Directory of Open Access Journals (Sweden)
Jie Yang
2016-08-01
Full Text Available Laccases are a class of multi-copper oxidases with industrial potential. In this study, eight laccases (Lac1–8 from Cerrena sp. strain HYB07, a white-rot fungus with high laccase yields, were analyzed. The laccases showed moderate identities to each other as well as with other fungal laccases and were predicted to have high redox potentials except for Lac6. Selected laccase isozymes were heterologously expressed in the yeast Pichia pastoris, and different enzymatic properties were observed. Transcription of the eight laccase genes was differentially regulated during submerged and solid state fermentation, as shown by quantitative real-time polymerase chain reaction and validated reference genes. During 6-day submerged fermentation, Lac7 and 2 were successively the predominantly expressed laccase gene, accounting for over 95% of all laccase transcripts. Interestingly, accompanying Lac7 downregulation, Lac2 transcription was drastically upregulated on days 3 and 5 to 9958-fold of the level on day 1. Consistent with high mRNA abundance, Lac2 and 7, but not other laccases, were identified in the fermentation broth by LC-MS/MS. In solid state fermentation, less dramatic differences in transcript abundance were observed, and Lac3, 7 and 8 were more highly expressed than other laccase genes. Elucidating the properties and expression profiles of the laccase gene family will facilitate understanding, production and commercialization of the fungal strain and its laccases.
Directory of Open Access Journals (Sweden)
Yang Yang
Full Text Available Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+ and Fe(2+ could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.
Yang, Yang; Wei, Fuxiang; Zhuo, Rui; Fan, Fangfang; Liu, Huahua; Zhang, Chen; Ma, Li; Jiang, Mulan; Zhang, Xiaoyu
2013-01-01
Laccase is useful for various biotechnological and industrial applications. The white-rot fungus Trametes velutina 5930 and its laccase, isolated from the Shennongjia Nature Reserve in China by our laboratory, has great potential for practical application in environmental biotechnology. However, the original level of laccase produced by Trametes velutina 5930 was relatively low in the absence of any inducer. Therefore, in order to enhance the laccase production by Trametes velutina 5930 and make better use of this fungus in the field of environmental biotechnology, the regulation of laccase production and laccase gene expression in Trametes velutina 5930 were investigated in this study. Different metal ions such as Cu(2+) and Fe(2+) could stimulate the laccase synthesis and laccase gene transcription in Trametes velutina 5930. Some aromatic compounds structurally related to lignin, such as tannic acid, syringic acid, cinnamic acid, gallic acid and guaiacol, could also enhance the level of laccase activity and laccase gene transcription. We also found that there existed a positive synergistic effect of aromatic compound and metal ion on the laccase production and laccase gene transcription in Trametes velutina 5930. Taken together, our study may contribute to the improvement of laccase productivity by Trametes velutina 5930.
Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.
Directory of Open Access Journals (Sweden)
Luka Ausec
Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.
Laccase Gene Expression and Vinasse Biodegradation by Trametes hirsuta Strain Bm-2
Directory of Open Access Journals (Sweden)
Raúl Tapia-Tussell
2015-08-01
Full Text Available Vinasse is the dark-colored wastewater that is generated by bioethanol distilleries from feedstock molasses. The vinasse that is generated from molasses contains high amounts of pollutants, including phenolic compounds and melanoindin. The goal of this work was to study the expression of laccase genes in the Trametes hirsuta strain Bm-2, isolated in Yucatan, Mexico, in the presence of phenolic compounds, as well as its effectiveness in removing colorants from vinasse. In the presence of all phenolic compounds tested (guaiacol, ferulic acid, and vanillic acid, increased levels of laccase-encoding mRNA were observed. Transcript levels in the presence of guaiacol were 40 times higher than those in the control. The lcc1 and lcc2 genes of T. hirsuta were differentially expressed; guaiacol and vanillin induced the expression of both genes, whereas ferulic acid only induced the expression of lcc2. The discoloration of vinasse was concomitant with the increase in laccase activity. The highest value of enzyme activity (2543.7 U/mL was obtained in 10% (v/v vinasse, which corresponded to a 69.2% increase in discoloration. This study demonstrates the potential of the Bm-2 strain of T. hirsuta for the biodegradation of vinasse.
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
International Nuclear Information System (INIS)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-01-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 laccase gene contains a putative site for xenobiotics (XRE). (Author)
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Cloning and expression of Icc1 Laccase gene promoter in Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Marqueda-Galvez, A. P.; Loera Carrol, O.; Xaconostle cazares, B.; Tellez-Jurado, A.; Arana-Cuenca, A.
2009-07-01
The white rot fungus Trametes sp. I-62 is a strain with laccase activity and a great potential for biotechnological applications given its ability to detoxify distillery effluents. The Icc1, Icc2 and Icc3 laccase genes of this basidiomycetes have been cloned and sequenced. The promoter region of Icc1 kaccase gene contains a putative site for xenobiotics (XRE). (Author)
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Itoh, Nobuya; Takagi, Shinya; Miki, Asami; Kurokawa, Junji
2016-01-01
Epitheaflagallin 3-O-gallate (ETFGg) is a minor polyphenol found in black tea extract, which has good physiological functions. It is synthesized from epigallocatechin gallate (EGCg) with gallic acid via laccase oxidation. Various basidiomycetes and fungi were screened to find a suitable laccase for the production of ETFGg. A basidiomycete, Hericium coralloides NBRC 7716, produced an appropriate extracellular laccase. The purified laccase produced twice the level of ETFGg compared with commercially available laccase from Trametes sp. The enzyme, termed Lcc2, is a monomeric protein with an apparent molecular mass of 67.2 kDa. The N-terminal amino acid sequence of Lcc2 is quite different from laccase isolated from the fruiting bodies of Hericium. Lcc2 showed similar substrate specificity to known laccases and could oxidize various phenolic substrates, including pyrogallol, gallic acid, and 2,6-dimethoxyphenol. The full-length lcc2 gene was obtained by PCR using degenerate primers, which were designed based on the N-terminal amino acid sequence of Lcc2 and conserved copper-binding sites of laccases, and 5'-, and 3'-RACE PCR with mRNA. The Lcc2 gene showed homology with Lentinula edodes laccase (sharing 77% amino acid identity with Lcc6). We successfully produced extracellular Lcc2 using a heterologous expression system with Saccharomyces cerevisiae. Moreover, it was confirmed that the recombinant laccase generates similar levels of ETFGg as the native enzyme. Copyright © 2015 Elsevier Inc. All rights reserved.
β-Carotene from Yeasts Enhances Laccase Production of Pleurotus eryngii var. ferulae in Co-culture.
Guo, Chaolin; Zhao, Liting; Wang, Feng; Lu, Jian; Ding, Zhongyang; Shi, Guiyang
2017-01-01
Laccase is widely used in several industrial applications and co-culture is a common method for enhancing laccase production in submerged fermentation. In this study, the co-culture of four yeasts with Pleurotus eryngii var. ferulae was found to enhance laccase production. An analysis of sterilization temperatures and extraction conditions revealed that the stimulatory compound in yeasts was temperature-sensitive, and that it was fat-soluble. An LC-MS analysis revealed that the possible stimulatory compound for laccase production in the four yeast extracts was β-carotene. Moreover, the addition of 4 mg β-carotene to 150 mL of P. eryngii var. ferulae culture broth improved laccase production by 2.2-fold compared with the control (i.e., a monoculture), and was similar to laccase production in co-culture. In addition, the enhanced laccase production was accompanied by an increase of lac gene transcription, which was 6.2-time higher than the control on the fifth day. Therefore, it was concluded that β-carotene from the co-cultured yeasts enhanced laccase production in P. eryngii var. ferulae , and strains that produce β-carotene could be selected to enhance fungal laccase production in a co-culture. Alternatively, β-carotene or crude extracts of β-carotene could be used to induce high laccase production in large scale.
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
Energy Technology Data Exchange (ETDEWEB)
D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.
Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici
Directory of Open Access Journals (Sweden)
Bao Zhen Feng
2014-01-01
Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid (ABTS as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 ºC, respectively . The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes.
Laccase 1 gene from Plutella xylostella (PxLac1) and its functions in humoral immune response.
Wang, Ze-Hua; Hu, Rong-Min; Ye, Xi-Qian; Huang, Jian-Hua; Chen, Xue-Xin; Shi, Min
Laccase (EC 1.10.3.2) is a phenoloxidase found in many insect species. The Laccase 1 gene from Plutella xylostella (PxLac1) was cloned, and its expression patterns and functions were determined using qPCR and RNAi methods. The results showed that the expression levels of PxLac1 were consistently high in all larval stages, and the most abundant was in the midgut during the 4th instar stage. Moreover, the expression of PxLac1 was up-regulated in response to bacterial infection, and decreased 24 h after being parasitized by Cotesia vestalis. Further analyses indicated that the effect of parasitization on PxLac1 was induced by active C. vestalis Bracovirus (CvBV). Haemocyte-free hemolymph phenoloxidase (PO) activity was suppressed when PxLac1 was treated with RNAi. Our results provide evidence for a connection between the Laccase 1 gene and insect immunity, and revealed that parasitoid polydnavirus suppresses host PO activity via PxLac1 regulation. Copyright © 2018. Published by Elsevier Ltd.
Characterization Of Laccase T-DNA Mutants In Arabidopsis thaliana
DEFF Research Database (Denmark)
Andersen, Jeppe Reitan; Asp, Torben; Mansfield, Shawn
2009-01-01
Laccases (P-diphenol:O2 oxidoreductase; EC 1.10.3.2), also termed laccase-like multicopper oxidases, are blue copper-containing oxidases which comprise multigene families in plants. In the Arabidopsis thaliana genome, 17 laccase genes (LAC1 to LAC17) have been annotated. To identify laccases...... for LAC15 T-DNA mutant seeds and an approximate 24 hour delay in germination was observed for these seeds. An approximate 20% reduction in glucose, galactose, and xylose was observed in primary stem cell walls of the LAC2 T-DNA mutants while similar relative increases in xylose were observed for LAC8...
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Huang, Meng Tian; Lu, Yi Chen; Zhang, Shuang; Luo, Fang; Yang, Hong
2016-08-24
Atrazine (ATR) and isoproturon (IPU) as herbicides have become serious environmental contaminants due to their overuse in crop production. Although ATR and IPU in soils are easily absorbed by many crops, the mechanisms for their degradation or detoxification in plants are poorly understood. This study identified a group of novel genes encoding laccases (EC 1.10.3.2) that are possibly involved in catabolism or detoxification of ATR and IPU residues in rice. Transcriptome profiling shows at least 22 differentially expressed laccase genes in ATR/IPU-exposed rice. Some of the laccase genes were validated by RT-PCR analysis. The biochemical properties of the laccases were analyzed, and their activities in rice were induced under ATR/IPU exposure. To investigate the roles of laccases in degrading or detoxifying ATR/IPU in rice, transgenic yeast cells (Pichia pastoris X-33) expressing two rice laccase genes (LOC_Os01g63180 and LOC_Os12g15680) were generated. Both transformants were found to accumulate less ATR/IPU compared to the control. The ATR/IPU-degraded products in the transformed yeast cells using UPLC-TOF-MS/MS were further characterized. Two metabolites, hydroxy-dehydrogenated atrazine (HDHA) and 2-OH-isopropyl-IPU, catalyzed by laccases were detected in the eukaryotic cells. These results indicate that the laccase-coding genes identified here could confer degradation or detoxification of the herbicides and suggest that the laccases could be one of the important enzymatic pathways responsible for ATR/IPU degradation/detoxification in rice.
Structural and Phylogenetic Analysis of Laccases from Trichoderma: A Bioinformatic Approach
Cázares-García, Saila Viridiana; Vázquez-Garcidueñas, Ma. Soledad; Vázquez-Marrufo, Gerardo
2013-01-01
The genus Trichoderma includes species of great biotechnological value, both for their mycoparasitic activities and for their ability to produce extracellular hydrolytic enzymes. Although activity of extracellular laccase has previously been reported in Trichoderma spp., the possible number of isoenzymes is still unknown, as are the structural and functional characteristics of both the genes and the putative proteins. In this study, the system of laccases sensu stricto in the Trichoderma species, the genomes of which are publicly available, were analyzed using bioinformatic tools. The intron/exon structure of the genes and the identification of specific motifs in the sequence of amino acids of the proteins generated in silico allow for clear differentiation between extracellular and intracellular enzymes. Phylogenetic analysis suggests that the common ancestor of the genus possessed a functional gene for each one of these enzymes, which is a characteristic preserved in T. atroviride and T. virens. This analysis also reveals that T. harzianum and T. reesei only retained the intracellular activity, whereas T. asperellum added an extracellular isoenzyme acquired through horizontal gene transfer during the mycoparasitic process. The evolutionary analysis shows that in general, extracellular laccases are subjected to purifying selection, and intracellular laccases show neutral evolution. The data provided by the present study will enable the generation of experimental approximations to better understand the physiological role of laccases in the genus Trichoderma and to increase their biotechnological potential. PMID:23383142
Glycosylated yellow laccases of the basidiomycete Stropharia aeruginosa.
Daroch, Maurycy; Houghton, Catharine A; Moore, Jonathan K; Wilkinson, Mark C; Carnell, Andrew J; Bates, Andrew D; Iwanejko, Lesley A
2014-05-10
Here we describe the identification, purification and characterisation of glycosylated yellow laccase proteins from the basidiomycete fungus Stropharia aeruginosa. Biochemical characterisation of two yellow laccases, Yel1p and Yel3p, show that they are both secreted, monomeric, N-glycosylated proteins of molecular weight around 55kDa with substrate specificities typical of laccases, but lacking the absorption band at 612nm typical of the blue laccase proteins. Low coverage, high throughput 454 transcriptome sequencing in combination with inverse-PCR was used to identify cDNA sequences. One of the cDNA sequences has been assigned to the Yel1p protein on the basis of identity between the translated protein sequence and the peptide data from the purified protein, and the full length gene sequence has been obtained. Biochemical properties, substrate specificities and protein sequence data have been used to discuss the unusual spectroscopic properties of S. aeruginosa proteins in the context of recent theories about the differences between yellow and blue laccases. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhichao eXu
2016-02-01
Full Text Available Salvianolic acids are among the main bioactive components in Salvia miltiorrhiza, and their biosynthesis has attracted widespread interest. However, previous studies on the biosynthesis of phenolic acids using next-generation sequencing platforms are limited with regard to the assembly of full-length transcripts. Based on hybrid-seq (next-generation and single molecular real-time sequencing of the S. miltiorrhiza root transcriptome, we experimentally identified 15 full-length transcripts and 4 alternative splicing events of enzyme-coding genes involved in the biosynthesis of rosmarinic acid. Moreover, we herein demonstrate that lithospermic acid B accumulates in the phloem and xylem of roots, in agreement with the expression patterns of the identified key genes related to rosmarinic acid biosynthesis. According to co-expression patterns, we predicted that 6 candidate cytochrome P450s and 5 candidate laccases participate in the salvianolic acid pathway. Our results provide a valuable resource for further investigation into the synthetic biology of phenolic acids in S. miltiorrhiza.
Directory of Open Access Journals (Sweden)
Claudia M Rivera-Hoyos
Full Text Available Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range
Gram-scale production of a basidiomycetous laccase in Aspergillus niger.
Mekmouche, Yasmina; Zhou, Simeng; Cusano, Angela M; Record, Eric; Lomascolo, Anne; Robert, Viviane; Simaan, A Jalila; Rousselot-Pailley, Pierre; Ullah, Sana; Chaspoul, Florence; Tron, Thierry
2014-01-01
We report on the expression in Aspergillus niger of a laccase gene we used to produce variants in Saccharomyces cerevisiae. Grams of recombinant enzyme can be easily obtained. This highlights the potential of combining this generic laccase sequence to the yeast and fungal expression systems for large-scale productions of variants. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Heterologous expression of trametes versicolor laccase in pichia pastoris and aspergillus niger
CSIR Research Space (South Africa)
Bohlin, C
2006-09-01
Full Text Available primarily for screening purposes. With A. niger, high levels of laccase (2700 U/L) were produced using a min- imal medium containing sucrose and yeast extract. Recombinant laccase from A. niger harboring the lcc2 cDNA was purified to homogeneity...). Methods Microbial Strains and Recombinant DNA The lcc1 and lcc2 cDNA genes from T. (Coriolus, Polyporus) versicolor (9–11) were used in the construction of plasmids for expression of laccases in P. pastoris and A. niger. For the expression in P...
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
Energy Technology Data Exchange (ETDEWEB)
C.A.Reddy, PI
2005-06-30
and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity
Screening for novel laccase-producing microbes.
Kiiskinen, L-L; Rättö, M; Kruus, K
2004-01-01
To discover novel laccases potential for industrial applications. Fungi were cultivated on solid media containing indicator compounds that enabled the detection of laccases as specific colour reactions. The indicators used were Remazol Brilliant Blue R (RBBR), Poly R-478, guaiacol and tannic acid. The screening work resulted in isolation of 26 positive fungal strains. Liquid cultivations of positive strains confirmed that four efficient laccase producers were found in the screening. Biochemical characteristics of the four novel laccases were typical for fungal laccases in terms of molecular weight, pH optima and pI. The laccases showed good thermal stability at 60 degrees C. Plate-test screening based on polymeric dye compounds, guaiacol and tannic acid is an efficient way to discover novel laccase producers. The results indicated that screening for laccase activity can be performed with guaiacol and RBBR or Poly R-478. Laccases have many potential industrial applications including textile dye decolourization, delignification of pulp and effluent detoxification. It is essential to find novel, efficient enzymes to further develop these applications. This study showed that relatively simple plate test screening method can be used for discovery of novel laccases. Copyright 2004 The Society for Applied Microbiology
Luo, Ling; Zhou, Zhi-Chao; Gu, Ji-Dong
2015-10-01
This study investigated the diversity and abundance of bacterial lacasse-like genes in different particle size fractions, namely sand, silt, and clay of sediments in a subtropical mangrove ecosystem. Moreover, the effects of nutrient conditions on bacterial laccase-like communities as well as the correlation between nutrients and, both the abundance and diversity indices of laccase-like bacteria in particle size fractions were also studied. Compared to bulk sediments, Bacteroidetes, Caldithrix, Cyanobacteria and Chloroflexi were dominated in all 3 particle-size fractions of intertidal sediment (IZ), but Actinobacteria and Firmicutes were lost after the fractionation procedures used. The diversity index of IZ fractions decreased in the order of bulk > clay > silt > sand. In fractions of mangrove forest sediment (MG), Verrucomicrobia was found in silt, and both Actinobacteria and Bacteroidetes appeared in clay, but no new species were found in sand. The declining order of diversity index in MG fractions was clay > silt > sand > bulk. Furthermore, the abundance of lacasse-like bacteria varied with different particle-size fractions significantly (p clay > silt in both IZ and MG fractions. Additionally, nutrient availability was found to significantly affect the diversity and community structure of laccase-like bacteria (p fractions (p < 0.05). Therefore, this study further provides evidence that bacterial laccase plays a vital role in turnover of sediment organic matter and cycling of nutrients.
Heterologous expression and characterization of a laccase from Laccaria bicolor in Pichia pastoris
Directory of Open Access Journals (Sweden)
Bo Wang
2016-01-01
Full Text Available Synthetic dyes are known to be highly toxic to mammalian cells and mutagenic and carcinogenic to humans and, therefore, should be detoxified and removed from industrial effluents. Different approaches for removal and detoxication are extensively sought. Biochemical methods are considered the most economical and effective method of dye decolourization. In this research, the laccase gene from Laccaria bicolor was modified and expressed in Pichia pastoris. The properties of the recombinant laccase and its ability to degrade synthetic dyes were studied. The laccase activity was optimal at pH 2.2 and 50 °C. Its Km value was 0.187 mmol/L for ABTS [2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid]. The laccase obtained was shown to decolorize the synthetic dyes, malachite green, crystal violet and orange G, with ABTS as a mediator. These results indicated that the laccase obtained may be used to treat industrial effluents containing artificial dyes.
Energy Technology Data Exchange (ETDEWEB)
Nakanishi, Akihito; Bae, Jun Gu; Fukai, Kotaro; Tokumoto, Naoki; Kuroda, Kouichi; Ogawa, Jun; Shimizu, Sakayu; Ueda, Mitsuyoshi [Kyoto Univ. (Japan). Div. of Applied Life Sciences; Nakatani, Masato [Daiwa Kasei, Shiga (Japan)
2012-05-15
A gene encoding laccase I was identified and cloned from the white-rot fungus Trametes sp. Ha1. Laccase I contained 10 introns and an original secretion signal sequence. After laccase I without introns was prepared by overlapping polymerase chain reaction, it was inserted into expression vector pULD1 for yeast cell surface display. The oxidation activity of a laccase-I-displaying yeast as a whole-cell biocatalyst was examined with 2,2{sup '}-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS), and the constructed yeast showed a high oxidation activity. After the pretreatment of hydrothermally processed rice straw (HPRS) with laccase-I-displaying yeast with ABTS, fermentation was conducted with yeast codisplaying endoglucanase, cellobiohydrolase, and {beta}-glucosidase with HPRS. Fermentation of HPRS treated with laccase-I-displaying yeast was performed with 1.21-fold higher activities than those of HPRS treated with control yeast. The results indicated that pretreatment with laccase-I-displaying yeast with ABTS was effective for direct fermentation of cellulosic materials by yeast codisplaying endoglucanase, cellobiohydrolase, and {beta}-glucosidase. (orig.)
Site-directed mutation of a laccase from Thermus thermophilus: Effect on the activity profile
Directory of Open Access Journals (Sweden)
Liu Xin
2012-01-01
Full Text Available A site-directed mutant R453T of a laccase from Thermus thermophilus HB27 (Tth-laccase was constructed in order to investigate the effect on laccase catalytic properties. The mutated gene was cloned and overexpressed in Escherichia coli. Nickel-affinity purification was achieved and followed by copper ion incorporation. The mature mutated enzyme was quantitatively equal to the wild type. A photometric assay based on the oxidation of the substrate 2,2-azino-bis-(3- ethylbenzthiazoline-6-sulfonate (ABTS was employed in comparison with the wild-type Tth-laccase on catalytic properties. The R453T mutant exhibited improvement in substrate affinity and specific activity at room temperature, whereas those parameters were not significantly influenced when the temperature increased up to 65°C or higher. The mutant had better catalytic activity than that of the wild type at acidic pH. Investigated by circular dichroism spectroscopy, the mutant Tth-laccase displayed similar profiles at low and high temperatures.
Development and mapping of gene-tagged SNP markers in laccases of maize (Zea mays L.)
DEFF Research Database (Denmark)
Andersen, J R; Asp, T; Lu, Y C
2009-01-01
Laccases, EC 1.10.3.2 or p-diphenol : dioxygen oxidoreductases, have been proposed to be involved in the oxidative polymerization of monolignols into lignins in plants. While 17 laccases have been identified in Arabidopsis, only five (ZmLac1-5) have so far been identified in maize. By a bioinform...
Sapmak, Ariya; Boyce, Kylie J; Andrianopoulos, Alex; Vanittanakom, Nongnuch
2015-01-01
Talaromyces marneffei (Basionym: Penicillium marneffei) is a significant opportunistic fungal pathogen in patients infected with human immunodeficiency virus in Southeast Asia. T. marneffei cells have been shown to become melanized in vivo. Melanins are pigment biopolymers which act as a non-specific protectant against various stressors and which play an important role during virulence in fungi. The synthesis of the two most commonly found melanins in fungi, the eumelanin DOPA-melanin and the allomelanin DHN-melanin, requires the action of laccase enzymes. The T. marneffei genome encodes a number of laccases and this study describes the characterization of one of these, pbrB, during growth and development. A strain carrying a PbrB-GFP fusion shows that pbrB is expressed at high levels during asexual development (conidiation) but not in cells growing vegetatively. The pbrB gene is required for the synthesis of DHN-melanin in conidia and when deleted results in brown pigmented conidia, in contrast to the green conidia of the wild type.
Directory of Open Access Journals (Sweden)
Kim Dae-Hyuk
2010-02-01
Full Text Available Abstract Background A tannic acid-inducible and mycoviral-regulated laccase3 (lac3 from the chestnut blight fungus Cryphonectria parasitica has recently been identified, but further characterization was hampered because of the precipitation of protein products by tannic acid supplementation. The present study investigated the heterologous expression of the functional laccase3 using a yeast Saccharomyces cerevisiae. Results Laccase activity in the culture broth of transformants measured using a laccase-specific substrate suggested that the lac3 gene was successfully expressed and the corresponding protein product secreted into the culture media. In addition, activity staining and Western blot analysis of a native gel revealed that the enzyme activity co-existed with the protein product specific to anti-laccase3 antibody, confirming that the cloned lac3 gene is responsible for the laccase activity. When transformants were grown on plates containing tannic acid-supplemented media, brown coloration was observed around transformed cells, indicating the oxidation of tannic acid. However, the enzymatic activity was measurable only in the selective ura- media and was negligible in nonselective nutrient-rich culture conditions. This was in part because of the increased plasmid instability in the nonselective media. Moreover, the protein product of lac3 appears to be sensitive to the cultured nonselective nutrient-rich broth, because a rapid decline in enzymatic activity was observed when the cultured broth of ura- media was mixed with that of nonselective nutrient-rich broth. In addition, constitutive expression of the lac3 gene resulted in a reduced cell number of the lac3 transformants compared to that of vector-only transformed control. However, the presence of recombinant vector without lac3 induction did not affect the growth of transformants. Conclusions The results suggest that expression of the lac3 gene has an inhibitory effect on the growth of
Bioprospecting and biotechnological applications of fungal laccase.
Upadhyay, Pooja; Shrivastava, Rahul; Agrawal, Pavan Kumar
2016-06-01
Laccase belongs to a small group of enzymes called the blue multicopper oxidases, having the potential ability of oxidation. It belongs to enzymes, which have innate properties of reactive radical production, but its utilization in many fields has been ignored because of its unavailability in the commercial field. There are diverse sources of laccase producing organisms like bacteria, fungi and plants. In fungi, laccase is present in Ascomycetes, Deuteromycetes, Basidiomycetes and is particularly abundant in many white-rot fungi that degrade lignin. Laccases can degrade both phenolic and non-phenolic compounds. They also have the ability to detoxify a range of environmental pollutants. Due to their property to detoxify a range of pollutants, they have been used for several purposes in many industries including paper, pulp, textile and petrochemical industries. Some other application of laccase includes in food processing industry, medical and health care. Recently, laccase has found applications in other fields such as in the design of biosensors and nanotechnology. The present review provides an overview of biological functions of laccase, its mechanism of action, laccase mediator system, and various biotechnological applications of laccase obtained from endophytic fungi.
Díaz, Rosario; Saparrat, Mario C N; Jurado, Miguel; García-Romera, Inmaculada; Ocampo, Juan Antonio; Martínez, María Jesús
2010-09-01
Two laccase isoenzymes were purified and characterized from the basidiomycete Coriolopsis rigida during transformation of the water-soluble fraction of "alpeorujo" (WSFA), a solid residue derived from the olive oil production containing high levels of toxic compounds. Zymogram assays of laccases secreted by the fungus growing on WSFA and WSFA supplemented with glucose showed two bands with isoelectric points of 3.3 and 3.4. The kinetic studies of the two purified isoenzymes showed similar affinity on 2,6-dimethoxyphenol and 2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonic acid), used as phenolic and non-phenolic model substrate, respectively. The molecular mass of both proteins was 66 kDa with 9% N-linked carbohydrate. Physico-chemical properties of the purified laccases from media containing WSFA were similar to those obtained from medium with glucose as the main carbon source. In-vitro studies performed with the purified laccases revealed a 42% phenol reduction of WSFA, as well as changes in the molecular mass distribution. These findings indicate that these laccases are involved in the process of transformation, via polymerization by the oxidation of phenolic compounds present in WSFA. A single laccase gene, containing an open reading frame of 1,488 bp, was obtained in PCR amplifications performed with cDNA extracted from mycelia grown on WSFA. The product of the gene shares 90% identity (95% similarity) with a laccase from Trametes trogii and 89% identity (95% similarity) with a laccase from Coriolopsis gallica. This is the first report on purification and molecular characterization of laccases directly involved in the transformation of olive oil residues.
Directory of Open Access Journals (Sweden)
Abdul Aziz Ahmad
2011-12-01
Full Text Available A zinc-laccase biofuel cell adapting the zinc-air cell design features is investigated. A simple cell design configuration is employed: a membraneless single chamber and a freely suspended laccase in a quasi-neutral buffer electrolyte. The cell is characterised according to its open-circuit voltage, polarization profile, power density plot and discharge capacity at constant current. The biocatalytic role of laccase is evident from the polarization profile and power output plot. Performance comparison between a single chamber and dual chamber cell design is also presented. The biofuel cell possessed an open-circuit voltage of 1.2 V and delivered a maximum power density of 0.9 mW/cm2 at current density of 2.5 mA/cm2. These characteristics are comparable to biofuel cell utilising a much more complex system design.KEY WORDS (keyword: Biofuel cell, Bioelectrochemical cell, Zinc anode, Laccase and Oxidoreductase.ABSTRAK: Sel bio-bahan api zink-laccase dengan adaptasi daripada ciri-ciri rekabentuk sel zink-udara telah dikaji. Sel dengan konfigurasi rekabentuk yang mudah digunapakai: ruangan tunggal tanpa membran dan laccase diampaikan secara bebas di dalam elektrolit pemampan quasi-neutral. Sel dicirikan berdasarkan voltan litar terbuka, profil polarisasi, plot ketumpatan kuasa dan kapasiti discas pada arus malar. Peranan laccase sebagai bio-pemangkin adalah amat ketara daripada profil polarisasi dan plot ketumpatan kuasa. Perbandingan prestasi di antara sel dengan rekabentuk ruangan tunggal and dwi-ruangan turut diketengahkan. Seperti dijangkakan, sel dengan rekabentuk ruangan tunggal menunjukkan kuasa keluaran yang lebih rendah jika dibandingkan dengan rekabentuk dwi-ruangan kemungkinan disebabkan fenomena cas bocor. Sel bio-bahan api ini mempunyai voltan litar terbuka 1.2 V dan memberikan ketumpatan kuasa maksima 0.9 mW/cm2 pada ketumpatan arus 2.5 mA/cm2. Ciri-ciri ini adalah sebanding dengan sel bio-bahan api yang menggunapakai rekabentuk sel
Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin
2014-01-01
Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870
Vats, Arpita; Mishra, Saroj
2018-02-15
Multiplicity in laccases among lignin degrading fungal species is of interest as it confers the ability to degrade several types of lignocellulosics. The combination of laccases produced on such substrates could be beneficial for treatment of complex aromatics, including dyes. In this study, we report on production of high units (679.6Ug -1 substrate) of laccase on solid wheat bran (WB) by Cyathus bulleri. Laccase, purified from the culture filtrates of WB grown fungus, was effective for oxidation of veratryl alcohol, Reactive blue 21 and textile effluent without assistance of externally added mediators. De novo sequencing of the 'purified' laccase lead to identification of several peptides that originated from different laccase genes. Transcriptome analysis of the fungus, cultivated on WB, confirmed presence of 8 isozymes, that were re-amplified and sequenced from the cDNA prepared from WB grown fungus. The 8 isozymes were grouped into 3 classes, based on their sequence relationship with other basidiomycete laccases. The isoforms produced on WB decolorized (by ∼57%) and degraded textile effluent far more effectively, compared to laccase obtained from Basal salt cultivated fungus. The decolorization and degradation was also accompanied by more than 95% reduction in phytotoxicity. Copyright © 2017 Elsevier B.V. All rights reserved.
Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj
2012-10-23
Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg(-1) protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Laccase of C. bulleri was successfully produced extra-cellularly to a high level of 7200
Xie, Huifang; Li, Qi; Wang, Minmin; Zhao, Linguo
2013-06-28
The recombinant strain P. pastoris GS115-lccC was used to produce laccase with high activity. Factors influencing laccase expression, such as pH, methanol concentration, copper concentration, peptone concentration, shaker rotate speed, and medium volume were investigated. Under the optimal conditions, laccase activity reached 12,344 U/L on day 15. The recombinant enzyme was purified by precipitating and dialyzing to electrophoretic homogeneity, and was estimated to have a molecular mass of about 58 kDa. When guaiacol was the substrate, the laccase showed the highest activity at pH 5.0 and was stable when the pH was 4.5~6.0. The optimal temperature for the laccase to oxidize guaiacol was 60°C, but it was not stable at high temperature. The enzyme could remain stable at 30°C for 5 days. The recombinant laccase was used to degrade chlorpyrifos in several laccase/mediator systems. Among three synthetic mediators (ABTS, HBT, VA) and three natural mediators (vanillin, 2,6-DMP, and guaiacol), vanillin showed the most enhancement on degradation of chlorpyrifos. Both laccase and vanillin were responsible for the degradation of chlorpyrifos. A higher dosage of vanillin may promote a higher level of degradation of chlorpyrifos, and the 2-step addition of vanillin led to 98% chlorpyrifos degradation. The degradation of chlorpyrifos was faster in the L/V system (kobs = 0.151) than that in the buffer solution (kobs = 0.028).
Osato, Naoki
2018-01-19
Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional
Preparation of Laccase Immobilized Cryogels and Usage for Decolorization
Directory of Open Access Journals (Sweden)
Murat Uygun
2013-01-01
Full Text Available Poly(methyl methacrylate-co-glycidyl methacrylate (poly(MMA-co-GMA cryogels were synthesized by radical cryopolymerization technique. Then, laccase enzyme was covalently attached to the cryogel and characterized by using swelling studies and SEM and EDX analyses. Kinetic properties and optimum conditions of the immobilized and free laccase were studied and it was found that of the immobilized laccase was lower than that of free laccase. of the immobilized laccase was increased upon immobilization. Optimum pH was found to be 4.0 for each type of laccase, while optimum temperature was shifted to the warmer region after the immobilization. It was also found that thermal stability of the immobilized laccase was higher than that of free laccase. Immobilized laccase could be used for 10 times successive reuse with no significant decrease in its activity. Also, these laccase immobilized cryogels were successfully used for the decolorization of seven different dyes.
Energy Technology Data Exchange (ETDEWEB)
Tennyson, C.N.; Worton, R.G. [Univ. of Toronto and the Hospital for Sick Children, Ontario (Canada)
1994-09-01
The largest known gene in any organism is the human DMD gene which has 79 exons that span 2400 kb. The extreme nature of the DMD gene raises questions concerning the time required for transcription and whether splicing begins before transcription is complete. DMD gene transcription is induced as cultured human myoblasts differentiate to form multinucleated myotubes, providing a system for studying the kinetics of transcription and splicing. Using quantitative RT-PCR, transcript accumulation was monitored from four different regions within the gene following induction of expression. By comparing the accumulation of transcripts from the 5{prime} and 3{prime} ends of the gene we have shown that approximately 12 hours are required to transcribe 1770 kb of the gene, extrapolating to a time of 16 hours for the transcription unit expressed in muscle. Comparison of accumulation profiles for spliced and total transcript demonstrated that transcripts are spliced at the 5{prime} end before transcription is complete, providing strong evidence for cotranscriptional splicing of DMD gene transcripts. Finally, the rate of transcript accumulation was reduced at the 3{prime} end of the gene relative to the 5{prime} end, perhaps due to premature termination of transcription complexes as they traverse this enormous transcription unit. The lag between transcription initiation and the appearance of complete transcripts could be important in limiting transcript production in dividing cells and to the timing of mRNA appearance in differentiating muscle.
Laccase Production from a Temperature and pH Tolerant Fungal Strain of Trametes hirsuta (MTCC 11397
Directory of Open Access Journals (Sweden)
Kusum Dhakar
2013-01-01
Full Text Available Laccase production by a temperature and pH tolerant fungal strain (GBPI-CDF-03 isolated from a glacial site in Indian Himalayan Region (IHR has been investigated. The fungus developed white cottony mass on potato dextrose agar and revealed thread-like mycelium under microscope. ITS region analysis of fungus showed its 100% similarity with Trametes hirsuta. The fungus tolerated temperature from 4 to 48°C ± 2 (25°C opt. and pH 3–13 (5–7 opt.. Molecular weight of laccase was determined approximately 45 kDa by native PAGE. Amplification of laccase gene fragment (corresponding to the copper-binding conserved domain contained 200 bp. The optimum pH for laccase production, at optimum growth temperature, was determined between 5.5 and 7.5. In optimization experiments, fructose and ammonium sulfate were found to be the best carbon and nitrogen sources, respectively, for enhancing the laccase production. Production of laccase was favored by high carbon/nitrogen ratio. Addition of CuSO4 (up to 1.0 mM induced laccase production up to 2-fold, in case of 0.4 mM concentration. Addition of organic solvents also induced the production of laccase; acetone showed the highest (2-fold induction. The study has implications in bioprospecting of ecologically resilient microbial strains.
Energy Technology Data Exchange (ETDEWEB)
Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)
2015-06-15
Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.
MADS-box gene evolution - structure and transcription patterns
DEFF Research Database (Denmark)
Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin
2002-01-01
Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...
Directory of Open Access Journals (Sweden)
Garg Neha
2012-10-01
Full Text Available Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac. Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was
Construction and direct electrochemistry of orientation controlled laccase electrode.
Li, Ying; Zhang, Jiwei; Huang, Xirong; Wang, Tianhong
2014-03-28
A laccase has multiple redox centres. Chemisorption of laccases on a gold electrode through a polypeptide tag introduced at the protein surface provides an isotropic orientation of laccases on the Au surface, which allows the orientation dependent study of the direct electrochemistry of laccase. In this paper, using genetic engineering technology, two forms of recombinant laccase which has Cys-6×His tag at the N or C terminus were generated. Via the Au-S linkage, the recombinant laccase was assembled orientationally on gold electrode. A direct electron transfer and a bioelectrocatalytic activity toward oxygen reduction were observed on the two orientation controlled laccase electrodes, but their electrochemical behaviors were found to be quite different. The orientation of laccase on the gold electrode affects both the electron transfer pathway and the electron transfer efficiency of O2 reduction. The present study is helpful not only to the in-depth understanding of the direct electrochemistry of laccase, but also to the development of laccase-based biofuel cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Laccase/Mediator Systems: Their Reactivity toward Phenolic Lignin Structures.
Hilgers, Roelant; Vincken, Jean-Paul; Gruppen, Harry; Kabel, Mirjam A
2018-02-05
Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it remains unclear to what extent the presence of a mediator influences the reactions of the phenolic subunits of lignin. To get more insight in this, UHPLC-MS was used to study the reactions of a phenolic lignin dimer (GBG), initiated by a laccase from Trametes versicolor , alone or in combination with the mediators HBT and ABTS. The role of HBT was negligible, as its oxidation by laccase occurred slowly in comparison to that of GBG. Laccase and laccase/HBT oxidized GBG at a comparable rate, resulting in extensive polymerization of GBG. In contrast, laccase/ABTS converted GBG at a higher rate, as GBG was oxidized both directly by laccase but also by ABTS radical cations, which were rapidly formed by laccase. The laccase/ABTS system resulted in Cα oxidation of GBG and coupling of ABTS to GBG, rather than polymerization of GBG. Based on these results, we propose reaction pathways of phenolic lignin model compounds with laccase/HBT and laccase/ABTS.
Directory of Open Access Journals (Sweden)
Edgar Balcázar-López
Full Text Available Fungal laccases are enzymes that have been studied because of their ability to decolorize and detoxify effluents; they are also used in paper bleaching, synthesis of polymers, bioremediation, etc. In this work we were able to express a laccase from Trametes (Pycnoporus sanguineus in the filamentous fungus Trichoderma atroviride. For this purpose, a transformation vector was designed to integrate the gene of interest in an intergenic locus near the blu17 terminator region. Although monosporic selection was still necessary, stable integration at the desired locus was achieved. The native signal peptide from T. sanguineus laccase was successful to secrete the recombinant protein into the culture medium. The purified, heterologously expressed laccase maintained similar properties to those observed in the native enzyme (Km and kcat and kcat/km values for ABTS, thermostability, substrate range, pH optimum, etc. To determine the bioremediation potential of this modified strain, the laccase-overexpressing Trichoderma strain was used to remove xenobiotic compounds. Phenolic compounds present in industrial wastewater and bisphenol A (an endocrine disruptor from the culture medium were more efficiently removed by this modified strain than with the wild type. In addition, the heterologously expressed laccase was able to decolorize different dyes as well as remove benzo[α]pyrene and phenanthrene in vitro, showing its potential for xenobiotic compound degradation.
Chen, Huei-Mei; Rosebrock, Adam P; Khan, Sohail R; Futcher, Bruce; Leatherwood, Janet K
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.
Multiple Reaction Monitoring for quantitative laccase kinetics by LC-MS
DEFF Research Database (Denmark)
Perna, Valentina; Agger, Jane W.; Holck, Jesper
2018-01-01
as substrates to assess enzyme kinetics by HPLC-MS on two fungal laccases Trametes versicolor laccase, Tv and Ganoderma lucidum laccase, Gl. The method allowed accurate kinetic measurements and detailed insight into the product profiles of both laccases. Both Tv and Gl laccase are active...
DEFF Research Database (Denmark)
de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan
generalist functional herbivores. Laccases are polyphenol oxidase enzymes (PPOs) that are best known for their ability to degrade lignin in saprophytic and wood-pathogenic fungi. We found that laccase activity was primarily expressed in newly constructed garden sections where secondary leaf compounds...
Zhao, Jie; Zeng, Shengquan; Xia, Ying; Xia, Liming
2018-04-01
The laccase gene from Pycnoporus sanguineus was cloned and inserted between the strong Pcbh1 promoter and the Tcbh1 terminator from Trichoderma reesei to form the recombinant plasmid pCH-lac. Using Agrobacterium-mediated technique, the pCH-lac was integrated into the chromosomes of T. reesei. Twenty positive transformants were obtained by employing hygromycin B as a selective agent. PCR was used to confirm that the laccase gene was integrated into the chromosomal DNA of T. reesei. Laccase production by recombinant transformants was performed in shaking flasks, and the activity of laccase reached 8.8 IU/mL after 96-h fermentation under a batch process, and 17.7 IU/mL after 144-h fermentation using a fed-batch process. SDS-PAGE analysis of the fermentation broth showed that the molecular mass of the protein was about 68 kDa, almost the same as that of the laccase produced by P. sanguineus, which indicated that laccase was successfully expressed in T. reesei and secreted out of the cells. The laccase produced by the recombinant T. reesei showed good thermal stability, and could degrade the toxic phenolic material bisphenol A efficiently, after 1-h reaction with 0.06 IU/mL laccase and 0.5 mmol/L ABTS as the mediator at 60 °C and pH 4.5, the degradation rate reached 95%, which demonstrated that it had great potential value in treating the household garbage and wastewater containing the bisphenol A. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674
Directory of Open Access Journals (Sweden)
Huei-Mei Chen
Full Text Available In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.
Automated chromatographic laccase-mediator-system activity assay.
Anders, Nico; Schelden, Maximilian; Roth, Simon; Spiess, Antje C
2017-08-01
To study the interaction of laccases, mediators, and substrates in laccase-mediator systems (LMS), an on-line measurement was developed using high performance anion exchange chromatography equipped with a CarboPac™ PA 100 column coupled to pulsed amperometric detection (HPAEC-PAD). The developed method was optimized for overall chromatographic run time (45 to 120 min) and automated sample drawing. As an example, the Trametes versicolor laccase induced oxidation of 1-(3,4-dimethoxyphenyl)-2-(2-methoxyphenoxy)-1,3-dihydroxypropane (adlerol) using 1-hydroxybenzotriazole (HBT) as mediator was measured and analyzed on-line. Since the Au electrode of the PAD detects only hydroxyl group containing substances with a limit of detection being in the milligram/liter range, not all products are measureable. Therefore, this method was applied for the quantification of adlerol, and-based on adlerol conversion-for the quantification of the LMS activity at a specific T. versicolor laccase/HBT ratio. The automated chromatographic activity assay allowed for a defined reaction start of all laccase-mediator-system reactions mixtures, and the LMS reaction progress was automatically monitored for 48 h. The automatization enabled an integrated monitoring overnight and over-weekend and minimized all manual errors such as pipetting of solutions accordingly. The activity of the LMS based on adlerol consumption was determined to 0.47 U/mg protein for a laccase/mediator ratio of 1.75 U laccase/g HBT. In the future, the automated method will allow for a fast screening of combinations of laccases, mediators, and substrates which are efficient for lignin modification. In particular, it allows for a fast and easy quantification of the oxidizing activity of an LMS on a lignin-related substrate which is not covered by typical colorimetric laccase assays. ᅟ.
