbon nanotubes substantially enables the prepared laccase/MWNT-based biosensors to be well competent for the selective determination of DA with the coexistence of physiological levels of AA and DOPAC. This demonstration offers a new method for the selective determination of DA, which could be potentially employed for the determination of DA in biological systems

  11. Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.

    Science.gov (United States)

    Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng

    2018-07-01

    Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

    Science.gov (United States)

    Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

    2017-11-01

    Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Gel-Based Purification and Biochemical Study of Laccase Isozymes from Ganoderma sp. and Its Role in Enhanced Cotton Callogenesis

    Directory of Open Access Journals (Sweden)

    Krishna K. Sharma

    2017-04-01

    Full Text Available Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM, ABTS (15–83 μM and O-tolidine (78–724 μM. Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method.

  14. Mediatorless electron transfer in glucose dehydrogenase/laccase system adsorbed on carbon nanotubes

    International Nuclear Information System (INIS)

    Ratautas, D.; Marcinkevičienė, L.; Meškys, R.; Kulys, J.

    2015-01-01

    Highlights: • Glucose dehydrogenase from Ewingella americana (GDH) demonstrated an effective mediatorless oxidation of glucose on single-walled carbon nanotubes (SWCNT). • Laccase from Trichaptum abietinum (LAC) exhibited mediatorless oxygen reduction when the enzyme was adsorbed on SWCNT. • Simultaneous adsorption of GDH and LAC on SWCNT formed an electron transfer chain in which glucose and lactose were oxidized by oxygen in mediatorless manner. - Abstract: A mediatorless electron transfer in the chain of glucose dehydrogenase (GDH) and laccase (LAC) catalysing the oxidation of glucose by molecular oxygen was studied. To demonstrate mediatorless processes, the GDH from Ewingella americana was adsorbed on single-walled carbon nanotubes (SWCNT). The effective mediatorless oxidation of glucose proceeded at 0.2–0.4 V vs. SCE. The electrode was most active at pH 6.1, and generated 0.8 mA cm −2 biocatalytic current in the presence of 50 mM glucose. The electrode showed a bell-shaped pH dependence with pK a values of 4.1 and 7.5. LAC from Trichaptum abietinum adsorbed on SWCNT exhibited mediatorless oxygen reduction at electrode potential less than 0.65 V. The electrode was most active at pH 3.0–4.0 and generated 1.1 mA cm −2 biocatalytic current in the presence of 0.254 mM oxygen, with an apparent pK a of 1.0 and 5.4. The electrodes prepared by simultaneous adsorption of GDH and LAC on SWCNT exhibited glucose oxidation at a potential higher than 0.25 V. The oxygen consumption in the chain was demonstrated using a Clark-type oxygen electrode. The dependence of oxygen consumption on glucose and lactose concentrations as well as activity of the system on pH were measured. A model of the pH dependence as well as mediatorless consecutive glucose oxidation with oxygen catalysed by LAC/GDH system is presented. This work provides a novel approach towards the synthesis of artificial multi enzyme systems by wiring oxidoreductases with SWCNT, and offers a better

  15. Engineering laccases: in search for novel catalysts.

    Science.gov (United States)

    Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry

    2011-04-01

    Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.

  16. Fungal Laccases and Their Applications in Bioremediation

    Directory of Open Access Journals (Sweden)

    Buddolla Viswanath

    2014-01-01

    Full Text Available Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection.

  17. Decolorization of industrial synthetic dyes using engineered Pseudomonas putida cells with surface-immobilized bacterial laccase

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2012-06-01

    Full Text Available Abstract Background Microbial laccases are highly useful in textile effluent dye biodegradation. However, the bioavailability of cellularly expressed or purified laccases in continuous operations is usually limited by mass transfer impediment or enzyme regeneration difficulty. Therefore, this study develops a regenerable bacterial surface-displaying system for industrial synthetic dye decolorization, and evaluates its effects on independent and continuous operations. Results A bacterial laccase (WlacD was engineered onto the cell surface of the solvent-tolerant bacterium Pseudomonas putida to construct a whole-cell biocatalyst. Ice nucleation protein (InaQ anchor was employed, and the ability of 1 to 3 tandemly aligned N-terminal repeats to direct WlacD display were compared. Immobilized WlacD was determined to be surface-displayed in functional form using Western blot analysis, immunofluorescence microscopy, flow cytometry, and whole-cell enzymatic activity assay. Engineered P. putida cells were then applied to decolorize the anthraquinone dye Acid Green (AG 25 and diazo-dye Acid Red (AR 18. The results showed that decolorization of both dyes is Cu2+- and mediator-independent, with an optimum temperature of 35°C and pH of 3.0, and can be stably performed across a temperature range of 15°C to 45°C. A high activity toward AG25 (1 g/l with relative decolorization values of 91.2% (3 h and 97.1% (18 h, as well as high activity to AR18 (1 g/l by 80.5% (3 h and 89.0% (18 h, was recorded. The engineered system exhibited a comparably high activity compared with those of separate dyes in a continuous three-round shake-flask decolorization of AG25/AR18 mixed dye (each 1 g/l. No significant decline in decolorization efficacy was noted during first two-rounds but reaction equilibriums were elongated, and the residual laccase activity eventually decreased to low levels. However, the decolorizing capacity of the system was easily retrieved

  18. Purification, partial characterization, and reactivity with aromatic compounds of two laccases from Marasmius quercophilus strain 17.

    Science.gov (United States)

    Farnet, A M; Criquet, S; Tagger, S; Gil, G; Le Petit, J

    2000-03-01

    Two isozymes of laccase were obtained from an induced liquid culture of Marasmius quercophilus with p-hydroxybenzoic acid as the inducer. Both the constitutive and the induced isozyme have a molecular mass of 60 kDa as determined by polyacrylamide gel electrophoresis. Using isoelectric focusing, we found three isozymes with the constitutive enzyme (pI 4, 4.2, 4.4) and four of the induced form (pI 4.75, 4.85, 4.95, 5.1). We observed certain differences between these two isozymes; the specific activity of the induced isozyme was twice as high, and two optimum pH levels (5 and 6) were observed with the induced isozyme (only one, pH 5, for the constitutive isozyme). However, both of these enzymes have the same thermal stability and the same temperature for their highest activity (80 degrees C). Furthermore, the reactivity of both these enzymes with aromatic compounds was similar. The use of mediators extended the oxidized substrate range of the laccases studied. Various products of degradation were observed, depending on the mediator used. When laccase was used alone, the decrease of the signal corresponding to the aromatic cycle, without any formations of other peaks at different wavelengths, suggested polymerisation of aromatic compounds.

  19. Resveratrol acts as a natural profungicide and induces self-intoxication by a specific laccase

    NARCIS (Netherlands)

    Schouten, A.; Wagemakers, L.; Stefanato, F.L.; Kaaij, van der R.M.; Kan, van J.A.L.

    2002-01-01

    The grapevine (Vitis) secondary metabolite resveratrol is considered a phytoalexin, which protects the plant from Botrytis cinerea infection. Laccase activity displayed by the fungus is assumed to detoxify resveratrol and to facilitate colonization of grape. We initiated a functional molecular

  20. Modification of Lignans by Trametes Hirsuta Laccase

    NARCIS (Netherlands)

    Mattinen, M.L.; Struijs, K.; Suortti, T.; Mattila, I.; Kruus, K.; Willfor, S.; Tamminen, T.; Vincken, J.P.

    2009-01-01

    Oxidative polymerization of two isolated lignans, secoisolariciresinol, and secoisolariciresinol diglucoside, as well as the lignan macromolecule, by a high redox potential Trametes hirsuta laccase was studied with different analytical methods. The reactivity of laccase with the different compounds

  1. Independent behavior of bacterial laccases to inducers and metal ...

    African Journals Online (AJOL)

    Valued Acer Customer

    2012-05-15

    May 15, 2012 ... The medium for production was a high nitrogen medium containing ... effects of metal ions on either laccase production or laccase activity were not clear. ... this study was to isolate bacterial strains that produce ... The growth of cell culture was measured by using optical ... Conditions of laccase production.

  2. Can laccases catalyze bond cleavage in lignin?

    DEFF Research Database (Denmark)

    Munk, Line; Sitarz, Anna Katarzyna; Kalyani, Dayanand

    2015-01-01

    illustrations of the putative laccase catalyzed reactions, including the possible reactions of the reactive radical intermediates taking place after the initial oxidation of the phenol-hydroxyl groups, we show that i) Laccase activity is able to catalyze bond cleavage in low molecular weight phenolic lignin......-substituted phenols, benzenethiols, polyphenols, and polyamines, which may be oxidized. In addition, the currently available analytical methods that can be used to detect enzyme catalyzed changes in lignin are summarized, and an improved nomenclature for unequivocal interpretation of the action of laccases on lignin...

  3. Production of extracellular laccase from the newly isolated Bacillus ...

    African Journals Online (AJOL)

    This study was carried out with aim of screening for extracellular thermostable laccase producing bacteria. Twenty-two (22) laccase positive strains were isolated from the selected environmental samples while extracellular laccase activity was detected only in six strains namely TM1, TMT1, PK4, PS1, TMS1 and ASP3.

  4. Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.

    Directory of Open Access Journals (Sweden)

    Luka Ausec

    Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.

  5. Fungal laccase: copper induction, semi-purification, immobilization ...

    African Journals Online (AJOL)

    Fungal laccase: copper induction, semi-purification, immobilization, phenolic effluent treatment and electrochemical measurement. ... In order to apply in an effluent treatment, laccase was immobilized on different vitroceramics supports, pyrolytic graphite and also on a carbon fiber electrode as biosensor. The maximum ...

  6. Characterization Of Laccase T-DNA Mutants In Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Andersen, Jeppe Reitan; Asp, Torben; Mansfield, Shawn

    2009-01-01

    Laccases (P-diphenol:O2 oxidoreductase; EC 1.10.3.2), also termed laccase-like multicopper oxidases, are blue copper-containing oxidases which comprise multigene families in plants. In the Arabidopsis thaliana genome, 17 laccase genes (LAC1 to LAC17) have been annotated. To identify laccases...... for LAC15 T-DNA mutant seeds and an approximate 24 hour delay in germination was observed for these seeds. An approximate 20% reduction in glucose, galactose, and xylose was observed in primary stem cell walls of the LAC2 T-DNA mutants while similar relative increases in xylose were observed for LAC8...

  7. Laccase of Cyathus bulleri: structural, catalytic characterization and expression in Escherichia coli.

    Science.gov (United States)

    Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S

    2008-02-01

    Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.

  8. Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.

    Science.gov (United States)

    Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A

    2014-05-10

    Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Exploiting the oxidizing capabilities of laccases exploiting the oxidizing capabilities of laccases for sustainable chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Cannatelli, Mark D. [Georgia Inst. of Technology, Atlanta, GA (United States)

    2017-05-01

    Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.

  10. Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

    Directory of Open Access Journals (Sweden)

    Prabin Shrestha

    2016-01-01

    Full Text Available At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate. Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L and copper sulfate (30 μM in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, Km, Vmax, and Kcat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

  11. Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal.

    Science.gov (United States)

    Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah

    2016-01-01

    At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30  μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110  μ M, 36  μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.

  12. Cleavage and synthesis function of high and low redox potential laccases towards 4-morpholinoaniline and aminated as well as chlorinated phenols.

    Science.gov (United States)

    Hahn, Veronika; Mikolasch, Annett; Schauer, Frieder

    2014-02-01

    Laccases are able to mediate both cleavage and synthesis processes. The basis for this dual reaction capability lies in the property of the enzyme laccase to oxidize phenolic, and to some extent non-phenolic substances, to reactive radicals which can undergo on the one hand separations of small substitutents or large molecule parts from the parent compound and on the other hand coupling reactions with other radicals or molecules which are not themselves oxidizable by laccase. The cleavage of the non-phenolic compound 4-morpholinoaniline as well as the deamination of 4-aminophenol and the dechlorination of 4-chlorophenol resulted in the formation of 1,4-hydroquinone which is immediately oxidized by laccase to 1,4-benzoquinone. The formation of the 1,4-hydroquinone/1,4-benzoquinone is the rate limiting step for the synthesis of the heteromolecular dimers and trimers composed of 1,4-benzoquinone and one or two molecules of morpholine. In addition to the synthesis of new compounds from the cleavage products, 4-morpholinoaniline polymerized probably via azo groups and C-N bonds to a homomolecular dimer and trimer. Similarities and differences in cleavage and synthesis reactions catalyzed by the low redox potential laccase of Myceliophthora thermophila (0.46 V) and the high redox potential laccase of Pycnoporus cinnabarinus (0.79 V) were determined. In addition, the dependency of the cleavage and synthesis efficiencies on the (a) structure and redox potential of the laccase, (b) structure and redox potential of the substrate, (c) pH value of the buffer used, (d) incubation temperature, (e) solvent concentration, and (f) laccase activity is discussed in general.

  13. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    OpenAIRE

    Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj

    2012-01-01

    Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported lacc...

  14. Laccase from Aspergillus niger: A novel tool to graft multifunctional materials of interests and their characterization

    Directory of Open Access Journals (Sweden)

    Hafiz M.N. Iqbal

    2018-03-01

    Full Text Available In the present study, we propose a green route to prepare poly(3-hydroxybutyrate [(P(3HB] grafted ethyl cellulose (EC based green composites with novel characteristics through laccase-assisted grafting. P(3HB was used as a side chain whereas, EC as a backbone material under ambient processing conditions. A novel laccase obtained from Aspergillus niger through its heterologous expression in Saccharomyces cerevisiae was used as a green catalyst for grafting purposes without the use of additional initiator and/or cross-linking agents. Subsequently, the resulting P(3HB-g-EC composites were characterized using a range of analytical and imagining techniques. Fourier transform infrared spectroscopy (FT-IR spectra showed an increase in the hydrogen-bonding type interactions between the side chains of P(3HB and backbone material of EC. Evidently, X-ray diffraction (XRD analysis revealed a decrease in the crystallinity of the P(3HB-g-EC composites as compared to the pristine individual polymers. A homogeneous P(3HB distribution was also achieved in case of the graft composite prepared in the presence of 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS as a mediator along with laccase as compared to the composite prepared using pure laccase alone. A substantial improvement in the thermal and mechanical characteristics was observed for grafted composites up to the different extent as compared to the pristine counterparts. The hydrophobic/hydrophilic properties of the grafted composites were better than those of the pristine counterparts. Keywords: Biological polymers, Composite materials, Laccase, Aspergillus niger

  15. Degradation of Synthetic Dyes by Laccases – A Mini-Review

    Directory of Open Access Journals (Sweden)

    Legerská Barbora

    2016-06-01

    Full Text Available Laccases provide a promising future as a tool to be used in the field of biodegradation of synthetic dyes with different chemical structures. These enzymes are able to oxidize a wide range of phenolic substrates without the presence of additional co-factors. Laccases have been confirmed for their potential of synthetic dye degradation from wastewater and degradation products of these enzymatic reactions become less toxic than selected dyes. This study discusses the potential of laccase enzymes as agents for laccase-catalyzed degradation in terms of biodegradation efficiency of synthetic dyes, specifically: azo dyes, triphenylmethane, indigo and anthraquinone dyes. Review also summarizes the laccase-catalyzed degradation mechanisms of the selected synthetic dyes, as well as the degradation products and the toxicity of the dyes and their degradation products.

  16. Isolation and Physicochemical Characterization of Laccase from Ganoderma lucidum-CDBT1 Isolated from Its Native Habitat in Nepal

    Science.gov (United States)

    Joshi, Jarina; Malla, Rajani

    2016-01-01

    At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471

  17. Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach

    Science.gov (United States)

    Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo

    2013-01-01

    The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142

  18. Modeling of growth and laccase production by Pycnoporus sanguineus.

    Science.gov (United States)

    Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf

    2014-05-01

    Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1).

  19. Laccase Enzymes in Inocula Pleurotus spp

    Directory of Open Access Journals (Sweden)

    Nora García-Oduardo

    2017-01-01

    Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.

  20. Fluorescent nanocellulosic hydrogels based on graphene quantum dots for sensing laccase

    International Nuclear Information System (INIS)

    Ruiz-Palomero, Celia; Benítez-Martínez, Sandra; Soriano, M. Laura; Valcárcel, Miguel

    2017-01-01

    A novel low-cost fluorimetric platform based on sulfur, nitrogen-codoped graphene quantum dots immersed into nanocellulosic hydrogels is designed and applied in detecting the laccase enzyme. Although most of methods for detecting laccase are based on their catalytic activity, which is strongly dependent on environmental parameters, we report a sensitive and selective method based on the fluorescence response of hydrogels containing graphene quantum dots (GQDs) acting as luminophore towards laccase. The easily-prepared gel matrix not only improves the fluorescence signal of GQDs by avoiding their self-quenching but also stabilizes their fluorescence signal and improves their sensitivity towards laccase. Noncovalent interactions between the sensor and the analyte are believed to be causing this significant quenching without peak-shifts of GQD fluorescence via energy transfer. The selective extraction of laccase was proved in different shampoos as complex matrices achieving a detection limit of 0.048 U mL −1 and recoveries of 86.2–94.1%. As the unusual properties of nanocellulose and GQDs, the fluorescent sensor is simple, eco-friendly and cost-efficient. This straightforward strategy is able to detect and stabilize laccase, being an added-value for storage and recycling enzymes. - Highlights: • Fluorescent hydrogels were constructed by combining nanocellulose and graphene quantum dots. • The resulting hydrogels exhibited fluorescence quenching in presence of laccase. • Equilibrium in the optical signal of S,N-graphene quantum dots in presence of laccase was achieved faster within hydrogels. • The proposed method to determine laccase using fluorescent hydrogels was successfully applied in shampoo.

  1. Reduced toxicity of malachite green decolorized by laccase produced from Ganoderma sp. rckk-02 under solid-state fermentation.

    Science.gov (United States)

    Sharma, Abha; Shrivastava, Bhuvnesh; Kuhad, Ramesh Chander

    2015-10-01

    Statistical designs were applied for optimizing laccase production from a white-rot fungus, Ganoderma sp. rckk-02 under solid-state fermentation (SSF). Compared to unoptimized conditions [2,154 U/gds (Unit per gram of dry substrate)], the optimization process resulted in a 17.3-fold increase in laccase production (37,423 U/gds). The laccase produced was evaluated for its potential to decolorize a recalcitrant synthetic dye, malachite green. Laccase at dosage of 30 U/ml in presence of 1 mM of 1-hydroxybenzotriazole (HBT) almost completely decolorized 100 and 200 mg/l of malachite green in 16 and 20 h, respectively, at 30 °C, pH 5.5 and 150 rpm. While, higher dyes concentrations of 300, 400 and 500 mg/l were decolorized to 72, 62 and 55 % in 24, 28 and 32 h, respectively, under similar conditions. Furthermore, it was observed that the decolorized malachite green was less toxic towards the growth of five white-rot fungi tested viz. Crinipellis sp. RCK-1, Ganoderma sp. rckk-02, Coriolopsis Caperata RCK 2011, Phanerochaete chrysosporium K3 and Pycnoporous cinnabarinus PB. The present study demonstrates the potential of Ganoderma sp. rckk-02 to produce high titres of laccase under SSF, which can be exploited in conjunction with redox mediator for the decolorization of high concentrations of malachite green from water bodies.

  2. Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.

    Science.gov (United States)

    Wang, J W; Wu, J H; Huang, W Y; Tan, R X

    2006-03-01

    The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.

  3. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

    Directory of Open Access Journals (Sweden)

    Bao Zhen Feng

    2014-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid (ABTS as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 ºC, respectively . The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes.

  4. A New Laccase Biosensor For Polyphenols Determination

    Directory of Open Access Journals (Sweden)

    M. J.F. Rebelo

    2003-06-01

    Full Text Available The relevance of polyphenols in human health is a well known fact. Prompted by that, a very intensive research has been directed to get a method to detect them, wich will improve the current ones. Laccase (p-diphenol:dioxygen oxidoreductase EC 1.10.3.2 is a multi-copper oxidase, wich couples catalytic oxidation of phenolic substrates with four electron reduction of dioxygen to water [1]. A maximum catalytic response in oxigenated electrolyte was observed between 4.5 and 5.5 [2], while for pH > 6.9 the laccase was found to be inactive [3]. We prepared a biosensor with laccase immobilised on a polyether sulphone membrane, at pH 4.5, wich was applied at Universal Sensors base electrode. Reduction of the product of oxidation of several polyphenols, catalysed by laccase, was done at a potential for wich the polyphenol of interest was found to respond. Reduction of catechol was found to occur at a potential of -200mV, wich is often referred to in the literature for polyphenolic biosensors. However other polyphenols did not respond at that potential. It was observed that (+- catechin produced a very large cathodic current when +100mV were applied to the laccase biosensor, both in aqueous acetate and 12% ethanol acetate buffer, whereas caffeic acid responded at -50mV. Other polyphenols tested were gallic acid, malvidin, quercetin, rutin, trans-resveratrol

  5. Laccase Gene Family in Cerrena sp. HYB07: Sequences, Heterologous Expression and Transcriptional Analysis

    Directory of Open Access Journals (Sweden)

    Jie Yang

    2016-08-01

    Full Text Available Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1–8 from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases.

  6. Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters

    Directory of Open Access Journals (Sweden)

    P. J. Strong

    2011-01-01

    Full Text Available Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium.

  7. Structural insights into 2,2'-azino-Bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS)-mediated degradation of reactive blue 21 by engineered Cyathus bulleri Laccase and characterization of degradation products.

    Science.gov (United States)

    Kenzom, T; Srivastava, P; Mishra, S

    2014-12-01

    Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  8. A chloride tolerant laccase from the plant pathogen ascomycete Botrytis aclada expressed at high levels in Pichia pastoris.

    Science.gov (United States)

    Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland

    2012-01-20

    Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Characterization and cloning of laccase gene from Hericium coralloides NBRC 7716 suitable for production of epitheaflagallin 3-O-gallate.

    Science.gov (United States)

    Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji

    2016-01-01

    Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Ethanol induction of laccase depends on nitrogen conditions of Pycnoporus sanguineus

    Directory of Open Access Journals (Sweden)

    Christian A. Hernández

    2015-07-01

    Conclusions: We suggest that laccase in P. sanguineus is regulated by a catabolic nitrogen repression mechanism; laccase activity is strongly inhibited by urea used as nitrogen source and it decreases when the amount of urea increases; contrarily, a synergic positive effect was observed between yeast extract and ethanol on laccase production.

  11. Characterization of C-terminally engineered laccases.

    Science.gov (United States)

    Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

    2014-08-01

    Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Structural Insights into 2,2′-Azino-Bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) (ABTS)-Mediated Degradation of Reactive Blue 21 by Engineered Cyathus bulleri Laccase and Characterization of Degradation Products

    OpenAIRE

    Kenzom, T.; Srivastava, P.; Mishra, S.

    2014-01-01

    Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2′-azino-bis(3-ethylbenzothiazoline-...

  13. A New Laccase Based Biosensor for Tartrazine

    Directory of Open Access Journals (Sweden)

    Siti Zulaikha Mazlan

    2017-12-01

    Full Text Available Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM (R2 = 0.979 and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.

  14. A New Laccase Based Biosensor for Tartrazine.

    Science.gov (United States)

    Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu

    2017-12-09

    Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM ( R ² = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.

  15. First evidence of a potential antibacterial activity involving a laccase-type enzyme of the phenoloxidase system in Pacific oyster Crassostrea gigas haemocytes.

    Science.gov (United States)

    Luna-Acosta, Andrea; Saulnier, Denis; Pommier, Mylène; Haffner, Philippe; De Decker, Sophie; Renault, Tristan; Thomas-Guyon, Hélène

    2011-12-01

    Phenoloxidases (POs) are a group of copper proteins including tyrosinase, catecholase and laccase. In several insects and crustaceans, antibacterial substances are produced through the PO cascade, participating in the direct killing of invading microorganisms. However, although POs are widely recognised as an integral part of the invertebrate immune defence system, experimental evidence is lacking that these properties are conserved in molluscs, and more particularly in the Pacific oyster Crassostrea gigas. In the present study, Vibrio splendidus LGP32 and Vibrio aestuarianus 02/041 growths were affected, after being treated with C. gigas haemocyte lysate supernatant (HLS), and either a common substrate of POs, l-3,4-dihydroxyphenylalanine (L-DOPA), to detect catecholase-type PO activity, or a specific substrate of laccase, p-phenylenediamine (PPD), to detect laccase-type PO activity. Interestingly, a higher bacterial growth inhibition was observed in the presence of PPD than in the presence of L-DOPA. These effects were suppressed when the specific PO inhibitor, phenylthiourea (PTU), was added to the medium. Results of the present study suggest, for the first time in a mollusc species, that antibacterial activities of HLS from C. gigas potentially involve POs, and more particularly laccase catalysed reactions. Copyright © 2011 Elsevier Ltd. All rights reserved.

  16. EFFECT OF POTENTIAL INDUCTORS ON LACCASE PRODUCTION BY WHITE-ROT FUNGUS CERIPORIOPSIS SUBVERMISPORA

    Directory of Open Access Journals (Sweden)

    Daniela Chmelová

    2014-02-01

    Full Text Available In this work, the influence of selected inorganic ions (Cu2+ and Mn2+ and aromatic amino acids (tryptophan and tyrosine on laccase production by white-rot fungus Ceriporiopsis subvermispora was investigated. This aim was realized by monitoring laccase production during cultivation of C. subvermispora. Secondary, we been evaluated glucose concentration in medium and biomass growth after cultivation. Extracellular laccase formation can stimulated by the addition of Cu2+ (3.0 mmol/L. The higher laccase activity reached maximum at 7th day (63 U/L, equivalent to 3.7-fold higher than the laccase production without copper (17.2 U/L. Higher concentration of copper ions had a negative effect on laccase production. The addition of copper ions inhibited the biomass growth. Mn2+ ions similarly stimulated laccase activity (3.0 and 7.0 mmol/L; 79.6 and 63.8 U/L, respectively and maximum activities were reached at 6th day. Manganese ions also stimulated fungal biomass of C. subvermispora. The addition of aromatic amino acids did not cause an increase laccase production. The highest laccase production was observed in cultivation media without aromatic amino acids (16.0 U/L at 8th day.

  17. Production and characterization of laccase from Cyathus bulleri and its use in decolourization of recalcitrant textile dyes.

    Science.gov (United States)

    Salony; Mishra, S; Bisaria, V S

    2006-08-01

    Many fungi (particularly the white rot) are well suited for treatment of a broad range of textile dye effluents due to the versatility of the lignin-degrading enzymes produced by them. We have investigated decolourization of a number of recalcitrant reactive azo and acid dyes using the culture filtrate and purified laccase from the fungus Cyathus bulleri. For this, the enzyme was purified from the culture filtrate to a high specific activity of 4,022 IU mg(-1) protein, produced under optimized carbon, nitrogen and C/N ratio with induction by 2,6-dimethylaniline. The protein was characterized as a monomer of 58+/-5.0 kDa with carbohydrate content of 16% and was found to contain all three Cu(II) centres. The three internal peptide sequences showed sequence identity (80-92%) with laccases of a number of white rot fungi. Substrate specificity indicated highest catalytic efficiency (k(cat)/K(M)) on guaiacol followed by 2,2'-azino-bis(3-ethylthiazoline-6-sulfonic acid) (ABTS). Decolourization of a number of reactive azo and acid dyes was seen with the culture filtrate of the fungus containing predominantly laccase. In spite of no observable effect of purified laccase on other dyes, the ability to decolourize these was achieved in the presence of the redox mediator ABTS, with 50% decolourization in 0.5-5.4 days.

  18. Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

    Energy Technology Data Exchange (ETDEWEB)

    C.A.Reddy, PI

    2005-06-30

    and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity

  19. Structural Insights into 2,2′-Azino-Bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) (ABTS)-Mediated Degradation of Reactive Blue 21 by Engineered Cyathus bulleri Laccase and Characterization of Degradation Products

    Science.gov (United States)

    Kenzom, T.; Srivastava, P.

    2014-01-01

    Advanced oxidation processes are currently used for the treatment of different reactive dyes which involve use of toxic catalysts. Peroxidases are reported to be effective on such dyes and require hydrogen peroxide and/or metal ions. Cyathus bulleri laccase, expressed in Pichia pastoris, catalyzes efficient degradation (78 to 85%) of reactive azo dyes (reactive black 5, reactive orange 16, and reactive red 198) in the presence of synthetic mediator ABTS [2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)]. This laccase was engineered to degrade effectively reactive blue 21 (RB21), a phthalocyanine dye reported to be decolorized only by peroxidases. The 816-bp segment (toward the C terminus) of the lcc gene was subjected to random mutagenesis and enzyme variants (Lcc35, Lcc61, and Lcc62) were selected based on increased ABTS oxidizing ability. Around 78 to 95% decolorization of RB21 was observed with the ABTS-supplemented Lcc variants in 30 min. Analysis of the degradation products by mass spectrometry indicated the formation of several low-molecular-weight compounds. Mapping the mutations on the modeled structure implicated residues both near and far from the T1 Cu site that affected the catalytic efficiency of the mutant enzymes on ABTS and, in turn, the rate of oxidation of RB21. Several inactive clones were also mapped. The importance of geometry as well as electronic changes on the reactivity of laccases was indicated. PMID:25261507

  20. Laccase from Aspergillus niger: A novel tool to graft multifunctional materials of interests and their characterization.

    Science.gov (United States)

    Iqbal, Hafiz M N; Kyazze, Godfrey; Tron, Thierry; Keshavarz, Tajalli

    2018-03-01

    In the present study, we propose a green route to prepare poly(3-hydroxybutyrate) [(P(3HB)] grafted ethyl cellulose (EC) based green composites with novel characteristics through laccase-assisted grafting. P(3HB) was used as a side chain whereas, EC as a backbone material under ambient processing conditions. A novel laccase obtained from Aspergillus niger through its heterologous expression in Saccharomyces cerevisiae was used as a green catalyst for grafting purposes without the use of additional initiator and/or cross-linking agents. Subsequently, the resulting P(3HB)- g -EC composites were characterized using a range of analytical and imagining techniques. Fourier transform infrared spectroscopy (FT-IR) spectra showed an increase in the hydrogen-bonding type interactions between the side chains of P(3HB) and backbone material of EC. Evidently, X-ray diffraction (XRD) analysis revealed a decrease in the crystallinity of the P(3HB)- g -EC composites as compared to the pristine individual polymers. A homogeneous P(3HB) distribution was also achieved in case of the graft composite prepared in the presence of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) as a mediator along with laccase as compared to the composite prepared using pure laccase alone. A substantial improvement in the thermal and mechanical characteristics was observed for grafted composites up to the different extent as compared to the pristine counterparts. The hydrophobic/hydrophilic properties of the grafted composites were better than those of the pristine counterparts.

  1. Bioinspired production of magnetic laccase-biotitania particles for the removal of endocrine disrupting chemicals.

    Science.gov (United States)

    Ardao, Inés; Magnin, Delphine; Agathos, Spiros N

    2015-10-01

    Microbial laccases are powerful enzymes capable of degrading lignin and other recalcitrant compounds including endocrine disrupting chemicals (EDCs). Efficient EDC removal on an industrial scale requires robust, stable, easy to handle and cost-effective immobilized biocatalysts. In this direction, magnetic biocatalysts are attractive due to their easy separation through an external magnetic field. Recently, a bioinspired immobilization technique that mimics the natural biomineralization reactions in diatoms has emerged as a fast and versatile tool for generating robust, cheap, and highly stable (nano) biocatalysts. In this work, bioinspired formation of a biotitania matrix is triggered on the surface of magnetic particles in the presence of laccase in order to produce laccase-biotitania (lac-bioTiO2 ) biocatalysts suitable for environmental applications using a novel, fast and versatile enzyme entrapment technique. Highly active lac-bioTiO2 particles have been produced and the effect of different parameters (enzyme loading, titania precursor concentration, pH, duration of the biotitania formation, and laccase adsorption steps) on the apparent activity yield of these biocatalysts were evaluated, the concentration of the titania precursor being the most influential. The lac-bioTiO2 particles were able to catalyze the removal of bisphenol A, 17α-ethinylestradiol and diclofenac in a mixture of six model EDCs and retained 90% of activity after five reaction cycles and 60% after 10 cycles. © 2015 Wiley Periodicals, Inc.

  2. Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.

    Directory of Open Access Journals (Sweden)

    Sunil S. More

    2011-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax⁡ values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.

  3. Laccase: microbial sources, production, purification, and potential biotechnological applications.

    Science.gov (United States)

    Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay

    2011-01-01

    Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

  4. Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications

    Directory of Open Access Journals (Sweden)

    Shraddha

    2011-01-01

    Full Text Available Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.

  5. Ethidium bromide stimulated hyper laccase production from bird's nest fungus Cyathus bulleri.

    Science.gov (United States)

    Dhawan, S; Lal, R; Kuhad, R C

    2003-01-01

    Effect of ethidium bromide, a DNA intercalating agent, on laccase production from Cyathus bulleri was studied. The bird's nest fungus, Cyathus bulleri was grown on 2% (w/v) malt extract agar (MEA) supplemented with 1.5 microg ml(-1) of the phenanthridine dye ethidium bromide (EtBr) for 7 d and when grown subsequently in malt extract broth (MEB), produced a 4.2-fold increase in laccase production as compared to the untreated fungus. The fungal cultures following a single EtBr treatment, when regrown on MEA devoid of EtBr, produced a sixfold increase in laccase in MEB. However, on subsequent culturing on MEA in the absence of EtBr, only a 2.5-fold increase in laccase production could be maintained. In another attempt, the initial EtBr-treated cultures, when subjected to a second EtBr treatment (1.5 microg ml(-1)) on MEA for 7 d, produced a 1.4-fold increase in laccase production in MEB. The white-rot fungus Cyathus bulleri, when treated with EtBr at a concentration of 1.5 microg ml(-1) and regrown on MEA devoid of EtBr, produced a sixfold increase in laccase production in MEB. The variable form of C. bulleri capable of hyper laccase production can improve the economic feasibility of environmentally benign processes involving use of fungal laccases in cosmetics (including hair dyes), food and beverages, clinical diagnostics, pulp and paper industry, industrial effluent treatment, animal biotechnology and biotransformations.

  6. Structure, functionality and tuning up of laccases for lignocellulose and other industrial applications

    DEFF Research Database (Denmark)

    Sitarz, Anna K.; Mikkelsen, Jørn D.; Meyer, Anne S.

    2016-01-01

    Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of diox...... but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing....

  7. Adsorption of Trametes versicolor laccase to soil iron and aluminum minerals: enzyme activity, kinetics and stability studies.

    Science.gov (United States)

    Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin

    2014-02-01

    Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  8. Purification and characterization of three laccase isozymes from the ...

    African Journals Online (AJOL)

    2012-04-17

    Apr 17, 2012 ... improve wine quality by removing fermentation inhibitors so as to increase yield of ethanol (Baldrian, 2006). They have also been used .... Summary of purification of laccase isozymes from Trametes sp. HS-03a. Purification .... and kinetics of a thermostable laccase from Pycnoporus sanguineus. (SCC 108).

  9. A step forward in laccase exploitation: Recombinant production and evaluation of techno-economic feasibility of the process.

    Science.gov (United States)

    Pezzella, Cinzia; Giacobelli, Valerio Guido; Lettera, Vincenzo; Olivieri, Giuseppe; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

    2017-10-10

    Protein heterologous production offers viable opportunities to tailor laccase properties to specific industrial needs. The high redox potential laccase POXA1b from Pleurotus ostreatus was chosen as case study of marketable enzyme, due to its desirable properties in terms of activity/stability profile, and already assessed applicability. POXA1b was heterologously produced in Pichia pastoris by investigating the effect of inducible and constitutive expression systems on both the yield and the cost of its production. System performances were first assessed in shaken-flasks and then scaled-up in bioreactor. The production level obtained in the inducible system is 42U/mL, while the activity value achieved with the constitutive one is 60U/mL, the highest obtained in constitutive systems so far. The economic feasibility of recombinant laccase production was simulated, describing the case of an Italian small-medium enterprise. Two scenarios were evaluated: Scenario (I) production based on methanol inducible system; Scenario (II) production based on the constitutive system, fed with glycerol. At all the scales the glycerol-based fermentation is more economic than the methanol-based one. The price forecast for rPOXA1b production is 0.34€kU -1 for glycerol-based process, and is very competitive with the current price of commercial laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Laccase-Based CLEAs: Chitosan as a Novel Cross-Linking Agent

    Directory of Open Access Journals (Sweden)

    Alexandre Arsenault

    2011-01-01

    Full Text Available Laccase from Coriolopsis Polyzona was insolubilized as cross-linked enzyme aggregates (CLEAs for the first time with chitosan as the cross-linking agent. Concentrations between 0.01 and 1.867 g/L of chitosan were used and between 0.05 and 600 mM of 1-ethyl-3-(3-dimethylaminopropylcarbodiimide hydrochloride. The laccase was precipitated using ammonium sulphate and cross-linked simultaneously. Specific activity and thermal stability of these biocatalysts were measured. Activities of up to 737 U/g were obtained when 2,2-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid (ABTS was used as a substrate. Moreover, the stability of these biocatalysts was improved with regards to thermal degradation compared to free laccase when exposed to denaturing conditions of high temperature and low pH. The CLEAs stability against chemical denaturants was also tested but no significant improvement was detected. The total amount of ABTS to be oxidized during thermal degradation by CLEAs and free laccase was calculated and the insolubilized enzymes were reported to oxidize more substrate than free laccase. The formation conditions were analyzed by response surface methodology in order to determine an optimal environment for the production of efficient laccase-based CLEAs using chitosan as the cross-linking agent. After 24 hours of formation at pH 3 and at 4°C without agitation, the CLEAs exhibit the best specific activity.

  11. Application of Bacterial Laccases for Sustainable Energy Production

    DEFF Research Database (Denmark)

    Lörcher, Samuel; Koschorreck, Katja; Shipovskov, Stepan

    for a number of special applications, such as disposable implantable power suppliers for medical sensor-transmitters and drug delivery/activator systems and self-powered enzyme-based biosensors; and they do offer practical advantages of using abundant organic raw materials for clean and sustainable energy...... in vivo glucose monitoring in diabetes patients). However, the most attractive are oxygen-reducing enzymes such as blue-copper-containing laccases coupled to electrodes, which provide the 4e- bioelectroreduction of O2 to H2O (1.23 V vs. NHE) at potentials approaching the thermodynamic ones. Exploitation...... of laccase-based biocathodes in the biofuel cells and in the hybrid biobattery-type or photovoltaic power sources could essentially broaden their application, enabling extraction of energy from the sea water/water dissolved oxygen. Here we demonstrate up to 0.8 mW cm-2 extracted power densities and 1.5 month...

  12. Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase

    Science.gov (United States)

    Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder

    2001-01-01

    We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052

  13. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    NARCIS (Netherlands)

    Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.

    2012-01-01

    BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The

  14. β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.

    Science.gov (United States)

    Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang

    2017-01-01

    Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.

  15. Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)

    1995-12-01

    It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.

  16. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    International Nuclear Information System (INIS)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-01-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)

  17. Cross-linking proteins by laccase: Effects on the droplet size and rheology of emulsions stabilized by sodium caseinate.

    Science.gov (United States)

    Sato, A C K; Perrechil, F A; Costa, A A S; Santana, R C; Cunha, R L

    2015-09-01

    The aim of this work was to evaluate the influence of laccase and ferulic acid on the characteristics of oil-in-water emulsions stabilized by sodium caseinate at different pH (3, 5 and 7). Emulsions were prepared by high pressure homogenization of soybean oil with sodium caseinate solution containing varied concentrations of laccase (0, 1 and 5mg/mL) and ferulic acid (5 and 10mM). Laccase treatment and pH exerted a strong influence on the properties with a consequent effect on stability, structure and rheology of emulsions stabilized by Na-caseinate. At pH7, O/W emulsions were kinetically stable due to the negative protein charge which enabled electrostatic repulsion between oil droplets resulting in an emulsion with small droplet size, low viscosity, pseudoplasticity and viscoelastic properties. The laccase treatment led to emulsions showing shear-thinning behavior as a result of a more structured system. O/W emulsions at pH5 and 3 showed phase separation due to the proximity to protein pI, but the laccase treatment improved their stability of emulsions especially at pH3. At pH3, the addition of ferulic acid and laccase produced emulsions with larger droplet size but with narrower droplet size distribution, increased viscosity, pseudoplasticity and viscoelastic properties (gel-like behavior). Comparing laccase treatments, the combined addition of laccase and ferulic acid generally produced emulsions with lower stability (pH5), larger droplet size (pH3, 5 and 7) and higher pseudoplasticity (pH5 and 7) than emulsion with only ferulic acid. The results suggested that the cross-linking of proteins by laccase and ferulic acid improved protein emulsifying properties by changing functional mechanisms of the protein on emulsion structure and rheology, showing that sodium caseinate can be successfully used in acid products when treated with laccase. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Upgrading Laccase Production and Biochemical Properties: Strategies and Challenges.

    Science.gov (United States)

    Bertrand, Brandt; Martínez-Morales, Fernando; Trejo-Hernández, María R

    2017-07-01

    Improving laccases continues to be crucial in novel biotechnological developments and industrial applications, where they are concerned. This review breaks down and explores the potential of the strategies (conventional and modern) that can be used for laccase enhancement (increased production and upgraded biochemical properties such as stability and catalytic efficiency). The challenges faced with these approaches are briefly discussed. We also shed light on how these strategies merge and give rise to new options and advances in this field of work. Additionally, this article seeks to serve as a guide for students and academic researchers interested in laccases. This document not only gives basic information on laccases, but also provides updated information on the state of the art of various technologies that are used in this line of investigation. It also gives the readers an idea of the areas extensively studied and the areas where there is still much left to be done. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1015-1034, 2017. © 2017 American Institute of Chemical Engineers.

  19. Media optimization for laccase production by Trichoderma harzianum ZF-2 using response surface methodology.

    Science.gov (United States)

    Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin

    2013-12-01

    Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2.

  20. Improved immobilization of laccase on a glassy carbon electrode by oriented covalent attachment

    Directory of Open Access Journals (Sweden)

    Liu Xin

    2014-01-01

    Full Text Available A laccase from Thermus thermophilus HB27 was reported to be potentially useful in the design of a temperature controlled biofuel cell. For enhancing its application in different thermal conditions, we engineered a laccase-oriented immobilized electrode. A site-directed mutant N323C of the laccase was constructed. A photometric assay was employed in order to compare the catalytic properties of wild-type laccase and mutant. The mutant was attached to a glass carbon electrode by covalent cross-linking. The electrochemical properties of the immobilized laccase were investigated by cyclic voltammetry. This immobilization allowed the active electrode to function at temperatures up to 95°C. The thermal and pH dependence profiles were similar to those of the soluble enzyme investigated by spectrophotometry.

  1. Laccase Enzymology in Relation to Lignocellulose Processing

    DEFF Research Database (Denmark)

    Sitarz, Anna Katarzyna

    ) and investigated for production of enzymes under such conditions (Paper I). G. lucidum was found to produce high amounts of laccase which corresponded to its exceptional growth on lignocellulosic substrate and lignin. This observation led to a hypothesis that this particular laccase might act in a synergistic way...... cocktail preparation. This discovery is significant considering the fact that the cellulase cocktail preparations, namely Cellic®CTec1 and Cellic®CTec2, are improved in respect to phenolic-derived, and end-substrate inhibitors. Additionally, the molecular dynamics simulations (MD) of the obtained amino...

  2. Effect of antibiotics on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus.

    Science.gov (United States)

    Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander

    2005-08-01

    The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri.

  3. Biosensor based on laccase immobilized on plasma polymerized allylamine/carbon electrode

    Energy Technology Data Exchange (ETDEWEB)

    Ardhaoui, Malika, E-mail: malika.ardhaoui@ucd.ie [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France); Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Surface Engineering Research Group, School of Electrical, Electronic and Mechanical Engineering, University College Dublin, Belfield, Dublin 4 (Ireland); Bhatt, Sudhir [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France); Zheng, Meihui [Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Dowling, Denis [Surface Engineering Research Group, School of Electrical, Electronic and Mechanical Engineering, University College Dublin, Belfield, Dublin 4 (Ireland); Jolivalt, Claude [Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Khonsari, Farzaneh Arefi [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France)

    2013-08-01

    In this work, a simple and rapid method was used to functionalize carbon electrode in order to efficiently immobilize laccase for biosensor application. A stable allylamine coating was deposited using a low pressure inductively excited RF tubular plasma reactor under mild plasma conditions (low plasma power (10 W), few minutes) to generate high density amine groups (N/C ratio up to 0.18) on rough carbon surface electrodes. The longer was the allylamine plasma deposition time; the better was the surface coverage. Laccase from Trametes versicolor was physisorbed and covalently bound to these allylamine modified carbon surfaces. The laccase activities and current outputs measured in the presence of 2,2′-azinobis-(3-ethylbenzothiazole-6-sulfonic acid) (ABTS) showed that the best efficiency was obtained for electrode plasma coated during 30 min. They showed also that for all the tested electrodes, the activities and current outputs of the covalently immobilized laccases were twice higher than the physically adsorbed ones. The sensitivity of these biocompatible bioelectrodes was evaluated by measuring their catalytic efficiency for oxygen reduction in the presence of ABTS as non-phenolic redox substrate and 2,6-dimethoxyphenol (DMP) as phenolic one. Sensitivities of around 4.8 μA mg{sup −1} L and 2.7 μA mg{sup −1} L were attained for ABTS and DMP respectively. An excellent stability of this laccase biosensor was observed for over 6 months. - Highlights: • Low pressure plasma was used to generate stable allylamine coating. • Laccase from Trametes versicolor was physisorbed and covalently immobilized. • Best biosensor efficiency obtained for the covalently immobilized laccases • Sensitivities of 4.8 μA mg{sup −1} L and 2.7 μA mg{sup −1} L for ABTS and DMP respectively.

  4. A High Redox Potential Laccase from Pycnoporus sanguineus RP15: Potential Application for Dye Decolorization

    Directory of Open Access Journals (Sweden)

    Ana L. R. L. Zimbardi

    2016-05-01

    Full Text Available Laccase production by Pycnoporus sanguineus RP15 grown in wheat bran and corncob under solid-state fermentation was optimized by response surface methodology using a Central Composite Rotational Design. A laccase (Lacps1 was purified and characterized and the potential of the pure Lacps1 and the crude culture extract for synthetic dye decolorization was evaluated. At optimal conditions (eight days, 26 °C, 18% (w/w milled corncob, 0.8% (w/w NH4Cl and 50 mmol·L−1 CuSO4, initial moisture 4.1 mL·g−1, the laccase activity reached 138.6 ± 13.2 U·g−1. Lacps1 was a monomeric glycoprotein (67 kDa, 24% carbohydrate. Optimum pH and temperature for the oxidation of 2,2’-azino-bis(3-ethylbenzthiazoline-6-sulfonate (ABTS were 4.4 and 74.4 °C, respectively. Lacps1 was stable at pH 3.0–8.0, and after two hours at 55–60 °C, presenting high redox potential (0.747 V vs. NHE. ABTS was oxidized with an apparent affinity constant of 147.0 ± 6.4 μmol·L−1, maximum velocity of 413.4 ± 21.2 U·mg−1 and catalytic efficiency of 3140.1 ± 149.6 L·mmol−1·s−1. The maximum decolorization percentages of bromophenol blue (BPB, remazol brilliant blue R and reactive blue 4 (RB4, at 25 or 40 °C without redox mediators, reached 90%, 80% and 60%, respectively, using either pure Lacps1 or the crude extract. This is the first study of the decolorization of BPB and RB4 by a P. sanguineus laccase. The data suggested good potential for treatment of industrial dye-containing effluents.

  5. Adsorption and transformation of PAHs from water by a laccase-loading spider-type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Junfeng, E-mail: junfengn@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Dai, Yunrong, E-mail: daiyunrong@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Guo, Huiyuan, E-mail: hyguo0216@163.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Xu, Jiangjie, E-mail: 1993120hb@163.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Shen, Zhenyao, E-mail: zyshen@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)

    2013-03-15

    Highlights: ► Laccase-loading spider-type reactor (LSTR) is got by emulsion electrospinning. ► LSTR consists of beads-in-string fibers with more laccase and higher activity. ► LSTR can achieve the rapid and efficient removal of PAHs from water. ► Aquatic environmental factors have little influence on the PAH removal by LSTR. ► A synergetic mechanism includes adsorption, directional migration and degradation. -- Abstract: The remediation of polycyclic aromatic hydrocarbons (PAHs) polluted waters has become a concern as a result of the widespread use of PAHs and their adverse impacts on water ecosystems and human health. To remove PAHs rapidly and efficiently in situ, an active fibrous membrane, laccase-loading spider-type reactor (LSTR) was fabricated by electrospinning a poly(D,L-lactide-co-glycolide) (PDLGA)/laccase emulsion. The LSTR is composed of beads-in-string structural core–shell fibers, with active laccase encapsulated inside the beads and nanoscale pores on the surface of the beads. This structure can load more laccase and retains higher activity than do linear structural core–shell fibers. The LSTR achieves the efficient removal/degradation of PAHs in water, which is attributed to not only the protection of the laccase activity by the core–shell structure but also the pre-concentration (adsorption) of PAHs on the surface of the LSTR and the concentration of laccase in the beads. Moreover, the effects of pH, temperature and dissolved organic matter (DOM) concentration on the removal of PAHs by the LSTR, in comparison with that by free laccase, have been taken into account. A synergetic mechanism including adsorption, directional migration and degradation for PAH removal is proposed.

  6. Effect of pretreatment of hydrothermally processed rice straw with laccase-displaying yeast on ethanol fermentation

    Energy Technology Data Exchange (ETDEWEB)

    Nakanishi, Akihito; Bae, Jun Gu; Fukai, Kotaro; Tokumoto, Naoki; Kuroda, Kouichi; Ogawa, Jun; Shimizu, Sakayu; Ueda, Mitsuyoshi [Kyoto Univ. (Japan). Div. of Applied Life Sciences; Nakatani, Masato [Daiwa Kasei, Shiga (Japan)

    2012-05-15

    A gene encoding laccase I was identified and cloned from the white-rot fungus Trametes sp. Ha1. Laccase I contained 10 introns and an original secretion signal sequence. After laccase I without introns was prepared by overlapping polymerase chain reaction, it was inserted into expression vector pULD1 for yeast cell surface display. The oxidation activity of a laccase-I-displaying yeast as a whole-cell biocatalyst was examined with 2,2{sup '}-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and the constructed yeast showed a high oxidation activity. After the pretreatment of hydrothermally processed rice straw (HPRS) with laccase-I-displaying yeast with ABTS, fermentation was conducted with yeast codisplaying endoglucanase, cellobiohydrolase, and {beta}-glucosidase with HPRS. Fermentation of HPRS treated with laccase-I-displaying yeast was performed with 1.21-fold higher activities than those of HPRS treated with control yeast. The results indicated that pretreatment with laccase-I-displaying yeast with ABTS was effective for direct fermentation of cellulosic materials by yeast codisplaying endoglucanase, cellobiohydrolase, and {beta}-glucosidase. (orig.)

  7. Laccase Immobilization by Chelated Metal Ion Coordination Chemistry

    Directory of Open Access Journals (Sweden)

    Qingqing Wang

    2014-09-01

    Full Text Available In this work, amidoxime polyacrylonitrile (AOPAN nanofibrous membrane was prepared by a reaction between PAN nanofibers and hydroxylamine hydrochloride. The AOPAN nanofibrous membranes were used for four metal ions (Fe3+, Cu2+, Ni2+, Cd2+ chelation under different conditions. Further, the competition of different metal ions coordinating with AOPAN nanofibrous membrane was also studied. The AOPAN chelated with individual metal ion (Fe3+, Cu2+, Ni2+, Cd2+ and also the four mixed metal ions were further used for laccase (Lac immobilization. Compared with free laccase, the immobilized laccase showed better resistance to pH and temperature changes as well as improved storage stability. Among the four individual metal ion chelated membranes, the stability of the immobilized enzymes generally followed the order as Fe–AOPAN–Lac > Cu–AOPAN–Lac > Ni–AOPAN–Lac > Cd–AOPAN–Lac. In addition, the immobilized enzyme on the carrier of AOPAN chelated with four mixed metal ions showed the best properties.

  8. Laccase treatment of recycled blue dyed paper: Physical properties and fiber charge

    Digital Repository Service at National Institute of Oceanography (India)

    Mohandass, C.; Knutson, K.; Ragauskas, A.J.

    Recycled blue colored paper was treated with laccase under various combinations of physical and chemical parameters including enzyme concentration, temperature, oxygen, and reaction time. Laccase treatment of recycled dyed pulp increased acid group...

  9. Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination

    Science.gov (United States)

    Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.

    2012-01-01

    In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075

  10. Diffusion-controlled oxygen reduction on multi-copper oxidase-adsorbed carbon aerogel electrodes without mediator

    Energy Technology Data Exchange (ETDEWEB)

    Tsujimura, S.; Kamitaka, Y.; Kano, K. [Division of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto (Japan)

    2007-12-15

    Bioelectrocatalytic reduction of O{sub 2} into water was archived at diffusion-controlled rate by using enzymes (laccase from Trametes sp. and bilirubin oxidase from Myrothecium verrucaria, which belong to the family of multi-copper oxidase) adsorbed on mesoporous carbon aerogel particle without a mediator. The current density was predominantly controlled by the diffusion of dissolved O{sub 2} in rotating-disk electrode experiments, and reached a value as large as 10 mA cm{sup -2} at 1 atm O{sub 2}, 25 C, and 8,000 rpm on the laccase-adsorbed electrode. The overpotential of the bioelectrocatalytic reduction of O{sub 2} was 0.4-0.55 V smaller than that observed on a Pt disk electrode. Without any optimization, the laccase-adsorbed biocathode showed stable current intensity of the O{sub 2} reduction in an air-saturated buffer at least for 10 days under continuous flow system. (Abstract Copyright [2007], Wiley Periodicals, Inc.)

  11. Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.

    Science.gov (United States)

    Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong

    2018-04-01

    Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.

  12. Molecular modeling and simulation studies of recombinant laccase from Yersinia enterocolitica suggests significant role in the biotransformation of non-steroidal anti-inflammatory drugs

    International Nuclear Information System (INIS)

    Singh, Deepti; Rawat, Surender; Waseem, Mohd; Gupta, Sunita; Lynn, Andrew; Nitin, Mukesh; Ramchiary, Nirala; Sharma, Krishna Kant

    2016-01-01

    The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K m values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative property against BSA and Cu 2+ /H 2 O 2 model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.

  13. Molecular modeling and simulation studies of recombinant laccase from Yersinia enterocolitica suggests significant role in the biotransformation of non-steroidal anti-inflammatory drugs

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Deepti; Rawat, Surender [Laboratory of Enzymology and Recombinant DNA Technology, Department of Microbiology, Maharshi Dayanand University, Rohtak 124001, Haryana (India); Waseem, Mohd; Gupta, Sunita; Lynn, Andrew [School of Computational & Integrative Sciences, Jawaharlal Nehru University, New Delhi 110067 (India); Nitin, Mukesh; Ramchiary, Nirala [School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067 (India); Sharma, Krishna Kant, E-mail: kekulsharma@gmail.com [Laboratory of Enzymology and Recombinant DNA Technology, Department of Microbiology, Maharshi Dayanand University, Rohtak 124001, Haryana (India)

    2016-01-08

    The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K{sub m} values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative property against BSA and Cu{sup 2+}/H{sub 2}O{sub 2} model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.

  14. Heterologous expression of trametes versicolor laccase in pichia pastoris and aspergillus niger

    CSIR Research Space (South Africa)

    Bohlin, C

    2006-09-01

    Full Text Available primarily for screening purposes. With A. niger, high levels of laccase (2700 U/L) were produced using a min- imal medium containing sucrose and yeast extract. Recombinant laccase from A. niger harboring the lcc2 cDNA was purified to homogeneity...). Methods Microbial Strains and Recombinant DNA The lcc1 and lcc2 cDNA genes from T. (Coriolus, Polyporus) versicolor (9–11) were used in the construction of plasmids for expression of laccases in P. pastoris and A. niger. For the expression in P...

  15. Continuous adsorption and biotransformation of micropollutants by granular activated carbon-bound laccase in a packed-bed enzyme reactor.

    Science.gov (United States)

    Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D

    2016-06-01

    Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Enhanced removal of aqueous acetaminophen by a laccase-catalyzed oxidative coupling reaction under a dual-pH optimization strategy.

    Science.gov (United States)

    Wang, Kaidong; Huang, Ke; Jiang, Guoqiang

    2018-03-01

    Acetaminophen is one kind of pharmaceutical contaminant that has been detected in municipal water and is hard to digest. A laccase-catalyzed oxidative coupling reaction is a potential method of removing acetaminophen from water. In the present study, the kinetics of radical polymerization combined with precipitation was studied, and the dual-pH optimization strategy (the enzyme solution at pH7.4 being added to the substrate solution at pH4.2) was proposed to enhance the removal efficiency of acetaminophen. The reaction kinetics that consisted of the laccase-catalyzed oxidation, radical polymerization and precipitation were studied by UV in situ, LC-MS and DLS (dynamic light scattering) in situ. The results showed that the laccase-catalyzed oxidation is the rate-limiting step in the whole process. The higher rate of enzyme-catalyzed oxidation under a dual-pH optimization strategy led to much faster formation of the dimer, trimer and tetramer. Similarly, the formation of polymerized products that could precipitate naturally from water was faster. Under the dual-pH optimization strategy, the initial laccase activity was increased approximately 2.9-fold, and the activity remained higher for >250s, during which approximately 63.7% of the total acetaminophen was transformed into biologically inactive polymerized products, and part of these polymerized products precipitated from the water. Laccase belongs to the family of multi-copper oxidases, and the present study provides a universal method to improve the activity of multi-copper oxidases for the high-performance removal of phenol and its derivatives. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Ol’ga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Morgunova, Ekaterina Yu.; Betzel, Christian; Lindley, Peter F.; Mikhailov, Al’bert M.

    2006-01-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R free = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO 2 substituents

  18. Direct electrochemistry of dopamine on gold-Agaricus bisporus laccase enzyme electrode: characterization and quantitative detection.

    Science.gov (United States)

    Shervedani, Reza Karimi; Amini, Akbar

    2012-04-01

    Direct electrochemistry of a new laccase enzyme immobilized on gold and its application as a biosensor for dopamine (DA) are investigated by voltammetry and electrochemical impedance spectroscopy. The sensor demonstrated a redox adsorption behavior with E(0') = + 180 mV vs. Ag/AgCl for immobilized Agaricus bisporus laccase (LacAB) enzyme. The MPA platform was assembled on Au with and without utilization of ultrasounds. Excellent results were obtained by using the enzyme electrode fabricated based on MPA assembled with sonication. The LacAB immobilized in this condition showed a large electrocatalytic activity for oxidation of DA. Accordingly, a third-generation (mediator free) biosensor was constructed for DA. The DA concentration could be measured in the linear range of 0.5 to 13.0 and 47.0 to 430.0 μmol L(-1) with correlation coefficients of 0.999 and 0.989, respectively, and a detection limit of 29.0 nmol L(-1). The biosensor was successfully tested for determination of DA in human blood plasma and pharmaceutical samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. The effect of laccase on cellulase-treated lignin in 1-n-butyl-3 ...

    African Journals Online (AJOL)

    treated lignin (CEL) in two different solution systems was further investigated. Results obtained were as follows: After laccase treatment of CEL in the heterogeneous water solution, CEL was then compared with control sample A. Ultraviolet (UV) ...

  20. Purification and characterization of an extracellular, thermo-alkali-stable, metal tolerant laccase from Bacillus tequilensis SN4.

    Directory of Open Access Journals (Sweden)

    Sonica Sondhi

    Full Text Available A novel extracellular thermo-alkali-stable laccase from Bacillus tequilensis SN4 (SN4LAC was purified to homogeneity. The laccase was a monomeric protein of molecular weight 32 KDa. UV-visible spectrum and peptide mass fingerprinting results showed that SN4LAC is a multicopper oxidase. Laccase was active in broad range of phenolic and non-phenolic substrates. Catalytic efficiency (kcat/Km showed that 2, 6-dimethoxyphenol was most efficiently oxidized by the enzyme. The enzyme was inhibited by conventional inhibitors of laccase like sodium azide, cysteine, dithiothreitol and β-mercaptoethanol. SN4LAC was found to be highly thermostable, having temperature optimum at 85°C and could retain more than 80% activity at 70°C for 24 h. The optimum pH of activity for 2, 6-dimethoxyphenol, 2, 2'-azino bis[3-ethylbenzthiazoline-6-sulfonate], syringaldazine and guaiacol was 8.0, 5.5, 6.5 and 8.0 respectively. Enzyme was alkali-stable as it retained more than 75% activity at pH 9.0 for 24 h. Activity of the enzyme was significantly enhanced by Cu2+, Co2+, SDS and CTAB, while it was stable in the presence of halides, most of the other metal ions and surfactants. The extracellular nature and stability of SN4LAC in extreme conditions such as high temperature, pH, heavy metals, halides and detergents makes it a highly suitable candidate for biotechnological and industrial applications.

  1. Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397

    Directory of Open Access Journals (Sweden)

    Kusum Dhakar

    2013-01-01

    Full Text Available Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03 isolated from a glacial site in Indian Himalayan Region (IHR has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt. and pH 3–13 (5–7 opt.. Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold induction. The study has implications in bioprospecting of ecologically resilient microbial strains.

  2. Site-directed mutation of a laccase from Thermus thermophilus: Effect on the activity profile

    Directory of Open Access Journals (Sweden)

    Liu Xin

    2012-01-01

    Full Text Available A site-directed mutant R453T of a laccase from Thermus thermophilus HB27 (Tth-laccase was constructed in order to investigate the effect on laccase catalytic properties. The mutated gene was cloned and overexpressed in Escherichia coli. Nickel-affinity purification was achieved and followed by copper ion incorporation. The mature mutated enzyme was quantitatively equal to the wild type. A photometric assay based on the oxidation of the substrate 2,2-azino-bis-(3- ethylbenzthiazoline-6-sulfonate (ABTS was employed in comparison with the wild-type Tth-laccase on catalytic properties. The R453T mutant exhibited improvement in substrate affinity and specific activity at room temperature, whereas those parameters were not significantly influenced when the temperature increased up to 65°C or higher. The mutant had better catalytic activity than that of the wild type at acidic pH. Investigated by circular dichroism spectroscopy, the mutant Tth-laccase displayed similar profiles at low and high temperatures.

  3. Electroenzymatic Reactions With Oxygen on Laccase-Modified Electrodes in Anhydrous (Pure) Organic Solvent

    DEFF Research Database (Denmark)

    Yarapolov, A.; Shleev, S.; Zaitseva, E.

    2007-01-01

    in two different ways: (i) by studying the electroreduction of oxygen in anhydrous DMSO via a direct electron transfer mechanism without proton donors and (ii) by doing the same experiments in the presence of laccase substrates, which display in pure organic solvents both the properties of electron......The electroenzymatic reactions of Trametes hirsuta laccase in the pure organic solvent dimethyl sulfoxide (DMSO) have been investigated within the framework for potential use as a catalytic reaction scheme for oxygen reduction. The bioelectrochemical characteristics of laccase were investigated...... donors as well as the properties of weak acids. The results obtained with laccase in anhydrous DMSO were compared with those obtained previously in aqueous buffer. It was shown that in the absence of proton donors under oxygenated conditions, formation of superoxide anion radicals is prevented at bare...

  4. Substrate Specificity and Enzyme Recycling Using Chitosan Immobilized Laccase

    Directory of Open Access Journals (Sweden)

    Everton Skoronski

    2014-10-01

    Full Text Available The immobilization of laccase (Aspergillus sp. on chitosan by cross-linking and its application in bioconversion of phenolic compounds in batch reactors were studied. Investigation was performed using laccase immobilized via chemical cross-linking due to the higher enzymatic operational stability of this method as compared to immobilization via physical adsorption. To assess the influence of different substrate functional groups on the enzyme’s catalytic efficiency, substrate specificity was investigated using chitosan-immobilized laccase and eighteen different phenol derivatives. It was observed that 4-nitrophenol was not oxidized, while 2,5-xylenol, 2,6-xylenol, 2,3,5-trimethylphenol, syringaldazine, 2,6-dimetoxyphenol and ethylphenol showed reaction yields up 90% at 40 °C. The kinetic of process, enzyme recyclability and operational stability were studied. In batch reactors, it was not possible to reuse the enzyme when it was applied to syringaldazne bioconversion. However, when the enzyme was applied to bioconversion of 2,6-DMP, the activity was stable for eight reaction batches.

  5. Characterization of the alkaline laccase Ssl1 from Streptomyces sviceus with unusual properties discovered by genome mining.

    Directory of Open Access Journals (Sweden)

    Matthias Gunne

    Full Text Available Fungal laccases are well investigated enzymes with high potential in diverse applications like bleaching of waste waters and textiles, cellulose delignification, and organic synthesis. However, they are limited to acidic reaction conditions and require eukaryotic expression systems. This raises a demand for novel laccases without these constraints. We have taken advantage of the laccase engineering database LccED derived from genome mining to identify and clone the laccase Ssl1 from Streptomyces sviceus which can circumvent the limitations of fungal laccases. Ssl1 belongs to the family of small laccases that contains only few characterized enzymes. After removal of the twin-arginine signal peptide Ssl1 was readily expressed in E. coli. Ssl1 is a small laccase with 32.5 kDa, consists of only two cupredoxin-like domains, and forms trimers in solution. Ssl1 oxidizes 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS and phenolic substrates like 2,6-dimethoxy phenol, guaiacol, and syringaldazine. The k(cat value for ABTS oxidation was at least 20 times higher than for other substrates. The optimal pH for oxidation reactions is substrate dependent: for phenolic substrates the highest activities were detected at alkaline conditions (pH 9.0 for 2,6-dimethoxy phenol and guaiacol and pH 8.0 for syringaldazine, while the highest reaction rates with ABTS were observed at pH 4.0. Though originating from a mesophilic organism, Ssl demonstrates remarkable stability at elevated temperatures (T(1/2,60°C = 88 min and in a wide pH range (pH 5.0 to 11.0. Notably, the enzyme retained 80% residual activity after 5 days of incubation at pH 11. Detergents and organic co-solvents do not affect Ssl1 stability. The described robustness makes Ssl1 a potential candidate for industrial applications, preferably in processes that require alkaline reaction conditions.

  6. Laccase-catalyzed dimerization of glycosylated lignols

    Czech Academy of Sciences Publication Activity Database

    Bassanini, I.; Gavezzotti, P.; Monti, D.; Krejzová, Jana; Křen, Vladimír; Riva, S.

    2016-01-01

    Roč. 134, SI (2016), s. 295-301 ISSN 1381-1177 R&D Projects: GA MŠk(CZ) LD15085 Institutional support: RVO:61388971 Keywords : Biocatalysis * Biooxidation * Laccase Subject RIV: CE - Biochemistry Impact factor: 2.269, year: 2016

  7. Rice (Oryza sativa) Laccases Involved in Modification and Detoxification of Herbicides Atrazine and Isoproturon Residues in Plants.

    Science.gov (United States)

    Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong

    2016-08-24

    Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.

  8. Laccase immobilized on methylene blue modified mesoporous silica MCM-41/PVA

    International Nuclear Information System (INIS)

    Xu Xinhua; Lu Ping; Zhou Yumei; Zhao Zhenzhen; Guo Meiqing

    2009-01-01

    The mesoporous silica sieve MCM-41 containing methylene blue (MB) provides a suitable immobilization of biomolecule matrix due to its uniform pore structure, high surface areas, good biocompatibility and nice conductivity. Based on this, a facilely fabricated amperometric biosensor by entrapping laccase into the MB modified MCM-41/PVA composite film has been developed. Laccase from Trametes versicolor is assembled on a composite film of MCM-41 containing MB/PVA modified Au electrode and the electrode is characterized with respect to transmission electron microscopy (TEM) and scanning electron microscopic (SEM), Cyclic voltammetry (CV), response time, detection limit, linear range and activity of laccase. The laccase modified electrode remains good redox behavior in pH 4.95 acetate buffer solution, at room temperature in present of 0.1 mM catechol. The response time (t 90% ) of the modified electrode is less than 4 s for catechol. The detection limit is 0.331 μM and the linear detect range is about from 4.0 μM to 87.98 μM for catechol with a correlation coefficient of 0.99913(S/N = 3). The apparent Michaelis-Menten (K M app ) is estimated using the Lineweaver-Burk equation and the K M app value is about 0.256 mM. This work demonstrated that the mesoporous silica MCM-41 containing MB provides a novel support for laccase immobilization and the construction of biosensors with a faster response and better bioactivity.

  9. Separation of phenolic acids from monosaccharides by low-pressure nanofiltration integrated with laccase pre-treatments

    DEFF Research Database (Denmark)

    Luo, Jianquan; Zeuner, Birgitte; Morthensen, Sofie Thage

    2015-01-01

    (e.g. dimers and trimers) were mainly responsible for the adsorption fouling. Free laccase treatment was preferred since it was prone to produce large polymeric products while the biocatalytic membrane with immobilized laccase was not suitable as it generated smaller polymers by in-situ product...... monosaccharides (xylose, arabinose, glucose). Four commercial NF membranes (NF270, NP030, NTR7450 and NP010) were evaluated at different pH values and with various laccase pre-treatments (for polymerization of phenolic acids). The results showed that with increasing pH, the retentions of phenolic acids by NF...... could be polymerized by laccase and then completely retained by the NF membranes via size exclusion at pH 5.15. The formation of large polymeric products by laccase could alleviate the irreversible fouling in/on a NF membrane and decrease the monosaccharide retention, while the small polymeric products...

  10. Two-domain laccase from Streptomyces coelicolor: a link between laccases and nitrite reductases

    Czech Academy of Sciences Publication Activity Database

    Skálová, Tereza; Dohnálek, Jan; Ostergaard, L. H.; Ostergaard, P. R.; Kolenko, Petr; Dušková, Jarmila; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Roč. 16, 3a - Special Issue (2009), s. 3-4 ISSN 1211-5894. [Heart of European Crystallographic Meeting /12./. 24.09.2009-26.09.2009, Třešt´] R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * oxidoreductase * multicopper blue protein Subject RIV: CD - Macromolecular Chemistry

  11. Chemical reactivity of alkali lignin modified with laccase

    International Nuclear Information System (INIS)

    Sun, Yong; Qiu, Xueqing; Liu, Yunquan

    2013-01-01

    The modification of alkali lignin with laccase was investigated. The structural change of lignin was analyzed. The sulfonation reactivity was measured by the content of sulfonic group. The results showed the sulfonation reactivity increased to some extent under the condition of atmosphere pressure, but decreased under the condition of 0.3 MPa oxygen pressure. The analysis of Fourier transform infrared spectroscopy (FTIR), nuclear magnetic resonance (NMR) and gel permeation chromatography (GPC) showed the cleavage of various ether linkages and demethylation took place in the structure of lignin to certain extent during modification with laccase, which contributed to the improvement of sulfonation reactivity. Under the condition of 0.3 MPa oxygen pressure, the ratio of s/g (guaiacyl/syringyl) increased after modification, which reduced the sulfonation reactivity of lignin. Simultaneously partial polymerization reaction, such as 4-O-5′, β-5, 5-5 and other reaction in the aromatic ring decreased the activity sites of C 2 , C 5 and C 6 . Abundant polymerization reaction of α-O increased steric hindrance of C 2 and C 6 in aromatic ring, resulting in low sulfonation reactivity of lignin. -- Highlights: ► The modification of alkali lignin with laccase was investigated. ► The sulfonation reactivity increased under the condition of atmosphere pressure. ► More content of guaiacyl and hydroxy, the less content of methoxyl, syringyl can enhance the sulfonation reactivity of lignin. ► Partial moieties polymerized each other with α-O linkgages during treatment with laccase under oxygen pressure. ► The steric hindrance on C 2 and C 6 in aromatic ring resulted in low sulfonation reaction reactivity of lignin

  12. Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.

    Science.gov (United States)

    Dhawan, Shikha; Kuhad, Ramesh Chander

    2002-08-01

    Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production.

  13. Xenobiotic Compounds Degradation by Heterologous Expression of a Trametes sanguineus Laccase in Trichoderma atroviride.

    Directory of Open Access Journals (Sweden)

    Edgar Balcázar-López

    Full Text Available Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc. To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation.

  14. Polymerization of different lignins by laccase

    NARCIS (Netherlands)

    Mattinen, M.L.; Suortti, T.; Gosselink, R.J.A.; Argyropoulos, D.S.; Evtuguin, D.; Suurnäkki, A.; Jong, de E.; Tamminen, T.

    2008-01-01

    In this study the oxidative polymerization of different lignins, i.e. Flax Soda lignin, Spruce EMAL, and Eucalyptus Dioxane lignin by Trametes hirsuta laccase was compared. Initially the structures of the different lignins were compared by Fourier transform infrared spectroscopy. The reactivity of

  15. Studies on Possible Activation of Microbial Laccase Production Using Gamma Irradiation

    International Nuclear Information System (INIS)

    ElKenawy, N.M.A.

    2013-01-01

    Enzyme production is an essential discipline in biotechnology. Laccase enzyme is an oxidoreductase that catalyzes the oxidation of various aromatic compounds, with the simultaneous reduction of oxygen into water. Although the enzyme is present in plants, insects and bacteria, the most important source is fungi and particularly the Basidiomycetes. In fungi, the enzyme plays a role in the removal of potentially toxic phenols arising during fungal morphogenesis, sporulation, phytopathogensis and virulence. In this work, the production of fungal laccase was optimized from a local isolate of Pleurotus ostreatus using solid state fermentation. Factorial design was used to study the effect of several nutrients and inducer on enzyme activity. Purification, characterization of the enzyme, the effect of temperature and ph were studied. The effect of gamma radiation on fungal growth and enzyme production was investigated. The optimization of the production conditions yielded an enzyme with activity over 32,054 IU/gram of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds and consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80 % reduction in color in case of methyl orange and trypan blue. The decolorisation of dyes is a simple method to assess the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications, which opens a door towards using of fungal laccase in further biotechnological processes.

  16. Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

    International Nuclear Information System (INIS)

    Osipov, E. M.; Polyakov, K. M.; Tikhonova, T. V.; Kittl, R.; Dorovatovskii, P.V.; Shleev, S. V.; Popov, V. O.; Ludwig, R.

    2015-01-01

    The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu + -containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu + - and Cu 2+ -containing solutions. Copper ions were found to be incorporated into the active site only when Cu + was used. A comparative analysis of the native and depleted forms of the enzymes was performed

  17. Oxidative polymerization of lignins by laccase in water-acetone mixture.

    Science.gov (United States)

    Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela

    2013-01-01

    The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.

  18. Advanced Synthesis of Conductive Polyaniline Using Laccase as Biocatalyst.

    Science.gov (United States)

    de Salas, Felipe; Pardo, Isabel; Salavagione, Horacio J; Aza, Pablo; Amougi, Eleni; Vind, Jesper; Martínez, Angel T; Camarero, Susana

    2016-01-01

    Polyaniline is a conductive polymer with distinctive optical and electrical properties. Its enzymatic synthesis is an environmentally friendly alternative to the use of harsh oxidants and extremely acidic conditions. 7D5L, a high-redox potential laccase developed in our lab, is the biocatalyst of choice for the synthesis of green polyaniline (emeraldine salt) due to its superior ability to oxidize aniline and kinetic stability at the required polymerization conditions (pH 3 and presence of anionic surfactants) as compared with other fungal laccases. Doses as low as 7.6 nM of 7D5L catalyze the polymerization of 15 mM aniline (in 24 h, room temperature, 7% yield) in the presence of different anionic surfactants used as doping templates to provide linear and water-soluble polymers. Aniline polymerization was monitored by the increase of the polaron absorption band at 800 nm (typical for emeraldine salt). Best polymerization results were obtained with 5 mM sodium dodecylbenzenesulfonate (SDBS) as template. At fixed conditions (15 mM aniline and 5mM SDBS), polymerization rates obtained with 7D5L were 2.5-fold the rates obtained with commercial Trametes villosa laccase. Moreover, polyaniline yield was notably boosted to 75% by rising 7D5L amount to 0.15 μM, obtaining 1g of green polyaniline in 1L-reaction volume. The green polymer obtained with the selected system (7D5L/SDBS) holds excellent electrochemical and electro-conductive properties displayed in water-dispersible nanofibers, which is advantageous for the nanomaterial to be readily cast into uniform films for different applications.

  19. Biopulping of sugarcane bagasse and decolorization of kraft liquor by the laccase produced by Klebsiella aerogenes NCIM 2098

    Directory of Open Access Journals (Sweden)

    Jha H.

    2013-12-01

    Full Text Available Aims: Laccase, a copper-containing enzyme, oxidizes variety of aromatic compounds. Since laccase is essential for lignin degradation, it can be used for lignin removal in the pulp and paper industry (biopulping. Laccase is also employed as a dechlorinating agent (biobleaching, along with the removal of phenolic and other aromatic pollutants. In the present investigation it was aimed to employ the laccase produced by the bacterium Klebsiella aerogenes along with the bacterium itself in biopulping of sugarcane bagasse and biobleaching of kraft liquor effluent. Methodology and results: A laccase was isolated from the bacterium K. aerogenes, purified to homogeneity and characterized. The enzyme was purified by conventional techniques following salt precipitation, ion exchange chromatography, and affinity chromatography on Con A sepharose. The purified laccase was found to be monomeric glycoprotein with a Mr of 64 kDa when measured by Sephadex G-200 gel chromatography and SDS-PAGE. The Vmax and Km of laccase towards the substrate guaiacol was determined. The optimum pH of the laccase was found to be 5.0. biopulping and biobleaching activities were determined by TAPPI standard methods. Treatment of sugarcane baggase by K. aerogenes also significantly reduced lignin content of the bagasse. Conclusion, significance and impact of study: The bacterium K. aerogenes and a laccase produced by it were used separately for biopulping of sugarcane bagasse and biobleaching of kraft liquor effluent. Treatment with both brought significant reduction in lignin content and kappa number of the pulp. The handsheets prepared from the treated pulp showed improved brightness without affecting the strength properties of paper. The bacterium and the laccase efficiently decolorized the kraft liquor proving to have biobleaching potential.

  20. Bio-coloration of bacterial cellulose assisted by immobilized laccase.

    Science.gov (United States)

    Song, Ji Eun; Su, Jing; Noro, Jennifer; Cavaco-Paulo, Artur; Silva, Carla; Kim, Hye Rim

    2018-02-13

    In this work a process for the bio-coloration of bacterial cellulose (BC) membranes was developed. Laccase from Myceliophthora thermophila was immobilized onto BC membranes and retained up to 88% of residual activity after immobilization. Four compounds belonging to the flavonoids family were chosen to test the in situ polymerase activity of immobilized laccase. All the flavonoids were successfully polymerized by laccase giving rise to yellow, orange and dark brown oligomers which conferred color to the BC support. The optimal bio-coloration conditions were studied for two of the tested flavonoids, catechol and catechin, by varying the concentration and time of incubation. High color depth and resistance to washing were obtained for both compounds. The highly porous bacterial cellulose material demonstrated great performance as a bio-coloration support, in contrast to other materials cited in literature, like cotton or wool. The process developed is presented as an environmentally friendly alternative for bacterial cellulose bio-coloration and will contribute deeply for the development of new fashionable products within this material.

  1. Plasticity of laccase generated by homeologous recombination in yeast.

    Science.gov (United States)

    Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry

    2009-10-01

    Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.

  2. Optimization of Laccase Production using White Rot Fungi and Agriculture Wastes in Solid State Fermentation

    Directory of Open Access Journals (Sweden)

    Hendro Risdianto

    2012-07-01

    Full Text Available Laccase has been produced in a solid state fermentation (SSF using white rot fungi and various lignocellulosic based substrates. White rot fungi used were Marasmius sp, Trametes hirsuta, Trametes versicolor and Phanerochaete crysosporium. The solid substrates employed in this research were collected from agriculture waste which were empty fruit bunches (EFB, rice straw, corn cob, and rice husk. The objective of this research was to determine the most promising fungus, the best solid substrate and the optimal conditions for the production of laccase. The results showed that Marasmius sp. on all solid substrates displayed higher laccase activity than that of any other strain of white rot fungi. Marasmius sp. and solid substrate of rice straw demonstrated the highest laccase activity of 1116.11 U/L on day 10. Three significant factors, i.e. pH, temperature and yeast extract concentration were studied by response surface method on laccase production using Marasmius sp and rice straw. The optimized conditions were pH, temperature and yeast extract concentration of 4.9, 31ºC and 0.36 g/L respectively. The fermentation of Marasmius sp. in SSF on agricultural waste shows a great potential for the production of laccase.

  3. Stabilized Laccases as Heterogeneous Bioelectrocatalysts (Postprint)

    Science.gov (United States)

    2012-10-01

    Reference Rhus vernificera catechin (anticancer flavonoid ) • covalent binding (amide chemistry) to Au Nps in dendrimers [82] Rigidoporus lignosis phenolic...proper· tiesP· 391 An interesting extension to the application of laccases in biosensors is the medically relevant detection of catechins and flavonoids

  4. Copper and dyes enhance laccase production in gamma-proteobacterium JB.

    Science.gov (United States)

    Malhotra, Kanam; Sharma, Prince; Capalash, Neena

    2004-07-01

    Laccase production in gamma-proteobacterium JB was enhanced 13-fold by adding 0.1 mM CuSO(4) 24 h after the onset of growth. Ethidium bromide (2.5 microM), Malachite Green, Phenol Red and Thymol Blue (10 microM each) enhanced laccase production 17-, 19-, 4- and 2-fold, respectively. Among the fourteen aromatic/organic compounds tried, p-aminobenzoic acid and an industrial effluent, from where the organism was isolated, showed 1.2- and 1.26-fold increases in production.

  5. Catalytic Efficiency of Basidiomycete Laccases: Redox Potential versus Substrate-Binding Pocket Structure

    Directory of Open Access Journals (Sweden)

    Olga A. Glazunova

    2018-04-01

    Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.

  6. Purification and Characterization of a White Laccase with Pronounced Dye Decolorizing Ability and HIV-1 Reverse Transcriptase Inhibitory Activity from Lepista nuda

    Directory of Open Access Journals (Sweden)

    Mengjuan Zhu

    2016-03-01

    Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.

  7. Enzymatic Treatments to Improve Mechanical Properties and Surface Hydrophobicity of Jute Fiber Membranes

    Directory of Open Access Journals (Sweden)

    Aixue Dong

    2016-02-01

    Full Text Available Fiber membranes prepared from jute fragments can be valuable, low cost, and renewable. They have broad application prospects in packing bags, geotextiles, filters, and composite reinforcements. Traditionally, chemical adhesives have been used to improve the properties of jute fiber membranes. A series of new laccase, laccase/mediator systems, and multi-enzyme synergisms were attempted. After the laccase treatment of jute fragments, the mechanical properties and surface hydrophobicity of the produced fiber membranes increased because of the cross-coupling of lignins with ether bonds mediated by laccase. The optimum conditions were a buffer pH of 4.5 and an incubation temperature of 60 °C with 0.92 U/mL laccase for 3 h. Laccase/guaiacol and laccase/alkali lignin treatments resulted in remarkable increases in the mechanical properties; in contrast, the laccase/2,2’-azino-bis-(3-ethylthiazoline-6-sulfonate (ABTS and laccase/2,6-dimethoxyphenol treatments led to a decrease. The laccase/ guaiacol system was favorable to the surface hydrophobicity of jute fiber membranes. However, the laccase/alkali lignin system had the opposite effect. Xylanase/laccase and cellulase/laccase combined treatments were able to enhance both the mechanical properties and the surface hydrophobicity of jute fiber membranes. Among these, cellulase/laccase treatment performed better; compared to mechanical properties, the surface hydrophobicity of the jute fiber membranes showed only a slight increase after the enzymatic multi-step processes.

  8. Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.

    Science.gov (United States)

    Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla

    2014-03-01

    The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Stability mechanisms of a thermophilic laccase probed by molecular dynamics

    DEFF Research Database (Denmark)

    Christensen, Niels Johan; Kepp, Kasper Planeta

    2013-01-01

    Laccases are highly stable, industrially important enzymes capable of oxidizing a large range of substrates. Causes for their stability are, as for other proteins, poorly understood. In this work, multiple-seed molecular dynamics (MD) was applied to a Trametes versicolor laccase in response...... integrity by increasing persistent backbone hydrogen bonds by ∼4 across simulations, mainly via prevention of F(-) intrusion. Hydrogen-bond loss in distinct loop regions and ends of critical β-sheets suggest potential strategies for laboratory optimization of these industrially important enzymes....

  10. Ecofriendly laccase-hydrogen peroxide/ultrasound-assisted bleaching of linen fabrics and its influence on dyeing efficiency.

    Science.gov (United States)

    Abou-Okeil, A; El-Shafie, A; El Zawahry, M M

    2010-02-01

    This study evaluates the bleaching efficiency of enzymatically scoured linen fabrics using a combined laccase-hydrogen peroxide bleaching process with and without ultrasonic energy, with the goal of obtaining fabrics with high whiteness levels, well preserved tensile strength and higher dye uptake. The effect of the laccase enzyme and the combined laccase-hydrogen peroxide bleaching process with and without ultrasound has been investigated with regard to whiteness value, tensile strength, dyeing efficiency and dyeing kinetics using both reactive and cationic dyes. The bleached linen fabrics were characterized using X-ray diffraction and by measuring tensile strength and lightness. The dyeing efficiency and kinetics were characterized by measuring dye uptake and colour fastness. The results indicated that ultrasound was an effective technique in the combined laccase-hydrogen peroxide bleaching process of linen fabrics. The whiteness values expressed as lightness of linen fabrics is enhanced by using ultrasonic energy. The measured colour strength values were found to be slightly better for combined laccase-hydrogen peroxide/ultrasound-assisted bleached fabrics than for combined laccase-hydrogen peroxide for both reactive and cationic dyes. The fastness properties of the fabrics dyed with reactive dye were better than those obtained when using cationic dye. The time/dye uptake isotherms were also enhanced when using combined laccase-hydrogen peroxide/ultrasound-assisted bleached fabric, which confirms the efficiency of ultrasound in the combined oxidative bleaching process. The dyeing rate constant, half-time of dyeing and dyeing efficiency have been calculated and discussed.

  11. Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.

    2009-07-01

    The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)

  12. Aldehyde PEGylation of laccase from Trametes versicolor in route to increase its stability: effect on enzymatic activity.

    Science.gov (United States)

    Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco

    2015-03-01

    Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  14. Hydrogen peroxide produced by glucose oxidase affects the performance of laccase cathodes in glucose/oxygen fuel cells: FAD-dependent glucose dehydrogenase as a replacement.

    Science.gov (United States)

    Milton, Ross D; Giroud, Fabien; Thumser, Alfred E; Minteer, Shelley D; Slade, Robert C T

    2013-11-28

    Hydrogen peroxide production by glucose oxidase (GOx) and its negative effect on laccase performance have been studied. Simultaneously, FAD-dependent glucose dehydrogenase (FAD-GDH), an O2-insensitive enzyme, has been evaluated as a substitute. Experiments focused on determining the effect of the side reaction of GOx between its natural electron acceptor O2 (consumed) and hydrogen peroxide (produced) in the electrolyte. Firstly, oxygen consumption was investigated by both GOx and FAD-GDH in the presence of substrate. Relatively high electrocatalytic currents were obtained with both enzymes. O2 consumption was observed with immobilized GOx only, whilst O2 concentration remained stable for the FAD-GDH. Dissolved oxygen depletion effects on laccase electrode performances were investigated with both an oxidizing and a reducing electrode immersed in a single compartment. In the presence of glucose, dramatic decreases in cathodic currents were recorded when laccase electrodes were combined with a GOx-based electrode only. Furthermore, it appeared that the major loss of performance of the cathode was due to the increase of H2O2 concentration in the bulk solution induced laccase inhibition. 24 h stability experiments suggest that the use of O2-insensitive FAD-GDH as to obviate in situ peroxide production by GOx is effective. Open-circuit potentials of 0.66 ± 0.03 V and power densities of 122.2 ± 5.8 μW cm(-2) were observed for FAD-GDH/laccase biofuel cells.

  15. A Novel Laccase from Ganoderma Lucidum Capable of Enhancing Enzymatic Degradation of Lignocellulolytic Biomass

    DEFF Research Database (Denmark)

    2014-01-01

    for the hydrolysis of biomass using a laccase derived from Ganoderma lucidum. Further, the invention provides an enzyme composition comprising a laccase derived from Ganoderma lucidum which may be combined with one or more cellulases, and for its use in enhancing lignocellulose biomass hydrolysis....

  16. Bacterial exopolysaccharides as a modern biotechnological tool for modification of fungal laccase properties and metal ion binding.

    Science.gov (United States)

    Osińska-Jaroszuk, Monika; Jaszek, Magdalena; Starosielec, Magdalena; Sulej, Justyna; Matuszewska, Anna; Janczarek, Monika; Bancerz, Renata; Wydrych, Jerzy; Wiater, Adrian; Jarosz-Wilkołazka, Anna

    2018-03-26

    Four bacterial EPSs extracted from Rhizobium leguminosarum bv. trifolii Rt24.2, Sinorhizobium meliloti Rm1021, Bradyrhizobium japonicum USDA110, and Bradyrhizobium elkanii USDA76 were determined towards their metal ion adsorption properties and possible modification of Cerrena unicolor laccase properties. The highest magnesium and iron ion-sorption capacity (~ 42 and ~ 14.5%, respectively) was observed for EPS isolated from B. japonicum USDA110. An evident influence of EPSs on the stability of laccase compared to the control values (without EPSs) was shown after 30-day incubation at 25 °C. The residual activity of laccases was obtained in the presence of Rh76EPS and Rh1021EPS, i.e., 49.5 and 41.5% of the initial catalytic activity, respectively. This result was confirmed by native PAGE electrophoresis. The EPS effect on laccase stability at different pH (from 3.8 to 7.0) was also estimated. The most significant changes at the optimum pH value (pH 5.8) was observed in samples of laccase stabilized by Rh76EPS and Rh1021EPS. Cyclic voltamperometry was used for analysis of electrochemical parameters of laccase stabilized by bacterial EPS and immobilized on single-walled carbon nanotubes (SWCNTs) with aryl residues. Laccases with Rh76EPS and Rh1021EPS had an evident shift of the value of the redox potential compared to the control without EPS addition. In conclusion, the results obtained in this work present a new potential use of bacterial EPSs as a metal-binding component and a modulator of laccase properties especially stability of enzyme activity, which can be a very effective tool in biotechnology and industrial applications.

  17. Biochemical and molecular characterization of Coriolopsis rigida laccases involved in transformation of the solid waste from olive oil production.

    Science.gov (United States)

    Díaz, Rosario; Saparrat, Mario C N; Jurado, Miguel; García-Romera, Inmaculada; Ocampo, Juan Antonio; Martínez, María Jesús

    2010-09-01

    Two laccase isoenzymes were purified and characterized from the basidiomycete Coriolopsis rigida during transformation of the water-soluble fraction of "alpeorujo" (WSFA), a solid residue derived from the olive oil production containing high levels of toxic compounds. Zymogram assays of laccases secreted by the fungus growing on WSFA and WSFA supplemented with glucose showed two bands with isoelectric points of 3.3 and 3.4. The kinetic studies of the two purified isoenzymes showed similar affinity on 2,6-dimethoxyphenol and 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonic acid), used as phenolic and non-phenolic model substrate, respectively. The molecular mass of both proteins was 66 kDa with 9% N-linked carbohydrate. Physico-chemical properties of the purified laccases from media containing WSFA were similar to those obtained from medium with glucose as the main carbon source. In-vitro studies performed with the purified laccases revealed a 42% phenol reduction of WSFA, as well as changes in the molecular mass distribution. These findings indicate that these laccases are involved in the process of transformation, via polymerization by the oxidation of phenolic compounds present in WSFA. A single laccase gene, containing an open reading frame of 1,488 bp, was obtained in PCR amplifications performed with cDNA extracted from mycelia grown on WSFA. The product of the gene shares 90% identity (95% similarity) with a laccase from Trametes trogii and 89% identity (95% similarity) with a laccase from Coriolopsis gallica. This is the first report on purification and molecular characterization of laccases directly involved in the transformation of olive oil residues.

  18. Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

    Science.gov (United States)

    Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

    2005-08-01

    Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.

  19. Highly-efficient liposome-mediated transformation system for the basidiomycetous fungus Flammulina velutipes.

    Science.gov (United States)

    Shi, Liang; Chen, Dongdong; Xu, Chao; Ren, Ang; Yu, Hanshou; Zhao, Mingwen

    2017-07-11

    Flammulina velutipes is a well-known edible mushroom cultivated all over the world. However, because of the low transformation frequency, the expensive instruments required, and the complicated, time-consuming procedures necessary, there is insufficient genetic research on F. velutipes. In this study, we report a liposome-mediated transformation (LMT) system for the genetic transformation of F. velutipes. Using the LMT system, we obtained 82 ± 4 stable F. velutipes transformants per 10 5 protoplasts, which is a clear increase in transformation frequency compared to the other methods used. We were able to detect the expression of an EGFP reporter gene in the F. velutipes transformants using fluorescence imaging assays. Furthermore, we used this method to transfer the laccase gene into F. velutipes and found that the transcriptional level and enzymatic activity increased in these transformants. Mitotic stability analysis showed that all of the selected transformants remained mitotically stable, even after five successive rounds of sub-culturing. These results demonstrate a new transgenic approach that will facilitate F. velutipes research.

  20. Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri

    Energy Technology Data Exchange (ETDEWEB)

    Shikha Dhawan; Ramesh Chander Kuhad [University of Delhi, New Delhi (India). Dept. of Microbiology

    2002-08-01

    Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production. (author)

  1. Green Synthesis and Antibacterial Activities of Silver Nanoparticles Using Extracellular Laccase of Lentinus edodes

    Directory of Open Access Journals (Sweden)

    Agbaje LATEEF

    2015-12-01

    Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.

  2. Production of Trametes pubescens Laccase under Submerged and Semi-Solid Culture Conditions on Agro-Industrial Wastes

    Science.gov (United States)

    Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametes pubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936

  3. Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

    Science.gov (United States)

    Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F

    2013-01-01

    Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

  4. Production of Trametes pubescens laccase under submerged and semi-solid culture conditions on agro-industrial wastes.

    Directory of Open Access Journals (Sweden)

    Juan C Gonzalez

    Full Text Available Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM, and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1 and 60 kDa (Lac2. Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1 of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.

  5. Potentiality of a ceramic membrane reactor for the laccase-catalyzed removal of bisphenol A from secondary effluents.

    Science.gov (United States)

    Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T

    2015-11-01

    In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane, which prevented the sorption of the pollutant and allowed the recovery and recycling of laccase. Nearly complete removal of BPA was attained under both operation regimes with removal yields above 94.5 %. In experiments with real wastewater, the removal of BPA remained high while the presence of colloids and certain ions and the formation of precipitates on the membrane potentially affected enzyme stability and made necessary the periodic addition of laccase. Polymerization and degradation were observed as probable mechanisms of BPA transformation by laccase.

  6. Laccases stabilization with phosphatidylcholine liposomes

    OpenAIRE

    Martí, M.; Zille, Andrea; Paulo, Artur Cavaco; Parra, J. L.; Coderch, L.

    2012-01-01

    In recent years, there has been an upsurge of interest in enzyme treatment of textile fibres. Enzymes are globular proteins whose catalytic function is due to their three dimensional structure. For this reason, stability strategies make use of compounds that avoid dismantling or distorting protein 3D structures. This study is concerned with the use of microencapsulation techniques to optimize enzyme stabilization. Laccases were embedded in phophatidylcholine liposomes and their encaps...