Artz, Rebekka R E; Reid, Eileen; Anderson, Ian C; Campbell, Colin D; Cairney, John W G
2009-03-01
Repeated prescribed burning alters the biologically labile fraction of nutrients and carbon of soil organic matter (SOM). Using a long-term (30 years) repeated burning experiment where burning has been carried out at a 2- or 4-year frequency, we analysed the effect of prescribed burning on gross potential C turnover rates and phenol oxidase activity in relation to shifts in SOM composition as observed using Fourier-transform infrared spectroscopy. In tandem, we assessed the genetic diversity of basidiomycete laccases. While the overall effect of burning was a decline in phenol oxidase activity, Shannon diversity and evenness of laccases was significantly higher in burned sites. Co-correspondence analysis of SOM composition and laccase operational taxonomic unit frequency data also suggested a strong correlation. While this correlation could indicate that the observed increase in laccase genetic diversity due to burning is due to increased resource diversity, a temporal replacement of the most abundant members of the assembly by an otherwise dormant pool of fungi cannot be excluded. As such, our results fit the intermediate disturbance hypothesis. Effects were stronger in plots burned in 2-year rotations, suggesting that the 4-year burn frequency may be a more sustainable practice to ensure the long-term stability of C cycling in such ecosystems.
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Naito, Yuki; Bono, Hidemasa
2012-07-01
GGRNA (http://GGRNA.dbcls.jp/) is a Google-like, ultrafast search engine for genes and transcripts. The web server accepts arbitrary words and phrases, such as gene names, IDs, gene descriptions, annotations of gene and even nucleotide/amino acid sequences through one simple search box, and quickly returns relevant RefSeq transcripts. A typical search takes just a few seconds, which dramatically enhances the usability of routine searching. In particular, GGRNA can search sequences as short as 10 nt or 4 amino acids, which cannot be handled easily by popular sequence analysis tools. Nucleotide sequences can be searched allowing up to three mismatches, or the query sequences may contain degenerate nucleotide codes (e.g. N, R, Y, S). Furthermore, Gene Ontology annotations, Enzyme Commission numbers and probe sequences of catalog microarrays are also incorporated into GGRNA, which may help users to conduct searches by various types of keywords. GGRNA web server will provide a simple and powerful interface for finding genes and transcripts for a wide range of users. All services at GGRNA are provided free of charge to all users.
FRUITING GENES OF SCHIZOPHYLLUM-COMMUNE ARE TRANSCRIPTIONALLY REGULATED
SCHUREN, FHJ; VANDERLENDE, TR; WESSELS, JGH
Fruiting genes in Schizophyllum commune are controlled by the mating-type genes and other regulatory genes. To examine whether differential accumulation of mRNAs for these fruiting genes is caused by transcriptional regulation, run-on transcription assaYs were performed with nuclei isolated from
DEFF Research Database (Denmark)
Manavalan, Arulmani
2006-01-01
Phanerochaete chrysosporium NCIM 1197 constitutively secretes considerable level of extracellular enzyme laccase in defined growth medium. Effect of several inducers on laccase production was attempted and found that copper sulphate alone at 30 mM concentration accelerate the laccase production...
Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription ...
Engineering and Applications of fungal laccases for organic synthesis
Directory of Open Access Journals (Sweden)
Ballesteros Antonio
2008-11-01
Full Text Available Abstract Laccases are multi-copper containing oxidases (EC 1.10.3.2, widely distributed in fungi, higher plants and bacteria. Laccase catalyses the oxidation of phenols, polyphenols and anilines by one-electron abstraction, with the concomitant reduction of oxygen to water in a four-electron transfer process. In the presence of small redox mediators, laccase offers a broader repertory of oxidations including non-phenolic substrates. Hence, fungal laccases are considered as ideal green catalysts of great biotechnological impact due to their few requirements (they only require air, and they produce water as the only by-product and their broad substrate specificity, including direct bioelectrocatalysis. Thus, laccases and/or laccase-mediator systems find potential applications in bioremediation, paper pulp bleaching, finishing of textiles, bio-fuel cells and more. Significantly, laccases can be used in organic synthesis, as they can perform exquisite transformations ranging from the oxidation of functional groups to the heteromolecular coupling for production of new antibiotics derivatives, or the catalysis of key steps in the synthesis of complex natural products. In this review, the application of fungal laccases and their engineering by rational design and directed evolution for organic synthesis purposes are discussed.
Comparison of two laccases from Trametes versicolor for application in the decolorization of dyes.
Li, Qi; Ge, Lin; Cai, Junli; Pei, Jianjun; Xie, Jingcong; Zhao, Linguo
2014-04-01
It has been previously demonstrated that laccases exhibit great potential for use in several industrial and environmental applications. In this paper, two laccase isoenzyme genes, lccB and lccC, were cloned and expressed in Pichia pastoris GS115. The sequence analysis indicated that the lccB and lccC genes consisted of 1,563 and 1,584 bp, and their open reading frames encoded 520 and 527 amino acids, respectively. They had 72.7% degree of identity in nucleotides and 86.7% in amino acids. The expression levels of LccB and LccC were up to 32,479 and 34,231 U/l, respectively. The recombinant laccases were purified by ultrafiltration and (NH4)2SO4 precipitation, showing a single band on SDS-PAGE, which had a molecular mass of 58 kDa. The optimal pH and temperature for LccB were 2.0 and 55°C with 2,2'-azino-bis-[3-ethylbenzthiazolinesulfonic acid (ABTS) as a substrate, whereas LccC exhibited optimal pH and temperature at 3.0 and 60°C. The apparent kinetic parameters of LccB were 0.43 mM for ABTS with a Vmax value of 51.28 U/mg, and the Km and Vmax values for LccC were 0.29 mM and 62.89 U/mg. The recombinant laccases were able to decolorize five types of dyes. Acid Violet 43 (100 g/ml) was completely decolorized by LccB or LccC (2 U/ml), and the decolorization of Reactive Blue KN-R (100 g/ml) was 91.6% by LccC (2 U/ml). Thus, the study characterizes useful laccase isoenzymes from T. versicolor that have the capability of being incorporated into the treatment of similar azo and anthraquinone dyes from dyeing industries.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Synthesis of novel laccase-biotitania biocatalysts for malachite green decolorization.
Zhang, Xinying; Wang, Meiyin; Lin, Linlin; Xiao, Gao; Tang, Zhenping; Zhu, Xuefeng
2018-07-01
Biomimetic mineralization has emerged as a novel tool for generating excellent supports for enzyme stabilization. In this work, protamine was used to induce titanium (IV) bis(ammonium lactato) dihydroxide (Ti-BALDH) into titania nanoparticles. This biomimetic titanification process was adopted for laccase immobilization. Laccase-biotitania biocatalyst was prepared and the effect of different parameters (buffer solution, titania precursor concentration, protamine concentration, and enzyme loading) on the encapsulation efficiency and recovery of laccase were evaluated. Compared with free laccase, the thermal and pH stability of immobilized laccase were improved significantly. In addition, laccase loaded on titania was effective at enhancing its storage stability. After seven consecutive cycles, the immobilized laccase still retained 51% of its original activity. Finally, laccase-biotitania biocatalysts showed good performance on decolorization of malachite green (MG), which can be attributed to an adsorption and degradation effect. The intermediates of the MG degradation were identified by gas chromatography-mass spectrometry (GC-MS) analysis, and the most probable degradation pathway was proposed. This study provides deeper understanding of the laccase-biotitania particles as a fast biocatalyst for MG decolorization. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander
2005-08-01
Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.
Engineering laccases: in search for novel catalysts.
Robert, Viviane; Mekmouche, Yasmina; Pailley, Pierre R; Tron, Thierry
2011-04-01
Laccases (p-diphenol oxidase, EC 1.10.3.2) are blue multicopper oxidases that catalyze the reduction of dioxygen to water, with a concomitant oxidation of small organic substrates. Since the description at the end of the nineteenth century of a factor catalyzing the rapid hardening of the latex of the Japanese lacquer trees (Rhus sp.) exposed to air laccases from different origins (plants, fungi bacteria) have been continuously discovered and extensively studied. Nowadays, molecular evolution and other powerful protein modification techniques offer possibilities to develop tailored laccases for a wide array of applications including drug synthesis, biosensors or biofuel cells. Here, we give an overview on strategies and results of our laboratory in the design of new biocatalysts based on laccases.
Fungal Laccases and Their Applications in Bioremediation
Directory of Open Access Journals (Sweden)
Buddolla Viswanath
2014-01-01
Full Text Available Laccases are blue multicopper oxidases, which catalyze the monoelectronic oxidation of a broad spectrum of substrates, for example, ortho- and para-diphenols, polyphenols, aminophenols, and aromatic or aliphatic amines, coupled with a full, four-electron reduction of O2 to H2O. Hence, they are capable of degrading lignin and are present abundantly in many white-rot fungi. Laccases decolorize and detoxify the industrial effluents and help in wastewater treatment. They act on both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants, and they can be effectively used in paper and pulp industries, textile industries, xenobiotic degradation, and bioremediation and act as biosensors. Recently, laccase has been applied to nanobiotechnology, which is an increasing research field, and catalyzes electron transfer reactions without additional cofactors. Several techniques have been developed for the immobilization of biomolecule such as micropatterning, self-assembled monolayer, and layer-by-layer techniques, which immobilize laccase and preserve their enzymatic activity. In this review, we describe the fungal source of laccases and their application in environment protection.
In silico Analysis for Laccase-mediated Bioremediation of the Emerging Pharmaceutical Pollutants
Directory of Open Access Journals (Sweden)
Anjali Singh
2015-12-01
Full Text Available Laccases, a copper oxidase enzyme, has been employed for bioremediation of anthropogenic pollutants in the recent past. Laccase has a broad range of substrate specificity which offers the prospect for screening in numerable xenobiotics. The present study was aimed to use protein-ligand docking as a tool for prediction of biodegradation of selected pharmaceutical pollutants. A comparative study was also done to determine the binding efficacy of bacterial and fungal laccase for those selected pollutants. The laccase-pollutant docking was carried out using HEX software. The docking scores of bacterial and fungal laccase for predefined pollutants were comparable to ABTS, a substrate for laccase, which suggested that laccase might be able to degrade emerging pharmaceutical pollutants. The docking analysis approach can be useful in prediction of binding competence of pharmaceutical pollutants with laccase for in situ laccase-mediated bioremediation.
Łukasiewicz, Kinga; Węgrzyn, Grzegorz
2016-01-01
An isolated population of apollo butterfly (Parnassius apollo, Lepidoptera: Papilionidae) occurs in Pieniny National Park (Poland). Deformations and reductions of wings in a relatively large number of individuals from this population is found, yet the reasons for these defects are unknown. During studies devoted to identify cause(s) of this phenomenon, we found that specific regions of genes coding of enzymes laccases 1 and 2 could not be amplified from DNA samples isolated from large fractions of malformed insects while expected PCR products were detected in almost all (with one exception) normal butterflies. Laccases (p-diphenol:dioxygen oxidoreductases) are oxidases containing several copper atoms. They catalyse single-electron oxidations of phenolic or other compounds with concomitant reduction of oxygen to water. In insects, their enzymatic activities were found previously in epidermis, midgut, Malpighian tubules, salivary glands, and reproductive tissues. Therefore, we suggest that defects in genes coding for laccases might contribute to deformation and reduction of wings in apollo butterflies, though it seems obvious that deficiency in these enzymes could not be the sole cause of these developmental improperties in P. apollo from Pieniny National Park.
Modification of Lignans by Trametes Hirsuta Laccase
Mattinen, M.L.; Struijs, K.; Suortti, T.; Mattila, I.; Kruus, K.; Willfor, S.; Tamminen, T.; Vincken, J.P.
2009-01-01
Oxidative polymerization of two isolated lignans, secoisolariciresinol, and secoisolariciresinol diglucoside, as well as the lignan macromolecule, by a high redox potential Trametes hirsuta laccase was studied with different analytical methods. The reactivity of laccase with the different compounds
Independent behavior of bacterial laccases to inducers and metal ...
African Journals Online (AJOL)
Valued Acer Customer
2012-05-15
May 15, 2012 ... The medium for production was a high nitrogen medium containing ... effects of metal ions on either laccase production or laccase activity were not clear. ... this study was to isolate bacterial strains that produce ... The growth of cell culture was measured by using optical ... Conditions of laccase production.
Can laccases catalyze bond cleavage in lignin?
DEFF Research Database (Denmark)
Munk, Line; Sitarz, Anna Katarzyna; Kalyani, Dayanand
2015-01-01
illustrations of the putative laccase catalyzed reactions, including the possible reactions of the reactive radical intermediates taking place after the initial oxidation of the phenol-hydroxyl groups, we show that i) Laccase activity is able to catalyze bond cleavage in low molecular weight phenolic lignin......-substituted phenols, benzenethiols, polyphenols, and polyamines, which may be oxidized. In addition, the currently available analytical methods that can be used to detect enzyme catalyzed changes in lignin are summarized, and an improved nomenclature for unequivocal interpretation of the action of laccases on lignin...
Functional Profiling of Transcription Factor Genes in Neurospora crassa
Directory of Open Access Journals (Sweden)
Alexander J. Carrillo
2017-09-01
Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.
Production of extracellular laccase from the newly isolated Bacillus ...
African Journals Online (AJOL)
This study was carried out with aim of screening for extracellular thermostable laccase producing bacteria. Twenty-two (22) laccase positive strains were isolated from the selected environmental samples while extracellular laccase activity was detected only in six strains namely TM1, TMT1, PK4, PS1, TMS1 and ASP3.
Fungal laccase: copper induction, semi-purification, immobilization ...
African Journals Online (AJOL)
Fungal laccase: copper induction, semi-purification, immobilization, phenolic effluent treatment and electrochemical measurement. ... In order to apply in an effluent treatment, laccase was immobilized on different vitroceramics supports, pyrolytic graphite and also on a carbon fiber electrode as biosensor. The maximum ...
Salony; Garg, N; Baranwal, R; Chhabra, M; Mishra, S; Chaudhuri, T K; Bisaria, V S
2008-02-01
Cyathus bulleri, a ligninolytic fungus, produces a single laccase the internal peptides (3) of which bear similarity to laccases of several white rot fungi. Comparison of the total amino acid composition of this laccase with several fungal laccases indicated dissimilarity in the proportion of some basic and hydrophobic amino acids. Analysis of the circular dichroism spectrum of the protein indicated 37% alpha-helical, 26% beta-sheet and 38% random coil content which differed significantly from that in the solved structures of other laccases, which contain higher beta-sheet structures. The critical role of the carboxylic group containing amino acids was demonstrated by determining the kinetic parameters at different pH and this was confirmed by the observation that a critical Asp is strongly conserved in both Ascomycete and Basidiomycete laccases. The enzyme was denatured in the presence of a number of denaturing agents and refolded back to functional state with copper. In the folding experiments under alkaline conditions, zinc could replace copper in restoring 100% of laccase activity indicating the non-essential role of copper in this laccase. The laccase was expressed in Escherichia coli by a modification of the ligation-anchored PCR approach making it the first fungal laccase to be expressed in a bacterial host. The laccase sequence was confirmed by way of analysis of a 435 bp sequence of the insert.
Energy Technology Data Exchange (ETDEWEB)
Cannatelli, Mark D. [Georgia Inst. of Technology, Atlanta, GA (United States)
2017-05-01
Part one of this dissertation research has focused on harnessing the ability of laccases to generate reactive para-quinones in situ from the corresponding hydroquinones, followed by reaction with a variety of nucleophiles to perform novel carbon-carbon, carbon-nitrogen, and carbon-sulfur bond forming reactions for the synthesis of new and existing compounds. In part two of this dissertation, the fundamental laccase-catalyzed coupling chemistry developed in part one was applied to functionalize the surface of kraft lignin.
Bacterial laccase: recent update on production, properties and industrial applications.
Chauhan, Prakram Singh; Goradia, Bindi; Saxena, Arunika
2017-10-01
Laccases (benzenediol: oxygen oxidoreductase, EC 1.10.3.2) are multi-copper enzymes which catalyze the oxidation of a wide range of phenolic and non-phenolic aromatic compounds in the presence or absence of a mediator. Till date, laccases have mostly been isolated from fungi and plants, whereas laccase from bacteria has not been well studied. Bacterial laccases have several unique properties that are not characteristics of fungal laccases such as stability at high temperature and high pH. Bacteria produce these enzymes either extracellularly or intracellularly and their activity is in a wide range of temperature and pH. It has application in pulp biobleaching, bioremediation, textile dye decolorization, pollutant degradation, biosensors, etc. Hence, comprehensive information including sources, production conditions, characterization, cloning and biotechnological applications is needed for the effective understanding and application of these enzymes at the industrial level. The present review provides exhaustive information of bacterial laccases reported till date.
De Fine Licht, Henrik H; Schiøtt, Morten; Rogowska-Wrzesinska, Adelina; Nygaard, Sanne; Roepstorff, Peter; Boomsma, Jacobus J
2013-01-08
Leaf-cutting ants combine large-scale herbivory with fungus farming to sustain advanced societies. Their stratified colonies are major evolutionary achievements and serious agricultural pests, but the crucial adaptations that allowed this mutualism to become the prime herbivorous component of neotropical ecosystems has remained elusive. Here we show how coevolutionary adaptation of a specific enzyme in the fungal symbiont has helped leaf-cutting ants overcome plant defensive phenolic compounds. We identify nine putative laccase-coding genes in the fungal genome of Leucocoprinus gongylophorus cultivated by the leaf-cutting ant Acromyrmex echinatior. One of these laccases (LgLcc1) is highly expressed in the specialized hyphal tips (gongylidia) that the ants preferentially eat, and we confirm that these ingested laccase molecules pass through the ant guts and remain active when defecated on the leaf pulp that the ants add to their gardens. This accurate deposition ensures that laccase activity is highest where new leaf material enters the fungus garden, but where fungal mycelium is too sparse to produce extracellular enzymes in sufficient quantities to detoxify phenolic compounds. Phylogenetic analysis of LgLcc1 ortholog sequences from symbiotic and free-living fungi revealed significant positive selection in the ancestral lineage that gave rise to the gongylidia-producing symbionts of leaf-cutting ants and their non-leaf-cutting ant sister group. Our results are consistent with fungal preadaptation and subsequent modification of a particular laccase enzyme for the detoxification of secondary plant compounds during the transition to active herbivory in the ancestor of leaf-cutting ants between 8 and 12 Mya.
Scaling proprioceptor gene transcription by retrograde NT3 signaling.
Directory of Open Access Journals (Sweden)
Jun Lee
Full Text Available Cell-type specific intrinsic programs instruct neuronal subpopulations before target-derived factors influence later neuronal maturation. Retrograde neurotrophin signaling controls neuronal survival and maturation of dorsal root ganglion (DRG sensory neurons, but how these potent signaling pathways intersect with transcriptional programs established at earlier developmental stages remains poorly understood. Here we determine the consequences of genetic alternation of NT3 signaling on genome-wide transcription programs in proprioceptors, an important sensory neuron subpopulation involved in motor reflex behavior. We find that the expression of many proprioceptor-enriched genes is dramatically altered by genetic NT3 elimination, independent of survival-related activities. Combinatorial analysis of gene expression profiles with proprioceptors isolated from mice expressing surplus muscular NT3 identifies an anticorrelated gene set with transcriptional levels scaled in opposite directions. Voluntary running experiments in adult mice further demonstrate the maintenance of transcriptional adjustability of genes expressed by DRG neurons, pointing to life-long gene expression plasticity in sensory neurons.
Lignin Biodegradation with Laccase-Mediator Systems
International Nuclear Information System (INIS)
Christopher, Lew Paul; Yao, Bin; Ji, Yun
2014-01-01
Lignin has a significant and largely unrealized potential as a source for the sustainable production of fuels and bulk high-value chemicals. It can replace fossil-based oil as a renewable feedstock that would bring about socio-economic and environmental benefits in our transition to a biobased economy. The efficient utilization of lignin however requires its depolymerization to low-molecular weight phenolics and aromatics that can then serve as the building blocks for chemical syntheses of high-value products. The ability of laccase to attack and degrade lignin in conjunction with laccase mediators is currently viewed as one of the potential “breakthrough” applications for lignin valorization. Here, we review the recent progress in lignin biodegradation with laccase-mediator systems, and research needs that need to be addressed in this field.
Lignin Biodegradation with Laccase-Mediator Systems
Energy Technology Data Exchange (ETDEWEB)
Christopher, Lew Paul, E-mail: lew.christopher@sdsmt.edu [Center for Bioprocessing Research and Development, South Dakota School of Mines & Technology, Rapid City, SD (United States); Department of Civil and Environmental Engineering, South Dakota School of Mines & Technology, Rapid City, SD (United States); Yao, Bin [Center for Bioprocessing Research and Development, South Dakota School of Mines & Technology, Rapid City, SD (United States); Ji, Yun [Department of Chemical Engineering, University of North Dakota, Grand Forks, ND (United States)
2014-03-31
Lignin has a significant and largely unrealized potential as a source for the sustainable production of fuels and bulk high-value chemicals. It can replace fossil-based oil as a renewable feedstock that would bring about socio-economic and environmental benefits in our transition to a biobased economy. The efficient utilization of lignin however requires its depolymerization to low-molecular weight phenolics and aromatics that can then serve as the building blocks for chemical syntheses of high-value products. The ability of laccase to attack and degrade lignin in conjunction with laccase mediators is currently viewed as one of the potential “breakthrough” applications for lignin valorization. Here, we review the recent progress in lignin biodegradation with laccase-mediator systems, and research needs that need to be addressed in this field.
Garg, Neha; Bieler, Nora; Kenzom, Tenzin; Chhabra, Meenu; Ansorge-Schumacher, Marion; Mishra, Saroj
2012-01-01
Abstract Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported lacc...
Gupta, Vijaya; Capalash, Neena; Gupta, Naveen; Sharma, Prince
2017-03-01
Activated sludge is an artificial ecosystem known to harbor complex microbial communities. Bacterial diversity in activated sludge from pulp and paper industry was studied to bioprospect for laccase, the multicopper oxidase applicable in a large number of industries due to its ability to utilize a wide range of substrates. Bacterial diversity using 454 pyrosequencing and laccase diversity using degenerate primers specific to conserved copper binding domain of laccase like multicopper oxidase (LMCO) genes were investigated. 1231 OTUs out of 11,425 sequence reads for bacterial diversity and 11 OTUs out of 15 reads for LMCO diversity were formed. Phylum Proteobacteria (64.95 %) with genus Thauera (13.65 %) was most abundant followed by phylum Bacteriodetes (11.46 %) that included the dominant genera Paludibacter (1.93 %) and Lacibacter (1.32 %). In case of LMCOs, 40 % sequences showed affiliation with Proteobacteria and 46.6 % with unculturable bacteria, indicating considerable novelty, and 13.3 % with Bacteroidetes. LMCOs belonged to H and J families.
Is gene transcription involved in seed dry after-ripening?
Directory of Open Access Journals (Sweden)
Patrice Meimoun
Full Text Available Orthodox seeds are living organisms that survive anhydrobiosis and may display dormancy, an inability to germinate at harvest. Seed germination potential can be acquired during a prolonged period of dry storage called after-ripening. The aim of this work was to determine if gene transcription is an underlying regulatory mechanism for dormancy alleviation during after-ripening. To identify changes in gene transcription strictly associated with the acquisition of germination potential but not with storage, we used seed storage at low relative humidity that maintains dormancy as control. Transcriptome profiling was performed using DNA microarray to compare change in gene transcript abundance between dormant (D, after-ripened non-dormant (ND and after-ripened dormant seeds (control, C. Quantitative real-time polymerase chain reaction (qPCR was used to confirm gene expression. Comparison between D and ND showed the differential expression of 115 probesets at cut-off values of two-fold change (p<0.05. Comparisons between both D and C with ND in transcript abundance showed that only 13 transcripts, among 115, could be specific to dormancy alleviation. qPCR confirms the expression pattern of these transcripts but without significant variation between conditions. Here we show that sunflower seed dormancy alleviation in the dry state is not related to regulated changes in gene expression.
Reactivity of bacterial and fungal laccases with lignin under alkaline conditions.
Moya, Raquel; Saastamoinen, Päivi; Hernández, Manuel; Suurnäkki, Anna; Arias, Enriqueta; Mattinen, Maija-Liisa
2011-11-01
The ability of Streptomyces ipomoea laccase to polymerize secoisolariciresinol lignan and technical lignins was assessed. The reactivity of S. ipomoea laccase was also compared to that of low redox fungal laccase from Melanocarpus albomyces using low molecular mass p-coumaric, ferulic and sinapic acid as well as natural (acetosyringone) and synthetic 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO) mediators as substrates. Oxygen consumption measurement, MALDI-TOF MS and SEC were used to follow the enzymatic reactions at pH 7, 8, 9 and 10 at 30°C and 50°C. Polymerization of lignins and lignan by S. ipomoea laccase under alkaline reaction conditions was observed, and was enhanced in the presence of acetosyringone almost to the level obtained with M. albomyces laccase without mediator. Reactivities of the enzymes towards acetosyringone and TEMPO were similar, suggesting exploitation of the compounds and low redox laccase in lignin valorization under alkaline conditions. The results have scientific impact on basic research of laccases. Copyright © 2011 Elsevier Ltd. All rights reserved.
Degradation of Synthetic Dyes by Laccases – A Mini-Review
Directory of Open Access Journals (Sweden)
Legerská Barbora
2016-06-01
Full Text Available Laccases provide a promising future as a tool to be used in the field of biodegradation of synthetic dyes with different chemical structures. These enzymes are able to oxidize a wide range of phenolic substrates without the presence of additional co-factors. Laccases have been confirmed for their potential of synthetic dye degradation from wastewater and degradation products of these enzymatic reactions become less toxic than selected dyes. This study discusses the potential of laccase enzymes as agents for laccase-catalyzed degradation in terms of biodegradation efficiency of synthetic dyes, specifically: azo dyes, triphenylmethane, indigo and anthraquinone dyes. Review also summarizes the laccase-catalyzed degradation mechanisms of the selected synthetic dyes, as well as the degradation products and the toxicity of the dyes and their degradation products.
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte
Directory of Open Access Journals (Sweden)
Kang Il-Ho
2010-06-01
Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this
Laccase Enzymes in Inocula Pleurotus spp
Directory of Open Access Journals (Sweden)
Nora García-Oduardo
2017-01-01
Full Text Available The cultivation of edible and medicinal mushrooms Pleurotus has been aimed at promoting alternative management for agricultural products. This basidiomicete has been the subject of numerous studies because of its fruiting body constitutes a food, being a producer of enzymes with industrial interest and for its ability of biotransformation of lignocellulosic substrates. Pleurotus inocula in the established technology for growing edible and medicinal mushrooms in the CEBI Research- Production Plant were performed using sorghum or wheat. However, it is possible to expand the possibilities with other substrates. In this paper, the results of laccase enzymes production in inocula prepared with sorghum, corn and coffee pulp with two strains Pleurotus ostreatus CCEBI 3021 and Pleurotus ostreatus CCEBI 3024 are presented. The period of preparation of seed reaches 15-21 days, the measurements of laccase activity were performed in periods of seven days. Extraction of crude enzyme was performed in aqueous phase, the determination of the laccase enzyme activity, using guaiacol as substrate. The results obtained in this work with studies in previous work using sorghum as inocula are compared. It is found that higher yields are obtained laccase in coffee pulp. This study contributes to the theoretical knowledge and to provide alternatives for securing the production process of the plant.
Post-transcriptional regulation of gene expression in Yersinia species
Directory of Open Access Journals (Sweden)
Chelsea A Schiano
2012-11-01
Full Text Available Proper regulation of gene expression is required by bacterial pathogens to respond to continually changing environmental conditions and the host response during the infectious process. While transcriptional regulation is perhaps the most well understood form of controlling gene expression, recent studies have demonstrated the importance of post-transcriptional mechanisms of gene regulation that allow for more refined management of the bacterial response to host conditions. Yersinia species of bacteria are known to use various forms of post-transcriptional regulation for control of many virulence-associated genes. These include regulation by cis- and trans-acting small non-coding RNAs, RNA-binding proteins, RNases, and thermoswitches. The effects of these and other regulatory mechanisms on Yersinia physiology can be profound and have been shown to influence type III secretion, motility, biofilm formation, host cell invasion, intracellular survival and replication, and more. In this review, we will discuss these and other post-transcriptional mechanisms and their influence on virulence gene regulation, with a particular emphasis on how these processes influence the virulence of Yersinia in the host.
Fluorescent nanocellulosic hydrogels based on graphene quantum dots for sensing laccase
International Nuclear Information System (INIS)
Ruiz-Palomero, Celia; Benítez-Martínez, Sandra; Soriano, M. Laura; Valcárcel, Miguel
2017-01-01
A novel low-cost fluorimetric platform based on sulfur, nitrogen-codoped graphene quantum dots immersed into nanocellulosic hydrogels is designed and applied in detecting the laccase enzyme. Although most of methods for detecting laccase are based on their catalytic activity, which is strongly dependent on environmental parameters, we report a sensitive and selective method based on the fluorescence response of hydrogels containing graphene quantum dots (GQDs) acting as luminophore towards laccase. The easily-prepared gel matrix not only improves the fluorescence signal of GQDs by avoiding their self-quenching but also stabilizes their fluorescence signal and improves their sensitivity towards laccase. Noncovalent interactions between the sensor and the analyte are believed to be causing this significant quenching without peak-shifts of GQD fluorescence via energy transfer. The selective extraction of laccase was proved in different shampoos as complex matrices achieving a detection limit of 0.048 U mL −1 and recoveries of 86.2–94.1%. As the unusual properties of nanocellulose and GQDs, the fluorescent sensor is simple, eco-friendly and cost-efficient. This straightforward strategy is able to detect and stabilize laccase, being an added-value for storage and recycling enzymes. - Highlights: • Fluorescent hydrogels were constructed by combining nanocellulose and graphene quantum dots. • The resulting hydrogels exhibited fluorescence quenching in presence of laccase. • Equilibrium in the optical signal of S,N-graphene quantum dots in presence of laccase was achieved faster within hydrogels. • The proposed method to determine laccase using fluorescent hydrogels was successfully applied in shampoo.
Laccase production by Monotospora sp., an endophytic fungus in Cynodon dactylon.
Wang, J W; Wu, J H; Huang, W Y; Tan, R X
2006-03-01
The effects of the carbon and nitrogen sources, initial pH and incubation temperature on laccase production by the endophytic fungus Monotospora sp. were evaluated. The optimal temperature and initial pH for laccase production by Monotospora sp. in submerged culture were found to be 30 degrees C and 8.5, respectively. Maltose (2 g l(-1)) and ammonium tartrate (10 g l(-1)) were the most suitable carbon and nitrogen source for laccase production. Under optimal culture medium, the maximum laccase activity was determined to be 13.55 U ml(-1), which was approximately four times higher than that in basal medium. This is the first report on laccase production by an endophytic fungus.
Frequency Modulation of Transcriptional Bursting Enables Sensitive and Rapid Gene Regulation.
Li, Congxin; Cesbron, François; Oehler, Michael; Brunner, Michael; Höfer, Thomas
2018-04-25
Gene regulation is a complex non-equilibrium process. Here, we show that quantitating the temporal regulation of key gene states (transcriptionally inactive, active, and refractory) provides a parsimonious framework for analyzing gene regulation. Our theory makes two non-intuitive predictions. First, for transcription factors (TFs) that regulate transcription burst frequency, as opposed to amplitude or duration, weak TF binding is sufficient to elicit strong transcriptional responses. Second, refractoriness of a gene after a transcription burst enables rapid responses to stimuli. We validate both predictions experimentally by exploiting the natural, optogenetic-like responsiveness of the Neurospora GATA-type TF White Collar Complex (WCC) to blue light. Further, we demonstrate that differential regulation of WCC target genes is caused by different gene activation rates, not different TF occupancy, and that these rates are tuned by both the core promoter and the distance between TF-binding site and core promoter. In total, our work demonstrates the relevance of a kinetic, non-equilibrium framework for understanding transcriptional regulation. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
International Nuclear Information System (INIS)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R.
2014-01-01
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
Alkane biosynthesis genes in cyanobacteria and their transcriptional organization
Directory of Open Access Journals (Sweden)
Stephan eKlähn
2014-07-01
Full Text Available In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl-acyl carrier protein reductase (AAR and aldehyde deformylating oxygenase (ADO. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado and sll0209 (aar, that give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313 and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in
Alkane Biosynthesis Genes in Cyanobacteria and Their Transcriptional Organization
Energy Technology Data Exchange (ETDEWEB)
Klähn, Stephan; Baumgartner, Desirée; Pfreundt, Ulrike; Voigt, Karsten; Schön, Verena; Steglich, Claudia; Hess, Wolfgang R., E-mail: wolfgang.hess@biologie.uni-freiburg.de [Genetics and Experimental Bioinformatics, Institute of Biology 3, Faculty of Biology, University of Freiburg, Freiburg (Germany)
2014-07-14
In cyanobacteria, alkanes are synthesized from a fatty acyl-ACP by two enzymes, acyl–acyl carrier protein reductase and aldehyde deformylating oxygenase. Despite the great interest in the exploitation for biofuel production, nothing is known about the transcriptional organization of their genes or the physiological function of alkane synthesis. The comparison of 115 microarray datasets indicates the relatively constitutive expression of aar and ado genes. The analysis of 181 available genomes showed that in 90% of the genomes both genes are present, likely indicating their physiological relevance. In 61% of them they cluster together with genes encoding acetyl-CoA carboxyl transferase and a short-chain dehydrogenase, strengthening the link to fatty acid metabolism and in 76% of the genomes they are located in tandem, suggesting constraints on the gene arrangement. However, contrary to the expectations for an operon, we found in Synechocystis sp. PCC 6803 specific promoters for the two genes, sll0208 (ado) and sll0209 (aar), which give rise to monocistronic transcripts. Moreover, the upstream located ado gene is driven by a proximal as well as a second, distal, promoter, from which a third transcript, the ~160 nt sRNA SyR9 is transcribed. Thus, the transcriptional organization of the alkane biosynthesis genes in Synechocystis sp. PCC 6803 is of substantial complexity. We verified all three promoters to function independently from each other and show a similar promoter arrangement also in the more distant Nodularia spumigena, Trichodesmium erythraeum, Anabaena sp. PCC 7120, Prochlorococcus MIT9313, and MED4. The presence of separate regulatory elements and the dominance of monocistronic mRNAs suggest the possible autonomous regulation of ado and aar. The complex transcriptional organization of the alkane synthesis gene cluster has possible metabolic implications and should be considered when manipulating the expression of these genes in cyanobacteria.
A New Laccase Biosensor For Polyphenols Determination
Directory of Open Access Journals (Sweden)
M. J.F. Rebelo
2003-06-01
Full Text Available The relevance of polyphenols in human health is a well known fact. Prompted by that, a very intensive research has been directed to get a method to detect them, wich will improve the current ones. Laccase (p-diphenol:dioxygen oxidoreductase EC 1.10.3.2 is a multi-copper oxidase, wich couples catalytic oxidation of phenolic substrates with four electron reduction of dioxygen to water [1]. A maximum catalytic response in oxigenated electrolyte was observed between 4.5 and 5.5 [2], while for pH > 6.9 the laccase was found to be inactive [3]. We prepared a biosensor with laccase immobilised on a polyether sulphone membrane, at pH 4.5, wich was applied at Universal Sensors base electrode. Reduction of the product of oxidation of several polyphenols, catalysed by laccase, was done at a potential for wich the polyphenol of interest was found to respond. Reduction of catechol was found to occur at a potential of -200mV, wich is often referred to in the literature for polyphenolic biosensors. However other polyphenols did not respond at that potential. It was observed that (+- catechin produced a very large cathodic current when +100mV were applied to the laccase biosensor, both in aqueous acetate and 12% ethanol acetate buffer, whereas caffeic acid responded at -50mV. Other polyphenols tested were gallic acid, malvidin, quercetin, rutin, trans-resveratrol
Laccase-mediator catalyzed conversion of model lignin compounds
Laccases play an important role in the biological breakdown of lignin and have great potential in the deconstruction of lignocellulosic feedstocks. We examined a variety of laccases, both commercially prepared and crude extracts, for their ability to oxidize three model lignol compounds (p-coumaryl...
Directory of Open Access Journals (Sweden)
Pieter Rottiers
1999-12-01
Full Text Available In addition to eugenetic changes, cancerous cells exhibit extensive modifications in the expression levels of a variety of genes. The phenotypic switch observed after inoculation of T lymphoma cells into syngenic mice illustrates the active participation of tumoral environment in the induction of an aberrant gene expression pattern. To further substantiate this contribution, we performed polymerase chain reaction (PCR-based subtraction suppression hybridization (SSH to identify genes that are differentially expressed in tumor-derived EL4/13.3 cells compared to the same cells isolated from cultures. Besides a number of unknown genes, the subtracted library contained several known genes that have been reported to be expressed at increased levels in tumors and/or to contribute to carcinogenesis. Apart from clones representing translated transcripts, the subtracted library also contained a high number of clones representing B2 repeat elements, viz. short interspersed repetitive elements that are transcribed by RNA polymerase III. Northern blotting confirmed the induction of B2 transcripts in tumor tissue and also revealed induction of chimeric, B2 repeat-containing mRNA. The appearance of chimeric transcripts was accompanied by aberrant, shorter-than-full-length transcripts, specifically from upregulated genes. Accordingly, in addition to altered gene expression, tumoral environmental triggers constitute a potent mechanism to create an epigenetic diversity in cancers by inducing extensive transcript anomalies.
Laccase engineering: from rational design to directed evolution.
Mate, Diana M; Alcalde, Miguel
2015-01-01
Laccases are multicopper oxidoreductases considered by many in the biotechonology field as the ultimate "green catalysts". This is mainly due to their broad substrate specificity and relative autonomy (they use molecular oxygen from air as an electron acceptor and they only produce water as by-product), making them suitable for a wide array of applications: biofuel production, bioremediation, organic synthesis, pulp biobleaching, textiles, the beverage and food industries, biosensor and biofuel cell development. Since the beginning of the 21st century, specific features of bacterial and fungal laccases have been exhaustively adapted in order to reach the industrial demands for high catalytic activity and stability in conjunction with reduced production cost. Among the goals established for laccase engineering, heterologous functional expression, improved activity and thermostability, tolerance to non-natural media (organic solvents, ionic liquids, physiological fluids) and resistance to different types of inhibitors are all challenges that have been met, while obtaining a more comprehensive understanding of laccase structure-function relationships. In this review we examine the most significant advances in this exciting research area in which rational, semi-rational and directed evolution approaches have been employed to ultimately convert laccases into high value-added biocatalysts. Copyright © 2014 Elsevier Inc. All rights reserved.
Improved Laccase Production by Trametes pubescens MB89 in Distillery Wastewaters
Directory of Open Access Journals (Sweden)
P. J. Strong
2011-01-01
Full Text Available Various culture parameters were optimised for laccase synthesis by Trametes pubescens MB89, including pH, carbon source, nitrogen source, lignocellulosic supplements, and reported inducers. Glucose, in conjunction with a complex nitrogen source at pH 5.0, resulted in the highest laccase yield. Adding ethanol, copper, or 2,5-xylidine prior to inoculation further improved laccase concentrations. The addition of 2,5-xylidine was further investigated with multiple additions applied at varying times. This novel application substantially improved laccase production when applied regularly from inoculation and during the growth phase, and also countered glucose repression of laccase synthesis. Single and multiple factor changes were studied in three distillery wastewaters and a wine lees. A synergistic increase in laccase synthesis was observed with the addition of glucose, copper, and 2,5-xylidine. Single addition of 2,5-xylidine proved most beneficial with distillery wastewaters, while copper addition was most beneficial when using the wine lees as a culture medium.
Transcription of the soybean leghemoglobin genes during nodule development
DEFF Research Database (Denmark)
Marcker, Anne; Ø Jensen, Erik; Marcker, Kjeld A
1984-01-01
During the early stages of soybean nodule development the leghemoglobin (Lb) genes are activated sequentially in the opposite order to which they are arranged in the soybean genome. At a specific stage after the initial activation of all the Lb genes, a large increment occurs in the transcription...... of the Lb(c1), Lb(c3) and Lb(a) genes while the transcription of the Lb(c2) gene is not amplified to a similar extent. All the Lb genes retain significant activity for a long period during the lifetime of a nodule. Consequently the soybean Lb genes are not regulated by a developmental gene switching...
Laccase mediated transformation of 17β-estradiol in soil
International Nuclear Information System (INIS)
Singh, Rashmi; Cabrera, Miguel L.; Radcliffe, David E.; Zhang, Hao; Huang, Qingguo
2015-01-01
It is known that 17β-estradiol (E2) can be transformed by reactions mediated by some oxidoreductases such as laccase in water. Whether or how such reactions can happen in soil is however unknown although they may significantly impact the environmental fate of E2 that is introduced to soil by land application of animal wastes. We herein studied the reaction of E2 in a model soil mediated by laccase, and found that the reaction behaviors differ significantly from those in water partly because of the dramatic difference in laccase stability. We also examined E2 transformation in soil using 14 C-labeling in combination with soil organic matter extraction and size exclusion chromatography, which indicated that applied 14 C radioactivity was preferably bound to humic acids. The study provides useful information for understanding the environmental fate of E2 and for developing a novel soil remediation strategy via enzyme-enhanced humification reactions. - Highlights: • E2 was effectively transformed in soil through reactions mediated by laccase. • The reaction behaviors in soil differ significantly from those in water. • E2 was preferably bound to the humic acids in soil. • Laccase treatment resulted in changes in the structures of the humic acids. - E2 was effectively transformed in soil by preferably binding to the humic acids through reactions mediated by laccase
Ethanol induction of laccase depends on nitrogen conditions of Pycnoporus sanguineus
Directory of Open Access Journals (Sweden)
Christian A. Hernández
2015-07-01
Conclusions: We suggest that laccase in P. sanguineus is regulated by a catabolic nitrogen repression mechanism; laccase activity is strongly inhibited by urea used as nitrogen source and it decreases when the amount of urea increases; contrarily, a synergic positive effect was observed between yeast extract and ethanol on laccase production.
Characterization of C-terminally engineered laccases.
Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry
2014-08-01
Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.
A New Laccase Based Biosensor for Tartrazine
Directory of Open Access Journals (Sweden)
Siti Zulaikha Mazlan
2017-12-01
Full Text Available Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM (R2 = 0.979 and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.
A New Laccase Based Biosensor for Tartrazine.
Mazlan, Siti Zulaikha; Lee, Yook Heng; Hanifah, Sharina Abu
2017-12-09
Laccase enzyme, a commonly used enzyme for the construction of biosensors for phenolic compounds was used for the first time to develop a new biosensor for the determination of the azo-dye tartrazine. The electrochemical biosensor was based on the immobilization of laccase on functionalized methacrylate-acrylate microspheres. The biosensor membrane is a composite of the laccase conjugated microspheres and gold nanoparticles (AuNPs) coated on a carbon-paste screen-printed electrode. The reaction involving tartrazine can be catalyzed by laccase enzyme, where the current change was measured by differential pulse voltammetry (DPV) at 1.1 V. The anodic peak current was linear within the tartrazine concentration range of 0.2 to 14 μM ( R ² = 0.979) and the detection limit was 0.04 μM. Common food ingredients or additives such as glucose, sucrose, ascorbic acid, phenol and sunset yellow did not interfere with the biosensor response. Furthermore, the biosensor response was stable up to 30 days of storage period at 4 °C. Foods and beverage were used as real samples for the biosensor validation. The biosensor response to tartrazine showed no significant difference with a standard HPLC method for tartrazine analysis.
Kawaguchi, H; Fukuda, I; Shiina, T; Toyoshima, Y
1992-11-01
The time course of the accumulation of the transcripts from 13 psb genes encoding a major part of the proteins composing photosystem II during light-induced greening of dark-grown wheat seedlings was examined focusing on early stages of plastid development (0.5 h through 72 h). The 13 genes can be divided into three groups. (1) The psbA gene is transcribed as a single transcript of 1.3 kb in the dark-grown seedlings, but its level increases 5- to 7-fold in response to light due to selective increase in RNA stability as well as in transcription activity. (2) The psbE-F-L-J operon, psbM and psbN genes are transcribed as a single transcript of 1.1 kb, two transcripts of 0.5 and 0.7 kb and a single transcript of 0.3 kb, respectively, in the dark-grown seedlings. The levels of accumulation of every transcript remain unchanged or rather decrease during plastid development under illumination. (3) The psbK-I-D-C gene cluster and psbB-H operon exhibit fairly complicated northern hybridization patterns during the greening process. When a psbC or psbD gene probe was used for northern hybridization, five transcripts differing in length were detected in the etioplasts from 5-day old dark-grown seedlings. After 2 h illumination, two new transcripts of different length appeared. Light induction of new transcripts was also observed in the psbB-H operon.
Optimization of Laccase-Aided Chlorine Dioxide Bleaching of Bagasse Pulp
Directory of Open Access Journals (Sweden)
Yong Pei
2015-11-01
Full Text Available The laccase-mediator system in laccase-aided chlorine dioxide bleaching of bagasse pulp was optimized using response surface methodology (RSM. The effects and interactions of the laccase enzyme dosage, the dosage of the mediator 1-hydroxybenzotriazole (HBT, and the reaction time on the adsorbed organic halogen (AOX content of the wastewater as well as the brightness and kappa number of the pulp were examined. The optimal reaction conditions to achieve a balance of lower AOX content, higher brightness, and lower kappa number were as follows: laccase enzyme dosage of 20.3 U/g, HBT dosage of 1.51%, and reaction time of 154.5 min. Under these conditions, an AOX content of 20.67 mg/L, brightness of 58.94% ISO, and kappa number of 2.71 were observed. These results will offer a favorable option for pulp and paper mills as well as the natural environment and therefore provide a theoretical foundation for the industrial application of laccase in bleaching processes.
Hilgers, Roelant; Vincken, Jean Paul; Gruppen, Harry; Kabel, Mirjam A.
2018-01-01
Laccase-mediator systems (LMS) have been widely studied for their capacity to oxidize the nonphenolic subunits of lignin (70-90% of the polymer). The phenolic subunits (10-30% of the polymer), which can also be oxidized without mediators, have received considerably less attention. Consequently, it
Luis F. Larrondo; Marcela Avila; Loreto Salas; Dan Cullen; Rafael Vicuna
2003-01-01
Analysis of genomic clones encoding a putative laccase in homokaryon strains of Ceriporiopsis subvermispora led to the identification of an allelic variant of the previously described lcs-1 gene. A cDNA clone corresponding to this gene was expressed in Aspergillus nidulans and in Aspergillus niger. Enzyme assays and Western blots showed that both hosts secreted active...
EFFECT OF POTENTIAL INDUCTORS ON LACCASE PRODUCTION BY WHITE-ROT FUNGUS CERIPORIOPSIS SUBVERMISPORA
Directory of Open Access Journals (Sweden)
Daniela Chmelová
2014-02-01
Full Text Available In this work, the influence of selected inorganic ions (Cu2+ and Mn2+ and aromatic amino acids (tryptophan and tyrosine on laccase production by white-rot fungus Ceriporiopsis subvermispora was investigated. This aim was realized by monitoring laccase production during cultivation of C. subvermispora. Secondary, we been evaluated glucose concentration in medium and biomass growth after cultivation. Extracellular laccase formation can stimulated by the addition of Cu2+ (3.0 mmol/L. The higher laccase activity reached maximum at 7th day (63 U/L, equivalent to 3.7-fold higher than the laccase production without copper (17.2 U/L. Higher concentration of copper ions had a negative effect on laccase production. The addition of copper ions inhibited the biomass growth. Mn2+ ions similarly stimulated laccase activity (3.0 and 7.0 mmol/L; 79.6 and 63.8 U/L, respectively and maximum activities were reached at 6th day. Manganese ions also stimulated fungal biomass of C. subvermispora. The addition of aromatic amino acids did not cause an increase laccase production. The highest laccase production was observed in cultivation media without aromatic amino acids (16.0 U/L at 8th day.
Directory of Open Access Journals (Sweden)
Hailong Yu
2014-06-01
Full Text Available Furfural residues (FRs were pretreated with laccase or a laccase-mediator (1-hydroxybenzotriazole, HBT system to produce fermentable sugar for bioethanol production. Compared to laccase-only pretreatment, laccase-mediator pretreatment dissolved more lignin. Approximately 10.5% of the initially present lignin was removed when FRs were treated with a laccase loading of 100 U/g of dry substrate in 1% (w/w HBT at 48 °C for 24 h in an acetate buffer (pH 4.8. The enzymatic saccharification process was carried out by a combined laccase or laccase-mediator pretreatment without washing of the treated solids. The results showed that active laccase had a negative effect on the rate and yield of enzymatic hydrolysis. Laccase-oxidized HBT seriously reduced glucose yield. However, non-oxidized HBT increased glucose yield when laccase was deactivated at 121 °C for 20 min prior to enzymatic hydrolysis. The highest glucose yield, 80.9%, was obtained from the substrate pretreated with 100 U/g of dry substrate laccase and 1% (w/w HBT at 48 °C for 24 h in an acetate buffer (pH 4.8. Furthermore, the structures of FRs before and after laccase-mediator pretreatment were characterized by scanning electron microscopy (SEM and Fourier Transform Infrared spectroscopy (FT-IR.
Natural and recombinant fungal laccases for paper pulp bleaching
Sigoillot, C.; Record, E.; Belle, V.; Robert, J.L.; Levasseur, A.; Punt, P.J.; Hondel, C.A.M.J.J. van den; Fournel, A.; Sigoillot, J.C.; Asther, M.
2004-01-01
Three laccases, a natural form and two recombinant forms obtained from two different expression hosts, were characterized and compared for paper pulp bleaching. Laccase from Pycnoporus cinnabarinus, a well known lignolytic fungus, was selected as a reference for this study. The corresponding
Phenol oxidation of petrol refinery wastewater catalyzed by Laccase
International Nuclear Information System (INIS)
Vargas, Maria Carolina; Ramirez, Nubia E.
2002-01-01
Laccase has been obtained through two different production systems, the first using Pleurotus ostreatus in solid-state fermentation, the second one using Trametes versicolor in submerged culture. Different substrates (by products from yeast, flour and beverage industries) have been evaluated in both systems. Maximum laccase yield with Pleurotus ostreatus (25 u/ml) was obtained in a wheat bran medium. The maximum enzyme concentration level using Trametes versicolor (25 u/ml) was achieved in a submerged system, containing 10% vinasse, 4,5% wheat bran and 0,2% molasses per liter of waste. Culture filtrate extracted from Pleurotus ostreatus was used to remove phenol from wastewater. The enzymatic treatment is effective over a wide pH and temperature range. The Laccase treatment has been successfully used to dephenolize industrial petrol refinery wastewater. The advantage of Laccase dephenolization is that this enzyme uses molecular oxygen as an oxidant
Isolation, Purification, and Characterization of Fungal Laccase from Pleurotus sp.
Directory of Open Access Journals (Sweden)
Sunil S. More
2011-01-01
Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 benzenediol: oxygen oxidoreductase that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. They are currently seen as highly interesting industrial enzymes because of their broad substrate specificity. A positive strain was isolated and characterized as nonspore forming Basidiomycetes Pleurotus sp. Laccase activity was determined using ABTS as substrate. Laccase was purified by ionexchange and gel filtration chromatography. The purified laccase was a monomer showed a molecular mass of 40±1 kDa as estimated by SDS-PAGE and a 72-fold purification with a 22% yield. The optimal pH and temperature were 4.5 and 65°C, respectively. The Km and Vmax values are 250 (mM and 0.33 (μmol/min, respectively, for ABTS as substrate. Metal ions like CuSO4, BaCl2, MgCl2, FeCl2, ZnCl2 have no effect on purified laccase whereas HgCl2 and MnCl2 moderately decrease enzyme activity. SDS and sodium azide inhibited enzyme activity, whereas Urea, PCMB, DTT, and mercaptoethanol have no effect on enzyme activity. The isolated laccase can be used in development of biosensor for detecting the phenolic compounds from the effluents of paper industries.
Mapping the transcription termination region of the mouse immunoglobulin kappa gene
International Nuclear Information System (INIS)
Xu, M.; Garrard, W.T.
1986-01-01
To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream
Laccase: microbial sources, production, purification, and potential biotechnological applications.
Shraddha; Shekher, Ravi; Sehgal, Simran; Kamthania, Mohit; Kumar, Ajay
2011-01-01
Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.
Laccase: Microbial Sources, Production, Purification, and Potential Biotechnological Applications
Directory of Open Access Journals (Sweden)
Shraddha
2011-01-01
Full Text Available Laccase belongs to the blue multicopper oxidases and participates in cross-linking of monomers, degradation of polymers, and ring cleavage of aromatic compounds. It is widely distributed in higher plants and fungi. It is present in Ascomycetes, Deuteromycetes and Basidiomycetes and abundant in lignin-degrading white-rot fungi. It is also used in the synthesis of organic substance, where typical substrates are amines and phenols, the reaction products are dimers and oligomers derived from the coupling of reactive radical intermediates. In the recent years, these enzymes have gained application in the field of textile, pulp and paper, and food industry. Recently, it is also used in the design of biosensors, biofuel cells, as a medical diagnostics tool and bioremediation agent to clean up herbicides, pesticides and certain explosives in soil. Laccases have received attention of researchers in the last few decades due to their ability to oxidize both phenolic and nonphenolic lignin-related compounds as well as highly recalcitrant environmental pollutants. It has been identified as the principal enzyme associated with cuticular hardening in insects. Two main forms have been found: laccase-1 and laccase-2. This paper reviews the occurrence, mode of action, general properties, production, applications, and immobilization of laccases within different industrial fields.
Microarray-Based Identification of Transcription Factor Target Genes
Gorte, M.; Horstman, A.; Page, R.B.; Heidstra, R.; Stromberg, A.; Boutilier, K.A.
2011-01-01
Microarray analysis is widely used to identify transcriptional changes associated with genetic perturbation or signaling events. Here we describe its application in the identification of plant transcription factor target genes with emphasis on the design of suitable DNA constructs for controlling TF
Ethidium bromide stimulated hyper laccase production from bird's nest fungus Cyathus bulleri.
Dhawan, S; Lal, R; Kuhad, R C
2003-01-01
Effect of ethidium bromide, a DNA intercalating agent, on laccase production from Cyathus bulleri was studied. The bird's nest fungus, Cyathus bulleri was grown on 2% (w/v) malt extract agar (MEA) supplemented with 1.5 microg ml(-1) of the phenanthridine dye ethidium bromide (EtBr) for 7 d and when grown subsequently in malt extract broth (MEB), produced a 4.2-fold increase in laccase production as compared to the untreated fungus. The fungal cultures following a single EtBr treatment, when regrown on MEA devoid of EtBr, produced a sixfold increase in laccase in MEB. However, on subsequent culturing on MEA in the absence of EtBr, only a 2.5-fold increase in laccase production could be maintained. In another attempt, the initial EtBr-treated cultures, when subjected to a second EtBr treatment (1.5 microg ml(-1)) on MEA for 7 d, produced a 1.4-fold increase in laccase production in MEB. The white-rot fungus Cyathus bulleri, when treated with EtBr at a concentration of 1.5 microg ml(-1) and regrown on MEA devoid of EtBr, produced a sixfold increase in laccase production in MEB. The variable form of C. bulleri capable of hyper laccase production can improve the economic feasibility of environmentally benign processes involving use of fungal laccases in cosmetics (including hair dyes), food and beverages, clinical diagnostics, pulp and paper industry, industrial effluent treatment, animal biotechnology and biotransformations.
DEFF Research Database (Denmark)
Sitarz, Anna K.; Mikkelsen, Jørn D.; Meyer, Anne S.
2016-01-01
Laccases (EC 1.10.3.2) are copper-containing oxidoreductases that have a relatively high redox potential which enables them to catalyze oxidation of phenolic compounds, including lignin-derived phenolics. The laccase-catalyzed oxidation of phenolics is accompanied by concomitant reduction of diox...... but differences in loop conformations. We also evaluate the features and regions of laccases in relation to modification and evolution of laccases for various industrial applications including lignocellulosic biomass processing....
Laccases as palladium oxidases.
Mekmouche, Yasmina; Schneider, Ludovic; Rousselot-Pailley, Pierre; Faure, Bruno; Simaan, A Jalila; Bochot, Constance; Réglier, Marius; Tron, Thierry
2015-02-01
The first example of a coupled catalytic system involving an enzyme and a palladium(ii) catalyst competent for the aerobic oxidation of alcohol in mild conditions is described. In the absence of dioxygen, the fungal laccase LAC3 is reduced by a palladium(0) species as evidenced by the UV/VIS and ESR spectra of the enzyme. During the oxidation of veratryl alcohol performed in water, at room temperature and atmospheric pressure, LAC3 regenerates the palladium catalyst, is reduced and catalyzes the four-electron reduction of dioxygen into water with no loss of enzyme activity. The association of a laccase with a water-soluble palladium complex results in a 7-fold increase in the catalytic efficiency of the complex. This is the first step in the design of a family of renewable palladium catalysts for aerobic oxidation.
Wu, Yue; Jiang, Ying; Jiao, Jiaguo; Liu, Manqiang; Hu, Feng; Griffiths, Bryan S; Li, Huixin
2014-02-01
Laccases play an important role in the degradation of soil phenol or phenol-like substance and can be potentially used in soil remediation through immobilization. Iron and aluminum minerals can adsorb extracellular enzymes in soil environment. In the present study, we investigated the adsorptive interaction of laccase, from the white-rot fungus Trametes versicolor, with soil iron and aluminum minerals and characterized the properties of the enzyme after adsorption to minerals. Results showed that both soil iron and aluminum minerals adsorbed great amount of laccase, independent of the mineral specific surface areas. Adsorbed laccases retained 26-64% of the activity of the free enzyme. Compared to the free laccase, all adsorbed laccases showed higher Km values and lower Vmax values, indicating a reduced enzyme-substrate affinity and a lower rate of substrate conversion in reactions catalyzed by the adsorbed laccase. Adsorbed laccases exhibited increased catalytic activities compared to the free laccase at low pH, implying the suitable application of iron and aluminum mineral-adsorbed T. versicolor laccase in soil bioremediation, especially in acid soils. In terms of the thermal profiles, adsorbed laccases showed decreased thermal stability and higher temperature sensitivity relative to the free laccase. Moreover, adsorption improved the resistance of laccase to proteolysis and extended the lifespan of laccase. Our results implied that adsorbed T. versicolor laccase on soil iron and aluminum minerals had promising potential in soil remediation. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Purification and characterization of three laccase isozymes from the ...
African Journals Online (AJOL)
2012-04-17
Apr 17, 2012 ... improve wine quality by removing fermentation inhibitors so as to increase yield of ethanol (Baldrian, 2006). They have also been used .... Summary of purification of laccase isozymes from Trametes sp. HS-03a. Purification .... and kinetics of a thermostable laccase from Pycnoporus sanguineus. (SCC 108).
Directory of Open Access Journals (Sweden)
Andrew Woodard
2011-01-01
Full Text Available Termination of transcription is an important component of bacterial gene expression. However, little is known concerning this process in the obligate intracellular pathogen and model for reductive evolution, Rickettsia prowazekii. To assess transcriptional termination in this bacterium, transcripts of convergent gene pairs, some containing predicted intrinsic terminators, were analyzed. These analyses revealed that, rather than terminating at a specific site within the intervening region between the convergent genes, most of the transcripts demonstrated either a lack of termination within this region, which generated antisense RNA, or a putative non-site-specific termination that occurred throughout the intervening sequence. Transcripts terminating at predicted intrinsic terminators, as well as at a putative Rho-dependant terminator, were also examined and found to vary based on the rickettsial host environment. These results suggest that transcriptional termination, or lack thereof, plays a role in rickettsial gene regulation.
Inactivation of Laccase by the Attack of As (III) Reaction in Water.
Hu, Jinyuan; Lu, Kun; Dong, Shipeng; Huang, Qingguo; Mao, Liang
2018-03-06
Laccase is a multicopper oxidase containing four coppers as reaction sites, including one type 1, one type 2, and two type 3. We here provide the first experimental data showing that As (III) can be effectively removed from water and transformed to As (V) through reactions mediated by laccase with the presence of oxygen. To this end, the As (III) removal, As (V) yields, total protein, active laccase, and copper concentrations in the aqueous phase were determined, respectively. Additionally, electron paramagnetic resonance spectra and UV-vis spectra were applied to probe possible structural changes of the laccase during the reaction. The data offer the first evidence that laccase can be inactivated by As (III) attack thus leading to the release of type 2 copper. The released copper has no reactivity with the As (III). These findings provide new ideas into a significant pathway likely to master the environmental transformation of arsenite, and advance the understanding of laccase inactivation mechanisms, thus providing a foundation for optimization of enzyme-based processes and potential development for removal and remediation of arsenite contamination in the environment.
Laccase-Based CLEAs: Chitosan as a Novel Cross-Linking Agent
Directory of Open Access Journals (Sweden)
Alexandre Arsenault
2011-01-01
Full Text Available Laccase from Coriolopsis Polyzona was insolubilized as cross-linked enzyme aggregates (CLEAs for the first time with chitosan as the cross-linking agent. Concentrations between 0.01 and 1.867 g/L of chitosan were used and between 0.05 and 600 mM of 1-ethyl-3-(3-dimethylaminopropylcarbodiimide hydrochloride. The laccase was precipitated using ammonium sulphate and cross-linked simultaneously. Specific activity and thermal stability of these biocatalysts were measured. Activities of up to 737 U/g were obtained when 2,2-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid (ABTS was used as a substrate. Moreover, the stability of these biocatalysts was improved with regards to thermal degradation compared to free laccase when exposed to denaturing conditions of high temperature and low pH. The CLEAs stability against chemical denaturants was also tested but no significant improvement was detected. The total amount of ABTS to be oxidized during thermal degradation by CLEAs and free laccase was calculated and the insolubilized enzymes were reported to oxidize more substrate than free laccase. The formation conditions were analyzed by response surface methodology in order to determine an optimal environment for the production of efficient laccase-based CLEAs using chitosan as the cross-linking agent. After 24 hours of formation at pH 3 and at 4°C without agitation, the CLEAs exhibit the best specific activity.
International Nuclear Information System (INIS)
Xiang, Ling; Lin, Yuqing; Yu, Ping; Su, Lei; Mao, Lanqun
2007-01-01
This study demonstrates a new electrochemical method for the selective determination of dopamine (DA) with the coexistence of ascorbic acid (AA) and 3,4-dihydroxyphenylacetic acid (DOPAC) with laccase/multi-walled carbon nanotube (MWNT)-based biosensors prepared by cross-linking laccase into MWNT layer confined onto glassy carbon electrodes. The method described here is essentially based on the chemical reaction properties of DA including oxidation, intramolecular cyclization and disproportionation reactions to finally give 5,6-dihydroxyindoline quinone and on the uses of the two-electron and two-proton reduction of the formed 5,6-dihydroxyindoline quinone to constitute a method for the selective determination of DA at a negative potential that is totally separated from those for the redox processes of AA and DOPAC. Instead of the ECE reactions of DA with the first oxidation of DA being driven electrochemically, laccase is used here as the biocatalyst to drive the first oxidation of DA into its quinone form and thus initialize the sequential reactions of DA finally into 5,6-dihydroxyindoline quinone. In addition, laccase also catalyzes the oxidation of AA and DOPAC into electroinactive species with the concomitant reduction of O 2 . As a consequence, a combinational exploitation of the chemical properties inherent in DA and the multifunctional catalytic properties of laccase as well as the excellent electrochemical properties of carbon nanotubes substantially enables the prepared laccase/MWNT-based biosensors to be well competent for the selective determination of DA with the coexistence of physiological levels of AA and DOPAC. This demonstration offers a new method for the selective determination of DA, which could be potentially employed for the determination of DA in biological systems
Dehalogenation of Chlorinated Hydroxybiphenyls by Fungal Laccase
Schultz, Asgard; Jonas, Ulrike; Hammer, Elke; Schauer, Frieder
2001-01-01
We have investigated the transformation of chlorinated hydroxybiphenyls by laccase produced by Pycnoporus cinnabarinus. The compounds used were transformed to sparingly water-soluble colored precipitates which were identified by gas chromatography-mass spectrometry as oligomerization products of the chlorinated hydroxybiphenyls. During oligomerization of 2-hydroxy-5-chlorobiphenyl and 3-chloro-4-hydroxybiphenyl, dechlorinated C—C-linked dimers were formed, demonstrating the dehalogenation ability of laccase. In addition to these nonhalogenated dimers, both monohalogenated and dihalogenated dimers were identified. PMID:11526052
Biobleaching chemistry of laccase-mediator systems on high-lignin-content kraft pulps
International Nuclear Information System (INIS)
Chakar, F.S.; Ragauskas, A.J.
2004-01-01
A high-lignin-content softwood kraft pulp was reacted with laccase in the presence of 1-hydroxybenzotriazole (HBT), N-acetyl-N-phenylhydroxylamine (NHA), and violuric acid (VA). The biodelignification response with violuric acid was superior to both 1-hydroxybenzotriazole and N-acetyl-N-phenylhydroxylamine. NMR analysis of residual lignins isolated before and after the biobleaching treatments revealed that the latter material was highly oxidized and that the magnitude of structural changes was most pronounced with the laccase - violuric acid biobleaching system. An increase in the content of carboxylic acid groups and a decrease in methoxyl groups were noted with all three laccase-mediator systems. The oxidation biobleaching pathway is directed primarily towards noncondensed C5 phenolic lignin functional structures for all three laccase-mediated systems. The laccase - violuric acid system was also reactive towards C5-condensed phenolic lignin structures. (author)
Cryptic Transcription and Early Termination in the Control of Gene Expression
Directory of Open Access Journals (Sweden)
Jessie Colin
2011-01-01
Full Text Available Recent studies on yeast transcriptome have revealed the presence of a large set of RNA polymerase II transcripts mapping to intergenic and antisense regions or overlapping canonical genes. Most of these ncRNAs (ncRNAs are subject to termination by the Nrd1-dependent pathway and rapid degradation by the nuclear exosome and have been dubbed cryptic unstable transcripts (CUTs. CUTs are often considered as by-products of transcriptional noise, but in an increasing number of cases they play a central role in the control of gene expression. Regulatory mechanisms involving expression of a CUT are diverse and include attenuation, transcriptional interference, and alternative transcription start site choice. This review focuses on the impact of cryptic transcription on gene expression, describes the role of the Nrd1-complex as the main actor in preventing nonfunctional and potentially harmful transcription, and details a few systems where expression of a CUT has an essential regulatory function. We also summarize the most recent studies concerning other types of ncRNAs and their possible role in regulation.
Biocatalytic potential of laccase-like multicopper oxidases from Aspergillus niger
Tamayo Ramos, J.A.; Berkel, van W.J.H.; Graaff, de L.H.
2012-01-01
BACKGROUND: Laccase-like multicopper oxidases have been reported in several Aspergillus species but they remain uncharacterized. The biocatalytic potential of the Aspergillus niger fungal pigment multicopper oxidases McoA and McoB and ascomycete laccase McoG was investigated. RESULTS: The
Demonstration of laccase in the white rot basidiomycete phanerochaete chrysosporium BKM-F1767
Energy Technology Data Exchange (ETDEWEB)
Srinivasan, C.; D`Souza, T.M.; Boominathan, K. [Michigan State Univ., East Lansing, MI (United States)
1995-12-01
It has been widely reported that the white rot basidiomycete Phanerochaete chrysosporium, unlike most other white rot fungi, does not produce laccase, an enzyme implicated in lignin biodegradation. Our results showed that P. chrysosporium BKM-F1767 produces extracellular laccase in a defined culture medium containing cellulose (10 g/liter) and either 2.4 or 24 mM ammonium tartrate. Laccase activity was demonstrated in the concentrated extracellular culture fluids of this organism as determined by a laccase plate assay as well as a spectrophotometric assay with ABTS [2,2`-azinobis(3-ethylbenzathiazoline-6-sulfonic acid)] as the substrate. Laccase activity was observed even after addition of excess catalase to the extracellular culture fluid to destroy the endogenously produced hydrogen peroxide, indicating that the observed activity is not due to a peroxidase. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by activity staining with ABTS revealed the presence of a laccase band with an estimated M{sub r} of 46,500.
Synaptic, transcriptional and chromatin genes disrupted in autism.
De Rubeis, Silvia; He, Xin; Goldberg, Arthur P; Poultney, Christopher S; Samocha, Kaitlin; Cicek, A Erucment; Kou, Yan; Liu, Li; Fromer, Menachem; Walker, Susan; Singh, Tarinder; Klei, Lambertus; Kosmicki, Jack; Shih-Chen, Fu; Aleksic, Branko; Biscaldi, Monica; Bolton, Patrick F; Brownfeld, Jessica M; Cai, Jinlu; Campbell, Nicholas G; Carracedo, Angel; Chahrour, Maria H; Chiocchetti, Andreas G; Coon, Hilary; Crawford, Emily L; Curran, Sarah R; Dawson, Geraldine; Duketis, Eftichia; Fernandez, Bridget A; Gallagher, Louise; Geller, Evan; Guter, Stephen J; Hill, R Sean; Ionita-Laza, Juliana; Jimenz Gonzalez, Patricia; Kilpinen, Helena; Klauck, Sabine M; Kolevzon, Alexander; Lee, Irene; Lei, Irene; Lei, Jing; Lehtimäki, Terho; Lin, Chiao-Feng; Ma'ayan, Avi; Marshall, Christian R; McInnes, Alison L; Neale, Benjamin; Owen, Michael J; Ozaki, Noriio; Parellada, Mara; Parr, Jeremy R; Purcell, Shaun; Puura, Kaija; Rajagopalan, Deepthi; Rehnström, Karola; Reichenberg, Abraham; Sabo, Aniko; Sachse, Michael; Sanders, Stephan J; Schafer, Chad; Schulte-Rüther, Martin; Skuse, David; Stevens, Christine; Szatmari, Peter; Tammimies, Kristiina; Valladares, Otto; Voran, Annette; Li-San, Wang; Weiss, Lauren A; Willsey, A Jeremy; Yu, Timothy W; Yuen, Ryan K C; Cook, Edwin H; Freitag, Christine M; Gill, Michael; Hultman, Christina M; Lehner, Thomas; Palotie, Aaarno; Schellenberg, Gerard D; Sklar, Pamela; State, Matthew W; Sutcliffe, James S; Walsh, Christiopher A; Scherer, Stephen W; Zwick, Michael E; Barett, Jeffrey C; Cutler, David J; Roeder, Kathryn; Devlin, Bernie; Daly, Mark J; Buxbaum, Joseph D
2014-11-13
The genetic architecture of autism spectrum disorder involves the interplay of common and rare variants and their impact on hundreds of genes. Using exome sequencing, here we show that analysis of rare coding variation in 3,871 autism cases and 9,937 ancestry-matched or parental controls implicates 22 autosomal genes at a false discovery rate (FDR) < 0.05, plus a set of 107 autosomal genes strongly enriched for those likely to affect risk (FDR < 0.30). These 107 genes, which show unusual evolutionary constraint against mutations, incur de novo loss-of-function mutations in over 5% of autistic subjects. Many of the genes implicated encode proteins for synaptic formation, transcriptional regulation and chromatin-remodelling pathways. These include voltage-gated ion channels regulating the propagation of action potentials, pacemaking and excitability-transcription coupling, as well as histone-modifying enzymes and chromatin remodellers-most prominently those that mediate post-translational lysine methylation/demethylation modifications of histones.
Durnford Dion, G; McKim, Sarah M; Sarchfield, Michelle L
2003-01-01
To compensate for increases in photon flux density (PFD), photosynthetic organisms possess mechanisms for reversibly modulating their photosynthetic apparatus to minimize photodamage. The photoacclimation response in Chlamydomonas reinhardtii was assessed following a 10-fold increase in PFD over 24h. In addition to a 50% reduction in the amount of chlorophyll and light-harvesting complexes (LHC) per cell, the expression of genes encoding polypeptides of the light-harvesting antenna were also affected. The abundance of Lhcb (a LHCH gene), Lhcb4 (a CP29-like gene), and Lhca (a LHCI gene) transcripts were reduced by 65 to 80%, within 1-2 h; however, the RNA levels of all three genes recovered to their low-light (LL) concentrations within 6-8 h. To determine the role of transcript turnover in this transient decline in abundance, the stability of all transcripts was measured. Although there was no change in the Lhcb or Lhca transcript turnover time, the Lhcb4 mRNA stability decreased 2.5-fold immediately following...
Post-transcriptional bursting in genes regulated by small RNA molecules
Rodrigo, Guillermo
2018-03-01
Gene expression programs in living cells are highly dynamic due to spatiotemporal molecular signaling and inherent biochemical stochasticity. Here we study a mechanism based on molecule-to-molecule variability at the RNA level for the generation of bursts of protein production, which can lead to heterogeneity in a cell population. We develop a mathematical framework to show numerically and analytically that genes regulated post transcriptionally by small RNA molecules can exhibit such bursts due to different states of translation activity (on or off), mostly revealed in a regime of few molecules. We exploit this framework to compare transcriptional and post-transcriptional bursting and also to illustrate how to tune the resulting protein distribution with additional post-transcriptional regulations. Moreover, because RNA-RNA interactions are predictable with an energy model, we define the kinetic constants of on-off switching as functions of the two characteristic free-energy differences of the system, activation and formation, with a nonequilibrium scheme. Overall, post-transcriptional bursting represents a distinctive principle linking gene regulation to gene expression noise, which highlights the importance of the RNA layer beyond the simple information transfer paradigm and significantly contributes to the understanding of the intracellular processes from a first-principles perspective.
International Nuclear Information System (INIS)
Singh, Deepti; Rawat, Surender; Waseem, Mohd; Gupta, Sunita; Lynn, Andrew; Nitin, Mukesh; Ramchiary, Nirala; Sharma, Krishna Kant
2016-01-01
The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K m values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative property against BSA and Cu 2+ /H 2 O 2 model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.
Energy Technology Data Exchange (ETDEWEB)
Singh, Deepti; Rawat, Surender [Laboratory of Enzymology and Recombinant DNA Technology, Department of Microbiology, Maharshi Dayanand University, Rohtak 124001, Haryana (India); Waseem, Mohd; Gupta, Sunita; Lynn, Andrew [School of Computational & Integrative Sciences, Jawaharlal Nehru University, New Delhi 110067 (India); Nitin, Mukesh; Ramchiary, Nirala [School of Life Sciences, Jawaharlal Nehru University, New Delhi 110067 (India); Sharma, Krishna Kant, E-mail: kekulsharma@gmail.com [Laboratory of Enzymology and Recombinant DNA Technology, Department of Microbiology, Maharshi Dayanand University, Rohtak 124001, Haryana (India)
2016-01-08
The YacK gene from Yersinia enterocolitica strain 7, cloned in pET28a vector and expressed in Escherichia coli BL21 (DE3), showed laccase activity when oxidized with 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) and guaiacol. The recombinant laccase protein was purified and characterized biochemically with a molecular mass of ≈58 KDa on SDS-PAGE and showed positive zymogram with ABTS. The protein was highly robust with optimum pH 9.0 and stable at 70 °C upto 12 h with residual activity of 70%. Kinetic constants, K{sub m} values, for ABTS and guaiacol were 675 μM and 2070 μM, respectively, with corresponding Vmax values of 0.125 μmol/ml/min and 6500 μmol/ml/min. It also possess antioxidative property against BSA and Cu{sup 2+}/H{sub 2}O{sub 2} model system. Constant pH MD simulation studies at different protonation states of the system showed ABTS to be most stable at acidic pH, whereas, diclofenac at neutral pH. Interestingly, aspirin drifted out of the binding pocket at acidic and neutral pH, but showed stable binding at alkaline pH. The biotransformation of diclofenac and aspirin by laccase also corroborated the in silico results. This is the first report on biotransformation of non-steroidal anti-inflammatory drugs (NSAIDs) using recombinant laccase from gut bacteria, supported by in silico simulation studies. - Highlights: • Laccase from Yersinia enterocolitica strain 7 was expressed in Escherichia coli BL21 (DE3). • Recombinant laccase was found to be thermostable and alkali tolerant. • The in silico and experimental studied proves the biotransformation of NSAIDs. • Laccase binds to ligands differentially under different protonation state. • Laccase also possesses free radical scavenging property.
Upgrading Laccase Production and Biochemical Properties: Strategies and Challenges.
Bertrand, Brandt; Martínez-Morales, Fernando; Trejo-Hernández, María R
2017-07-01
Improving laccases continues to be crucial in novel biotechnological developments and industrial applications, where they are concerned. This review breaks down and explores the potential of the strategies (conventional and modern) that can be used for laccase enhancement (increased production and upgraded biochemical properties such as stability and catalytic efficiency). The challenges faced with these approaches are briefly discussed. We also shed light on how these strategies merge and give rise to new options and advances in this field of work. Additionally, this article seeks to serve as a guide for students and academic researchers interested in laccases. This document not only gives basic information on laccases, but also provides updated information on the state of the art of various technologies that are used in this line of investigation. It also gives the readers an idea of the areas extensively studied and the areas where there is still much left to be done. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1015-1034, 2017. © 2017 American Institute of Chemical Engineers.
Laccase/mediator assisted degradation of triarylmethane dyes in a continuous membrane reactor.
Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy
2009-08-10
Laccase/mediator systems are important bioremediation agents as the rates of reactions can be enhanced in the presence of the mediators. The decolorization mechanism of two triarylmethane dyes, namely, Basic Green 4 and Acid Violet 17 is reported using Cyathus bulleri laccase. Basic Green 4 was decolorized through N-demethylation by laccase alone, while in mediator assisted reactions, dye breakdown was initiated from oxidation of carbinol form of the dye. Benzaldehyde and N,N-dimethyl aniline were the major end products. With Acid Violet 17, laccase carried out N-deethylation and in mediator assisted reactions, oxidation of the carbinol form of the dye occurred resulting in formation of formyl benzene sulfonic acid, carboxy benzene sulfonic acid and benzene sulfonic acid. Toxicity analysis revealed that Basic Green 4 was toxic and treatment with laccase/mediators resulted in 80-100% detoxification. The treatment of the textile dye solution using laccase and 2,2'-azino-di-(-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was demonstrated in an enzyme membrane reactor. At a hydraulic retention time of 6h, the process was operated for a period of 15 days with nearly 95% decolorization, 10% reduction in flux and 70% recovery of active ABTS.
Thermokinetic comparison of trypan blue decolorization by free laccase and fungal biomass.
Razak, N N A; Annuar, M S M
2014-03-01
Free laccase and fungal biomass from white-rot fungi were compared in the thermokinetics study of the laccase-catalyzed decolorization of an azo dye, i.e., Trypan Blue. The decolorization in both systems followed a first-order kinetics. The apparent first-order rate constant, k1', value increases with temperature. Apparent activation energy of decolorization was similar for both systems at ∼ 22 kJ mol(-1), while energy for laccase inactivation was 18 kJ mol(-1). Although both systems were endothermic, fungal biomass showed higher enthalpy, entropy, and Gibbs free energy changes for the decolorization compared to free laccase. On the other hand, free laccase showed reaction spontaneity over a wider range of temperature (ΔT = 40 K) as opposed to fungal biomass (ΔT = 15 K). Comparison of entropy change (ΔS) values indicated metabolism of the dye by the biomass.
Gao, Huiju; Chu, Xiang; Wang, Yanwen; Zhou, Fei; Zhao, Kai; Mu, Zhimei; Liu, Qingxin
2013-12-01
Trichoderma harzianum ZF-2 producing laccase was isolated from decaying samples from Shandong, China, and showed dye decolorization activities. The objective of this study was to optimize its culture conditions using a statistical analysis of its laccase production. The interactions between different fermentation parameters for laccase production were characterized using a Plackett-Burman design and the response surface methodology. The different media components were initially optimized using the conventional one-factor-at-a-time method and an orthogonal test design, and a Plackett-Burman experiment was then performed to evaluate the effects on laccase production. Wheat straw powder, soybean meal, and CuSO4 were all found to have a significant influence on laccase production, and the optimal concentrations of these three factors were then sequentially investigated using the response surface methodology with a central composite design. The resulting optimal medium components for laccase production were determined as follows: wheat straw powder 7.63 g/l, soybean meal 23.07 g/l, (NH4)2SO4 1 g/l, CuSO4 0.51 g/l, Tween-20 1 g/l, MgSO4 1 g/l, and KH2PO4 0.6 g/l. Using this optimized fermentation method, the yield of laccase was increased 59.68 times to 67.258 U/ml compared with the laccase production with an unoptimized medium. This is the first report on the statistical optimization of laccase production by Trichoderma harzianum ZF-2.
Transcriptional regulation of genes related to progesterone production.
Mizutani, Tetsuya; Ishikane, Shin; Kawabe, Shinya; Umezawa, Akihiro; Miyamoto, Kaoru
2015-01-01
Steroid hormones are synthesized from cholesterol in various tissues, mainly in the adrenal glands and gonads. Because these lipid-soluble steroid hormones immediately diffuse through the cells in which they are produced, their secretion directly reflects the activity of the genes related to their production. Progesterone is important not only for luteinization and maintenance of pregnancy, but also as a substrate for most other steroids. Steroidogenic acute regulatory protein (STAR), cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc), and 3β-hydroxysteroid dehydrogenase/Δ(5)-Δ(4) isomerase (3β-HSD) are well-known proteins essential for progesterone production. In addition to them, glutathione S-transferase A1-1 and A3-3 are shown to exert Δ(5)-Δ(4) isomerization activity to produce progesterone in a cooperative fashion with 3β-HSD. 5-Aminolevulinic acid synthase 1, ferredoxin 1, and ferredoxin reductase also play a role in steroidogenesis as accessory factors. Members of the nuclear receptor 5A (NR5A) family (steroidogenic factor 1 and liver receptor homolog 1) play a crucial role in the transcriptional regulation of these genes. The NR5A family activates these genes by binding to NR5A responsive elements present within their promoter regions, as well as to the elements far from their promoters. In addition, various NR5A-interacting proteins including peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), nuclear receptor subfamily 0, group B, member 1 (DAX-1), and CCAAT/enhancer-binding proteins (C/EBP) are involved in the transcription of NR5A target genes and regulate the transcription either positively or negatively under both basal and tropic hormone-stimulated conditions. In this review, we describe the transcriptional regulation of genes related to progesterone production.
Laccase-catalyzed oxidation of iodide and formation of organically bound iodine in soils.
Seki, Miharu; Oikawa, Jun-ichi; Taguchi, Taro; Ohnuki, Toshihiko; Muramatsu, Yasuyuki; Sakamoto, Kazunori; Amachi, Seigo
2013-01-02
Laccase oxidizes iodide to molecular iodine or hypoiodous acid, both of which are easily incorporated into natural soil organic matter. In this study, iodide sorption and laccase activity in 2 types of Japanese soil were determined under various experimental conditions to evaluate possible involvement of this enzyme in the sorption of iodide. Batch sorption experiment using radioactive iodide tracer ((125)I(-)) revealed that the sorption was significantly inhibited by autoclaving (121 °C, 40 min), heat treatment (80 and 100 °C, 10 min), γ-irradiation (30 kGy), N(2) gas flushing, and addition of reducing agents and general laccase inhibitors (KCN and NaN(3)). Interestingly, very similar tendency of inhibition was observed in soil laccase activity, which was determined using 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) as a substrate. The partition coefficient (K(d): mL g(-1)) for iodide and specific activity of laccase in soils (Unit g(-1)) showed significant positive correlation in both soil samples. Addition of a bacterial laccase with an iodide-oxidizing activity to the soils strongly enhanced the sorption of iodide. Furthermore, the enzyme addition partially restored iodide sorption capacity of the autoclaved soil samples. These results suggest that microbial laccase is involved in iodide sorption on soils through the oxidation of iodide.
International Nuclear Information System (INIS)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal; Thomsen, Bo; Larsen, Knud; Hedegaard, Jakob; Bendixen, Christian; Madsen, Lone Bruhn
2013-01-01
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable the differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i
Plants increase laccase activity in soil with long-term elevated CO2 legacy
DEFF Research Database (Denmark)
Partavian, Asrin; Mikkelsen, Teis Nørgaard; Vestergård, Mette
2015-01-01
[CO2] stimulate laccase activity. We incubated soil exposed to seven years of elevated or ambient field [CO2] in ambient or elevated [CO2] chambers for six months either with or without plants (Deschampsia flexuosa). Elevated chamber [CO2] increased D. flexuosa production and belowground respiration....... Interestingly, plants also grew larger in soil with an elevated [CO2] legacy. Plants stimulated soil microbial biomass, belowground respiration and laccase activity, and the plant-induced laccase stimulation was particularly apparent in soil exposed to long-term elevated [CO2] in the field, whereas laccase......Actively growing plants can stimulate mineralization of recalcitrant soil organic matter (SOM), and increased atmospheric [CO2] can further enhance such plant-mediated SOM degradation. Laccases are central for recalcitrant SOM decomposition, and we therefore hypothesized that plants and elevated...
Improved immobilization of laccase on a glassy carbon electrode by oriented covalent attachment
Directory of Open Access Journals (Sweden)
Liu Xin
2014-01-01
Full Text Available A laccase from Thermus thermophilus HB27 was reported to be potentially useful in the design of a temperature controlled biofuel cell. For enhancing its application in different thermal conditions, we engineered a laccase-oriented immobilized electrode. A site-directed mutant N323C of the laccase was constructed. A photometric assay was employed in order to compare the catalytic properties of wild-type laccase and mutant. The mutant was attached to a glass carbon electrode by covalent cross-linking. The electrochemical properties of the immobilized laccase were investigated by cyclic voltammetry. This immobilization allowed the active electrode to function at temperatures up to 95°C. The thermal and pH dependence profiles were similar to those of the soluble enzyme investigated by spectrophotometry.
Laccase Enzymology in Relation to Lignocellulose Processing
DEFF Research Database (Denmark)
Sitarz, Anna Katarzyna
) and investigated for production of enzymes under such conditions (Paper I). G. lucidum was found to produce high amounts of laccase which corresponded to its exceptional growth on lignocellulosic substrate and lignin. This observation led to a hypothesis that this particular laccase might act in a synergistic way...... cocktail preparation. This discovery is significant considering the fact that the cellulase cocktail preparations, namely Cellic®CTec1 and Cellic®CTec2, are improved in respect to phenolic-derived, and end-substrate inhibitors. Additionally, the molecular dynamics simulations (MD) of the obtained amino...
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts
Energy Technology Data Exchange (ETDEWEB)
Tucker, James D., E-mail: jtucker@biology.biosci.wayne.edu [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Joiner, Michael C. [Department of Radiation Oncology, Wayne State University, Detroit, Michigan (United States); Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V. [Department of Biological Sciences, Wayne State University, Detroit, Michigan (United States); Chinkhota, Chantelle N.; Smolinski, Joseph M. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States); Divine, George W. [Department of Public Health Sciences, Henry Ford Hospital, Detroit, Michigan (United States); Auner, Gregory W. [Department of Electrical and Computer Engineering, Wayne State University, Detroit, Michigan (United States)
2014-03-15
Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.
Circadian Enhancers Coordinate Multiple Phases of Rhythmic Gene Transcription In Vivo
Fang, Bin; Everett, Logan J.; Jager, Jennifer; Briggs, Erika; Armour, Sean M.; Feng, Dan; Roy, Ankur; Gerhart-Hines, Zachary; Sun, Zheng; Lazar, Mitchell A.
2014-01-01
SUMMARY Mammalian transcriptomes display complex circadian rhythms with multiple phases of gene expression that cannot be accounted for by current models of the molecular clock. We have determined the underlying mechanisms by measuring nascent RNA transcription around the clock in mouse liver. Unbiased examination of eRNAs that cluster in specific circadian phases identified functional enhancers driven by distinct transcription factors (TFs). We further identify on a global scale the components of the TF cistromes that function to orchestrate circadian gene expression. Integrated genomic analyses also revealed novel mechanisms by which a single circadian factor controls opposing transcriptional phases. These findings shed new light on the diversity and specificity of TF function in the generation of multiple phases of circadian gene transcription in a mammalian organ. PMID:25416951
Dhawan, Shikha; Lal, Rup; Hanspal, Manjit; Kuhad, Ramesh Chander
2005-08-01
The effect of nine different antibiotics (chloramphenicol, ampicillin trihydrate, kanamycin A monosulfate, neomycin sulfate, erythromycin, thiostrepton, tetracycline, apramycin sulfate and streptomycin sulfate) on growth and laccase production from Cyathus bulleri and Pycnoporus cinnabarinus has been investigated. All the antibiotics tested at a concentration of 200 mg/l affected the fungal growth, release of protein and laccase production to different extent. Inhibition in fungal growth was found to be positively correlated with increase in laccase production. Interestingly, apramycin sulfate inhibited biomass production (14.9-26.2%), nevertheless, it stimulated maximum laccase production (18.2 U/ml) in both the fungi. Increasing concentrations of apramycin sulfate enhanced laccase production from P. cinnabarinus but not from C. bulleri.