  7. Crystal structures of E. coli laccase CueO at different copper concentrations

    International Nuclear Information System (INIS)

    Li Xu; Wei Zhiyi; Zhang Min; Peng Xiaohui; Yu Guangzhe; Teng Maikun; Gong Weimin

    2007-01-01

    CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra α-helix from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper

  8. Effects of laccase on lignin depolymerization and enzymatic hydrolysis of ensiled corn stover.

    Science.gov (United States)

    Chen, Qin; Marshall, Megan N; Geib, Scott M; Tien, Ming; Richard, Tom L

    2012-08-01

    The aim of this study was to explore the synergies of laccase, a ligninolytic enzyme, with cellulose and hemicellulase amendments on ensiled corn stover. Molecular signals of lignin decomposition were observed by tetramethylammonium hydroxide thermochemolysis and gas chromatography-mass spectroscopy (TMAH-GC-MS) analysis. The significant findings suggest that ensilage might provide a platform for biological pretreatment. By partially hydrolyzing cellulose and hemicellulose into soluble sugars, ensilage facilitates laccase penetration into the lignocellulose complex to enhance lignin degradation. Downstream cellulose hydrolysis was improved 7% with increasing laccase loading rate. These results demonstrate the potential of enzymes, either directly amended or expressed by microbes during ensilage, to maximize utilization of corn stover for cellulosic biofuels and other downstream fermentations. Copyright © 2012. Published by Elsevier Ltd.

  9. Decolorization of azo dye and generation of electricity by microbial fuel cell with laccase-producing white-rot fungus on cathode

    International Nuclear Information System (INIS)

    Lai, Chi-Yung; Wu, Chih-Hung; Meng, Chui-Ting; Lin, Chi-Wen

    2017-01-01

    Highlights: • A laccase-producing fungus on cathode of MFC was used to enhance degradation of azo dye. • Laccase-producing fungal cathodes performed better than laccase-free control cathodes. • A maximum power density of 13.38 mW/m"2 and an >90% decolorization of acid orange 7 were obtained. • Growing a fungal culture with continuous laccase production improved MFC’s electricity generation. - Abstract: Wood-degrading white-rot fungi produce many extracellular enzymes, including the multi-copper oxidative enzyme laccase (EC 1.10.3.2). Laccase uses atmospheric oxygen as the electron acceptor to catalyze a one-electron oxidation reaction of phenolic compounds and therefore has the potential to simultaneously act as a cathode catalyst in a microbial fuel cell (MFC) and degrade azo dye pollutants. In this study, the laccase-producing white-rot fungus Ganoderma lucidum BCRC 36123 was planted on the cathode surface of a single-chamber MFC to degrade the azo dye acid orange 7 (AO7) synergistically with an anaerobic microbial community in the anode chamber. In a batch culture, the fungus used AO7 as the sole carbon source and produced laccase continuously, reaching a maximum activity of 20.3 ± 0.3 U/L on day 19 with a 77% decolorization of the dye (50 mg/L). During MFC operations, AO7 in the anolyte diffused across a layer of polyvinyl alcohol-hydrogel that separated the cathode membrane from the anode chamber, and served as a carbon source to support the growth of, and production of laccase by, the fungal mycelium that was planted on the cathode. In such MFCs, laccase-producing fungal cathodes outperformed laccase-free controls, yielding a maximum open-circuit voltage of 821 mV, a closed-circuit voltage of 394 mV with an external resistance of 1000 Ω, a maximum power density of 13.38 mW/m"2, a maximum current density of 33 mA/m"2, and a >90% decolorization of AO7. This study demonstrates the feasibility of growing a white-rot fungal culture with continuous

  10. The small laccase from Streptomyces coelicolor

    Czech Academy of Sciences Publication Activity Database

    Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Ostergaard, P. R.; Hašek, Jindřich

    2009-01-01

    Roč. 16, 1a (2009), b4-b5 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] R&D Projects: GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * Streptomyces coelicolor * enzymer Subject RIV: CD - Macromolecular Chemistry

  11. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  12. Laccase aided modification of nanofibrillated cellulose with dodecyl gallate

    Directory of Open Access Journals (Sweden)

    Päivi Saastamoinen

    2012-11-01

    Full Text Available Nanofibrillated cellulose, NFC, is an interesting wood fibre-based material that could be utilized in coatings, foams, composites, packages, dispersions, and emulsions, due to its high tensile strength and barrier properties, light weight, and stabilizing features. To improve applicability and properties of NFC, modification of its surface properties is often needed. In this study, the applicability of laccase-aided surface modification with hydrophobic dodecyl gallate (DOGA on unbleached NFC was investigated. Also, laccase-catalyzed polymerization of DOGA and other phenolic compounds with lignin moieties was investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy (MALDI-TOF MS. NFC modified with T. hirsuta-based laccase and DOGA showed decreased hydrophilicity, as compared with the native NFC, when coated on a paper surface. When dried as free-standing films, the surface properties of chemo-enzymatically modified NFC resembled those of the native NFC. The effect of modification was thus greatly influenced by different surface formation in differently prepared samples. Also, changing of the dispersion properties of DOGA by enzymatic polymerization affected the surface properties of the dried NFC samples. Covalent bonding between DOGA and NFC was not the main factor affecting the surface properties of the NFC in free-standing films or coatings.

  13. Oxidation of lignin in hemp fibres by laccase: effects on mechanical properties of hemp fibres and unidirectional fibre/epoxy composites

    DEFF Research Database (Denmark)

    Liu, Ming; Baum, Andreas; Odermatt, Jürgen

    2017-01-01

    Laccase activity catalyzes oxidation and polymerization of phenols. The effect of laccase treatment on the mechanical properties of hemp fibres and hemp fibre/epoxy composites was examined. Laccase treatment on top of 0.5% EDTA + 0.2% endo-polygalacturonase (EPG) treatments increased the mechanical...... properties of hemp fibres and fibre/epoxy composites. Comparing all fibre treatments, composites with 0.5% EDTA + 0.2% EPG + 0.5% laccase treated fibres had highest stiffness of 42 GPa and highest ultimate tensile strength (UTS) of 326 MPa at a fibre volume content of 50%. The thermal resistance of hemp...... hemp fibres and their composites were due to laccase catalyzed polymerization of lignin moieties in hemp fibres....

  14. Decolorization of textile dye RB19 using volcanic rock matrix immobilized Bacillus thuringiensis cells with surface displayed laccase.

    Science.gov (United States)

    Wan, Juan; Sun, Xiaowen; Liu, Cheng; Tang, Mengjun; Li, Lin; Ni, Hong

    2017-06-01

    A triplicate volcanic rock matrix-Bacillus thuringiensis-laccase WlacD (VRMs-Bt-WlacD) dye decolorization system was developed. WlacD was displayed on the B. thuringiensis MB174 cell surface to prepare a whole-cell laccase biocatalyst by using two repeat N-terminal domains of autolysin Mbg (Mbgn) 2 as the anchoring motif. Immunofluorescence microscopic assays confirmed that the fusion protein (Mbgn) 2 -WlacD was anchored on the surface of the recombinant B. thuringiensis MB174. After optimization by a single factor test, L 9 (3 4 )-orthogonal test, Plackett-Burman test, steepest ascent method, and Box-Behnken response surface methodology, the whole-cell specific laccase activity of B. thuringiensis MB174 was improved to 555.2 U L -1 , which was 2.25 times than that of the primary culture condition. Optimized B. thuringiensis MB174 cells were further adsorbed by VRMs to prepare VRMs-Bt-WlacD, an immobilized whole-cell laccase biocatalyst. Decolorization capacity of as-prepared VRMs-Bt-WlacD toward an initial concentration of 500 mg L -1 of an textile dye reactive blue 19 (RB19) aqueous solution reached 72.36% at a solid-to-liquid ratio of 10 g-100 mL. Repeated decolorization-activation operations showed the high decolorization capacity of VRMs-Bt-WlacD and have the potential for large-scale or continuous operations.

  15. Diamination by n-coupling using a commercial laccase

    CSIR Research Space (South Africa)

    Wellington, Kevin W

    2010-02-01

    Full Text Available Nuclear diamination of p-hydrobenzoquinones with aromatic and aliphatic primary amines was catalyzed by a immobilised commercial laccase, Denilite II Base, from Novozymes. The amine and the p-hydrobenzoquinone was reacted under mild conditions (at...

  16. Akkumulation von L-Malat und D-Lactat in Arabidopsis thaliana und Laccase/HBT-vermittelte Delignifizierung von Spartina alterniflora und Phragmites australis

    OpenAIRE

    Heil, Alexander

    2016-01-01

    The current work contains two projects "Accumulation of L-malate and D-lactate in Arabidopsis thaliana" (A) "Laccase/HBT mediated delignification of Spartina alterniflora and Phragmites australis" (B). In project A, L-malate and D-lactate accumulated in A. thaliana plants. The accumulation of L-malate is carried out by modification of the plant metabolism with the enzymes PEPC, MDH and the tonoplast dicarboxylate transporter (TDT). Gene pepci2 (Hydrilla verticillata), mdh5 (Zea mays) and tdt ...

  17. Effects and interactions of medium components on laccase from a marine-derived fungus using response surface methodology

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.

    The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...

  18. Optimization of laccase production from Marasmiellus palmivorus LA1 by Taguchi method of Design of experiments.

    Science.gov (United States)

    Chenthamarakshan, Aiswarya; Parambayil, Nayana; Miziriya, Nafeesathul; Soumya, P S; Lakshmi, M S Kiran; Ramgopal, Anala; Dileep, Anuja; Nambisan, Padma

    2017-02-13

    Fungal laccase has profound applications in different fields of biotechnology due to its broad specificity and high redox potential. Any successful application of the enzyme requires large scale production. As laccase production is highly dependent on medium components and cultural conditions, optimization of the same is essential for efficient product production. Production of laccase by fungal strain Marasmiellus palmivorus LA1 under solid state fermentation was optimized by the Taguchi design of experiments (DOE) methodology. An orthogonal array (L8) was designed using Qualitek-4 software to study the interactions and relative influence of the seven selected factors by one factor at a time approach. The optimum condition formulated was temperature (28 °C), pH (5), galactose (0.8%w/v), cupric sulphate (3 mM), inoculum concentration (number of mycelial agar pieces) (6Nos.) and substrate length (0.05 m). Overall yield increase of 17.6 fold was obtained after optimization. Statistical optimization leads to the elimination of an insignificant medium component ammonium dihydrogen phosphate from the process and contributes to a 1.06 fold increase in enzyme production. A final production of 667.4 ± 13 IU/mL laccase activity paves way for the application of this strain for industrial applications. Study optimized lignin degrading laccases from Marasmiellus palmivorus LA1. This laccases can thus be used for further applications in different scales of production after analyzing the properties of the enzyme. Study also confirmed the use of taguchi method for optimizations of product production.

  19. Development and mapping of gene-tagged SNP markers in laccases of maize (Zea mays L.)

    DEFF Research Database (Denmark)

    Andersen, J R; Asp, T; Lu, Y C

    2009-01-01

    Laccases, EC 1.10.3.2 or p-diphenol : dioxygen oxidoreductases, have been proposed to be involved in the oxidative polymerization of monolignols into lignins in plants. While 17 laccases have been identified in Arabidopsis, only five (ZmLac1-5) have so far been identified in maize. By a bioinform...

  20. Comparison of the efficiency of bacterial and fungal laccases in delignification and detoxification of steam-pretreated lignocellulosic biomass for bioethanol production.

    Science.gov (United States)

    De La Torre, María; Martín-Sampedro, Raquel; Fillat, Úrsula; Eugenio, María E; Blánquez, Alba; Hernández, Manuel; Arias, María E; Ibarra, David

    2017-11-01

    This study evaluates the potential of a bacterial laccase from Streptomyces ipomoeae (SilA) for delignification and detoxification of steam-exploded wheat straw, in comparison with a commercial fungal laccase from Trametes villosa. When alkali extraction followed by SilA laccase treatment was applied to the water insoluble solids fraction, a slight reduction in lignin content was detected, and after a saccharification step, an increase in both glucose and xylose production (16 and 6%, respectively) was observed. These effects were not produced with T. villosa laccase. Concerning to the fermentation process, the treatment of the steam-exploded whole slurry with both laccases produced a decrease in the phenol content by up to 35 and 71% with bacterial and fungal laccases, respectively. The phenols reduction resulted in an improved performance of Saccharomyces cerevisiae during a simultaneous saccharification and fermentation (SSF) process, improving ethanol production rate. This enhancement was more marked with a presaccharification step prior to the SSF process.

  1. Performance of an alkalophilic and halotolerant laccase from gamma-proteobacterium JB in the presence of industrial pollutants.

    Science.gov (United States)

    Singh, Gursharan; Sharma, Prince; Capalash, Neena

    2009-08-01

    An alkalophilic and halotolerant laccase from gamma-proteobacterium JB catalyzed in high concentrations of organic solvents and various salts. The enzyme retained 80-100% activity in 10% concentration of dimethylsulfoxide (DMSO), ethanol, acetone or methanol; 100, 85 and 50% activity in 20 mM MgCl(2), 5.0 mM MnCl(2) and 0.1 mM CuCl(2); 140, 120 and 110% activity in 5.0 mM MnSO(4), 10 mM MgSO(4) and 1mM CaSO(4), respectively. Sodium halides inhibited the enzyme in the order: F(-)> Br(-)> I(-)> Cl(-). In 0.5 M NaCl, pH 6.0, laccase was approximately 60% active. Decolorization of indigo carmine by laccase at pH 9.0 was not inhibited even in the presence of 0.5 M NaCl. Release of chromophoric, reducing and hydrophobic compounds during biobleaching of straw rich-soda pulp by laccase was not inhibited when the enzyme was applied in the presence of 1 M NaCl at pH 8.0. Laccase retained 50% residual activity even when incubated with 5% calcium hypochlorite for 30 min.

  2. The structure of the small laccase from Streptomyces coelicolor reveals a link between laccases and nitrite reductases

    Czech Academy of Sciences Publication Activity Database

    Skálová, Tereza; Dohnálek, Jan; Ostergaard, L. H.; Ostergaard, P. R.; Kolenko, Petr; Dušková, Jarmila; Štěpánková, Andrea; Hašek, Jindřich

    2009-01-01

    Roč. 385, č. 4 (2009), s. 1165-1178 ISSN 0022-2836 R&D Projects: GA MŠk 1K05008; GA ČR GA305/07/1073; GA AV ČR 1ET400500402 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * oxidoreductase * multicopper blue protein * Streptomyces coelicolor * crystal structure Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.871, year: 2009

  3. Electrochemical and AFM characterization on gold and carbon electrodes of a high redox potential laccase from Fusarium proliferatum.

    Science.gov (United States)

    González Arzola, K; Gimeno, Y; Arévalo, M C; Falcón, M A; Hernández Creus, A

    2010-08-01

    The redox potential of the T1 copper site of laccase from Fusarium proliferatum was determined by titration to be about 510 mV vs. SCE (750 mV vs. NHE), which makes it a high redox potential enzyme. Anaerobic electron transfer reactions between laccase and carbon and gold electrodes were detected, both in solution and when the enzyme was adsorbed on these surfaces. In solution, a single high-potential signal (660 mV vs. SCE) was recorded at the carbon surfaces, attributable to the T1 copper site of the enzyme. However, a well-defined oxidative process at about 660 mV and an anodic wave at 350 mV vs. SCE were recorded at the gold electrode, respectively associated with the T1 and T2 copper sites. Laccase-modified carbon electrodes behaved analogously when the enzyme was in solution, unlike laccase adsorbed on gold, which showed only a low-potential signal. Laccase molecules were successfully imaged by AFM; obtaining a thick compact stable film on Au(111), and large aggregates forming a complex network of small branches leaving voids on the HOPG surface. Laccase-modified carbon electrodes retained significant enzymatic activity, efficiently oxidising violuric acid and reducing molecular oxygen. Explanations are proposed for how protein-film organisation affects the electrode function. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  4. Identification of a laccase from Ganoderma lucidum CBS 229.93 having potential for enhancing cellulase catalyzed lignocellulose degradation.

    Science.gov (United States)

    Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S

    2013-12-10

    Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Green Synthesis and Antibacterial Activities of Silver Nanoparticles Using Extracellular Laccase of Lentinus edodes

    Directory of Open Access Journals (Sweden)

    Agbaje LATEEF

    2015-12-01

    Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.

  6. Purification and characterization of laccase from Trametes hirsuta ...

    African Journals Online (AJOL)

    oem

    2012-02-21

    Feb 21, 2012 ... wine, and in beer stabilization (Minussi et al., 2002), paper pulp .... Laccase was incubated with ethanol and acetonitrile 20% at room temperature for 24 h. ... Apparent kinetic constants (Km, Vmax) were calculated using ..... from Trametes versicolor produced by solid-substrate fermentation. Adv. Biosci.

  7. Laccase-Catalyzed Decolorization of Malachite Green: Performance Optimization and Degradation Mechanism

    Science.gov (United States)

    Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun

    2015-01-01

    Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270

  8. Laccase-catalyzed decolorization of malachite green: performance optimization and degradation mechanism.

    Directory of Open Access Journals (Sweden)

    Jie Yang

    Full Text Available Malachite green (MG was decolorized by laccase (LacA of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1 LacA, 109.9 mg L(-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1, respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.

  9. Nuclear track-based biosensors with the enzyme laccase

    Energy Technology Data Exchange (ETDEWEB)

    García-Arellano, H. [Departamento de Ciencias Ambientales, División de Ciencias Biológicas y de la Salud, Universidad Autónoma Metropolitana-Lerma, Av. de las Garzas No. 10, Col. El Panteón, Lerma de Villada, Municipio de Lerma, Estado de México, C.P. 52005 (Mexico); Fink, D., E-mail: fink@xanum.uam.mx [Division de Ciencias Naturales e Ingeneria, Universidad Autónoma Metropolitana-Cuajimalpa, Artificios 40, Col. Hidalgo, Del. Álvaro Obregón C.P. 01120, México, D.F. (Mexico); Nuclear Physics Institute, 25068 Řež (Czech Republic); Muñoz Hernández, G. [Division de Ciencias Naturales e Ingeneria, Universidad Autónoma Metropolitana-Cuajimalpa, Artificios 40, Col. Hidalgo, Del. Álvaro Obregón C.P. 01120, México, D.F. (Mexico); Departamento de Fisica, Universidad Autónoma Metropolitana-Iztapalapa, PO Box 55-534, 09340 México, D.F. (Mexico); Vacík, J.; Hnatowicz, V. [Nuclear Physics Institute, 25068 Řež (Czech Republic); Alfonta, L. [Avram and Stella Goldstein-Goren Department of Biotechnology Engineering, Ben-Gurion University of the Negev, PO Box 653, Beer-Sheva 84105 (Israel)

    2014-08-15

    Highlights: • We construct a biosensor using polymer foils with laccase-clad etched nuclear tracks. • We use the biosensor for quantitation of phenolic compounds. • The biosensor can detect picomolar concentrations for some phenolic compounds. - Abstract: A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration – in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.

  10. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  11. Development of biosensors containing laccase and imidazolium bis(trifluoromethylsulfonyl)imide ionic liquid for the determination of rutin

    International Nuclear Information System (INIS)

    Franzoi, Ana Cristina; Migowski, Pedro; Dupont, Jairton; Cruz Vieira, Iolanda

    2009-01-01

    Biosensors based on hydrophobic ionic liquids (ILs) derived from the bis(trifluoromethylsulfonyl)imide [(CF 3 SO 2 ) 2 N - = Tf 2 N - ] anion associated with three different imidazolium cations: 1-butyl-3-methylimidazolium (BMI.Tf 2 N), 1-decyl-3-methylimidazolium (DMI.Tf 2 N) and 1-tetradecyl-3-methylimidazolium (TDMI.Tf 2 N), along with laccase from Aspergillus oryzae, were constructed and optimized for determination of rutin. The laccase catalyzes the oxidation of rutin to the corresponding o-quinone, which is electrochemically reduced back to rutin. The best performance was obtained with 50:20:15:15% (w/w/w/w) as the graphite powder:laccase:Nujol:ILs composition in 0.1 mol L -1 acetate buffer solution (pH 5.0). The parameters for the square-wave voltammetry experiments and scanning electron microscopy images of the biosensors were studied. Under the selected conditions, the cathodic peak current increased linearly in the rutin concentration ranges of 4.77 x 10 -6 to 4.62 x 10 -5 mol L -1 , 5.84 x 10 -6 to 5.36 x 10 -5 mol L -1 and 5.84 x 10 -6 to 5.36 x 10 -5 mol L -1 using the (I) BMI.Tf 2 N-laccase, (II) DMI.Tf 2 N-laccase and (III) TDMI.Tf 2 N-laccase, respectively. The rutin contents of commercial samples of pharmaceuticals were successfully determined by the biosensors and the results compared well with those obtained using the official method. The studies on rutin recovery from these samples gave values of 96.9-104.6%.

  12. Optimization of laccase production by two strains of Ganoderma lucidum using phenolic and metallic inducers

    Directory of Open Access Journals (Sweden)

    Francisco Kuhar

    Full Text Available Ganoderma lucidum (Curtis P. Karst is a white rot fungus that is able to degrade the lignin component in wood. The ability of two strains of this species to produce the ligninolytic enzyme laccase was assessed. After the evaluation of induction with heavy metals and phenolic compounds, it was found that among the tested substances, copper and ferulic acid are the best laccase inducers. It was also observed that the two types of inducers (phenolic and metallic produce different electrophoretic patterns of laccase activity. Optimized concentrations of inducers were obtained through a factorial design and the thermal stability of optimized supernatants was studied at a wide range of acidic pH. We found that the enzyme is more thermostable at higher pH values.

  13. Molecular characterization of a novel thermostable laccase PPLCC2 from the brown rot fungus Postia placenta MAD-698-R

    Directory of Open Access Journals (Sweden)

    Hongde An

    2015-11-01

    Conclusions: This is the first identified thermo activated and thermostable laccase in brown rot fungi. This investigation will contribute to understanding the roles played by laccases in brown rot fungi.

  14. Comparative analyses of laccase-catalyzed amination reactions for production of novel β-lactam antibiotics.

    Science.gov (United States)

    Mikolasch, Annett; Manda, Katrin; Schlüter, Rabea; Lalk, Michael; Witt, Sabine; Seefeldt, Simone; Hammer, Elke; Schauer, Frieder; Jülich, Wolf-Dieter; Lindequist, Ulrike

    2012-01-01

    Seven novel β-lactam antibiotics with activities against Gram-positive bacterial strains, among them methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, were synthesized by amination of 2,5-dihydroxyphenylacetic acid in usable yields (30-60%). These products protected mice against an infection with S. aureus lethal to the control animals. The results show the usefulness of laccase for the synthesis of potential new antibiotics, in addition to the interdependence of the laccase substrates, the amino coupling partners, and the product formation, yield, and activity. The syntheses of β-lactam antibiotics with 2,5-dihydroxyaromatic acid substructures (para-substituted) are then compared with those of 3,4-dihydroxyaromatic acid substructures (ortho-substituted). Para-substituted laccase substrates were better reaction partners in these syntheses than ortho-substituted compounds. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.

  15. Laccase production by Coriolopsis caperata RCK2011: Optimization under solid state fermentation by Taguchi DOE methodology

    Science.gov (United States)

    Nandal, Preeti; Ravella, Sreenivas Rao; Kuhad, Ramesh Chander

    2013-01-01

    Laccase production by Coriolopsis caperata RCK2011 under solid state fermentation was optimized following Taguchi design of experiment. An orthogonal array layout of L18 (21 × 37) was constructed using Qualitek-4 software with eight most influensive factors on laccase production. At individual level pH contributed higher influence, whereas, corn steep liquor (CSL) accounted for more than 50% of the severity index with biotin and KH2PO4 at the interactive level. The optimum conditions derived were; temperature 30°C, pH 5.0, wheat bran 5.0 g, inoculum size 0.5 ml (fungal cell mass = 0.015 g dry wt.), biotin 0.5% w/v, KH2PO4 0.013% w/v, CSL 0.1% v/v and 0.5 mM xylidine as an inducer. The validation experiments using optimized conditions confirmed an improvement in enzyme production by 58.01%. The laccase production to the level of 1623.55 Ugds−1 indicates that the fungus C. caperata RCK2011 has the commercial potential for laccase. PMID:23463372

  16. Biobleaching of wheat straw-rich soda pulp with alkalophilic laccase from gamma-proteobacterium JB: optimization of process parameters using response surface methodology.

    Science.gov (United States)

    Singh, Gursharan; Ahuja, Naveen; Batish, Mona; Capalash, Neena; Sharma, Prince

    2008-11-01

    An alkalophilic laccase from gamma-proteobacterium JB was applied to wheat straw-rich soda pulp to check its bleaching potential by using response surface methodology based on central composite design. The design was employed by selecting laccase units, ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) concentration and pH as model factors. The results of second order factorial design experiments showed that all three independent variables had significant effect on brightness and kappa number of laccase-treated pulp. Optimum conditions for biobleaching of pulp with laccase preparation (specific activity, 65 nkat mg(-1) protein) were 20 nkat g(-1) of pulp, 2mM ABTS and pH 8.0 which enhanced brightness by 5.89% and reduced kappa number by 21.1% within 4h of incubation at 55 degrees C, without further alkaline extraction of pulp. Tear index (8%) and burst index (18%) also improved for laccase-treated pulp as compared to control raw pulp. Treatment of chemically (CEH1H2) bleached pulp with laccase showed significant effect on release of chromophores, hydrophobic and reducing compounds. Laccase-prebleaching of raw pulp reduced the use of hypochlorite by 10% to achieve brightness of resultant hand sheets similar to the fully chemically bleached pulp.

  17. Characterisation of a novel white laccase from the deuteromycete fungus Myrothecium verrucaria NF-05 and its decolourisation of dyes.

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    Full Text Available A novel 'white' laccase was purified from the deuteromycete fungus, Myrothecium verrucaria NF-05, which was a high laccase-producing strain (40.2 U·ml(-1 on the thirteenth day during fermentation. SDS-PAGE and native-PAGE revealed a single band with laccase activity corresponding to a molecular weight of approximately 66 kDa. The enzyme had three copper and one iron atoms per protein molecule determined by ICP-AES. Furthermore, both UV/visible and EPR spectroscopy remained silence, indicating the enzyme a novel laccase with new metal compositions of active centre and spectral properties. The N-terminal amino acid sequence of the purified protein was APQISPQYPM. Together with MALDI-TOF analysis, the protein revealed a high homology of the protein with that from reported M. verrucaria. The highest activity was detected at pH 4.0 and at 30°C. The enzyme activity was significantly enhanced by Na(+, Mn(2+, Cu(2+ and Zn(2+ while inhibited by DTT, NaN(3 and halogen anions. The kinetic constant (Km showed the enzyme was more affinitive to ABTS than other tested aromatic substrates. Twelve structurally different dyes could be effectively decolourised by the laccase within 10 min. The high production of the strain and novel properties of the laccase suggested its potential for biotechnological applications.

  18. Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles

    Directory of Open Access Journals (Sweden)

    Ahmed I. El-Batal

    2015-03-01

    Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.

  19. Heterologous expression of a tannic acid-inducible laccase3 of Cryphonectria parasitica in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Kim Dae-Hyuk

    2010-02-01

    Full Text Available Abstract Background A tannic acid-inducible and mycoviral-regulated laccase3 (lac3 from the chestnut blight fungus Cryphonectria parasitica has recently been identified, but further characterization was hampered because of the precipitation of protein products by tannic acid supplementation. The present study investigated the heterologous expression of the functional laccase3 using a yeast Saccharomyces cerevisiae. Results Laccase activity in the culture broth of transformants measured using a laccase-specific substrate suggested that the lac3 gene was successfully expressed and the corresponding protein product secreted into the culture media. In addition, activity staining and Western blot analysis of a native gel revealed that the enzyme activity co-existed with the protein product specific to anti-laccase3 antibody, confirming that the cloned lac3 gene is responsible for the laccase activity. When transformants were grown on plates containing tannic acid-supplemented media, brown coloration was observed around transformed cells, indicating the oxidation of tannic acid. However, the enzymatic activity was measurable only in the selective ura- media and was negligible in nonselective nutrient-rich culture conditions. This was in part because of the increased plasmid instability in the nonselective media. Moreover, the protein product of lac3 appears to be sensitive to the cultured nonselective nutrient-rich broth, because a rapid decline in enzymatic activity was observed when the cultured broth of ura- media was mixed with that of nonselective nutrient-rich broth. In addition, constitutive expression of the lac3 gene resulted in a reduced cell number of the lac3 transformants compared to that of vector-only transformed control. However, the presence of recombinant vector without lac3 induction did not affect the growth of transformants. Conclusions The results suggest that expression of the lac3 gene has an inhibitory effect on the growth of

  20. Elimination of estrogenic activity of thermal paper using laccase from Trichoderma sp NFCCI-2745.

    Science.gov (United States)

    Divya, L M; Prasanth, G K; Sadasivan, C

    2013-02-01

    In thermal printing, bisphenol A (BPA) functions chemically as a developer and reacts with white or colorless dyes in the presence of heat, converting them to a dark color. BPA can transfer readily to skin in small amounts from these papers. Its damage to environment and organisms has caused an extensive concern. In the present study, thermal paper used at the local automated teller machine counters of India were analyzed for the presence of BPA, and the capability of the paper to produce estrogenicity were assessed using a yeast two-hybrid assay experimental system. The study also focused on eliminating the endocrine-disrupting properties with partially purified laccase from newly isolated ascomycete fungi. The results indicate that these papers can produce estrogen hormone-like effect on experimental systems. It should be noted that on a daily basis, tons of such receipts are being dumped in the environment. Estrogenic properties of thermal paper were effectively removed from the reaction mixture within 3 h of incubation with the partially purified enzyme. We propose the utilization of waste thermal paper as a cheap substrate for laccase production for a safer and cleaner environment.

  1. Enzymatic removal of estrogenic activity of nonylphenol and octylphenol aqueous solutions by immobilized laccase from Trametes versicolor

    Energy Technology Data Exchange (ETDEWEB)

    Catapane, Maria [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Nicolucci, Carla; Menale, Ciro; Mita, Luigi [National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy); Rossi, Sergio [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); Mita, Damiano G., E-mail: mita@igb.cnr.it [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy); Diano, Nadia [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy)

    2013-03-15

    Highlights: ► Endocrine disruptors cause adverse effects in living organisms. ► Nonylphenol and Octylphenol are alkylphenols recognized as endocrine disruptors. ► It is necessary to remove or reduce their presence in the environment. ► Waters polluted by these pollutants have been bioremediated by immobilized laccase from Trametes versicolor. ► Laccase treated solutions were found to have lost any estrogenic activity. -- Abstract: A fluidized bed reactor, filled with laccase-based beads, has been employed to bioremediate aqueous solutions polluted by endocrine disruptors belonging to the alkylphenols (APs) class. In particular Octylphenol and Nonylphenol have been studied. The catalytic activity of free and immobilized laccase from Trametes versicolor has been characterized as a function of pH, temperature and substrate concentration in the reaction medium. In view of practical applications for each substrate concentration the removal efficiency (RE), the time to halve the initial concentration (τ{sub 50}), and the t{sub c=0}, i.e. the time to reach complete pollutant removal, have been calculated. The immobilized laccase exhibited a lower affinity for octylphenol (K{sub m} = 1.11 mM) than for Nonylphenol (K{sub m} = 0.72 mM), but all the other parameters of applicative interest resulted more significant for octylphenol. For example, the times to reach the complete removal of octylphenol compared to those for nonylphenol at the same concentration is shorter of about 15% (at low concentrations) up to 40% (at high concentrations). The study of cell proliferation with MPP89 cells, a human mesothelioma cell line, and the assay with the YES test indicated the loss of estrogenic activity of the APs solutions after laccase treatment.

  2. Laccase gene expression as a possible key adaptation for herbivorous niche expansion in the attine fungus-growing ants

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

    generalist functional herbivores. Laccases are polyphenol oxidase enzymes (PPOs) that are best known for their ability to degrade lignin in saprophytic and wood-pathogenic fungi. We found that laccase activity was primarily expressed in newly constructed garden sections where secondary leaf compounds...

  3. Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.

    Science.gov (United States)

    Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo

    2014-04-01

    It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries.

  4. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  5. Anomaly mediated supersymmetry breaking in four dimensions, naturally

    International Nuclear Information System (INIS)

    Luty, Markus A.; Sundrum, Raman

    2003-01-01

    We present a simple four-dimensional model in which anomaly mediated supersymmetry breaking naturally dominates. The central ingredient is that the hidden sector is near a strongly coupled infrared fixed point for several decades of energy below the Planck scale. Strong renormalization effects then sequester the hidden sector from the visible sector. Supersymmetry is broken dynamically and requires no small input parameters. The model provides a natural and economical explanation of the hierarchy between the supersymmetry-breaking scale and the Planck scale, while allowing anomaly mediation to address the phenomenological challenges posed by weak scale supersymmetry. In particular, flavor-changing neutral currents are naturally near their experimental limits

  6. Development of biosensors containing laccase and imidazolium bis(trifluoromethylsulfonyl)imide ionic liquid for the determination of rutin

    Energy Technology Data Exchange (ETDEWEB)

    Franzoi, Ana Cristina [Departamento de Quimica, Laboratorio de Biossensores, Universidade Federal de Santa Catarina, 88040-970 Florianopolis, SC (Brazil); Migowski, Pedro; Dupont, Jairton [Departamento de Quimica Organica, Laboratorio de Catalise Molecular, Universidade Federal do Rio Grande do Sul, 91501-970 Porto Alegre, RS (Brazil); Cruz Vieira, Iolanda, E-mail: iolanda@qmc.ufsc.br [Departamento de Quimica, Laboratorio de Biossensores, Universidade Federal de Santa Catarina, 88040-970 Florianopolis, SC (Brazil)

    2009-04-20

    Biosensors based on hydrophobic ionic liquids (ILs) derived from the bis(trifluoromethylsulfonyl)imide [(CF{sub 3}SO{sub 2}){sub 2}N{sup -} = Tf{sub 2}N{sup -}] anion associated with three different imidazolium cations: 1-butyl-3-methylimidazolium (BMI.Tf{sub 2}N), 1-decyl-3-methylimidazolium (DMI.Tf{sub 2}N) and 1-tetradecyl-3-methylimidazolium (TDMI.Tf{sub 2}N), along with laccase from Aspergillus oryzae, were constructed and optimized for determination of rutin. The laccase catalyzes the oxidation of rutin to the corresponding o-quinone, which is electrochemically reduced back to rutin. The best performance was obtained with 50:20:15:15% (w/w/w/w) as the graphite powder:laccase:Nujol:ILs composition in 0.1 mol L{sup -1} acetate buffer solution (pH 5.0). The parameters for the square-wave voltammetry experiments and scanning electron microscopy images of the biosensors were studied. Under the selected conditions, the cathodic peak current increased linearly in the rutin concentration ranges of 4.77 x 10{sup -6} to 4.62 x 10{sup -5} mol L{sup -1}, 5.84 x 10{sup -6} to 5.36 x 10{sup -5} mol L{sup -1} and 5.84 x 10{sup -6} to 5.36 x 10{sup -5} mol L{sup -1} using the (I) BMI.Tf{sub 2}N-laccase, (II) DMI.Tf{sub 2}N-laccase and (III) TDMI.Tf{sub 2}N-laccase, respectively. The rutin contents of commercial samples of pharmaceuticals were successfully determined by the biosensors and the results compared well with those obtained using the official method. The studies on rutin recovery from these samples gave values of 96.9-104.6%.

  7. Secretory expression of the non-secretory-type Lentinula edodes laccase by Aspergillus oryzae.

    Science.gov (United States)

    Yano, Akira; Kikuchi, Sayaka; Nakagawa, Yuko; Sakamoto, Yuichi; Sato, Toshitsugu

    2009-01-01

    The shiitake mushroom, Lentinula edodes, has an extracelluar secretory-type laccase, Lcc1, and a fruiting-body-accumulation-type laccase, Lcc4. We previously reported the production of Lcc1 by plant cells, but had difficulty producing Lcc4. Here, we report the production of Lcc1 and Lcc4 by Aspergillus oryzae and the extracellular secretory production of Lcc4 using a modified secretion signal peptide (SP) from Lcc1. Sp-Lcc4 produced by A. oryzae had biochemical activities similar to Lcc4 produced by L. edodes. Lcc1 did not react with beta-(3,4-dihydroxyphenol) alanine (DOPA), but Lcc4 from L. edodes and A. oryzae could oxidize DOPA. K(M) values for the substrates 2,2'-azino-di-(3-ethylbenzthiazolinsulfonate), 2,6-dimethoxyphenol, guaiacol, pyrogallol, and catechol were similar for Lcc4 and Sp-Lcc4. In conclusion, a non-secretory-type fungal laccase is secreted into the culture media with its original enzymatic properties by exploiting modified secretory signal peptide. 2008 Elsevier GmbH.

  8. Effects of Soil Oxygen Conditions and Soil pH on Remediation of DDT-contaminated Soil by Laccase from White Rot Fungi

    Directory of Open Access Journals (Sweden)

    Yuechun Zhao

    2010-04-01

    Full Text Available High residues of DDT in agricultural soils are of concern because they present serious threats to food security and human health. This article focuses on remediation of DDT-contaminated soil using laccase under different soil oxygen and soil pH conditions. The laboratory experiment results showed significant effects of soil oxygen conditions and soil pH on remediation of DDT-contaminated soil by laccase at the end of a 25-d incubation period. This study found the positive correlation between the concentration of oxygen in soil and the degradation of DDT by laccase. The residue of DDTs in soil under the atmosphere of oxygen decreased by 28.1% compared with the atmosphere of nitrogen at the end of the incubation with laccase. A similar pattern was observed in the remediation of DDT-contaminated soil by laccase under different flooding conditions, the higher the concentrations of oxygen in soil, the lower the residues of four DDT components and DDTs in soils. The residue of DDTs in the nonflooding soil declined by 16.7% compared to the flooded soil at the end of the incubation. The residues of DDTs in soils treated with laccase were lower in the pH range 2.5–4.5.

  9. Reductant-dependent electron distribution among redox sites of laccase

    DEFF Research Database (Denmark)

    Farver, O; Goldberg, M; Wherland, S

    1978-01-01

    Rhus laccase (monophenol monooxygenase, monophenol,dihydroxyphenylalanine:oxygen oxidoreductase, EC 1.14.18.1) an O2/H2O oxidoreductase containing four copper ions bound to three redox sites (type 1, type 2, and type 3 Cu pair), was titrated anaerobically with several reductants having various ch...

  10. Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger

    Directory of Open Access Journals (Sweden)

    Tamayo-Ramos Juan Antonio

    2012-12-01

    Full Text Available Abstract Background Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. Results The laccase-like multicopper oxidases McoA, McoB and McoG from the commonly used cell factory Aspergillus niger were homologously expressed, purified and analyzed for their biocatalytic potential. All three recombinant enzymes were monomers with apparent molecular masses ranging from 80 to 110 kDa. McoA and McoG resulted to be blue, whereas McoB was yellow. The newly obtained oxidases displayed strongly different activities towards aromatic compounds and synthetic dyes. McoB exhibited high catalytic efficiency with N,N-dimethyl-p-phenylenediamine (DMPPDA and 2,2-azino-di(3-ethylbenzthiazoline sulfonic acid (ABTS, and appeared to be a promising biocatalyst. Besides oxidizing a variety of phenolic compounds, McoB catalyzed successfully the decolorization and detoxification of the widely used textile dye malachite green. Conclusions The A. niger McoA, McoB, and McoG enzymes showed clearly different catalytic properties. Yellow McoB showed broad substrate specificity, catalyzing the oxidation of several phenolic compounds commonly present in different industrial effluents. It also harbored high decolorization and detoxification activity with the synthetic dye malachite green, showing to have an interesting potential as a new industrial biocatalyst.

  11. Effect of the L499M mutation of the ascomycetous Botrytis aclada laccase on redox potential and catalytic properties

    International Nuclear Information System (INIS)

    Osipov, Evgeny; Polyakov, Konstantin; Kittl, Roman; Shleev, Sergey; Dorovatovsky, Pavel; Tikhonova, Tamara; Hann, Stephan; Ludwig, Roland; Popov, Vladimir

    2014-01-01

    The structures of the ascomycetous B. aclada laccase and its L499M T1-site mutant have been solved at 1.7 Å resolution. The mutant enzyme shows a 140 mV lower redox potential of the type 1 copper and altered kinetic behaviour. The wild type and the mutant have very similar structures, which makes it possible to relate the changes in the redox potential to the L499M mutation Laccases are members of a large family of multicopper oxidases that catalyze the oxidation of a wide range of organic and inorganic substrates accompanied by the reduction of dioxygen to water. These enzymes contain four Cu atoms per molecule organized into three sites: T1, T2 and T3. In all laccases, the T1 copper ion is coordinated by two histidines and one cysteine in the equatorial plane and is covered by the side chains of hydrophobic residues in the axial positions. The redox potential of the T1 copper ion influences the enzymatic reaction and is determined by the nature of the axial ligands and the structure of the second coordination sphere. In this work, the laccase from the ascomycete Botrytis aclada was studied, which contains conserved Ile491 and nonconserved Leu499 residues in the axial positions. The three-dimensional structures of the wild-type enzyme and the L499M mutant were determined by X-ray crystallography at 1.7 Å resolution. Crystals suitable for X-ray analysis could only be grown after deglycosylation. Both structures did not contain the T2 copper ion. The catalytic properties of the enzyme were characterized and the redox potentials of both enzyme forms were determined: E 0 = 720 and 580 mV for the wild-type enzyme and the mutant, respectively. Since the structures of the wild-type and mutant forms are very similar, the change in the redox potential can be related to the L499M mutation in the T1 site of the enzyme

  12. Formation and composition of adsorbates on hydrophobic carbon surfaces from aqueous laccase-maltodextrin mixture suspension

    Energy Technology Data Exchange (ETDEWEB)

    Corrales Ureña, Yendry Regina, E-mail: yendry386@hotmail.com [UNESP São Paulo State University, Av. Eng. Luiz Edmundo Carrijo Coube, 14-01, Bauru, São Paulo (Brazil); Fraunhofer Institute for Manufacturing Technology and Advanced Materials IFAM, Wiener Strasse 12, 28359 Bremen (Germany); Lisboa-Filho, Paulo Noronha [UNESP São Paulo State University, Av. Eng. Luiz Edmundo Carrijo Coube, 14-01, Bauru, São Paulo (Brazil); Szardenings, Michael [Fraunhofer Institute for Cell Therapy and Immunology IZI, Perlickstrasse 1, 04103 Leipzig (Germany); Gätjen, Linda; Noeske, Paul-Ludwig Michael; Rischka, Klaus [Fraunhofer Institute for Manufacturing Technology and Advanced Materials IFAM, Wiener Strasse 12, 28359 Bremen (Germany)

    2016-11-01

    Highlights: • Less than 10 nm layer formed on carbon based materials composed by laccase and maltodextrin. • Improvement of the wettability of carbon based materials. • A protein-polysaccharide biofilm layer formation at solid liquid interface. • Stable layers formed under buffer and water rinsing. - Abstract: A robust procedure for the surface bio-functionalization of carbon surfaces was developed. It consists on the modification of carbon materials in contact with an aqueous suspension of the enzyme laccase from Trametes versicolor and the lyophilization agent maltodextrin, with the pH value adjusted close to the isoelectric point of the enzyme. We report in-situ investigations applying Quartz Crystal Microbalance with Dissipation (QCM-D) for carbon-coated sensor surfaces and, moreover, ex-situ measurements with static contact angle measurements, X-ray Photoelectron Spectroscopy (XPS) and Scanning Force Microscopy (SFM) for smooth Highly Oriented Pyrolytic Graphite (HOPG) substrates, for contact times between the enzyme formulation and the carbon material surface ranging from 20 s to 24 h. QCM-D studies reveals the formation of rigid layer of biomaterial, a few nanometers thin, which shows a strongly improved wettability of the substrate surface upon contact angle measurements. Following spectroscopic characterization, these layers are composed of mixtures of laccase and maltodextrin. The formation of these adsorbates is attributed to attractive interactions between laccase, the maltodextrin-based lyophilization agent and the hydrophobic carbon surfaces; a short-term contact between the aqueous laccase mixture suspension and HOPG surfaces is shown to merely result in de-wetting patterns influencing the results of contact angle measurements. The new enzyme-based surface modification of carbon-based materials is suggested to be applicable for the improvement of not only the wettability of low energy substrate surfaces with fluid formulations like coatings

  13. The novel role of fungal intracellular laccase: used to screen hybrids between Hypsizigus marmoreus and Clitocybe maxima by protoplasmic fusion.

    Science.gov (United States)

    Xu, Jianzhong; Zhang, Junlan; Zhang, Weiguo; Hu, Kaihui

    2012-08-01

    Laccase has been proved important in decolorization of Remazol Brilliant Blue R (RBBR), oxidation of 2, 2'-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, lignin degradation and fruiting-body formation. The decolorization of RBBR by laccase was firstly used to screen protoplast fusants. Fusants were obtained by protoplast fusion between the strains of Hypsizigus marmoreus and Clitocybe maxima, and two fusants (IM1 and IIIM5) were screened on PDA medium containing RBBR. These fusants were significant higher in laccase activity than H. marmoreus, nearly 413 and 395 times, respectively. Their hyphal growth rates were also remarkable higher than H. marmoreus, nearly 1.5 and 1.4 times, respectively. Sodium dodecyl sulfate polyacrylamide gel electrophoresis analysis showed these fusants contained the laccase, and the molecular mass of the laccase was consistent with the laccase of C. maxima, nearly 62 kDa. The pileus color of the IM1 and IIIM5 also showed partial recombined characteristics comparing to the parental strains, while biological efficiency ratios were prominent higher than that of H. marmoreus, up to 14.58 and 10.87 %, respectively. Randomly amplified polymorphic DNA bands of fusants not only were similar to parental bands, but presented new non-parental bands. Using the Unweighted pair-group method together with mathematic averages method to gain a dendrogram, in which the fusants showed intra-cluster variations. Significantly, H. marmoreus was the dominant parent, while C. maxima were distant from the fusants. The differences among IM1, IIIM5 and H. marmoreus, and the similarities among IM1, IIIM5 and C. maxima indicated IM1 and IIIM5 were somatic hybrids of H. marmoreus and C. maxima. Accordingly, it is feasible to use laccase to screen fusants of H. marmoreus and C. maxima.

  14. Characterization of an Alkali- and Halide-Resistant Laccase Expressed in E. coli: CotA from Bacillus clausii

    DEFF Research Database (Denmark)

    Brander, Søren; Mikkelsen, Jørn Dalgaard; Kepp, Kasper Planeta

    2014-01-01

    The limitations of fungal laccases at higher pH and salt concentrations have intensified the search for new extremophilic bacterial laccases. We report the cloning, expression, and characterization of the bacterial cotA from Bacillus clausii, a supposed alkalophilic ortholog of cotA from B. subti...

  15. Combination of Superheated Steam with Laccase Pretreatment Together with Size Reduction to Enhance Enzymatic Hydrolysis of Oil Palm Biomass

    Directory of Open Access Journals (Sweden)

    Nur Fatin Athirah Ahmad Rizal

    2018-04-01

    Full Text Available The combination of superheated steam (SHS with ligninolytic enzyme laccase pretreatment together with size reduction was conducted in order to enhance the enzymatic hydrolysis of oil palm biomass into glucose. The oil palm empty fruit bunch (OPEFB and oil palm mesocarp fiber (OPMF were pretreated with SHS and ground using a hammer mill to sizes of 2, 1, 0.5 and 0.25 mm before pretreatment using laccase to remove lignin. This study showed that reduction of size from raw to 0.25 mm plays important role in lignin degradation by laccase that removed 38.7% and 39.6% of the lignin from OPEFB and OPMF, respectively. The subsequent saccharification process of these pretreated OPEFB and OPMF generates glucose yields of 71.5% and 63.0%, which represent a 4.6 and 4.8-fold increase, respectively, as compared to untreated samples. This study showed that the combination of SHS with laccase pretreatment together with size reduction could enhance the glucose yield.

  16. Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2

    Directory of Open Access Journals (Sweden)

    Raúl Tapia-Tussell

    2015-08-01

    Full Text Available Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid, increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL was obtained in 10% (v/v vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse.

  17. Long term repeated prescribed burning increases evenness in the basidiomycete laccase gene pool in forest soils.

    Science.gov (United States)

    Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G

    2009-03-01

    Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.

  18. Role of ethanol on growth, laccase production and protease activity in Pycnoporus cinnabarinus ss3

    OpenAIRE

    Meza, Juan Carlos; Auria, Richard; Lomascolo, A.; Sigoillot, J. C.; Casalot, Laurence

    2007-01-01

    Laccase production by the strain Pycnoporus cinnabarinus ss3 was studied in a solid-state culture on sugar-cane bagasse using chemical compounds as inducers (ethanol, methanol, veratryl alcohol and ferulic acid). Laccase productions were about 5- to 8.5-fold higher than non-induced cultures. Liquid-culture experiments with "Glabeled ethanol were conducted. Ninety-eight percent of the initial amount of C-14 from ethanol was recovered as (CO2)-C-14, C-14-biomass and soluble C-14-compounds (main...

  19. Visible light-driven O2 reduction by a porphyrin-laccase system.

    Science.gov (United States)

    Lazarides, Theodore; Sazanovich, Igor V; Simaan, A Jalila; Kafentzi, Maria Chrisanthi; Delor, Milan; Mekmouche, Yasmina; Faure, Bruno; Réglier, Marius; Weinstein, Julia A; Coutsolelos, Athanassios G; Tron, Thierry

    2013-02-27

    Several recent studies have shown that the combination of photosensitizers with metalloenzymes can support a light-driven multielectron reduction of molecules such as CO(2) or HCN. Here we show that the association of the zinc tetramethylpyridinium porphyrin (ZnTMPyP(4+)) photosensitizer with the multicopper oxidase (MCO) laccase allows to link the oxidation of an organic molecule to the four electrons reduction of dioxygen into water. The enzyme is photoreduced within minutes with porphyrin/enzyme ratio as low as 1:40. With a 1:1 ratio, the dioxygen consumption rate is 1.7 μmol L(-1) s(-1). Flash photolysis experiments support the formation of the triplet excited state of ZnTMPyP(4+) which reduces the enzyme to form a radical cation of the porphyrin with a k(ET) ≈ 10(7) s(-1) M(-1). The long-lived triplet excited state of the ZnTMPyP(4+) (τ(0) = 0.72 ms) accounts for a substantial electron-transfer quantum yield, φ(ET) = 0.35. Consequently, the enzyme-dependent photo-oxidation of the electron donor occurs with a turnover of 8 min(-1) for the one-electron oxidation process, thereby supporting the suitability of such enzyme/sensitizer hybrid systems for aerobic photodriven transformations on substrates. This study is the first example of a phorphyrin-sensitized four-electron reduction of an enzyme of the MCO family, leading to photoreduction of dioxygen into water.

  20. Bio-Prospecting Laccases in the Bacterial Diversity of Activated Sludge From Pulp and Paper Industry.

    Science.gov (United States)

    Gupta, Vijaya; Capalash, Neena; Gupta, Naveen; Sharma, Prince

    2017-03-01

    Activated sludge is an artificial ecosystem known to harbor complex microbial communities. Bacterial diversity in activated sludge from pulp and paper industry was studied to bioprospect for laccase, the multicopper oxidase applicable in a large number of industries due to its ability to utilize a wide range of substrates. Bacterial diversity using 454 pyrosequencing and laccase diversity using degenerate primers specific to conserved copper binding domain of laccase like multicopper oxidase (LMCO) genes were investigated. 1231 OTUs out of 11,425 sequence reads for bacterial diversity and 11 OTUs out of 15 reads for LMCO diversity were formed. Phylum Proteobacteria (64.95 %) with genus Thauera (13.65 %) was most abundant followed by phylum Bacteriodetes (11.46 %) that included the dominant genera Paludibacter (1.93 %) and Lacibacter (1.32 %). In case of LMCOs, 40 % sequences showed affiliation with Proteobacteria and 46.6 % with unculturable bacteria, indicating considerable novelty, and 13.3 % with Bacteroidetes. LMCOs belonged to H and J families.

  1. Yeast Hosts for the Production of Recombinant Laccases: A Review

    Czech Academy of Sciences Publication Activity Database

    Antošová, Zuzana; Sychrová, Hana

    2016-01-01

    Roč. 58, č. 2 (2016), s. 93-116 ISSN 1073-6085 R&D Projects: GA TA ČR(CZ) TA01011461 Institutional support: RVO:67985823 Keywords : laccase * yeasts * heterologous expression * recombinant * expression optimization Subject RIV: EE - Microbiology, Virology Impact factor: 1.634, year: 2016

  2. Expression of a new laccase from Moniliophthora roreri at high levels in Pichia pastoris and its potential application in micropollutant degradation

    NARCIS (Netherlands)

    Bronikowski, Agathe; Hagedoorn, P.L.; Koschorreck, Katja; Urlacher, Vlada B.

    2017-01-01

    Laccases have gained significant attention due to their emerging applications including bioremediation, biomass degradation and biofuel cells. One of the prerequisites for the industrial application of laccases is their sufficient availability. However, expression levels of recombinantly

  3. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    International Nuclear Information System (INIS)

    Liu, Zhongchuan; Xie, Tian; Zhong, Qiuping; Wang, Ganggang

    2016-01-01

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature of CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases

  4. Crystal structure of CotA laccase complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) at a novel binding site

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhongchuan; Xie, Tian [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China); Zhong, Qiuping [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China); University of Chinese Academy of Sciences, Beijing 100049, People’s Republic of (China); Wang, Ganggang, E-mail: wanggg@cib.ac.cn [Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People’s Republic of (China); Key Laboratory of Environmental Microbiology of Sichuan Province, Chengdu 610041, People’s Republic of (China)

    2016-03-24

    The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) in a hole motif has been solved; this novel binding site could be a potential structure-based target for protein engineering of CotA laccase. The CotA laccase from Bacillus subtilis is an abundant component of the spore outer coat and has been characterized as a typical laccase. The crystal structure of CotA complexed with 2,2-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS) in a hole motif has been solved. The novel binding site was about 26 Å away from the T1 binding pocket. Comparison with known structures of other laccases revealed that the hole is a specific feature of CotA. The key residues Arg476 and Ser360 were directly bound to ABTS. Site-directed mutagenesis studies revealed that the residues Arg146, Arg429 and Arg476, which are located at the bottom of the novel binding site, are essential for the oxidation of ABTS and syringaldazine. Specially, a Thr480Phe variant was identified to be almost 3.5 times more specific for ABTS than for syringaldazine compared with the wild type. These results suggest this novel binding site for ABTS could be a potential target for protein engineering of CotA laccases.

  5. Biochemical Characteristics of Three Laccase Isoforms from the Basidiomycete Pleurotus nebrodensis

    Directory of Open Access Journals (Sweden)

    Xianghe Yuan

    2016-02-01

    Full Text Available The characterization of three laccase isoforms from Pleurotus nebrodensis is described. Isoenzymes Lac1, Lac2 and Lac3 were purified to homogeneity using ion exchange chromatography on DEAE-cellulose, CM-cellulose and Q-Sepharose and a gel filtration step on Superdex 75. The molecular weights of the purified laccases were estimated to be 68, 64 and 51 kDa, respectively. The isoenzymes demonstrated the same optimum pH at 3.0 but slightly different temperature optima: 50–60 °C for Lac1 and Lac3 and 60 °C for Lac2. Lac2 was always more stable than the other two isoforms and exposure to 50 °C for 120 min caused 30% loss in activity. Lac2 was relatively less stable than the other two isoforms when exposed to the pH range of 3.0–8.0 for 24 h, but inactivation only occurred initially, with around 70% residual activity being maintained during the whole process. Oxidative ability towards aromatic compounds varied substantially among the isoforms and each of them displayed preference toward some substrates. Kinetic constants (Km, Kcat were determined by using a 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid diammonium salt (ABTS assay, with Lac3 showing the best affinity and Lac2 displaying the highest catalytic efficiency. Amino acid sequences from peptides derived from digestion of isoenzymes showed great consistency with laccases in the databases.

  6. Enzyme mediated synthesis of polypyrrole in the presence of chondroitin sulfate and redox mediators of natural origin

    International Nuclear Information System (INIS)

    Grijalva-Bustamante, G.A.; Evans-Villegas, A.G.; Castillo-Castro, T. del; Castillo-Ortega, M.M.; Cruz-Silva, R.; Huerta, F.; Morallón, E.

    2016-01-01

    Polypyrrole (PPy) was synthesized by enzyme mediated oxidation of pyrrole using naturally occurring compounds as redox mediators. The catalytic mechanism is an enzymatic cascade reaction in which hydrogen peroxide is the oxidizer and soybean peroxidase, in the presence of acetosyringone, syringaldehyde or vanillin, acts as a natural catalysts. The effect of the initial reaction composition on the polymerization yield and electrical conductivity of PPy was analyzed. Morphology of the PPy particles was studied by scanning electron microscopy and transmission electron microscopy whereas the chemical structure was studied by X-ray photoelectron and Fourier transformed infrared spectroscopic techniques. The redox mediators increased the polymerization yield without a significant modification of the electronic structure of PPy. The highest conductivity of PPy was reached when chondroitin sulfate was used simultaneously as dopant and template during pyrrole polymerization. Electroactive properties of PPy obtained from natural precursors were successfully used in the amperometric quantification of uric acid concentrations. PPy increases the amperometric sensitivity of carbon nanotube screen-printed electrodes toward uric acid detection. - Highlights: • A new method of pyrrole polymerization using naturally occurring redox mediators and doping agents was studied. • The catalytic efficiency of different redox mediators toward pyrrole oxidation was evaluated. • Two different naturally occurring polymers were studied as bifunctional steric stabilizer/doping agents. • Polypyrrole improves the amperometric response of carbon nanotube screen printed electrodes toward uric acid sensing.

  7. Enzyme mediated synthesis of polypyrrole in the presence of chondroitin sulfate and redox mediators of natural origin

    Energy Technology Data Exchange (ETDEWEB)

    Grijalva-Bustamante, G.A. [Departamento de Investigación en Polímeros y Materiales, Universidad de Sonora, CP 83000 Hermosillo, Sonora (Mexico); Evans-Villegas, A.G. [Departamento de Ciencias Químico Biológicas, Universidad de Sonora, CP 83000 Hermosillo, Sonora (Mexico); Castillo-Castro, T. del, E-mail: terecat@polimeros.uson.mx [Departamento de Investigación en Polímeros y Materiales, Universidad de Sonora, CP 83000 Hermosillo, Sonora (Mexico); Castillo-Ortega, M.M. [Departamento de Investigación en Polímeros y Materiales, Universidad de Sonora, CP 83000 Hermosillo, Sonora (Mexico); Cruz-Silva, R. [Research Center for Exotic Nanocarbons, Shinshu University, 4-17-1 Wakasato, 380-8553, Nagano (Japan); Huerta, F. [Departamento Ingeniería Textil y Papelera, Universitat Politecnica de Valencia, Plaza Ferrandiz y Carbonell, 1, E-03801 Alcoy (Spain); Morallón, E. [Departamento Química Física e Instituto Universitario de Materiales, Universidad de Alicante, Ap. 99, E-03080 Alicante (Spain)

    2016-06-01

    Polypyrrole (PPy) was synthesized by enzyme mediated oxidation of pyrrole using naturally occurring compounds as redox mediators. The catalytic mechanism is an enzymatic cascade reaction in which hydrogen peroxide is the oxidizer and soybean peroxidase, in the presence of acetosyringone, syringaldehyde or vanillin, acts as a natural catalysts. The effect of the initial reaction composition on the polymerization yield and electrical conductivity of PPy was analyzed. Morphology of the PPy particles was studied by scanning electron microscopy and transmission electron microscopy whereas the chemical structure was studied by X-ray photoelectron and Fourier transformed infrared spectroscopic techniques. The redox mediators increased the polymerization yield without a significant modification of the electronic structure of PPy. The highest conductivity of PPy was reached when chondroitin sulfate was used simultaneously as dopant and template during pyrrole polymerization. Electroactive properties of PPy obtained from natural precursors were successfully used in the amperometric quantification of uric acid concentrations. PPy increases the amperometric sensitivity of carbon nanotube screen-printed electrodes toward uric acid detection. - Highlights: • A new method of pyrrole polymerization using naturally occurring redox mediators and doping agents was studied. • The catalytic efficiency of different redox mediators toward pyrrole oxidation was evaluated. • Two different naturally occurring polymers were studied as bifunctional steric stabilizer/doping agents. • Polypyrrole improves the amperometric response of carbon nanotube screen printed electrodes toward uric acid sensing.

  8. Laccase from a non-melanogenic, alkalotolerant gamma-proteobacterium JB isolated from industrial wastewater drained soil.

    Science.gov (United States)

    Bains, Jasleen; Capalash, Neena; Sharma, Prince

    2003-07-01

    A gram-negative, alkalotolerant bacterium, isolated from the soil continually drained with industrial wastewater and identified as gamma-proteobacterium by partial 16S rRNA sequence analysis, produced a polyphenol oxidase, which showed laccase but not tyrosinase activity. The organism grew well from pH 6 to 10 and produced laccase maximally at pH 10. The enzyme was stable from pH 3 to 10.6 for at least 24 h and was optimally active at 55 degrees C and pH 6.5 in a 5 min assay.

  9. Preparation of Biocolorant and Eco-Dyeing Derived from Polyphenols Based on Laccase-Catalyzed Oxidative Polymerization

    Directory of Open Access Journals (Sweden)

    Fubang Wang

    2018-02-01

    Full Text Available Natural products have been believed to be a promising source to obtain ecological dyes and pigments. Plant polyphenol is a kind of significant natural compound, and tea provides a rich source of polyphenols. In this study, biocolorant derived from phenolic compounds was generated based on laccase-catalyzed oxidative polymerization, and eco-dyeing of silk and wool fabrics with pigments derived from tea was investigated under the influence of pH variation. This work demonstrated that the dyeing property was better under acidic conditions compared to alkalinity, and fixation rate was the best when pH value was 3. Furthermore, breaking strength of dyed fabrics sharply reduced under the condition of pH 11. Eventually, the dyeing method was an eco-friendly process, which was based on bioconversion, and no mordant was added during the process of dyeing.

  10. Expression of a new laccase from Moniliophthora roreri at high levels in Pichia pastoris and its potential application in micropollutant degradation.

    Science.gov (United States)

    Bronikowski, Agathe; Hagedoorn, Peter-Leon; Koschorreck, Katja; Urlacher, Vlada B

    2017-12-01

    Laccases have gained significant attention due to their emerging applications including bioremediation, biomass degradation and biofuel cells. One of the prerequisites for the industrial application of laccases is their sufficient availability. However, expression levels of recombinantly expressed laccases are often low. In this study Mrl2, a new laccase from the basidiomycete Moniliophthora roreri, was cloned in Pichia pastoris and produced in an optimized fed-batch process at an exceptionally high yield of 1.05 g l -1 . With a redox potential of 0.58 V, Mrl2 belongs to mid-redox potential laccases. However, Mrl2 demonstrated high k cat values of 316, 20, 74, and 36 s -1 towards 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), syringaldazine (SGZ), 2,6-dimethoxyphenol (2,6-DMP) and guaiacol, respectively. Mrl2 remained stable above pH 6 and in the presence of many metal ions, which is important for application in bioremediation. Mrl2 was investigated for the ability to degrade endocrine disrupting chemicals (EDCs) and non-steroidal anti-inflammatory drugs (NSDAIs) at neutral pH value. The enzyme accepted and converted estrone, 17β-estradiol, estriol, the synthetic contraceptive 17α-ethinyl estradiol and bisphenol A at pH 7 faster than high-potential laccases from Trametes versicolor. For example, within 30 min Mrl2 removed more than 90% bisphenol A, 17ß-estradiol, 17α-ethinyl estradiol and estriol, respectively. The concentration of the recalcitrant drug diclofenac dropped by 56% after 20 h incubation with Mrl2.

  11. Autoindicating optical properties of laccase as the base of an optical biosensor film for phenol determination

    Energy Technology Data Exchange (ETDEWEB)

    Sanz, J.; Marcos, S. de; Galban, J. [University of Zaragoza, Analytical Biosensors Group (GBA), Analytical Chemistry Department, Faculty of Sciences, Zaragoza (Spain)

    2012-08-15

    In the context of sustainable analytical chemistry, phenol has been determined through its enzymatic reaction with laccase. The method has been studied and optimized through the autoindicating optical properties of laccase both by intrinsic molecular absorption and fluorescence. The method shows a linear range from 9.79.10{sup -6} to 7.50.10{sup -4} M with a relative standard deviation of 1.07 %. The molecular absorption methodology has been implemented in a polyacrylamide film for the design of an autoindicating optical sensor. In order to increase the lifetime of the sensor, the reversibility study of the enzymatic reaction has proposed, as a novelty, the regeneration of laccase with an oxidase-type enzyme (glucose oxidase). The lifetime of the sensor film has improved from 15 to 30 measurements. The reaction mechanism has also been studied and confirmed by fluorescence and molecular absorption. The method leads to the determination of phenol in environmental samples. (orig.)

  12. Induction of fungal laccase production under solid state bioprocessing of new agroindustrial waste and its application on dye decolorization.

    Science.gov (United States)

    Akpinar, Merve; Ozturk Urek, Raziye

    2017-06-01

    Lignocellulosic wastes are generally produced in huge amounts worldwide. Peach waste of these obtained from fruit juice industry was utilized as the substrate for laccase production by Pleurotus eryngii under solid state bioprocessing (SSB). Its chemical composition was determined and this bioprocess was carried out under stationary conditions at 28 °C. The effects of different compounds; copper, iron, Tween 80, ammonium nitrate and manganese, and their variable concentrations on laccase production were investigated in detail. The optimum production of laccase (43,761.33 ± 3845 U L -1 ) was achieved on the day of 20 by employing peach waste of 5.0 g and 70 µM Cu 2+ , 18 µM Fe 2+ , 0.025% (v/v) Tween 80, 4.0 g L -1 ammonium nitrate, 750 µM Mn 2+ as the inducers. The dye decolorization also researched to determine the degrading capability of laccase produced from peach culture under the above-mentioned conditions. Within this scope of the study, methyl orange, tartrazine, reactive red 2 and reactive black dyes were treated with this enzyme. The highest decolorization was performed with methyl orange as 43 ± 2.8% after 5 min of treatment when compared to other dyes. Up to now, this is the first report on the induction of laccase production by P. eryngii under SSB using peach waste as the substrate.

  13. The Type 3 copper site is intact but labile in Type 2-depleted laccase

    DEFF Research Database (Denmark)

    Frank, P; Farver, O; Pecht, I

    1983-01-01

    We report results of experiments designed to characterize the Type 1 and Type 3 copper sites in Rhus laccase depleted of Type 2 copper (T2D). Use of the Lowry method for determining protein concentration yielded the value 5620 +/- 570 M-1 cm-1 for the extinction of the 615-nm absorption band...... as intensity perturbations at 280 and 615 nm. Comparison of difference spectra show that this 330-nm band derives from a Type 3 copper-bound peroxide and not from a reoxidized Type 3 site. Dioxygen reoxidation of ascorbate-reduced T2D laccase produced new difference bands at 330 nm (delta epsilon = 770 M-1 cm...

  14. Biodegradation of brominated aromatics by cultures and laccase of Trametes versicolor

    Czech Academy of Sciences Publication Activity Database

    Uhnáková, Bronislava; Petříčková, Alena; Biedermann, David; Homolka, Ladislav; Vejvoda, Vojtěch; Bednář, P.; Papoušková, B.; Šulc, Miroslav; Martínková, Ludmila

    2009-01-01

    Roč. 76, č. 6 (2009), s. 826-832 ISSN 0045-6535 R&D Projects: GA MŠk 2B06151 Institutional research plan: CEZ:AV0Z50200510 Keywords : Brominated phenols * Tetrabromobisphenol A * Laccase Subject RIV: CE - Biochemistry Impact factor: 3.253, year: 2009

  15. Laccase-Functionalized Graphene Oxide Assemblies as Efficient Nanobiocatalysts for Oxidation Reactions

    NARCIS (Netherlands)

    Patila, Michaela; Kouloumpis, Antonios; Gournis, Dimitrios; Rudolf, Petra; Stamatis, Haralambos

    Multi-layer graphene oxide-enzyme nanoassemblies were prepared through the multi-point covalent immobilization of laccase from Trametes versicolor (TvL) on functionalized graphene oxide (fGO). The catalytic properties of the fGO-TvL nanoassemblies were found to depend on the number of the graphene

  16. Variability of Laccase Activity in the White-Rot Basidiomycete Pleurotus ostreatus

    Czech Academy of Sciences Publication Activity Database

    Baldrian, Petr; Gabriel, Jiří

    2002-01-01

    Roč. 47, č. 4 (2002), s. 385-390 ISSN 0015-5632 R&D Projects: GA ČR GP204/02/P100 Institutional research plan: CEZ:AV0Z5020903 Keywords : laccase * pleurotus ostreatus Subject RIV: EE - Microbiology, Virology Impact factor: 0.979, year: 2002

  17. Kinetic modeling of a bi-enzymatic system for efficient conversion of lactose to lactobionic acid.

    Science.gov (United States)

    Van Hecke, Wouter; Bhagwat, Aditya; Ludwig, Roland; Dewulf, Jo; Haltrich, Dietmar; Van Langenhove, Herman

    2009-04-01

    A model has been developed to describe the interaction between two enzymes and an intermediary redox mediator. In this bi-enzymatic process, the enzyme cellobiose dehydrogenase oxidizes lactose at the C-1 position of the reducing sugar moiety to lactobionolactone, which spontaneously hydrolyzes to lactobionic acid. 2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt is used as electron acceptor and is continuously regenerated by laccase. Oxygen is the terminal electron acceptor and is fully reduced to water by laccase, a copper-containing oxidase. Oxygen is added to the system by means of bubble-free oxygenation. Using the model, the productivity of the process is investigated by simultaneous solution of the rate equations for varying enzyme quantities and redox mediator concentrations, solved with the aid of a numerical solution. The isocharts developed in this work provide an easy-to-use graphical tool to determine optimal process conditions. The model allows the optimization of the employed activities of the two enzymes and the redox mediator concentration for a given overall oxygen mass transfer coefficient by using the isocharts. Model predictions are well in agreement with the experimental data.

  18. Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Claudia M Rivera-Hoyos

    Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range

  19. Elimination of Bisphenol A and Triclosan Using the Enzymatic System of Autochthonous Colombian Forest Fungi

    Science.gov (United States)

    Arboleda, Carolina; Cabana, H.; De Pril, E.; Jones, J. Peter; Jiménez, G. A.; Mejía, A. I.; Agathos, S. N.; Penninckx, M. J.

    2013-01-01

    Bisphenol A (BPA) and triclosan (TCS) are known or suspected potential endocrine disrupting chemicals (EDCs) which may pose a risk to human health and have an environmental impact. Enzyme preparations containing mainly laccases, obtained from Ganoderma stipitatum and Lentinus swartzii, two autochthonous Colombian forest white rot fungi (WRF), previously identified as high enzyme producers, were used to remove BPA and TCS from aqueous solutions. A Box-Behnken factorial design showed that pH, temperature, and duration of treatment were significant model terms for the elimination of BPA and TCS. Our results demonstrated that these EDCs were extensively removed from 5 mg L−1 solutions after a contact time of 6 hours. Ninety-four percent of TCS and 97.8% of BPA were removed with the enzyme solution from G. stipitatum; 83.2% of TCS and 88.2% of BPA were removed with the L. swartzii enzyme solution. After a 6-hour treatment with enzymes from G. stipitatum and L. swartzii, up to 90% of the estrogenic activity of BPA was lost, as shown by the yeast estrogen screen assay. 2,2-Azino-bis-(3-ethylthiazoline-6-sulfonate) (ABTS) was used as a mediator (laccase/mediator system) and significantly improved the laccase catalyzed elimination of BPA and TCS. The elimination of BPA in the absence of a mediator resulted in production of oligomers of molecular weights of 454, 680, and 906 amu as determined by mass spectra analysis. The elimination of TCS in the same conditions produced dimers, trimers, and tetramers of molecular weights of 574, 859, and 1146 amu. Ecotoxicological studies using Daphnia pulex to determine lethal concentration (LC50) showed an important reduction of the toxicity of BPA and TCS solutions after enzymatic treatments. Use of laccases emerges thus as a key alternative in the development of innovative wastewater treatment technologies. Moreover, the exploitation of local biodiversity appears as a potentially promising approach for identifying new efficient

  20. Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.

    Science.gov (United States)

    Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min

    Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.

  1. Synthesis and effect of modification on methacylate - acrylate microspheres for Trametes versicolor laccase enzyme immobilization

    Science.gov (United States)

    Mazlan, Siti Zulaikha; Hanifah, Sharina Abu

    2014-09-01

    Immobilization of laccase on the modified copolymer methacrylate-acrylate microspheres was studied. A poly (glycidyl methacrylate-co-n-butyl acrylate) microsphere consists of epoxy groups were synthesized using suspension photocuring technique. The epoxy group in poly (GMA-nBA) microspheres were converted into amino groups with aldehyde group. Laccase immobilization is based on having the amino groups on the enzyme surface and aldehyde group on the microspheres via covalent binding. Fourier transform infrared spectroscopy (FT-IR) analysis proved the successful surface modification on microspheres. The FTIR spectrum shows the characteristic peaks at 1646 cm-1 assigned to the conformation of the polymerization that took place between monomer GMA and nBA respectively. In addition, after modification, FTIR peaks that assigned to the epoxy ring (844 cm-1 and 904 cm-1) were decreased. The results obtained from FTIR method signify good agreement with the epoxy content method. Hence, the activity of the laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly (GMA-nBA) exhibited uniform microspheres with below 2 μm surface. Immobilized enzyme showed a broader pH profile and higher temperature compared native enzyme.

  2. Effects of Temperature and pH on Immobilized Laccase Activity in Conjugated Methacrylate-Acrylate Microspheres

    Directory of Open Access Journals (Sweden)

    Siti Zulaikha Mazlan

    2017-01-01

    Full Text Available Immobilization of laccase on the functionalized methacrylate-acrylate copolymer microspheres was studied. Poly(glycidyl methacrylate-co-n-butyl acrylate microspheres consisting of epoxy groups were synthesized using facile emulsion photocuring technique. The epoxy groups in poly(GMA-co-nBA microspheres were then converted to amino groups. Laccase immobilization is based on covalent binding via amino groups on the enzyme surface and aldehyde group on the microspheres. The FTIR spectra showed peak at 1646 cm−1 assigned to the conformation of the polymerization that referred to GMA and nBA monomers, respectively. After modification of the polymer, intensity of FTIR peaks assigned to the epoxy ring at 844 cm−1 and 904 cm−1 was decreased. The results obtained from FTIR exhibit a good agreement with the epoxy content method. The activity of laccase-immobilized microspheres increased upon increasing the epoxy content. Furthermore, poly(GMA-co-nBA microspheres revealed uniform size below 2 µm that contributes to large surface area of the microspheres to be used as a matrix, thus increasing the enzyme capacity and enzymatic reaction. Immobilized enzyme also shifted to higher pH and temperature compared to free enzyme.

  3. The effects of mediator and granular activated carbon addition on degradation of trace organic contaminants by an enzymatic membrane reactor.

    Science.gov (United States)

    Nguyen, Luong N; Hai, Faisal I; Price, William E; Leusch, Frederic D L; Roddick, Felicity; Ngo, Hao H; Guo, Wenshan; Magram, Saleh F; Nghiem, Long D

    2014-09-01

    The removal of four recalcitrant trace organic contaminants (TrOCs), namely carbamazepine, diclofenac, sulfamethoxazole and atrazine by laccase in an enzymatic membrane reactor (EMR) was studied. Laccases are not effective for degrading non-phenolic compounds; nevertheless, 22-55% removal of these four TrOCs was achieved by the laccase EMR. Addition of the redox-mediator syringaldehyde (SA) to the EMR resulted in a notable dose-dependent improvement (15-45%) of TrOC removal affected by inherent TrOC properties and loading rates. However, SA addition resulted in a concomitant increase in the toxicity of the treated effluent. A further 14-25% improvement in aqueous phase removal of the TrOCs was consistently observed following a one-off dosing of 3g/L granular activated carbon (GAC). Mass balance analysis reveals that this improvement was not due solely to adsorption but also enhanced biodegradation. GAC addition also reduced membrane fouling and the SA-induced toxicity of the effluent. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Enhancing Natural Killer Cell Mediated Targeting and Responses to Myeloid Leukemias

    Science.gov (United States)

    2017-10-01

    AWARD NUMBER: W81XWH-16-1-0380 TITLE: Enhancing Natural Killer Cell Mediated Targeting and Responses to Myeloid Leukemias PRINCIPAL...2017 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Enhancing Natural Killer Cell Mediated Targeting and Responses to Myeloid Leukemias 5b. GRANT NUMBER...leukemias still have poor prognosis, particularly in the elderly, and require hematopoietic cell transplants to fully kill the tumor, which is both

  5. Banana peel: a potential substrate for laccase production by Aspergillus fumigatus VkJ2.4.5 in solid-state fermentation.

    Science.gov (United States)

    Vivekanand, V; Dwivedi, Pallavi; Pareek, Nidhi; Singh, Rajesh P

    2011-09-01

    In solid-state fermentation, among various solid supports evaluated, banana peel was found to be an ideal support and resulted into higher levels of laccase (6281.4 ± 63.60 U l(-1)) along with notable levels of manganese peroxidase production (1339.0 ± 131.23 U l(-1)) by Aspergillus fumigatus VkJ2.4.5. Maximum levels of laccase was achieved under derived conditions consisting of 80% of moisture level, 6 days of incubation period, 6% inoculum level, and an aeration level of 2.5 l min(-1). A column-tray bioreactor was designed to scale up and economize the enzyme production in three successive cycles of fermentation using the same fungal biomass. Thermal and pH stability profiles revealed that enzyme was stable up to 50°C and at varying pH range from 5-9 for up to 2 h. The apparent molecular weight of laccase was found to be 34 ± 1 kDa. MALDI-TOF/TOF analysis of the protein showed significant homology with maximum identity of 67% to other laccases reported in database.

  6. Laccase activity in soils: Considerations for the measurement of enzyme activity

    Czech Academy of Sciences Publication Activity Database

    Eichlerová, Ivana; Šnajdr, Jaroslav; Baldrian, Petr

    2012-01-01

    Roč. 88, č. 10 (2012), s. 1154-1160 ISSN 0045-6535 R&D Projects: GA MŠk(CZ) OC10064; GA MŠk(CZ) ME10152; GA MZe QH72216 Institutional support: RVO:61388971 Keywords : Laccase * Soil * Michaelis constant Subject RIV: EE - Microbiology, Virology Impact factor: 3.137, year: 2012

  7. Influence of Laccase and Tyrosinase on the Antioxidant Capacity of Selected Phenolic Compounds on Human Cell Lines

    Directory of Open Access Journals (Sweden)

    Matthias Riebel

    2015-09-01

    Full Text Available Polyphenolic compounds affect the color, odor and taste of numerous food products of plant origin. In addition to the visual and gustatory properties, they serve as radical scavengers and have antioxidant effects. Polyphenols, especially resveratrol in red wine, have gained increasing scientific and public interest due to their presumptive beneficial impact on human health. Enzymatic oxidation of phenolic compounds takes place under the influence of polyphenol oxidases (PPO, including tyrosinase and laccase. Several studies have demonstrated the radical scavenger effect of plants, food products and individual polyphenols in vitro, but, apart from resveratrol, such impact has not been proved in physiological test systems. Furthermore, only a few data exist on the antioxidant capacities of the enzymatic oxidation products of phenolic compounds generated by PPO. We report here first results about the antioxidant effects of phenolic substances, before and after oxidation by fungal model tyrosinase and laccase. In general, the common chemical 2,2-diphenyl-1-picrylhydrazyl assay and the biological tests using two different types of cell cultures (monocytes and endothelial cells delivered similar results. The phenols tested showed significant differences with respect to their antioxidant activity in all test systems. Their antioxidant capacities after enzymatic conversion decreased or increased depending on the individual PPO used.

  8. Immobilization of laccase by encapsulation in a sol-gel matrix and its characterization and use for the removal of estrogens.

    Science.gov (United States)

    Lloret, L; Eibes, G; Feijoo, G; Moreira, M T; Lema, J M; Hollmann, F

    2011-01-01

    Laccase from Myceliophthora thermophila was immobilized by encapsulation in a sol-gel matrix based on methyltrimethoxysilane and tetramethoxysilane. The amount of laccase used for the preparation of the hydrogel was in the range 2.2-22 mg of protein/mL sol and the corresponding enzymatic activities were in the range 5.5-17.0 U/g biocatalyst. The kinetic parameters of the encapsulated laccase showed that the immobilized enzyme presented lower affinity for the substrate 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate) (ABTS). However, the stability of laccase was significantly enhanced after immobilization; thus, both pH and thermal stability improved about 10-30% and tolerance to different inactivating agents (NaN(3) , ZnCl(2) , CoCl(2) , CaCl(2) , methanol, and acetone) was 20-40% higher. The reusability of the immobilized laccase was demonstrated in the oxidation of ABTS for several consecutive cycles, preserving 80% of the initial laccase activity after 10 cycles. The feasibility of the immobilized biocatalyst was tested for the continuous elimination of Acid Green 27 dye as a model compound in a packed-bed reactor (PBR). Removals of 70, 58, 57, and 55% were achieved after four consecutive cycles with limited adsorption on the support: only 10-15%. Finally, both batch stirred tank reactor (BSTR) operated in several cycles and PBR, containing the solid biocatalyst were applied for the treatment of a solution containing the endocrine disrupting chemicals (EDCs): estrone (E1), 17β-estradiol (E2), and 17α-ethinylestradiol (EE2). Eliminations of EDCs in the BSTR were higher than 85% and the reusability of the biocatalyst for the degradation of those estrogens was demonstrated. In the continuous operation of the PBR, E1 was degraded by 55% and E2 and EE2 were removed up to 75 and 60%, at steady-state conditions. In addition, a 63% decrease in estrogenic activity was detected. Copyright © 2011 American Institute of Chemical Engineers (AIChE).

  9. Laccase applications in biofuels production: current status and future prospects.

    Science.gov (United States)

    Kudanga, Tukayi; Le Roes-Hill, Marilize

    2014-08-01

    The desire to reduce dependence on the ever diminishing fossil fuel reserves coupled with the impetus towards green energy has seen increased research in biofuels as alternative sources of energy. Lignocellulose materials are one of the most promising feedstocks for advanced biofuels production. However, their utilisation is dependent on the efficient hydrolysis of polysaccharides, which in part is dependent on cost-effective and benign pretreatment of biomass to remove or modify lignin and release or expose sugars to hydrolytic enzymes. Laccase is one of the enzymes that are being investigated not only for potential use as pretreatment agents in biofuel production, mainly as a delignifying enzyme, but also as a biotechnological tool for removal of inhibitors (mainly phenolic) of subsequent enzymatic processes. The current review discusses the major advances in the application of laccase as a potential pretreatment strategy, the underlying principles as well as directions for future research in the search for better enzyme-based technologies for biofuel production. Future perspectives could include synergy between enzymes that may be required for optimal results and the adoption of the biorefinery concept in line with the move towards the global implementation of the bioeconomy strategy.

  10. Laccase-Catalyzed Dimerization of Piceid, a Resveratrol Glucoside, and its Further Enzymatic Elaboration

    Czech Academy of Sciences Publication Activity Database

    Gavezzotti, P.; Bertacchi, F.; Fronza, G.; Křen, Vladimír; Monti, D.; Riva, S.

    2015-01-01

    Roč. 357, č. 8 (2015), s. 1831-1839 ISSN 1615-4150 R&D Projects: GA MŠk(CZ) LD13041 Institutional support: RVO:61388971 Keywords : glycosidase * laccase * piceid Subject RIV: CC - Organic Chemistry Impact factor: 6.453, year: 2015

  11. Systematic gene deletions evidences that laccases are involved in several stages of wood degradation in the filamentous fungus Podospora anserina.

    Science.gov (United States)

    Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël

    2014-01-01

    Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. Enhanced performance of immobilized laccase in electrospun fibrous membranes by carbon nanotubes modification and its application for bisphenol A removal from water

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Yunrong, E-mail: daiyr@cugb.edu.cn [School of Water Resources and Environment, School of Scientific Research, China University of Geosciences (Beijing), 100083, Beijing (China); Department of Urban Water Environmental Research, Chinese Research Academy of Environmental Sciences, 100012, Beijing (China); Yao, Jun, E-mail: yaojun@cugb.edu.cn [School of Water Resources and Environment, School of Scientific Research, China University of Geosciences (Beijing), 100083, Beijing (China); Song, Yonghui, E-mail: songyhcraes@gmail.com [Department of Urban Water Environmental Research, Chinese Research Academy of Environmental Sciences, 100012, Beijing (China); Liu, Xiaoling, E-mail: liuxl@craes.org.cn [Department of Urban Water Environmental Research, Chinese Research Academy of Environmental Sciences, 100012, Beijing (China); Wang, Siyu, E-mail: wangsy@craes.org.cn [Department of Urban Water Environmental Research, Chinese Research Academy of Environmental Sciences, 100012, Beijing (China); Yuan, Yu, E-mail: yhzmlyy90311@126.com [Department of Urban Water Environmental Research, Chinese Research Academy of Environmental Sciences, 100012, Beijing (China)

    2016-11-05

    Highlights: • Both MWCNTs and laccase could be successfully encapsulated into electrospun fibers. • MWCNTs-LCEFMs showed higher activity recovery and better stability than LCEFMs. • Specific surface area and tensile strength of MWCNTs-LCEFMs were also improved. • Addition of MWCNTs enhanced adsorption and removal efficiency of LCEFMs for BPA. • MWCNTs-LCEFMs exhibited better endurance to the change of pH and temperature. - Abstract: Multi-walled carbon nanotubes (MWCNTs) were used as modified materials to improve the performance of laccase-carrying electrospun fibrous membranes (LCEFMs). The MWCNTs modified LCEFMs (MWCNTs-LCEFMs) were successfully fabricated via emulsion electrospinning, with active laccase and MWCNTs encapsulated inside the fibers. After modified by an optimal amount (1.5 wt%, vs. polymer) of MWCNTs, the obtained MWCNTs-LCEFMs showed not only higher activity recovery (85.3%, vs. free laccase) than LCEFMs (71.2%), but also better storage and operational stability, which were mainly attributed to the promoted electron transfer in laccase-catalytic reaction. Furthermore, the specific surface area and tensile strength of MWCNTs-LCEFMs have also been enhanced nearly 2 and 3 times than those of LCEFMs, respectively. The MWCNTs-LCEFMs were applied to remove the widespread bisphenol A from water, where their removal efficiency reached above 90%, with the degradation efficiency accounting for over 80%, and their adsorption efficiency increased about 45% than that of LCEFMs. In addition, the endurances of MWCNTs-LCEFMs to environmental factors such as pH and temperature were also improved.

  13. Enhanced performance of immobilized laccase in electrospun fibrous membranes by carbon nanotubes modification and its application for bisphenol A removal from water

    International Nuclear Information System (INIS)

    Dai, Yunrong; Yao, Jun; Song, Yonghui; Liu, Xiaoling; Wang, Siyu; Yuan, Yu

    2016-01-01

    Highlights: • Both MWCNTs and laccase could be successfully encapsulated into electrospun fibers. • MWCNTs-LCEFMs showed higher activity recovery and better stability than LCEFMs. • Specific surface area and tensile strength of MWCNTs-LCEFMs were also improved. • Addition of MWCNTs enhanced adsorption and removal efficiency of LCEFMs for BPA. • MWCNTs-LCEFMs exhibited better endurance to the change of pH and temperature. - Abstract: Multi-walled carbon nanotubes (MWCNTs) were used as modified materials to improve the performance of laccase-carrying electrospun fibrous membranes (LCEFMs). The MWCNTs modified LCEFMs (MWCNTs-LCEFMs) were successfully fabricated via emulsion electrospinning, with active laccase and MWCNTs encapsulated inside the fibers. After modified by an optimal amount (1.5 wt%, vs. polymer) of MWCNTs, the obtained MWCNTs-LCEFMs showed not only higher activity recovery (85.3%, vs. free laccase) than LCEFMs (71.2%), but also better storage and operational stability, which were mainly attributed to the promoted electron transfer in laccase-catalytic reaction. Furthermore, the specific surface area and tensile strength of MWCNTs-LCEFMs have also been enhanced nearly 2 and 3 times than those of LCEFMs, respectively. The MWCNTs-LCEFMs were applied to remove the widespread bisphenol A from water, where their removal efficiency reached above 90%, with the degradation efficiency accounting for over 80%, and their adsorption efficiency increased about 45% than that of LCEFMs. In addition, the endurances of MWCNTs-LCEFMs to environmental factors such as pH and temperature were also improved.

  14. Naturalness from Runaways in Direct Mediation

    Energy Technology Data Exchange (ETDEWEB)

    Schafer-Nameki, Sakura; /UC, Santa Barbara /King' s Coll. London; Tamarit, Carlos; /UC, Santa Barbara; Torroba, Gonzalo; /SLAC

    2011-02-07

    Postulating that the NMSSM singlet is a meson of a microscopic confining theory opens up new model-building possibilities. Based on this, we construct calculable models of direct mediation that solve the {mu}/B{mu} problem and simultaneously lead to realistic phenomenology. The singlet that couples to the Higgs fields develops a runaway produced by soft interactions, then stabilized by a small superpotential perturbation. The mechanism is first realized in an O'Raifeartaigh model of direct gauge mediation with metastable supersymmetry breaking. Focusing then on the microscopic theory, we argue that super QCD with massless and massive flavors in the free magnetic phase gives rise to this dynamics in the infrared. A deformation of the SQCD superpotential leads to large spontaneous R-symmetry breaking, gaugino masses naturally at the scale of the Higgs mass parameters, and absence of CP violating phases.

  15. Performance and efficiency of old newspaper deinking by combining cellulase/hemicellulase with laccase-violuric acid system

    International Nuclear Information System (INIS)

    Xu Qinghua; Fu Yingjuan; Gao Yang; Qin Menghua

    2009-01-01

    Performance and efficiency of old newspaper (ONP) deinking by combining cellulase/hemicellulase with laccase-violuric acid system (LVS) were investigated in this study. Brightness, effective residual ink concentration (ERIC) and physical properties were evaluated for the deinked pulp. Fiber length, coarseness, specific surface area and specific volume were also tested. The changes of dissolved lignin during the deinking processes were measured with UV spectroscopy. The fiber morphology was observed with environmental scanning electronic microscopy (ESEM). Experimental results showed that, compared to the pulp deinked with each individual enzyme, ERIC was lower for the cellulase/hemicellulase-LVS-deinked pulp. This indicated that a synergy existed in ONP deinking using a combination of enzymes. After being bleached by H 2 O 2 , enzyme-combining deinked pulp gave higher brightness and better strength properties. Compared with individual enzyme deinked pulp, average fiber length and coarseness decreased a little for the enzyme-combining deinked pulps. A higher specific surface area and specific volume of the pulp fibers were achieved. UV analysis proved that more lignin was released during the enzyme-combining deinking process. ESEM images showed that more fibrillation was observed on the fiber surface due to synergistic treatment

  16. Halide Binding and Inhibition of Laccase Copper Clusters: The Role of Reorganization Energy

    DEFF Research Database (Denmark)

    Kepp, Kasper Planeta

    2015-01-01

    Laccase-like proteins are multicopper oxidases involved in several biological and industrial processes. Their application is commonly limited due to inhibition by fluoride and chloride, and as-isolated proteins are often substantially activated by heat, suggesting that multiple redox states can c...

  17. Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

    Science.gov (United States)

    Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

    2011-10-01

    Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Voltammetry and single-molecule in situ scanning tunneling microscopy of laccases and bilirubin oxidase in electrocatalytic dioxygen reduction on Au(111) single-crystal electrodes

    DEFF Research Database (Denmark)

    Climent, Victor; Zhang, Jingdong; Friis, Esben Peter

    2012-01-01

    Laccases (E.C. 1.10.3.2) are multicopper oxidases catalytically active in the oxidation of diphenolics and related compounds by molecular dioxygen. The laccases contain a single-copper type I center and a trinuclear cluster of a single-copper type II and a dinuclear type III center. The oxidation...

  19. Laccase-catalyzed modification of PES membranes with 4-hydroxybenzoic acid and gallic acid

    NARCIS (Netherlands)

    Nady, N.; Schroën, C.G.P.H.; Franssen, M.C.R.; Mohy Eldin, M.S.; Zuilhof, H.; Boom, R.M.

    2012-01-01

    We here report on the performance of poly(ethersulfone) membranes modified with 4-hydroxybenzoic acid and gallic acid as substrates, and using laccase as biocatalyst under several modification conditions. The average flux of the base membrane was never reduced more than 20% (mostly below 10%

  20. Amperometric catechol biosensor based on laccase immobilized on nitrogen-doped ordered mesoporous carbon (N-OMC)/PVA matrix

    International Nuclear Information System (INIS)

    Guo, Meiqing; Wang, Hefeng; Huang, Di; Han, Zhijun; Wang, Xiaojun; Li, Qiang; Chen, Jing

    2014-01-01

    A functionalized nitrogen-containing ordered mesoporous carbon (N-OMC), which shows good electrical properties, was synthesized by the carbonization of polyaniline inside a SBA-15 mesoporous silica template. Based on this, through entrapping laccase onto the N-OMC/polyvinyl alcohol (PVA) film a facilely fabricated amperometric biosensor was developed. Laccase from Trametes versicolor was assembled on a composite film of a N-OMC/PVA modified Au electrode and the electrochemical behavior was investigated. The results indicated that the N-OMC modified electrode exhibits electrical properties towards catechol. The optimum experimental conditions of a biosensor for the detection of catechol were studied in detail. Under the optimal conditions, the sensitivity of the biosensor was 0.29 A*M −1 with a detection limit of 0.31 μM and a linear detection range from 0.39 μM to 8.98 μM for catechol. The calibration curve followed the Michaelis–Menten kinetics and the apparent Michaelis–Menten (K M app ) was 6.28 μM. This work demonstrated that the N-OMC/PVA composite provides a suitable support for laccase immobilization and the construction of a biosensor. (papers)

  1. Screening of Lignocellulose-Degrading Superior Mushroom Strains and Determination of Their CMCase and Laccase Activity

    Directory of Open Access Journals (Sweden)

    Li Fen

    2014-01-01

    Full Text Available In order to screen lignocellulose-degrading superior mushroom strains ten strains of mushrooms (Lentinus edodes939, Pholiota nameko, Lentinus edodes868, Coprinus comatus, Macrolepiota procera, Auricularia auricula, Hericium erinaceus, Grifola frondosa, Pleurotus nebrodensis, and Shiraia bambusicola were inoculated onto carboxymethylcellulose agar-Congo red plates to evaluate their ability to produce carbomethyl cellulase (CMCase. The results showed that the ratio of transparent circle to mycelium circle of Hericium erinaceus was 8.16 (P<0.01 higher than other strains. The filter paper culture screening test showed that Hericium erinaceus and Macrolepiota procera grew well and showed extreme decomposition of the filter paper. When cultivated in guaiacol culture medium to detect their abilities to secrete laccase, Hericium erinaceus showed the highest ability with the largest reddish brown circles of 4.330 cm. CMCase activity determination indicated that Coprinus comatus and Hericium erinaceus had the ability to produce CMCase with 33.92 U/L on the 9th day and 22.58 U/L on the 10th day, respectively, while Coprinus comatus and Pleurotus nebrodensis had the ability to produce laccase with 496.67 U/L and 489.17 U/L on the 16th day and 18th day. Based on the results, Coprinus comatus might be the most promising lignocellulose-degrading strain to produce both CMCase and laccase at high levels.