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE)
Energy Technology Data Exchange (ETDEWEB)
Karen S. Browning; Marie Petrocek; Bonnie Bartel
2006-06-01
The 5th Symposium on Post-Transcriptional Regulation of Plant Gene Expression (PTRoPGE) will be held June 8-12, 2005 at the University of Texas at Austin. Exciting new and ongoing discoveries show significant regulation of gene expression occurs after transcription. These post-transcriptional control events in plants range from subtle regulation of transcribed genes and phosphorylation, to the processes of gene regulation through small RNAs. This meeting will focus on the regulatory role of RNA, from transcription, through translation and finally degradation. The cross-disciplinary design of this meeting is necessary to encourage interactions between researchers that have a common interest in post-transcriptional gene expression in plants. By bringing together a diverse group of plant molecular biologist and biochemists at all careers stages from across the world, this meeting will bring about more rapid progress in understanding how plant genomes work and how genes are finely regulated by post-transcriptional processes to ultimately regulate cells.
Biosensor based on laccase immobilized on plasma polymerized allylamine/carbon electrode
Energy Technology Data Exchange (ETDEWEB)
Ardhaoui, Malika, E-mail: malika.ardhaoui@ucd.ie [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France); Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Surface Engineering Research Group, School of Electrical, Electronic and Mechanical Engineering, University College Dublin, Belfield, Dublin 4 (Ireland); Bhatt, Sudhir [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France); Zheng, Meihui [Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Dowling, Denis [Surface Engineering Research Group, School of Electrical, Electronic and Mechanical Engineering, University College Dublin, Belfield, Dublin 4 (Ireland); Jolivalt, Claude [Laboratoire Charles Friedel, CNRS UMR 7223, Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05 (France); Khonsari, Farzaneh Arefi [Laboratoire de Génie des Procédés Plasma et Traitements de Surface, Université Pierre et Marie Curie-Chimie ParisTech, 11 rue Pierre et Marie Curie, 75231 Paris (France)
2013-08-01
In this work, a simple and rapid method was used to functionalize carbon electrode in order to efficiently immobilize laccase for biosensor application. A stable allylamine coating was deposited using a low pressure inductively excited RF tubular plasma reactor under mild plasma conditions (low plasma power (10 W), few minutes) to generate high density amine groups (N/C ratio up to 0.18) on rough carbon surface electrodes. The longer was the allylamine plasma deposition time; the better was the surface coverage. Laccase from Trametes versicolor was physisorbed and covalently bound to these allylamine modified carbon surfaces. The laccase activities and current outputs measured in the presence of 2,2′-azinobis-(3-ethylbenzothiazole-6-sulfonic acid) (ABTS) showed that the best efficiency was obtained for electrode plasma coated during 30 min. They showed also that for all the tested electrodes, the activities and current outputs of the covalently immobilized laccases were twice higher than the physically adsorbed ones. The sensitivity of these biocompatible bioelectrodes was evaluated by measuring their catalytic efficiency for oxygen reduction in the presence of ABTS as non-phenolic redox substrate and 2,6-dimethoxyphenol (DMP) as phenolic one. Sensitivities of around 4.8 μA mg{sup −1} L and 2.7 μA mg{sup −1} L were attained for ABTS and DMP respectively. An excellent stability of this laccase biosensor was observed for over 6 months. - Highlights: • Low pressure plasma was used to generate stable allylamine coating. • Laccase from Trametes versicolor was physisorbed and covalently immobilized. • Best biosensor efficiency obtained for the covalently immobilized laccases • Sensitivities of 4.8 μA mg{sup −1} L and 2.7 μA mg{sup −1} L for ABTS and DMP respectively.
Lin, Kunde; Zhou, Shiyang; Chen, Xi; Ding, Jiafeng; Kong, Xiaoyan; Gan, Jay
2015-11-01
Hydroxylated polybrominated diphenyl ethers (OH-PBDEs) have been frequently found in the marine biosphere as emerging organic contaminants. Studies to date have suggested that OH-PBDEs in marine biota are natural products. However, the mechanisms leading to the biogenesis of OH-PBDEs are still far from clear. In this study, using a laccase isolated from Trametes versicolor as the model enzyme, we explored the formation of OH-PBDEs from the laccase-catalyzed oxidation of simple bromophenols (e.g., 2,4-DBP and 2,4,6-TBP). Experiments under ambient conditions clearly showed that OH-PBDEs were produced from 2,4-DBP and 2,4,6-TBP in presence of laccase. Polybrominated compounds 2'-OH-BDE68, 2,2'-diOH-BB80, and 1,3,8-TrBDD were identified as the products from 2,4-DBP, and 2'-OH-BDE121 and 4'-OH-BDE121 from 2,4,6-TBP. The production of OH-PBDEs was likely a result of the coupling of bromophenoxy radicals, generated from the laccase-catalyzed oxidation of 2,4-DBP or 2,4,6-TBP. The transformation of bromophenols by laccase was pH-dependant, and was also influenced by enzymatic activity. In view of the abundance of 2,4-DBP and 2,4,6-TBP and the phylogenetic distribution of laccases in the environment, laccase-catalyzed conversion of bromophenols may be potentially an important route for the natural biosynthesis of OH-PBDEs. Copyright © 2015 Elsevier Ltd. All rights reserved.
Thirty-seven transcription factor genes differentially respond to a ...
Indian Academy of Sciences (India)
Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.
Energy Technology Data Exchange (ETDEWEB)
Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.
2006-05-25
Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.
Directory of Open Access Journals (Sweden)
Yang Yu
2017-07-01
Full Text Available Seed setting rate is one of the most important components of rice grain yield. To date, only several genes regulating setting rate have been identified in plant. In this study, we showed that laccase-13 (OsLAC13, a member of laccase family genes which are known for their roles in modulating phenylpropanoid pathway and secondary lignification in cell wall, exerts a regulatory function in rice seed setting rate. OsLAC13 expressed in anthers and promotes hydrogen peroxide production both in vitro and in the filaments and anther connectives. Knock-out of OsLAC13 showed significantly increased seed setting rate, while overexpression of this gene exhibited induced mitochondrial damage and suppressed sugar transportation in anthers, which in turn affected seed setting rate. OsLAC13 also induced H2O2 production and mitochondrial damage in the root tip cells which caused the lethal phenotype. We also showed that high abundant of OsmiR397, the suppressor of OsLAC13 mRNA, increased the seed setting rate of rice plants, and restrains H2O2 accumulation in roots during oxidative stress. Our results suggested a novel regulatory role of OsLAC13 gene in regulating seed setting rate by affecting H2O2 dynamics and mitochondrial integrity in rice.
Adsorption and transformation of PAHs from water by a laccase-loading spider-type reactor
Energy Technology Data Exchange (ETDEWEB)
Niu, Junfeng, E-mail: junfengn@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Dai, Yunrong, E-mail: daiyunrong@mail.bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Guo, Huiyuan, E-mail: hyguo0216@163.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Xu, Jiangjie, E-mail: 1993120hb@163.com [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China); Shen, Zhenyao, E-mail: zyshen@bnu.edu.cn [State Key Laboratory of Water Environment Simulation, School of Environment, Beijing Normal University, Beijing 100875 (China)
2013-03-15
Highlights: ► Laccase-loading spider-type reactor (LSTR) is got by emulsion electrospinning. ► LSTR consists of beads-in-string fibers with more laccase and higher activity. ► LSTR can achieve the rapid and efficient removal of PAHs from water. ► Aquatic environmental factors have little influence on the PAH removal by LSTR. ► A synergetic mechanism includes adsorption, directional migration and degradation. -- Abstract: The remediation of polycyclic aromatic hydrocarbons (PAHs) polluted waters has become a concern as a result of the widespread use of PAHs and their adverse impacts on water ecosystems and human health. To remove PAHs rapidly and efficiently in situ, an active fibrous membrane, laccase-loading spider-type reactor (LSTR) was fabricated by electrospinning a poly(D,L-lactide-co-glycolide) (PDLGA)/laccase emulsion. The LSTR is composed of beads-in-string structural core–shell fibers, with active laccase encapsulated inside the beads and nanoscale pores on the surface of the beads. This structure can load more laccase and retains higher activity than do linear structural core–shell fibers. The LSTR achieves the efficient removal/degradation of PAHs in water, which is attributed to not only the protection of the laccase activity by the core–shell structure but also the pre-concentration (adsorption) of PAHs on the surface of the LSTR and the concentration of laccase in the beads. Moreover, the effects of pH, temperature and dissolved organic matter (DOM) concentration on the removal of PAHs by the LSTR, in comparison with that by free laccase, have been taken into account. A synergetic mechanism including adsorption, directional migration and degradation for PAH removal is proposed.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes
International Nuclear Information System (INIS)
Zhang, H.; Wang, J.C.; Liu, L.F.
1988-01-01
Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
Transcriptional delay stabilizes bistable gene networks.
Gupta, Chinmaya; López, José Manuel; Ott, William; Josić, Krešimir; Bennett, Matthew R
2013-08-02
Transcriptional delay can significantly impact the dynamics of gene networks. Here we examine how such delay affects bistable systems. We investigate several stochastic models of bistable gene networks and find that increasing delay dramatically increases the mean residence times near stable states. To explain this, we introduce a non-Markovian, analytically tractable reduced model. The model shows that stabilization is the consequence of an increased number of failed transitions between stable states. Each of the bistable systems that we simulate behaves in this manner.
Directory of Open Access Journals (Sweden)
Marcelo Silva Ferreira
2015-05-01
Full Text Available Carbon paste electrodes based on the immobilization of laccase from Aspergillus oryzae were developed and voltammetric measurements were performed to evaluate the amperometric response. The 2,2′-azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid diammonium salt (ABTS functions as substrate and mediator for the laccase enzyme. Electrodes were modified in two different conditions: without mediator (EPC/laccase and with mediator (EPC/laccase/ABTS. The addition of ABTS as a mediator increased eight-fold the amperometric response. The electrode was sensitive to pH variation with best response at pH 4.0. Studies on different concentrations of laccase and ABTS at different pH rates revealed that the composition 187 U mL-1 in laccase and 200 µL of ABTS obtained the highest amperometric response. The carbon paste electrode modified with ABTS proved to be a good base for the immobilization of the laccase enzyme. Moreover, it is easy to manufacture and inexpensive to produce a modified electrode with potential application in biosensors.
Johnston, Stephen; Gallaher, Zachary; Czaja, Krzysztof
2012-05-15
Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2(-∆∆Ct) normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.
Effect Of Metal Ions On Triphenylmethane Dye Decolorization By Laccase From Trametes Versicolor
Directory of Open Access Journals (Sweden)
Chmelová Daniela
2015-12-01
Full Text Available The aim of this study was investigate the influence of different metal ions on laccase activity and triphenylmethane dye decolorization by laccase from white-rot fungus Trametes versicolor. Laccase activity was inhibited by monovalent ions (Li+, Na+, K+ and Ag+ but the presence of divalent ions increased laccase activity at the concentration of 10 mmol/l. The effect of metal ions on decolorization of triphenylmethane dyes with different structures namely Bromochlorophenol Blue, Bromophenol Blue, Bromocresol Blue and Phenol Red was tested. The presence of metal ions (Na+, K+, Mg2+, Ca2+, Ba2+, Mn2+, Zn2+ slightly decreased triphenylmethane dye decolorization by laccase from T. versicolor except Na+ and Mg2+, which caused the increase of decolorization for all tested dyes. Decolorization of selected dyes showed that the presence of low-molecular-weight compounds is necessary for effective decolorization. Hydroxybenzotriazole (HBT is the most frequently used. Although HBT belongs to most frequently used redox mediator and generally increase decolorization efficiency, so its presence decreased decolorization percentage of Bromophenol Blue and Bromochlorophenol Blue, the influence of metal ions to dye decolorization by laccase has the similar course with or without presence of redox mediator HBT.
Extracellular laccase production and phenolic degradation by an olive mill wastewater isolate
Directory of Open Access Journals (Sweden)
R. Kumar
2018-03-01
Full Text Available Olive mill wastewater (OMWW presents a challenge to the control of effluents due to the presence of a high organic load, antimicrobial agents (monomeric-polymeric phenols, volatile acids, polyalcohols, and tannins, salinity and acidity. In this study, the production of extracellular laccase, monomeric or polymeric phenol, from an OMWW isolate based on its ability to biodegrade phenols and gallic acid as a model of phenolic compounds in OMWW was investigated. Phylogenetic analysis of the 16S RNA gene sequences identified the bacterial isolate (Acinetobacter REY as being closest to Acinetobacter pittii. This isolate exhibited a constitutive production of extracellular laccase with an activity of 1.5 and 1.3 U ml/L when supplemented with the inducers CuSO4 and CuSO4+phenols, respectively. Batch experiments containing minimal media supplemented with phenols or gallic acid as the sole carbon and energy source were performed in order to characterize their phenolic biodegradability. Acinetobacter REY was capable of biodegrading up to 200 mg/L of phenols and gallic acid both after 10 h and 72 h, respectively.
International Nuclear Information System (INIS)
Panduro, A.; Shalaby, F.; Weiner, F.R.; Biempica, L.; Zern, M.A.; Shafritz, D.A.
1986-01-01
During liver regeneration induced by CCl 4 administration to rats, changes in the relative transcription rates of albumin and alpha-fetoprotein genes have been measured in conjunction with other liver-specific and general cellular function genes. Within 24 h following CCl 4 administration, albumin gene transcription decreases by 85%, whereas alpha-fetoprotein transcription increases from undetectable levels to 50% of that observed for albumin. These changes precede maximal [ 3 H]thymidine incorporation into DNA which peaks at 48 h. Other genes related to liver-specific functions, such as ligandin, alpha 1-antitrypsin, and cytochrome P-450's, as well as general cellular genes pro alpha 1- and pro alpha 2-collagen, beta-actin, and alpha-tubulin, respond in kinetic patterns often distinct from each other and from albumin and alpha-fetoprotein. Changes in the steady-state levels of albumin and alpha-fetoprotein mRNA correlate with changes in transcription, but there is a lag in alpha-fetoprotein mRNA accumulation, which peaks at 72 h following CCl 4 administration. These studies indicate that reciprocal changes in albumin and alpha-fetoprotein gene transcription occur during CCl 4 -induced liver regeneration, leading to changes in the level of these specific mRNAs. These changes precede DNA synthesis and would appear to represent an alteration in differentiated function of hepatocytes in conjunction with the liver regenerative process
Laccase Immobilization by Chelated Metal Ion Coordination Chemistry
Directory of Open Access Journals (Sweden)
Qingqing Wang
2014-09-01
Full Text Available In this work, amidoxime polyacrylonitrile (AOPAN nanofibrous membrane was prepared by a reaction between PAN nanofibers and hydroxylamine hydrochloride. The AOPAN nanofibrous membranes were used for four metal ions (Fe3+, Cu2+, Ni2+, Cd2+ chelation under different conditions. Further, the competition of different metal ions coordinating with AOPAN nanofibrous membrane was also studied. The AOPAN chelated with individual metal ion (Fe3+, Cu2+, Ni2+, Cd2+ and also the four mixed metal ions were further used for laccase (Lac immobilization. Compared with free laccase, the immobilized laccase showed better resistance to pH and temperature changes as well as improved storage stability. Among the four individual metal ion chelated membranes, the stability of the immobilized enzymes generally followed the order as Fe–AOPAN–Lac > Cu–AOPAN–Lac > Ni–AOPAN–Lac > Cd–AOPAN–Lac. In addition, the immobilized enzyme on the carrier of AOPAN chelated with four mixed metal ions showed the best properties.
Laccase treatment of recycled blue dyed paper: Physical properties and fiber charge
Digital Repository Service at National Institute of Oceanography (India)
Mohandass, C.; Knutson, K.; Ragauskas, A.J.
Recycled blue colored paper was treated with laccase under various combinations of physical and chemical parameters including enzyme concentration, temperature, oxygen, and reaction time. Laccase treatment of recycled dyed pulp increased acid group...
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...
The WRKY Transcription Factor Genes in Lotus japonicus
Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun
2014-01-01
WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (...
Thermodynamics-based models of transcriptional regulation with gene sequence.
Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing
2015-12-01
Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.
Protection of Wood from Microorganisms by Laccase-Catalyzed Iodination
Engel, J.; Thöny-Meyer, L.; Schwarze, F. W. M. R.; Ihssen, J.
2012-01-01
In the present work, Norway spruce wood (Picea abies L.) was reacted with a commercial Trametes versicolor laccase in the presence of potassium iodide salt or the phenolic compounds thymol and isoeugenol to impart an antimicrobial property to the wood surface. In order to assess the efficacy of the wood treatment, a leaching of the iodinated and polymerized wood and two biotests including bacteria, a yeast, blue stain fungi, and wood decay fungi were performed. After laccase-catalyzed oxidation of the phenols, the antimicrobial effect was significantly reduced. In contrast, the enzymatic oxidation of iodide (I−) to iodine (I2) in the presence of wood led to an enhanced resistance of the wood surface against all microorganisms, even after exposure to leaching. The efficiency of the enzymatic wood iodination was comparable to that of a chemical wood preservative, VP 7/260a. The modification of the lignocellulose by the laccase-catalyzed iodination was assessed by the Fourier transform infrared spectroscopy-attenuated total reflectance (FTIR-ATR) technique. The intensities of the selected lignin-associated bands and carbohydrate reference bands were analyzed, and the results indicated a structural change in the lignin matrix. The results suggest that the laccase-catalyzed iodination of the wood surface presents an efficient and ecofriendly method for wood protection. PMID:22865075
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice
Directory of Open Access Journals (Sweden)
Shuchi eSmita
2015-12-01
Full Text Available MYB transcription factor (TF is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by top down and guide gene approaches. More than 50% of OsMYBs were strongly correlated under fifty experimental conditions with 51 hub genes via top down approach. Further, clusters were identified using Markov Clustering (MCL. To maximize the clustering performance, parameter evaluation of the MCL inflation score (I was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by guide gene approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought
Directory of Open Access Journals (Sweden)
Valéria Mafra
Full Text Available Real-time reverse transcription PCR (RT-qPCR has emerged as an accurate and widely used technique for expression profiling of selected genes. However, obtaining reliable measurements depends on the selection of appropriate reference genes for gene expression normalization. The aim of this work was to assess the expression stability of 15 candidate genes to determine which set of reference genes is best suited for transcript normalization in citrus in different tissues and organs and leaves challenged with five pathogens (Alternaria alternata, Phytophthora parasitica, Xylella fastidiosa and Candidatus Liberibacter asiaticus. We tested traditional genes used for transcript normalization in citrus and orthologs of Arabidopsis thaliana genes described as superior reference genes based on transcriptome data. geNorm and NormFinder algorithms were used to find the best reference genes to normalize all samples and conditions tested. Additionally, each biotic stress was individually analyzed by geNorm. In general, FBOX (encoding a member of the F-box family and GAPC2 (GAPDH was the most stable candidate gene set assessed under the different conditions and subsets tested, while CYP (cyclophilin, TUB (tubulin and CtP (cathepsin were the least stably expressed genes found. Validation of the best suitable reference genes for normalizing the expression level of the WRKY70 transcription factor in leaves infected with Candidatus Liberibacter asiaticus showed that arbitrary use of reference genes without previous testing could lead to misinterpretation of data. Our results revealed FBOX, SAND (a SAND family protein, GAPC2 and UPL7 (ubiquitin protein ligase 7 to be superior reference genes, and we recommend their use in studies of gene expression in citrus species and relatives. This work constitutes the first systematic analysis for the selection of superior reference genes for transcript normalization in different citrus organs and under biotic stress.
Mapping of gene transcripts by nuclease protection assays and cDNA primer extension
International Nuclear Information System (INIS)
Calzone, F.J.; Britten, R.J.; Davidson, E.J.
1987-01-01
An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements
Mechanism of salt-induced activity enhancement of a marine-derived laccase, Lac15.
Li, Jie; Xie, Yanan; Wang, Rui; Fang, Zemin; Fang, Wei; Zhang, Xuecheng; Xiao, Yazhong
2018-04-01
Laccase (benzenediol: oxygen oxidoreductases, EC1.10.3.2) is a multi-copper oxidase capable of oxidizing a variety of phenolic and other aromatic organic compounds. The catalytic power of laccase makes it an attractive candidate for potential applications in many areas of industry including biodegradation of organic pollutants and synthesis of novel drugs. Most laccases are vulnerable to high salt and have limited applications. However, some laccases are not only tolerant to but also activated by certain concentrations of salt and thus have great application potential. The mechanisms of salt-induced activity enhancement of laccases are unclear as yet. In this study, we used dynamic light scattering, size exclusion chromatography, analytical ultracentrifugation, intrinsic fluorescence emission, circular dichroism, ultraviolet-visible light absorption, and an enzymatic assay to investigate the potential correlation between the structure and activity of the marine-derived laccase, Lac15, whose activity is promoted by low concentrations of NaCl. The results showed that low concentrations of NaCl exert little influence on the protein structure, which was partially folded in the absence of the salt; moreover, the partially folded rather than the fully folded state seemed to be favorable for enzyme activity, and this partially folded state was distinctive from the so-called 'molten globule' occasionally observed in active enzymes. More data indicated that salt might promote laccase activity through mechanisms involving perturbation of specific local sites rather than a change in global structure. Potential binding sites for chloride ions and their roles in enzyme activity promotion are proposed.
Sequential Logic Model Deciphers Dynamic Transcriptional Control of Gene Expressions
Yeo, Zhen Xuan; Wong, Sum Thai; Arjunan, Satya Nanda Vel; Piras, Vincent; Tomita, Masaru; Selvarajoo, Kumar; Giuliani, Alessandro; Tsuchiya, Masa
2007-01-01
Background Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. Methodology Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM) is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. Principal Findings SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin) during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. Conclusions/Significance The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet providing rich biological
Sequential logic model deciphers dynamic transcriptional control of gene expressions.
Directory of Open Access Journals (Sweden)
Zhen Xuan Yeo
Full Text Available BACKGROUND: Cellular signaling involves a sequence of events from ligand binding to membrane receptors through transcription factors activation and the induction of mRNA expression. The transcriptional-regulatory system plays a pivotal role in the control of gene expression. A novel computational approach to the study of gene regulation circuits is presented here. METHODOLOGY: Based on the concept of finite state machine, which provides a discrete view of gene regulation, a novel sequential logic model (SLM is developed to decipher control mechanisms of dynamic transcriptional regulation of gene expressions. The SLM technique is also used to systematically analyze the dynamic function of transcriptional inputs, the dependency and cooperativity, such as synergy effect, among the binding sites with respect to when, how much and how fast the gene of interest is expressed. PRINCIPAL FINDINGS: SLM is verified by a set of well studied expression data on endo16 of Strongylocentrotus purpuratus (sea urchin during the embryonic midgut development. A dynamic regulatory mechanism for endo16 expression controlled by three binding sites, UI, R and Otx is identified and demonstrated to be consistent with experimental findings. Furthermore, we show that during transition from specification to differentiation in wild type endo16 expression profile, SLM reveals three binary activities are not sufficient to explain the transcriptional regulation of endo16 expression and additional activities of binding sites are required. Further analyses suggest detailed mechanism of R switch activity where indirect dependency occurs in between UI activity and R switch during specification to differentiation stage. CONCLUSIONS/SIGNIFICANCE: The sequential logic formalism allows for a simplification of regulation network dynamics going from a continuous to a discrete representation of gene activation in time. In effect our SLM is non-parametric and model-independent, yet
Nguyen, Luong N; Hai, Faisal I; Dosseto, Anthony; Richardson, Christopher; Price, William E; Nghiem, Long D
2016-06-01
Laccase was immobilized on granular activated carbon (GAC) and the resulting GAC-bound laccase was used to degrade four micropollutants in a packed-bed column. Compared to the free enzyme, the immobilized laccase showed high residual activities over a broad range of pH and temperature. The GAC-bound laccase efficiently removed four micropollutants, namely, sulfamethoxazole, carbamazepine, diclofenac and bisphenol A, commonly detected in raw wastewater and wastewater-impacted water sources. Mass balance analysis showed that these micropollutants were enzymatically degraded following adsorption onto GAC. Higher degradation efficiency of micropollutants by the immobilized compared to free laccase was possibly due to better electron transfer between laccase and substrate molecules once they have adsorbed onto the GAC surface. Results here highlight the complementary effects of adsorption and enzymatic degradation on micropollutant removal by GAC-bound laccase. Indeed laccase-immobilized GAC outperformed regular GAC during continuous operation of packed-bed columns over two months (a throughput of 12,000 bed volumes). Copyright © 2016 Elsevier Ltd. All rights reserved.
Ido, Ayaka; Iwata, Shinya; Iwata, Yuka; Igarashi, Hisako; Hamada, Takahiro; Sonobe, Seiji; Sugiura, Masahiro; Yukawa, Yasushi
2016-01-01
In vitro transcription is an essential tool to study the molecular mechanisms of transcription. For over a decade, we have developed an in vitro transcription system from tobacco (Nicotiana tabacum)-cultured cells (BY-2), and this system supported the basic activities of the three RNA polymerases (Pol I, Pol II, and Pol III). However, it was not suitable to study photosynthetic genes, because BY-2 cells have lost their photosynthetic activity. Therefore, Arabidopsis (Arabidopsis thaliana) in vitro transcription systems were developed from green and etiolated suspension cells. Sufficient in vitro Pol II activity was detected after the minor modification of the nuclear soluble extracts preparation method; removal of vacuoles from protoplasts and L-ascorbic acid supplementation in the extraction buffer were particularly effective. Surprisingly, all four Arabidopsis Rubisco small subunit (rbcS-1A, rbcS-1B, rbcS-2B, and rbcS-3B) gene members were in vitro transcribed from the naked DNA templates without any light-dependent manner. However, clear light-inducible transcriptions were observed using chromatin template of rbcS-1A gene, which was prepared with a human nucleosome assembly protein 1 (hNAP1) and HeLa histones. This suggested that a key determinant of light-dependency through the rbcS gene transcription was a higher order of DNA structure (i.e. chromatin). PMID:26662274
Transcriptional control in the segmentation gene network of Drosophila.
Directory of Open Access Journals (Sweden)
Mark D Schroeder
2004-09-01
Full Text Available The segmentation gene network of Drosophila consists of maternal and zygotic factors that generate, by transcriptional (cross- regulation, expression patterns of increasing complexity along the anterior-posterior axis of the embryo. Using known binding site information for maternal and zygotic gap transcription factors, the computer algorithm Ahab recovers known segmentation control elements (modules with excellent success and predicts many novel modules within the network and genome-wide. We show that novel module predictions are highly enriched in the network and typically clustered proximal to the promoter, not only upstream, but also in intronic space and downstream. When placed upstream of a reporter gene, they consistently drive patterned blastoderm expression, in most cases faithfully producing one or more pattern elements of the endogenous gene. Moreover, we demonstrate for the entire set of known and newly validated modules that Ahab's prediction of binding sites correlates well with the expression patterns produced by the modules, revealing basic rules governing their composition. Specifically, we show that maternal factors consistently act as activators and that gap factors act as repressors, except for the bimodal factor Hunchback. Our data suggest a simple context-dependent rule for its switch from repressive to activating function. Overall, the composition of modules appears well fitted to the spatiotemporal distribution of their positive and negative input factors. Finally, by comparing Ahab predictions with different categories of transcription factor input, we confirm the global regulatory structure of the segmentation gene network, but find odd skipped behaving like a primary pair-rule gene. The study expands our knowledge of the segmentation gene network by increasing the number of experimentally tested modules by 50%. For the first time, the entire set of validated modules is analyzed for binding site composition under a
Directory of Open Access Journals (Sweden)
Ricardo Sposina S. Teixeira
2010-01-01
Full Text Available Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR, Drimaren Blue X-BLN (DMBBLN, Drimaren Rubinol X-3LR (DMR, and Drimaren Blue C-R (RBBR. The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid, and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h and RBBR (80–90%, 24 h with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h and DMBBLN (63–84%, 24 h. The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h.
Directory of Open Access Journals (Sweden)
Elham Jahangiri
2014-08-01
Full Text Available The versatile oxidase enzyme laccase was immobilized on porous supports such as polymer membranes and cryogels with a view of using such biocatalysts in bioreactors aiming at the degradation of environmental pollutants in wastewater. Besides a large surface area for supporting the biocatalyst, the aforementioned porous systems also offer the possibility for simultaneous filtration applications in wastewater treatment. Herein a “green” water-based, initiator-free, and straightforward route to highly reactive membrane and cryogel-based bioreactors is presented, where laccase was immobilized onto the porous polymer supports using a water-based electron beam-initiated grafting reaction. In a second approach, the laccase redox mediators 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS and syringaldehyde were cross-linked instead of the enzyme via electron irradiation in a frozen aqueous poly(acrylate mixture in a one pot set-up, yielding a mechanical stable macroporous cryogel with interconnected pores ranging from 10 to 50 µm in size. The membranes as well as the cryogels were characterized regarding their morphology, chemical composition, and catalytic activity. The reactivity towards waste- water pollutants was demonstrated by the degradation of the model compound bisphenol A (BPA. Both membrane- and cryogel-immobilized laccase remained highly active after electron beam irradiation. Apparent specific BPA removal rates were higher for cryogel- than for membrane-immobilized and free laccase, whereas membrane-immobilized laccase was more stable with respect to maintenance of enzymatic activity and prevention of enzyme leakage from the carrier than cryogel-immobilized laccase. Cryogel-immobilized redox mediators remained functional in accelerating the laccase-catalyzed BPA degradation, and especially ABTS was found to act more efficiently in immobilized than in freely dissolved state.
Analysis of Single-cell Gene Transcription by RNA Fluorescent In Situ Hybridization (FISH)
DEFF Research Database (Denmark)
Ronander, Elena; Bengtsson, Dominique C; Joergensen, Louise
2012-01-01
Adhesion of Plasmodium falciparum infected erythrocytes (IE) to human endothelial receptors during malaria infections is mediated by expression of PfEMP1 protein variants encoded by the var genes. The haploid P. falciparum genome harbors approximately 60 different var genes of which only one has...... been believed to be transcribed per cell at a time during the blood stage of the infection. How such mutually exclusive regulation of var gene transcription is achieved is unclear, as is the identification of individual var genes or sub-groups of var genes associated with different receptors...... fluorescent in situ hybridization (FISH) analysis of var gene transcription by the parasite in individual nuclei of P. falciparum IE(1). Here, we present a detailed protocol for carrying out the RNA-FISH methodology for analysis of var gene transcription in single-nuclei of P. falciparum infected human...
Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27.
Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy
2015-01-01
Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by LC MS/MS analysis. The method led to very effective (90%) laccase immobilization and also imparted significant stability to the enzyme (more than 70% after 5 months of storage at 4°C). In batch decolorization, 90-95% decolorization was achieved of the simulated dye effluent for up to 10-20 cycles. Continuous decolorization in a packed bed bioreactor led to nearly 90% decolorization for up to 5 days. The immobilized laccase was also effective in decolorization and degradation of Acid Red 27 in the presence of a mediator. Four products of degradation were identified by LC-MS/MS analysis. The immobilized laccase in PVA-nitrate was concluded to be an effective agent in treatment of textile dye effluents.
Evaluation of fungal laccase immobilized on natural nanostructured bacterial cellulose
Directory of Open Access Journals (Sweden)
Lin eChen
2015-11-01
Full Text Available The aim of this work was to assess the possibility of using native bacterial nanocellulose (BC as a carrier for laccase immobilization. BC was synthesized by Gluconacetobacter xylinus, which was statically cultivated in a mannitol-based medium and was freeze-dried to form BC sponge after purification. For the first time, fungal laccase from Trametes versicolor was immobilized on the native nanofibril network-structured BC sponge through physical adsorption and cross-linking with glutaraldehyde. The properties including morphologic and structural features of the BC as well as the immobilized enzyme were thoroughly investigated. It was found that enzyme immobilized by cross-linking exhibited broader pH operation range of high catalytic activity as well as higher running stability compared to free and adsorbed enzyme. Using ABTS as substrate, the optimum pH value was 3.5 for the adsorption-immobilized laccase and 4.0 for the crosslinking-immobilized laccase. The immobilized enzyme retained 69% of the original activity after being recycled 7 times. Novel applications of the BC-immobilized enzyme tentatively include active packaging, construction of biosensors, and establishment of bioreactors.
Directory of Open Access Journals (Sweden)
Tu Kang
2007-06-01
Full Text Available Abstract Background The wide use of Affymetrix microarray in broadened fields of biological research has made the probeset annotation an important issue. Standard Affymetrix probeset annotation is at gene level, i.e. a probeset is precisely linked to a gene, and probeset intensity is interpreted as gene expression. The increased knowledge that one gene may have multiple transcript variants clearly brings up the necessity of updating this gene-level annotation to a refined transcript-level. Results Through performing rigorous alignments of the Affymetrix probe sequences against a comprehensive pool of currently available transcript sequences, and further linking the probesets to the International Protein Index, we generated transcript-level or protein-level annotation tables for two popular Affymetrix expression arrays, Mouse Genome 430A 2.0 Array and Human Genome U133A Array. Application of our new annotations in re-examining existing expression data sets shows increased expression consistency among synonymous probesets and strengthened expression correlation between interacting proteins. Conclusion By refining the standard Affymetrix annotation of microarray probesets from the gene level to the transcript level and protein level, one can achieve a more reliable interpretation of their experimental data, which may lead to discovery of more profound regulatory mechanism.
Interferon-Stimulated Genes Are Transcriptionally Repressed by PR in Breast Cancer.
Walter, Katherine R; Goodman, Merit L; Singhal, Hari; Hall, Jade A; Li, Tianbao; Holloran, Sean M; Trinca, Gloria M; Gibson, Katelin A; Jin, Victor X; Greene, Geoffrey L; Hagan, Christy R
2017-10-01
The progesterone receptor (PR) regulates transcriptional programs that drive proliferation, survival, and stem cell phenotypes. Although the role of native progesterone in the development of breast cancer remains controversial, PR clearly alters the transcriptome in breast tumors. This study identifies a class of genes, Interferon (IFN)-stimulated genes (ISGs), potently downregulated by ligand-activated PR which have not been previously shown to be regulated by PR. Progestin-dependent transcriptional repression of ISGs was observed in breast cancer cell line models and human breast tumors. Ligand-independent regulation of ISGs was also observed, as basal transcript levels were markedly higher in cells with PR knockdown. PR repressed ISG transcription in response to IFN treatment, the canonical mechanism through which these genes are activated. Liganded PR is robustly recruited to enhancer regions of ISGs, and ISG transcriptional repression is dependent upon PR's ability to bind DNA. In response to PR activation, key regulatory transcription factors that are required for IFN-activated ISG transcription, STAT2 and IRF9, exhibit impaired recruitment to ISG promoter regions, correlating with PR/ligand-dependent ISG transcriptional repression. IFN activation is a critical early step in nascent tumor recognition and destruction through immunosurveillance. As the large majority of breast tumors are PR positive at the time of diagnosis, PR-dependent downregulation of IFN signaling may be a mechanism through which early PR-positive breast tumors evade the immune system and develop into clinically relevant tumors. Implications: This study highlights a novel transcriptional mechanism through which PR drives breast cancer development and potentially evades the immune system. Mol Cancer Res; 15(10); 1331-40. ©2017 AACR . ©2017 American Association for Cancer Research.
Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression.
Kabadi, Ami M; Gersbach, Charles A
2014-09-01
Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications. Copyright © 2014 Elsevier Inc. All rights reserved.
Boldogköi, Zsolt
2012-01-01
The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organization, transcription, various post-transcriptional processes, and translation. In this study, the Transcriptional Interference Network (TIN) hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighboring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronized cascade of gene expression in functionally linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular organisms too.
Directory of Open Access Journals (Sweden)
Zsolt eBoldogkoi
2012-07-01
Full Text Available The regulation of gene expression is essential for normal functioning of biological systems in every form of life. Gene expression is primarily controlled at the level of transcription, especially at the phase of initiation. Non-coding RNAs are one of the major players at every level of genetic regulation, including the control of chromatin organisation, transcription, various post-transcriptional processes and translation. In this study, the Transcriptional Interference Network (TIN hypothesis was put forward in an attempt to explain the global expression of antisense RNAs and the overall occurrence of tandem gene clusters in the genomes of various biological systems ranging from viruses to mammalian cells. The TIN hypothesis suggests the existence of a novel layer of genetic regulation, based on the interactions between the transcriptional machineries of neighbouring genes at their overlapping regions, which are assumed to play a fundamental role in coordinating gene expression within a cluster of functionally-linked genes. It is claimed that the transcriptional overlaps between adjacent genes are much more widespread in genomes than is thought today. The Waterfall model of the TIN hypothesis postulates a unidirectional effect of upstream genes on the transcription of downstream genes within a cluster of tandemly-arrayed genes, while the Seesaw model proposes a mutual interdependence of gene expression between the oppositely-oriented genes. The TIN represents an auto-regulatory system with an exquisitely timed and highly synchronised cascade of gene expression in functionally-linked genes located in close physical proximity to each other. In this study, we focused on herpesviruses. The reason for this lies in the compressed nature of viral genes, which allows a tight regulation and an easier investigation of the transcriptional interactions between genes. However, I believe that the same or similar principles can be applied to cellular
Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima
International Nuclear Information System (INIS)
Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Ol’ga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Morgunova, Ekaterina Yu.; Betzel, Christian; Lindley, Peter F.; Mikhailov, Al’bert M.
2006-01-01
The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R free = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO 2 substituents
DNA context represents transcription regulation of the gene in mouse embryonic stem cells
Ha, Misook; Hong, Soondo
2016-04-01
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
Genome Binding and Gene Regulation by Stem Cell Transcription Factors
J.H. Brandsma (Johan)
2016-01-01
markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Genes Involved in Human Ribosome Biogenesis areTranscriptionally Upregulated in Colorectal Cancer
DEFF Research Database (Denmark)
Mansilla, Francisco; Lamy, Philippe; Ørntoft, Torben Falck
2009-01-01
Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p<10-3) when compared to normal mucosa. Overexpression was independent of microsate......Microarray gene expression profiling comprising 168 colorectal adenocarcinomas and 10 normal mucosas showed that over 79% of the genes involved in human ribosome biogenesis are significantly upregulated (log2>0.5, p... of microsatellite status. The promoters of the genes studied showed a significant enrichment for several transcription factor binding sites. There was a significant correlation between the number of binding site targets for these transcription factors and the observed gene transcript upregulation. The upregulation...
Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.
2017-01-01
Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552
Perfluorooctanoic acid stimulated mitochondrial biogenesis and gene transcription in rats
International Nuclear Information System (INIS)
Walters, M.W.; Bjork, J.A.; Wallace, K.B.
2009-01-01
Perfluorooctanoic acid (PFOA), used in the production of non-stick surface compounds, exhibits a worldwide distribution in the serum of humans and wildlife. In rodents PFOA transactivates PPARα and PPARγ nuclear receptors and increases mitochondrial DNA (mtDNA) copy number, which may be critical to the altered metabolic state of affected animals. A key regulator of mitochondrial biogenesis and transcription of mitochondrial genes is the PPARγ coactivator-1α (Pgc-1α) protein. The purpose of this study was to determine if Pgc-1α is implicated in the stimulation of mitochondrial biogenesis that occurs following the treatment of rats with PFOA. Livers from adult male Sprague-Dawley rats that received a 30 mg/kg daily oral dose of PFOA for 28 days were used for all experiments. Analysis of mitochondrial replication and transcription was performed by real time PCR, and proteins were detected using western blotting. PFOA treatment caused a transcriptional activation of the mitochondrial biogenesis pathway leading to a doubling of mtDNA copy number. Further, transcription of OXPHOS genes encoded by mtDNA was 3-4 times greater than that of nuclear encoded genes, suggestive of a preferential induction of mtDNA transcription. Western blot analysis revealed an increase in Pgc-1α, unchanged Tfam and decreased Cox II and Cox IV subunit protein expression. We conclude that PFOA treatment in rats induces mitochondrial biogenesis at the transcriptional level with a preferential stimulation of mtDNA transcription and that this occurs by way of activation of the Pgc-1α pathway. Implication of the Pgc-1α pathway is consistent with PPARγ transactivation by PFOA and reveals new understanding and possibly new critical targets for assessing or averting the associated metabolic disease.
DEFF Research Database (Denmark)
Yarapolov, A.; Shleev, S.; Zaitseva, E.
2007-01-01
in two different ways: (i) by studying the electroreduction of oxygen in anhydrous DMSO via a direct electron transfer mechanism without proton donors and (ii) by doing the same experiments in the presence of laccase substrates, which display in pure organic solvents both the properties of electron......The electroenzymatic reactions of Trametes hirsuta laccase in the pure organic solvent dimethyl sulfoxide (DMSO) have been investigated within the framework for potential use as a catalytic reaction scheme for oxygen reduction. The bioelectrochemical characteristics of laccase were investigated...... donors as well as the properties of weak acids. The results obtained with laccase in anhydrous DMSO were compared with those obtained previously in aqueous buffer. It was shown that in the absence of proton donors under oxygenated conditions, formation of superoxide anion radicals is prevented at bare...
Transcriptional regulation of gene expression clusters in motor neurons following spinal cord injury
Directory of Open Access Journals (Sweden)
Westerdahl Ann-Charlotte
2010-06-01
Full Text Available Abstract Background Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Results Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. Conclusions This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper
Ryge, Jesper; Winther, Ole; Wienecke, Jacob; Sandelin, Albin; Westerdahl, Ann-Charlotte; Hultborn, Hans; Kiehn, Ole
2010-06-09
Spinal cord injury leads to neurological dysfunctions affecting the motor, sensory as well as the autonomic systems. Increased excitability of motor neurons has been implicated in injury-induced spasticity, where the reappearance of self-sustained plateau potentials in the absence of modulatory inputs from the brain correlates with the development of spasticity. Here we examine the dynamic transcriptional response of motor neurons to spinal cord injury as it evolves over time to unravel common gene expression patterns and their underlying regulatory mechanisms. For this we use a rat-tail-model with complete spinal cord transection causing injury-induced spasticity, where gene expression profiles are obtained from labeled motor neurons extracted with laser microdissection 0, 2, 7, 21 and 60 days post injury. Consensus clustering identifies 12 gene clusters with distinct time expression profiles. Analysis of these gene clusters identifies early immunological/inflammatory and late developmental responses as well as a regulation of genes relating to neuron excitability that support the development of motor neuron hyper-excitability and the reappearance of plateau potentials in the late phase of the injury response. Transcription factor motif analysis identifies differentially expressed transcription factors involved in the regulation of each gene cluster, shaping the expression of the identified biological processes and their associated genes underlying the changes in motor neuron excitability. This analysis provides important clues to the underlying mechanisms of transcriptional regulation responsible for the increased excitability observed in motor neurons in the late chronic phase of spinal cord injury suggesting alternative targets for treatment of spinal cord injury. Several transcription factors were identified as potential regulators of gene clusters containing elements related to motor neuron hyper-excitability, the manipulation of which potentially could be
Fungal Laccases Degradation of Endocrine Disrupting Compounds
Directory of Open Access Journals (Sweden)
Gemma Macellaro
2014-01-01
Full Text Available Over the past decades, water pollution by trace organic compounds (ng/L has become one of the key environmental issues in developed countries. This is the case of the emerging contaminants called endocrine disrupting compounds (EDCs. EDCs are a new class of environmental pollutants able to mimic or antagonize the effects of endogenous hormones, and are recently drawing scientific and public attention. Their widespread presence in the environment solicits the need of their removal from the contaminated sites. One promising approach to face this challenge consists in the use of enzymatic systems able to react with these molecules. Among the possible enzymes, oxidative enzymes are attracting increasing attention because of their versatility, the possibility to produce them on large scale, and to modify their properties. In this study five different EDCs were treated with four different fungal laccases, also in the presence of both synthetic and natural mediators. Mediators significantly increased the efficiency of the enzymatic treatment, promoting the degradation of substrates recalcitrant to laccase oxidation. The laccase showing the best performances was chosen to further investigate its oxidative capabilities against micropollutant mixtures. Improvement of enzyme performances in nonylphenol degradation rate was achieved through immobilization on glass beads.
Substrate Specificity and Enzyme Recycling Using Chitosan Immobilized Laccase
Directory of Open Access Journals (Sweden)
Everton Skoronski
2014-10-01
Full Text Available The immobilization of laccase (Aspergillus sp. on chitosan by cross-linking and its application in bioconversion of phenolic compounds in batch reactors were studied. Investigation was performed using laccase immobilized via chemical cross-linking due to the higher enzymatic operational stability of this method as compared to immobilization via physical adsorption. To assess the influence of different substrate functional groups on the enzyme’s catalytic efficiency, substrate specificity was investigated using chitosan-immobilized laccase and eighteen different phenol derivatives. It was observed that 4-nitrophenol was not oxidized, while 2,5-xylenol, 2,6-xylenol, 2,3,5-trimethylphenol, syringaldazine, 2,6-dimetoxyphenol and ethylphenol showed reaction yields up 90% at 40 °C. The kinetic of process, enzyme recyclability and operational stability were studied. In batch reactors, it was not possible to reuse the enzyme when it was applied to syringaldazne bioconversion. However, when the enzyme was applied to bioconversion of 2,6-DMP, the activity was stable for eight reaction batches.
Liver lipid molecules induce PEPCK-C gene transcription and attenuate insulin action
International Nuclear Information System (INIS)
Chen Guoxun
2007-01-01
Cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) plays key roles in gluconeogenesis, glyceroneogenesis, and cataplerosis. Experiments were designed to examine the effects of endogenous lipid molecules from rat livers on the expression of PEPCK-C gene in primary rat hepatocytes. The lipid extracts prepared from livers of Zucker fatty, lean, and Wistar rats induced the expression levels of PEPCK-C transcripts. Insulin-mediated reduction of PEPCK-C gene expression was attenuated by the same treatment. The lipid extracts induced the relative luciferase activity of reporter gene constructs that contain a 2.2-kb 5' promoter fragment of PEPCK-C gene, but not the construct that contains only the 3' untranslated region (UTR) of its mRNA. The estimated half life of PEPCK-C transcripts in the presence of the lipid extract is the same as that in the absence of it. My results demonstrate for the first time that endogenous lipid molecules induce PEPCK-C gene transcription and attenuate insulin action in liver
Directory of Open Access Journals (Sweden)
Krishna K. Sharma
2017-04-01
Full Text Available Basidiomycetous fungi, Ganoderma lucidum MDU-7 and Ganoderma sp. kk-02 secreted multiple laccase isozymes under diverse growth condition. Aromatic compounds and metal salts were also found to regulate the differential expression of laccase isozymes from both the Ganoderma sp. Laccase isozymes induced in the presence of copper from G. lucidum MDU-7 were purified by gel-based (native-PAGE purification method. The purity of laccase isozymes was checked by zymogram and SDS-PAGE. The SDS-PAGE of purified proteins confirmed the multimeric nature of laccase isozymes. The molecular mass of isozymes was found to be in the range of 40–66 kDa. Further, the purified laccase isozymes and their peptides were confirmed with the help of MALDI-TOF peptide fingerprinting. The biochemical characterization of laccase isozymes viz. Glac L2, Glac L3, Glac L4, and Glac L5 have shown the optimum temperature in the range of 30°–45°C and pH 3.0. The Km values of all the laccase isozymes determined for guaiacol were (96–281 μM, ABTS (15–83 μM and O-tolidine (78–724 μM. Further, laccase isozymes from G. lucidum whole genome were studied using bioinformatics tools. The molecular modeling and docking of laccase isozymes with different substrates showed a significant binding affinity, which further validates our experimental results. Interestingly, copper induced laccase of 40 U/ml in culture medium was found to significantly induce cotton callogenesis. Interestingly, all the laccase isozymes were found to have an antioxidative role and therefore capable in free radicals scavenging during callogenesis. This is the first detailed study on the biochemical characterization of all the laccase isozymes purified by a gel-based novel method.
Laccase-catalyzed dimerization of glycosylated lignols
Czech Academy of Sciences Publication Activity Database
Bassanini, I.; Gavezzotti, P.; Monti, D.; Krejzová, Jana; Křen, Vladimír; Riva, S.
2016-01-01
Roč. 134, SI (2016), s. 295-301 ISSN 1381-1177 R&D Projects: GA MŠk(CZ) LD15085 Institutional support: RVO:61388971 Keywords : Biocatalysis * Biooxidation * Laccase Subject RIV: CE - Biochemistry Impact factor: 2.269, year: 2016
Laccase immobilized on methylene blue modified mesoporous silica MCM-41/PVA
International Nuclear Information System (INIS)
Xu Xinhua; Lu Ping; Zhou Yumei; Zhao Zhenzhen; Guo Meiqing
2009-01-01
The mesoporous silica sieve MCM-41 containing methylene blue (MB) provides a suitable immobilization of biomolecule matrix due to its uniform pore structure, high surface areas, good biocompatibility and nice conductivity. Based on this, a facilely fabricated amperometric biosensor by entrapping laccase into the MB modified MCM-41/PVA composite film has been developed. Laccase from Trametes versicolor is assembled on a composite film of MCM-41 containing MB/PVA modified Au electrode and the electrode is characterized with respect to transmission electron microscopy (TEM) and scanning electron microscopic (SEM), Cyclic voltammetry (CV), response time, detection limit, linear range and activity of laccase. The laccase modified electrode remains good redox behavior in pH 4.95 acetate buffer solution, at room temperature in present of 0.1 mM catechol. The response time (t 90% ) of the modified electrode is less than 4 s for catechol. The detection limit is 0.331 μM and the linear detect range is about from 4.0 μM to 87.98 μM for catechol with a correlation coefficient of 0.99913(S/N = 3). The apparent Michaelis-Menten (K M app ) is estimated using the Lineweaver-Burk equation and the K M app value is about 0.256 mM. This work demonstrated that the mesoporous silica MCM-41 containing MB provides a novel support for laccase immobilization and the construction of biosensors with a faster response and better bioactivity.
Step out of the groove : epigenetic gene control systems and engineered transcription factors
Verschure, P.J.; Visser, A.E.; Rots, M.G.
2006-01-01
At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not
Role of natural antisense transcripts pertaining to tumor suppressor genes in human carcinomas
International Nuclear Information System (INIS)
Pelicci, G.; Pierotti, M.
2009-01-01
Overlapping transcripts in opposite orientations can potentially form perfect sense-antisense duplex RNA. Recently, several studies have revealed the extent of natural antisense transcripts (NATs) and their role in important biological phenomena also in higher organisms. In order to test the hypothesis that the function of NATs in man might represent an essential element in the regulation of gene expression, especially at transcriptional level, in this study we planned to look for, systematically examine, and characterize NATs belonging in the human genome to the tumour suppressor class of genes, so to identify physiological (and potentially pathological) modulators in this gene class
Directory of Open Access Journals (Sweden)
López-Barragán María J
2011-11-01
Full Text Available Abstract Background It has been shown that nearly a quarter of the initial predicted gene models in the Plasmodium falciparum genome contain errors. Although there have been efforts to obtain complete cDNA sequences to correct the errors, the coverage of cDNA sequences on the predicted genes is still incomplete, and many gene models for those expressed in sexual or mosquito stages have not been validated. Antisense transcripts have widely been reported in P. falciparum; however, the extent and pattern of antisense transcripts in different developmental stages remain largely unknown. Results We have sequenced seven bidirectional libraries from ring, early and late trophozoite, schizont, gametocyte II, gametocyte V, and ookinete, and four strand-specific libraries from late trophozoite, schizont, gametocyte II, and gametocyte V of the 3D7 parasites. Alignment of the cDNA sequences to the 3D7 reference genome revealed stage-specific antisense transcripts and novel intron-exon splicing junctions. Sequencing of strand-specific cDNA libraries suggested that more genes are expressed in one direction in gametocyte than in schizont. Alternatively spliced genes, antisense transcripts, and stage-specific expressed genes were also characterized. Conclusions It is necessary to continue to sequence cDNA from different developmental stages, particularly those of non-erythrocytic stages. The presence of antisense transcripts in some gametocyte and ookinete genes suggests that these antisense RNA may play an important role in gene expression regulation and parasite development. Future gene expression studies should make use of directional cDNA libraries. Antisense transcripts may partly explain the observed discrepancy between levels of mRNA and protein expression.
Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.
Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping
2015-02-01
Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.
Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L
2009-09-01
Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.
Directory of Open Access Journals (Sweden)
Giselle Torres-Farradá
2017-05-01
Full Text Available White-rot fungi (WRF and their ligninolytic enzymes (laccases and peroxidases are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba. All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains.
Torres-Farradá, Giselle; Manzano León, Ana M.; Rineau, François; Ledo Alonso, Lucía L.; Sánchez-López, María I.; Thijs, Sofie; Colpaert, Jan; Ramos-Leal, Miguel; Guerra, Gilda; Vangronsveld, Jaco
2017-01-01
White-rot fungi (WRF) and their ligninolytic enzymes (laccases and peroxidases) are considered promising biotechnological tools to remove lignin related Persistent Organic Pollutants from industrial wastewaters and contaminated ecosystems. A high diversity of the genus Ganoderma has been reported in Cuba; in spite of this, the diversity of ligninolytic enzymes and their genes remained unexplored. In this study, 13 native WRF strains were isolated from decayed wood in urban ecosystems in Havana (Cuba). All strains were identified as Ganoderma sp. using a multiplex polymerase chain reaction (PCR)-method based on ITS sequences. All Ganoderma sp. strains produced laccase enzymes at higher levels than non-specific peroxidases. Native-PAGE of extracellular enzymatic extracts revealed a high diversity of laccase isozymes patterns between the strains, suggesting the presence of different amino acid sequences in the laccase enzymes produced by these Ganoderma strains. We determined the diversity of genes encoding laccases and peroxidases using a PCR and cloning approach with basidiomycete-specific primers. Between two and five laccase genes were detected in each strain. In contrast, only one gene encoding manganese peroxidase or versatile peroxidase was detected in each strain. The translated laccases and peroxidases amino acid sequences have not been described before. Extracellular crude enzymatic extracts produced by the Ganoderma UH strains, were able to degrade model chromophoric compounds such as anthraquinone and azo dyes. These findings hold promises for the development of a practical application for the treatment of textile industry wastewaters and also for bioremediation of polluted ecosystems by well-adapted native WRF strains. PMID:28588565
Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J
2016-06-01
Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Luo, Jianquan; Zeuner, Birgitte; Morthensen, Sofie Thage
2015-01-01
(e.g. dimers and trimers) were mainly responsible for the adsorption fouling. Free laccase treatment was preferred since it was prone to produce large polymeric products while the biocatalytic membrane with immobilized laccase was not suitable as it generated smaller polymers by in-situ product...... monosaccharides (xylose, arabinose, glucose). Four commercial NF membranes (NF270, NP030, NTR7450 and NP010) were evaluated at different pH values and with various laccase pre-treatments (for polymerization of phenolic acids). The results showed that with increasing pH, the retentions of phenolic acids by NF...... could be polymerized by laccase and then completely retained by the NF membranes via size exclusion at pH 5.15. The formation of large polymeric products by laccase could alleviate the irreversible fouling in/on a NF membrane and decrease the monosaccharide retention, while the small polymeric products...
Directory of Open Access Journals (Sweden)
James Claudine G
2006-09-01
Full Text Available Abstract Background Coordinated chondrocyte proliferation and differentiation are required for normal endochondral bone growth. Transcription factors binding to the cyclicAMP response element (CRE are known to regulate these processes. One member of this family, Activating Tanscription Factor 3 (ATF3, is expressed during skeletogenesis and acts as a transcriptional repressor, but the function of this protein in chondrogenesis is unknown. Results Here we demonstrate that Atf3 mRNA levels increase during mouse chondrocyte differentiation in vitro and in vivo. In addition, Atf3 mRNA levels are increased in response to cytochalasin D treatment, an inducer of chondrocyte maturation. This is accompanied by increased Atf3 promoter activity in cytochalasin D-treated chondrocytes. We had shown earlier that transcription of the cell cycle genes cyclin D1 and cyclin A in chondrocytes is dependent on CREs. Here we demonstrate that overexpression of ATF3 in primary mouse chondrocytes results in reduced transcription of both genes, as well as decreased activity of a CRE reporter plasmid. Repression of cyclin A transcription by ATF3 required the CRE in the cyclin A promoter. In parallel, ATF3 overexpression reduces the activity of a SOX9-dependent promoter and increases the activity of a RUNX2-dependent promoter. Conclusion Our data suggest that transcriptional induction of the Atf3 gene in maturing chondrocytes results in down-regulation of cyclin D1 and cyclin A expression as well as activation of RUNX2-dependent transcription. Therefore, ATF3 induction appears to facilitate cell cycle exit and terminal differentiation of chondrocytes.
Neurotoxocarosis alters myelin protein gene transcription and expression.
Heuer, Lea; Beyerbach, Martin; Lühder, Fred; Beineke, Andreas; Strube, Christina
2015-06-01
Neurotoxocarosis is an infection of the central nervous system caused by migrating larvae of the common dog and cat roundworms (Toxocara canis and Toxocara cati), which are zoonotic agents. As these parasites are prevalent worldwide and neuropathological and molecular investigations on neurotoxocarosis are scare, this study aims to characterise nerve fibre demyelination associated with neurotoxocarosis on a molecular level. Transcription of eight myelin-associated genes (Cnp, Mag, Mbp, Mog, Mrf-1, Nogo-A, Plp1, Olig2) was determined in the mouse model during six time points of the chronic phase of infection using qRT-PCR. Expression of selected proteins was analysed by Western blotting or immunohistochemistry. Additionally, demyelination and neuronal damage were investigated histologically. Significant differences (p ≤ 0.05) between transcription rates of T. canis-infected and uninfected control mice were detected for all analysed genes while T. cati affected five of eight investigated genes. Interestingly, 2', 3 ´-cyclic nucleotide 3'-phosphodiesterase (Cnp) and myelin oligodendrocyte glycoprotein (Mog) were upregulated in both T. canis- and T. cati-infected mice preceding demyelination. Later, CNPase expression was additionally enhanced. As expected, myelin basic protein (Mbp) was downregulated in cerebra and cerebella of T. canis-infected mice when severe demyelination was present 120 days post infectionem (dpi). The transcriptional pattern observed in the present study appears to reflect direct traumatic and hypoxic effects of larval migration as well as secondary processes including host immune reactions, demyelination and attempts to remyelinate damaged areas.
Two-domain laccase from Streptomyces coelicolor: a link between laccases and nitrite reductases
Czech Academy of Sciences Publication Activity Database
Skálová, Tereza; Dohnálek, Jan; Ostergaard, L. H.; Ostergaard, P. R.; Kolenko, Petr; Dušková, Jarmila; Štěpánková, Andrea; Hašek, Jindřich
2009-01-01
Roč. 16, 3a - Special Issue (2009), s. 3-4 ISSN 1211-5894. [Heart of European Crystallographic Meeting /12./. 24.09.2009-26.09.2009, Třešt´] R&D Projects: GA AV ČR IAA500500701; GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * oxidoreductase * multicopper blue protein Subject RIV: CD - Macromolecular Chemistry
Immobilized laccase mediated dye decolorization and transformation pathway of azo dye acid red 27
Chhabra, Meenu; Mishra, Saroj; Sreekrishnan, Trichur Ramaswamy
2015-01-01
Background Laccases have good potential as bioremediating agents and can be used continuously in the immobilized form like many other enzymes. Methods In the present study, laccase from Cyathus bulleri was immobilized by entrapment in Poly Vinyl Alcohol (PVA) beads cross-linked with either nitrate or boric acid. Immobilized laccase was used for dye decolorization in both batch and continuous mode employing a packed bed column. The products of degradation of dye Acid Red 27 were identified by ...
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Walworth, Aaron E; Chai, Benli; Song, Guo-Qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora'), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of these
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants.
Directory of Open Access Journals (Sweden)
Aaron E Walworth
Full Text Available In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L., a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora ('VcFT-Aurora', which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT. Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in 'VcFT-Aurora'. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5 gene was down-regulated and associated with five other differentially expressed (DE genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2, a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5, and a VERNALIZATION1-like gene (VcVRN1, may function as integrators in place of FLOWERING LOCUS C (FLC in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1, LEAFY-like (VcLFY, APETALA1-like (VcAP1, CAULIFLOWER 1-like (VcCAL1, and FRUITFULL-like (VcFUL genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all of
Transcript Profile of Flowering Regulatory Genes in VcFT-Overexpressing Blueberry Plants
Walworth, Aaron E.; Chai, Benli; Song, Guo-qing
2016-01-01
In order to identify genetic components in flowering pathways of highbush blueberry (Vaccinium corymbosum L.), a transcriptome reference composed of 254,396 transcripts and 179,853 gene contigs was developed by assembly of 72.7 million reads using Trinity. Using this transcriptome reference and a query of flowering pathway genes of herbaceous plants, we identified potential flowering pathway genes/transcripts of blueberry. Transcriptome analysis of flowering pathway genes was then conducted on leaf tissue samples of transgenic blueberry cv. Aurora (‘VcFT-Aurora’), which overexpresses a blueberry FLOWERING LOCUS T-like gene (VcFT). Sixty-one blueberry transcripts of 40 genes showed high similarities to 33 known flowering-related genes of herbaceous plants, of which 17 down-regulated and 16 up-regulated genes were identified in ‘VcFT-Aurora’. All down-regulated genes encoded transcription factors/enzymes upstream in the signaling pathway containing VcFT. A blueberry CONSTANS-LIKE 5-like (VcCOL5) gene was down-regulated and associated with five other differentially expressed (DE) genes in the photoperiod-mediated flowering pathway. Three down-regulated genes, i.e., a MADS-AFFECTING FLOWERING 2-like gene (VcMAF2), a MADS-AFFECTING FLOWERING 5-like gene (VcMAF5), and a VERNALIZATION1-like gene (VcVRN1), may function as integrators in place of FLOWERING LOCUS C (FLC) in the vernalization pathway. Because no CONSTAN1-like or FLOWERING LOCUS C-like genes were found in blueberry, VcCOL5 and VcMAF2/VcMAF5 or VRN1 might be the major integrator(s) in the photoperiod- and vernalization-mediated flowering pathway, respectively. The major down-stream genes of VcFT, i.e., SUPPRESSOR of Overexpression of Constans 1-like (VcSOC1), LEAFY-like (VcLFY), APETALA1-like (VcAP1), CAULIFLOWER 1-like (VcCAL1), and FRUITFULL-like (VcFUL) genes were present and showed high similarity to their orthologues in herbaceous plants. Moreover, overexpression of VcFT promoted expression of all
Chemical reactivity of alkali lignin modified with laccase
International Nuclear Information System (INIS)
Sun, Yong; Qiu, Xueqing; Liu, Yunquan
2013-01-01
The modification of alkali lignin with laccase was investigated. The structural change of lignin was analyzed. The sulfonation reactivity was measured by the content of sulfonic group. The results showed the sulfonation reactivity increased to some extent under the condition of atmosphere pressure, but decreased under the condition of 0.3 MPa oxygen pressure. The analysis of Fourier transform infrared spectroscopy (FTIR), nuclear magnetic resonance (NMR) and gel permeation chromatography (GPC) showed the cleavage of various ether linkages and demethylation took place in the structure of lignin to certain extent during modification with laccase, which contributed to the improvement of sulfonation reactivity. Under the condition of 0.3 MPa oxygen pressure, the ratio of s/g (guaiacyl/syringyl) increased after modification, which reduced the sulfonation reactivity of lignin. Simultaneously partial polymerization reaction, such as 4-O-5′, β-5, 5-5 and other reaction in the aromatic ring decreased the activity sites of C 2 , C 5 and C 6 . Abundant polymerization reaction of α-O increased steric hindrance of C 2 and C 6 in aromatic ring, resulting in low sulfonation reactivity of lignin. -- Highlights: ► The modification of alkali lignin with laccase was investigated. ► The sulfonation reactivity increased under the condition of atmosphere pressure. ► More content of guaiacyl and hydroxy, the less content of methoxyl, syringyl can enhance the sulfonation reactivity of lignin. ► Partial moieties polymerized each other with α-O linkgages during treatment with laccase under oxygen pressure. ► The steric hindrance on C 2 and C 6 in aromatic ring resulted in low sulfonation reaction reactivity of lignin
Kittl, Roman; Mueangtoom, Kitti; Gonaus, Christoph; Khazaneh, Shima Tahvilda; Sygmund, Christoph; Haltrich, Dietmar; Ludwig, Roland
2012-01-20
Fungal laccases from basidiomycetous fungi are thoroughly investigated in respect of catalytic mechanism and industrial applications, but the number of reported and well characterized ascomycetous laccases is much smaller although they exhibit interesting catalytic properties. We report on a highly chloride tolerant laccase produced by the plant pathogen ascomycete Botrytis aclada, which was recombinantly expressed in Pichia pastoris with an extremely high yield and purified to homogeneity. In a fed-batch fermentation, 495 mg L(-1) of laccase was measured in the medium, which is the highest concentration obtained for a laccase by a yeast expression system. The recombinant B. aclada laccase has a typical molecular mass of 61,565 Da for the amino acid chain. The pI is approximately 2.4, a very low value for a laccase. Glycosyl residues attached to the recombinant protein make up for approximately 27% of the total protein mass. B. aclada laccase exhibits very low K(M) values and high substrate turnover numbers for phenolic and non-phenolic substrates at acidic and near neutral pH. The enzyme's stability increases in the presence of chloride ions and, even more important, its substrate turnover is only weakly inhibited by chloride ions (I(50)=1.4M), which is in sharp contrast to most other described laccases. This high chloride tolerance is mandatory for some applications such as implantable biofuel cells and laccase catalyzed reactions, which suffer from the presence of chloride ions. The high expression yield permits fast and easy production for further basic and applied research. Copyright © 2011 Elsevier B.V. All rights reserved.
Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny
2009-01-01
We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...
Directory of Open Access Journals (Sweden)
Hsiung Chao
2011-10-01
Full Text Available Abstract Background Changes in transcriptional orientation (“CTOs” occur frequently in prokaryotic genomes. Such changes usually result from genomic inversions, which may cause a conflict between the directions of replication and transcription and an increase in mutation rate. However, CTOs do not always lead to the replication-transcription confrontation. Furthermore, CTOs may cause deleterious disruptions of operon structure and/or gene regulations. The currently existing CTOs may indicate relaxation of selection pressure. Therefore, it is of interest to investigate whether CTOs have an independent effect on the evolutionary rates of the affected genes, and whether these genes are subject to any type of selection pressure in prokaryotes. Methods Three closely related enterbacteria, Escherichia coli, Klebsiella pneumoniae and Salmonella enterica serovar Typhimurium, were selected for comparisons of synonymous (dS and nonsynonymous (dN substitution rate between the genes that have experienced changes in transcriptional orientation (changed-orientation genes, “COGs” and those that do not (same-orientation genes, “SOGs”. The dN/dS ratio was also derived to evaluate the selection pressure on the analyzed genes. Confounding factors in the estimation of evolutionary rates, such as gene essentiality, gene expression level, replication-transcription confrontation, and decreased dS at gene terminals were controlled in the COG-SOG comparisons. Results We demonstrate that COGs have significantly higher dN and dS than SOGs when a series of confounding factors are controlled. However, the dN/dS ratios are similar between the two gene groups, suggesting that the increase in dS can sufficiently explain the increase in dN in COGs. Therefore, the increases in evolutionary rates in COGs may be mainly mutation-driven. Conclusions Here we show that CTOs can increase the evolutionary rates of the affected genes. This effect is independent of the
The histone genes in HeLa cells are on individual transcriptional units
International Nuclear Information System (INIS)
Hackett, P.B.; Traub, P.; Gallwitz, D.
1978-01-01
The distances of the five major histone genes from their promotors have been investigated in order to determine whether in human cells these genes could be transcribed as a single polycistronic transcriptional unit. By measuring the decreases of both histone protein and histone mRNA synthesis as functions of the ultraviolet light dosage, it was possible to calculate the distances of the histone genes from their promotors. The inactivation kinetics for histone genes H1 and H3 are first-order, indicating a single type of transcriptional unit for each gene. The dose-response kinetics for genes H2A, H2B and H4 are first-order with two distinct rates; 10 to 15% of the genes for each of these histones appear to be much more sensitive to ultraviolet light inactivation than are the majority. It is concluded that the transcriptional units for 85 to 90% of the genes for H2A, H2B and H4 are similar. As determined by the inhibition of protein synthesis, the inactivation coefficients for the major component of each histone are: H1, 907 mm 2 /erg; H2A, 878 mm 2 /erg; H2B, 871 mm 2 /erg; H3, 965 mm 2 /erg; and H4, 792 mm 2 /erg. The sensitivities of histone mRNA synthesis to irradiation were measured by translation in vitro with similar results. The calculated target sizes for the genes (in base-pairs) are: H1, 1190; H2A, 1240; H2B, 1250; H3, 1130; and H4, 1380. This similarity in target sizes for all five of the histones genes indicates that they are primarily transcribed from individual transcriptional units. (author)
Directory of Open Access Journals (Sweden)
Samuel A Shelburne
2010-03-01
Full Text Available Transcriptional regulatory networks are fundamental to how microbes alter gene expression in response to environmental stimuli, thereby playing a critical role in bacterial pathogenesis. However, understanding how bacterial transcriptional regulatory networks function during host-pathogen interaction is limited. Recent studies in group A Streptococcus (GAS suggested that the transcriptional regulator catabolite control protein A (CcpA influences many of the same genes as the control of virulence (CovRS two-component gene regulatory system. To provide new information about the CcpA and CovRS networks, we compared the CcpA and CovR transcriptomes in a serotype M1 GAS strain. The transcript levels of several of the same genes encoding virulence factors and proteins involved in basic metabolic processes were affected in both DeltaccpA and DeltacovR isogenic mutant strains. Recombinant CcpA and CovR bound with high-affinity to the promoter regions of several co-regulated genes, including those encoding proteins involved in carbohydrate and amino acid metabolism. Compared to the wild-type parental strain, DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains were significantly less virulent in a mouse myositis model. Inactivation of CcpA and CovR alone and in combination led to significant alterations in the transcript levels of several key GAS virulence factor encoding genes during infection. Importantly, the transcript level alterations in the DeltaccpA and DeltacovRDeltaccpA isogenic mutant strains observed during infection were distinct from those occurring during growth in laboratory medium. These data provide new knowledge regarding the molecular mechanisms by which pathogenic bacteria respond to environmental signals to regulate virulence factor production and basic metabolic processes during infection.
Resistance-related gene transcription and antioxidant enzyme ...
African Journals Online (AJOL)
The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...
Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri.
Dhawan, Shikha; Kuhad, Ramesh Chander
2002-08-01
Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production.
Kroes, R A; Abravaya, K; Seidenfeld, J; Morimoto, R I
1991-01-01
Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or beta-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes. Images PMID:2052560
Glucocorticoid control of gene transcription in neural tissue
Morsink, Maarten Christian
2007-01-01
Glucocorticoid hormones exert modulatory effects on neural function in a delayed genomic fashion. The two receptor types that can bind glucocorticoids, the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR), are ligand-inducible transcription factors. Therefore, changes in gene
Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda
2017-06-26
The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis
Dissecting specific and global transcriptional regulation of bacterial gene expression
Gerosa, Luca; Kochanowski, Karl; Heinemann, Matthias; Sauer, Uwe
Gene expression is regulated by specific transcriptional circuits but also by the global expression machinery as a function of growth. Simultaneous specific and global regulation thus constitutes an additional-but often neglected-layer of complexity in gene expression. Here, we develop an
Polymerization of different lignins by laccase
Mattinen, M.L.; Suortti, T.; Gosselink, R.J.A.; Argyropoulos, D.S.; Evtuguin, D.; Suurnäkki, A.; Jong, de E.; Tamminen, T.
2008-01-01
In this study the oxidative polymerization of different lignins, i.e. Flax Soda lignin, Spruce EMAL, and Eucalyptus Dioxane lignin by Trametes hirsuta laccase was compared. Initially the structures of the different lignins were compared by Fourier transform infrared spectroscopy. The reactivity of
Insulin increases transcription of rat gene 33 through cis-acting elements in 5[prime]-flanking DNA
Energy Technology Data Exchange (ETDEWEB)
Cadilla, C.; Isham, K.R.; Lee, K.L.; Ch' ang, L.Y.; Kenney, F.T. (Oak Ridge National Lab., TN (United States)); Johnson, A.C. (National Cancer Institute, Bethesda, MD (United States). Lab. of Molecular Biology)
1992-01-01
Gene 33 is a multihormonally-regulated rat gene whose transcription is rapidly and markedly enhanced by insulin in liver and cultured hepatoma cells. To examine the mechanism by which insulin regulates transcription, the authors have constructed chimeric plasmids in which expression of the bacterial cat gene, encoding chloramphenicol acetyltransferase (CAT), is governed by gene 33 promoter elements and contiguous sequence in DNA flanking the transcription start point (tsp). When transfected into H4IIE hepatoma cells, these constructs gave rise to stably transformed cell lines producing the bacterial CAT enzyme. This expression was increased by insulin treatment in a fashion resembling the effect of this hormone on transcription of the native gene. In vitro transcription assays in nuclear extracts also revealed increased transcription of the chimeric plasmids when the extracts were prepared from insulin-treated rat hepatoma cells. The results demonstrate that induction by insulin is mediated by cis-acting nucleotide sequences located between bp [minus]480 to +27 relative to the tsp.
Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya
2014-05-01
Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Studies on Possible Activation of Microbial Laccase Production Using Gamma Irradiation
International Nuclear Information System (INIS)
ElKenawy, N.M.A.
2013-01-01
Enzyme production is an essential discipline in biotechnology. Laccase enzyme is an oxidoreductase that catalyzes the oxidation of various aromatic compounds, with the simultaneous reduction of oxygen into water. Although the enzyme is present in plants, insects and bacteria, the most important source is fungi and particularly the Basidiomycetes. In fungi, the enzyme plays a role in the removal of potentially toxic phenols arising during fungal morphogenesis, sporulation, phytopathogensis and virulence. In this work, the production of fungal laccase was optimized from a local isolate of Pleurotus ostreatus using solid state fermentation. Factorial design was used to study the effect of several nutrients and inducer on enzyme activity. Purification, characterization of the enzyme, the effect of temperature and ph were studied. The effect of gamma radiation on fungal growth and enzyme production was investigated. The optimization of the production conditions yielded an enzyme with activity over 32,054 IU/gram of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds and consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80 % reduction in color in case of methyl orange and trypan blue. The decolorisation of dyes is a simple method to assess the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications, which opens a door towards using of fungal laccase in further biotechnological processes.
DEFF Research Database (Denmark)
Munk, Line; Andersen, Mogens Larsen; Meyer, Anne S.
2017-01-01
Laccases (EC 1.10.3.2) catalyse removal of an electron and a proton from phenolic hydroxyl groups, including phenolic hydroxyls in lignins, to form phenoxy radicals during reduction of O2. We employed electron paramagnetic resonance spectroscopy (EPR) for real time measurement of such catalytic...... to suspensions of the individual lignin samples produced immediate time and enzyme dose dependent increases in intensity in the EPR signal with g-values in the range 2.0047–2.0050 allowing a direct quantitative monitoring of the radical formation and thus allowed laccase enzyme kinetics assessment on lignin...... for the radical formation rate in organosolv lignin was determined by response surface methodology to pH 4.8, 33 °C and pH 5.8, 33 °C for the Tv laccase and the Mt laccase, respectively. The results verify direct radical formation action of fungal laccases on lignin without addition of mediators and the EPR...
Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada
International Nuclear Information System (INIS)
Osipov, E. M.; Polyakov, K. M.; Tikhonova, T. V.; Kittl, R.; Dorovatovskii, P.V.; Shleev, S. V.; Popov, V. O.; Ludwig, R.
2015-01-01
The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu + -containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu + - and Cu 2+ -containing solutions. Copper ions were found to be incorporated into the active site only when Cu + was used. A comparative analysis of the native and depleted forms of the enzymes was performed
Oxidative polymerization of lignins by laccase in water-acetone mixture.
Fiţigău, Ionița Firuța; Peter, Francisc; Boeriu, Carmen Gabriela
2013-01-01
The enzymatic oxidative polymerization of five technical lignins with different molecular properties, i.e. Soda Grass/Wheat straw Lignin, Organosolv Hardwood Lignin, Soda Wheat straw Lignin, Alkali pretreated Wheat straw Lignin, and Kraft Softwood was studied. All lignins were previously fractionated by acetone/water 50:50 (v/v) and the laccase-catalyzed polymerization of the low molecular weight fractions (Mw Reactivity of lignin substrates in laccase-catalyzed reactions was determined by monitoring the oxygen consumption. The oxidation reactions in 50% acetone in water mixture proceed with high rate for all tested lignins. Polymerization products were analyzed by size exclusion chromatography, FT-IR, and (31)P-NMR and evidence of important lignin modifications after incubation with laccase. Lignin polymers with higher molecular weight (Mw up to 17500 g/mol) were obtained. The obtained polymers have potential for applications in bioplastics, adhesives and as polymeric dispersants.
Directory of Open Access Journals (Sweden)
Niggli Felix K
2006-06-01
Full Text Available Abstract Background The Epstein-Barr virus (EBV is associated with lymphoid malignancies, including Burkitt's lymphoma (BL, and can transform human B cells in vitro. EBV-harboring cell lines are widely used to investigate lymphocyte transformation and oncogenesis. Qualitative EBV gene expression has been extensively described, but knowledge of quantitative transcription is lacking. We hypothesized that transcription levels of EBNA1, the gene essential for EBV persistence within an infected cell, are similar in BL cell lines. Results To compare quantitative gene transcription in the BL cell lines Namalwa, Raji, Akata, Jijoye, and P3HR1, we developed an oligonucleotide microarray chip, including 17 housekeeping genes, six latent EBV genes (EBNA1, EBNA2, EBNA3A, EBNA3C, LMP1, LMP2, and four lytic EBV genes (BZLF1, BXLF2, BKRF2, BZLF2, and used the cell line B95.8 as a reference for EBV gene transcription. Quantitative polymerase chain reaction assays were used to validate microarray results. We found that transcription levels of housekeeping genes differed considerably among BL cell lines. Using a selection of housekeeping genes with similar quantitative transcription in the tested cell lines to normalize EBV gene transcription data, we showed that transcription levels of EBNA1 were quite similar in very different BL cell lines, in contrast to transcription levels of other EBV genes. As demonstrated with Akata cells, the chip allowed us to accurately measure EBV gene transcription changes triggered by treatment interventions. Conclusion Our results suggest uniform EBNA1 transcription levels in BL and that microarray profiling can reveal novel insights on quantitative EBV gene transcription and its impact on lymphocyte biology.
Integrating gene transcription-based biomarkers to understand desert tortoise and ecosystem health
Bowen, Lizabeth; Miles, A. Keith; Drake, Karla K.; Waters, Shannon C.; Esque, Todd C.; Nussear, Kenneth E.
2015-01-01
Tortoises are susceptible to a wide variety of environmental stressors, and the influence of human disturbances on health and survival of tortoises is difficult to detect. As an addition to current diagnostic methods for desert tortoises, we have developed the first leukocyte gene transcription biomarker panel for the desert tortoise (Gopherus agassizii), enhancing the ability to identify specific environmental conditions potentially linked to declining animal health. Blood leukocyte transcript profiles have the potential to identify physiologically stressed animals in lieu of clinical signs. For desert tortoises, the gene transcript profile included a combination of immune or detoxification response genes with the potential to be modified by biological or physical injury and consequently provide information on the type and magnitude of stressors present in the animal’s habitat. Blood from 64 wild adult tortoises at three sites in Clark County, NV, and San Bernardino, CA, and from 19 captive tortoises in Clark County, NV, was collected and evaluated for genes indicative of physiological status. Statistical analysis using a priori groupings indicated significant differences among groups for several genes, while multidimensional scaling and cluster analyses of transcriptionC T values indicated strong differentiation of a large cluster and multiple outlying individual tortoises or small clusters in multidimensional space. These analyses highlight the effectiveness of the gene panel at detecting environmental perturbations as well as providing guidance in determining the health of the desert tortoise.
Vastano, Valeria; Perrone, Filomena; Marasco, Rosangela; Sacco, Margherita; Muscariello, Lidia
2016-04-01
Exopolysaccharides (EPS) from lactic acid bacteria contribute to specific rheology and texture of fermented milk products and find applications also in non-dairy foods and in therapeutics. Recently, four clusters of genes (cps) associated with surface polysaccharide production have been identified in Lactobacillus plantarum WCFS1, a probiotic and food-associated lactobacillus. These clusters are involved in cell surface architecture and probably in release and/or exposure of immunomodulating bacterial molecules. Here we show a transcriptional analysis of these clusters. Indeed, RT-PCR experiments revealed that the cps loci are organized in five operons. Moreover, by reverse transcription-qPCR analysis performed on L. plantarum WCFS1 (wild type) and WCFS1-2 (ΔccpA), we demonstrated that expression of three cps clusters is under the control of the global regulator CcpA. These results, together with the identification of putative CcpA target sequences (catabolite responsive element CRE) in the regulatory region of four out of five transcriptional units, strongly suggest for the first time a role of the master regulator CcpA in EPS gene transcription among lactobacilli.
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Evolved α-factor prepro-leaders for directed laccase evolution in Saccharomyces cerevisiae.
Mateljak, Ivan; Tron, Thierry; Alcalde, Miguel
2017-11-01
Although the functional expression of fungal laccases in Saccharomyces cerevisiae has proven to be complicated, the replacement of signal peptides appears to be a suitable approach to enhance secretion in directed evolution experiments. In this study, twelve constructs were prepared by fusing native and evolved α-factor prepro-leaders from S. cerevisiae to four different laccases with low-, medium- and high-redox potential (PM1L from basidiomycete PM1; PcL from Pycnoporus cinnabarinus; TspC30L from Trametes sp. strain C30; and MtL from Myceliophthora thermophila). Microcultures of the prepro-leader:laccase fusions were grown in selective expression medium that used galactose as both the sole carbon source and as the inducer of expression so that the secretion and activity were assessed with low- and high-redox potential mediators in a high-throughput screening context. With total activity improvements as high as sevenfold over those obtained with the native α-factor prepro-leader, the evolved prepro-leader from PcL (α PcL ) most strongly enhanced secretion of the high- and medium-redox potential laccases PcL, PM1L and TspC30L in the microtiter format with an expression pattern driven by prepro-leaders in the order α PcL > α PM 1L ~ α native . By contrast, the pattern of the low-redox potential MtL was α native > α PcL > α PM 1L . When produced in flask with rich medium, the evolved prepro-leaders outperformed the α native signal peptide irrespective of the laccase attached, enhancing secretion over 50-fold. Together, these results highlight the importance of using evolved α-factor prepro-leaders for functional expression of fungal laccases in directed evolution campaigns. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Jha H.
2013-12-01
Full Text Available Aims: Laccase, a copper-containing enzyme, oxidizes variety of aromatic compounds. Since laccase is essential for lignin degradation, it can be used for lignin removal in the pulp and paper industry (biopulping. Laccase is also employed as a dechlorinating agent (biobleaching, along with the removal of phenolic and other aromatic pollutants. In the present investigation it was aimed to employ the laccase produced by the bacterium Klebsiella aerogenes along with the bacterium itself in biopulping of sugarcane bagasse and biobleaching of kraft liquor effluent. Methodology and results: A laccase was isolated from the bacterium K. aerogenes, purified to homogeneity and characterized. The enzyme was purified by conventional techniques following salt precipitation, ion exchange chromatography, and affinity chromatography on Con A sepharose. The purified laccase was found to be monomeric glycoprotein with a Mr of 64 kDa when measured by Sephadex G-200 gel chromatography and SDS-PAGE. The Vmax and Km of laccase towards the substrate guaiacol was determined. The optimum pH of the laccase was found to be 5.0. biopulping and biobleaching activities were determined by TAPPI standard methods. Treatment of sugarcane baggase by K. aerogenes also significantly reduced lignin content of the bagasse. Conclusion, significance and impact of study: The bacterium K. aerogenes and a laccase produced by it were used separately for biopulping of sugarcane bagasse and biobleaching of kraft liquor effluent. Treatment with both brought significant reduction in lignin content and kappa number of the pulp. The handsheets prepared from the treated pulp showed improved brightness without affecting the strength properties of paper. The bacterium and the laccase efficiently decolorized the kraft liquor proving to have biobleaching potential.
Stochastic model for gene transcription on Drosophila melanogaster embryos
Prata, Guilherme N.; Hornos, José Eduardo M.; Ramos, Alexandre F.
2016-02-01
We examine immunostaining experimental data for the formation of stripe 2 of even-skipped (eve) transcripts on D. melanogaster embryos. An estimate of the factor converting immunofluorescence intensity units into molecular numbers is given. The analysis of the eve dynamics at the region of stripe 2 suggests that the promoter site of the gene has two distinct regimes: an earlier phase when it is predominantly activated until a critical time when it becomes mainly repressed. That suggests proposing a stochastic binary model for gene transcription on D. melanogaster embryos. Our model has two random variables: the transcripts number and the state of the source of mRNAs given as active or repressed. We are able to reproduce available experimental data for the average number of transcripts. An analysis of the random fluctuations on the number of eves and their consequences on the spatial precision of stripe 2 is presented. We show that the position of the anterior or posterior borders fluctuate around their average position by ˜1 % of the embryo length, which is similar to what is found experimentally. The fitting of data by such a simple model suggests that it can be useful to understand the functions of randomness during developmental processes.
A high effective NADH-ferricyanide dehydrogenase coupled with laccase for NAD(+) regeneration.
Wang, Jizhong; Yang, Chengli; Chen, Xing; Bao, Bingxin; Zhang, Xuan; Li, Dali; Du, Xingfan; Shi, Ruofu; Yang, Junfang; Zhu, Ronghui
2016-08-01
To find an efficient and cheap system for NAD(+) regeneration A NADH-ferricyanide dehydrogenase was obtained from an isolate of Escherichia coli. Optimal activity of the NADH dehydrogenase was at 45 °C and pH 7.5, with a K m value for NADH of 10 μM. By combining the NADH dehydrogenase, potassium ferricyanide and laccase, a bi-enzyme system for NAD(+) regeneration was established. The system is attractive in that the O2 consumed by laccase is from air and the sole byproduct of the reaction is water. During the reaction process, 10 mM NAD(+) was transformed from NADH in less than 2 h under the condition of 0.5 U NADH dehydrogenase, 0.5 U laccase, 0.1 mM potassium ferricyanide at pH 5.6, 30 °C CONCLUSION: The bi-enzyme system employed the NADH-ferricyanide dehydrogenase and laccase as catalysts, and potassium ferricyanide as redox mediator, is a promising alternative for NAD(+) regeneration.
DEFF Research Database (Denmark)
Eckert-Boulet, Nadine; Regenberg, Birgitte; Nielsen, Jens
2005-01-01
and a grr1 Delta strain and adding citrulline in the exponential phase. Whole-genome transcription analyses were performed on samples from each cultivation, both immediately before and 30 min after citrulline addition. Transcriptional induction of the AAP genes AGP1, BAP2, BAP3, DIP5, GNP1 and TAT1 is fully...
Czech Academy of Sciences Publication Activity Database
Antošová, Zuzana; Herkommerová, Klára; Pichová, I.; Sychrová, Hana
2018-01-01
Roč. 34, č. 1 (2018), s. 69-80 ISSN 8756-7938 R&D Projects: GA TA ČR(CZ) TA01011461 Institutional support: RVO:67985823 Keywords : laccase * decolorization * gene expression * expression optimization * Saccharomyces cerevisiae Subject RIV: EI - Biotechnology ; Bionics OBOR OECD: Industrial biotechnology Impact factor: 1.986, year: 2016
Modeling of growth and laccase production by Pycnoporus sanguineus.
Saat, Muhammad Naziz; Annuar, Mohamad Suffian Mohamad; Alias, Zazali; Chuan, Ling Tau; Chisti, Yusuf
2014-05-01
Production of extracellular laccase by the white-rot fungus Pycnoporus sanguineus was examined in batch submerged cultures in shake flasks, baffled shake flasks and a stirred tank bioreactor. The biomass growth in the various culture systems closely followed a logistic growth model. The production of laccase followed a Luedeking-Piret model. A modified Luedeking-Piret model incorporating logistic growth effectively described the consumption of glucose. Biomass productivity, enzyme productivity and substrate consumption were enhanced in baffled shake flasks relative to the cases for the conventional shake flasks. This was associated with improved oxygen transfer in the presence of the baffles. The best results were obtained in the stirred tank bioreactor. At 28 °C, pH 4.5, an agitation speed of 600 rpm and a dissolved oxygen concentration of ~25 % of air saturation, the laccase productivity in the bioreactor exceeded 19 U L(-1 )days(-1), or 1.5-fold better than the best case for the baffled shake flask. The final concentration of the enzyme was about 325 U L(-1).
Bio-coloration of bacterial cellulose assisted by immobilized laccase.