  2. Induction of Laccase, Lignin Peroxidase and Manganese Peroxidase Activities in White-Rot Fungi Using Copper Complexes

    Directory of Open Access Journals (Sweden)

    Martina Vrsanska

    2016-11-01

    Full Text Available Ligninolytic enzymes, such as laccase, lignin peroxidase and manganese peroxidase, are biotechnologically-important enzymes. The ability of five white-rot fungal strains Daedaleopsis confragosa, Fomes fomentarius, Trametes gibbosa, Trametes suaveolens and Trametes versicolor to produce these enzymes has been studied. Three different copper(II complexes have been prepared ((Him[Cu(im4(H2O2](btc·3H2O, where im = imidazole, H3btc = 1,3,5-benzenetricarboxylic acid, [Cu3(pmdien3(btc](ClO43·6H2O and [Cu3(mdpta3(btc](ClO43·4H2O, where pmdien = N,N,N′,N′′,N′′-pentamethyl-diethylenetriamine and mdpta = N,N-bis-(3-aminopropylmethyl- amine, and their potential application for laccase and peroxidases induction have been tested. The enzyme-inducing activities of the complexes were compared with that of copper sulfate, and it has been found that all of the complexes are suitable for the induction of laccase and peroxidase activities in white-rot fungi; however, the newly-synthesized complex M1 showed the greatest potential for the induction. With respect to the different copper inducers, this parameter seems to be important for enzyme activity, which depends also on the fungal strains.

  3. Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

    Science.gov (United States)

    Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

    2017-06-01

    Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

  4. Electrochemical estimation of the polyphenol index in wines using a laccase biosensor.

    Science.gov (United States)

    Gamella, M; Campuzano, S; Reviejo, A J; Pingarrón, J M

    2006-10-18

    The use of a laccase biosensor, under both batch and flow injection (FI) conditions, for a rapid and reliable amperometric estimation of the total content of polyphenolic compounds in wines is reported. The enzyme was immobilized by cross-linking with glutaraldehyde onto a glassy carbon electrode. Caffeic acid and gallic acid were selected as standard compounds to carry out such estimation. Experimental variables such as the enzyme loading, the applied potential, and the pH value were optimized, and different aspects regarding the operational stability of the laccase biosensor were evaluated. Using batch amperometry at -200 mV, the detection limits obtained were 2.6 x 10(-3) and 7.2 x 10(-4) mg L(-1) gallic acid and caffeic acid, respectively, which compares advantageously with previous biosensor designs. An extremely simple sample treatment consisting only of an appropriate dilution of wine sample with the supporting electrolyte solution (0.1 mol L(-1) citrate buffer of pH 5.0) was needed for the amperometric analysis of red, rosé, and white wines. Good correlations were found when the polyphenol indices obtained with the biosensor (in both the batch and FI modes) for different wine samples were plotted versus the results achieved with the classic Folin-Ciocalteu method. Application of the calibration transfer chemometric model (multiplicative fitting) allowed that the confidence intervals (for a significance level of 0.05) for the slope and intercept values of the amperometric index versus Folin-Ciocalteu index plots (r = 0.997) included the unit and zero values, respectively. This indicates that the laccase biosensor can be successfully used for the estimation of the polyphenol index in wines when compared with the Folin-Ciocalteu reference method.

  5. Extracellular laccase production and phenolic degradation by an olive mill wastewater isolate

    Directory of Open Access Journals (Sweden)

    R. Kumar

    2018-03-01

    Full Text Available Olive mill wastewater (OMWW presents a challenge to the control of effluents due to the presence of a high organic load, antimicrobial agents (monomeric-polymeric phenols, volatile acids, polyalcohols, and tannins, salinity and acidity. In this study, the production of extracellular laccase, monomeric or polymeric phenol, from an OMWW isolate based on its ability to biodegrade phenols and gallic acid as a model of phenolic compounds in OMWW was investigated. Phylogenetic analysis of the 16S RNA gene sequences identified the bacterial isolate (Acinetobacter REY as being closest to Acinetobacter pittii. This isolate exhibited a constitutive production of extracellular laccase with an activity of 1.5 and 1.3 U ml/L when supplemented with the inducers CuSO4 and CuSO4+phenols, respectively. Batch experiments containing minimal media supplemented with phenols or gallic acid as the sole carbon and energy source were performed in order to characterize their phenolic biodegradability. Acinetobacter REY was capable of biodegrading up to 200 mg/L of phenols and gallic acid both after 10 h and 72 h, respectively.

  6. Natural cocoa as diet-mediated antimalarial prophylaxis.

    Science.gov (United States)

    Addai, F K

    2010-05-01

    The Maya of Central America are credited with the first consumption of cocoa and maintaining its ancient Olmec name kakawa translated in English as "God Food", in recognition of its multiple health benefits. The legend of cocoa is receiving renewed attention in recent years, on account of epidemiological and scientific studies that support its cardiovascular health benefits. Increasing numbers of scientific reports corroborating cocoa's antiquated reputation as health food persuaded this author to promote regular consumption of cocoa in Ghana since 2004. Cocoa is readily available in Ghana; the country is the second largest producer accounting for 14% of the world's output. Numerous anecdotal reports of reduced episodic malaria in people who daily drink natural unsweetened cocoa beverage prompted a search for scientific mechanisms that possibly account for cocoa's antimalarial effects. This paper presents the outcome as a hypothesis. Internet search for literature on effects of cocoa's ingredients on malaria parasites and illness using a variety of search tools. Evidential literature suggests five mechanisms that possibly underpin cocoa's anecdotal antimalarial effects. (i) Increased availability of antioxidants in plasma, (ii) membrane effects in general and erythrocyte membrane in particular, (iii) increased plasma levels of nitric oxide, (iv) antimalarial activity of cocoa flavanoids and their derivatives, and (v) boosted immune system mediated by components of cocoa including cocoa butter, polyphenols, magnesium, and zinc. A hypothesis is formulated that cocoa offers a diet-mediated antimalarial prophylaxis; and an additional novel tool in the fight against the legendary scourge.

  7. Role of Laccase and Low Molecular Weight Metabolites from Trametes versicolor in Dye Decolorization

    Directory of Open Access Journals (Sweden)

    Diego Moldes

    2012-01-01

    Full Text Available The studies regarding decolorization of dyes by laccase may not only inform about the possible application of this enzyme for environmental purposes, but also may provide important information about its reaction mechanism and the influence of several factors that could be involved. In this paper, decolorization of crystal violet and phenol red was carried out with different fractions of extracellular liquids from Trametes versicolor cultures, in order to describe the role of laccase in this reaction. Moreover, the possible role of the low molecular weight metabolites (LMWMs also produced by the fungus was evaluated. The results confirm the existence of a nonenzymatic decolorization factor, since the nonprotein fraction of the extracellular liquids from cultures of T. versicolor has shown decolorization capability. Several experiments were performed in order to identify the main compounds related to this ability, which are probably low molecular weight peroxide compounds.

  8. Transporter-mediated natural product–drug interactions for the treatment of cardiovascular diseases

    Directory of Open Access Journals (Sweden)

    Weibin Zha

    2018-04-01

    Full Text Available The growing use of natural products in cardiovascular (CV patients has been greatly raising the concerns about potential natural product–CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product–CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product–drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins have been identified to be substrates and inhibitors of the solute carrier (SLC transporters and the ATP-binding cassette (ABC transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product–CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product–CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product–CV drug interactions and help public and physicians understand these type of interactions. Keywords: Cardiovascular drugs, Natural products, Drug transporters, Natural product–drug interaction, Pharmacokinetics

  9. Distribution, diversity and abundance of bacterial laccase-like genes in different particle size fractions of sediments in a subtropical mangrove ecosystem.

    Science.gov (United States)

    Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong

    2015-10-01

    This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.

  10. Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

    Science.gov (United States)

    Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

    2014-01-01

    Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

  11. Fabrication of an Amperometric Flow-Injection Microfluidic Biosensor Based on Laccase for In Situ Determination of Phenolic Compounds

    Directory of Open Access Journals (Sweden)

    Juan C. Gonzalez-Rivera

    2015-01-01

    Full Text Available We aim to develop an in situ microfluidic biosensor based on laccase from Trametes pubescens with flow-injection and amperometry as the transducer method. The enzyme was directly immobilized by potential step chronoamperometry, and the immobilization was studied using cyclic voltammetry and electrochemical impedance spectroscopy. The electrode response by amperometry was probed using ABTS and syringaldazine. A shift of interfacial electron transfer resistance and the electron transfer rate constant from 18.1 kΩ to 3.9 MΩ and 4.6 × 10−2 cm s−1 to 2.1 × 10−4 cm s−1, respectively, evidenced that laccase was immobilized on the electrode by the proposed method. We established the optimum operating conditions of temperature (55°C, pH (4.5, injection flow rate (200 µL min−1, and applied potential (0.4 V. Finally, the microfluidic biosensor showed better lower limit of detection (0.149 µM and sensitivity (0.2341 nA µM−1 for ABTS than previous laccase-based biosensors and the in situ operation capacity.

  12. A laccase-glucose oxidase biofuel cell prototype operating in a physiological buffer

    International Nuclear Information System (INIS)

    Barriere, Frederic; Kavanagh, Paul; Leech, Donal

    2006-01-01

    Here we report on the design and study of a biofuel cell consisting of a glucose oxidase-based anode (Aspergillus niger) and a laccase-based cathode (Trametes versicolor) using osmium-based redox polymers as mediators of the biocatalysts' electron transfer at graphite electrode surfaces. The graphite electrodes of the device are modified with the deposition and immobilization of the appropriate enzyme and the osmium redox polymer mediator. A redox polymer [Os(4,4'-diamino-2,2'bipyridine) 2 (poly{N-vinylimidazole})-(poly{ N-vinylimidazole}) 9 Cl]Cl (E ' = -0.110 V versus Ag/AgCl) of moderately low redox potential is used for the glucose oxidizing anode and a redox polymer [Os(phenanthroline) 2 (poly{N-vinylimidazole}) 2 -(poly{N-vinylimidazole}) 8 ]Cl 2 (E ' = 0.49 V versus Ag/AgCl) of moderately high redox potential is used at the dioxygen reducing cathode. The enzyme and redox polymer are cross-linked with polyoxyethylene bis(glycidyl ether). The working biofuel cell was studied under air at 37 deg. C in a 0.1 M phosphate buffer solution of pH range 4.4-7.4, containing 0.1 M sodium chloride and 10 mM glucose. Under physiological conditions (pH 7.4) maximum power density, evaluated from the geometric area of the electrode, reached 16 μW/cm 2 at a cell voltage of 0.25 V. At lower pH values maximum power density was 40 μW/cm 2 at 0.4 V (pH 5.5) and 10 μW/cm 2 at 0.3 V (pH 4.4)

  13. Natural Environments and Childhood Experiences Promoting Physical Activity, Examining the Mediational Effects of Feelings about Nature and Social Networks.

    Science.gov (United States)

    Calogiuri, Giovanna

    2016-04-21

    The importance of natural environments (NEs) for physical activity (PA) has been studied extensively. However, there is scant evidence to explain the motivational processes underlying the NE-PA relation. The aim of this study was to investigate the NE-PA relation using an ecological framework, focusing on perception of NEs, childhood experiences and possible intra- and inter-individual mediators. Data were retrieved from a cross-sectional survey among 2168 adults from all over Norway. In addition, the coverage of NEs by municipalities was retrieved from national registers. Logistic regression showed that, unlike the self-reported proximity to NEs, higher ratings of perceived supportiveness of NEs for PA predicted participation in NE-based PA for at least 60 min/week or 150 min/week, before and after controlling for socio-demographic characteristics. Reporting frequent experiences in nature during childhood was also an important predictor of higher levels of NE-based PA. Furthermore, a mediational analysis showed that the effect of both predictors was mediated by "feelings about nature" and "social networks". These findings indicate that to encourage the use of local NE for PA, not only should environmental perceptions be taken into account, positive feelings towards nature alongside opportunities to share activity in nature with others should also be promoted.

  14. Transporter-mediated natural product-drug interactions for the treatment of cardiovascular diseases.

    Science.gov (United States)

    Zha, Weibin

    2018-04-01

    The growing use of natural products in cardiovascular (CV) patients has been greatly raising the concerns about potential natural product-CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product-CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product-drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins) have been identified to be substrates and inhibitors of the solute carrier (SLC) transporters and the ATP-binding cassette (ABC) transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients) are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product-CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product-CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product-CV drug interactions and help public and physicians understand these type of interactions. Copyright © 2017. Published by Elsevier B.V.

  15. Laccase enzyme detoxifies hydrolysates and improves biogas production from hemp straw and miscanthus.

    Science.gov (United States)

    Schroyen, Michel; Van Hulle, Stijn W H; Holemans, Sander; Vervaeren, Han; Raes, Katleen

    2017-11-01

    The impact of various phenolic compounds, vanillic acid, ferulic acid, p-coumaric acid and 4-hydroxybenzoic acid on anaerobic digestion of lignocellulosic biomass (hemp straw and miscanthus) was studied. Such phenolic compounds have been known to inhibit biogas production during anaerobic digestion. The different phenolic compounds were added in various concentrations: 0, 100, 500, 1000 and 2000mg/L. A difference in inhibition of biomethane production between the phenolic compounds was noted. Hydrolysis rate, during anaerobic digestion of miscanthus was inhibited up to 50% by vanillic acid, while vanillic acid had no influence on the initial rate of biogas production during the anaerobic digestion of hemp straw. Miscanthus has a higher lignin concentration (12-30g/100gDM) making it less accessible for degradation, and in combination with phenolic compounds released after harsh pretreatments, it can cause severe inhibition levels during the anaerobic digestion, lowering biogas production. To counter the inhibition, lignin degrading enzymes can be used to remove or degrade the inhibitory phenolic compounds. The interaction of laccase and versatile peroxidase individually with the different phenolic compounds was studied to have insight in the polymerization of inhibitory compounds or breakdown of lignocellulose. Hemp straw and miscanthus were incubated with 0, 100 and 500mg/L of the different phenolic compounds for 0, 6 and 24h and pretreated with the lignin degrading enzymes. A laccase pretreatment successfully detoxified the substrate, while versatile peroxidase however was inhibited by 100mg/L of each of the individual phenolic compounds. Finally a combination of enzymatic detoxification and subsequent biogas production showed that a decrease in phenolic compounds by laccase treatment can considerably lower the inhibition levels of the biogas production. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Enzymatic grafting of simple phenols on flax and sisal pulp fibres using laccases.

    Science.gov (United States)

    Aracri, Elisabetta; Fillat, Amanda; Colom, José F; Gutiérrez, Ana; Del Río, José C; Martínez, Angel T; Vidal, Teresa

    2010-11-01

    Flax and sisal pulps were treated with two laccases (from Pycnoporus cinnabarinus, PcL and Trametes villosa, TvL, respectively), in the presence of different phenolic compounds (syringaldehyde, acetosyringone and p-coumaric acid in the case of flax pulp, and coniferaldehyde, sinapaldehyde, ferulic acid and sinapic acid in the case of sisal pulp). In most cases the enzymatic treatments resulted in increased kappa number of pulps suggesting the incorporation of the phenols into fibres. The covalent binding of these compounds to fibres was evidenced by the analysis of the treated pulps, after acetone extraction, by pyrolysis coupled with gas chromatography/mass spectrometry in the absence and/or in the presence of tetramethylammonium hydroxide (TMAH) as methylating agent. The highest extents of phenol incorporation were observed with the p-hydroxycinnamic acids, p-coumaric and ferulic acids. The present work shows for the first time the use of analytical pyrolysis as an effective approach to study fibre functionalization by laccase-induced grafting of phenols. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Decolorization of the azo dye Acid Orange 51 by laccase produced in solid culture of a newly isolated Trametes trogii strain.

    Science.gov (United States)

    Daâssi, Dalel; Zouari-Mechichi, Hela; Frikha, Fakher; Martinez, Maria Jesus; Nasri, Moncef; Mechichi, Tahar

    2013-04-01

    This study concerns the decolorization and detoxification of the azo dye Acid Orange 51 (AO51) by crude laccase from Trametes trogii produced in solid culture using sawdust as support media. A three-level Box-Behnken factorial design with four factors (enzyme concentration, 1-hydroxybenzotriazole (HBT) concentration, dye concentration and reaction time) combined with response surface methodology was applied to optimize AO51 decolorization. A mathematical model was developed showing the effect of each factor and their interactions on color removal. The model predicted that Acid Orange 51 decolorization above 87.87 ± 1.27 % could be obtained when enzyme concentration, HBT concentration, dye concentration and reaction time were set at 1 U/mL, 0.75 mM, 60 mg/L and 2 days, respectively. The experimental values were in good agreement with the predicted ones and the models were highly significant, the correlation coefficient (R 2 ) being 0.9. Then the desirability function was employed to determine the optimal decolorization condition for each dye and minimize the process cost simultaneously. In addition, germination index assay showed that laccase-treated dye was detoxified; however in the presence of HBT, the phytotoxicity of the treated dye was increased. By using cheap agro-industrial wastes, such as sawdust, a potential laccase was obtained. The low cost of laccase production may further broaden its application in textile wastewater treatment.

  18. Enzymes improve ECF bleaching of pulp

    Directory of Open Access Journals (Sweden)

    Lachenal, D.

    2006-07-01

    Full Text Available The delignification efficiency of different laccase enzymes was examined on the eucalyptus Kraft pulp. The laccase enzyme from Trametes versicolor showing the highest delignification efficiency was selected and used in the elemental chlorine-free bleaching sequence for improving the pulp bleachability. An appreciable reduction in chlorine dioxide consumption was also obtained. Further reduction in chlorine dioxide consumption was obtained when the same laccase treated pulp was subjected to an acid treatment after the extraction stage followed by the DEPD sequence. Elemental-chlorine free bleaching was also performed using the xylanase-laccase treated pulp. Xylanase treatment was incorporated to the laccase mediator system in the elemental-chlorine free bleaching both sequentially and simultaneously. The bleaching sequence DEPD followed and in both the cases, the reduction in chlorine dioxide consumption was greater in comparison to the control. The chlorine dioxide consumption was reduced further when xylanase-laccase treated pulp was given an additional acid treatment. The final pulp properties of the treated pulps were comparable to the control pulp.

  19. The implication of Dichomitus squalens laccase isoenzymes in dye decolorization by immobilized fungal cultures

    Czech Academy of Sciences Publication Activity Database

    Šušla, Martin; Novotný, Čeněk; Svobodová, Kateřina

    2007-01-01

    Roč. 98, - (2007), s. 2109-2115 ISSN 0960-8524 R&D Projects: GA ČR GP526/06/P102; GA AV ČR IAA6020411 Institutional research plan: CEZ:AV0Z5020903 Keywords : decolorization * dichotomitus squalens * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 3.103, year: 2007

  20. Biodecolorization of Reactive Black 5 by laccasemediator system ...

    African Journals Online (AJOL)

    Reactive azo dyes are widely used as textile colorants, typically for cotton dyeing, due to their variety of color shades, and minimal energy consumption. In the present study, commercial laccase from Trametes versicolor was used for the biodecolorization of Reactive Black 5 (RB-5) dye using different redox mediators viz, ...

  1. Screening of Colletotrichum (Ascomycota isolates, causal agents of Soybean Anthracnose, for Laccase production Relevamiento de la producción de lacasa en aislamientos de Colletotrichum (Ascomycota, agente causal de antracnosis de la Soja

    Directory of Open Access Journals (Sweden)

    L. Levin

    2007-07-01

    Full Text Available Colletotrichum truncatum is the most common pathogen fungus associated with soybean anthracnose. Although the lignin-degrading enzyme laccase has been implicated in pathogenicity of a wide range of plant pathogenic fungi, its biological role in the Colletotrichum -soybean disease system is unknown. The extent of the infection in our country led us to examine laccase production in Argentinean Colletotrichum strains isolated from diseased soybean plants from different geographic locations. Ten strains (eight of them identified as C. truncatum , were screened for in vitro laccase production. Only six of the isolates, all of them C. truncatum , produced laccase activity when cultured on a defined medium based on pectin and asparagine as carbon and nitrogen sources, respectively. Strain BAFC 3102 (isolated from Chaco province, yielded the highest laccase titers (44 U/L in this medium. Denaturing polyacrylamide gel electrophoresis of extracellular culture fluids revealed one band with laccase activity (mol wt 67 kDa. CuSO 4 addition to media with either glucose or pectin as carbon sources increased up to 7-fold laccase production (280 U/L in the glucose medium, but the pattern of isoenzyme was not affected by culture age or medium composition. This is the first report on laccase production by C. truncatum.Colletotrichum truncatum es el hongo patógeno más comúnmente asociado con la antracnosis de soja. Aunque la enzima ligninolítica lacasa se relaciona con la patogenicidad de un amplio rango de hongos fitopatógenos, su rol biológico en la interacción Colletotrichum -soja aún se desconoce. La extensión de la infección en la Argentina , nos ha llevado a examinar la producción de lacasa en cepas aisladas de plantas enfermas de soja de diferentes regiones de nuestro país. Se evaluó la producción in vitro de lacasa en diez cepas (ocho de ellas identificadas como C. truncatum . Sólo seis, todas correspondientes a C. truncatum , produjeron

  2. Mediator oxidation systems in organic electrosynthesis

    International Nuclear Information System (INIS)

    Ogibin, Yurii N; Elinson, Michail N; Nikishin, Gennady I

    2009-01-01

    The data on the use of mediator oxidation systems activated by electric current (anodic or parallel anodic and cathodic) in organic electrosynthesis are considered and generalised. Electrochemical activation of these systems permits successful application of catalytic versions and easy scaling of mediator-promoted processes. Chemical and environmental advantages of electrochemical processes catalysed by mediator oxidation systems are demonstrated. Examples of the application of organic and inorganic mediators for the oxidation of various classes of organic compounds under conditions of electrolysis are given.

  3. Multiple resistance to pirimiphos-methyl and bifenthrin in Tribolium castaneum involves the activity of lipases, esterases, and laccase2.

    Science.gov (United States)

    Julio, Alison Henrique Ferreira; Gigliolli, Adriana Aparecida Sinópolis; Cardoso, Kátia Aparecida Kern; Drosdoski, Sandro Daniel; Kulza, Rodrigo Amaral; Seixas, Flávio Augusto Vicente; Ruvolo-Takasusuki, Maria Claudia Colla; de Souza, Cristina Giatti Marques; Lapenta, Ana Silvia

    2017-05-01

    Several recent studies have elucidated the molecular mechanisms that confer insecticide resistance on insect pests. However, little is known about multiple resistance in red flour beetle (Tribolium castaneum) at molecular level. The multiple resistance is characterized as resistance to different classes of insecticides that have different target sites, and is mediated by several enzymatic systems. In this study, we investigated the biochemical and molecular mechanisms involved in multiple resistance of T. castaneum to bifenthrin (pyrethroid [Pyr]) and pirimiphos-methyl (organophosphate [Org]). We used artificial selection, biochemical and in silico approaches including structural computational biology. After five generations of artificial selection in the presence of bifenthrin (F5Pyr) or pirimiphos-methyl (F5Org), we found high levels of multiple resistance. The hierarchical enzymatic cluster revealed a pool of esterases (E), lipases (LIPs) and laccase2 (LAC2) potentially contributing to the resistance in different ways throughout development, after one or more generations in the presence of insecticides. The enzyme-insecticide interaction network indicated that E2, E3, LIP3, and LAC2 are enzymes potentially required for multiple resistance phenotype. Kinetic analysis of esterases from F5Pyr and F5Org showed that pirimiphos-methyl and specially bifenthrin promote enzyme inhibition, indicating that esterases mediate resistance by sequestering bifenthrin and pirimiphos-methyl. Our computational data were in accordance with kinetic results, indicating that bifenthrin has higher affinity at the active site of esterase than pirimiphos-methyl. We also report the capability of these insecticides to modify the development in T. castaneum. Our study provide insights into the biochemical mechanisms employed by T. castaneum to acquire multiple resistance. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Natural Environments and Childhood Experiences Promoting Physical Activity, Examining the Mediational Effects of Feelings about Nature and Social Networks

    Directory of Open Access Journals (Sweden)

    Giovanna Calogiuri

    2016-04-01

    Full Text Available The importance of natural environments (NEs for physical activity (PA has been studied extensively. However, there is scant evidence to explain the motivational processes underlying the NE-PA relation. The aim of this study was to investigate the NE-PA relation using an ecological framework, focusing on perception of NEs, childhood experiences and possible intra- and inter-individual mediators. Data were retrieved from a cross-sectional survey among 2168 adults from all over Norway. In addition, the coverage of NEs by municipalities was retrieved from national registers. Logistic regression showed that, unlike the self-reported proximity to NEs, higher ratings of perceived supportiveness of NEs for PA predicted participation in NE-based PA for at least 60 min/week or 150 min/week, before and after controlling for socio-demographic characteristics. Reporting frequent experiences in nature during childhood was also an important predictor of higher levels of NE-based PA. Furthermore, a mediational analysis showed that the effect of both predictors was mediated by “feelings about nature” and “social networks”. These findings indicate that to encourage the use of local NE for PA, not only should environmental perceptions be taken into account, positive feelings towards nature alongside opportunities to share activity in nature with others should also be promoted.

  5. Xenobiotics enhance laccase activity in alkali-tolerant γ-proteobacterium JB.

    Science.gov (United States)

    Singh, Gursharan; Batish, Mona; Sharma, Prince; Capalash, Neena

    2009-01-01

    Various genotoxic textile dyes, xenobiotics, substrates (10 µM) and agrochemicals (100 µg/ml) were tested for enhancement of alkalophilic laccase activity in γ-proteobacterium JB. Neutral Red, Indigo Carmine, Naphthol Base Bordears and Sulphast Ruby dyes increased the activity by 3.7, 2.7, 2.6 and 2.3 fold respectively. Xenobiotics/substrates like p-toluidine, 8-hydroxyquinoline and anthracine increased it by 3.4, 2.8 and 2.3 fold respectively. Atrazine and trycyclozole pesticides enhanced the activity by 1.95 and 1.5 fold respectively.

  6. A laccase-glucose oxidase biofuel cell prototype operating in a physiological buffer

    Energy Technology Data Exchange (ETDEWEB)

    Barriere, Frederic [Universite de Rennes I, Institut de Chimie, UMR CNRS 6510, 35042 Rennes (France); Kavanagh, Paul; Leech, Donal [Department of Chemistry, National University of Ireland, Galway (Ireland)

    2006-07-15

    Here we report on the design and study of a biofuel cell consisting of a glucose oxidase-based anode (Aspergillus niger) and a laccase-based cathode (Trametes versicolor) using osmium-based redox polymers as mediators of the biocatalysts' electron transfer at graphite electrode surfaces. The graphite electrodes of the device are modified with the deposition and immobilization of the appropriate enzyme and the osmium redox polymer mediator. A redox polymer [Os(4,4'-diamino-2,2'bipyridine){sub 2}(poly(N-vinylimidazole))-(poly(N-vinylimidazole)){sub 9}Cl]Cl (E{sup 0}'=-0.110V versus Ag/AgCl) of moderately low redox potential is used for the glucose oxidizing anode and a redox polymer [Os(phenanthroline){sub 2}(poly(N-vinylimidazole)){sub 2}-(poly(N-vinylimidazole)){sub 8}]Cl {sub 2} (E{sup 0}'=0.49V versus Ag/AgCl) of moderately high redox potential is used at the dioxygen reducing cathode. The enzyme and redox polymer are cross-linked with polyoxyethylene bis(glycidyl ether). The working biofuel cell was studied under air at 37{sup o}C in a 0.1M phosphate buffer solution of pH range 4.4-7.4, containing 0.1M sodium chloride and 10mM glucose. Under physiological conditions (pH 7.4) maximum power density, evaluated from the geometric area of the electrode, reached 16{mu}W/cm{sup 2} at a cell voltage of 0.25V. At lower pH values maximum power density was 40{mu}W/cm{sup 2} at 0.4V (pH 5.5) and 10{mu}W/cm{sup 2} at 0.3V (pH 4.4). (author)

  7. A biosensor based on Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes and graphene oxide for polyphenol detection

    International Nuclear Information System (INIS)

    Aguila, Sergio A; Shimomoto, David; Ipinza, Franscisco; Bedolla-Valdez, Zaira I; Romo-Herrera, José; Contreras, Oscar E; Farías, Mario H; Alonso-Núñez, Gabriel

    2015-01-01

    The use of nanomaterials allows the design of ultrasensitive biosensors with advantages in the detection of organic molecules. Catechol and catechin are molecules that occur naturally in fruits, and their presence in products like dyes and wines affects quality standards. In this study, catechol and catechin were measured at the nanoscale by means of cyclic voltammetry. The oxidation of Coriolopsis gallica laccase immobilized on nitrogen-doped multiwalled carbon nanotubes (Lac/CN x -MWCNT) and on graphene oxide (Lac/GO) was used to measure the concentrations of catechol and catechin. Nitrogen-doped multiwalled carbon nanotubes (CN x -MWCNT) were synthesized by spray pyrolysis and characterized by scanning electron microscopy (SEM), transmission electron microscopy (TEM), and x-ray photoelectron spectroscopy (XPS). Covalently bonded hybrids with laccase (Lac/CN x -MWCNT and Lac/GO) were generated. Catalytic activity of free enzymes determined with syringaldazine yielded 14 584 UmL −1 . With Lac/CN x -MWCNT at concentrations of 6.4 mmol L −1 activity was 9326 U mL −1 , while enzyme activity measured with Lac/GO at concentration of 6.4 mmol L −1 was 9 234 U mL −1 . The Lac/CN x -MWCNT hybrid showed higher stability than Lac/GO at different ethyl alcohol concentrations. The Lac/CN x -MWCNT hybrid can measure concentrations, not previously reported, as low as 1 × 10 −8 mol L −1 by measuring the electric current responses. (paper)

  8. Laccase-catalyzed removal of the antimicrobials chlorophene and dichlorophen from water: Reaction kinetics, pathway and toxicity evaluation.

    Science.gov (United States)

    Shi, Huanhuan; Peng, Jianbiao; Li, Jianhua; Mao, Liang; Wang, Zunyao; Gao, Shixiang

    2016-11-05

    As active agents in cleaning and disinfecting products, antimicrobials have been widely spread in the environment and have drawn extensive attention as potential threats to the ecological system and human health. In this study, the laccase-catalyzed removal of two emerging antimicrobials, chlorophene (CP) and dichlorophen (DCP), was investigated under simulated environmental conditions. Intrinsic reaction kinetics showed that the removal of CP and DCP followed second-order reaction kinetics, first-order with respect to both the enzyme and the substrate concentration. It was also found that fulvic acid could suppress the transformation of CP and DCP by reversing the oxidation reactions through its action as a scavenger of the free radical intermediates produced from reactions between laccase and the substrates. Several reaction products were identified by a quadrupole time-of-flight mass spectrometer, and detailed reaction pathways were proposed. For both CP and DCP, direct polymerization was the principal pathway, and the coupling patterns were further corroborated based on molecular modeling. The nucleophilic substitution of chlorine by the hydroxyl group was observed, and further oxidation products capable of coupling with each other were also found. Additionally, toxicity evaluation tests using Scenedesmus obliquus confirmed that the toxicity of CP and DCP was effectively eliminated during the reaction processes. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Combined strategies for improving production of a thermo-alkali stable laccase in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Jiayi Wang

    2017-07-01

    Conclusions: The productivity of the thermo-alkali stable laccase from B. licheniformis expressed in P. pastoris was significantly improved through the combination of site-directed mutagenesis and optimization of the cultivation process. The mutant enzyme retains good stability under high temperature and alkaline conditions, and is a good candidate for industrial application in dye decolorization.

  10. Online UV-visible spectroscopy and multivariate curve resolution as powerful tool for model-free investigation of laccase-catalysed oxidation.

    Science.gov (United States)

    Kandelbauer, A; Kessler, W; Kessler, R W

    2008-03-01

    The laccase-catalysed transformation of indigo carmine (IC) with and without a redox active mediator was studied using online UV-visible spectroscopy. Deconvolution of the mixture spectra obtained during the reaction was performed on a model-free basis using multivariate curve resolution (MCR). Thereby, the time courses of educts, products, and reaction intermediates involved in the transformation were reconstructed without prior mechanistic assumptions. Furthermore, the spectral signature of a reactive intermediate which could not have been detected by a classical hard-modelling approach was extracted from the chemometric analysis. The findings suggest that the combined use of UV-visible spectroscopy and MCR may lead to unexpectedly deep mechanistic evidence otherwise buried in the experimental data. Thus, although rather an unspecific method, UV-visible spectroscopy can prove useful in the monitoring of chemical reactions when combined with MCR. This offers a wide range of chemists a cheap and readily available, highly sensitive tool for chemical reaction online monitoring.

  11. Stability mechanisms of a thermophilic laccase probed by molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Niels J Christensen

    Full Text Available Laccases are highly stable, industrially important enzymes capable of oxidizing a large range of substrates. Causes for their stability are, as for other proteins, poorly understood. In this work, multiple-seed molecular dynamics (MD was applied to a Trametes versicolor laccase in response to variable ionic strengths, temperatures, and glycosylation status. Near-physiological conditions provided excellent agreement with the crystal structure (average RMSD ∼0.92 Å and residual agreement with experimental B-factors. The persistence of backbone hydrogen bonds was identified as a key descriptor of structural response to environment, whereas solvent-accessibility, radius of gyration, and fluctuations were only locally relevant. Backbone hydrogen bonds decreased systematically with temperature in all simulations (∼9 per 50 K, probing structural changes associated with enthalpy-entropy compensation. Approaching T opt (∼350 K from 300 K, this change correlated with a beginning "unzipping" of critical β-sheets. 0 M ionic strength triggered partial denucleation of the C-terminal (known experimentally to be sensitive at 400 K, suggesting a general salt stabilization effect. In contrast, F(- (but not Cl(- specifically impaired secondary structure by formation of strong hydrogen bonds with backbone NH, providing a mechanism for experimentally observed small anion destabilization, potentially remedied by site-directed mutagenesis at critical intrusion sites. N-glycosylation was found to support structural integrity by increasing persistent backbone hydrogen bonds by ∼4 across simulations, mainly via prevention of F(- intrusion. Hydrogen-bond loss in distinct loop regions and ends of critical β-sheets suggest potential strategies for laboratory optimization of these industrially important enzymes.

  12. Potentialities of a Membrane Reactor with Laccase Grafted Membranes for the Enzymatic Degradation of Phenolic Compounds in Water

    Directory of Open Access Journals (Sweden)

    Vorleak Chea

    2014-10-01

    Full Text Available This paper describes the degradation of phenolic compounds by laccases from Trametes versicolor in an enzymatic membrane reactor (EMR. The enzymatic membranes were prepared by grafting laccase on a gelatine layer previously deposited onto α-alumina tubular membranes. The 2,6-dimethoxyphenol (DMP was selected  from among the three different phenolic compounds tested (guaiacol, 4-chlorophenol and DMP to study the performance of the EMR in dead end configuration. At the lowest feed substrate concentration tested (100 mg·L−1, consumption increased with flux (up to 7.9 × 103 mg·h−1·m−2 at 128 L·h−1·m−2, whereas at the highest substrate concentration (500 mg·L−1, it was shown that the reaction was limited by the oxygen content.

  13. Separation of active laccases from Pleurotus sapidus culture supernatant using aqueous two-phase systems in centrifugal partition chromatography.

    Science.gov (United States)

    Schwienheer, C; Prinz, A; Zeiner, T; Merz, J

    2015-10-01

    For the production of bio active compounds, e.g., active enzymes or antibodies, a conserved purification process with a minimum loss of active compounds is necessary. In centrifugal partition chromatography (CPC), the separation effect is based on the different distribution of the components to be separated between two immiscible liquid phases. Thereby, one liquid phase is kept stationary in chambers by a centrifugal field and the mobile phase is pumped through via connecting ducts. Aqueous two phase systems (ATPS) are known to provide benign conditions for biochemical products and seem to be promising when used in CPC for purification tasks. However, it is not known if active biochemical compounds can "survive" the conditions in a CPC where strong shear forces can occur due to the two-phasic flow under centrifugal forces. Therefore, this aspect has been faced within this study by the separation of active laccases from a fermentation broth of Pleurotus sapidus. After selecting a suitable ATPS and operating conditions, the activity yield was calculated and the preservation of the active enzymes could be observed. Therefore, CPC could be shown as potentially suitable for the purification of bio-active compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Laccase electrodes based on the combination of single-walled carbon nanotubes and redox layered double hydroxides: Towards the development of biocathode for biofuel cells

    Science.gov (United States)

    Ding, Shou-Nian; Holzinger, Michael; Mousty, Christine; Cosnier, Serge

    Single-walled carbon nanotubes (SWCNT) were combined with layered double hydroxides (LDH) intercalated with 2,2‧-azino-bis(3-ethylbenzothiazoline-6-sulfonate) diammonium salt [ZnCr-ABTS] to entrap and electrically connect laccase enzyme. The resulting laccase electrodes exhibited an electro-enzymatic activity for O 2 reduction. To improve this electrocatalytic activity, varying SWCNT quantities and loading methods were tested to optimize the configuration of the laccase electrodes. Furthermore, the resulting bioelectrode was successfully used as a biocathode for the elaboration of a membrane-less glucose/air biofuel cell. In 0.1 M phosphate buffer (PBS) of pH 6.0, containing glucose (5 mM) under ambient conditions, the assembled biofuel cell yielded a maximum power density of 18 μW cm -2 at a cell voltage of 0.3 V whereas this power decreased to 8.3 μW cm -2 for a biofuel cell based on the identical biocathode setup without SWCNT.

  15. Laccase electrodes based on the combination of single-walled carbon nanotubes and redox layered double hydroxides: Towards the development of biocathode for biofuel cells

    Energy Technology Data Exchange (ETDEWEB)

    Ding, Shou-Nian; Holzinger, Michael; Cosnier, Serge [Departement de Chimie Moleculaire UMR-5250, ICMG FR-2607, CNRS Universite Joseph Fourier, BP-53, 38041 Grenoble Cedex 9 (France); Mousty, Christine [Laboratoire des Materiaux Inorganiques, Universite Blaise Pascal, CNRS UMR-6002, 63177 Aubiere Cedex (France)

    2010-08-01

    Single-walled carbon nanotubes (SWCNT) were combined with layered double hydroxides (LDH) intercalated with 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) diammonium salt [ZnCr-ABTS] to entrap and electrically connect laccase enzyme. The resulting laccase electrodes exhibited an electro-enzymatic activity for O{sub 2} reduction. To improve this electrocatalytic activity, varying SWCNT quantities and loading methods were tested to optimize the configuration of the laccase electrodes. Furthermore, the resulting bioelectrode was successfully used as a biocathode for the elaboration of a membrane-less glucose/air biofuel cell. In 0.1 M phosphate buffer (PBS) of pH 6.0, containing glucose (5 mM) under ambient conditions, the assembled biofuel cell yielded a maximum power density of 18 {mu}W cm{sup -2} at a cell voltage of 0.3 V whereas this power decreased to 8.3 {mu}W cm{sup -2} for a biofuel cell based on the identical biocathode setup without SWCNT. (author)

  16. EVALUATION OF ENDOGLUCANASE, EXOGLUCANASE, LACCASE, AND LIGNIN PEROXIDASE ACTIVITIES ON TEN WHITE-ROT FUNGI

    Directory of Open Access Journals (Sweden)

    Sandra Montoya B

    2014-12-01

    Full Text Available This paper presents a way of tracking the production of lignocellulolytic enzymes in ten species of white rot fungi: Lentinula edodes, Schizophyllum commune, Trametes trogii, Coriolus versicolor, Pycnoporus sanguineus, Ganoderma applanatum, Ganoderma lucidum, Grifola frondosa, Pleurotus ostreatus and Auricularia delicata. These species were first screened on solid culture media containing carboxymethyl cellulose, crystalline cellulose, ABTS (2,2´-azino-bis(3-ethylbenzothiazoline-6-sulphonate and azure B, which showed the production of endoglucanase, exoglucanase, laccase and lignin peroxidase (LiP enzymes. Cellulolytic activities were detected after five days of incubation with congo red indicator, forming a clear-white halo in areas where cellulose was degraded. For ligninases, the tracking consisted of the monitoring in the formation of green halos due to ABTS oxidation for laccase, and decolorization halos on azure B for LiP during 14 days of incubation. From this qualitative screening, four strains were selected (G. lucidum, L. edodes, C. versicolor and T. trogii as the best producers of cellulolytic and ligninolytic enzymes. These four species were inoculated on a substrate of sawdust oak, yielding 51,8% of lignin degraded by L. edodes and 22% of cellulose degraded by C. versicolor.

  17. Plackett-Burman Design for rGILCC1 Laccase Activity Enhancement in Pichia pastoris: Concentrated Enzyme Kinetic Characterization

    Directory of Open Access Journals (Sweden)

    Edwin D. Morales-Álvarez

    2017-01-01

    Full Text Available Laccases are multicopper oxidases that catalyze aromatic and nonaromatic compounds with concomitant reduction of molecular oxygen to water. They are of great interest due to their potential biotechnological applications. In this work we statistically improved culture media for recombinant GILCC1 (rGILCC1 laccase production at low scale from Ganoderma lucidum containing the construct pGAPZαA-GlucPost-Stop in Pichia pastoris. Temperature, pH stability, and kinetic parameter characterizations were determined by monitoring concentrate enzyme oxidation at different ABTS substrate concentrations. Plackett-Burman Design allowed improving enzyme activity from previous work 36.08-fold, with a laccase activity of 4.69 ± 0.39 UL−1 at 168 h of culture in a 500 mL shake-flask. Concentrated rGILCC1 remained stable between 10 and 50°C and retained a residual enzymatic activity greater than 70% at 60°C and 50% at 70°C. In regard to pH stability, concentrated enzyme was more stable at pH 4.0 ± 0.2 with a residual activity greater than 90%. The lowest residual activity greater than 55% was obtained at pH 10.0 ± 0.2. Furthermore, calculated apparent enzyme kinetic parameters were a Vmax of 6.87 × 10−5 mM s−1, with an apparent Km of 5.36 × 10−2 mM. Collectively, these important stability findings open possibilities for applications involving a wide pH and temperature ranges.

  18. Synthesis of naturally-derived macromolecules through simplified electrochemically mediated ATRP

    Directory of Open Access Journals (Sweden)

    Paweł Chmielarz

    2017-11-01

    Full Text Available The flavonoid-based macroinitiator was received for the first time by the transesterification reaction of quercetin with 2-bromoisobutyryl bromide. In accordance with the “grafting from” strategy, a naturally-occurring star-like polymer with a polar 3,3',4',5,6-pentahydroxyflavone core and hydrophobic poly(tert-butyl acrylate (PtBA side arms was synthesized via a simplified electrochemically mediated ATRP (seATRP, utilizing only 78 ppm by weight (wt of a catalytic CuII complex. To demonstrate the possibility of temporal control, seATRP was carried out utilizing a multiple-step potential electrolysis. The rate of the polymerizations was well-controlled by applying optimal potential values during preparative electrolysis to prevent the possibility of intermolecular coupling of the growing polymer arms. This appears to be the first report using on-demand seATRP for the synthesis of QC-(PtBA-Br5 pseudo-star polymers. The naturally-derived macromolecules showed narrow MWDs (Đ = 1.08–1.11. 1H NMR spectral results confirm the formation of quercetin-based polymers. These new flavonoid-based polymer materials may find applications as antifouling coatings and drug delivery systems.

  19. EXTRACTION AND PURIFICATION OF EXTRACELLULAR LACCASE FROM WILD, MUTANTS AND HYBRID STRAINS OF TWO WHITE-ROT FUNGUS AND ITS APPLICATIONS IN DECOLOURIZATION AND LIGNINOLYSIS

    Directory of Open Access Journals (Sweden)

    Olusola Majolagbe

    2012-12-01

    Full Text Available Extracellular laccases were extracted from a 5-day old submerge cultures of the wild, mutants and hybrid of Lentinus subnudus. Mutants were generated by exposure of the wild strain of L. subnudus to ultraviolet radiation (ג = 280 nm at specific time intervals while the hybrid was produced by cross-breeding L. subnudus with L. edodes. The crude enzyme was fractionated with 80% ammonium sulphate and further purified on DEAE column. The laccase has a molecular weight of about 45 KDa. Purification yield on DEAE column gave the highest purification yield of 23.25% in SWT and least in SHT (5.29%. Its potentials in decolourization of 2, 6-dichlorophenol-indophenol dye at different pH conditions were investigated. Five out of the six fungal strains tested gave significant (P<0.05 percentage decolourization (≥43.94% at pH 8. The fungus was further studied for their ability in degrading wheat and paddy straws. The solid substrate fermentation was inoculated with two pieces (0.6cm diameter mycelial agar blocks of each of the fungal strains, supplemented with 30mg/100g sucrose, 24mg/100g KNO3 and 60mg/100g CaCO3. The periodic reduction in weight of the solid substrate medium and enzymatic activity of laccase for each of the fungal strains was assessed. Therefore, the ability of the wild, mutants and hybrid of L subnudus strains to produce laccase enzyme shows their significant potential in textile industry, especially in decolourization of dye and bioconversion of lignocellulosic wastes.

  20. Molecular and biochemical characterization of a new thermostable bacterial laccase from Meiothermus ruber DSM 1279

    DEFF Research Database (Denmark)

    Kalyani, D. C.; Munk, L.; Mikkelsen, J. D.

    2016-01-01

    . Spectroscopic analysis of the purified enzyme by UV/visible and electron paramagnetic resonance spectroscopy confirmed that the Mrlac was a multicopper oxidase. The Mrlac had a molecular weight of ∼ 50 kDa and exhibited activity towards the canonical laccase substrates 2,2'-azino-bis(3-ethylbenzothiazoline-6...

  1. Natural killer cells in psoriasis.

    LENUS (Irish Health Repository)

    Tobin, A M

    2012-02-01

    Psoriasis is one of the most common immune-mediated disorders. There is evidence that it is mediated by Th1 and, more recently, Th17 cells. The cytokine pattern, particularly the dominance of TNF-alpha, implicates the innate immune system in psoriasis pathogenesis. Of the many components of the innate immune system known to be involved in psoriatic lesions, natural killer and natural killer T cells appear to have a unique role. We review the evidence supporting a role for natural killer cells in psoriasis.

  2. Laccases as a Potential Tool for the Efficient Conversion of Lignocellulosic Biomass: A Review

    Directory of Open Access Journals (Sweden)

    Úrsula Fillat

    2017-05-01

    Full Text Available The continuous increase in the world energy and chemicals demand requires the development of sustainable alternatives to non-renewable sources of energy. Biomass facilities and biorefineries represent interesting options to gradually replace the present industry based on fossil fuels. Lignocellulose is the most promising feedstock to be used in biorefineries. From a sugar platform perspective, a wide range of fuels and chemicals can be obtained via microbial fermentation processes, being ethanol the most significant lignocellulose-derived fuel. Before fermentation, lignocellulose must be pretreated to overcome its inherent recalcitrant structure and obtain the fermentable sugars. Usually, harsh conditions are required for pretreatment of lignocellulose, producing biomass degradation and releasing different compounds that are inhibitors of the hydrolytic enzymes and fermenting microorganisms. Moreover, the lignin polymer that remains in pretreated materials also affects biomass conversion by limiting the enzymatic hydrolysis. The use of laccases has been considered as a very powerful tool for delignification and detoxification of pretreated lignocellulosic materials, boosting subsequent saccharification and fermentation processes. This review compiles the latest studies about the application of laccases as useful and environmentally friendly delignification and detoxification technology, highlighting the main challenges and possible ways to make possible the integration of these enzymes in future lignocellulose-based industries.

  3. Forms of Mediation: The Case of Interpreter-Mediated Interactions in Medical Systems

    Science.gov (United States)

    Baraldi, Claudio

    2009-01-01

    This paper analyses the forms of mediation in interlinguistic interactions performed in Italian healthcare services and in contexts of migration. The literature encourages dialogic transformative mediation, empowering participants' voices and changing cultural presuppositions in social systems. It may be doubtful, however, whether mediation can…

  4. Immobilization in polyvinyl alcohol hydrogel enhances yeast storage stability and reusability of recombinant laccase-producing S-cerevisiae

    Czech Academy of Sciences Publication Activity Database

    Herkommerová, Klára; Zemančíková, Jana; Sychrová, Hana; Antošová, Zuzana

    2018-01-01

    Roč. 40, č. 2 (2018), s. 405-411 ISSN 0141-5492 R&D Projects: GA TA ČR(CZ) TA01011461 Institutional support: RVO:67985823 Keywords : immobilization * laccase * LentiKats * polyvinyl alcohol hydrogel * reusability * storage stability * yeasts Subject RIV: EI - Biotechnology ; Bionics OBOR OECD: Industrial biotechnology Impact factor: 1.730, year: 2016

  5. The pbrB gene encodes a laccase required for DHN-melanin synthesis in conidia of Talaromyces (Penicillium) marneffei.

    Science.gov (United States)

    Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch

    2015-01-01

    Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.

  6. A novel quantum dot-laccase hybrid nanobiosensor for low level determination of dopamine.

    Science.gov (United States)

    Shamsipur, Mojtaba; Shanehasz, Maryam; Khajeh, Khosro; Mollania, Nasrin; Kazemi, Sayyed Habib

    2012-12-07

    This work reports a novel nanobiosensor based on a thioglycolic acid (TGA)-capped CdTe quantum dot-laccase (Lac) enzyme system for sensitive detection of dopamine (DA). The enzyme used catalyzes the oxidation of DA to dopamine-o-quinone (DOQ), which can selectively quench the strong luminescence of CdTe nanocrystals at neutral pH. The relationship between luminescence intensity of CdTe nanocrystals and DA concentration is nicely described by the Stern-Volmer equation. At an optimum pH of 7.4, the proposed sensor gives a linear calibration over a DA concentration range of 0.3 to 100 μM, with a limit of detection of 0.16 μM and a response time of 2 min. The relative standard deviation for seven replicate determinations of 6.0 μM of DA was found to be 3.7%. The sensor was successfully applied to the determination of DA in a blood plasma sample and in a DA injection formulation.

  7. Application of Polarization Modulated Infrared Reflection Absorption Spectroscopy for electrocatalytic activity studies of laccase adsorbed on modified gold electrodes

    International Nuclear Information System (INIS)

    Olejnik, Piotr; Pawłowska, Aleksandra; Pałys, Barbara

    2013-01-01

    Orientation of the enzyme macromolecule on the electrode surface is crucially important for the efficiency of the electron transport between the active site and electrode surface. The orientation can be controlled by affecting the surface charge and the pH of the buffer solution. In this contribution we study laccase physically adsorbed on gold surface modified by mercapto-ethanol, lipid and variously charged diazonium salts. Polarization Modulated Infrared Reflection Absorption Spectroscopy (PMIRRAS) enables the molecular orientation study of the protein molecule by comparison of the amide I to amide II band intensity ratios assuming that the protein secondary structure does not change. We observe significant differences in the intensity ratios depending on the kind of support and the enzyme deposition. The comparison of infrared spectra and cyclic voltammetry responses of variously prepared laccase layers reveals that the parallel orientation of beta-sheet moieties results in high enzyme activity

  8. Screening of inducers for laccase production by Lentinula edodes in liquid medium Seleção de indutores para produção de lacase por Lentinula edodes

    Directory of Open Access Journals (Sweden)

    José Renato P. Cavallazzi

    2005-12-01

    Full Text Available Laccases are enzymes involved in lignin degradation and are produced by various organisms. Due to their low substrate specificity their potential to be used in biotechnological applications has received attention. The addition of laccase inducers to the culture medium of microorganisms can enhance laccase production and facilitate its purification and utilization. The aim of this study was to investigate the effect of some compounds as laccase inducers in cultures of Lentinula edodes (shiitake. First, it was selected a culture medium suitable for laccase production by shiitake using two levels of N (2.6 and 26 mM and seven levels of Cu (0, 50, 100, 150, 200, 250 and 300 µM. The medium with 2.6 mM N and 250 µM Cu was found to provide the highest laccase activity. To the selected medium it were added gallic acid (1 mM, catechol (1 mM, ammonium tartrate (55 µM, hydroxybenzoic acid (1 mM and vanillin (1 mM. The two first compounds completely inhibited laccase activity and a 30 day time course experiment was carried out with the remaining compounds. Only cultures with ammonium tartrate exhibited laccase activity higher than control cultures, reaching 251 U/mL of extract after 30 days. A native-PAGE was performed and showed only one band, suggesting that no isozyme was produced.Lacases são enzimas envolvidas na degradação da lignina e produzidas por diversos organismos. Devido à sua baixa especificidade por substratos, seu potencial para utilização em aplicações biotecnológicas tem sido objeto de investigação. A adição de indutores de lacases ao meio de cultivo de microrganismos aumenta a produção dessas enzimas, facilitando sua purificação e utilização. Este trabalho teve como objetivo investigar o efeito de alguns compostos utilizados como indutores de lacases em fungos na produção destas enzimas por Lentinula edodes (shiitake. Previamente a utilização de indutores, foi selecionado um meio de cultura para a produção de

  9. Implication of mycelium-associated laccase from Irpex lacteus in the decolorization of synthetic dyes

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Majcherczyk, A.; Novotný, Čeněk; Kuees, U.

    2007-01-01

    Roč. 99, - (2007), s. 463-471 ISSN 0960-8524 R&D Projects: GA AV ČR IAA6020411 Grant - others:XE(XE) Marie Curie Fellowship HPMT-CT-2001-00259; DE(DE) Deutsche Bundesstiftung Umwelt Institutional research plan: CEZ:AV0Z50200510 Source of funding: R - rámcový projekt EK ; O - operačné programy Keywords : irpex lacteus * dye decolorization * laccase Subject RIV: EE - Microbiology, Virology Impact factor: 3.103, year: 2007

  10. Heterologous expression of laccase cDNA from Ceriporiopsis subvermispora yields copper-activated apoprotein and complex isoform patterns

    Science.gov (United States)

    Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna

    2003-01-01

    Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...

  11. Removal of trace organic contaminants by an MBR comprising a mixed culture of bacteria and white-rot fungi.

    Science.gov (United States)

    Nguyen, Luong N; Hai, Faisal I; Yang, Shufan; Kang, Jinguo; Leusch, Frederic D L; Roddick, Felicity; Price, William E; Nghiem, Long D

    2013-11-01

    The degradation of 30 trace organic contaminants (TrOC) by a white-rot fungus-augmented membrane bioreactor (MBR) was investigated. The results show that white-rot fungal enzyme (laccase), coupled with a redox mediator (1-hydroxy benzotriazole, HBT), could degrade TrOC that are resistant to bacterial degradation (e.g. diclofenac, triclosan, naproxen and atrazine) but achieved low removal of compounds (e.g. ibuprofen, gemfibrozil and amitriptyline) that are well removed by conventional activated sludge treatment. Overall, the fungus-augmented MBR showed better TrOC removal compared to a system containing conventional activated sludge. The major role of biodegradation in removal by the MBR was noted. Continuous mediator dosing to MBR may potentially enhance its performance, although not as effectively as for mediator-enhanced batch laccase systems. A ToxScreen3 assay revealed no significant increase in the toxicity of the effluent during MBR treatment of the synthetic wastewater comprising TrOC, confirming that no toxic by-products were produced. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Degradation of Aflatoxins by Means of Laccases from Trametes versicolor: An In Silico Insight

    Directory of Open Access Journals (Sweden)

    Luca Dellafiora

    2017-01-01

    Full Text Available Mycotoxins are secondary metabolites of fungi that contaminate food and feed, and are involved in a series of foodborne illnesses and disorders in humans and animals. The mitigation of mycotoxin content via enzymatic degradation is a strategy to ensure safer food and feed, and to address the forthcoming issues in view of the global trade and sustainability. Nevertheless, the search for active enzymes is still challenging and time-consuming. The in silico analysis may strongly support the research by providing the evidence-based hierarchization of enzymes for a rational design of more effective experimental trials. The present work dealt with the degradation of aflatoxin B1 and M1 by laccase enzymes from Trametes versicolor. The enzymes–substrate interaction for various enzyme isoforms was investigated through 3D molecular modeling techniques. Structural differences among the isoforms have been pinpointed, which may cause different patterns of interaction between aflatoxin B1 and M1. The possible formation of different products of degradation can be argued accordingly. Moreover, the laccase gamma isoform was identified as the most suitable for protein engineering aimed at ameliorating the substrate specificity. Overall, 3D modeling proved to be an effective analytical tool to assess the enzyme–substrate interaction and provided a solid foothold for supporting the search of degrading enzyme at the early stage.

  13. Conductive cotton prepared by polyaniline in situ polymerization using laccase.

    Science.gov (United States)

    Zhang, Ya; Dong, Aixue; Wang, Qiang; Fan, Xuerong; Cavaco-Paulo, Artur; Zhang, Ying

    2014-09-01

    The high-redox-potential catalyst laccase, isolated from Aspergillus, was first used as a biocatalyst in the oxidative polymerization of water-soluble conductive polyaniline, and then conductive cotton was prepared by in situ polymerization under the same conditions. The polymerization of aniline was performed in a water dispersion of sodium dodecylbenzenesulfonate (SDBS) micellar solution with atmospheric oxygen serving as the oxidizing agent. This method is ecologically clean and permits a greater degree of control over the kinetics of the reaction. The conditions for polyaniline synthesis were optimized. Characterizations of the conducting polyaniline and cotton were carried out using Fourier transform infrared spectroscopy, UV-vis spectroscopy, cyclic voltammetry, the fabric induction electrostatic tester, and the far-field EMC shielding effectiveness test fixture.

  14. Laccase-based biosensor for the determination of polyphenol index in wine.

    Science.gov (United States)

    Di Fusco, Massimo; Tortolini, Cristina; Deriu, Daniela; Mazzei, Franco

    2010-04-15

    In this work we have developed and characterized the use of Laccases from Trametes versicolor (TvL) and Trametes hirsuta (ThL) as biocatalytic components of electrochemical biosensors for the determination of polyphenol index in wines. Polyazetidine prepolimer (PAP) was used as immobilizing agent, multi-walled and single-walled carbon nanotubes screen-printed electrodes as sensors (MWCNTs-SPE and SWCNTs-SPE) and gallic acid as standard substrate. The amperometric measurements were carried out by using a flow system at a fixed potential of -100 mV vs. silver/silver chloride electrode in Britton-Robinson buffer 0.1 mol L(-1), pH 5. The results were compared with those obtained with the Folin-Ciocalteau reference method. The results obtained in the analysis of twelve Italian wines put in evidence the better suitability of ThL-MWCNTs-based biosensor in the determination of the polyphenol index in wines. This biosensor shows fast and reliable amperometric responses to gallic acid with a linear range 0.1-18.0 mg L(-1) (r(2)=0.999). The influence of the interferences on both spectrophotometric and electrochemical measurements have been carefully evaluated. (c) 2009 Elsevier B.V. All rights reserved.

  15. Fasting enhances TRAIL-mediated liver natural killer cell activity via HSP70 upregulation.

    Directory of Open Access Journals (Sweden)

    Vu T A Dang

    Full Text Available Acute starvation, which is frequently observed in clinical practice, sometimes augments the cytolytic activity of natural killer cells against neoplastic cells. In this study, we investigated the molecular mechanisms underlying the enhancement of natural killer cell function by fasting in mice. The total number of liver resident natural killer cells in a unit weight of liver tissue obtained from C57BL/6J mice did not change after a 3-day fast, while the proportions of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL+ and CD69+ natural killer cells were significantly elevated (n = 7, p <0.01, as determined by flow cytometric analysis. Furthermore, we found that TRAIL- natural killer cells that were adoptively transferred into Rag-2-/- γ chain-/- mice could convert into TRAIL+ natural killer cells in fasted mice at a higher proportion than in fed mice. Liver natural killer cells also showed high TRAIL-mediated antitumor function in response to 3-day fasting. Since these fasted mice highly expressed heat shock protein 70 (n = 7, p <0.05 in liver tissues, as determined by western blot, the role of this protein in natural killer cell activation was investigated. Treatment of liver lymphocytes with 50 µg/mL of recombinant heat shock protein 70 led to the upregulation of both TRAIL and CD69 in liver natural killer cells (n = 6, p <0.05. In addition, HSP70 neutralization by intraperitoneally injecting an anti- heat shock protein 70 monoclonal antibody into mice prior to fasting led to the downregulation of TRAIL expression (n = 6, p <0.05. These findings indicate that acute fasting enhances TRAIL-mediated liver natural killer cell activity against neoplastic cells through upregulation of heat shock protein 70.

  16. Self-esteem mediates the relationship between connectedness to nature and body appreciation in women, but not men.

    Science.gov (United States)

    Swami, Viren; von Nordheim, Laura; Barron, David

    2016-03-01

    Connectedness to nature (i.e., an affective and experiential connection to nature) is known to have a positive effect on psychological well-being, but its specific associations with body image have not been fully examined. To attend to this oversight, we conducted a preliminary investigation of associations between connectedness to nature and body appreciation. A total of 380 British adults completed measures of connectedness to nature, body appreciation, and self-esteem. Bivariate correlations revealed significant positive associations between all variables in women. In men, body appreciation was significantly correlated with self-esteem, but not connectedness to nature. Mediation analysis showed that, in women, self-esteem fully mediated the relationship between connectedness to nature and body appreciation. In men, body appreciation was significantly associated with self-esteem, but not connectedness to nature. These results point to a potential route for improving body image among women through connectedness to nature and self-esteem, but further research is necessary. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Laccase-based biocathodes: Comparison of chitosan and Nafion.

    Science.gov (United States)

    El Ichi-Ribault, S; Zebda, A; Laaroussi, A; Reverdy-Bruas, N; Chaussy, D; Belgacem, M N; Suherman, A L; Cinquin, P; Martin, D K

    2016-09-21

    Chitosan and Nafion(®) are both reported as interesting polymers to be integrated into the structure of 3D electrodes for biofuel cells. Their advantage is mainly related to their chemical properties, which have a positive impact on the stability of electrodes such as the laccase-based biocathode. For optimal function in implantable applications the biocathode requires coating with a biocompatible semi-permeable membrane that is designed to prevent the loss of enzyme activity and to protect the structure of the biocathode. Since such membranes are integrated into the electrodes ultimately implanted, they must be fully characterized to demonstrate that there is no interference with the performance of the electrode. In the present study, we demonstrate that chitosan provides superior stability compared with Nafion(®) and should be considered as an optimum solution to enhance the biocompatibility and the stability of 3D bioelectrodes. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Isolation, one-step affinity purification, and characterization of a polyextremotolerant laccase from the halophilic bacterium Aquisalibacillus elongatus and its application in the delignification of sugar beet pulp.

    Science.gov (United States)

    Rezaei, Shahla; Shahverdi, Ahmad Reza; Faramarzi, Mohammad Ali

    2017-04-01

    The aim of the present work was to study the ability of a halophilic bacterial laccase to efficient delignification in extreme conditions. Here, a highly stable extracellular laccase showing ligninolytic activity from halophilic Aquisalibacillus elongatus is described. The laccase production was strongly influenced by NaCl and CuSO 4 and under optimal conditions reached 4.8UmL -1 . The monomeric enzyme of 75kDa was purified by a synthetic affinity column with 68.2% yield and 99.8-fold purification. The enzyme showed some valuable features viz. stability against a wide range of organic solvents, salts, metals, inhibitors, and surfactants and specificity to a wide spectrum of substrates diverse in structure and redox potential. It retained more than 50% of the original activity at 25-75°C and pH 5.0-10.0. Furthermore, the enzyme was found to be effective in the delignification of sugar beet pulp in an ionic liquid that makes it useful for industrial applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Mediation: A concept that has to do not just with the justice system

    Directory of Open Access Journals (Sweden)

    Endira Bushati

    2013-01-01

    Full Text Available Conflicts and disputes among people are an integral part of everyday life, of our private and professional life. They can be of any kind, from social, commercial, family related disputes up to those between the states themselves. Just as the types and natures of disputes increase with the economic and cultural development of any society, the mechanisms of dealing with them take a special importance as well. Besides dispute resolution by state bodies that are established by law, alternative ways for resolving disputes are developing increasingly and are receiving a special importance as well. The alternative solution of a dispute is nothing more than an alternative for resolving the dispute outside the judicial system, where the main ways are mediation and arbitration. Alternative solutions to disputes are widespread in countries of common law systems, considering that most disputes are solved in this way. In this article we will examine mediation and its development especially in Albania. Mediation is a way to resolve disputes between two or more parties, where a third person, the mediator, negotiates with the parties so that they arrive at a solution acceptable to all.

  20. Characterisation of manganese peroxidase and laccase producing bacteria capable for degradation of sucrose glutamic acid-Maillard reaction products at different nutritional and environmental conditions.

    Science.gov (United States)

    Kumar, Vineet; Chandra, Ram

    2018-02-02

    Maillard reactions products (MRPs) are a major colorant of distillery effluent. It is major source of environmental pollution due to its complex structure and recalcitrant nature. This study has revealed that sucrose glutamic acid-Maillard reaction products (SGA-MRPs) showed many absorption peaks between 200 and 450 nm. The absorption maximum peak was noted at 250 nm in spectrophotometric detection. This indicated the formation of variable molecular weight Maillard products during the SGA-MRPs formation at high temperature. The identified aerobic bacterial consortium consisting Klebsiella pneumoniae (KU726953), Salmonella enterica (KU726954), Enterobacter aerogenes (KU726955), Enterobacter cloaceae (KU726957) showed optimum production of MnP and laccase at 120 and 144 h of growth, respectively. The potential bacterial consortium showed decolourisation of Maillard product up to 70% in presence of glucose (1%), peptone (0.1%) at optimum pH (8.1), temperature (37 °C) and shaking speed (180 rpm) within 192 h of incubation. The reduction of colour of Maillard product correlated with shifting of absorption peaks in UV-Vis spectrophotometry analysis. Further, the changing of functional group in FT-IR data showed appearance of new peaks and GC-MS analysis of degraded sample revealed the depolymerisation of complex MRPs. The toxicity evaluation using seed of Phaseolus mungo L. showed reduction of toxicity of MRPs after bacterial treatment. Hence, this study concluded that developed bacterial consortium have capability for decolourisation of MRPs due to high content of MnP and laccase.

  1. The Dialectic of the Nature-Society-System

    Directory of Open Access Journals (Sweden)

    Christian Fuchs

    2008-07-01

    Full Text Available There are four logical possibilities for conceiving the relationship of nature and society: the reduction of society to nature, the projection of nature into society, dualism, and a nature-society-dialectic. This differentiation results in four different approaches. Nature is a self-organizing system that produces an evolutionary hierarchy of interconnected systems with specific qualities. Society is a product of nature where humans produce and reproduce structures that enable and constrain human practices in dynamic processes. Parts of nature are observed and appropriated by humans from within society, these parts are socially constructed and form a subsystem of society. The self-organization cycle of nature and the self-organization cycle of the socio-sphere are mutually connected in a productive cycle of society where natural self-organization serves as the material foundation that enables and constrains social self-organization and human production processes transform natural structures and incorporate these very structures into society as means of production (technologies, raw materials. The economy is that part of the socio-sphere where the relationship between nature and the socio-sphere is established, the mediation is achieved by human labour processes. Nature enters the economic process as material input in the form of means of production (constant capital: machines, raw materials, auxiliary materials. Organized nature that is part of the production process in the form of technology increases the productivity of labour and hence reduces the costs of variable capital (total amount of wages and increases the speed of the production of surplus value. The production system of modern society is oriented on economic profit and productivity, ecological depletion and pollution are by-products of modernization. The Fordist production model that originated in the West and was copied by the Soviet Union is one of the major causes of the global

  2. Immobilisation of laccase on Eupergit supports and its application for the removal of endocrine disrupting chemicals in a packed-bed reactor.

    Science.gov (United States)

    Lloret, L; Hollmann, F; Eibes, G; Feijoo, G; Moreira, M T; Lema, J M

    2012-06-01

    Laccase from Myceliophthora thermophila was covalently immobilised on Eupergit C and Eupergit C 250L yielding specific activities of up to 17 and 80 U/g, respectively. Due to its superior activity, Eupergit C 250L was chosen for further research. The somewhat lower catalytic efficiency (based on the ratio between the turnover number and the Michaelis constant, k(cat)/K(M)) of the immobilised enzyme in comparison with that of the free enzyme was balanced by its increased stability and broader operational window related to temperature and pH. The feasibility of the immobilised laccase was tested by using a packed bed reactor (PBR) operating in consecutive cycles for the removal of Acid Green 27 dye as model substrate. High degrees of elimination were achieved (88, 79, 69 and 57% in 4 consecutive cycles), while the levels of adsorption on the support varied from 18 to 6%, proving that dye removal took place mainly due to the action of the enzyme. Finally, a continuous PBR with the solid biocatalyst was applied for the treatment of a solution containing the following endocrine disrupting chemicals: estrone (E1), 17β-estradiol (E2) and 17α-ethinylestradiol (EE2). At steady-state operation, E1 was degraded by 65% and E2 and EE2 were removed up to 80% and only limited adsorption of these compounds on the support, between 12 and 22%, was detected. In addition, a 79% decrease in estrogenic activity was detected in the effluent of the enzymatic reactor while only 14% was attained by inactivated laccase.

  3. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

    2015-11-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

  4. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    International Nuclear Information System (INIS)

    Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

    2015-01-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

  5. TtMCO: A highly thermostable laccase-like multicopper oxidase from the thermophilic Thermobaculum terrenum

    DEFF Research Database (Denmark)

    Brander, Søren; Mikkelsen, Jørn Dalgaard; Kepp, Kasper Planeta

    2015-01-01

    This paper reports the identification, heterologous expression in Escherichia coli and characterization of TtMCO from the thermophilic bacterium Thermobaculum terrenum, the first laccase-like multi-copper oxidase (LMCO) from the distinct Phylum Chloroflexi. TtMCO has only 39% identity to its...... closest characterized homologue, CotA from Bacillus subtilis, but sequence and spectrophotometry confirmed copper coordination similar to that of LMCOs. TtMCO is extremely thermophilic with a half-time of inactivation of 2.24 days at 70 degrees C and 350 min at 80°C and pH 7, consistent...

  6. Development of an enzymatic microreactor based on microencapsulated laccase with off-line capillary electrophoresis for measurement of oxidation reactions.

    Science.gov (United States)

    Roman-Gusetu, Georgiana; Waldron, Karen C; Rochefort, Dominic

    2009-11-20

    Microencapsulation is used here as a new technique to immobilize enzymes in a microreactor coupled off-line to capillary electrophoresis (CE), allowing the determination of enzymatic reaction products. The redox enzyme laccase was encapsulated using the method of interfacial cross-linking of poly(ethyleneimine) (PEI). The 50 microm diameter capsules were slurry packed from a suspension into a capillary-sized reactor made easily and quickly from a short length of 530 microm diameter fused-silica tubing. The volume of the bed of laccase microcapsules in the microreactor was in the order of 1.1 microL through which 50 microL of the substrate o-phenylenediamine (OPD) was flowed. The oxidation product 2,3-diaminophenazine (DAP) and the remaining OPD were quantified by CE in a pH 2.5 phosphate buffer. Peak migration time reproducibility was in the order of 0.4% RSD and peak area reproducibility was less than 1.7% RSD within the same day. Using the OPD peak area calibration curve, a conversion efficiency of 48% was achieved for a 2-min oxidation reaction in the microreactor.

  7. Interventional Effects for Mediation Analysis with Multiple Mediators.

    Science.gov (United States)

    Vansteelandt, Stijn; Daniel, Rhian M

    2017-03-01

    The mediation formula for the identification of natural (in)direct effects has facilitated mediation analyses that better respect the nature of the data, with greater consideration of the need for confounding control. The default assumptions on which it relies are strong, however. In particular, they are known to be violated when confounders of the mediator-outcome association are affected by the exposure. This complicates extensions of counterfactual-based mediation analysis to settings that involve repeatedly measured mediators, or multiple correlated mediators. VanderWeele, Vansteelandt, and Robins introduced so-called interventional (in)direct effects. These can be identified under much weaker conditions than natural (in)direct effects, but have the drawback of not adding up to the total effect. In this article, we adapt their proposal to achieve an exact decomposition of the total effect, and extend it to the multiple mediator setting. Interestingly, the proposed effects capture the path-specific effects of an exposure on an outcome that are mediated by distinct mediators, even when-as often-the structural dependence between the multiple mediators is unknown, for instance, when the direction of the causal effects between the mediators is unknown, or there may be unmeasured common causes of the mediators.

  8. A recombinase-mediated transcriptional induction system in transgenic plants

    DEFF Research Database (Denmark)

    Hoff, T; Schnorr, K M; Mundy, J

    2001-01-01

    We constructed and tested a Cre-loxP recombination-mediated vector system termed pCrox for use in transgenic plants. In this system, treatment of Arabidopsis under inducing conditions mediates an excision event that removes an intervening piece of DNA between a promoter and the gene to be expressed......-mediated GUS activation. Induction was shown to be possible at essentially any stage of plant growth. This single vector system circumvents the need for genetic crosses required by other, dual recombinase vector systems. The pCrox system may prove particularly useful in instances where transgene over...

  9. Immobilized laccase-based biosensor for the detection of disubstituted methyl and methoxy phenols - application of Box-Behnken design with response surface methodology for modeling and optimization of performance parameters.

    Science.gov (United States)

    Sarika, C; Rekha, K; Narasimha Murthy, B

    2016-11-01

    An amperometric principle-based biosensor, employing immobilized laccase enzyme from Trametes versicolor, was developed for the detection of disubstituted methyl and methoxy phenols. Three immobilization methods such as entrapment, cross-linking, and co-cross-linking, with bovine serum albumin (BSA) on nylon membrane have been compared. Among tested methods of immobilization, co-cross-linking method with BSA was superior to the other methods in terms of; sensitivity, limit of detection, response time, and operating stability. The increased sensitivity of the probe optimization of concentrations of laccase, BSA and glutaraldehyde can be achieved by, employing the Box-Behnken design of experiment.

  10. Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

    Directory of Open Access Journals (Sweden)

    Huiping Liu

    Full Text Available Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid (ABTS, syringaldazine (SGZ, guaiacol, and 2,6-dimethoxyphenol (2,6-DMP as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

  11. Natural Information Processing Systems

    OpenAIRE

    John Sweller; Susan Sweller

    2006-01-01

    Natural information processing systems such as biological evolution and human cognition organize information used to govern the activities of natural entities. When dealing with biologically secondary information, these systems can be specified by five common principles that we propose underlie natural information processing systems. The principles equate: (1) human long-term memory with a genome; (2) learning from other humans with biological reproduction; (3) problem solving through random ...

  12. Enzymatic hydrophobization of jute fabrics and its effect on the mechanical and interfacial properties of jute/PP composites

    Directory of Open Access Journals (Sweden)

    A. Dong

    2016-05-01

    Full Text Available In this work, a hydrophobic surface of lignocellulosic jute fabric was achieved via the laccase-mediated grafting of octadecylamine (OA on lignin moieties of jute aiming to improve the interfacial compatibility with the hydrophobic polypropylene (PP resins in the fiber-reinforced composites. Firstly, the surface and total elemental compositions of the modified jute fabrics were investigated by X-ray photoelectron spectroscopy (XPS and elemental analysis, respectively. The increases in the surface C/O ratio and total nitrogen content of jute fabrics after the laccase/OA treatment indicated that OA molecules were successfully grafted onto the jute surface mediated by laccase. The grafting percentage of OA on jute fabrics was 0.96%. The surface hydrophobicity of jute fabrics with static contact angle of 112.5°, advancing angle of 116.4° and receding angle of 42.7° supported the presence of nonpolar alkyl chains on the jute surface after the laccase-mediated OA-grafting. The tensile strength, tensile modulus as well as the elongation at break of the hydrophobized jute/PP composites were increased. The fracture surface of the composites became neat and the jute fibers on the section surface were surrounded by PP resins closely, which suggested better interfacial adhesion between the jute reinforcement and the PP resin.

  13. Immobilisation of laccase on Eupergit supports and its application for the removal of endocrine disrupting chemicals in a packed-bed reactor

    NARCIS (Netherlands)

    Lloret, L.; Hollmann, F.; Eibes, G.; Feijoo, G.; Moreira, M.T.; Lema, J.M.

    2011-01-01

    Laccase from Myceliophthora thermophila was covalently immobilised on Eupergit C and Eupergit C 250L yielding specific activities of up to 17 and 80 U/g, respectively. Due to its superior activity, Eupergit C 250L was chosen for further research. The somewhat lower catalytic efficiency (based on the

  14. Laccase on Black Pearl 2000 modified glassy carbon electrode: Characterization of direct electron transfer and biological sensing properties for pyrocatechol

    International Nuclear Information System (INIS)

    Wang Kunqi; Tang Juan; Zhang Zuoming; Gao Ying; Chen Gang

    2012-01-01

    Highlights: ► Laccase can complete direct electron transfer process on BP2000 matrices. ► Laccase immobilized on BP2000 matrices has catalytic oxidation effect to pyrocatechol. ► A pyrocatechol biosensor has constructed been using Nafion/Lac-BP2000/GC electrode. ► Detection limit and linear range of the biosensor are 0.003 mM and 0.003–5.555 mM. - Abstract: In this paper, it was found that Laccase (Lac) could be stably immobilized on the glassy carbon electrode modified with Black Pearl 2000 (BP2000) and Nafion by a simple technique. The adsorption behavior of Lac immobilized on BP2000 matrix was characterized by environment scanning electron microscope (ESEM), ultraviolet–visible (UV–vis) and Fourier transform infrared (FTIR), which demonstrated that BP2000 could facilitate the electron exchange between the active center of Lac and modified electrode. The direct electrochemistry and electrocatalysis behavior of Lac on the modified electrode were characterized by cyclic voltammogram (CV) which indicated that Lac immobilized on the modified electrode displayed a direct, nearly reversible and surface-controlled redox reaction with an enhanced electron-transfer rate constant of 1.940 s −1 at the scan rate of 100 mV s −1 in 0.1 M phosphate buffer solution (PBS) (pH 7.0). Furthermore, it was also discovered that, in the presence of O 2 , Lac immobilized on the modified electrode exhibited the electrocatalytic response to pyrocatechol, and the kinetic apparent Michaelis-constant (K M app ) obtained from the Lineweaver–Burk equation was 1.79 mM. The detection limit, linear range and sensitivity of the Lac biosensor were 0.003 mM, 0.003–5.555 mM and 99.84 μA mM −1 cm −2 , respectively.

  15. Laccase-13 Regulates Seed Setting Rate by Affecting Hydrogen Peroxide Dynamics and Mitochondrial Integrity in Rice

    Directory of Open Access Journals (Sweden)

    Yang Yu

    2017-07-01

    Full Text Available Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 (OsLAC13, a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H2O2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H2O2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H2O2 dynamics and mitochondrial integrity in rice.

  16. Efficient secretion of three fungal laccases from Saccharomyces cerevisiae and their potential for decolorization of textile industry effluent - A comparative study

    Czech Academy of Sciences Publication Activity Database

    Antošová, Zuzana; Herkommerová, Klára; Pichová, I.; Sychrová, Hana

    2018-01-01

    Roč. 34, č. 1 (2018), s. 69-80 ISSN 8756-7938 R&D Projects: GA TA ČR(CZ) TA01011461 Institutional support: RVO:67985823 Keywords : laccase * decolorization * gene expression * expression optimization * Saccharomyces cerevisiae Subject RIV: EI - Biotechnology ; Bionics OBOR OECD: Industrial biotechnology Impact factor: 1.986, year: 2016

  17. Enhanced production of laccase by a marine fungus during treatment of colored effluents and synthetic dyes

    Digital Repository Service at National Institute of Oceanography (India)

    DeSouza-Ticlo, D.; Tiwari, R.; Sah, A.K.; Raghukumar, C.

    . Laccase (EC 1.10.3.2, benzenediol:oxygen oxidoreductase) is a multicopper blue oxidase capable of oxidizing ortho and para-diphenols and aromatic amines by removing an electron and proton from a hydroxyl group to form a free radical. These enzymes lack...) were collected in sterile plastic bags and processed within 3 hours. They were washed free of attached soil particles and other extraneous matter using sterile seawater. The wood pieces were then incubated in sterile bags lined with moist filter...

  18. DECOLORIZATION OF DENIM DYESTUFF BY LACCASE ENZYME

    Directory of Open Access Journals (Sweden)

    Serap GEDİKLİ

    2011-02-01

    Full Text Available Large quantities of dyes used in the textile industry are discharged to recipient environment during manufacture. This situation is beginning of a process which is difficult to recovery and relevant toenvironment and human health. Therefore, pollution of dyestuff produced textile industry will be reduced by cleaning of polluted area and integrating biological approaches with technologies havingpolluting potential. In scope of this study, commercial denim dye was decolorized by using high laccase activity culture supernatant of Trametes versicolor ATCC 200801 pellets grown in potato dextrose broth including wheat bran and determined optimum conditions. In the result of experiments done, pH, initial dye concentration, temperature and incubation time were selected 4.0, 75 mg/l, 55 oCand 120 minutes, respectively. 68.02 % of decolorization was obtained at the determined optimum conditions. Furthermore, adding different metal ions to find in textile wastewater and supplementarychemical materials used fabric dyeing process to reaction medium, potential of decolorization copied with improvement was investigated effects of these. When the obtained data were examined, pollutantswhich tested at optimum conditions were observed not affected negatively decolorization. Even in the presence of Tween 80 detected the maximum inhibitor effect, 54.68 % of decolorization was obtained.

  19. Structure of laccase from Streptomyces coelicolor after soaking with potassium hexacyanoferrate and at an improved resolution of 2.3 Å

    Czech Academy of Sciences Publication Activity Database

    Skálová, Tereza; Dušková, Jarmila; Hašek, Jindřich; Štěpánková, Andrea; Kovaľ, Tomáš; Ostergaard, L. H.; Dohnálek, Jan

    2011-01-01

    Roč. 67, č. 1 (2011), s. 27-32 ISSN 1744-3091 R&D Projects: GA ČR GA305/07/1073; GA AV ČR IAA500500701 Institutional research plan: CEZ:AV0Z40500505; CEZ:AV0Z10100521 Keywords : laccase * potassium hexacyanoferrate * X-ray diffraction Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.506, year: 2011

  20. Interventional effects for mediation analysis with multiple mediators

    OpenAIRE

    Vansteelandt, Stijn; Daniel, Rhian M.

    2017-01-01

    The mediation formula for the identification of natural (in)direct effects has facilitated mediation analyses that better respect the nature of the data, with greater consideration of the need for confounding control. The default assumptions on which it relies are strong, however. In particular, they are known to be violated when confounders of the mediator–outcome association are affected by the exposure. This complicates extensions of counterfactual-based mediation analysis to settings that...

  1. Biodegradation of sulfamethazine by Trametes versicolor: Removal from sewage sludge and identification of intermediate products by UPLC-QqTOF-MS

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Galan, Ma. Jesus, E-mail: mggqam@cid.csic.es [Departament de Quimica Ambiental, IDAEA-CSIC, C/Jordi Girona 18-26, 08034 Barcelona (Spain); Rodriguez-Rodriguez, Carlos E., E-mail: CarlosEsteban.Rodriguez@uab.cat [Unitat asociada de Biocatalisi Aplicada IQAC-CSIC, Escola d' Enginyeria, Universitat Autonoma de Barcelona, 08193 Bellaterra, Barcelona (Spain); Centro de Investigacion en Contaminacion Ambiental, Universidad de Costa Rica, 2060 San Jose (Costa Rica); Vicent, Teresa, E-mail: Teresa.Vicent@uab.cat [Departament d' Enginyeria Quimica, Escola d' Enginyeria, Universitat Autonoma de Barcelona, 08193 Bellaterra, Barcelona (Spain); Caminal, Gloria, E-mail: Gloria.Caminal@uab.cat [Unitat asociada de Biocatalisi Aplicada IQAC-CSIC, Escola d' Enginyeria, Universitat Autonoma de Barcelona, 08193 Bellaterra, Barcelona (Spain); Diaz-Cruz, M. Silvia, E-mail: sdcqam@cid.csic.es [Departament de Quimica Ambiental, IDAEA-CSIC, C/Jordi Girona 18-26, 08034 Barcelona (Spain); Barcelo, Damia, E-mail: dbcqam@cid.csic.es [Departament de Quimica Ambiental, IDAEA-CSIC, C/Jordi Girona 18-26, 08034 Barcelona (Spain); Catalan Institute for Water Research (ICRA), Parc Cientific i Tecnologic de la Universitat de Girona. C/Emili Grahit, 101 Edifici H2O, E-17003 Girona (Spain); King Saud University, P.O. Box 2455, Riyadh 11451 (Saudi Arabia)

    2011-11-15

    Degradation of the sulfonamide sulfamethazine (SMZ) by the white-rot fungus Trametes versicolor was assessed. Elimination was achieved to nearly undetectable levels after 20 h in liquid medium when SMZ was added at 9 mg L{sup -1}. Experiments with purified laccase and laccase-mediators resulted in almost complete removal. On the other hand, inhibition of SMZ degradation was observed when piperonilbutoxide, a cytochrome P450-inhibitor, was added to the fungal cultures. UPLC-QqTOF-MS analysis allowed the identification and confirmation of 4 different SMZ degradation intermediates produced by fungal cultures or purified laccase: desulfo-SMZ, N{sup 4}-formyl-SMZ, N{sup 4}-hydroxy-SMZ and desamino-SMZ; nonetheless SMZ mineralization was not demonstrated with the isotopically labeled sulfamethazine-phenyl-{sup 13}C{sub 6} after 7 days. Inoculation of T. versicolor to sterilized sewage sludge in solid-phase systems showed complete elimination of SMZ and also of other sulfonamides (sulfapyridine, sulfathiazole) at real environmental concentrations, making this fungus an interesting candidate for further remediation research. - Highlights: {yields}Degradation of sulfamethazine by Trametes versicolor was evaluated. {yields}The laccase enzymatic system and cytochrome P-450 were involved in the degradation. {yields}Four different degradation products of sulfamethazine were identified and confirmed. {yields}The molecular structures and masses of the metabolites were accurately calculated. {yields}Full elimination of sulfamethazine was observed in regular sewage sludge.

  2. Mediation analysis with time varying exposures and mediators.

    Science.gov (United States)

    VanderWeele, Tyler J; Tchetgen Tchetgen, Eric J

    2017-06-01

    In this paper we consider causal mediation analysis when exposures and mediators vary over time. We give non-parametric identification results, discuss parametric implementation, and also provide a weighting approach to direct and indirect effects based on combining the results of two marginal structural models. We also discuss how our results give rise to a causal interpretation of the effect estimates produced from longitudinal structural equation models. When there are time-varying confounders affected by prior exposure and mediator, natural direct and indirect effects are not identified. However, we define a randomized interventional analogue of natural direct and indirect effects that are identified in this setting. The formula that identifies these effects we refer to as the "mediational g-formula." When there is no mediation, the mediational g-formula reduces to Robins' regular g-formula for longitudinal data. When there are no time-varying confounders affected by prior exposure and mediator values, then the mediational g-formula reduces to a longitudinal version of Pearl's mediation formula. However, the mediational g-formula itself can accommodate both mediation and time-varying confounders and constitutes a general approach to mediation analysis with time-varying exposures and mediators.

  3. Intelligent query processing for semantic mediation of information systems

    Directory of Open Access Journals (Sweden)

    Saber Benharzallah

    2011-11-01

    Full Text Available We propose an intelligent and an efficient query processing approach for semantic mediation of information systems. We propose also a generic multi agent architecture that supports our approach. Our approach focuses on the exploitation of intelligent agents for query reformulation and the use of a new technology for the semantic representation. The algorithm is self-adapted to the changes of the environment, offers a wide aptitude and solves the various data conflicts in a dynamic way; it also reformulates the query using the schema mediation method for the discovered systems and the context mediation for the other systems.

  4. Whey protein isolate with improved film properties through cross-linking catalyzed by small laccase from Streptomyces coelicolor.

    Science.gov (United States)

    Quan, Wei; Zhang, Chong; Zheng, Meixia; Lu, Zhaoxin; Lu, Fengxia

    2018-08-01

    The effects of small laccase (SLAC) from Streptomyces coelicolor on the properties of whey protein isolate (WPI) films were studied. WPI was catalyze by SLAC without phenolic acid assistance. Particle size distribution results showed that some complexes with higher relative molecular weight formed in WPI samples treated with SLAC. The content of α-helixes decreased while those of β-sheets and random coils increased following SLAC treatment according to circular dichroism results. Fourier transform infrared spectral analysis suggested that some conformational changes occurred in WPI following SLAC treatment. Analysis of WPI films prepared by casting after SLAC treatment indicated that their film properties were all improved, including mechanical properties, solubility, water vapor, oxygen and carbon dioxide barrier properties, film color, light transmission, transparency and thermal properties. Compared with that of the control film, some obvious differences in the morphology of the WPI films were observed following SLAC treatment. This report demonstrates that laccase can directly catalyze protein cross-linking, which may be useful to improve the performance of protein films. In this study, SLAC was applied to WPI edible film during the film-making process. The results showed that SLAC can catalyze WPI cross-linking without phenolic acid assistance, and WPI film properties were improved after SLAC treatment. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  5. Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

    Science.gov (United States)

    Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

    2014-01-01

    Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

  6. Oxidation of Wine Polyphenols by Secretomes of Wild Botrytis cinerea Strains from White and Red Grape Varieties and Determination of Their Specific Laccase Activity.

    Science.gov (United States)

    Zimdars, Sabrina; Hitschler, Julia; Schieber, Andreas; Weber, Fabian

    2017-12-06

    Processing of Botrytis cinerea-infected grapes leads to enhanced enzymatic browning reactions mainly caused by the enzyme laccase which is able to oxidize a wide range of phenolic compounds. The extent of color deterioration depends on the activity of the enzymes secreted by the fungus. The present study revealed significant differences in the oxidative properties of secretomes of several B. cinerea strains isolated from five grape varieties. The presumed laccase-containing secretomes varied in their catalytic activity toward six phenolic compounds present in grapes. All strains led to identical product profiles for five of six substrates, but two strains showed deviating product profiles during gallic acid oxidation. Fast oxidation of caffeic acid, ferulic acid, and malvidin 3-O-glucoside was observed. Product formation rates and relative product concentrations were determined. The results reflect the wide range of enzyme activity and the corresponding different impact on color deterioration by B. cinerea.

  7. Charge transfer mediator based systems for electrocatalytic oxygen reduction

    Science.gov (United States)

    Stahl, Shannon S.; Gerken, James B.; Anson, Colin W.

    2017-07-18

    Disclosed are systems for the electrocatalytic reduction of oxygen, having redox mediator/redox catalyst pairs and an electrolyte solution in contact with an electrode. The redox mediator is included in the electrolyte solution, and the redox catalyst may be included in the electrolyte solution, or alternatively, may be in contact with the electrolyte solution. In one form a cobalt redox catalyst is used with a quinone redox mediator. In another form a nitrogen oxide redox catalyst is used with a nitroxyl type redox mediator. The systems can be used in electrochemical cells wherein neither the anode nor the cathode comprise an expensive metal such as platinum.

  8. Charge transfer mediator based systems for electrocatalytic oxygen reduction

    Energy Technology Data Exchange (ETDEWEB)

    Stahl, Shannon S.; Gerken, James B.; Anson, Colin W.

    2017-11-07

    Disclosed are systems for the electrocatalytic reduction of oxygen, having redox mediator/redox catalyst pairs and an electrolyte solution in contact with an electrode. The redox mediator is included in the electrolyte solution, and the redox catalyst may be included in the electrolyte solution, or alternatively, may be in contact with the electrolyte solution. In one form a cobalt redox catalyst is used with a quinone redox mediator. In another form a nitrogen oxide redox catalyst is used with a nitroxyl type redox mediator. The systems can be used in electrochemical cells wherein neither the anode nor the cathode comprise an expensive metal such as platinum.

  9. Efficient secretion of three fungal laccases from Saccharomyces cerevisiae and their potential for decolorization of textile industry effluent - A comparative study

    Czech Academy of Sciences Publication Activity Database

    Antošová, Z.; Herkommerová, Klára; Pichová, Iva; Sychrová, H.

    2018-01-01

    Roč. 34, č. 1 (2018), s. 69-80 ISSN 8756-7938 R&D Projects: GA TA ČR(CZ) TA01011461; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : laccase * decolorization * gene expression * expression optimization * Saccharomyces cerevisiae Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 1.986, year: 2016

  10. A systems biology perspective on Nrf2-mediated antioxidant response

    International Nuclear Information System (INIS)

    Zhang Qiang; Pi Jingbo; Woods, Courtney G.; Andersen, Melvin E.

    2010-01-01

    Cells in vivo are constantly exposed to reactive oxygen species (ROS) generated endogenously and exogenously. To defend against the deleterious consequences of ROS, cells contain multiple antioxidant enzymes expressed in various cellular compartments to scavenge these toxic species. Under oxidative stresses, these antioxidant enzymes are upregulated to restore redox homeostasis. Such an adaptive response results from the activation of a redox-sensitive gene regulatory network mediated by nuclear factor E2-related factor 2. To more completely understand how the redox control system is designed by nature to meet homeostatic goals, we have examined the network from a systems perspective using engineering approaches. As with man-made control devices, the redox control system can be decomposed into distinct functional modules, including transducer, controller, actuator, and plant. Cells achieve specific performance objectives by utilizing nested feedback loops, feedforward control, and ultrasensitive signaling motifs, etc. Given that endogenously generated ROS are also used as signaling molecules, our analysis suggests a novel mode of action to explain oxidative stress-induced pathological conditions and diseases. Specifically, by adaptively upregulating antioxidant enzymes, oxidative stress may inadvertently attenuate ROS signals that mediate physiological processes, resulting in aberrations of cellular functions and adverse consequences. Lastly, by simultaneously considering the two competing cellular tasks-adaptive antioxidant defense and ROS signaling-we re-examine the premise that dietary antioxidant supplements is generally beneficial to human health. Our analysis highlights some possible adverse effects of these widely consumed antioxidants.

  11. Causal mediation analysis with multiple causally non-ordered mediators.

    Science.gov (United States)

    Taguri, Masataka; Featherstone, John; Cheng, Jing

    2018-01-01

    In many health studies, researchers are interested in estimating the treatment effects on the outcome around and through an intermediate variable. Such causal mediation analyses aim to understand the mechanisms that explain the treatment effect. Although multiple mediators are often involved in real studies, most of the literature considered mediation analyses with one mediator at a time. In this article, we consider mediation analyses when there are causally non-ordered multiple mediators. Even if the mediators do not affect each other, the sum of two indirect effects through the two mediators considered separately may diverge from the joint natural indirect effect when there are additive interactions between the effects of the two mediators on the outcome. Therefore, we derive an equation for the joint natural indirect effect based on the individual mediation effects and their interactive effect, which helps us understand how the mediation effect works through the two mediators and relative contributions of the mediators and their interaction. We also discuss an extension for three mediators. The proposed method is illustrated using data from a randomized trial on the prevention of dental caries.

  12. Molecular and biochemical characterization of a highly stable bacterial laccase that occurs as a structural component of the Bacillus subtilis endospore coat.