Song, Ji Eun; Su, Jing; Noro, Jennifer; Cavaco-Paulo, Artur; Silva, Carla; Kim, Hye Rim
2018-02-13
In this work a process for the bio-coloration of bacterial cellulose (BC) membranes was developed. Laccase from Myceliophthora thermophila was immobilized onto BC membranes and retained up to 88% of residual activity after immobilization. Four compounds belonging to the flavonoids family were chosen to test the in situ polymerase activity of immobilized laccase. All the flavonoids were successfully polymerized by laccase giving rise to yellow, orange and dark brown oligomers which conferred color to the BC support. The optimal bio-coloration conditions were studied for two of the tested flavonoids, catechol and catechin, by varying the concentration and time of incubation. High color depth and resistance to washing were obtained for both compounds. The highly porous bacterial cellulose material demonstrated great performance as a bio-coloration support, in contrast to other materials cited in literature, like cotton or wool. The process developed is presented as an environmentally friendly alternative for bacterial cellulose bio-coloration and will contribute deeply for the development of new fashionable products within this material.
Plasticity of laccase generated by homeologous recombination in yeast.
Cusano, Angela M; Mekmouche, Yasmina; Meglecz, Emese; Tron, Thierry
2009-10-01
Laccase-encoding sequences sharing 65-71% identity were shuffledin vivo by homeologous recombination. Yeast efficiently repaired linearized plasmids containing clac1, clac2 or clac5 Trametes sp. C30 cDNAs using a clac3 PCR fragment. From transformants secreting active variants, three chimeric laccases (LAC131, LAC232 and LAC535), each resulting from double crossovers, were purified, and their apparent kinetic parameters were determined using 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) and syringaldazine (SGZ) as substrates. At acidic pH, the apparent kinetic parameters of the chimera were not distinguishable from each other or from those obtained for the LAC3 enzyme used as reference. On the other hand, the pH tolerance of the variants was visibly extended towards alkaline pH values. Compared to the parental LAC3, a 31-fold increase in apparent k(cat) was observed for LAC131 at pH 8. This factor is one of the highest ever observed for laccase in a single mutagenesis step.
Directory of Open Access Journals (Sweden)
Olson Matthew S
2010-01-01
Full Text Available Abstract Background Although rapid changes in copy number and gene order are common within plant mitochondrial genomes, associated patterns of gene transcription are underinvestigated. Previous studies have shown that the gynodioecious plant species Silene vulgaris exhibits high mitochondrial diversity and occasional paternal inheritance of mitochondrial markers. Here we address whether variation in DNA molecular markers is correlated with variation in transcription of mitochondrial genes in S. vulgaris collected from natural populations. Results We analyzed RFLP variation in two mitochondrial genes, cox1 and atp1, in offspring of ten plants from a natural population of S. vulgaris in Central Europe. We also investigated transcription profiles of the atp1 and cox1 genes. Most DNA haplotypes and transcription profiles were maternally inherited; for these, transcription profiles were associated with specific mitochondrial DNA haplotypes. One individual exhibited a pattern consistent with paternal inheritance of mitochondrial DNA; this individual exhibited a transcription profile suggestive of paternal but inconsistent with maternal inheritance. We found no associations between gender and transcript profiles. Conclusions Specific transcription profiles of mitochondrial genes were associated with specific mitochondrial DNA haplotypes in a natural population of a gynodioecious species S. vulgaris. Our findings suggest the potential for a causal association between rearrangements in the plant mt genome and transcription product variation.
Directory of Open Access Journals (Sweden)
Hua-Bing Li
2013-04-01
Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.
Directory of Open Access Journals (Sweden)
Hendro Risdianto
2012-07-01
Full Text Available Laccase has been produced in a solid state fermentation (SSF using white rot fungi and various lignocellulosic based substrates. White rot fungi used were Marasmius sp, Trametes hirsuta, Trametes versicolor and Phanerochaete crysosporium. The solid substrates employed in this research were collected from agriculture waste which were empty fruit bunches (EFB, rice straw, corn cob, and rice husk. The objective of this research was to determine the most promising fungus, the best solid substrate and the optimal conditions for the production of laccase. The results showed that Marasmius sp. on all solid substrates displayed higher laccase activity than that of any other strain of white rot fungi. Marasmius sp. and solid substrate of rice straw demonstrated the highest laccase activity of 1116.11 U/L on day 10. Three significant factors, i.e. pH, temperature and yeast extract concentration were studied by response surface method on laccase production using Marasmius sp and rice straw. The optimized conditions were pH, temperature and yeast extract concentration of 4.9, 31ºC and 0.36 g/L respectively. The fermentation of Marasmius sp. in SSF on agricultural waste shows a great potential for the production of laccase.
Stabilized Laccases as Heterogeneous Bioelectrocatalysts (Postprint)
2012-10-01
Reference Rhus vernificera catechin (anticancer flavonoid ) • covalent binding (amide chemistry) to Au Nps in dendrimers [82] Rigidoporus lignosis phenolic...proper· tiesP· 391 An interesting extension to the application of laccases in biosensors is the medically relevant detection of catechins and flavonoids
Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls.
Fassah, Dilla Mareistia; Jeong, Jin Young; Baik, Myunggi
2018-04-01
This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Castration increased the mRNA (3.6 fold; pcastration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; pCastration increased mRNA levels of glycerol kinase (2.7 fold; pCastration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial) (3.5 fold; pCastration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition.
Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms
Directory of Open Access Journals (Sweden)
Mueller Nancy
2005-10-01
Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.
Copper and dyes enhance laccase production in gamma-proteobacterium JB.
Malhotra, Kanam; Sharma, Prince; Capalash, Neena
2004-07-01
Laccase production in gamma-proteobacterium JB was enhanced 13-fold by adding 0.1 mM CuSO(4) 24 h after the onset of growth. Ethidium bromide (2.5 microM), Malachite Green, Phenol Red and Thymol Blue (10 microM each) enhanced laccase production 17-, 19-, 4- and 2-fold, respectively. Among the fourteen aromatic/organic compounds tried, p-aminobenzoic acid and an industrial effluent, from where the organism was isolated, showed 1.2- and 1.26-fold increases in production.
Innate immune responses: Crosstalk of signaling and regulation of gene transcription
International Nuclear Information System (INIS)
Zhong Bo; Tien Po; Shu Hongbing
2006-01-01
Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes
Wang, Yonglin; Hu, Xiaoping; Fang, Yulin; Anchieta, Amy; Goldman, Polly H; Hernandez, Gustavo; Klosterman, Steven J
2018-04-01
Verticillium dahliae is a soilborne fungus that causes vascular wilt diseases on numerous plant species worldwide. The production of darkly melanized microsclerotia is crucial in the disease cycle of V. dahliae, as these structures allow for long-term survival in soil. Previously, transcriptomic and genomic analysis identified a cluster of genes in V. dahliae that encodes some dihydroxynaphthalene (DHN) melanin biosynthetic pathway homologues found in related fungi. In this study, we explored the roles of cluster-specific transcription factor VdCmr1, as well as two other genes within the cluster encoding a polyketide synthase (VdPKS1) and a laccase (VdLac1), enzymes at initial and endpoint steps in DHN melanin production. The results revealed that VdCmr1 and VdPKS1 are required for melanin production, but neither is required for microsclerotia production. None of the three genes were required for pathogenesis on tobacco and lettuce. Exposure of ΔVdCmr1 and wild-type strains to UV irradiation, or to high temperature (40 °C), revealed an approx. 50 % reduction of survival in the ΔVdCmr1 strain, relative to the wild-type strain, in response to either condition. Expression profiles revealed that expression of some melanin biosynthetic genes are in part dependent on VdCmr1. Combined data indicate VdCmr1 is a key regulator of melanin biosynthesis, and that via regulation of melanogenesis, VdCmr1 affects survival of V. dahliae in response to abiotic threats. We conclude with a model showing regulation of VdCmr1 by a high osmolarity glycerol response (Hog)-type MAP kinase pathway.
Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy
International Nuclear Information System (INIS)
Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.
1986-01-01
The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA
Predictive modelling of gene expression from transcriptional regulatory elements.
Budden, David M; Hurley, Daniel G; Crampin, Edmund J
2015-07-01
Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
The "fourth dimension" of gene transcription.
O'Malley, Bert W
2009-05-01
The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators.
Directory of Open Access Journals (Sweden)
Olga A. Glazunova
2018-04-01
Full Text Available Laccases are copper-containing oxidases that catalyze a one-electron abstraction from various phenolic and non-phenolic compounds with concomitant reduction of molecular oxygen to water. It is well-known that laccases from various sources have different substrate specificities, but it is not completely clear what exactly provides these differences. The purpose of this work was to study the features of the substrate specificity of four laccases from basidiomycete fungi Trametes hirsuta, Coriolopsis caperata, Antrodiella faginea, and Steccherinum murashkinskyi, which have different redox potentials of the T1 copper center and a different structure of substrate-binding pockets. Enzyme activity toward 20 monophenolic substances and 4 phenolic dyes was measured spectrophotometrically. The kinetic parameters of oxidation of four lignans and lignan-like substrates were determined by monitoring of the oxygen consumption. For the oxidation of the high redox potential (>700 mV monophenolic substrates and almost all large substrates, such as phenolic dyes and lignans, the redox potential difference between the enzyme and the substrate (ΔE played the defining role. For the low redox potential monophenolic substrates, ΔE did not directly influence the laccase activity. Also, in the special cases, the structure of the large substrates, such as dyes and lignans, as well as some structural features of the laccases (flexibility of the substrate-binding pocket loops and some amino acid residues in the key positions affected the resulting catalytic efficiency.
Directory of Open Access Journals (Sweden)
Mengjuan Zhu
2016-03-01
Full Text Available A strain LN07 with high laccase yield was identified as basidiomycete fungus Lepista nuda from which a white laccase without type I copper was purified and characterized. The laccase was a monomeric protein with a molecular mass of 56 kDa. Its N-terminal amino acid sequence was AIGPAADLHIVNKDISPDGF. Besides, eight inner peptide sequences were determined and lac4, lac5 and lac6 sequences were in the Cu2+ combination and conservation zones of laccases. HIV-1 reverse transcriptase was inhibited by the laccase with a half-inhibitory concentration of 0.65 μM. Cu2+ ions (1.5 mM enhanced the laccase production and the optimal pH and temperature of the laccase were pH 3.0 and 50 °C, respectively. The Km and Vmax of the laccase using ABTS as substrate were respectively 0.19 mM and 195 μM. Several dyes including laboratory dyes and textile dyes used in this study, such as Methyl red, Coomassie brilliant blue, Reactive brilliant blue and so on, were decolorized in different degrees by the purified laccase. By LC-MS analysis, Methyl red was structurally degraded by the laccase. Moreover, the laccase affected the absorbance at the maximum wavelength of many pesticides. Thus, the white laccase had potential commercial value for textile finishing and wastewater treatment.
Directory of Open Access Journals (Sweden)
Xueping Song
2016-07-01
Full Text Available This paper presents a kinetic model of the laccase-aided chlorine dioxide bleaching of bagasse pulp. The kinetic model was based on the rate of reduction of adsorbed organic halogen (AOX. The effects of the laccase enzyme dosage, the mediator 1-hydroxybenzotriazole (HBT dosage, and the reaction temperature on the AOX content of the bleaching effluent are discussed. Good fits were obtained for the experimental data obtained from the different laccase enzyme dosages, HBT dosages, and reaction temperatures, indicating the feasibility of the kinetic model as a means of predicting the optimal operation conditions for the laccase-aided chlorine dioxide bleaching of bagasse pulp in the future.
Sonochemical and hydrodynamic cavitation reactors for laccase/hydrogen peroxide cotton bleaching.
Gonçalves, Idalina; Martins, Madalena; Loureiro, Ana; Gomes, Andreia; Cavaco-Paulo, Artur; Silva, Carla
2014-03-01
The main goal of this work is to develop a novel and environmental-friendly technology for cotton bleaching with reduced processing costs. This work exploits a combined laccase-hydrogen peroxide process assisted by ultrasound. For this purpose, specific reactors were studied, namely ultrasonic power generator type K8 (850 kHz) and ultrasonic bath equipment Ultrasonic cleaner USC600TH (45 kHz). The optimal operating conditions for bleaching were chosen considering the highest levels of hydroxyl radical production and the lowest energy input. The capacity to produce hydroxyl radicals by hydrodynamic cavitation was also assessed in two homogenizers, EmulsiFlex®-C3 and APV-2000. Laccase nanoemulsions were produced by high pressure homogenization using BSA (bovine serum albumin) as emulsifier. The bleaching efficiency of these formulations was tested and the results showed higher whiteness values when compared to free laccase. The combination of laccase-hydrogen peroxide process with ultrasound energy produced higher whiteness levels than those obtained by conventional methods. The amount of hydrogen peroxide was reduced 50% as well as the energy consumption in terms of temperature (reduction of 40 °C) and operating time (reduction of 90 min). Copyright © 2013 Elsevier Inc. All rights reserved.
Advanced Glycation End-Products affect transcription factors regulating insulin gene expression
International Nuclear Information System (INIS)
Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.
2010-01-01
Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.
Regulating expressin of cell and tissue-specific genes by modifying transcription
Energy Technology Data Exchange (ETDEWEB)
Beachy, Roger N. [Donald Danforth Plant Science Center, St. Louis, MO (United States); Dai, Shunhong [Donald Danforth Plant Science Center, St. Louis, MO (United States)
2009-12-15
Transcriptional regulation is the primary step to control gene expression, therefore function. Such regulation is achieved primarily via a combination of the activities of the promoter cis regulatory DNA elements and trans regulatory proteins that function through binding to these DNA elements. Our research supported by this program has led to the identification of rice bZIP transcription factors RF2a, RF2b and RLP1 that play key roles in regulating the activity of a vascular tissue specific promoter isolated from Rice Tungro Bacilliform Virus (RTBV) through their interactions with the Box II essential cis element located in the promoter. RF2a, RF2b and RLP1 possess multiple regulatory domains. Functional characterization reveals that those domains can activate or repress the activity of the RTBV promoter. Studies of transcriptional regulation of the RTBV promoter by this group of bZIP proteins not only provide insights about gene expression in the vascular tissue, but also insights about general mechanisms of transcription activation and repression. The knowledge gained from this research will also enable us to develop a well-described set of tools that can be used to control expression of multiple genes in transgenic plants and to improve biofuel feedstock.
Mechanical control of cyclic AMP signalling and gene transcription through integrins
Meyer, C. J.; Alenghat, F. J.; Rim, P.; Fong, J. H.; Fabry, B.; Ingber, D. E.
2000-01-01
This study was carried out to discriminate between two alternative hypotheses as to how cells sense mechanical forces and transduce them into changes in gene transcription. Do cells sense mechanical signals through generalized membrane distortion or through specific transmembrane receptors, such as integrins? Here we show that mechanical stresses applied to the cell surface alter the cyclic AMP signalling cascade and downstream gene transcription by modulating local release of signals generated by activated integrin receptors in a G-protein-dependent manner, whereas distortion of integrins in the absence of receptor occupancy has no effect.
Thongkum, Monthathip; Burns, Parichart; Bhunchoth, Anjana; Warin, Nuchnard; Chatchawankanphanich, Orawan; van Doorn, Wouter G
2015-03-15
We studied the expression of a gene encoding an ethylene receptor, called Ethylene Response Sensor 1 (Den-ERS1), in the petals of Dendrobium orchid flowers. Transcripts accumulated during the young floral bud stage and declined by the time the flowers had been open for several days. Pollination or exposure to exogenous ethylene resulted in earlier flower senescence, an increase in ethylene production and a lower Den-ERS1 transcript abundance. Treatment with 1-methylcyclopropene (1-MCP), an inhibitor of the ethylene receptor, decreased ethylene production and resulted in high transcript abundance. The literature indicates two kinds of ethylene receptor genes with regard to the effects of ethylene. One group shows ethylene-induced down-regulated transcription, while the other has ethylene-induced up-regulation. The present gene is an example of the first group. The 5' flanking region showed binding sites for Myb and myb-like, homeodomain, MADS domain, NAC, TCP, bHLH and EIN3-like transcription factors. The binding site for the EIN3-like factor might explain the ethylene effect on transcription. A few other transcription factors (RAV1 and NAC) seem also related to ethylene effects. Copyright © 2015 Elsevier GmbH. All rights reserved.
Stability mechanisms of a thermophilic laccase probed by molecular dynamics
DEFF Research Database (Denmark)
Christensen, Niels Johan; Kepp, Kasper Planeta
2013-01-01
Laccases are highly stable, industrially important enzymes capable of oxidizing a large range of substrates. Causes for their stability are, as for other proteins, poorly understood. In this work, multiple-seed molecular dynamics (MD) was applied to a Trametes versicolor laccase in response...... integrity by increasing persistent backbone hydrogen bonds by ∼4 across simulations, mainly via prevention of F(-) intrusion. Hydrogen-bond loss in distinct loop regions and ends of critical β-sheets suggest potential strategies for laboratory optimization of these industrially important enzymes....
Abou-Okeil, A; El-Shafie, A; El Zawahry, M M
2010-02-01
This study evaluates the bleaching efficiency of enzymatically scoured linen fabrics using a combined laccase-hydrogen peroxide bleaching process with and without ultrasonic energy, with the goal of obtaining fabrics with high whiteness levels, well preserved tensile strength and higher dye uptake. The effect of the laccase enzyme and the combined laccase-hydrogen peroxide bleaching process with and without ultrasound has been investigated with regard to whiteness value, tensile strength, dyeing efficiency and dyeing kinetics using both reactive and cationic dyes. The bleached linen fabrics were characterized using X-ray diffraction and by measuring tensile strength and lightness. The dyeing efficiency and kinetics were characterized by measuring dye uptake and colour fastness. The results indicated that ultrasound was an effective technique in the combined laccase-hydrogen peroxide bleaching process of linen fabrics. The whiteness values expressed as lightness of linen fabrics is enhanced by using ultrasonic energy. The measured colour strength values were found to be slightly better for combined laccase-hydrogen peroxide/ultrasound-assisted bleached fabrics than for combined laccase-hydrogen peroxide for both reactive and cationic dyes. The fastness properties of the fabrics dyed with reactive dye were better than those obtained when using cationic dye. The time/dye uptake isotherms were also enhanced when using combined laccase-hydrogen peroxide/ultrasound-assisted bleached fabric, which confirms the efficiency of ultrasound in the combined oxidative bleaching process. The dyeing rate constant, half-time of dyeing and dyeing efficiency have been calculated and discussed.
Mayolo-Deloisa, Karla; González-González, Mirna; Simental-Martínez, Jesús; Rito-Palomares, Marco
2015-03-01
Laccase is a multicopper oxidase that catalyzes the oxidation of phenolic compounds. Laccase can be used in bioremediation, beverage (wine, fruit juice, and beer) processing, ascorbic acid determination, sugar beet pectin gelation baking, and as a biosensor. Recently, the antiproliferative activity of laccase toward tumor cells has been reported. Because of the potential applications of this enzyme, the efforts for enhancing and stabilizing its activity have increased. Thus, the PEGylation of laccase can be an alternative. PEGylation is the covalent attachment of one or more molecules of methoxy poly(ethylene glycol) (mPEG) to a protein. Normally, during the PEGylation reaction, the activity is reduced but the stability increases; thus, it is important to minimize the loss of activity. In this work, the effects of molar ratio (1:4, 1:8, and 1:12), concentration of laccase (6 and 12 mg/ml), reaction time (4 and 17 h), molecular weight, and type of mPEG (20, 30, 40 kDa and 40 kDa-branched) were analyzed. The activity was measured using three substrates: ABTS, 2,6-dimethoxyphenol, and syringaldazine. The best conditions for laccase PEGylation were 12 mg/ml of laccase, molar ratio 1:4, and 4 h reaction time. Under these conditions, the enzyme was able to maintain nearly 100% of its enzymatic activity with ABTS. The PEGylation of laccase has not been extensively explored, so it is important to analyze the effects of this bioconjugation in route to produce a robust modified enzyme. Copyright © 2015 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
2013-01-01
, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the "electron transport chain" and neuronal differentiation, emphasizing that "tissue important" genes are regulated at several...
An excited state underlies gene regulation of a transcriptional riboswitch
Zhao, Bo; Guffy, Sharon L.; Williams, Benfeard; Zhang, Qi
2017-01-01
Riboswitches control gene expression through ligand-dependent structural rearrangements of the sensing aptamer domain. However, we found that the Bacillus cereus fluoride riboswitch aptamer adopts identical tertiary structures in solution with and without ligand. Using chemical exchange saturation transfer (CEST) NMR spectroscopy, we revealed that the structured ligand-free aptamer transiently accesses a low-populated (~1%) and short-lived (~3 ms) excited conformational state that unravels a conserved ‘linchpin’ base pair to signal transcription termination. Upon fluoride binding, this highly localized fleeting process is allosterically suppressed to activate transcription. We demonstrated that this mechanism confers effective fluoride-dependent gene activation over a wide range of transcription rates, which is essential for robust toxicity response across diverse cellular conditions. These results unveil a novel switching mechanism that employs ligand-dependent suppression of an aptamer excited state to coordinate regulatory conformational transitions rather than adopting distinct aptamer ground-state tertiary architectures, exemplifying a new mode of ligand-dependent RNA regulation. PMID:28719589
Directory of Open Access Journals (Sweden)
Paolo Kunderfranco
2010-05-01
Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.
Sood, Varun; Cajigas, Ivelisse; D'Urso, Agustina; Light, William H; Brickner, Jason H
2017-08-01
Previously expressed inducible genes can remain poised for faster reactivation for multiple cell divisions, a conserved phenomenon called epigenetic transcriptional memory. The GAL genes in Saccharomyces cerevisiae show faster reactivation for up to seven generations after being repressed. During memory, previously produced Gal1 protein enhances the rate of reactivation of GAL1 , GAL10 , GAL2 , and GAL7 These genes also interact with the nuclear pore complex (NPC) and localize to the nuclear periphery both when active and during memory. Peripheral localization of GAL1 during memory requires the Gal1 protein, a memory-specific cis -acting element in the promoter, and the NPC protein Nup100 However, unlike other examples of transcriptional memory, the interaction with NPC is not required for faster GAL gene reactivation. Rather, downstream of Gal1, the Tup1 transcription factor and growth in glucose promote GAL transcriptional memory. Cells only show signs of memory and only benefit from memory when growing in glucose. Tup1 promotes memory-specific chromatin changes at the GAL1 promoter: incorporation of histone variant H2A.Z and dimethylation of histone H3, lysine 4. Tup1 and H2A.Z function downstream of Gal1 to promote binding of a preinitiation form of RNA Polymerase II at the GAL1 promoter, poising the gene for faster reactivation. This mechanism allows cells to integrate a previous experience (growth in galactose, reflected by Gal1 levels) with current conditions (growth in glucose, potentially through Tup1 function) to overcome repression and to poise critical GAL genes for future reactivation. Copyright © 2017 by the Genetics Society of America.
Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio
2014-11-07
Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and
Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte
Energy Technology Data Exchange (ETDEWEB)
Zeng, Yanli [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Li, Hui [The Central Hospital of Wuhan, Tongji Medical College Huazhong University of Science Technology, Wuhan, 430000 (China); Zhang, Xiaoju [Department of Respiratory Medicine, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Shang, Jia [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China); Kang, Yi, E-mail: kykangyi@163.com [Department of Infectious Diseases, Zhengzhou University People' s Hospital (Henan Provincial People' s Hospital), Zhengzhou, 450003 (China)
2016-01-29
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.
Basal transcription of APOBEC3G is regulated by USF1 gene in hepatocyte
International Nuclear Information System (INIS)
Zeng, Yanli; Li, Hui; Zhang, Xiaoju; Shang, Jia; Kang, Yi
2016-01-01
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptional start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.
Directory of Open Access Journals (Sweden)
Kristel Kaer
Full Text Available Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown.Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3' ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals.Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
NFIA co-localizes with PPARγ and transcriptionally controls the brown fat gene program
DEFF Research Database (Denmark)
Hiraike, Yuta; Waki, Hironori; Yu, Jing
2017-01-01
. NFIA and the master transcriptional regulator of adipogenesis, PPARγ, co-localize at the brown-fat-specific enhancers. Moreover, the binding of NFIA precedes and facilitates the binding of PPARγ, leading to increased chromatin accessibility and active transcription. Introduction of NFIA into myoblasts...... results in brown adipocyte differentiation. Conversely, the brown fat of NFIA-knockout mice displays impaired expression of the brown-fat-specific genes and reciprocal elevation of muscle genes. Finally, expression of NFIA and the brown-fat-specific genes is positively correlated in human brown fat...
DEFF Research Database (Denmark)
2014-01-01
for the hydrolysis of biomass using a laccase derived from Ganoderma lucidum. Further, the invention provides an enzyme composition comprising a laccase derived from Ganoderma lucidum which may be combined with one or more cellulases, and for its use in enhancing lignocellulose biomass hydrolysis....
Gersbach, Charles A; Perez-Pinera, Pablo
2014-08-01
New technologies have recently been developed to control the expression of human genes in their native genomic context by engineering synthetic transcription factors that can be targeted to any DNA sequence. The ability to precisely regulate any gene as it occurs naturally in the genome provides a means to address a variety of diseases and disorders. This approach also circumvents some of the traditional challenges of gene therapy. In this editorial, we review the technologies that have enabled targeted human gene activation, including the engineering of transcription factors based on zinc finger proteins, transcription activator-like effectors and the CRISPR/Cas9 system. Additionally, we highlight examples in which these methods have been developed for therapeutic applications and discuss challenges and opportunities.
Osińska-Jaroszuk, Monika; Jaszek, Magdalena; Starosielec, Magdalena; Sulej, Justyna; Matuszewska, Anna; Janczarek, Monika; Bancerz, Renata; Wydrych, Jerzy; Wiater, Adrian; Jarosz-Wilkołazka, Anna
2018-03-26
Four bacterial EPSs extracted from Rhizobium leguminosarum bv. trifolii Rt24.2, Sinorhizobium meliloti Rm1021, Bradyrhizobium japonicum USDA110, and Bradyrhizobium elkanii USDA76 were determined towards their metal ion adsorption properties and possible modification of Cerrena unicolor laccase properties. The highest magnesium and iron ion-sorption capacity (~ 42 and ~ 14.5%, respectively) was observed for EPS isolated from B. japonicum USDA110. An evident influence of EPSs on the stability of laccase compared to the control values (without EPSs) was shown after 30-day incubation at 25 °C. The residual activity of laccases was obtained in the presence of Rh76EPS and Rh1021EPS, i.e., 49.5 and 41.5% of the initial catalytic activity, respectively. This result was confirmed by native PAGE electrophoresis. The EPS effect on laccase stability at different pH (from 3.8 to 7.0) was also estimated. The most significant changes at the optimum pH value (pH 5.8) was observed in samples of laccase stabilized by Rh76EPS and Rh1021EPS. Cyclic voltamperometry was used for analysis of electrochemical parameters of laccase stabilized by bacterial EPS and immobilized on single-walled carbon nanotubes (SWCNTs) with aryl residues. Laccases with Rh76EPS and Rh1021EPS had an evident shift of the value of the redox potential compared to the control without EPS addition. In conclusion, the results obtained in this work present a new potential use of bacterial EPSs as a metal-binding component and a modulator of laccase properties especially stability of enzyme activity, which can be a very effective tool in biotechnology and industrial applications.
Sato, A C K; Perrechil, F A; Costa, A A S; Santana, R C; Cunha, R L
2015-09-01
The aim of this work was to evaluate the influence of laccase and ferulic acid on the characteristics of oil-in-water emulsions stabilized by sodium caseinate at different pH (3, 5 and 7). Emulsions were prepared by high pressure homogenization of soybean oil with sodium caseinate solution containing varied concentrations of laccase (0, 1 and 5mg/mL) and ferulic acid (5 and 10mM). Laccase treatment and pH exerted a strong influence on the properties with a consequent effect on stability, structure and rheology of emulsions stabilized by Na-caseinate. At pH7, O/W emulsions were kinetically stable due to the negative protein charge which enabled electrostatic repulsion between oil droplets resulting in an emulsion with small droplet size, low viscosity, pseudoplasticity and viscoelastic properties. The laccase treatment led to emulsions showing shear-thinning behavior as a result of a more structured system. O/W emulsions at pH5 and 3 showed phase separation due to the proximity to protein pI, but the laccase treatment improved their stability of emulsions especially at pH3. At pH3, the addition of ferulic acid and laccase produced emulsions with larger droplet size but with narrower droplet size distribution, increased viscosity, pseudoplasticity and viscoelastic properties (gel-like behavior). Comparing laccase treatments, the combined addition of laccase and ferulic acid generally produced emulsions with lower stability (pH5), larger droplet size (pH3, 5 and 7) and higher pseudoplasticity (pH5 and 7) than emulsion with only ferulic acid. The results suggested that the cross-linking of proteins by laccase and ferulic acid improved protein emulsifying properties by changing functional mechanisms of the protein on emulsion structure and rheology, showing that sodium caseinate can be successfully used in acid products when treated with laccase. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Redman Julia C
2008-07-01
Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.
Czech Academy of Sciences Publication Activity Database
Antošová, Z.; Herkommerová, Klára; Pichová, Iva; Sychrová, H.
2018-01-01
Roč. 34, č. 1 (2018), s. 69-80 ISSN 8756-7938 R&D Projects: GA TA ČR(CZ) TA01011461; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : laccase * decolorization * gene expression * expression optimization * Saccharomyces cerevisiae Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 1.986, year: 2016
Connected Gene Communities Underlie Transcriptional Changes in Cornelia de Lange Syndrome.
Boudaoud, Imène; Fournier, Éric; Baguette, Audrey; Vallée, Maxime; Lamaze, Fabien C; Droit, Arnaud; Bilodeau, Steve
2017-09-01
Cornelia de Lange syndrome (CdLS) is a complex multisystem developmental disorder caused by mutations in cohesin subunits and regulators. While its precise molecular mechanisms are not well defined, they point toward a global deregulation of the transcriptional gene expression program. Cohesin is associated with the boundaries of chromosome domains and with enhancer and promoter regions connecting the three-dimensional genome organization with transcriptional regulation. Here, we show that connected gene communities, structures emerging from the interactions of noncoding regulatory elements and genes in the three-dimensional chromosomal space, provide a molecular explanation for the pathoetiology of CdLS associated with mutations in the cohesin-loading factor NIPBL and the cohesin subunit SMC1A NIPBL and cohesin are important constituents of connected gene communities that are centrally positioned at noncoding regulatory elements. Accordingly, genes deregulated in CdLS are positioned within reach of NIPBL- and cohesin-occupied regions through promoter-promoter interactions. Our findings suggest a dynamic model where NIPBL loads cohesin to connect genes in communities, offering an explanation for the gene expression deregulation in the CdLS. Copyright © 2017 by the Genetics Society of America.
A PCA3 gene-based transcriptional amplification system targeting primary prostate cancer
Neveu, Bertrand; Jain, Pallavi; T?tu, Bernard; Wu, Lily; Fradet, Yves; Pouliot, Fr?d?ric
2015-01-01
Targeting specifically primary prostate cancer (PCa) cells for immune therapy, gene therapy or molecular imaging is of high importance. The PCA3 long non-coding RNA is a unique PCa biomarker and oncogene that has been widely studied. This gene has been mainly exploited as an accurate diagnostic urine biomarker for PCa detection. In this study, the PCA3 promoter was introduced into a new transcriptional amplification system named the 3-Step Transcriptional Amplification System (PCA3-3STA) and ...
Oxygen cathode based on a layer-by-layer self-assembled laccase and osmium redox mediator
Energy Technology Data Exchange (ETDEWEB)
Szamocki, R.; Flexer, V. [INQUIMAE-DQIAyQF, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Levin, L.; Forchiasin, F. [Micologia Experimental, Departamento de Biodiversidad y Biologia Experimental. Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina); Calvo, E.J. [INQUIMAE-DQIAyQF, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, 1428 Buenos Aires (Argentina)], E-mail: calvo@qi.fcen.uba.ar
2009-02-28
Trametes trogii laccase has been studied as biocatalyst for the oxygen electro-reduction in three different systems: (i) soluble laccase was studied in solution; (ii) an enzyme monolayer was tethered to a gold surface by dithiobis N-succinimidyl propionate (DTSP), with a soluble osmium pyridine-bipyridine redox mediator in both cases. The third case (iii) consisted in the sequential immobilization of laccase and the osmium complex derivatized poly(allylamine) self-assembled layer-by-layer (LbL) on mercaptopropane sulfonate modified gold to produce an all integrated and wired enzymatic oxygen cathode. The polycation was the same osmium complex covalently bound to poly-(ally-lamine) backbone (PAH-Os), the polyanion was the enzyme adsorbed from a solution of a suitable pH so that the protein carries a net negative charge. The adsorption of laccase was studied by monitoring the mass uptake with a quartz crystal microbalance and the oxygen reduction electrocatalysis was studied by linear scan voltammetry. While for the three cases, oxygen electrocatalysis mediated by the osmium complex was observed, for tethered laccase direct electron transfer in the absence of redox mediator was also apparent but no electrocatalysis for the oxygen reduction was recorded in the absence of mediator in solution. For the fully integrated LbL self-assembled laccase and redox mediator (case iii) a catalytic reduction of oxygen could be recorded at different oxygen partial pressures and different electrolyte pH. The tolerance of the reaction to methanol and chloride was also investigated.
Oxygen cathode based on a layer-by-layer self-assembled laccase and osmium redox mediator
International Nuclear Information System (INIS)
Szamocki, R.; Flexer, V.; Levin, L.; Forchiasin, F.; Calvo, E.J.
2009-01-01
Trametes trogii laccase has been studied as biocatalyst for the oxygen electro-reduction in three different systems: (i) soluble laccase was studied in solution; (ii) an enzyme monolayer was tethered to a gold surface by dithiobis N-succinimidyl propionate (DTSP), with a soluble osmium pyridine-bipyridine redox mediator in both cases. The third case (iii) consisted in the sequential immobilization of laccase and the osmium complex derivatized poly(allylamine) self-assembled layer-by-layer (LbL) on mercaptopropane sulfonate modified gold to produce an all integrated and wired enzymatic oxygen cathode. The polycation was the same osmium complex covalently bound to poly-(ally-lamine) backbone (PAH-Os), the polyanion was the enzyme adsorbed from a solution of a suitable pH so that the protein carries a net negative charge. The adsorption of laccase was studied by monitoring the mass uptake with a quartz crystal microbalance and the oxygen reduction electrocatalysis was studied by linear scan voltammetry. While for the three cases, oxygen electrocatalysis mediated by the osmium complex was observed, for tethered laccase direct electron transfer in the absence of redox mediator was also apparent but no electrocatalysis for the oxygen reduction was recorded in the absence of mediator in solution. For the fully integrated LbL self-assembled laccase and redox mediator (case iii) a catalytic reduction of oxygen could be recorded at different oxygen partial pressures and different electrolyte pH. The tolerance of the reaction to methanol and chloride was also investigated
Transcriptional Mechanisms Controlling miR-375 Gene Expression in the Pancreas
Directory of Open Access Journals (Sweden)
Tali Avnit-Sagi
2012-01-01
Full Text Available MicroRNAs (miRNAs are a class of small non-coding RNAs that play an important role in mediating a broad and expanding range of biological activities. miR-375 is expressed selectively in the pancreas. We have previously shown that selective expression of miR-375 in pancreatic beta cells is controlled by transcriptional mechanisms operating through a TATA box-containing promoter. Expression of miR-375 has been reported in non-beta cells within the endocrine pancreas, and indeed inactivation of miR-375 leads to perturbation in cell mass and number of both alpha and beta cells. Consistent with its expression throughout the endocrine pancreas, we now show that the promoter of the miR-375 gene shows selective activity in pancreatic endocrine alpha cells, comparable to that observed in beta cells. We previously identified a novel negative regulatory element located downstream of the miR-375 gene transcription start site. By generating luciferase reporter genes, we now show that the sequence is functional also when positioned upstream of a heterologous promoter, thus proving that the repressor effect is mediated at least in part at the level of transcription. Further characterization of the transcriptional control mechanism regulating expression of miR-375 and other pancreatic miRNAs will contribute to a better understanding of pancreas development and function.
Kamenova, Ivanka; Warfield, Linda; Hahn, Steven
2014-08-01
Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
diCenzo, George C; Wellappili, Deelaka; Golding, G Brian; Finan, Turlough M
2018-05-04
Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT). Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome. Copyright © 2018 diCenzo, et al.
Directory of Open Access Journals (Sweden)
George C. diCenzo
2018-05-01
Full Text Available Integration of newly acquired genes into existing regulatory networks is necessary for successful horizontal gene transfer (HGT. Ten percent of bacterial species contain at least two DNA replicons over 300 kilobases in size, with the secondary replicons derived predominately through HGT. The Sinorhizobium meliloti genome is split between a 3.7 Mb chromosome, a 1.7 Mb chromid consisting largely of genes acquired through ancient HGT, and a 1.4 Mb megaplasmid consisting primarily of recently acquired genes. Here, RNA-sequencing is used to examine the transcriptional consequences of massive, synthetic genome reduction produced through the removal of the megaplasmid and/or the chromid. Removal of the pSymA megaplasmid influenced the transcription of only six genes. In contrast, removal of the chromid influenced expression of ∼8% of chromosomal genes and ∼4% of megaplasmid genes. This was mediated in part by the loss of the ETR DNA region whose presence on pSymB is due to a translocation from the chromosome. No obvious functional bias among the up-regulated genes was detected, although genes with putative homologs on the chromid were enriched. Down-regulated genes were enriched in motility and sensory transduction pathways. Four transcripts were examined further, and in each case the transcriptional change could be traced to loss of specific pSymB regions. In particularly, a chromosomal transporter was induced due to deletion of bdhA likely mediated through 3-hydroxybutyrate accumulation. These data provide new insights into the evolution of the multipartite bacterial genome, and more generally into the integration of horizontally acquired genes into the transcriptome.
Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA.
Chwalenia, Katarzyna; Qin, Fujun; Singh, Sandeep; Tangtrongstittikul, Panjapon; Li, Hui
2017-11-22
cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.
Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls
Directory of Open Access Journals (Sweden)
Dilla Mareistia Fassah
2018-04-01
Full Text Available Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10 and steers (n = 10 of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; p<0.01 and protein levels (1.4 fold; p< 0.05 of pyruvate carboxylase and mitochondrial phosphoenolpyruvate carboxykinase genes (1.7 fold; p<0.05. Hepatic mRNA levels of genes encoding the glycolysis enzymes were not changed by castration. Castration increased mRNA levels of both lactate dehydrogenase A (1.5 fold; p<0.05 and lactate dehydrogenase B (2.2 fold; p<0.01 genes for lactate utilization. Castration increased mRNA levels of glycerol kinase (2.7 fold; p<0.05 and glycerol-3-phosphate dehydrogenase 1 (1.5 fold; p<0.05 genes for glycerol utilization. Castration also increased mRNA levels of propionyl-CoA carboxylase beta (mitochondrial (3.5 fold; p<0.01 and acyl-CoA synthetase short chain family member 3 (1.3 fold; p = 0.06 genes for propionate incorporation. Conclusion Castration increases transcription levels of critical genes coding for enzymes involved in irreversible gluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular
Directory of Open Access Journals (Sweden)
Settles Matthew L
2009-05-01
Full Text Available Abstract Background Natural antisense transcripts (NATs are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded or a different locus (trans-encoded. They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation. NATs give rise to sense-antisense transcript pairs and the number of these identified has escalated greatly with the availability of DNA sequencing resources and public databases. Traditionally, NATs were identified by the alignment of full-length cDNAs or expressed sequence tags to genome sequences, but an alternative method for large-scale detection of sense-antisense transcript pairs involves the use of microarrays. In this study we developed a novel protocol to assay sense- and antisense-strand transcription on the 55 K Affymetrix GeneChip Wheat Genome Array, which is a 3' in vitro transcription (3'IVT expression array. We selected five different tissue types for assay to enable maximum discovery, and used the 'Chinese Spring' wheat genotype because most of the wheat GeneChip probe sequences were based on its genomic sequence. This study is the first report of using a 3'IVT expression array to discover the expression of natural sense-antisense transcript pairs, and may be considered as proof-of-concept. Results By using alternative target preparation schemes, both the sense- and antisense-strand derived transcripts were labeled and hybridized to the Wheat GeneChip. Quality assurance verified that successful hybridization did occur in the antisense-strand assay. A stringent threshold for positive hybridization was applied, which resulted in the identification of 110 sense-antisense transcript pairs, as well as 80 potentially antisense-specific transcripts. Strand-specific RT-PCR validated the microarray observations, and showed that antisense transcription is likely to be tissue specific. For the annotated sense
Hepatic transcriptional changes in critical genes for gluconeogenesis following castration of bulls
Fassah, Dilla Mareistia; Jeong, Jin Young
2018-01-01
Objective This study was performed to understand transcriptional changes in the genes involved in gluconeogenesis and glycolysis pathways following castration of bulls. Methods Twenty Korean bulls were weaned at average 3 months of age, and castrated at 6 months. Liver tissues were collected from bulls (n = 10) and steers (n = 10) of Korean cattle, and hepatic gene expression levels were measured using quantitative real-time polymerase chain reaction. We examined hepatic transcription levels of genes encoding enzymes for irreversible reactions in both gluconeogenesis and glycolysis as well as genes encoding enzymes for the utilization of several glucogenic substrates. Correlations between hepatic gene expression and carcass characteristics were performed to understand their associations. Results Castration increased the mRNA (3.6 fold; pgluconeogenesis reactions from pyruvate to glucose and enzymes responsible for incorporation of glucogenic substrates including lactate, glycerol, and propionate. Hepatic gluconeogenic gene expression levels were associated with intramuscular fat deposition. PMID:29502393
Effect of amino acids and vitamins on laccase production by the bird's nest fungus Cyathus bulleri
Energy Technology Data Exchange (ETDEWEB)
Shikha Dhawan; Ramesh Chander Kuhad [University of Delhi, New Delhi (India). Dept. of Microbiology
2002-08-01
Various amino acids, their analogues and vitamins have shown stimulatory as well as inhibitory effects on laccase production by Cyathus bulleri. DL-methionine, DL-tryptophan, glycine and DL-valine stimulated laccase production, while L-cysteine monohydrochloride completely inhibited the enzyme production. Among vitamins tested biotin, riboflavin and pyridoxine hydrochloride were found to induce laccase production. (author)
Directory of Open Access Journals (Sweden)
Prabin Shrestha
2016-01-01
Full Text Available At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate. Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L and copper sulfate (30 μM in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, Km, Vmax, and Kcat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process.
Shrestha, Prabin; Joshi, Bishnu; Joshi, Jarina; Malla, Rajani; Sreerama, Lakshmaiah
2016-01-01
At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum -CDBT1 , Ganoderma japonicum, and Lentinula edodes , isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum -CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum -CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μ M) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum -CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m , V max , and K cat , determined using 2,2'-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μ M, 36 μ mol/min/mg, and 246 min -1 , respectively. The isolated thermostable laccase will be used in future experiments for delignification process.
Directory of Open Access Journals (Sweden)
Agbaje LATEEF
2015-12-01
Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.
International Nuclear Information System (INIS)
Shirley, B.W.; Berry-Lowe, S.L.; Grandbastien, M.A.; Zurfluh, L.L.; Shah, D.M.; Meagher, R.B.
1987-01-01
The expression of two closely related soybean ribulose bisphosphate carboxylase small subunit (Rubisco ss) genes, SRS1 and SRS4, has been compared. These genes account for approximately 2-4% of the total transcription in light grown leaves, SRS4 being twice as transcriptionally active as SRS1. The transcription of these genes is reduced more than 30 fold after a pulse of far-red light or extended periods of darkness. When etiolated seedlings are shifted to the light the transcription of both genes increases 30-50 fold. Despite this 30-fold range in transcriptional expression the steady state mRNA levels in light and dark grown tissue differ by less than 8 fold. This suggests that the mRNAs are less stable in light grown tissue. 38 refs., 5 figs
Two genes in Balbiani ring 2 with metabolically different 75S transcripts
Galler, R.; Saiga, H.; Widmer, R. M.; Lezzi, M.; Edström, J.-E.
1985-01-01
Balbiani ring 2 (BR2) in salivary glands of Chironomus pallidivittatus and C. tentans (two sibling species of the subgenus Camptochironomus) is a favoured model system for studies of gene organization and transcript formation. Here we show that BR2 is more complex than hitherto believed, containing two 75S RNA-producing genes, BR2a and BR2b, present in different 35–40 kb blocks of DNA. The transcripts hybridizing to two different repeat units originating in BR2 differ in size. Further support...
Rodriguez, Alexander; Osma, Johann F.; Alméciga-Díaz, Carlos J.; Sánchez, Oscar F.
2013-01-01
Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametes pubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69±0.28 U mg-1 of protein for the crude extract, and 0.08±0.001 and 2.86±0.05 U mg-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct. PMID:24019936
Gonzalez, Juan C; Medina, Sandra C; Rodriguez, Alexander; Osma, Johann F; Alméciga-Díaz, Carlos J; Sánchez, Oscar F
2013-01-01
Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM), and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1) and 60 kDa (Lac2). Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1) of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1) of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.