    Science.gov (United States)

    Martins, Ligia O; Soares, Claudio M; Pereira, Manuela M; Teixeira, Miguel; Costa, Teresa; Jones, George H; Henriques, Adriano O

    2002-05-24

    The Bacillus subtilis endospore coat protein CotA shows laccase activity. By using comparative modeling techniques, we were able to derive a model for CotA based on the known x-ray structures of zucchini ascorbate oxidase and Cuprinus cereneus laccase. This model of CotA contains all the structural features of a laccase, including the reactive surface-exposed copper center (T1) and two buried copper centers (T2 and T3). Single amino acid substitutions in the CotA T1 copper center (H497A, or M502L) did not prevent assembly of the mutant proteins into the coat and did not alter the pattern of extractable coat polypeptides. However, in contrast to a wild type strain, both mutants produced unpigmented colonies and spores unable to oxidize syringaldazine (SGZ) and 2'2-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS). The CotA protein was purified to homogeneity from an overproducing Escherichia coli strain. The purified CotA shows an absorbance and a EPR spectra typical of blue multicopper oxidases. Optimal enzymatic activity was found at < or =pH 3.0 and at pH 7.0 for ABTS or SGZ oxidation, respectively. The apparent K(m) values for ABTS and SGZ at 37 degrees C were of 106 +/- 11 and 26 +/- 2 microm, respectively, with corresponding k(cat) values of 16.8 +/- 0.8 and 3.7 +/- 0.1 s(-1). Maximal enzyme activity was observed at 75 degrees C with ABTS as substrate. Remarkably, the coat-associated or the purified enzyme showed a half-life of inactivation at 80 degrees C of about 4 and 2 h, respectively, indicating that CotA is intrinsically highly thermostable.

  13. Natural light illumination system.

    Science.gov (United States)

    Whang, Allen Jong-Woei; Chen, Yi-Yung; Yang, Shu-Hua; Pan, Po-Hsuan; Chou, Kao-Hsu; Lee, Yu-Chi; Lee, Zong-Yi; Chen, Chi-An; Chen, Cheng-Nan

    2010-12-10

    In recent years, green energy has undergone a lot of development and has been the subject of many applications. Many research studies have focused on illumination with sunlight as a means of saving energy and creating healthy lighting. Natural light illumination systems have collecting, transmitting, and lighting elements. Today, most daylight collectors use dynamic concentrators; these include Sun tracking systems. However, this design is too expensive to be cost effective. To create a low-cost collector that can be easily installed on a large building, we have designed a static concentrator, which is prismatic and cascadable, to collect sunlight for indoor illumination. The transmission component uses a large number of optical fibers. Because optical fibers are expensive, this means that most of the cost for the system will be related to transmission. In this paper, we also use a prismatic structure to design an optical coupler for coupling n to 1. With the n-to-1 coupler, the number of optical fibers necessary can be greatly reduced. Although this new natural light illumination system can effectively guide collected sunlight and send it to the basement or to other indoor places for healthy lighting, previously there has been no way to manage the collected sunlight when lighting was not desired. To solve this problem, we have designed an optical switch and a beam splitter to control and separate the transmitted light. When replacing traditional sources, the lighting should have similar characteristics, such as intensity distribution and geometric parameters, to those of traditional artificial sources. We have designed, simulated, and optimized an illumination lightpipe with a dot pattern to redistribute the collected sunlight from the natural light illumination system such that it equals the qualities of a traditional lighting system. We also provide an active lighting module that provides lighting from the natural light illumination system or LED auxiliary

  14. Green coconut fiber: a novel carrier for the immobilization of commercial laccase by covalent attachment for textile dyes decolourization.

    Science.gov (United States)

    Cristóvão, Raquel O; Silvério, Sara C; Tavares, Ana P M; Brígida, Ana Iraidy S; Loureiro, José M; Boaventura, Rui A R; Macedo, Eugénia A; Coelho, Maria Alice Z

    2012-09-01

    Commercial laccase formulation was immobilized on modified green coconut fiber silanized with 3-glycidoxypropyltrimethoxysilane, aiming to achieve a cheap and effective biocatalyst. Two different strategies were followed: one point (pH 7.0) and multipoint (pH 10.0) covalent attachment. The influence of immobilization time on enzymatic activity and the final reduction with sodium borohydride were evaluated. The highest activities were achieved after 2 h of contact time in all situations. Commercial laccase immobilized at pH 7.0 was found to have higher activity and higher affinity to the substrate. However, the immobilization by multipoint covalent attachment improved the biocatalyst thermal stability at 50 °C, when compared to soluble enzyme and to the immobilized enzyme at pH 7.0. The Schiff's bases reduction by sodium borohydride, in spite of causing a decrease in enzyme activity, showed to contribute to the increase of operational stability through bonds stabilization. Finally, these immobilized enzymes showed high efficiency in the continuous decolourization of reactive textile dyes. In the first cycle, the decolourization is mainly due to dyes adsorption on the support. However, when working in successive cycles, the adsorption capacity of the support decreases (saturation) and the enzymatic action increases, indicating the applicability of this biocatalyst for textile wastewater treatment.

  15. Reuma.pt contribution to the knowledge of immune-mediated systemic rheumatic diseases.

    Science.gov (United States)

    Santos, Maria José; Canhão, Helena; Mourão, Ana Filipa; Oliveira Ramos, Filipa; Ponte, Cristina; Duarte, Cátia; Barcelos, Anabela; Martins, Fernando; Melo Gomes, José António

    2017-01-01

    Patient registries are key instruments aimed at a better understanding of the natural history of diseases, at assessing the effectiveness of therapeutic interventions, as well as identifying rare events or outcomes that are not captured in clinical trials. However, the potential of registries goes far beyond these aspects. For example, registries promote the standardization of clinical practice, can also provide information on domains that are not routinely collected in clinical practice and can support decision-making. Being aware of the importance of registries, the Portuguese Society of Rheumatology developed the Rheumatic Diseases Portuguese Register- Reuma.pt - which proved to be an innovative instrument essential to a better understanding of systemic immune-mediated rheumatic diseases. To describe the contribution of Reuma.pt to the knowledge of systemic immune-mediated rheumatic diseases. Reuma.pt is widely implemented, with 77 centres actively contributing to the recruitment and follow-up of patients. Reuma.pt follows in a standardized way patients with the following systemic inflammatory rheumatic diseases: rheumatoid arthritis (n=6218), psoriatic arthritis (n=1498), spondyloarthritis (n=2529), juvenile idiopathic arthritis (n =1561), autoinflammatory syndromes (n=122), systemic lupus erythematosus (n =1718), systemic sclerosis (n=180) and vasculitis (n=221). This platform is intended for use as an electronic medical record, provides standardized assessment of patients and support to the clinical decision, thereby contributing to a better quality of care of rheumatic patients. The research based on Reuma.pt identified genetic determinants of susceptibility and response to therapy, characterized in detail systemic rheumatic diseases and their long-term impact, critically appraised the performance of instruments for monitoring the disease activity, established the effectiveness and safety of biologic therapies and identified predictors of response, and

  16. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  17. A synthetic redox biofilm made from metalloprotein-prion domain chimera nanowires

    Science.gov (United States)

    Altamura, Lucie; Horvath, Christophe; Rengaraj, Saravanan; Rongier, Anaëlle; Elouarzaki, Kamal; Gondran, Chantal; Maçon, Anthony L. B.; Vendrely, Charlotte; Bouchiat, Vincent; Fontecave, Marc; Mariolle, Denis; Rannou, Patrice; Le Goff, Alan; Duraffourg, Nicolas; Holzinger, Michael; Forge, Vincent

    2017-02-01

    Engineering bioelectronic components and set-ups that mimic natural systems is extremely challenging. Here we report the design of a protein-only redox film inspired by the architecture of bacterial electroactive biofilms. The nanowire scaffold is formed using a chimeric protein that results from the attachment of a prion domain to a rubredoxin (Rd) that acts as an electron carrier. The prion domain self-assembles into stable fibres and provides a suitable arrangement of redox metal centres in Rd to permit electron transport. This results in highly organized films, able to transport electrons over several micrometres through a network of bionanowires. We demonstrate that our bionanowires can be used as electron-transfer mediators to build a bioelectrode for the electrocatalytic oxygen reduction by laccase. This approach opens opportunities for the engineering of protein-only electron mediators (with tunable redox potentials and optimized interactions with enzymes) and applications in the field of protein-only bioelectrodes.

  18. Mill Designed Bio bleaching Technologies

    Energy Technology Data Exchange (ETDEWEB)

    Institute of Paper Science Technology

    2004-01-30

    A key finding of this research program was that Laccase Mediator Systems (LMS) treatments on high-kappa kraft could be successfully accomplished providing substantial delignification (i.e., > 50%) without detrimental impact on viscosity and significantly improved yield properties. The efficiency of the LMS was evident since most of the lignin from the pulp was removed in less than one hour at 45 degrees C. Of the mediators investigated, violuric acid was the most effective vis-a-vis delignification. A comparative study between oxygen delignification and violuric acid revealed that under relatively mild conditions, a single or a double LMS{sub VA} treatment is comparable to a single or a double O stage. Of great notability was the retention of end viscosity of LMS{sub VA} treated pulps with respect to the end viscosity of oxygen treated pulps. These pulps could then be bleached to full brightness values employing conventional ECF bleaching technologies and the final pulp physical properties were equal and/or better than those bleached in a conventional ECF manner employing an aggressively O or OO stage initially. Spectral analyses of residual lignins isolated after LMS treated high-kappa kraft pulps revealed that similar to HBT, VA and NHA preferentially attack phenolic lignin moieties. In addition, a substantial decrease in aliphatic hydroxyl groups was also noted, suggesting side chain oxidation. In all cases, an increase in carboxylic acid was observed. Of notable importance was the different selectivity of NHA, VA and HBT towards lignin functional groups, despite the common N-OH moiety. C-5 condensed phenolic lignin groups were overall resistant to an LMS{sub NHA, HBT} treatments but to a lesser extent to an LMS{sub VA}. The inactiveness of these condensed lignin moieties was not observed when low-kappa kraft pulps were biobleached, suggesting that the LMS chemistry is influenced by the extent of delignification. We have also demonstrated that the current

  19. Changes is genes coding for laccases 1 and 2 may contribute to deformation and reduction of wings in apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) from the isolated population in Pieniny National Park (Poland).

    Science.gov (United States)

    Łukasiewicz, Kinga; Węgrzyn, Grzegorz

    2016-01-01

    An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park.

  20. Laccase-catalyzed C-S and C-C coupling for a one-pot synthesis of 1,4-naphthoquinone sulfides and 1,4-naphthoquinone sulfide dimers

    CSIR Research Space (South Africa)

    Wellington, Kevin W

    2013-06-01

    Full Text Available Oxidative C-S and C-C bond formation with aryl and alkyl thiols was catalyzed under mild conditions in a reaction vessel open to air at pH 4.5 in the presence of a commercial laccase (Novozym 51003 or Suberase) and a cosolvent (DMF) to afford 1...

  1. Bayesian dynamic mediation analysis.

    Science.gov (United States)

    Huang, Jing; Yuan, Ying

    2017-12-01

    Most existing methods for mediation analysis assume that mediation is a stationary, time-invariant process, which overlooks the inherently dynamic nature of many human psychological processes and behavioral activities. In this article, we consider mediation as a dynamic process that continuously changes over time. We propose Bayesian multilevel time-varying coefficient models to describe and estimate such dynamic mediation effects. By taking the nonparametric penalized spline approach, the proposed method is flexible and able to accommodate any shape of the relationship between time and mediation effects. Simulation studies show that the proposed method works well and faithfully reflects the true nature of the mediation process. By modeling mediation effect nonparametrically as a continuous function of time, our method provides a valuable tool to help researchers obtain a more complete understanding of the dynamic nature of the mediation process underlying psychological and behavioral phenomena. We also briefly discuss an alternative approach of using dynamic autoregressive mediation model to estimate the dynamic mediation effect. The computer code is provided to implement the proposed Bayesian dynamic mediation analysis. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  2. Magnitude and Mechanism of Siderophore-Mediated Competition at Low Iron Solubility in the Pseudomonas aeruginosa Pyochelin System

    Directory of Open Access Journals (Sweden)

    Konstanze T. Schiessl

    2017-10-01

    Full Text Available A central question in microbial ecology is whether microbial interactions are predominantly cooperative or competitive. The secretion of siderophores, microbial iron chelators, is a model system for cooperative interactions. However, siderophores have also been shown to mediate competition by sequestering available iron and making it unavailable to competitors. The details of how siderophores mediate competition are not well understood, especially considering the complex distribution of iron phases in the environment. One pertinent question is whether sequestering iron through siderophores can indeed be effective in natural conditions; many natural environments are characterized by large pools of precipitated iron, and it is conceivable that any soluble iron that is sequestered by siderophores is replenished by the dissolution of these precipitated iron sources. Our goal here was to address this issue, and investigate the magnitude and mechanism of siderophore-mediated competition in the presence of precipitated iron. We combined experimental work with thermodynamic modeling, using Pseudomonas aeruginosa as a model system and ferrihydrite precipitates as the iron source with low solubility. Our experiments show that competitive growth inhibition by the siderophore pyochelin is indeed efficient, and that inhibition of a competitor can even have a stronger growth-promoting effect than solubilization of precipitated iron. Based on the results of our thermodynamic models we conclude that the observed inhibition of a competitor is effective because sequestered iron is only very slowly replenished by the dissolution of precipitated iron. Our research highlights the importance of competitive benefits mediated by siderophores, and underlines that the dynamics of siderophore production and uptake in environmental communities could be a signature of competitive, not just cooperative, dynamics.

  3. Magnitude and Mechanism of Siderophore-Mediated Competition at Low Iron Solubility in the Pseudomonas aeruginosa Pyochelin System.

    Science.gov (United States)

    Schiessl, Konstanze T; Janssen, Elisabeth M-L; Kraemer, Stephan M; McNeill, Kristopher; Ackermann, Martin

    2017-01-01

    A central question in microbial ecology is whether microbial interactions are predominantly cooperative or competitive. The secretion of siderophores, microbial iron chelators, is a model system for cooperative interactions. However, siderophores have also been shown to mediate competition by sequestering available iron and making it unavailable to competitors. The details of how siderophores mediate competition are not well understood, especially considering the complex distribution of iron phases in the environment. One pertinent question is whether sequestering iron through siderophores can indeed be effective in natural conditions; many natural environments are characterized by large pools of precipitated iron, and it is conceivable that any soluble iron that is sequestered by siderophores is replenished by the dissolution of these precipitated iron sources. Our goal here was to address this issue, and investigate the magnitude and mechanism of siderophore-mediated competition in the presence of precipitated iron. We combined experimental work with thermodynamic modeling, using Pseudomonas aeruginosa as a model system and ferrihydrite precipitates as the iron source with low solubility. Our experiments show that competitive growth inhibition by the siderophore pyochelin is indeed efficient, and that inhibition of a competitor can even have a stronger growth-promoting effect than solubilization of precipitated iron. Based on the results of our thermodynamic models we conclude that the observed inhibition of a competitor is effective because sequestered iron is only very slowly replenished by the dissolution of precipitated iron. Our research highlights the importance of competitive benefits mediated by siderophores, and underlines that the dynamics of siderophore production and uptake in environmental communities could be a signature of competitive, not just cooperative, dynamics.

  4. NK-cell-dependent killing of colon carcinoma cells is mediated by natural cytotoxicity receptors (NCRs) and stimulated by parvovirus infection of target cells

    International Nuclear Information System (INIS)

    Bhat, Rauf; Rommelaere, Jean

    2013-01-01

    Investigating how the immune system functions during malignancies is crucial to developing novel therapeutic strategies. Natural killer (NK) cells, an important component of the innate immune system, play a vital role in immune defense against tumors and virus-infected cells. The poor survival rate in colon cancer makes it particularly important to develop novel therapeutic strategies. Oncolytic viruses, in addition to lysing tumor cells, may have the potential to augment antitumor immune responses. In the present study, we investigate the role of NK cells and how parvovirus H-1PV can modulate NK-cell mediated immune responses against colon carcinoma. Human NK cells were isolated from the blood of healthy donors. The cytotoxicity and antibody-mediated inhibition of NK cells were measured in chromium release assays. Phenotypic assessment of colon cancer and dendritic cells was done by FACS. The statistical significance of the results was calculated with Student’s t test (*p <0.05; **, p < 0.01; ***, p < 0.001). We show that IL-2-activated human NK cells can effectively kill colon carcinoma cells. Killing of colon carcinoma cells by NK cells was further enhanced upon infection of the former cells with parvovirus H-1PV. H-1PV has potent oncolytic activity against various tumors, yet its direct killing effect on colon carcinoma cells is limited. The cytotoxicity of NK cells towards colon carcinoma cells, both mock- and H-1PV-infected, was found to be mostly mediated by a combination of natural cytotoxicity receptors (NCRs), namely NKp30, 44, and 46. Colon carcinoma cells displayed low to moderate expression of NK cell ligands, and this expression was modulated upon H-1PV infection. Lysates of H-1PV-infected colon carcinoma cells were found to increase MHC class II expression on dendritic cells. Altogether, these data suggest that IL-2-activated NK cells actively kill colon carcinoma cells and that this killing is mediated by several natural cytotoxicity receptors

  5. Comparison of the chemical properties of wheat straw and beech fibers following alkaline wet oxidation and laccase treatments

    DEFF Research Database (Denmark)

    Schmidt, A. S.; Mallon, S.; Thomsen, Anne Belinda

    2002-01-01

    Wheat straw (Triticum aestivum) and beech (Fagus sylvatica), were used to evaluate the effects of two pre-treatment processes (alkaline wet oxidation and enzyme treatment with laccase) on lignocellulosic materials for applications in particleboards and fiberboards. Wheat straw and beech fibers...... treatment gave a more reactive surface than alkaline wet oxidation for wheat straw, whereas the opposite was observed for beech. Fourier transform infrared (FT-IR) spectroscopy showed an almost complete loss of the ester carbonyl stretching signal and the corresponding C-C-O stretching in wet...

  6. The Nature of Negotiations in Face-to-Face versus Computer-Mediated Communication in Pair Interactions

    Science.gov (United States)

    Rouhshad, Amir; Wigglesworth, Gillian; Storch, Neomy

    2016-01-01

    The Interaction Approach argues that negotiation for meaning and form is conducive to second language development. To date, most of the research on negotiations has been either in face-to-face (FTF) or text-based synchronous computer-mediated communication (SCMC) modes. Very few studies have compared the nature of negotiations across the modes.…

  7. Target motifs affecting natural immunity by a constitutive CRISPR-Cas system in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Cristóbal Almendros

    Full Text Available Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR and CRISPR associated (cas genes conform the CRISPR-Cas systems of various bacteria and archaea and produce degradation of invading nucleic acids containing sequences (protospacers that are complementary to repeat intervening spacers. It has been demonstrated that the base sequence identity of a protospacer with the cognate spacer and the presence of a protospacer adjacent motif (PAM influence CRISPR-mediated interference efficiency. By using an original transformation assay with plasmids targeted by a resident spacer here we show that natural CRISPR-mediated immunity against invading DNA occurs in wild type Escherichia coli. Unexpectedly, the strongest activity is observed with protospacer adjoining nucleotides (interference motifs that differ from the PAM both in sequence and location. Hence, our results document for the first time native CRISPR activity in E. coli and demonstrate that positions next to the PAM in invading DNA influence their recognition and degradation by these prokaryotic immune systems.

  8. Influence of pH on the growth, laccase activity and RBBR decolorization by tropical basidiomycetes

    Directory of Open Access Journals (Sweden)

    Sérgio Luiz Moreira Neto

    2009-10-01

    Full Text Available The basidiomycete fungi Lentinus crinitus and Psilocybe castanella are being evaluated in a bioremediation process of soils contaminated with organochlorine industrial residues in the Baixada Santista, São Paulo. The aim of the present study was to determine the influence of pH on the fungal growth, in vitro decolorization of anthraquinonic dye Remazol Brilliant Blue R (RBBR and laccase activity. The pH of the culture medium influenced the growth of L. crinitus and P. castanella, which presented less growth at pH 5.9 and pH 2.7, respectively. The fungi were able to modify the pH of the culture medium, adjusting it to the optimum pH for growth which was close to 4.5. Decolorization of the RBBR was maximal at a pH of 2.5 to 3.5. Higher laccase activity was observed at pH 3.5 and pH 4.5 for L. crinitus and P. castanella, respectively. pH was found to be an important parameter for both the growth of these fungi and the enzymatic system involved in RBBR decolorization.Os fungos basidiomicetos Lentinus crinitus e Psilocybe castanella estão sendo avaliados em processo de biorremediação de solos contaminados com resíduos industriais organoclorados, na Baixada Santista, SP. O presente estudo avaliou a influência do pH no crescimento, na descoloração in vitro do corante Azul Brilhante de Remazol R (RBBR e na atividade de lacase durante cultivo destes fungos, de forma a subsidiar a otimização do processo. O pH do meio influenciou o crescimento de L. crinitus e de P. castanella, com menor biomassa em pH 5,9 e pH 2,7, respectivamente. Os fungos foram capazes de modificar o pH inicial do meio de cultura, de modo a ajustá-lo ao valor ótimo de crescimento, próximo a 4,5. Descoloração in vitro do RBBR foi máxima em pH 2,5 e 3,5. Maiores atividades de lacase foram obtidas em pH 3,5 e em pH 4,5 para L. crinitus e P. castanella, respectivamente. Evidenciou-se que o pH é um parâmetro importante para o crescimento destes fungos, atividade de lacase

  9. The Bucket System – A computer mediated signaling system for group improvisation

    DEFF Research Database (Denmark)

    Dahlstedt, Palle; Nilsson, Per Anders; Robair, Gino

    2015-01-01

    The Bucket System is a new system for computer-mediated ensemble improvisation, designed by improvisers for improvisers. Coming from a tradition of structured free ensemble improvisation practices (comprovisation), influenced by post-WW2 experimental music practices, it is a signaling system...

  10. Setting the stage for electron transfer: Molecular basis of ABTS-binding to four laccases from Trametes versicolor at variable pH and protein oxidation state

    DEFF Research Database (Denmark)

    Christensen, Niels Johan; Kepp, Kasper Planeta

    2014-01-01

    , very high (R2∼0.99) correlation was observed between logKm (ABTS) and binding-pocket charge due to sites 157, 161, 269, 271, and 333, i.e. laccases optimal for ABTS turnover have positively charged anchor points in their pockets. Our work also demonstrates how activity-constraints can markedly improve...

  11. Mediation analysis with multiple versions of the mediator.

    Science.gov (United States)

    Vanderweele, Tyler J

    2012-05-01

    The causal inference literature has provided definitions of direct and indirect effects based on counterfactuals that generalize the approach found in the social science literature. However, these definitions presuppose well-defined hypothetical interventions on the mediator. In many settings, there may be multiple ways to fix the mediator to a particular value, and these various hypothetical interventions may have very different implications for the outcome of interest. In this paper, we consider mediation analysis when multiple versions of the mediator are present. Specifically, we consider the problem of attempting to decompose a total effect of an exposure on an outcome into the portion through the intermediate and the portion through other pathways. We consider the setting in which there are multiple versions of the mediator but the investigator has access only to data on the particular measurement, not information on which version of the mediator may have brought that value about. We show that the quantity that is estimated as a natural indirect effect using only the available data does indeed have an interpretation as a particular type of mediated effect; however, the quantity estimated as a natural direct effect, in fact, captures both a true direct effect and an effect of the exposure on the outcome mediated through the effect of the version of the mediator that is not captured by the mediator measurement. The results are illustrated using 2 examples from the literature, one in which the versions of the mediator are unknown and another in which the mediator itself has been dichotomized.

  12. Combined enzymatic and physical deinking methodology for efficient eco-friendly recycling of old newsprint.

    Directory of Open Access Journals (Sweden)

    Antar Puneet Virk

    Full Text Available BACKGROUND: The development in the deinking process has made recycled fiber a major part of the raw material for pulp and paper industry. Enzymes have revolutionized the deinking process obtaining brightness levels surpassing conventional deinking processes. This study explores the deinking efficiencies of bacterial alkalophilic laccase (L and xylanase (X enzymes along with physical deinking methods of microwaving (MW and sonication (S for recycling of old newsprint (ONP. METHODS AND RESULTS: The operational parameters viz. enzyme dose, pH and treatment time for X and L deinking were optimized statistically using Response Surface Methodology. Laccase did not require any mediator supplementation for deinking. Deinking of ONP pulp with a combination of xylanase and laccase enzymes was investigated, and fiber surface composition and morphological changes were studied using X-ray diffraction, fourier transform infrared spectroscopy and scanning electron microscopy. Compared to the pulp deinked with xylanase (47.9% or laccase (62.2% individually, the percentage reduction of effective residual ink concentration (ERIC was higher for the combined xylanase/laccase-deinked pulp (65.8%. An increase in brightness (21.6%, breaking length (16.5%, burst factor (4.2% tear factor (6.9%, viscosity (13% and cellulose crystallinity (10.3% along with decrease in kappa number (22% and chemical consumption (50% were also observed. Surface appeared more fibrillar along with changes in surface functional groups. A combination of physical and enzymatic processes (S-MW-XL for deinking further improved brightness (28.8% and decreased ERIC (73.9% substantially. CONCLUSION: This is the first report on deinking of ONP with laccase without any mediator supplementation. XL pretreatment resulted in marked improvement in paper quality and a new sequence being reported for deinking (S-MW-XL will contribute further in decreasing chemical consumption and making the process

  13. Decolorization of the azo dye Acid Orange 51 by laccase produced in solid culture of a newly isolated Trametes trogii strain

    OpenAIRE

    Daâssi, Dalel; Zouari-Mechichi, Héla; Frikha, Fakher; Martínez, María Jesús; Nasri, M.; Mechichi, Tahar

    2013-01-01

    This study concerns the decolorization and detoxification of the azo dye Acid Orange 51 (AO51) by crude laccase from Trametes trogii produced in solid culture using sawdust as support media. A three-level Box?Behnken factorial design with four factors (enzyme concentration, 1-hydroxybenzotriazole (HBT) concentration, dye concentration and reaction time) combined with response surface methodology was applied to optimize AO51 decolorization. A mathematical model was developed showing the effect...

  14. Studies on Agrobacterium-mediated genetic transformation of ...

    African Journals Online (AJOL)

    SERVER

    2008-03-04

    Mar 4, 2008 ... Sweet potato (Ipomoea batatas) is the sixth most impor- tant crop in the world after ... mediated transformation system does not involve sophis- .... (w/v) agarose gel. .... This work was supported by National Natural Science.

  15. Volatile-Mediated within-Plant Signaling in Hybrid Aspen: Required for Systemic Responses.

    Science.gov (United States)

    Li, Tao; Blande, James D

    2017-04-01

    Plant volatiles play crucial roles in signaling between plants and their associated community members, but their role in within-plant signaling remains largely unexplored, particularly under field conditions. Using a system comprising the hybrid aspen (Populus tremula x tremuloides) and the specialized herbivorous leaf beetle (Phratora laticollis) and, combining field, greenhouse and laboratory experiments, we examined whether local damage triggered systemic responses in undamaged branches that lack vascular connection to the damaged branches, and to what extent this was caused by airborne volatile signals versus internal signals. An experiment tracing dye through the vasculature of saplings revealed no downward movement of the dye from upper to lower branches, suggesting a lack of vascular connectivity among branches. However, we found under both field and laboratory conditions that herbivore feeding on upper branches elicited volatile emissions by undamaged lower branches. Greenhouse experiments manipulating air contact between damaged and undamaged branches showed that systemic induction of volatiles was almost eliminated when air contact was interrupted. Our findings clearly demonstrate that herbivore-induced volatiles overcome vascular constraints and mediate within-plant signaling. Further, we found that volatile signaling led to induction of different classes of volatiles under field and environment controlled conditions, with a weaker response observed in the field. This difference not only reflects the dose- and time-dependent nature of volatile signaling, but also points out that future studies should focus more on field observations to better understand the ecological role of volatile-mediated within-plant signaling.

  16. Accurate Stabilities of Laccase Mutants Predicted with a Modified FoldX Protocol

    DEFF Research Database (Denmark)

    Christensen, Niels Johan; Kepp, Kasper Planeta

    2012-01-01

    ) with up to 11 simultaneously mutated sites with good correlation against experimental stability trends. Molecular dynamics simulations of the two laccases show that FoldX is very structure-sensitive, since all mutants and the wild-type must share structural configuration to avoid artifacts of local...... sampling. However, using the average of 50 MD snapshots of the equilibrated trajectories restores correlation (r ~0.7-0.9, r2 ~0.49-0.81) and provides a root-mean-square accuracy of ~1.2 kcal/mol for ∆∆G or 3.5 ○C for T50, suggesting that the time-average of the crystal structure is recovered. MD......-averaged input also reduces the spread in ∆∆G, suggesting that local FoldX sampling overestimates free energy changes because of neglected protein relaxation. FoldX can be viewed as a simple “linear interaction energy” method using sampling of wild-type and mutant and a parameterized relative free energy...

  17. Bioconversion of Biomass-Derived Phenols Catalyzed by Myceliophthora thermophila Laccase

    Directory of Open Access Journals (Sweden)

    Anastasia Zerva

    2016-04-01

    Full Text Available Biomass-derived phenols have recently arisen as an attractive alternative for building blocks to be used in synthetic applications, due to their widespread availability as an abundant renewable resource. In the present paper, commercial laccase from the thermophilic fungus Myceliophthora thermophila was used to bioconvert phenol monomers, namely catechol, pyrogallol and gallic acid in water. The resulting products from catechol and gallic acid were polymers that were partially characterized in respect to their optical and thermal properties, and their average molecular weight was estimated via solution viscosity measurements and GPC. FT-IR and 1H-NMR data suggest that phenol monomers are connected with ether or C–C bonds depending on the starting monomer, while the achieved molecular weight of polycatechol is found higher than the corresponding poly(gallic acid. On the other hand, under the same condition, pyrogallol was dimerized in a pure red crystalline compound and its structure was confirmed by 1H-NMR as purpurogallin. The herein studied green synthesis of enzymatically synthesized phenol polymers or biological active compounds could be exploited as an alternative synthetic route targeting a variety of applications.

  18. Integrating hospital information systems in healthcare institutions: a mediation architecture.

    Science.gov (United States)

    El Azami, Ikram; Cherkaoui Malki, Mohammed Ouçamah; Tahon, Christian

    2012-10-01

    Many studies have examined the integration of information systems into healthcare institutions, leading to several standards in the healthcare domain (CORBAmed: Common Object Request Broker Architecture in Medicine; HL7: Health Level Seven International; DICOM: Digital Imaging and Communications in Medicine; and IHE: Integrating the Healthcare Enterprise). Due to the existence of a wide diversity of heterogeneous systems, three essential factors are necessary to fully integrate a system: data, functions and workflow. However, most of the previous studies have dealt with only one or two of these factors and this makes the system integration unsatisfactory. In this paper, we propose a flexible, scalable architecture for Hospital Information Systems (HIS). Our main purpose is to provide a practical solution to insure HIS interoperability so that healthcare institutions can communicate without being obliged to change their local information systems and without altering the tasks of the healthcare professionals. Our architecture is a mediation architecture with 3 levels: 1) a database level, 2) a middleware level and 3) a user interface level. The mediation is based on two central components: the Mediator and the Adapter. Using the XML format allows us to establish a structured, secured exchange of healthcare data. The notion of medical ontology is introduced to solve semantic conflicts and to unify the language used for the exchange. Our mediation architecture provides an effective, promising model that promotes the integration of hospital information systems that are autonomous, heterogeneous, semantically interoperable and platform-independent.

  19. Epinephrine mediates facultative carbohydrate-induced thermogenesis in human skeletal muscle

    DEFF Research Database (Denmark)

    Astrup, A; Simonsen, L; Bülow, J

    1989-01-01

    The thermic effect of carbohydrate has a component mediated by the sympathoadrenal system but of unknown anatomical localization. We have studied the contribution of skeletal muscle to the thermic effect of a carbohydrate-rich natural meal (115 g of carbohydrate, approximately 80% of energy...... postprandially and coinciding with the peak in arterial epinephrine. The present study provides evidence of a facultative thermogenic component in skeletal muscle, mediated by epinephrine via beta 2-adrenoreceptors. However, it also points to a nonmuscle component mediated through beta 1-adrenoceptors...... by norepinephrine released from the sympathetic nervous system. Consequently, the sympathoadrenal system seems to play a physiological role in the daily energy balance....

  20. Ratio-of-Mediator-Probability Weighting for Causal Mediation Analysis in the Presence of Treatment-by-Mediator Interaction

    Science.gov (United States)

    Hong, Guanglei; Deutsch, Jonah; Hill, Heather D.

    2015-01-01

    Conventional methods for mediation analysis generate biased results when the mediator--outcome relationship depends on the treatment condition. This article shows how the ratio-of-mediator-probability weighting (RMPW) method can be used to decompose total effects into natural direct and indirect effects in the presence of treatment-by-mediator…

  1. Establishment of a simple and efficient Agrobacterium-mediated transformation system for Phytophthora palmivora.

    Science.gov (United States)

    Wu, Dongliang; Navet, Natasha; Liu, Yingchao; Uchida, Janice; Tian, Miaoying

    2016-09-06

    As an agriculturally important oomycete genus, Phytophthora contains a large number of destructive plant pathogens that severely threaten agricultural production and natural ecosystems. Among them is the broad host range pathogen P. palmivora, which infects many economically important plant species. An essential way to dissect their pathogenesis mechanisms is genetic modification of candidate genes, which requires effective transformation systems. Four methods were developed for transformation of Phytophthora spp., including PEG(polyethylene glycol)/CaCl2 mediated protoplast transformation, electroporation of zoospores, microprojectile bombardment and Agrobacterium-mediated transformation (AMT). Among them, AMT has many advantages over the other methods such as easy handling and mainly generating single-copy integration in the genome. An AMT method previously reported for P. infestans and P. palmivora has barely been used in oomycete research due to low success and low reproducibility. In this study, we report a simple and efficient AMT system for P. palmivora. Using this system, we were able to reproducibly generate over 40 transformants using zoospores collected from culture grown in a single 100 mm-diameter petri dish. The generated GFP transformants constitutively expressed GFP readily detectable using a fluorescence microscope. All of the transformants tested using Southern blot analysis contained a single-copy T-DNA insertion. This system is highly effective and reproducible for transformation of P. palmivora and expected to be adaptable for transformation of additional Phytophthora spp. and other oomycetes. Its establishment will greatly accelerate their functional genomic studies.

  2. Computer-Mediated Communications Systems: Will They Catch On?

    Science.gov (United States)

    Cook, Dave; Ridley, Michael

    1990-01-01

    Describes the use of CoSy, a computer conferencing system, by academic librarians at McMaster University in Ontario. Computer-mediated communications systems (CMCS) are discussed, the use of the system for electronic mail and computer conferencing is described, the perceived usefulness of CMCS is examined, and a sidebar explains details of the…

  3. High level secretion of laccase (LccH from a newly isolated white rot basidiomycete, Hexagonia hirta MSF2

    Directory of Open Access Journals (Sweden)

    Sujatha eKandhasamy

    2016-05-01

    Full Text Available Newer and novel laccases attract considerable attention due to its promising and valuable multiple applications in biotech industry. This present investigation documents, for the first time, on high level extracellular secretion of laccase (LccH in newly isolated wood-degrading basidiomycete Hexagonia hirta MSF2. LccH was optimally active at 40°C in citrate phosphate buffer with a pH of 3.4. Optimized Cu2+ in glucose yeast extract (GY medium enhanced the LccH production by H. hirta to 1944.44 U.ml-1. A further increment in LccH activity of 5671.30 U.ml-1 was achieved by the addition of a phenolic inducer, 2,5 Xylidine. Zymogram and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE analysis of LccH revealed that LccH is a monomer with a molecular mass of 66 kDa. MALDI-TOF-MS based peptide mass fingerprinting and comparative modelling of the amino acid sequence of LccH showed that it was closer to Trametes sp. AH28-2 (PDB: 3KW7 with 48% identity, 95% coverage, 0.011 alignment score and RMSD of 0.497Å. Crude LccH delignified lignocellulosic biomass such as wood and corncob, to a level of 28.6 and 16.5 % respectively. Such high level secretion, thermal and solvent stability of LccH make H.hirta a potential candidate not only for LccH production and biodelignification but also generation of lignin derived aromatic feed stock chemicals for industrial and environmental applications.

  4. Corrosion inhibition of iota-carrageenan natural polymer on aluminum in presence of zwitterion mediator in HCl media

    International Nuclear Information System (INIS)

    Fares, Mohammad M.; Maayta, A.K.; Al-Mustafa, Jamil A.

    2012-01-01

    Highlights: ► Inhibition of Al by ι-carrageenan in the presence of zwitterion mediator was investigated. ► Considerable improvement in inhibition efficiency observed in the presence of zwitterion mediator. ► Coherent physical adsorption layer was evidenced by kinetic and thermodynamic parameters. ► Small but consistent fractured island layers observed after acid exposure as revealed by SEM images. - Abstract: ι-Carrageenan a natural polymer has been used as corrosion inhibitor of aluminum in presence of pefloxacin mesylate, acting as zwitterionic mediator, in acidic medium. Considerable improvement in inhibition efficiency occurred in the presence of the mediator. Activation energy of corrosion and other thermodynamic parameters such as standard free energy, standard enthalpy, and standard entropy of the adsorption process revealed better and well-ordered physical adsorption layers in presence of pefloxacin. Adsorption isotherms in absence or presence of pefloxacin mediator appropriately fit in the Langmuir isotherms. The scanning electron microscope (SEM) images demonstrated smooth, glossy, and relatively coherent adsorption layers of the inhibitor on the metal surface in aqueous solution. After the exposure to 2.0 M HCl for 2 h, a smaller but consistent regular shaped fractured layer is obtained.

  5. Enhanced performance of a glucose/O(2) biofuel cell assembled with laccase-covalently immobilized three-dimensional macroporous gold film-based biocathode and bacterial surface displayed glucose dehydrogenase-based bioanode.

    Science.gov (United States)

    Hou, Chuantao; Yang, Dapeng; Liang, Bo; Liu, Aihua

    2014-06-17

    The power output and stability of enzyme-based biofuel cells (BFCs) is greatly dependent on the properties of both the biocathode and bioanode, which may be adapted for portable power production. In this paper, a novel highly uniform three-dimensional (3D) macroporous gold (MP-Au) film was prepared by heating the gold "supraspheres", which were synthesized by a bottom-up protein templating approach, and followed by modification of laccase on the MP-Au film by covalent immobilization. The as-prepared laccase/MP-Au biocathode exihibited an onset potential of 0.62 V versus saturated calomel electrode (SCE, or 0.86 V vs NHE, normal hydrogen electrode) toward O2 reduction and a high catalytic current of 0.61 mAcm(-2). On the other hand, mutated glucose dehydrogenase (GDH) surface displayed bacteria (GDH-bacteria) were used to improve the stability of the glucose oxidation at the bioanode. The as-assembled membraneless glucose/O2 fuel cell showed a high power output of 55.8 ± 2.0 μW cm(-2) and open circuit potential of 0.80 V, contributing to the improved electrocatalysis toward O2 reduction at the laccase/MP-Au biocathode. Moreover, the BFC retained 84% of its maximal power density even after continuous operation for 55 h because of the high stability of the bacterial surface displayed GDH mutant toward glucose oxidation. Our findings may be promising for the development of more efficient glucose BFC for portable battery or self-powered device applications.

  6. Integration of Artificial Neural Network Modeling and Genetic Algorithm Approach for Enrichment of Laccase Production in Solid State Fermentation by Pleurotus ostreatus

    OpenAIRE

    Potu Venkata Chiranjeevi; Moses Rajasekara Pandian; Sathish Thadikamala

    2014-01-01

    Black gram husk was used as a solid substrate for laccase production by Pleurotus ostreatus, and various fermentation conditions were optimized based on an artificial intelligence method. A total of six parameters, i.e., temperature, inoculum concentration, moisture content, CuSO4, glucose, and peptone concentrations, were optimized. A total of 50 experiments were conducted, and the obtained data were modeled by a hybrid of artificial neural network (ANN) and genetic algorithm (GA) approaches...

  7. Patterns in natural systems

    NARCIS (Netherlands)

    Sewalt, L.

    2016-01-01

    In the thesis, `Patterns in natural systems’ the formation and evolution of patterns as solutions of several partial differential systems are studied. These mathematical systems model three different biological and ecological processes. First, the way that plankton concentrates in the water column,

  8. Aspirin and lipid mediators in the cardiovascular system.

    Science.gov (United States)

    Schrör, Karsten; Rauch, Bernhard H

    2015-09-01

    Aspirin is an unique compound because it bears two active moieties within one and the same molecule: a reactive acetyl group and the salicylate metabolite. Salicylate has some effects similar to aspirin, however only at higher concentrations, usually in the millimolar range, which are not obtained at conventional antiplatelet aspirin doses of 100-300 mg/day. Pharmacological actions of aspirin in the cardiovascular system at these doses are largely if not entirely due to target structure acetylation. Several classes of lipid mediators become affected: Best known is the cyclooxygenase-1 (COX-1) in platelets with subsequent inhibition of thromboxane and, possibly, thrombin formation. By this action, aspirin also inhibits paracrine thromboxane functions on other lipid mediators, such as the platelet storage product sphingosine-1-phosphate (S1P), an inflammatory mediator. Acetylation of COX-2 allows for generation of 15-(R)HETE and subsequent formation of "aspirin-triggered lipoxin" (ATL) by interaction with white cell lipoxygenases. In the cardiovascular system, aspirin also acetylates eNOS with subsequent upregulation of NO formation and enhanced expression of the antioxidans heme-oxygenase-1. This action is possibly also COX-2/ATL mediated. Many more acetylation targets have been identified in live cells by quantitative acid-cleavable activity-based protein profiling and might result in discovery of even more aspirin targets in the near future. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Causal mediation analysis with multiple mediators.

    Science.gov (United States)

    Daniel, R M; De Stavola, B L; Cousens, S N; Vansteelandt, S

    2015-03-01

    In diverse fields of empirical research-including many in the biological sciences-attempts are made to decompose the effect of an exposure on an outcome into its effects via a number of different pathways. For example, we may wish to separate the effect of heavy alcohol consumption on systolic blood pressure (SBP) into effects via body mass index (BMI), via gamma-glutamyl transpeptidase (GGT), and via other pathways. Much progress has been made, mainly due to contributions from the field of causal inference, in understanding the precise nature of statistical estimands that capture such intuitive effects, the assumptions under which they can be identified, and statistical methods for doing so. These contributions have focused almost entirely on settings with a single mediator, or a set of mediators considered en bloc; in many applications, however, researchers attempt a much more ambitious decomposition into numerous path-specific effects through many mediators. In this article, we give counterfactual definitions of such path-specific estimands in settings with multiple mediators, when earlier mediators may affect later ones, showing that there are many ways in which decomposition can be done. We discuss the strong assumptions under which the effects are identified, suggesting a sensitivity analysis approach when a particular subset of the assumptions cannot be justified. These ideas are illustrated using data on alcohol consumption, SBP, BMI, and GGT from the Izhevsk Family Study. We aim to bridge the gap from "single mediator theory" to "multiple mediator practice," highlighting the ambitious nature of this endeavor and giving practical suggestions on how to proceed. © 2014 The Authors Biometrics published by Wiley Periodicals, Inc. on behalf of International Biometric Society.

  10. A multicopper oxidase is essential for manganese oxidation and laccase-like activity in Pedomicrobium sp. ACM 3067.

    Science.gov (United States)

    Ridge, Justin P; Lin, Marianne; Larsen, Eloise I; Fegan, Mark; McEwan, Alastair G; Sly, Lindsay I

    2007-04-01

    Pedomicrobium sp. ACM 3067 is a budding-hyphal bacterium belonging to the alpha-Proteobacteria which is able to oxidize soluble Mn2+ to insoluble manganese oxide. A cosmid, from a whole-genome library, containing the putative genes responsible for manganese oxidation was identified and a primer-walking approach yielded 4350 bp of novel sequence. Analysis of this sequence showed the presence of a predicted three-gene operon, moxCBA. The moxA gene product showed homology to multicopper oxidases (MCOs) and contained the characteristic four copper-binding motifs (A, B, C and D) common to MCOs. An insertion mutation of moxA showed that this gene was essential for both manganese oxidation and laccase-like activity. The moxB gene product showed homology to a family of outer membrane proteins which are essential for Type I secretion in Gram-negative bacteria. moxBA has not been observed in other manganese-oxidizing bacteria but homologues were identified in the genomes of several bacteria including Sinorhizobium meliloti 1021 and Agrobacterium tumefaciens C58. These results suggest that moxBA and its homologues constitute a family of genes encoding an MCO and a predicted component of the Type I secretion system.

  11. Bioconversion of rape straw into a nutritionally enriched substrate by ...

    African Journals Online (AJOL)

    Jane

    2011-06-22

    Jun 22, 2011 ... rape straw substrate and the secretion of ligninolytic enzyme system including laccase (Lac), manganese ... results are mostly fields burning or natural degradation. The former ... Microbial conversion, especially fungal bio- conversion ... out at 27°C in plastic bags containing 200 g of lignocellulosic substrate ...

  12. Curcumin: A natural modulator of immune cells in systemic lupus erythematosus.

    Science.gov (United States)

    Momtazi-Borojeni, Amir Abbas; Haftcheshmeh, Saeed Mohammadian; Esmaeili, Seyed-Alireza; Johnston, Thomas P; Abdollahi, Elham; Sahebkar, Amirhossein

    2018-02-01

    Curcumin is a polyphenol natural product isolated from turmeric, interacting with different cellular and molecular targets and, consequently, showing a wide range of pharmacological effects. Recent preclinical and clinical trials have revealed immunomodulatory properties of curcumin that arise from its effects on immune cells and mediators involved in the immune response, such as various T-lymphocyte subsets and dendritic cells, as well as different inflammatory cytokines. Systemic lupus erythematosus (SLE) is an inflammatory, chronic autoimmune-mediated disease characterized by the presence of autoantibodies, deposition of immune complexes in various organs, recruitment of autoreactive and inflammatory T cells, and excessive levels of plasma proinflammatory cytokines. The function and numbers of dendritic cells and T cell subsets, such as T helper 1 (Th1), Th17, and regulatory T cells have been found to be significantly altered in SLE. In the present report, we reviewed the results of in vitro, experimental (pre-clinical), and clinical studies pertaining to the modulatory effects that curcumin produces on the function and numbers of dendritic cells and T cell subsets, as well as relevant cytokines that participate in SLE. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. An easy compartment-less biofuel cell construction based on the physical co-inclusion of enzyme and mediator redox within pressed graphite discs

    Energy Technology Data Exchange (ETDEWEB)

    Cosnier, Serge [Department de Chimie Moleculaire UMR-5250, ICMG FR-2607, CNRS Universite Joseph Fourier, BP-53, 38041 Grenoble (France); Shan, Dan [Department de Chimie Moleculaire UMR-5250, ICMG FR-2607, CNRS Universite Joseph Fourier, BP-53, 38041 Grenoble (France); School of Chemistry and Chemical Engineering, Yangzhou University, Yangzhou 225002 (China); Ding, Shou-Nian [Department de Chimie Moleculaire UMR-5250, ICMG FR-2607, CNRS Universite Joseph Fourier, BP-53, 38041 Grenoble (France); School of Chemistry and Chemical Engineering, Shouthest University, Nanjing 211189 (China)

    2010-02-15

    We report on the easy and fast immobilization of glucose oxidase (GOD) and laccase by mechanical compression with graphite particles to form disc electrodes. The electrical wiring of GOD and laccase was efficiently carried out by their co-inclusion with ferrocene (Fc) and 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate) diammonium salt (ABTS) respectively. A glucose/air compartment-less biofuel cell was constructed based on the association of GOD-ferrocene-graphite disc and laccase-ABTS - graphite disc electrodes as bioanode and biocathode respectively. Such biofuel cell yielded a power density of 23 {mu}W cm{sup -2} at 0.33 V as well as an open-circuit voltage and a short-circuit current of 0.63 V and 166 {mu}A, respectively. (author)

  14. Naturally large radiative lepton flavor violating Higgs decay mediated by lepton-flavored dark matter

    International Nuclear Information System (INIS)

    Baek, Seungwon; Kang, Zhaofeng

    2016-01-01

    In the standard model (SM), lepton flavor violating (LFV) Higgs decay is absent at renormalizable level and thus it is a good probe to new physics. In this article we study a type of new physics that could lead to large LFV Higgs decay, i.e., a lepton-flavored dark matter (DM) model which is specified by a Majorana DM and scalar lepton mediators. Different from other similar models with similar setup, we introduce both left-handed and right-handed scalar leptons. They allow large LFV Higgs decay and thus may explain the tentative Br(h→τμ)∼1% experimental results from the LHC. In particular, we find that the stringent bound from τ→μγ can be naturally evaded. One reason, among others, is a large chirality violation in the mediator sector. Aspects of relic density and especially radiative direct detection of the leptonic DM are also investigated, stressing the difference from previous lepton-flavored DM models.