Directory of Open Access Journals (Sweden)
Juan C Gonzalez
Full Text Available Laccases are copper-containing enzymes involved in the degradation of lignocellulosic materials and used in the treatment of phenol-containing wastewater. In this study we investigated the effect of culture conditions, i.e. submerged or semi-solid, and copper supplementation on laccase production by Trametespubescens grown on coffee husk, soybean pod husk, or cedar sawdust. The highest specific laccase activity was achieved when the culture was conducted under submerged conditions supplemented with copper (5 mM, and using coffee husk as substrate. The crude extracts presented two laccase isoforms with molecular mass of 120 (Lac1 and 60 kDa (Lac2. Regardless of the substrate, enzymatic crude extract and purified fractions behaved similarly at different temperatures and pHs, most of them presented the maximum activity at 55 °C and a pH range between 2 and 3. In addition, they showed similar stability and electro-chemical properties. At optimal culture conditions laccase activity was 7.69 ± 0.28 U mg(-1 of protein for the crude extract, and 0.08 ± 0.001 and 2.86 ± 0.05 U mg(-1 of protein for Lac1 and Lac2, respectively. In summary, these results show the potential of coffee husk as an important and economical growth medium to produce laccase, offering a new alternative use for this common agro-industrial byproduct.
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Gene transcription in polar bears (Ursus maritimus) from disparate populations
Bowen, Lizabeth; Miles, A. Keith; Waters, Shannon C.; Meyerson, Randi; Rode, Karyn D.; Atwood, Todd C.
2015-01-01
Polar bears in the Beaufort (SB) and Chukchi (CS) Seas experience different environments due primarily to a longer history of sea ice loss in the Beaufort Sea. Ecological differences have been identified as a possible reason for the generally poorer body condition and reproduction of Beaufort polar bears compared to those from the Chukchi, but the influence of exposure to other stressors remains unknown. We use molecular technology, quantitative PCR, to identify gene transcription differences among polar bears from the Beaufort and Chukchi Seas as well as captive healthy polar bears. We identified significant transcriptional differences among a priori groups (i.e., captive bears, SB 2012, SB 2013, CS 2013) for ten of the 14 genes of interest (i.e., CaM, HSP70, CCR3, TGFβ, COX2, THRα, T-bet, Gata3, CD69, and IL17); transcription levels of DRβ, IL1β, AHR, and Mx1 did not differ among groups. Multivariate analysis also demonstrated separation among the groups of polar bears. Specifically, we detected transcript profiles consistent with immune function impairment in polar bears from the Beaufort Sea, when compared with Chukchi and captive polar bears. Although there is no strong indication of differential exposure to contaminants or pathogens between CS and SB bears, there are clearly differences in important transcriptional responses between populations. Further investigation is warranted to refine interpretation of potential effects of described stress-related conditions for the SB population.
Arca-Ramos, A; Eibes, G; Feijoo, G; Lema, J M; Moreira, M T
2015-11-01
In this study, the removal of bisphenol A (BPA) by laccase in a continuous enzymatic membrane reactor (EMR) was investigated. The effects of key parameters, namely, type of laccase, pH, and enzyme activity, were initially evaluated. Once optimal conditions were determined, the continuous removal of the pollutant in an EMR was assessed in synthetic and real biologically treated wastewaters. The reactor configuration consisted of a stirred tank reactor coupled to a ceramic membrane, which prevented the sorption of the pollutant and allowed the recovery and recycling of laccase. Nearly complete removal of BPA was attained under both operation regimes with removal yields above 94.5 %. In experiments with real wastewater, the removal of BPA remained high while the presence of colloids and certain ions and the formation of precipitates on the membrane potentially affected enzyme stability and made necessary the periodic addition of laccase. Polymerization and degradation were observed as probable mechanisms of BPA transformation by laccase.
Liu, Hao; Zhou, Pandeng; Wu, Xing; Sun, Jianliang; Chen, Shicheng
2015-11-04
The biosynthetic utilization of laccase/mediator system is problematic because the use of organic cosolvent causes significant inhibition of laccase activity. This work explored how the organic cosolvent impacts on the laccase catalytic capacity towards 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) in aqueous solution. Effects of acetone on the kinetic constants of laccase were determined and the results showed Km and Vmax varied exponentially with increasing acetone content. Acetone as well as some other cosolvents could transform ABTS radicals into its reductive form. The content of acetone in media significantly affected the radical scavenging rates. Up to 95% of the oxidized ABTS was successfully recovered in 80% (v/v) acetone in 60 min. This allows ABTS recycles at least six times with 70%-75% of active radicals recovered after each cycle. This solvent-based recovery strategy may help improve the economic feasibility of laccase/ABTS system in biosynthesis.
Directory of Open Access Journals (Sweden)
Jiny Nair
Full Text Available Network analysis is a novel method to understand the complex pathogenesis of inflammation-driven atherosclerosis. Using this approach, we attempted to identify key inflammatory genes and their core transcriptional regulators in coronary artery disease (CAD. Initially, we obtained 124 candidate genes associated with inflammation and CAD using Polysearch and CADgene database for which protein-protein interaction network was generated using STRING 9.0 (Search Tool for the Retrieval of Interacting Genes and visualized using Cytoscape v 2.8.3. Based on betweenness centrality (BC and node degree as key topological parameters, we identified interleukin-6 (IL-6, vascular endothelial growth factor A (VEGFA, interleukin-1 beta (IL-1B, tumor necrosis factor (TNF and prostaglandin-endoperoxide synthase 2 (PTGS2 as hub nodes. The backbone network constructed with these five hub genes showed 111 nodes connected via 348 edges, with IL-6 having the largest degree and highest BC. Nuclear factor kappa B1 (NFKB1, signal transducer and activator of transcription 3 (STAT3 and JUN were identified as the three core transcription factors from the regulatory network derived using MatInspector. For the purpose of validation of the hub genes, 97 test networks were constructed, which revealed the accuracy of the backbone network to be 0.7763 while the frequency of the hub nodes remained largely unaltered. Pathway enrichment analysis with ClueGO, KEGG and REACTOME showed significant enrichment of six validated CAD pathways - smooth muscle cell proliferation, acute-phase response, calcidiol 1-monooxygenase activity, toll-like receptor signaling, NOD-like receptor signaling and adipocytokine signaling pathways. Experimental verification of the above findings in 64 cases and 64 controls showed increased expression of the five candidate genes and the three transcription factors in the cases relative to the controls (p<0.05. Thus, analysis of complex networks aid in the
Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin
2014-01-01
The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.
Novel fusion genes and chimeric transcripts in ependymal tumors
DEFF Research Database (Denmark)
Olsen, Thale Kristin; Panagopoulos, Ioannis; Gorunova, Ludmila
2016-01-01
with subsequent Sanger sequencing was used to validate the potential fusions. Fluorescent in situ hybridization (FISH) using locus-specific probes was also performed. A total of 841 candidate chimeric transcripts were identified in the 12 tumors, with an average of 49 unique candidate fusions per tumor. After...... infratentorial anaplastic ependymoma. Our previously reported ALK rearrangements and the RELA and YAP1 fusions found in supratentorial ependymomas were until now the only known fusion genes present in ependymal tumors. The chimeric transcripts presented here are the first to be reported in infratentorial...
Laccases stabilization with phosphatidylcholine liposomes
Martí, M.; Zille, Andrea; Paulo, Artur Cavaco; Parra, J. L.; Coderch, L.
2012-01-01
In recent years, there has been an upsurge of interest in enzyme treatment of textile fibres. Enzymes are globular proteins whose catalytic function is due to their three dimensional structure. For this reason, stability strategies make use of compounds that avoid dismantling or distorting protein 3D structures. This study is concerned with the use of microencapsulation techniques to optimize enzyme stabilization. Laccases were embedded in phophatidylcholine liposomes and their encaps...
The WRKY Transcription Factor Genes in Lotus japonicus.
Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun
2014-01-01
WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (LjWRKY) genes can be classified into three groups (I-III). Investigations of gene copy number and gene clusters indicate that only one gene duplication event occurred on chromosome 4 and no clustered genes were detected on chromosomes 3 or 6. Researchers previously believed that group II and III WRKY domains were derived from the C-terminal WRKY domain of group I. Our results suggest that some WRKY genes in group II originated from the N-terminal domain of group I WRKY genes. Additional evidence to support this hypothesis was obtained by Medicago truncatula WRKY (MtWRKY) protein motif analysis. We found that LjWRKY and MtWRKY group III genes are under purifying selection, suggesting that WRKY genes will become increasingly structured and functionally conserved.
Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan
2009-02-01
The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.
Crystal structures of E. coli laccase CueO at different copper concentrations
International Nuclear Information System (INIS)
Li Xu; Wei Zhiyi; Zhang Min; Peng Xiaohui; Yu Guangzhe; Teng Maikun; Gong Weimin
2007-01-01
CueO protein is a hypothetical bacterial laccase and a good laccase candidate for large scale industrial application. Four CueO crystal structures were determined at different copper concentrations. Low copper occupancy in apo-CueO and slow copper reconstitution process in CueO with exogenous copper were demonstrated. These observations well explain the copper dependence of CueO oxidase activity. Structural comparison between CueO and other three fungal laccase proteins indicates that Glu106 in CueO constitutes the primary counter-work for reconstitution of the trinuclear copper site. Mutation of Glu106 to a Phe enhanced CueO oxidation activity and supported this hypothesis. In addition, an extra α-helix from Leu351 to Gly378 covers substrate biding pocket of CueO and might compromises the electron transfer from substrate to type I copper
Effects of laccase on lignin depolymerization and enzymatic hydrolysis of ensiled corn stover.
Chen, Qin; Marshall, Megan N; Geib, Scott M; Tien, Ming; Richard, Tom L
2012-08-01
The aim of this study was to explore the synergies of laccase, a ligninolytic enzyme, with cellulose and hemicellulase amendments on ensiled corn stover. Molecular signals of lignin decomposition were observed by tetramethylammonium hydroxide thermochemolysis and gas chromatography-mass spectroscopy (TMAH-GC-MS) analysis. The significant findings suggest that ensilage might provide a platform for biological pretreatment. By partially hydrolyzing cellulose and hemicellulose into soluble sugars, ensilage facilitates laccase penetration into the lignocellulose complex to enhance lignin degradation. Downstream cellulose hydrolysis was improved 7% with increasing laccase loading rate. These results demonstrate the potential of enzymes, either directly amended or expressed by microbes during ensilage, to maximize utilization of corn stover for cellulosic biofuels and other downstream fermentations. Copyright © 2012. Published by Elsevier Ltd.
Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina
2017-05-01
Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt
2017-04-21
The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee
2008-01-01
Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059
Directory of Open Access Journals (Sweden)
Deyholos Michael K
2006-10-01
Full Text Available Abstract Background Roots are an attractive system for genomic and post-genomic studies of NaCl responses, due to their primary importance to agriculture, and because of their relative structural and biochemical simplicity. Excellent genomic resources have been established for the study of Arabidopsis roots, however, a comprehensive microarray analysis of the root transcriptome following NaCl exposure is required to further understand plant responses to abiotic stress and facilitate future, systems-based analyses of the underlying regulatory networks. Results We used microarrays of 70-mer oligonucleotide probes representing 23,686 Arabidopsis genes to identify root transcripts that changed in relative abundance following 6 h, 24 h, or 48 h of hydroponic exposure to 150 mM NaCl. Enrichment analysis identified groups of structurally or functionally related genes whose members were statistically over-represented among up- or down-regulated transcripts. Our results are consistent with generally observed stress response themes, and highlight potentially important roles for underappreciated gene families, including: several groups of transporters (e.g. MATE, LeOPT1-like; signalling molecules (e.g. PERK kinases, MLO-like receptors, carbohydrate active enzymes (e.g. XTH18, transcription factors (e.g. members of ZIM, WRKY, NAC, and other proteins (e.g. 4CL-like, COMT-like, LOB-Class 1. We verified the NaCl-inducible expression of selected transcription factors and other genes by qRT-PCR. Conclusion Micorarray profiling of NaCl-treated Arabidopsis roots revealed dynamic changes in transcript abundance for at least 20% of the genome, including hundreds of transcription factors, kinases/phosphatases, hormone-related genes, and effectors of homeostasis, all of which highlight the complexity of this stress response. Our identification of these transcriptional responses, and groups of evolutionarily related genes with either similar or divergent
Directory of Open Access Journals (Sweden)
Ian M Willis
2008-07-01
Full Text Available Transcriptional repression of ribosomal components and tRNAs is coordinately regulated in response to a wide variety of environmental stresses. Part of this response involves the convergence of different nutritional and stress signaling pathways on Maf1, a protein that is essential for repressing transcription by RNA polymerase (pol III in Saccharomyces cerevisiae. Here we identify the functions buffering yeast cells that are unable to down-regulate transcription by RNA pol III. MAF1 genetic interactions identified in screens of non-essential gene-deletions and conditionally expressed essential genes reveal a highly interconnected network of 64 genes involved in ribosome biogenesis, RNA pol II transcription, tRNA modification, ubiquitin-dependent proteolysis and other processes. A survey of non-essential MAF1 synthetic sick/lethal (SSL genes identified six gene-deletions that are defective in transcriptional repression of ribosomal protein (RP genes following rapamycin treatment. This subset of MAF1 SSL genes included MED20 which encodes a head module subunit of the RNA pol II Mediator complex. Genetic interactions between MAF1 and subunits in each structural module of Mediator were investigated to examine the functional relationship between these transcriptional regulators. Gene expression profiling identified a prominent and highly selective role for Med20 in the repression of RP gene transcription under multiple conditions. In addition, attenuated repression of RP genes by rapamycin was observed in a strain deleted for the Mediator tail module subunit Med16. The data suggest that Mediator and Maf1 function in parallel pathways to negatively regulate RP mRNA and tRNA synthesis.
International Nuclear Information System (INIS)
Lai, Chi-Yung; Wu, Chih-Hung; Meng, Chui-Ting; Lin, Chi-Wen
2017-01-01
Highlights: • A laccase-producing fungus on cathode of MFC was used to enhance degradation of azo dye. • Laccase-producing fungal cathodes performed better than laccase-free control cathodes. • A maximum power density of 13.38 mW/m"2 and an >90% decolorization of acid orange 7 were obtained. • Growing a fungal culture with continuous laccase production improved MFC’s electricity generation. - Abstract: Wood-degrading white-rot fungi produce many extracellular enzymes, including the multi-copper oxidative enzyme laccase (EC 1.10.3.2). Laccase uses atmospheric oxygen as the electron acceptor to catalyze a one-electron oxidation reaction of phenolic compounds and therefore has the potential to simultaneously act as a cathode catalyst in a microbial fuel cell (MFC) and degrade azo dye pollutants. In this study, the laccase-producing white-rot fungus Ganoderma lucidum BCRC 36123 was planted on the cathode surface of a single-chamber MFC to degrade the azo dye acid orange 7 (AO7) synergistically with an anaerobic microbial community in the anode chamber. In a batch culture, the fungus used AO7 as the sole carbon source and produced laccase continuously, reaching a maximum activity of 20.3 ± 0.3 U/L on day 19 with a 77% decolorization of the dye (50 mg/L). During MFC operations, AO7 in the anolyte diffused across a layer of polyvinyl alcohol-hydrogel that separated the cathode membrane from the anode chamber, and served as a carbon source to support the growth of, and production of laccase by, the fungal mycelium that was planted on the cathode. In such MFCs, laccase-producing fungal cathodes outperformed laccase-free controls, yielding a maximum open-circuit voltage of 821 mV, a closed-circuit voltage of 394 mV with an external resistance of 1000 Ω, a maximum power density of 13.38 mW/m"2, a maximum current density of 33 mA/m"2, and a >90% decolorization of AO7. This study demonstrates the feasibility of growing a white-rot fungal culture with continuous
The small laccase from Streptomyces coelicolor
Czech Academy of Sciences Publication Activity Database
Dohnálek, Jan; Skálová, Tereza; Ostergaard, L. H.; Ostergaard, P. R.; Hašek, Jindřich
2009-01-01
Roč. 16, 1a (2009), b4-b5 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] R&D Projects: GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * Streptomyces coelicolor * enzymer Subject RIV: CD - Macromolecular Chemistry
Rudnik, Radoslaw; Bulcha, Jote Tafese; Reifschneider, Elena; Ellersiek, Ulrike; Baier, Margarete
2017-08-23
The Arabidopsis ERFIb / RAP2.4 transcription factor family consists of eight members with highly conserved DNA binding domains. Selected members have been characterized individually, but a systematic comparison is pending. The redox-sensitive transcription factor RAP2.4a mediates chloroplast-to-nucleus redox signaling and controls induction of the three most prominent chloroplast peroxidases, namely 2-Cys peroxiredoxin A (2CPA) and thylakoid- and stromal ascorbate peroxidase (tAPx and sAPx). To test the specificity and redundancy of RAP2.4 transcription factors in the regulation of genes for chloroplast peroxidases, we compared the DNA-binding sites of the transcription factors in tertiary structure models, analyzed transcription factor and target gene regulation by qRT-PCR in RAP2.4, 2-Cys peroxiredoxin and ascorbate peroxidase T-DNA insertion lines and RAP2.4 overexpressing lines of Arabidopsis thaliana and performed promoter binding studies. All RAP2.4 proteins bound the tAPx promoter, but only the four RAP2.4 proteins with identical DNA contact sites, namely RAP2.4a, RAP2.4b, RAP2.4d and RAP2.4h, interacted stably with the redox-sensitive part of the 2CPA promoter. Gene expression analysis in RAP2.4 knockout lines revealed that RAP2.4a is the only one supporting 2CPA and chloroplast APx expression. Rap2.4h binds to the same promoter region as Rap2.4a and antagonizes 2CPA expression. Like the other six RAP2.4 proteins, Rap2.4 h promotes APx mRNA accumulation. Chloroplast ROS signals induced RAP2.4b and RAP2.4d expression, but these two transcription factor genes are (in contrast to RAP2.4a) insensitive to low 2CP availability, and their expression decreased in APx knockout lines. RAP2.4e and RAP2.4f gradually responded to chloroplast APx availability and activated specifically APx expression. These transcription factors bound, like RAP2.4c and RAP2.4g, the tAPx promoter, but hardly the 2CPA promoter. The RAP2.4 transcription factors form an environmentally and
Directory of Open Access Journals (Sweden)
Emmanuelle Deniaud
Full Text Available BACKGROUND: The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression. METHODOLOGY AND PRINCIPAL FINDINGS: We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis. CONCLUSION: This study shows that the binding to DNA
Laccase aided modification of nanofibrillated cellulose with dodecyl gallate
Directory of Open Access Journals (Sweden)
Päivi Saastamoinen
2012-11-01
Full Text Available Nanofibrillated cellulose, NFC, is an interesting wood fibre-based material that could be utilized in coatings, foams, composites, packages, dispersions, and emulsions, due to its high tensile strength and barrier properties, light weight, and stabilizing features. To improve applicability and properties of NFC, modification of its surface properties is often needed. In this study, the applicability of laccase-aided surface modification with hydrophobic dodecyl gallate (DOGA on unbleached NFC was investigated. Also, laccase-catalyzed polymerization of DOGA and other phenolic compounds with lignin moieties was investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy (MALDI-TOF MS. NFC modified with T. hirsuta-based laccase and DOGA showed decreased hydrophilicity, as compared with the native NFC, when coated on a paper surface. When dried as free-standing films, the surface properties of chemo-enzymatically modified NFC resembled those of the native NFC. The effect of modification was thus greatly influenced by different surface formation in differently prepared samples. Also, changing of the dispersion properties of DOGA by enzymatic polymerization affected the surface properties of the dried NFC samples. Covalent bonding between DOGA and NFC was not the main factor affecting the surface properties of the NFC in free-standing films or coatings.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
The hematopoietic transcription factor PU.1 regulates RANK gene expression in myeloid progenitors
International Nuclear Information System (INIS)
Kwon, Oh Hyung; Lee, Chong-Kil; Lee, Young Ik; Paik, Sang-Gi; Lee, Hyun-Jun
2005-01-01
Osteoclasts are bone resorbing cells of hematopoietic origin. The hematopoietic transcription factor PU.1 is critical for osteoclastogenesis; however, the molecular mechanisms of PU.1-regulated osteoclastogenesis have not been explored. Here, we present evidence that the receptor activator of nuclear factor κB (RANK) gene that has been shown to be crucial for osteoclastogenesis is a transcriptional target of PU.1. The PU.1 -/- progenitor cells failed to express the RANK gene and reconstitution of PU.1 in these cells induced RANK expression. Treatment of the PU.1 reconstituted cells with M-CSF and RANKL further augmented the RANK gene expression. To explore the regulatory mechanism of the RANK gene expression by PU.1, we have cloned the human RANK promoter. Transient transfection assays have revealed that the 2.2-kb RANK promoter was functional in a monocyte line RAW264.7, whereas co-transfection of PU.1 transactivated the RANK promoter in HeLa cells. Taken together, these results suggest that PU.1 regulates the RANK gene transcription and this may represent one of the key roles of PU.1 in osteoclast differentiation
Land use type significantly affects microbial gene transcription in soil.
Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf
2014-05-01
Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.
DEFF Research Database (Denmark)
Liu, Ming; Baum, Andreas; Odermatt, Jürgen
2017-01-01
Laccase activity catalyzes oxidation and polymerization of phenols. The effect of laccase treatment on the mechanical properties of hemp fibres and hemp fibre/epoxy composites was examined. Laccase treatment on top of 0.5% EDTA + 0.2% endo-polygalacturonase (EPG) treatments increased the mechanical...... properties of hemp fibres and fibre/epoxy composites. Comparing all fibre treatments, composites with 0.5% EDTA + 0.2% EPG + 0.5% laccase treated fibres had highest stiffness of 42 GPa and highest ultimate tensile strength (UTS) of 326 MPa at a fibre volume content of 50%. The thermal resistance of hemp...... hemp fibres and their composites were due to laccase catalyzed polymerization of lignin moieties in hemp fibres....
Joshi, Jarina; Malla, Rajani
2016-01-01
At present, few organisms are known to and capable of naturally producing laccases and white rot fungi are one such group. In the present study, three fungal species, namely, Ganoderma lucidum-CDBT1, Ganoderma japonicum, and Lentinula edodes, isolated from their native habitat in Nepal were screened for laccase production, and G. lucidum-CDBT1 was found to express highest levels of enzyme (day 10 culture media showed 0.92 IU/mg total protein or 92 IU/mL laccase activity with ABTS as substrate). Lignin extracted from rice straw was used in Olga medium for laccase production and isolation from G. lucidum-CDBT1. Presence of lignin (5 g/L) and copper sulfate (30 μM) in the media increased the extracellular laccase content by 111% and 114%, respectively. The laccase enzyme produced by G. lucidum-CDBT1 was fractionated by ammonium sulfate and purified by DEAE Sepharose anion exchange chromatography. The purified enzyme was found to have a molecular mass of 43 kDa and exhibits optimal activity at pH 5.0 and 30°C. The isolated laccase was thermally stable for up to 70°C for 1 h and exhibited broad pH stability. The kinetic constants, K m, V max, and K cat, determined using 2,2′-azinobis-(-3-ethylbenzothiazoline-6-sulfonic acid) as substrate were found to be 110 μM, 36 μmol/min/mg, and 246 min−1, respectively. The isolated thermostable laccase will be used in future experiments for delignification process. PMID:27822471
Regulation of human protein S gene (PROS1) transcription
Wolf, Cornelia de
2006-01-01
This thesis describes the investigation of the transcriptional regulation of the gene for anticoagulant plasma Protein S, PROS1. Protein S is a cofactor for Protein C in the Protein C anticoagulant pathway. The coagulation cascade is negatively regulated by this pathway through inactivation of
Identification of transcriptional factors and key genes in primary osteoporosis by DNA microarray.
Xie, Wengui; Ji, Lixin; Zhao, Teng; Gao, Pengfei
2015-05-09
A number of genes have been identified to be related with primary osteoporosis while less is known about the comprehensive interactions between regulating genes and proteins. We aimed to identify the differentially expressed genes (DEGs) and regulatory effects of transcription factors (TFs) involved in primary osteoporosis. The gene expression profile GSE35958 was obtained from Gene Expression Omnibus database, including 5 primary osteoporosis and 4 normal bone tissues. The differentially expressed genes between primary osteoporosis and normal bone tissues were identified by the same package in R language. The TFs of these DEGs were predicted with the Essaghir A method. DAVID (The Database for Annotation, Visualization and Integrated Discovery) was applied to perform the GO (Gene Ontology) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis of DEGs. After analyzing regulatory effects, a regulatory network was built between TFs and the related DEGs. A total of 579 DEGs was screened, including 310 up-regulated genes and 269 down-regulated genes in primary osteoporosis samples. In GO terms, more up-regulated genes were enriched in transcription regulator activity, and secondly in transcription factor activity. A total 10 significant pathways were enriched in KEGG analysis, including colorectal cancer, Wnt signaling pathway, Focal adhesion, and MAPK signaling pathway. Moreover, total 7 TFs were enriched, of which CTNNB1, SP1, and TP53 regulated most up-regulated DEGs. The discovery of the enriched TFs might contribute to the understanding of the mechanism of primary osteoporosis. Further research on genes and TFs related to the WNT signaling pathway and MAPK pathway is urgent for clinical diagnosis and directing treatment of primary osteoporosis.
Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki; Mühlberger, Elke
2014-11-01
Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined
Directory of Open Access Journals (Sweden)
Mallya Meera
2008-09-01
Full Text Available Abstract Background Regulation of the expression of particular genes can rely on mechanisms that are different from classical transcriptional and translational control. The LY6G5B and LY6G6D genes encode LY-6 domain proteins, whose expression seems to be regulated in an original fashion, consisting of an intron retention event which generates, through an early premature stop codon, a non-coding transcript, preventing expression in most cell lines and tissues. Results The MHC LY-6 non-coding transcripts have shown to be stable and very abundant in the cell, and not subject to Nonsense Mediated Decay (NMD. This retention event appears not to be solely dependent on intron features, because in the case of LY6G5B, when the intron is inserted in the artificial context of a luciferase expression plasmid, it is fully spliced but strongly stabilises the resulting luciferase transcript. In addition, by quantitative PCR we found that the retained and spliced forms are differentially expressed in tissues indicating an active regulation of the non-coding transcript. EST database analysis revealed that these genes have an alternative expression pathway with the formation of Transcription Induced Chimeras (TIC. This data was confirmed by RT-PCR, revealing the presence of different transcripts that would encode the chimeric proteins CSNKβ-LY6G5B and G6F-LY6G6D, in which the LY-6 domain would join to a kinase domain and an Ig-like domain, respectively. Conclusion In conclusion, the LY6G5B and LY6G6D intron-retained transcripts are not subjected to NMD and are more abundant than the properly spliced forms. In addition, these genes form chimeric transcripts with their neighbouring same orientation 5' genes. Of interest is the fact that the 5' genes (CSNKβ or G6F undergo differential splicing only in the context of the chimera (CSNKβ-LY6G5B or G6F-LY6G6C and not on their own.
The “Fourth Dimension” of Gene Transcription
O'Malley, Bert W.
2009-01-01
The three dimensions of space provide our relationship to position on the earth, but the fourth dimension of time has an equally profound influence on our lives. Everything from light and sound to weather and biology operate on the principle of measurable temporal periodicity. Consequently, a wide variety of time clocks affect all aspects of our existence. The annual (and biannual) cycles of activity, metabolism, and mating, the monthly physiological clocks of women and men, and the 24-h diurnal rhythms of humans are prime examples. Should it be surprising to us that the fourth dimension also impinges upon gene expression and that the genome itself is regulated by the fastest running of all biological clocks? Recent evidence substantiates the existence of such a ubiquitin-dependent transcriptional clock that is based upon the activation and destruction of transcriptional coactivators. PMID:19221049
Gene transcripts as potential diagnostic markers for allergic contact dermatitis
DEFF Research Database (Denmark)
Hansen, Malene Barré; Skov, Lone; Menné, Torkil
2005-01-01
The standard procedure for diagnosing allergic contact dermatitis is to perform a patch test. Because this has several disadvantages, the development of a new in vitro test system would be of immense value. Gene transcripts that distinguish allergics from non-allergics may have the potential...... widely available. The 26 differentially expressed genes identified in this study may potentially function as diagnostic markers for contact sensitivity....
International Nuclear Information System (INIS)
Vandegehuchte, Michiel B.; De Coninck, Dieter; Vandenbrouck, Tine; De Coen, Wim M.; Janssen, Colin R.
2010-01-01
A reduced level of DNA methylation has recently been described in both Zn-exposed and non-exposed offspring of Daphnia magna exposed to Zn. The hypothesis examined in this study is that DNA hypomethylation has an effect on gene transcription. A second hypothesis is that accumulative epigenetic effects can affect gene transcription in non-exposed offspring from parents with an exposure history of more than one generation. Transcriptional gene regulation was studied with a cDNA microarray. In the exposed and non-exposed hypomethylated daphnids, a large proportion of common genes were similarly up- or down-regulated, indicating a possible effect of the DNA hypomethylation. Two of these genes can be mechanistically involved in DNA methylation reduction. The similar transcriptional regulation of two and three genes in the F 0 and F 1 exposed daphnids on one hand and their non-exposed offspring on the other hand, could be the result of a one-generation temporary transgenerational epigenetic effect, which was not accumulative. - Zn-induced DNA hypomethylation is related to gene transcription in Daphnia magna and Zn exposure potentially induced limited temporary transgenerational effects on gene transcription.
Diamination by n-coupling using a commercial laccase
CSIR Research Space (South Africa)
Wellington, Kevin W
2010-02-01
Full Text Available Nuclear diamination of p-hydrobenzoquinones with aromatic and aliphatic primary amines was catalyzed by a immobilised commercial laccase, Denilite II Base, from Novozymes. The amine and the p-hydrobenzoquinone was reacted under mild conditions (at...
Herteleer, L; Zwarts, L; Hens, K; Forero, D; Del-Favero, J; Callaerts, P
2016-05-01
Lithium and valproate (VPA) are drugs used in the management of bipolar disorder. Even though they reportedly act on various pathways, the transcriptional targets relevant for disease mechanism and therapeutic effect remain unclear. Furthermore, multiple studies used lymphoblasts of bipolar patients as a cellular proxy, but it remains unclear whether peripheral cells provide a good readout for the effects of these drugs in the brain. We used Drosophila culture cells and adult flies to analyze the transcriptional effects of lithium and VPA and define mechanistic pathways. Transcriptional profiles were determined for Drosophila S2-cells and adult fly heads following lithium or VPA treatment. Gene ontology categories were identified using the DAVID functional annotation tool with a cut-off of p neuronal development, neuronal function, and metabolism. (i) Transcriptional effects of lithium and VPA in Drosophila S2 cells and heads show significant overlap. (ii) The overlap between transcriptional alterations in peripheral versus neuronal cells at the single gene level is negligible, but at the gene ontology and pathway level considerable overlap can be found. (iii) Lithium and VPA act on evolutionarily conserved pathways in Drosophila and mammalian models.
Post-transcriptional trafficking and regulation of neuronal gene expression.
Goldie, Belinda J; Cairns, Murray J
2012-02-01
Intracellular messenger RNA (mRNA) traffic and translation must be highly regulated, both temporally and spatially, within eukaryotic cells to support the complex functional partitioning. This capacity is essential in neurons because it provides a mechanism for rapid input-restricted activity-dependent protein synthesis in individual dendritic spines. While this feature is thought to be important for synaptic plasticity, the structures and mechanisms that support this capability are largely unknown. Certainly specialized RNA binding proteins and binding elements in the 3' untranslated region (UTR) of translationally regulated mRNA are important, but the subtlety and complexity of this system suggests that an intermediate "specificity" component is also involved. Small non-coding microRNA (miRNA) are essential for CNS development and may fulfill this role by acting as the guide strand for mediating complex patterns of post-transcriptional regulation. In this review we examine post-synaptic gene regulation, mRNA trafficking and the emerging role of post-transcriptional gene silencing in synaptic plasticity.
Xiao, Dan; Zhang, Weifeng; Li, Yan; Liu, Kuan; Zhao, Junli; Sun, Xiaohong; Shan, Linlin; Mao, Qinwen; Xia, Haibin
2016-02-10
Sox2 is an important transcriptional factor that has multiple functions in stem cell maintenance and tumorigenesis. To investigate the transcriptional regulation of the Sox2 gene, a luciferase knock-in reporter system was established in HEK293 cells by placing the luciferase gene in the genome under the control of the Sox2 gene promoter using a transcription activator-like effector nuclease (TALEN)-mediated genome editing technique. PCR and Southern blot results confirmed the site-specific integration of a single copy of the exogenous luciferase gene into the genome. To prove the reliability and sensitivity of this novel luciferase knock-in system, a CRISPR/Cas transcription activation system for the Sox2 gene was constructed and applied to the knock-in system. The results indicated that luciferase activity was directly correlated with the activity of the Sox2 endogenous promoter. This novel system will be a useful tool to study the transcriptional regulation of Sox2, and has great potential in medical and industrial applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Thiel, Gerald; Rössler, Oliver G
2018-06-05
The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Tomotaka eShinya
2016-04-01
Full Text Available Eucalyptus species constitutes the most widely planted hardwood trees in temperate and subtropical regions. In this study, we compared the transcript levels of genes involved in lignocellulose formation such as cellulose, hemicellulose and lignin biosynthesis in two selected three-year old hybrid Eucalyptus (Eucalyptus urophylla x E. grandis genotypes (AM063 and AM380 that have different lignin content. AM063 and AM380 had 20.2 and 35.5% of Klason lignin content and 59.0% and 48.2%, -cellulose contents, respectively. We investigated the correlation between wood properties and transcript levels of wood formation-related genes using RNA-seq with total RNAs extracted from developing xylem tissues at a breast height. Transcript levels of cell wall construction genes such as cellulose synthase (CesA and sucrose synthase (SUSY were almost the same in both genotypes. However, AM063 exhibited higher transcript levels of UDP-glucose pyrophosphorylase (UGP and xyloglucan endotransglucoxylase (XTH than those in AM380. Most monolignol biosynthesis- related isozyme genes showed higher transcript levels in AM380. These results indicate monolignol biosynthesis-related genes may regulate wood composition in Eucalyptus. Flavonoids contents were also observed at much higher levels in AM380 as a result of the elevated transcript levels of common phenylpropanoid pathway genes, phenylalanine ammonium lyase (PAL, cinnamate-4-hydroxylase (C4H and 4-coumarate-CoA ligase (4CL. Secondary plant cell wall formation is regulated by many transcription factors. We analyzed genes encoding NAC, WRKY, AP2/ERF and KNOX transcription factors and found higher transcript levels of these genes in AM380. We also observed increased transcription of some MYB and LIM domain transcription factors in AM380 compared to AM063. All these results show that genes related to monolignol biosynthesis may regulate the wood composition and help maintain the ratio of cellulose and lignin contents
Directory of Open Access Journals (Sweden)
Bontems Sébastien
2007-10-01
Full Text Available Abstract Background Varicella Zoster Virus Immediate Early 63 protein (IE63 has been shown to be essential for VZV replication, and critical for latency establishment. The activity of the protein as a transcriptional regulator is not fully clear yet. Using transient transfection assays, IE63 has been shown to repress viral and cellular promoters containing typical TATA boxes by interacting with general transcription factors. Results In this paper, IE63 regulation properties on endogenous gene expression were evaluated using an oligonucleotide-based micro-array approach. We found that IE63 modulates the transcription of only a few genes in HeLa cells including genes implicated in transcription or immunity. Furthermore, we showed that this effect is mediated by a modification of RNA POL II binding on the promoters tested and that IE63 phosphorylation was essential for these effects. In MeWo cells, the number of genes whose transcription was modified by IE63 was somewhat higher, including genes implicated in signal transduction, transcription, immunity, and heat-shock signalling. While IE63 did not modify the basal expression of several NF-κB dependent genes such as IL-8, ICAM-1, and IκBα, it modulates transcription of these genes upon TNFα induction. This effect was obviously correlated with the amount of p65 binding to the promoter of these genes and with histone H3 acetylation and HDAC-3 removal. Conclusion While IE63 only affected transcription of a small number of cellular genes, it interfered with the TNF-inducibility of several NF-κB dependent genes by the accelerated resynthesis of the inhibitor IκBα.
Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W
2017-08-10
DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.
Directory of Open Access Journals (Sweden)
O. V. Blazhenko
2014-02-01
Full Text Available In a previous study we cloned GSH2 gene, encoding γ-glutamylcysteine synthetase (γGCS in the yeast Hansenula рolymorpha. In this study an analysis of molecular organisation of the H. рolymorpha GSH2 gene promoter was conducted and the potential binding sites of Yap1, Skn7, Creb/Atf1, and Cbf1 transcription factors were detected. It was established that full regulation of GSH2 gene expression in the response to cadmium and oxidative stress requires the length of GSH2 promoter to be longer than 450 bp from the start of translation initiation. To study the transcriptional regulation of H. polymorpha GSH2 gene recombinant strain, harbouring a reporter system, in which 1.832 kb regulatory region of GSH2 gene was fused to structural and terminatory regions of alcohol oxidase gene, was constructed. It was shown that maximum increase in H. polymorpha GSH2 gene transcription by 33% occurs in the rich medium under four-hour incubation with 1 μM concentration of cadmium ions. In the minimal medium the GSH2 gene expression does not correlate with the increased total cellular glutathione levels under cadmium ion treatment. We assume that the increased content of total cellular glutathione under cadmium stress in the yeast H. polymorpha probably is not controlled on the level of GSH2 gene transcription.
Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.
Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K
1989-01-01
The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.
Quispe, Ruth L; Justino, Emily B; Vieira, Felipe N; Jaramillo, Michael L; Rosa, Rafael D; Perazzolo, Luciane M
2016-11-01
We have performed here a gene expression analysis to determine the developmental stage at the main genes involved in crustacean immune response begin to be expressed and their changes in mRNA abundance during shrimp development. By using a quantitative PCR-based approach, we have measured the mRNA abundance of 24 immune-related genes from different functional categories in twelve developmental stages ranging from fertilized eggs to larval and postlarval stages and also in juveniles. We showed for the first time that the main genes from the RNAi-based post-transcriptional pathway involved in shrimp antiviral immunity are transcribed in all developmental stages, but exhibit a diverse pattern of gene expression during shrimp ontogenesis. On the other hand, hemocyte-expressed genes mainly involved in antimicrobial defenses appeared to be transcribed in larval stages, indicating that hematopoiesis initiates early in development. Moreover, transcript levels of some genes were early detected in fertilized eggs at 0-4 h post-spawning, suggesting a maternal contribution of immune-related transcripts to shrimp progeny. Altogether, our results provide important clues regarding the ontogenesis of hemocytes as well the establishment of antiviral and antimicrobial defenses in shrimp. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Directory of Open Access Journals (Sweden)
Daniel Meier
Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Digital Repository Service at National Institute of Oceanography (India)
DeSouza-Ticlo, D.; Garg, S.; Raghukumar, C.
The effects of various synthetic medium components and their interactions with each other ultimately impact laccase production in fungi. This was studied using a laccase-hyper-producing marine-derived basidiomycete, Cerrena unicolor MTCC 5159...
DEFF Research Database (Denmark)
Vestergaard, Anna L; Knudsen, Ulla B; Munk, Torben
2011-01-01
Endometriosis is a painful chronic female disease defined by the presence of endometrial tissue implants in ectopic locations. The pathogenesis is much debated, and type I interferons could be involved. The expression of genes of the type I interferon response were profiled by a specific PCR Array...... of RNA obtained from ectopic and eutopic endometrium collected from 9 endometriosis patients and 9 healthy control women. Transcriptional expression levels of selected interferon-regulated and housekeeping genes were investigated by real-time quantitative reverse transcriptase PCR (qRT-PCR). Stably...... expressed housekeeping genes for valid normalization of transcriptional studies of endometrium and endometriosis have not yet been published. Here, seven housekeeping genes were evaluated for stability using the GeNorm and NormFinder software. A normalization factor based on HMBS, TBP, and YWHAZ expression...
Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine
2006-07-01
Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.
A transcription factor active on the epidermal growth factor receptor gene
International Nuclear Information System (INIS)
Kageyama, R.; Merlino, G.T.; Pastan, I.
1988-01-01
The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR
Enzyme-Catalyzed Oxidation of 17β-Estradiol Using Immobilized Laccase from Trametes versicolor
Cardinal-Watkins, Chantale; Nicell, Jim A.
2011-01-01
Many natural and synthetic estrogens are amenable to oxidation through the catalytic action of oxidative enzymes such as the fungal laccase Trametes versicolor. This study focused on characterizing the conversion of estradiol (E2) using laccase that had been immobilized by covalent bonding onto silica beads contained in a bench-scale continuous-flow packed bed reactor. Conversion of E2 accomplished in the reactor declined when the temperature of the system was changed from room temperature to just above freezing at pH 5 as a result of a reduced rate of reaction rather than inactivation of the enzyme. Similarly, conversion increased when the system was brought to warmer temperatures. E2 conversion increased when the pH of the influent to the immobilized laccase reactor was changed from pH 7 to pH 5, but longer-term experiments showed that the enzyme is more stable at pH 7. Results also showed that the immobilized laccase maintained its activity when treating a constant supply of aqueous E2 at a low mean residence time over a 12-hour period and when treating a constant supply of aqueous E2 at a high mean residence time over a period of 9 days. PMID:21869925
Chenthamarakshan, Aiswarya; Parambayil, Nayana; Miziriya, Nafeesathul; Soumya, P S; Lakshmi, M S Kiran; Ramgopal, Anala; Dileep, Anuja; Nambisan, Padma
2017-02-13
Fungal laccase has profound applications in different fields of biotechnology due to its broad specificity and high redox potential. Any successful application of the enzyme requires large scale production. As laccase production is highly dependent on medium components and cultural conditions, optimization of the same is essential for efficient product production. Production of laccase by fungal strain Marasmiellus palmivorus LA1 under solid state fermentation was optimized by the Taguchi design of experiments (DOE) methodology. An orthogonal array (L8) was designed using Qualitek-4 software to study the interactions and relative influence of the seven selected factors by one factor at a time approach. The optimum condition formulated was temperature (28 °C), pH (5), galactose (0.8%w/v), cupric sulphate (3 mM), inoculum concentration (number of mycelial agar pieces) (6Nos.) and substrate length (0.05 m). Overall yield increase of 17.6 fold was obtained after optimization. Statistical optimization leads to the elimination of an insignificant medium component ammonium dihydrogen phosphate from the process and contributes to a 1.06 fold increase in enzyme production. A final production of 667.4 ± 13 IU/mL laccase activity paves way for the application of this strain for industrial applications. Study optimized lignin degrading laccases from Marasmiellus palmivorus LA1. This laccases can thus be used for further applications in different scales of production after analyzing the properties of the enzyme. Study also confirmed the use of taguchi method for optimizations of product production.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Chicken globin gene transcription is cell lineage specific during the time of the switch
International Nuclear Information System (INIS)
Lois, R.; Martinson, H.G.
1989-01-01
Posttranscriptional silencing of embryonic globin gene expression occurs during hemoglobin switching in chickens. Here the authors use Percoll density gradients to fractionate the red blood cells of 5-9 day embryos in order to determine the cellular source and the timing of this posttranscriptional process. By means of nuclear run-on transcription in vitro they show that it is within mature primitive cells that production of embryonic globin mRNA is terminated posttranscriptionally. In contrast, young definitive cells produce little (or no) embryonic globin mRNA because of regulation at the transcriptional level. Thus the lineage specificity of embryonic and adult globin gene expression is determined transcriptionally, and the posttranscriptional process described by Landes et al. is a property of the senescing primitive cells, not a mechanism operative in the hemoglobin switch. This conclusion is supported by [ 3 H]leucine incorporation experiments on Percoll-fractionated cells which reveal no posttranscriptional silencing of the embryonic genes during the early stages of the switch. In the course of these studies they have noticed a strong transcriptional pause near the second exon of the globin genes which is induced by 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) and which resembles a natural pause near that position
De La Torre, María; Martín-Sampedro, Raquel; Fillat, Úrsula; Eugenio, María E; Blánquez, Alba; Hernández, Manuel; Arias, María E; Ibarra, David
2017-11-01
This study evaluates the potential of a bacterial laccase from Streptomyces ipomoeae (SilA) for delignification and detoxification of steam-exploded wheat straw, in comparison with a commercial fungal laccase from Trametes villosa. When alkali extraction followed by SilA laccase treatment was applied to the water insoluble solids fraction, a slight reduction in lignin content was detected, and after a saccharification step, an increase in both glucose and xylose production (16 and 6%, respectively) was observed. These effects were not produced with T. villosa laccase. Concerning to the fermentation process, the treatment of the steam-exploded whole slurry with both laccases produced a decrease in the phenol content by up to 35 and 71% with bacterial and fungal laccases, respectively. The phenols reduction resulted in an improved performance of Saccharomyces cerevisiae during a simultaneous saccharification and fermentation (SSF) process, improving ethanol production rate. This enhancement was more marked with a presaccharification step prior to the SSF process.