  15. Causal mediation analysis with multiple mediators in the presence of treatment noncompliance.

    Science.gov (United States)

    Park, Soojin; Kürüm, Esra

    2018-05-20

    Randomized experiments are often complicated because of treatment noncompliance. This challenge prevents researchers from identifying the mediated portion of the intention-to-treated (ITT) effect, which is the effect of the assigned treatment that is attributed to a mediator. One solution suggests identifying the mediated ITT effect on the basis of the average causal mediation effect among compliers when there is a single mediator. However, considering the complex nature of the mediating mechanisms, it is natural to assume that there are multiple variables that mediate through the causal path. Motivated by an empirical analysis of a data set collected in a randomized interventional study, we develop a method to estimate the mediated portion of the ITT effect when both multiple dependent mediators and treatment noncompliance exist. This enables researchers to make an informed decision on how to strengthen the intervention effect by identifying relevant mediators despite treatment noncompliance. We propose a nonparametric estimation procedure and provide a sensitivity analysis for key assumptions. We conduct a Monte Carlo simulation study to assess the finite sample performance of the proposed approach. The proposed method is illustrated by an empirical analysis of JOBS II data, in which a job training intervention was used to prevent mental health deterioration among unemployed individuals. Copyright © 2018 John Wiley & Sons, Ltd.

  16. The system of nature

    CERN Document Server

    D'Holbac, Baron

    1999-01-01

    "The source of Man's unhappiness is his ignorance of Nature."D'Holbach believed that the misery he saw in mankind around him was caused by religion and its superstitious beliefs - that there was a God who controlled destiny and would reward or punish individuals. The System of Nature was written to replace these delusions with a schema of understanding based solely on the physical workings of nature. "Let Man study this nature, let him learn her laws, contemplate her energies." For d'Holbach the soul is only the physical body, understood from a certain point of view, which dies when the body dies. All the events and the nature of the world can be understood in terms of the motion and properties of matter; even the tiniest causes contribute to huge events - a simple change in the diet of an Emperor (or some other such insignificant cause), he suggests might have been capable of "saving kingdoms." For him, nature's laws are fixed and necessary, and if Man wants to find happiness it is best to accept this - if g...

  17. Enzyme oxidation of plant galactomannans yielding biomaterials with novel properties and applications, including as delivery systems.

    Science.gov (United States)

    Galante, Yves M; Merlini, Luca; Silvetti, Tiziana; Campia, Paola; Rossi, Bianca; Viani, Fiorenza; Brasca, Milena

    2018-06-01

    New biomaterials from renewable sources and the development of "functionalized biopolymers" are fields of growing industrial interest. Plant polysaccharides represent a valid alternative to traditional synthetic polymers, which are obtained from monomers of fossil, non-renewable origin. Several polysaccharides, either in their natural or chemically/biochemically modified forms, are currently employed in the biomedical, food and feed, and industrial fields, including packaging. Sustainable biochemical reactions, such as enzyme modifications of polysaccharides, open further possibilities for new product and process innovation. In the present review, we summarize the recent progress on enzyme oxidation of galactomannans (GM) from few leguminous plants (performed either with galactose oxidase or laccase) and we focus on the versatile and easily accessible laccase/TEMPO oxidative reaction. The latter causes a steep viscosity increase of GM water solutions and a transition of the gels from a viscous to an elastic form, due to formation of emiacetalic bonds and thus of internal cross-linking of the polymers. Following lyophilization of these hydrogels, stable aerogels can be obtained, which were shown to have good potential as delivery systems (DS) of actives. The active molecules tested and herewith described are polymyxin B, an antibiotic; nisin, an antimicrobial peptide; the enzymes lysozyme, protease and lipase; the mixture of the industrial microbiocides 5-chloro-2-methyl-4-isothiazolin-3-one (CIT) and 2-methyl-4-isothiazolin-3-one (MIT). The advantages of such aerogel systems and the possibilities they open for future developments, including as DS, are described.

  18. Short-Term and Long-Term Biological Effects of Chronic Chemical Contamination on Natural Populations of a Marine Bivalve.

    Directory of Open Access Journals (Sweden)

    Marine Breitwieser

    Full Text Available Understanding the effects of chronic chemical contamination on natural populations of marine organisms is complex due to the combined effects of different types of pollutants and environmental parameters that can modulate the physiological responses to stress. Here, we present the effects of a chronic contamination in a marine bivalve by combining multiple approaches that provide information on individual and population health. We sampled variegated scallops (Mimachlamys varia at sites characterized by different contaminants and contamination levels to study the short and long-term (intergenerational responses of this species to physiological stress. We used biomarkers (SOD, MDA, GST, laccase, citrate synthase and phosphatases as indicators of oxidative stress, immune system alteration, mitochondrial respiration and general metabolism, and measured population genetic diversity at each site. In parallel, concentration of 14 trace metals and 45 organic contaminants (PAHs, PCBs, pesticides in tissues were measured. Scallops were collected outside and during their reproductive season to investigate temporal variability in contaminant and biomarker levels. Our analyses revealed that the levels of two biomarkers (Laccase-type phenoloxidase and malondialdehyde were significantly correlated with Cd concentration. Additionally, we observed significant seasonal differences for four of the five biomarkers, which is likely due to the scallop reproductive status at time of sampling. As a source of concern, a location that was identified as a reference site on the basis of inorganic contaminant levels presented the same level of some persistent organic pollutants (DDT and its metabolites than more impacted sites. Finally, potential long-term effects of heavy metal contamination were observed for variegated scallops as genetic diversity was depressed in the most polluted sites.

  19. Short-Term and Long-Term Biological Effects of Chronic Chemical Contamination on Natural Populations of a Marine Bivalve.

    Science.gov (United States)

    Breitwieser, Marine; Viricel, Amélia; Graber, Marianne; Murillo, Laurence; Becquet, Vanessa; Churlaud, Carine; Fruitier-Arnaudin, Ingrid; Huet, Valérie; Lacroix, Camille; Pante, Eric; Le Floch, Stéphane; Thomas-Guyon, Hélène

    2016-01-01

    Understanding the effects of chronic chemical contamination on natural populations of marine organisms is complex due to the combined effects of different types of pollutants and environmental parameters that can modulate the physiological responses to stress. Here, we present the effects of a chronic contamination in a marine bivalve by combining multiple approaches that provide information on individual and population health. We sampled variegated scallops (Mimachlamys varia) at sites characterized by different contaminants and contamination levels to study the short and long-term (intergenerational) responses of this species to physiological stress. We used biomarkers (SOD, MDA, GST, laccase, citrate synthase and phosphatases) as indicators of oxidative stress, immune system alteration, mitochondrial respiration and general metabolism, and measured population genetic diversity at each site. In parallel, concentration of 14 trace metals and 45 organic contaminants (PAHs, PCBs, pesticides) in tissues were measured. Scallops were collected outside and during their reproductive season to investigate temporal variability in contaminant and biomarker levels. Our analyses revealed that the levels of two biomarkers (Laccase-type phenoloxidase and malondialdehyde) were significantly correlated with Cd concentration. Additionally, we observed significant seasonal differences for four of the five biomarkers, which is likely due to the scallop reproductive status at time of sampling. As a source of concern, a location that was identified as a reference site on the basis of inorganic contaminant levels presented the same level of some persistent organic pollutants (DDT and its metabolites) than more impacted sites. Finally, potential long-term effects of heavy metal contamination were observed for variegated scallops as genetic diversity was depressed in the most polluted sites.

  20. Natural systems prediction of radionuclide migration

    International Nuclear Information System (INIS)

    Ewing, R.C.

    1991-01-01

    This paper reviews the application (and limitations) of data from natural systems to the verification of performance assessments, particularly as they apply to the evaluation of the long-term performance of waste forms, backfill, canister materials, and finally, the integrity of the repository itself. Two specific examples, the corrosion of borosilicate glass and the formation of alteration products of spent fuel, will be discussed. In both cases, inferences are of three types: 1) directly applicable data (i.e. radiation effects, stable phase assemblages): 2) inferences based on the analogous behaviour of the natural and repository systems (e.g. long-term corrosion rate); 3) specific identification of new phenomena that could not have been anticipated from the short term laboratory data (i.e. new mechanisms for the retention or release of radionuclides). The latter can only be derived from the observation of natural systems. Finally, specific attention will be paid to the limitations in the use of natural systems, particularly as the spatial and temporal scales expand, and to the inherent limitations of prediction and verification. (J.P.N.)

  1. The sensory system acts with a neuromedin U signaling pathway to mediate food type-dependent effects on lifespan

    OpenAIRE

    Adilov, Bakhtiyor

    2010-01-01

    In order to survive, the animal uses its sensory system to interpret the complexity of its environment. Interestingly, a subset of sensory neurons, which function in taste or olfaction, has been found to influence the lifespan of C. elegans and Drosophila. Although the mechanisms by which these neurons affect lifespan are unknown, the nature of these neurons suggest that the sensory influence on lifespan is mediated by food-derived cues. This thesis shows that sensory neurons r...

  2. IgE-mediated reaction to local anaesthetics

    International Nuclear Information System (INIS)

    Kartal, O.; Gulec, M.; Sener, O.; Caliskaner, A.Z.

    2013-01-01

    Local anaesthetics (LAs) are essential agents in daily practices of dentistry, minor surgery and dermatology. Although they have an impressive history of safety and efficacy, LAs also have the potential to produce adverse events, which are mainly of non-immune nature. The true IgE-mediated allergies are quite rare, but are more considerable in terms of ability to cause life-threatening outcomes. In this report, we present a case of IgE-mediated systemic reaction to LAs occurring during epidural anaesthesia for Cesarean section. (author)

  3. Paucity of natural killer and cytotoxic T cells in human neuromyelitis optica lesions

    Science.gov (United States)

    Saadoun, Samira; Bridges, Leslie R.; Verkman, A. S.; Papadopoulos, Marios C.

    2013-01-01

    Neuromyelitis optica is a severe inflammatory demyelinating disease of the central nervous system. Most patients with neuromyelitis optica have circulating immunoglobulin G (IgG) antibodies against the astrocytic water channel protein aquaporin-4 (AQP4), which are pathogenic. Anti-AQP4 IgG-mediated complement-dependent astrocyte toxicity is a key mechanism of central nervous system damage in neuromyelitis optica, but the role of natural killer and cytotoxic T cells is unknown. Our objective was to determine whether natural killer and cytotoxic T cells play a role in human neuromyelitis optica lesions. We immunostained four actively demyelinating lesions, obtained from patients with anti-AQP4 IgG positive neuromyelitis optica, for Granzyme B and Perforin. The inflammatory cells were perivascular neutrophils, eosinophils and macrophages, with only occasional Granzyme B+ or Perforin + cells. Greater than 95% of inflamed vessels in each lesion had no surrounding Granzyme B+ or Perforin + cells. Granzyme B+ or Perforin+ cells were abundant in human spleen (positive control). Although natural killer cells produce central nervous system damage in mice injected with anti-AQP4 IgG, our findings here indicate that natural killer-mediated and T cell-mediated cytotoxicity are probably not involved in central nervous system damage in human neuromyelitis optica. PMID:23108041

  4. Purificação de lacases PPO-I de Botryosphaeria rhodina - DOI: 10.4025/actascibiolsci.v27i3.1317 Purification of laccases PPO-I of fungus Botryosphaeria rhodina - DOI: 10.4025/actascibiolsci.v27i3.1317

    Directory of Open Access Journals (Sweden)

    Dalva Tomoe Miyagui

    2005-03-01

    Full Text Available Lacases são glicoproteínas polifenol oxidases envolvidas na patogenicidade de alguns fungos e úteis em processos biotecnológicos. O ascomiceto ligninolítico Botryosphaeria rhodina tem sido estudado como produtor de exopolissacarídeos e de lacases PPO-I e PPO-II induzidas pelo álcool veratrílico. Como as lacases produzidas ainda não foram isoladas, o objetivo deste trabalho foi purificar lacases PPO-I e identificar os carboidratos constituintes da porção glicosídica. O fungo foi cultivado em meio mínimo de Vogel contendo 1% de glicose e 30,4 mM de álcool veratrílico, a 28C e agitação de 180 rpm durante 4,5 dias. O extrato livre de células apresentou elevada concentração de carboidratos e de PPO-I estáveis a 4ºC e -18ºC durante 40 dias. Técnicas de ultrafiltração, cromatografia em gel Sephadex G-100 e em resina DEAE-Celulose purificaram lacases PPO-I com peso molecular de 113 kDa por eletroforese PAGE-SDS, contendo 40% de proteínas e 60% carboidratos identificados por HPAEC-PAD como fucose, galactose, manose, glucose e glucosaminaLaccases are glycoprotein polyphenol oxidases which are involved in fungal pathogenicity and they are also useful for biotechnological applications. The ligninolytic ascomycete, Botryosphaeria rhodina, has been studied as producer of exopolysaccharide and PPO-I and PPO-II laccases induced by veratryl alcohol. However, as the induced laccases have not been isolated, the aim of this study was to purify the enzyme and to identify the carbohydrates constituents of the glycosidic moiety. The fungus was cultivated on broth Vogel, 1% glucose and 30.4mM veratryl alcohol during 4.5 days at 28°C/180 rpm. The extracellular fluid showed high carbohydrate concentration and the stability of PPO-I laccase under conditions of refrigeration and freezing at 4ºC-18ºC over 40 days. The purification was developed by ultrafiltration using a NMWL 100 and 30 kDa membrane, gelfiltration on Sephadex G-100, and ion

  5. Native lignin for bonding fiber boards - evaluation of bonding mechanisms in boards made from laccase-treated fibers of beech (Fagus sylvatica)

    DEFF Research Database (Denmark)

    Felby, Claus; Thygesen, Lisbeth Garbrecht; Sanadi, Anand

    2004-01-01

    indicate that lignin extractives are precipitated on the fiber surfaces. The improved bonding may be related to several factors, linked to a more lignin rich fiber surface, such as surface molecular entanglements and covalent bonding between fibers through cross-linking of radicals. (C) 2004 Published......The auto-adhesion of beech wood (Fagus sylvatica) fibers can be enhanced by a pretreatment of the fibers with a phenol oxidase enzyme. The mechanism of enzymatic catalyzed bonding is linked to the generation of stable radicals in lignin by oxidation. Fiberboards made from laccase-treated fibers...

  6. A biomimetic colorimetric logic gate system based on multi-functional peptide-mediated gold nanoparticle assembly.

    Science.gov (United States)

    Li, Yong; Li, Wang; He, Kai-Yu; Li, Pei; Huang, Yan; Nie, Zhou; Yao, Shou-Zhuo

    2016-04-28

    In natural biological systems, proteins exploit various functional peptide motifs to exert target response and activity switch, providing a functional and logic basis for complex cellular activities. Building biomimetic peptide-based bio-logic systems is highly intriguing but remains relatively unexplored due to limited logic recognition elements and complex signal outputs. In this proof-of-principle work, we attempted to address these problems by utilizing multi-functional peptide probes and the peptide-mediated nanoparticle assembly system. Here, the rationally designed peptide probes function as the dual-target responsive element specifically responsive to metal ions and enzymes as well as the mediator regulating the assembly of gold nanoparticles (AuNPs). Taking advantage of Zn2+ ions and chymotrypsin as the model inputs of metal ions and enzymes, respectively, we constructed the peptide logic system computed by the multi-functional peptide probes and outputted by the readable colour change of AuNPs. In this way, the representative binary basic logic gates (AND, OR, INHIBIT, NAND, IMPLICATION) have been achieved by delicately coding the peptide sequence, demonstrating the versatility of our logic system. Additionally, we demonstrated that the three-input combinational logic gate (INHIBIT-OR) could also be successfully integrated and applied as a multi-tasking biosensor for colorimetric detection of dual targets. This nanoparticle-based peptide logic system presents a valid strategy to illustrate peptide information processing and provides a practical platform for executing peptide computing or peptide-related multiplexing sensing, implying that the controllable nanomaterial assembly is a promising and potent methodology for the advancement of biomimetic bio-logic computation.

  7. Computer-Mediated Communication Systems

    Directory of Open Access Journals (Sweden)

    Bin Yu

    2011-10-01

    Full Text Available The essence of communication is to exchange and share information. Computers provide a new medium to human communication. CMC system, composed of human and computers, absorbs and then extends the advantages of all former formats of communication, embracing the instant interaction of oral communication, the abstract logics of printing dissemination, and the vivid images of movie and television. It also creates a series of new communication formats, such as Hyper Text, Multimedia etc. which are the information organizing methods, and cross-space message delivering patterns. Benefiting from the continuous development of technique and mechanism, the computer-mediated communication makes the dream of transmitting information cross space and time become true, which will definitely have a great impact on our social lives.

  8. Free-radical-mediated conjugate additions. Enantioselective synthesis of butyrolactone natural products: (-)-enterolactone, (-)-arctigenin, (-)-isoarctigenin, (-)-nephrosteranic acid, and (-)-roccellaric acid.

    Science.gov (United States)

    Sibi, Mukund P; Liu, Pingrong; Ji, Jianguo; Hajra, Saumen; Chen, Jian-xie

    2002-03-22

    Lewis acid-mediated conjugate addition of alkyl radicals to a differentially protected fumarate 10 produced the monoalkylated succinates with high chemical efficiency and excellent stereoselectivity. A subsequent alkylation or an aldol reaction furnished the disubstituted succinates with syn configuration. The chiral auxiliary, 4-diphenylmethyl-2-oxazolidinone, controlled the stereoselectivity in both steps. Manipulation of the disubstituted succinates obtained by alkylation furnished the natural products (-)-enterolactone, (-)-arctigenin, and (-)-isoarctigenin. The overall yields for the target natural products were 20-26% over six steps. Selective functionalization of the disubstituted succinates obtained by aldol condensation gave the paraconic acid natural products (-)-nephrosteranic acid (8) and (-)-roccellaric acid (9). The overall yield of the natural products 8 and 9 over four steps was 53% and 42%, respectively.

  9. Including natural systems into the system engineering process: benefits to spaceflight and beyond

    Science.gov (United States)

    Studor, George

    2014-03-01

    How did we get to the point where we don't have time to be inspired by the wonders of Nature? Our office walls, homes and city streets are so plain that even when we do escape to a retreat with nature all around us, we may be blind to its magnificence. Yet there are many who have applied what can be known of natural systems (NS) to create practical solutions, but often definite applications for them are lacking. Mimicry of natural systems is not only more possible than ever before, but the education and research programs in many major universities are churning out graduates with a real appreciation for Nature's complex integrated systems. What if these skills and perspectives were employed in the teams of systems engineers and the technology developers that support them to help the teams think "outside-the-box" of manmade inventions? If systems engineers (SE) and technology developers regularly asked the question, "what can we learn from Nature that will help us?" as a part of their processes, they would discover another set of potential solutions. Biomimicry and knowledge of natural systems is exploding. What does this mean for systems engineering and technology? Some disciplines such as robotics and medical devices must consider nature constantly. Perhaps it's time for all technology developers and systems engineers to perceive natural systems experts as potential providers of the technologies they need.

  10. Layered composites of PEDOT/PSS/nanoparticles and PEDOT/PSS/phthalocyanines as electron mediators for sensors and biosensors

    Directory of Open Access Journals (Sweden)

    Celia García-Hernández

    2016-12-01

    Full Text Available The sensing properties of electrodes chemically modified with PEDOT/PSS towards catechol and hydroquinone sensing have been successfully improved by combining layers of PEDOT/PSS with layers of a secondary electrocatalytic material such as gold nanoparticles (PEDOT/PSS/AuNPs, copper phthalocyanine (PEDOT/PSS/CuPc or lutetium bisphthalocyanine (PEDOT/PSS/LuPc2. Layered composites exhibit synergistic effects that strongly enhance the electrocatalytic activity as indicated by the increase in intensity and the shift of the redox peaks to lower potentials. A remarkable improvement has been achieved using PEDOT/PSS/LuPc2, which exhibits excellent electrocatalytic activity towards the oxidation of catechol. The kinetic studies demonstrated diffusion-controlled processes at the electrode surfaces. The kinetic parameters such as Tafel slopes and charge transfer coefficient (α confirm the improved electrocatalytic activity of the layered electron mediators. The peak currents increased linearly with concentration of catechol and hydroquinone over the range of 1.5 × 10−4 to 4.0 × 10−6 mol·L−1 with a limit of detection on the scale of μmol·L−1. The layered composite hybrid systems were also found to be excellent electron mediators in biosensors containing tyrosinase and laccase, and they combine the recognition and biocatalytic properties of biomolecules with the unique catalytic features of composite materials. The observed increase in the intensity of the responses allowed detection limits of 1 × 10−7 mol·L−1 to be attained.

  11. Autonomic nervous system mediated effects of food intake. Interaction between gastrointestinal and cardiovascular systems.

    NARCIS (Netherlands)

    van Orshoven, N.P.

    2008-01-01

    The studies presented in this thesis focused on the autonomic nervous system mediated interactions between the gastrointestinal and cardiovascular systems in response to food intake and on potential consequences of failure of these interactions. The effects of food intake on cardiovascular

  12. Cell-free one-pot conversion of (+)-valencene to (+)-nootkatone by a unique dye-decolorizing peroxidase combined with a laccase from Funalia trogii.

    Science.gov (United States)

    Kolwek, Julia; Behrens, Christoph; Linke, Diana; Krings, Ulrich; Berger, Ralf G

    2018-02-01

    A combined system of a unique dye-decolorizing peroxidase (Ftr-DyP) and a laccase obtained from the basidiomycete Funalia trogii converted the precursor (+)-valencene completely to the high-value grapefruit flavour constituent (+)-nootkatone, reaching a concentration maximum of 1100 mg/L. In the presence of 1 mM Mn 2+ and 2.5 mM p-coumaric acid, (+)-nootkatone was the predominating volatile product, and only traces of substrate and the nootkatols were detectable after 24 h. Hence, the two-enzyme-system reproduced the oxidizing activity observed before for the crude culture supernatant. The newly discovered Ftr-DyP was purified, sequenced and further characterized as a thermostable, non-glycosylated protein with a pH-optimum in the acidic range and a calculated mass of 52.3 kDa. Besides the typical activity of DyPs towards anthraquinone dyes, Ftr-DyP also oxidized Mn 2+ and showed activity in the absence of hydrogen peroxide. Neither the DyP from Mycetinis scorodonius nor the manganese peroxidase from Nematoloma frowardii were able to replace Ftr-DyP in this reaction. A hypothetical reaction mechanism is presented.

  13. Scaling view by the Virtual Nature Systems

    Science.gov (United States)

    Klenov, Valeriy

    2010-05-01

    The Actual Nature Systems (ANS) continually are under spatial-temporal governing external influences from other systems (Meteorology and Geophysics). This influences provide own spatial temporal patterns on the Earth Nature Systems, which reforms these influences by own manner and scales. These at last three systems belong to the Open Non Equilibrium Nature Systems (ONES). The Geophysics and Meteorology Systems are both governing for the ANS on the Earth. They provide as continual energetic pressure and impacts, and direct Extremes from the both systems to the ANS on Earth surface (earthquakes, storms, and others). The Geodynamics of the ANS is under mixing of influence for both systems, on their scales and on dynamics of their spatial-temporal structures, and by own ANS properties, as the ONES. To select influences of external systems on the Earth systems always is among major tasks of the Geomorphology. Mixing of the Systems scales and dynamics provide specific properties for the memory of Earth system. The memory of the ANS has practical value for their multi-purpose management. The knowledge of these properties is the key for research spatial-temporal GeoDynamics and Trends of Earth Nature Systems. Selection of the influences in time and space requires for special tool, requires elaboration and action of the Virtual Nature Systems (VNS), which are enliven computer doubles for analysis Geodynamics of the ANS. The Experience on the VNS enables to assess influence of each and both external factors on the ANS. It is source of knowledge for regional tectonic and climate oscillations, trends, and threats. Research by the VNS for spatial-temporal dynamics and structures of stochastic regimes of governing systems and processes results in stochastic GeoDynamics of environmental processes, in forming of false trends and blanks in natural records. This ‘wild dance' of 2D stochastic patterns and their interaction each other and generates acting structures of river nets

  14. A conserved pattern in plant-mediated interactions between herbivores

    OpenAIRE

    Lu Jing; Robert Christelle A. M.; Lou Yonggen; Erb Matthias

    2016-01-01

    Abstract Plant?mediated interactions between herbivores are important determinants of community structure and plant performance in natural and agricultural systems. Current research suggests that the outcome of the interactions is determined by herbivore and plant identity, which may result in stochastic patterns that impede adaptive evolution and agricultural exploitation. However, few studies have systemically investigated specificity versus general patterns in a given plant system by varyi...

  15. Substratum formulation for laccase and mycelial biomass production of Pleurotus ostreatusFormulação de substratos na produção de biomassa micelial e de lacase de Pleurotus ostreatus

    Directory of Open Access Journals (Sweden)

    Juliana Silveira do Valle

    2012-10-01

    Full Text Available Pleurotus ostreatus is a producer of biomass and laccase, an enzyme used in fermentation processes for the hydrolysis of lignocellulosic substrate, with potential use in biofuel production and animal feed. Thus, there is a need to seek more appropriate regional substrate for the production of mycelial biomass and laccase. Hence, the aim of this study was to evaluate the effect of physical and chemical characteristics of agro-industrial byproducts in a substratum formulation for the mycelial growth and laccase production by P. ostreatus. The experiment was conducted with the milled raw materials: soy fiber, wheat bran, rice bran, corn grain and corn cob that were separated according to size and analyzed for carbon/nitrogen (C/N ratio. Mycelial growth was evaluated on substratum in cylindrical tubes of borosilicate. Then laccase production was assessed using a 26-2 fractional factorial design with the variables: raw material granulometry and addition of minerals (copper, zinc, iron, cadmium and magnesium in the substrate. The production of laccase was determined by oxidation of ABTS (2,2’-bisazin-(3-ethylbenzothiazoline-6-sulfonic acid. The results indicate that the most important factor for mycelial growth is the holding capacity of oxygen in the substratum. For mycelial growth of P. ostreatus the corn cob and wheat bran are the best components for the substrate. The other raw materials reduced the mycelial growth. However the most important factor for the induction of laccase production is the reduction of particle size, increasing the contact area between the mycelium and the substratum. Pleurotus ostreatus é um produtor de biomassa e lacase, enzima utilizada em processos fermentativos para a hidrólise de substratos lignocelulósicos, com potencial de utilização na produção de biocombustíveis e na alimentação animal. Desta forma, há a necessidade de buscar substratos regionais mais apropriados para a produção de biomassa micelial

  16. Laccase-mediated dimerization of the flavonolignan silybin

    Czech Academy of Sciences Publication Activity Database

    Gažák, Radek; Sedmera, Petr; Marzorati, M.; Riva, S.; Křen, Vladimír

    2008-01-01

    Roč. 50, 2-4 (2008), s. 87-92 ISSN 1381-1177 R&D Projects: GA AV ČR KJB400200701; GA MŠk OC D25.001; GA MŠk(CZ) LC06010; GA MŠk OC 170; GA MŠk ME 922 Grant - others:CZ(CZ) Bilateral Czech-Italian inter-academic projec Institutional research plan: CEZ:AV0Z50200510 Keywords : silybin * silymarin * dimer formation Subject RIV: EE - Microbiology, Virology Impact factor: 2.015, year: 2008

  17. Enzymological Characterization of Atm, the First Laccase from Agrobacterium sp. S5-1, with the Ability to Enhance In Vitro digestibility of Maize Straw.

    Directory of Open Access Journals (Sweden)

    Wei Si

    Full Text Available Laccase is an enzyme that catalyzes oxidation of phenolic compounds, diamines and aromatic amines. In this study, a novel laccase-like gene (atm in a ligninolyitic isolate Agrobacterium sp. S5-1 from soil humus was identified and heterologously expressed in Escherichia coli. Atm exhibited its maximal activity at pH 4.5 and at 50°C. This enzyme was tolerant to high temperature, a broad range of pH, heavy metal ions (Co3+, Mn2+, Cu2+ and Ni2+, 20 mM and all tested organic solvents. Furthermore, Atm significantly (p<0.05 increased dry matter digestibility of maize straw from 23.44% to 27.96% and from 29.53% to 37.10% after 8 or 24 h of digestion and improved acid detergent fiber digestibility from 5.81% to 10.33% and from 12.80% to 19.07% after 8 or 24 h of digestion, respectively. The combination of Atm and fibrolytic enzymes significantly (p<0.05 enhanced neutral detergent fiber digestibility from 19.02% to 24.55% after 24 h of digestion respectively. Results showed treatment with Atm effectively improved in vitro digestibility of maize straw, thus suggesting that Atm has an application potential for bioconversion of lignin rich agricultural byproducts into animal feed and cellulosic ethanol.

  18. Laser control of natural disperse systems

    Science.gov (United States)

    Vlasova, Olga L.; Bezrukova, Alexandra G.

    2003-10-01

    Different water disperse systems were studied by integral (spectroturbidemetry) and differential light scattering method with a laser as a source of light. The investigation done concerns the state of kaolin dispersions at storage and under dilution as an example of mineral dispersion systems such as natural water. The role of some light scattering parameters for an optical analysis of water dispersions, like the dispersion of erythrocytes and bacterial cells -Escherichia coli is discussed. The results obtained can help to elaborate the methods for on-line optical control fo natural disperse systems (water, air) with mineral and biological particles.

  19. Sunscope natural light systems : tubular skylights

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    This brochure described a tubular skylight designed by Sunscope Natural Light Systems. The Sunscope is a super-reflective light system in which daylight is reflected down a cylinder to a translucent ceiling fixture that diffuses natural light throughout the room in which it is placed. The Sunscope requires no structure changes, is installed in less than 3 hours, and requires no drywall repairs or repainting. The system eliminates the need for daytime electric lighting, and causes no winter heat losses or summer heat gains. Available in 3 sizes, the Sunscope has no moving parts and is fully maintenance-free. The system was designed for use in commercial and residential applications. 7 figs.

  20. Concepts and implementations of natural language query systems

    Science.gov (United States)

    Dominick, Wayne D. (Editor); Liu, I-Hsiung

    1984-01-01

    The currently developed user language interfaces of information systems are generally intended for serious users. These interfaces commonly ignore potentially the largest user group, i.e., casual users. This project discusses the concepts and implementations of a natural query language system which satisfy the nature and information needs of casual users by allowing them to communicate with the system in the form of their native (natural) language. In addition, a framework for the development of such an interface is also introduced for the MADAM (Multics Approach to Data Access and Management) system at the University of Southwestern Louisiana.

  1. Combined gauge-mediated and anomaly-mediated supersymmetry breaking and conformal sequestering

    International Nuclear Information System (INIS)

    Sundrum, Raman

    2005-01-01

    Anomaly-mediated supersymmetry breaking in the context of 4D conformally sequestered models is combined with Poppitz-Trivedi D-type gauge-mediation. The implementation of the two mediation mechanisms naturally leads to visible soft masses at the same scale so that they can cooperatively solve the μ and flavor problems of weak scale supersymmetry, as well as the tachyonic-slepton problem of pure anomaly-mediation. The tools are developed in a modular fashion for more readily fitting into the general program of optimizing supersymmetric dynamics in hunting for the most attractive weak scale phenomenologies combined with Planck-scale plausibility

  2. Growth and extracellular laccase production in liquid cultures of Minimidochium parvum LPSC # 548 Strain Crecimiento y producción de lacasa extracelular en cultivos líquidos de Minimidochium parvum cepa LPSC # 548

    Directory of Open Access Journals (Sweden)

    Mario C. N. Saparrat

    2007-07-01

    Full Text Available Minimidochium parvum LPSC # 548, a fungus isolated from litter floating on waters of Río Santiago (Provincia de Buenos Aires, Argentina polluted with industrial effluents and crude-oil, was grown as a shaking culture on a C-limited medium to evaluate its ability to produce extracellular laccase. The effect of anthracene, CuSO4 · 5H2O, ethanol, guaiacol, humic acids, Kraft lignin, MnSO4· H2O, Tween 20 and veratryl alcohol on its growth and extracellular laccase activity levels was also analyzed. The cultures grown on basal medium produced maximum biomass (over 420 mg/100 ml and maximum extracellular laccase activity (351.7 ±53.3 pkat/ml after 5 days of incubation. Among the different factors tested, only the humic acids at 0.1 % (w/v were found to stimulate the growth of M. parvum . However, Tween 20 (0.1 %, v/v was the only one that produced an increase of laccase activity levels up to 2.5-fold compared to the control.Minimidochium parvum LPSC # 548, un hongo aislado de materia orgánica colectada en aguas de Río Santiago (Provincia de Buenos Aires, Argentina contaminadas con efluentes industriales y crudo de petróleo, se cultivó en un medio líquido limitante en carbono bajo agitación para evaluar su habilidad para producir lacasa extracelular. Se analizó también el efecto de ácidos húmicos, alcohol veratrílico, antraceno, CuSO4 · 5H2O, etanol, guaiacol, lignina Kraft, MnSO4· H2O y Tween 20 sobre el crecimiento fúngico y los niveles de actividad lacasa extracelular. Los cultivos sobre medio basal produjeron máximos niveles de biomasa (superior a 420 mg/100 ml y actividad lacasa extracelular (351,7 ±53,3 pkat/ml después de 5 días de incubación. Entre los diferentes agentes químicos testeados, sólo los ácidos húmicos al 0,1 % (p/v estimularon el crecimiento de M. parvum . No obstante, sólo el Tween 20 (0,1 %, v/v produjo un incremento de los niveles de actividad lacasa (2,5 veces comparado a cultivos control.

  3. Interleukin-15 stimulates natural killer cell-mediated killing of both human pancreatic cancer and stellate cells

    Science.gov (United States)

    Van Audenaerde, Jonas R.M.; De Waele, Jorrit; Marcq, Elly; Van Loenhout, Jinthe; Lion, Eva; Van den Bergh, Johan M.J.; Jesenofsky, Ralf; Masamune, Atsushi; Roeyen, Geert; Pauwels, Patrick; Lardon, Filip; Peeters, Marc; Smits, Evelien L.J.

    2017-01-01

    Pancreatic ductal adenocarcinoma (PDAC) is the 4th leading cause of cancer-related death in Western countries with a 5-year survival rate below 5%. One of the hallmarks of this cancer is the strong desmoplastic reaction within the tumor microenvironment (TME), orchestrated by activated pancreatic stellate cells (PSC). This results in a functional and mechanical shield which causes resistance to conventional therapies. Aiming to overcome this resistance by tackling the stromal shield, we assessed for the first time the capacity of IL-15 stimulated natural killer (NK) cells to kill PSC and pancreatic cancer cells (PCC). The potency of IL-15 to promote NK cell-mediated killing was evaluated phenotypically and functionally. In addition, NK cell and immune checkpoint ligands on PSC were charted. We demonstrate that IL-15 activated NK cells kill both PCC and PSC lines (range 9-35% and 20-50%, respectively) in a contact-dependent manner and significantly higher as compared to resting NK cells. Improved killing of these pancreatic cell lines is, at least partly, dependent on IL-15 induced upregulation of TIM-3 and NKG2D. Furthermore, we confirm significant killing of primary PSC by IL-15 activated NK cells in an ex vivo autologous system. Screening for potential targets for immunotherapeutic strategies, we demonstrate surface expression of both inhibitory (PD-L1, PD-L2) and activating (MICA/B, ULBPs and Galectin-9) ligands on primary PSC. These data underscore the therapeutic potential of IL-15 to promote NK cell-mediated cytotoxicity as a treatment of pancreatic cancer and provide promising future targets to tackle remaining PSC. PMID:28915646

  4. The mediating effect of sustainability control system on reverse ...

    African Journals Online (AJOL)

    This paper analyses part of the viability of green supply chain management practices created for fisheries industry to implement sustainability control system adoption as mediating on reverse logistics innovation and customer environmental collaboration towards sustainability performance. It examines reverse logistics ...

  5. Natural interaction for unmanned systems

    Science.gov (United States)

    Taylor, Glenn; Purman, Ben; Schermerhorn, Paul; Garcia-Sampedro, Guillermo; Lanting, Matt; Quist, Michael; Kawatsu, Chris

    2015-05-01

    Military unmanned systems today are typically controlled by two methods: tele-operation or menu-based, search-andclick interfaces. Both approaches require the operator's constant vigilance: tele-operation requires constant input to drive the vehicle inch by inch; a menu-based interface requires eyes on the screen in order to search through alternatives and select the right menu item. In both cases, operators spend most of their time and attention driving and minding the unmanned systems rather than on being a warfighter. With these approaches, the platform and interface become more of a burden than a benefit. The availability of inexpensive sensor systems in products such as Microsoft Kinect™ or Nintendo Wii™ has resulted in new ways of interacting with computing systems, but new sensors alone are not enough. Developing useful and usable human-system interfaces requires understanding users and interaction in context: not just what new sensors afford in terms of interaction, but how users want to interact with these systems, for what purpose, and how sensors might enable those interactions. Additionally, the system needs to reliably make sense of the user's inputs in context, translate that interpretation into commands for the unmanned system, and give feedback to the user. In this paper, we describe an example natural interface for unmanned systems, called the Smart Interaction Device (SID), which enables natural two-way interaction with unmanned systems including the use of speech, sketch, and gestures. We present a few example applications SID to different types of unmanned systems and different kinds of interactions.

  6. The Impact of HLA Class I-Specific Killer Cell Immunoglobulin-Like Receptors on Antibody-Dependent Natural Killer Cell-Mediated Cytotoxicity and Organ Allograft Rejection.

    Science.gov (United States)

    Rajalingam, Raja

    2016-01-01

    Natural killer (NK) cells of the innate immune system are cytotoxic lymphocytes that play an important roles following transplantation of solid organs and hematopoietic stem cells. Recognition of self-human leukocyte antigen (HLA) class I molecules by inhibitory killer cell immunoglobulin-like receptors (KIRs) is involved in the calibration of NK cell effector capacities during the developmental stage, allowing the subsequent recognition and elimination of target cells with decreased expression of self-HLA class I (due to virus infection or tumor transformation) or HLA class I disparities (in the setting of allogeneic transplantation). NK cells expressing an inhibitory KIR-binding self-HLA can be activated when confronted with allografts lacking a ligand for the inhibitory receptor. Following the response of the adaptive immune system, NK cells can further destroy allograft endothelium by antibody-dependent cell-mediated cytotoxicity (ADCC), triggered through cross-linking of the CD16 Fc receptor by donor-specific antibodies bound to allograft. Upon recognizing allogeneic target cells, NK cells also secrete cytokines and chemokines that drive maturation of dendritic cells to promote cellular and humoral adaptive immune responses against the allograft. The cumulative activating and inhibitory signals generated by ligation of the receptors regulates mature NK cell killing of target cells and their production of cytokines and chemokines. This review summarizes the role of NK cells in allograft rejection and proposes mechanistic concepts that indicate a prominent role for KIR-HLA interactions in facilitating NK cells for Fc receptor-mediated ADCC effector function involved in antibody-mediated rejection of solid organ transplants.

  7. The impact of HLA class I-specific killer cell immunoglobulin-like receptors on antibody-dependent natural killer cell-mediated cytotoxicity and organ allograft rejection

    Directory of Open Access Journals (Sweden)

    Raja Rajalingam

    2016-12-01

    Full Text Available Natural killer (NK cells of the innate immune system are cytotoxic lymphocytes that play important roles following transplantation of solid organs and hematopoietic stem cells. Recognition of self HLA class I molecules by inhibitory killer cell immunoglobulin-like receptors (KIR is involved in the calibration of NK cell effector capacities during a developmental stage, allowing the subsequent recognition and elimination of target cells with decreased expression of self HLA class I (due to virus infection or tumor transformation or HLA class I disparities (in the setting of allogeneic transplantation. NK cells expressing an inhibitory KIR binding self HLA can be activated when confronted with allografts lacking a ligand for the inhibitory receptor. Following the response of the adaptive immune system, NK cells can further destroy allograft endothelium by antibody-dependent cell-mediated cytotoxicity (ADCC, triggered through cross-linking of the CD16 Fc receptor by donor-specific antibodies bound to allograft. Upon recognizing allogeneic target cells, NK cells also secrete cytokines and chemokines that drive maturation of dendritic cells to promote cellular and humoral adaptive immune responses against the allograft. The cumulative activating and inhibitory signals generated by ligation of the receptors regulates mature NK cell killing of target cells and their production of cytokines and chemokines. This review summarizes the role of NK cells in allograft rejection and proposes mechanistic concepts that indicate a prominent role for KIR-HLA interactions in facilitating NK cells for Fc receptor-mediated ADCC effector function involved in antibody-mediated rejection of solid organ transplants.

  8. Ontogeny of human natural killer (NK) cells: fetal NK cells mediate cytolytic function and express cytoplasmic CD3 epsilon,delta proteins

    NARCIS (Netherlands)

    Phillips, J. H.; Hori, T.; Nagler, A.; Bhat, N.; Spits, H.; Lanier, L. L.

    1992-01-01

    Natural killer (NK) cells have been defined as CD3 epsilon-, CD16+ and/or CD56+ lymphocytes that mediate major histocompatibility complex (MHC)-unrestricted cytotoxicity against certain tumors and virus-infected cells. Unlike T lymphocytes, NK cells do not rearrange or productively express T cell

  9. Arabic Natural Language Processing System Code Library

    Science.gov (United States)

    2014-06-01

    Adelphi, MD 20783-1197 This technical note provides a brief description of a Java library for Arabic natural language processing ( NLP ) containing code...for training and applying the Arabic NLP system described in the paper "A Cross-Task Flexible Transition Model for Arabic Tokenization, Affix...and also English) natural language processing ( NLP ), containing code for training and applying the Arabic NLP system described in Stephen Tratz’s

  10. The Influence of Computer-Mediated Communication Systems on Community

    Science.gov (United States)

    Rockinson-Szapkiw, Amanda J.

    2012-01-01

    As higher education institutions enter the intense competition of the rapidly growing global marketplace of online education, the leaders within these institutions are challenged to identify factors critical for developing and for maintaining effective online courses. Computer-mediated communication (CMC) systems are considered critical to…

  11. Immobilization of CotA, an extremophilic laccase from Bacillus subtilis, on glassy carbon electrodes for biofuel cell applications

    Energy Technology Data Exchange (ETDEWEB)

    Beneyton, T.; El Harrak, A.; Griffiths, A.D.; Taly, V. [Institut de Science et d' Ingenierie Supramoleculaire, CNRS UMR, Strasbourg (France); Hellwig, P. [Institut de Chimie, Universite de Strasbourg, CNRS UMR, Strasbourg (France)

    2011-01-15

    Thanks to their high stability over a wide range of experimental conditions, extremophilic enzymes represent an interesting alternative to mesophilic enzymes as catalysts for biofuel cell applications. In the present work, we report for the first time the immobilization of a thermophilic laccase (CotA from Bacillus subtilis endospore coat) on glassy carbon electrodes functionalized via electrochemical reduction of in situ generated aminophenyl monodiazonium salts. We compare the performance of CotA-modified electrodes for the reduction of O{sub 2} to mutant variants and demonstrate that the measured electrical current is directly correlated to the catalytic efficiencies (k{sub cat}/K{sub m}) of the immobilized enzyme. CotA-modified electrodes showed an optimal operation temperature of 45-50 C and stable catalytic activity for at least 7 weeks. (author)

  12. Practical guidance for conducting mediation analysis with multiple mediators using inverse odds ratio weighting.

    Science.gov (United States)

    Nguyen, Quynh C; Osypuk, Theresa L; Schmidt, Nicole M; Glymour, M Maria; Tchetgen Tchetgen, Eric J

    2015-03-01

    Despite the recent flourishing of mediation analysis techniques, many modern approaches are difficult to implement or applicable to only a restricted range of regression models. This report provides practical guidance for implementing a new technique utilizing inverse odds ratio weighting (IORW) to estimate natural direct and indirect effects for mediation analyses. IORW takes advantage of the odds ratio's invariance property and condenses information on the odds ratio for the relationship between the exposure (treatment) and multiple mediators, conditional on covariates, by regressing exposure on mediators and covariates. The inverse of the covariate-adjusted exposure-mediator odds ratio association is used to weight the primary analytical regression of the outcome on treatment. The treatment coefficient in such a weighted regression estimates the natural direct effect of treatment on the outcome, and indirect effects are identified by subtracting direct effects from total effects. Weighting renders treatment and mediators independent, thereby deactivating indirect pathways of the mediators. This new mediation technique accommodates multiple discrete or continuous mediators. IORW is easily implemented and is appropriate for any standard regression model, including quantile regression and survival analysis. An empirical example is given using data from the Moving to Opportunity (1994-2002) experiment, testing whether neighborhood context mediated the effects of a housing voucher program on obesity. Relevant Stata code (StataCorp LP, College Station, Texas) is provided. © The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. BaCO3 mediated modifications in structural and magnetic properties of natural nanoferrites

    Science.gov (United States)

    Widanarto, W.; Jandra, M.; Ghoshal, S. K.; Effendi, M.; Cahyanto, W. T.

    2015-04-01

    Preparing M-type barium hexaferrite and improving the magnetic response of natural ferrites by incorporating barium carbonate (BaCO3) is ever-demanding. Series of barium carbonate doped ferrites with composition (100-x)Fe3O4·xBaCO3 (x=0, 10, 20, 30 wt%) are prepared through solid state reaction method and sintered gradually at temperatures of 800 and 1000 °C. Nanoparticles of natural ferrite and commercial BaCO3 are used as raw materials. Impacts of BaCO3 on structural and magnetic properties of these synthesized ferrites are inspected. The obtained ferrites are characterized using scanning electron microscopy (SEM), X-ray diffraction (XRD) and vibrating sample magnetometer (VSM) at room temperature. Uniform barium hexaferrite particles in terms of both morphology and size are not achieved. The average crystallite size of BaFe12O19 is observed to be within 30-600 nm. The sintering process results phase transformation from Fe3O4 (magnetite) to α-Fe2O3 (hematite) and the formation of hexagonal barium ferrite crystals. The occurrence of barium crystal is found to enhance with the increase of BaCO3 concentrations up to 20 wt% and suddenly drop at 30 wt%. Saturation and remanent magnetization of the doped ferrites are significantly augmented up to 16.37 and 8.92 emu g-1, respectively compared to their pure counterpart. Furthermore, the coercivity field is slightly decreased as BaCO3 concentrations are increased. BaCO3 mediated improvements in the magnetic response of natural ferrites are demonstrated.

  14. Design guidelines for natural ventilation systems in tertiary sector buildings

    OpenAIRE

    Van Moeseke, Geoffrey; Bruyère, Isabelle; De Herde, André; CISBAT 2005: Renewables in a changing climate

    2005-01-01

    Parameters determining efficiency of natural ventilation systems are numerous. The most important are architecture and system design. This article get onto both but focuses on system design. Through dynamic simulations it shows that natural ventilation management has a large impact on energy saving but most of all on thermal comfort. Natural ventilation techniques are also weighted against hybrid solutions and high efficiency mechanical cooling solutions. Natural ventilation techniques show t...

  15. The transport system for natural gas

    International Nuclear Information System (INIS)

    Bjoerndalen, Joergen; Nese, Gjermund

    2003-01-01

    In 2002, the actors on the Norwegian shelf in cooperation with the authorities established a new regime for sale and transport of gas. This article deals with some issues of interest relating to this new regime. The transport system for natural gas shows clear signs of being a natural monopoly, which makes it difficult to use the system efficiently. Two main problems of the current way of organizing are pointed out: (1) lack of price and market signals in capacity allocation and (2) unclear incentive effects. The article indicates a possible solution based on the form of organization that is used in the power market