International Nuclear Information System (INIS)
Thomassen, Mads; Tan, Qihua; Kruse, Torben A
2008-01-01
Metastasis is believed to progress in several steps including different pathways but the determination and understanding of these mechanisms is still fragmentary. Microarray analysis of gene expression patterns in breast tumors has been used to predict outcome in recent studies. Besides classification of outcome, these global expression patterns may reflect biological mechanisms involved in metastasis of breast cancer. Our purpose has been to investigate pathways and transcription factors involved in metastasis by use of gene expression data sets. We have analyzed 8 publicly available gene expression data sets. A global approach, 'gene set enrichment analysis' as well as an approach focusing on a subset of significantly differently regulated genes, GenMAPP, has been applied to rank pathway gene sets according to differential regulation in metastasizing tumors compared to non-metastasizing tumors. Meta-analysis has been used to determine overrepresentation of pathways and transcription factors targets, concordant deregulated in metastasizing breast tumors, in several data sets. The major findings are up-regulation of cell cycle pathways and a metabolic shift towards glucose metabolism reflected in several pathways in metastasizing tumors. Growth factor pathways seem to play dual roles; EGF and PDGF pathways are decreased, while VEGF and sex-hormone pathways are increased in tumors that metastasize. Furthermore, migration, proteasome, immune system, angiogenesis, DNA repair and several signal transduction pathways are associated to metastasis. Finally several transcription factors e.g. E2F, NFY, and YY1 are identified as being involved in metastasis. By pathway meta-analysis many biological mechanisms beyond major characteristics such as proliferation are identified. Transcription factor analysis identifies a number of key factors that support central pathways. Several previously proposed treatment targets are identified and several new pathways that may
Application of Bacterial Laccases for Sustainable Energy Production
DEFF Research Database (Denmark)
Lörcher, Samuel; Koschorreck, Katja; Shipovskov, Stepan
for a number of special applications, such as disposable implantable power suppliers for medical sensor-transmitters and drug delivery/activator systems and self-powered enzyme-based biosensors; and they do offer practical advantages of using abundant organic raw materials for clean and sustainable energy...... in vivo glucose monitoring in diabetes patients). However, the most attractive are oxygen-reducing enzymes such as blue-copper-containing laccases coupled to electrodes, which provide the 4e- bioelectroreduction of O2 to H2O (1.23 V vs. NHE) at potentials approaching the thermodynamic ones. Exploitation...... of laccase-based biocathodes in the biofuel cells and in the hybrid biobattery-type or photovoltaic power sources could essentially broaden their application, enabling extraction of energy from the sea water/water dissolved oxygen. Here we demonstrate up to 0.8 mW cm-2 extracted power densities and 1.5 month...
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Directory of Open Access Journals (Sweden)
Wang Shu-Qiang
2012-07-01
Full Text Available Abstract Background A key challenge in the post genome era is to identify genome-wide transcriptional regulatory networks, which specify the interactions between transcription factors and their target genes. Numerous methods have been developed for reconstructing gene regulatory networks from expression data. However, most of them are based on coarse grained qualitative models, and cannot provide a quantitative view of regulatory systems. Results A binding affinity based regulatory model is proposed to quantify the transcriptional regulatory network. Multiple quantities, including binding affinity and the activity level of transcription factor (TF are incorporated into a general learning model. The sequence features of the promoter and the possible occupancy of nucleosomes are exploited to estimate the binding probability of regulators. Comparing with the previous models that only employ microarray data, the proposed model can bridge the gap between the relative background frequency of the observed nucleotide and the gene's transcription rate. Conclusions We testify the proposed approach on two real-world microarray datasets. Experimental results show that the proposed model can effectively identify the parameters and the activity level of TF. Moreover, the kinetic parameters introduced in the proposed model can reveal more biological sense than previous models can do.
Energy Technology Data Exchange (ETDEWEB)
Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp
2015-07-31
Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.
Singh, Gursharan; Sharma, Prince; Capalash, Neena
2009-08-01
An alkalophilic and halotolerant laccase from gamma-proteobacterium JB catalyzed in high concentrations of organic solvents and various salts. The enzyme retained 80-100% activity in 10% concentration of dimethylsulfoxide (DMSO), ethanol, acetone or methanol; 100, 85 and 50% activity in 20 mM MgCl(2), 5.0 mM MnCl(2) and 0.1 mM CuCl(2); 140, 120 and 110% activity in 5.0 mM MnSO(4), 10 mM MgSO(4) and 1mM CaSO(4), respectively. Sodium halides inhibited the enzyme in the order: F(-)> Br(-)> I(-)> Cl(-). In 0.5 M NaCl, pH 6.0, laccase was approximately 60% active. Decolorization of indigo carmine by laccase at pH 9.0 was not inhibited even in the presence of 0.5 M NaCl. Release of chromophoric, reducing and hydrophobic compounds during biobleaching of straw rich-soda pulp by laccase was not inhibited when the enzyme was applied in the presence of 1 M NaCl at pH 8.0. Laccase retained 50% residual activity even when incubated with 5% calcium hypochlorite for 30 min.
Czech Academy of Sciences Publication Activity Database
Skálová, Tereza; Dohnálek, Jan; Ostergaard, L. H.; Ostergaard, P. R.; Kolenko, Petr; Dušková, Jarmila; Štěpánková, Andrea; Hašek, Jindřich
2009-01-01
Roč. 385, č. 4 (2009), s. 1165-1178 ISSN 0022-2836 R&D Projects: GA MŠk 1K05008; GA ČR GA305/07/1073; GA AV ČR 1ET400500402 Institutional research plan: CEZ:AV0Z40500505 Keywords : laccase * oxidoreductase * multicopper blue protein * Streptomyces coelicolor * crystal structure Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.871, year: 2009
Transcriptional regulation of the tyrosine hydroxylase gene by glucocorticoid and cyclic AMP
International Nuclear Information System (INIS)
Lewis, E.J.; Harrington, C.A.; Chikaraishi, D.M.
1987-01-01
Glucocorticoid and cyclic AMP increase tyrosine hydroxylase (TH) activity and mRNA levels in pheochromocytoma cultures. The transcriptional activity of the TH gene, as measured by nuclear run-on assay, is also increased when cultures are treated with the synthetic glucocorticoid dexamethasone or agents that increase intracellular cyclic AMP, such as forskolin and 8-BrcAMP. Both inducers effect transcriptional changes within 10 min after treatment and are maximal after 30 min for forskolin and after 60 min for dexamethasone. The 5' flanking sequences of the TH gene were fused to the bacterial gene chloramphenicol acetyltransferase (CAT), and the hybrid gene was transfected into pheochromocytoma cultures and GH 4 pituitary cells. In both cell lines, a region of the TH gene containing bases -272 to +27 conferred induction of CAT by cyclic AMP, but not by glucocorticoid. The same results were found when a region of the TH gene containing -773 to + 27 was used. Thus, the sequences required for induction of TH by cyclic AMP are contained within 272 bases of 5' flanking sequence, but sequences sufficient for glucocorticoid regulation are not contained with 773 bases
Ahi, Ehsan Pashay; Kapralova, Kalina Hristova; Pálsson, Arnar; Maier, Valerie Helene; Gudbrandsson, Jóhannes; Snorrason, Sigurdur S; Jónsson, Zophonías O; Franzdóttir, Sigrídur Rut
2014-01-01
Understanding the molecular basis of craniofacial variation can provide insights into key developmental mechanisms of adaptive changes and their role in trophic divergence and speciation. Arctic charr (Salvelinus alpinus) is a polymorphic fish species, and, in Lake Thingvallavatn in Iceland, four sympatric morphs have evolved distinct craniofacial structures. We conducted a gene expression study on candidates from a conserved gene coexpression network, focusing on the development of craniofacial elements in embryos of two contrasting Arctic charr morphotypes (benthic and limnetic). Four Arctic charr morphs were studied: one limnetic and two benthic morphs from Lake Thingvallavatn and a limnetic reference aquaculture morph. The presence of morphological differences at developmental stages before the onset of feeding was verified by morphometric analysis. Following up on our previous findings that Mmp2 and Sparc were differentially expressed between morphotypes, we identified a network of genes with conserved coexpression across diverse vertebrate species. A comparative expression study of candidates from this network in developing heads of the four Arctic charr morphs verified the coexpression relationship of these genes and revealed distinct transcriptional dynamics strongly correlated with contrasting craniofacial morphologies (benthic versus limnetic). A literature review and Gene Ontology analysis indicated that a significant proportion of the network genes play a role in extracellular matrix organization and skeletogenesis, and motif enrichment analysis of conserved noncoding regions of network candidates predicted a handful of transcription factors, including Ap1 and Ets2, as potential regulators of the gene network. The expression of Ets2 itself was also found to associate with network gene expression. Genes linked to glucocorticoid signalling were also studied, as both Mmp2 and Sparc are responsive to this pathway. Among those, several transcriptional
Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family
Directory of Open Access Journals (Sweden)
Bowerman Bruce
2009-08-01
Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456
Stimulation of albumin gene transcription by insulin in primary cultures of rat hepatocytes
International Nuclear Information System (INIS)
Lloyd, C.E.; Kalinyak, J.E.; Hutson, S.M.; Jefferson, L.S.
1987-01-01
The first goal of the work reported here was to prepare single-stranded DNA sequences for use in studies on the regulation of albumin gene expression. A double-stranded rat albumin cDNA clone was subcloned into the bacteriophage vector M13mp7. Single-stranded recombinant clones were screened for albumin sequences containing either the mRNA strand or the complementary strand. Two clones were selected that contained the 1200 nucleotide long 3' end of the albumin sequence. DNA from the clone containing the mRNA strand was used as a template for DNA polymerase I to prepare a radiolabeled, single-stranded cDNA to albumin mRNA. This radiolabeled cDNA probe was used to quantitate the relative abundance of albumin mRNA in samples of total cellular RNA. DNA from the clone containing the complementary strand was used to measure relative rates of albumin gene transcription in isolated nuclei. The second goal was to use the single-stranded DNA probes to investigate the mechanism of the insulin-mediated stimulation of albumin synthesis in primary cultures of rat hepatocytes. Addition of insulin to hepatocytes maintained in a chemically defined, serum-free medium for 40 h in the absence of any hormones resulted in a specific 1.5- to 2.5-fold stimulation of albumin gene transcription that was maximal at 3 h and was maintained above control values for at least 24 h. The rate of albumin gene transcription in nuclei isolated from livers of diabetic rats was reduced to 50% of the value recorded in control nuclei. Taken together, these findings demonstrate that insulin regulates synthesis of albumin at the level of gene transcription
Induced tubulin synthesis is caused by induced gene transcription in Tetrahymena
International Nuclear Information System (INIS)
Seyfert, H.M.; Kohle, D.; Jenovai, S.
1987-01-01
Tubulin synthesis and tubulin mRNA concentrations increase to variable extents during ciliary regeneration in the ciliate Tetrahymena. Experiments described here were carried out to determine whether the increased tubulin mRNa concentrations are due to induced transcription of tubulin genes or to stabilization of tubulin mRNA. In vivo labeling experiments with [ 3 H]uridine and in vitro transcription assays suggest that under conditions of increased protein and tubulin synthesis the rate of transcription is enhanced. Hybridization assays of in vitro transcribed RNA also demonstrate qualitatively that the tubulin genes are transcribed at higher rates when tubulin synthesis is stimulated during ciliary regeneration. This observation is supported by measurements of the half-life of tubulin mRNA molecules in nondeciliated cells: This is approximately 2 h. Since the concentration of tubulin mRNA in cells engaged in cilia regeneration increases from 5 to 19-fold during the first hour of the regeneration period, even a complete stabilization of the tubulin mRNA molecules could not account for an increase in tubulin mRNA concentration of this magnitude
González Arzola, K; Gimeno, Y; Arévalo, M C; Falcón, M A; Hernández Creus, A
2010-08-01
The redox potential of the T1 copper site of laccase from Fusarium proliferatum was determined by titration to be about 510 mV vs. SCE (750 mV vs. NHE), which makes it a high redox potential enzyme. Anaerobic electron transfer reactions between laccase and carbon and gold electrodes were detected, both in solution and when the enzyme was adsorbed on these surfaces. In solution, a single high-potential signal (660 mV vs. SCE) was recorded at the carbon surfaces, attributable to the T1 copper site of the enzyme. However, a well-defined oxidative process at about 660 mV and an anodic wave at 350 mV vs. SCE were recorded at the gold electrode, respectively associated with the T1 and T2 copper sites. Laccase-modified carbon electrodes behaved analogously when the enzyme was in solution, unlike laccase adsorbed on gold, which showed only a low-potential signal. Laccase molecules were successfully imaged by AFM; obtaining a thick compact stable film on Au(111), and large aggregates forming a complex network of small branches leaving voids on the HOPG surface. Laccase-modified carbon electrodes retained significant enzymatic activity, efficiently oxidising violuric acid and reducing molecular oxygen. Explanations are proposed for how protein-film organisation affects the electrode function. Copyright (c) 2009 Elsevier B.V. All rights reserved.
Regulation of a transcription factor network by Cdk1 coordinates late cell cycle gene expression.
Landry, Benjamin D; Mapa, Claudine E; Arsenault, Heather E; Poti, Kristin E; Benanti, Jennifer A
2014-05-02
To maintain genome stability, regulators of chromosome segregation must be expressed in coordination with mitotic events. Expression of these late cell cycle genes is regulated by cyclin-dependent kinase (Cdk1), which phosphorylates a network of conserved transcription factors (TFs). However, the effects of Cdk1 phosphorylation on many key TFs are not known. We find that elimination of Cdk1-mediated phosphorylation of four S-phase TFs decreases expression of many late cell cycle genes, delays mitotic progression, and reduces fitness in budding yeast. Blocking phosphorylation impairs degradation of all four TFs. Consequently, phosphorylation-deficient mutants of the repressors Yox1 and Yhp1 exhibit increased promoter occupancy and decreased expression of their target genes. Interestingly, although phosphorylation of the transcriptional activator Hcm1 on its N-terminus promotes its degradation, phosphorylation on its C-terminus is required for its activity, indicating that Cdk1 both activates and inhibits a single TF. We conclude that Cdk1 promotes gene expression by both activating transcriptional activators and inactivating transcriptional repressors. Furthermore, our data suggest that coordinated regulation of the TF network by Cdk1 is necessary for faithful cell division.
Schmeier, Sebastian; MacPherson, Cameron R; Essack, Magbubah; Kaur, Mandeep; Schaefer, Ulf; Suzuki, Harukazu; Hayashizaki, Yoshihide; Bajic, Vladimir B.
2009-01-01
Background: Macrophages are immune cells involved in various biological processes including host defence, homeostasis, differentiation, and organogenesis. Disruption of macrophage biology has been linked to increased pathogen infection, inflammation and malignant diseases. Differential gene expression observed in monocytic differentiation is primarily regulated by interacting transcription factors (TFs). Current research suggests that microRNAs (miRNAs) degrade and repress translation of mRNA, but also may target genes involved in differentiation. We focus on getting insights into the transcriptional circuitry regulating miRNA genes expressed during monocytic differentiation. Results: We computationally analysed the transcriptional circuitry of miRNA genes during monocytic differentiation using in vitro time-course expression data for TFs and miRNAs. A set of TF?miRNA associations was derived from predicted TF binding sites in promoter regions of miRNA genes. Time-lagged expression correlation analysis was utilised to evaluate the TF?miRNA associations. Our analysis identified 12 TFs that potentially play a central role in regulating miRNAs throughout the differentiation process. Six of these 12 TFs (ATF2, E2F3, HOXA4, NFE2L1, SP3, and YY1) have not previously been described to be important for monocytic differentiation. The remaining six TFs are CEBPB, CREB1, ELK1, NFE2L2, RUNX1, and USF2. For several miRNAs (miR-21, miR-155, miR-424, and miR-17-92), we show how their inferred transcriptional regulation impacts monocytic differentiation. Conclusions: The study demonstrates that miRNAs and their transcriptional regulatory control are integral molecular mechanisms during differentiation. Furthermore, it is the first study to decipher on a large-scale, how miRNAs are controlled by TFs during human monocytic differentiation. Subsequently, we have identified 12 candidate key controllers of miRNAs during this differentiation process. 2009 Schmeier et al; licensee Bio
Schmeier, Sebastian
2009-12-10
Background: Macrophages are immune cells involved in various biological processes including host defence, homeostasis, differentiation, and organogenesis. Disruption of macrophage biology has been linked to increased pathogen infection, inflammation and malignant diseases. Differential gene expression observed in monocytic differentiation is primarily regulated by interacting transcription factors (TFs). Current research suggests that microRNAs (miRNAs) degrade and repress translation of mRNA, but also may target genes involved in differentiation. We focus on getting insights into the transcriptional circuitry regulating miRNA genes expressed during monocytic differentiation. Results: We computationally analysed the transcriptional circuitry of miRNA genes during monocytic differentiation using in vitro time-course expression data for TFs and miRNAs. A set of TF?miRNA associations was derived from predicted TF binding sites in promoter regions of miRNA genes. Time-lagged expression correlation analysis was utilised to evaluate the TF?miRNA associations. Our analysis identified 12 TFs that potentially play a central role in regulating miRNAs throughout the differentiation process. Six of these 12 TFs (ATF2, E2F3, HOXA4, NFE2L1, SP3, and YY1) have not previously been described to be important for monocytic differentiation. The remaining six TFs are CEBPB, CREB1, ELK1, NFE2L2, RUNX1, and USF2. For several miRNAs (miR-21, miR-155, miR-424, and miR-17-92), we show how their inferred transcriptional regulation impacts monocytic differentiation. Conclusions: The study demonstrates that miRNAs and their transcriptional regulatory control are integral molecular mechanisms during differentiation. Furthermore, it is the first study to decipher on a large-scale, how miRNAs are controlled by TFs during human monocytic differentiation. Subsequently, we have identified 12 candidate key controllers of miRNAs during this differentiation process. 2009 Schmeier et al; licensee Bio
Sp1 and CREB regulate basal transcription of the human SNF2L gene
International Nuclear Information System (INIS)
Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin
2008-01-01
Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene
Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel
2016-04-26
Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Gene expression and metabolite changes during Tuber magnatum fruiting body storage.
Zampieri, Elisa; Guzzo, Flavia; Commisso, Mauro; Mello, Antonietta; Bonfante, Paola; Balestrini, Raffaella
2014-11-01
The aim of this study was to investigate the impact of different 4 °C post-harvest storage periods on the quality of the white truffle Tuber magnatum. The expression of selected genes and the profiles of non-volatile metabolites have been analyzed. The up-regulation of genes related to cell wall metabolism and to a putative laccase points to cell wall modifications and browning events during cold storage. Time course RT-qPCR experiments have demonstrated that such transcription events probably depend on the ripening status, since this is delayed in partially ripe fruiting bodies. Changes in the concentrations of linoleate-derived metabolites occur during the first 3 days of considered cold storage, while the other metabolites, such as the amino acids, do not change. Taken together, the results demonstrate that complex molecular events occur in white truffles in the post-harvest period and before they are used as fresh products.
Sitarz, Anna K; Mikkelsen, Jørn D; Højrup, Peter; Meyer, Anne S
2013-12-10
Based on a differential pre-screening of 44 white-rot fungi on a lignocellulose-supplemented minimal medium, four basidiomycetes were selected for further study: Ganoderma lucidum, Polyporus brumalis, Polyporus ciliatus and Trametes versicolor. Only G. lucidum was able to grow vividly on malt extract or minimal media supplemented with alkali lignin. When grown on malt extract or minimal medium supplemented with lignocellulose (sugar cane bagasse), the crude G. lucidum protein extract exhibited high laccase activity, ∼3U/mL toward syringaldazine. This activity was 13-17 fold higher than the corresponding activities of the crude protein extracts of P. brumalis, P. ciliatus and T. versicolor. Native PAGE electrophoresis of the crude G. lucidum extract confirmed the presence of an active laccase. The G. lucidum laccase had a molecular weight of ∼62.5kDa, and a Km value of 0.107mM (determined on ABTS). A partial amino acid sequence analysis of four short de novo sequenced peptides, defined after trypsin digest analysis using MALDI-TOF MS/MS analysis, revealed 64-100% homology to sequences in related laccases in the UniProt database, but also indicated that certain sequence stretches had low homology. Addition of the laccase-rich G. lucidum broth to lignocellulosic biomass (pretreated sugar cane bagasse) together with a state-of-the-art cellulase enzyme preparation (Cellic™CTec1) produced significantly increased cellulolytic yields, which were also better than those obtained with a T. versicolor laccase addition, indicating that the laccase from G. lucidum has unique properties that may be momentous in lignocellulosic biomass conversion. Copyright © 2013 Elsevier Inc. All rights reserved.
Gene expression of herpes simplex virus. II. Uv radiological analysis of viral transcription units
International Nuclear Information System (INIS)
Millette, R. L.; Klaiber, R.
1980-01-01
The transcriptional organization of the genome of herpes simplex virus type 1 was analyzed by measuring the sensitivity of viral polypeptide synthesis to uv irradiation of the infecting virus. Herpes simplex virus type 1 was irradiated with various doses of uv light and used to infect xeroderma pigmentosum fibroblasts. Immediate early transcription units were analyzed by having cycloheximide present throughout the period of infection, removing the drug at 8 h postinfection, and pulse-labeling proteins with [355]methionine. Delayed early transcription units were analyzed in similar studies by having 9-beta-D-arabinofuranosyladenine present during the experiment to block replication of the input irradiated genome. The results indicate that none of the immediate early genes analyzed can be cotranscribed, whereas some of the delayed early genes might be cotranscribed. No evidence was found for the existence of large, multigene transcription units
Directory of Open Access Journals (Sweden)
Agbaje LATEEF
2015-12-01
Full Text Available This study reports the multi-step mutagenesis of Lentinus edodes towards optimization of the production of laccase and novel application of laccase in the biosynthesis of silver nanoparticles (AgNPs which could be used to develop an eco-friendly method for the rapid biosynthesis of AgNPs. The wild strain of L. edodes was subjected to UV irradiation at 254 nm and the resultant viable mutant was further treated with acridine orange, a chemical mutagen. The strains were evaluated for the production of laccase and the crude laccase of the UV mutant (UV10 was used for the green synthesis of AgNPs. The particles were characterized by UV-Visible spectroscopy, Fourier transform infrared (FTIR spectroscopy and scanning electron microscopy (SEM. Laccase activities of wild, UV10 and UV10ACR8 strains of L. edodes were obtained as 2.6, 10.6 and 2.8 U/ml/min respectively after 7 days of fermentation, showing laccase yield improvement of 4.08-fold for UV10 mutant. UV-Visible spectroscopy indicated the formation of AgNPs at absorption band of 430 nm. FTIR result indicated that proteins were responsible for AgNP synthesis, while SEM analysis confirmed the formation of walnut-shaped nanoparticles with size range of 50-100 nm. The biosynthesized nanoparticles revealed effective inhibition against clinical isolates of Escherichia coli, Pseudomonas aeruginosa and Klebsiella pneumoniae. To the best of the authors’ knowledge, this result represents the first report on the biosynthesis of AgNPs using L. edodes metabolite. The report adds to the growing relevance of L. edodes as potential industrially viable organism, used for diverse biotechnological applications.
Transcriptional profiling uncovers a network of cholesterol-responsive atherosclerosis target genes.
Directory of Open Access Journals (Sweden)
Josefin Skogsberg
2008-03-01
Full Text Available Despite the well-documented effects of plasma lipid lowering regimes halting atherosclerosis lesion development and reducing morbidity and mortality of coronary artery disease and stroke, the transcriptional response in the atherosclerotic lesion mediating these beneficial effects has not yet been carefully investigated. We performed transcriptional profiling at 10-week intervals in atherosclerosis-prone mice with human-like hypercholesterolemia and a genetic switch to lower plasma lipoproteins (Ldlr(-/-Apo(100/100Mttp(flox/flox Mx1-Cre. Atherosclerotic lesions progressed slowly at first, then expanded rapidly, and plateaued after advanced lesions formed. Analysis of lesion expression profiles indicated that accumulation of lipid-poor macrophages reached a point that led to the rapid expansion phase with accelerated foam-cell formation and inflammation, an interpretation supported by lesion histology. Genetic lowering of plasma cholesterol (e.g., lipoproteins at this point all together prevented the formation of advanced plaques and parallel transcriptional profiling of the atherosclerotic arterial wall identified 37 cholesterol-responsive genes mediating this effect. Validation by siRNA-inhibition in macrophages incubated with acetylated-LDL revealed a network of eight cholesterol-responsive atherosclerosis genes regulating cholesterol-ester accumulation. Taken together, we have identified a network of atherosclerosis genes that in response to plasma cholesterol-lowering prevents the formation of advanced plaques. This network should be of interest for the development of novel atherosclerosis therapies.
Kibinge, Nelson; Ono, Naoaki; Horie, Masafumi; Sato, Tetsuo; Sugiura, Tadao; Altaf-Ul-Amin, Md; Saito, Akira; Kanaya, Shigehiko
2016-06-01
Conventionally, workflows examining transcription regulation networks from gene expression data involve distinct analytical steps. There is a need for pipelines that unify data mining and inference deduction into a singular framework to enhance interpretation and hypotheses generation. We propose a workflow that merges network construction with gene expression data mining focusing on regulation processes in the context of transcription factor driven gene regulation. The pipeline implements pathway-based modularization of expression profiles into functional units to improve biological interpretation. The integrated workflow was implemented as a web application software (TransReguloNet) with functions that enable pathway visualization and comparison of transcription factor activity between sample conditions defined in the experimental design. The pipeline merges differential expression, network construction, pathway-based abstraction, clustering and visualization. The framework was applied in analysis of actual expression datasets related to lung, breast and prostrate cancer. Copyright © 2016 Elsevier Inc. All rights reserved.
Bowen, Lizabeth; Miles, A. Keith; Murray, Michael; Haulena, Martin; Tuttle, Judy; van Bonn, William; Adams, Lance; Bodkin, James L.; Ballachey, Brenda E.; Estes, James A.; Tinker, M. Tim; Keister, Robin; Stott, Jeffrey L.
2012-01-01
Gene transcription analysis for diagnosing or monitoring wildlife health requires the ability to distinguish pathophysiological change from natural variation. Herein, we describe methodology for the development of quantitative real-time polymerase chain reaction (qPCR) assays to measure differential transcript levels of multiple immune function genes in the sea otter (Enhydra lutris); sea otter-specific qPCR primer sequences for the genes of interest are defined. We establish a ‘reference’ range of transcripts for each gene in a group of clinically healthy captive and free-ranging sea otters. The 10 genes of interest represent multiple physiological systems that play a role in immuno-modulation, inflammation, cell protection, tumour suppression, cellular stress response, xenobiotic metabolizing enzymes, antioxidant enzymes and cell–cell adhesion. The cycle threshold (CT) measures for most genes were normally distributed; the complement cytolysis inhibitor was the exception. The relative enumeration of multiple gene transcripts in simple peripheral blood samples expands the diagnostic capability currently available to assess the health of sea otters in situ and provides a better understanding of the state of their environment.
International Nuclear Information System (INIS)
Smialowska, Agata; Djupedal, Ingela; Wang, Jingwen; Kylsten, Per; Swoboda, Peter; Ekwall, Karl
2014-01-01
Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its role in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe
Directory of Open Access Journals (Sweden)
Ma Menggen
2010-06-01
Full Text Available Abstract Background Derived from our lignocellulosic conversion inhibitor-tolerant yeast, we generated an ethanol-tolerant strain Saccharomyces cerevisiae NRRL Y-50316 by enforced evolutionary adaptation. Using a newly developed robust mRNA reference and a master equation unifying gene expression data analyses, we investigated comparative quantitative transcription dynamics of 175 genes selected from previous studies for an ethanol-tolerant yeast and its closely related parental strain. Results A highly fitted master equation was established and applied for quantitative gene expression analyses using pathway-based qRT-PCR array assays. The ethanol-tolerant Y-50316 displayed significantly enriched background of mRNA abundance for at least 35 genes without ethanol challenge compared with its parental strain Y-50049. Under the ethanol challenge, the tolerant Y-50316 responded in consistent expressions over time for numerous genes belonging to groups of heat shock proteins, trehalose metabolism, glycolysis, pentose phosphate pathway, fatty acid metabolism, amino acid biosynthesis, pleiotropic drug resistance gene family and transcription factors. The parental strain showed repressed expressions for many genes and was unable to withstand the ethanol stress and establish a viable culture and fermentation. The distinct expression dynamics between the two strains and their close association with cell growth, viability and ethanol fermentation profiles distinguished the tolerance-response from the stress-response in yeast under the ethanol challenge. At least 82 genes were identified as candidate and key genes for ethanol-tolerance and subsequent fermentation under the stress. Among which, 36 genes were newly recognized by the present study. Most of the ethanol-tolerance candidate genes were found to share protein binding motifs of transcription factors Msn4p/Msn2p, Yap1p, Hsf1p and Pdr1p/Pdr3p. Conclusion Enriched background of transcription abundance
Purification and characterization of laccase from Trametes hirsuta ...
African Journals Online (AJOL)
oem
2012-02-21
Feb 21, 2012 ... wine, and in beer stabilization (Minussi et al., 2002), paper pulp .... Laccase was incubated with ethanol and acetonitrile 20% at room temperature for 24 h. ... Apparent kinetic constants (Km, Vmax) were calculated using ..... from Trametes versicolor produced by solid-substrate fermentation. Adv. Biosci.
Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription
International Nuclear Information System (INIS)
Rauen, Thomas; Frye, Bjoern C.; Wang, Jialin; Raffetseder, Ute; Alidousty, Christina; En-Nia, Abdelaziz; Floege, Jürgen; Mertens, Peter R.
2016-01-01
Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3′ enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3′ adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPO production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. - Highlights: • Hypoxia drives nuclear translocation of cold shock protein YB-1. • YB-1 physically interacts with hypoxia-inducible factor (HIF)-1α. • YB-1 binds to the hypoxia-responsive element (HRE) within the erythropoietin (EPO) 3′ enhancer. • YB-1 trans-regulates transcription of hypoxia-dependent genes such as EPO and VEGF.
New PAH gene promoter KLF1 and 3'-region C/EBPalpha motifs influence transcription in vitro.
Klaassen, Kristel; Stankovic, Biljana; Kotur, Nikola; Djordjevic, Maja; Zukic, Branka; Nikcevic, Gordana; Ugrin, Milena; Spasovski, Vesna; Srzentic, Sanja; Pavlovic, Sonja; Stojiljkovic, Maja
2017-02-01
Phenylketonuria (PKU) is a metabolic disease caused by mutations in the phenylalanine hydroxylase (PAH) gene. Although the PAH genotype remains the main determinant of PKU phenotype severity, genotype-phenotype inconsistencies have been reported. In this study, we focused on unanalysed sequences in non-coding PAH gene regions to assess their possible influence on the PKU phenotype. We transiently transfected HepG2 cells with various chloramphenicol acetyl transferase (CAT) reporter constructs which included PAH gene non-coding regions. Selected non-coding regions were indicated by in silico prediction to contain transcription factor binding sites. Furthermore, electrophoretic mobility shift assay (EMSA) and supershift assays were performed to identify which transcriptional factors were engaged in the interaction. We found novel KLF1 motif in the PAH promoter, which decreases CAT activity by 50 % in comparison to basal transcription in vitro. The cytosine at the c.-170 promoter position creates an additional binding site for the protein complex involving KLF1 transcription factor. Moreover, we assessed for the first time the role of a multivariant variable number tandem repeat (VNTR) region located in the 3'-region of the PAH gene. We found that the VNTR3, VNTR7 and VNTR8 constructs had approximately 60 % of CAT activity. The regulation is mediated by the C/EBPalpha transcription factor, present in protein complex binding to VNTR3. Our study highlighted two novel promoter KLF1 and 3'-region C/EBPalpha motifs in the PAH gene which decrease transcription in vitro and, thus, could be considered as PAH expression modifiers. New transcription motifs in non-coding regions will contribute to better understanding of the PKU phenotype complexity and may become important for the optimisation of PKU treatment.
Yang, Jie; Yang, Xiaodan; Lin, Yonghui; Ng, Tzi Bun; Lin, Juan; Ye, Xiuyun
2015-01-01
Malachite green (MG) was decolorized by laccase (LacA) of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL-1 LacA, 109.9 mg L-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s-1, respectively. UV–visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography–mass spectrometry (LC-MS) analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries. PMID:26020270
Directory of Open Access Journals (Sweden)
Jie Yang
Full Text Available Malachite green (MG was decolorized by laccase (LacA of white-rot fungus Cerrena sp. with strong decolorizing ability. Decolorization conditions were optimized with response surface methodology. A highly significant quadratic model was developed to investigate MG decolorization with LacA, and the maximum MG decolorization ratio of 91.6% was predicted under the conditions of 2.8 U mL(-1 LacA, 109.9 mg L(-1 MG and decolorization for 172.4 min. Kinetic studies revealed the Km and kcat values of LacA toward MG were 781.9 mM and 9.5 s(-1, respectively. UV-visible spectra confirmed degradation of MG, and the degradation mechanism was explored with liquid chromatography-mass spectrometry (LC-MS analysis. Based on the LC-MS spectra of degradation products, LacA catalyzed MG degradation via two simultaneous pathways. In addition, the phytotoxicity of MG, in terms of inhibition on seed germination and seedling root elongation of Nicotiana tabacum and Lactuca sativa, was reduced after laccase treatment. These results suggest that laccase of Cerrena was effective in decolorizing MG and promising in bioremediation of wastewater in food and aquaculture industries.
Directory of Open Access Journals (Sweden)
Rebeccah J Katzenberger
Full Text Available To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE. The TCE functions in the 5' untranslated region of Mst(3CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and
Katzenberger, Rebeccah J; Rach, Elizabeth A; Anderson, Ashley K; Ohler, Uwe; Wassarman, David A
2012-01-01
To investigate the importance of core promoter elements for tissue-specific transcription of RNA polymerase II genes, we examined testis-specific transcription in Drosophila melanogaster. Bioinformatic analyses of core promoter sequences from 190 genes that are specifically expressed in testes identified a 10 bp A/T-rich motif that is identical to the translational control element (TCE). The TCE functions in the 5' untranslated region of Mst(3)CGP mRNAs to repress translation, and it also functions in a heterologous gene to regulate transcription. We found that among genes with focused initiation patterns, the TCE is significantly enriched in core promoters of genes that are specifically expressed in testes but not in core promoters of genes that are specifically expressed in other tissues. The TCE is variably located in core promoters and is conserved in melanogaster subgroup species, but conservation dramatically drops in more distant species. In transgenic flies, short (300-400 bp) genomic regions containing a TCE directed testis-specific transcription of a reporter gene. Mutation of the TCE significantly reduced but did not abolish reporter gene transcription indicating that the TCE is important but not essential for transcription activation. Finally, mutation of testis-specific TFIID (tTFIID) subunits significantly reduced the transcription of a subset of endogenous TCE-containing but not TCE-lacking genes, suggesting that tTFIID activity is limited to TCE-containing genes but that tTFIID is not an obligatory regulator of TCE-containing genes. Thus, the TCE is a core promoter element in a subset of genes that are specifically expressed in testes. Furthermore, the TCE regulates transcription in the context of short genomic regions, from variable locations in the core promoter, and both dependently and independently of tTFIID. These findings set the stage for determining the mechanism by which the TCE regulates testis-specific transcription and understanding the
Nuclear track-based biosensors with the enzyme laccase
Energy Technology Data Exchange (ETDEWEB)
García-Arellano, H. [Departamento de Ciencias Ambientales, División de Ciencias Biológicas y de la Salud, Universidad Autónoma Metropolitana-Lerma, Av. de las Garzas No. 10, Col. El Panteón, Lerma de Villada, Municipio de Lerma, Estado de México, C.P. 52005 (Mexico); Fink, D., E-mail: fink@xanum.uam.mx [Division de Ciencias Naturales e Ingeneria, Universidad Autónoma Metropolitana-Cuajimalpa, Artificios 40, Col. Hidalgo, Del. Álvaro Obregón C.P. 01120, México, D.F. (Mexico); Nuclear Physics Institute, 25068 Řež (Czech Republic); Muñoz Hernández, G. [Division de Ciencias Naturales e Ingeneria, Universidad Autónoma Metropolitana-Cuajimalpa, Artificios 40, Col. Hidalgo, Del. Álvaro Obregón C.P. 01120, México, D.F. (Mexico); Departamento de Fisica, Universidad Autónoma Metropolitana-Iztapalapa, PO Box 55-534, 09340 México, D.F. (Mexico); Vacík, J.; Hnatowicz, V. [Nuclear Physics Institute, 25068 Řež (Czech Republic); Alfonta, L. [Avram and Stella Goldstein-Goren Department of Biotechnology Engineering, Ben-Gurion University of the Negev, PO Box 653, Beer-Sheva 84105 (Israel)
2014-08-15
Highlights: • We construct a biosensor using polymer foils with laccase-clad etched nuclear tracks. • We use the biosensor for quantitation of phenolic compounds. • The biosensor can detect picomolar concentrations for some phenolic compounds. - Abstract: A new type of biosensors for detecting phenolic compounds is presented here. These sensors consist of thin polymer foils with laccase-clad etched nuclear tracks. The presence of suitable phenolic compounds in the sensors leads to the formation of enzymatic reaction products in the tracks, which differ in their electrical conductivities from their precursor materials. These differences correlate with the concentrations of the phenolic compounds. Corresponding calibration curves have been established for a number of compounds. The sensors thus produced are capable to cover between 5 and 9 orders of magnitude in concentration – in the best case down to some picomoles. The sensor's detection sensitivity strongly depends on the specific compound. It is highest for caffeic acid and acid blue 74, followed by ABTS and ferulic acid.
Farnet, A M; Criquet, S; Pocachard, E; Gil, G; Ferre, E
2002-01-01
A new isoform of laccase from Marasmius quercophilus is described in this study. The strain of this white-rot fungus was isolated for the first time on a cork oak litter. This isoform exhibited certain common properties of laccases (a molecular weight of 65 Kda, an optimum pH of 6.2 with syringaldazine). But this laccase has also particularly novel features: the best activity measured was observed at high temperatures (80 C) and this isoform was not inhibited with EDTA. Furthermore, this induced laccase was able to transform most of the aromatic compounds tested without the addition of mediators to the reaction mixture, and the transformation of certain chlorophenols (2-chlorophenol and 2,4-dichlorophenol) by a laccase isoform from M. quercophilus is reported here for the first time. We also demonstrate the importance of 2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) as a mediator since it allowed veratryl alcohol and p-hydroxybenzoic acid transformation. Moreover, new products of transformation were observed using the combination of ABTS with this isoform of laccase.
Danilova, Maria N; Kudryakova, Natalia V; Doroshenko, Anastasia S; Zabrodin, Dmitry A; Rakhmankulova, Zulfira F; Oelmüller, Ralf; Kusnetsov, Victor V
2017-03-01
Cytokinin membrane receptors of the Arabidopsis thaliana AHK2 and AHK3 play opposite roles in the expression of plastid genes and genes for the plastid transcriptional machinery during leaf senescence Loss-of-function mutants of Arabidopsis thaliana were used to study the role of cytokinin receptors in the expression of chloroplast genes during leaf senescence. Accumulation of transcripts of several plastid-encoded genes is dependent on the АНК2/АНК3 receptor combination. АНК2 is particularly important at the final stage of plant development and, unlike АНК3, a positive regulator of leaf senescence. Cytokinin-dependent up-regulation of the nuclear encoded genes for chloroplast RNA polymerases RPOTp and RPOTmp suggests that the hormone controls plastid gene expression, at least in part, via the expression of nuclear genes for the plastid transcription machinery. This is further supported by cytokinin dependent regulation of genes for the nuclear encoded plastid σ-factors, SIG1-6, which code for components of the transcriptional apparatus in chloroplasts.
International Nuclear Information System (INIS)
Franzoi, Ana Cristina; Migowski, Pedro; Dupont, Jairton; Cruz Vieira, Iolanda
2009-01-01
Biosensors based on hydrophobic ionic liquids (ILs) derived from the bis(trifluoromethylsulfonyl)imide [(CF 3 SO 2 ) 2 N - = Tf 2 N - ] anion associated with three different imidazolium cations: 1-butyl-3-methylimidazolium (BMI.Tf 2 N), 1-decyl-3-methylimidazolium (DMI.Tf 2 N) and 1-tetradecyl-3-methylimidazolium (TDMI.Tf 2 N), along with laccase from Aspergillus oryzae, were constructed and optimized for determination of rutin. The laccase catalyzes the oxidation of rutin to the corresponding o-quinone, which is electrochemically reduced back to rutin. The best performance was obtained with 50:20:15:15% (w/w/w/w) as the graphite powder:laccase:Nujol:ILs composition in 0.1 mol L -1 acetate buffer solution (pH 5.0). The parameters for the square-wave voltammetry experiments and scanning electron microscopy images of the biosensors were studied. Under the selected conditions, the cathodic peak current increased linearly in the rutin concentration ranges of 4.77 x 10 -6 to 4.62 x 10 -5 mol L -1 , 5.84 x 10 -6 to 5.36 x 10 -5 mol L -1 and 5.84 x 10 -6 to 5.36 x 10 -5 mol L -1 using the (I) BMI.Tf 2 N-laccase, (II) DMI.Tf 2 N-laccase and (III) TDMI.Tf 2 N-laccase, respectively. The rutin contents of commercial samples of pharmaceuticals were successfully determined by the biosensors and the results compared well with those obtained using the official method. The studies on rutin recovery from these samples gave values of 96.9-104.6%.
Directory of Open Access Journals (Sweden)
Francisco Kuhar
Full Text Available Ganoderma lucidum (Curtis P. Karst is a white rot fungus that is able to degrade the lignin component in wood. The ability of two strains of this species to produce the ligninolytic enzyme laccase was assessed. After the evaluation of induction with heavy metals and phenolic compounds, it was found that among the tested substances, copper and ferulic acid are the best laccase inducers. It was also observed that the two types of inducers (phenolic and metallic produce different electrophoretic patterns of laccase activity. Optimized concentrations of inducers were obtained through a factorial design and the thermal stability of optimized supernatants was studied at a wide range of acidic pH. We found that the enzyme is more thermostable at higher pH values.
Zang, Hongyan; Li, Ning; Pan, Yuling; Hao, Jingguang
2017-03-01
Breast cancer is a common malignancy among women with a rising incidence. Our intention was to detect transcription factors (TFs) for deeper understanding of the underlying mechanisms of breast cancer. Integrated analysis of gene expression datasets of breast cancer was performed. Then, functional annotation of differentially expressed genes (DEGs) was conducted, including Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. Furthermore, TFs were identified and a global transcriptional regulatory network was constructed. Seven publically available GEO datasets were obtained, and a set of 1196 DEGs were identified (460 up-regulated and 736 down-regulated). Functional annotation results showed that cell cycle was the most significantly enriched pathway, which was consistent with the fact that cell cycle is closely related to various tumors. Fifty-three differentially expressed TFs were identified, and the regulatory networks consisted of 817 TF-target interactions between 46 TFs and 602 DEGs in the context of breast cancer. Top 10 TFs covering the most downstream DEGs were SOX10, NFATC2, ZNF354C, ARID3A, BRCA1, FOXO3, GATA3, ZEB1, HOXA5 and EGR1. The transcriptional regulatory networks could enable a better understanding of regulatory mechanisms of breast cancer pathology and provide an opportunity for the development of potential therapy.
Directory of Open Access Journals (Sweden)
Luca Crepaldi
Full Text Available In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE conditions. We discovered that Short Interspersed Elements (SINEs located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs, and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.
Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella
2013-01-01
In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.
Directory of Open Access Journals (Sweden)
Hongde An
2015-11-01
Conclusions: This is the first identified thermo activated and thermostable laccase in brown rot fungi. This investigation will contribute to understanding the roles played by laccases in brown rot fungi.
Joshi, Anagha
2014-12-30
Transcriptional hotspots are defined as genomic regions bound by multiple factors. They have been identified recently as cell type specific enhancers regulating developmentally essential genes in many species such as worm, fly and humans. The in-depth analysis of hotspots across multiple cell types in same species still remains to be explored and can bring new biological insights. We therefore collected 108 transcription-related factor (TF) ChIP sequencing data sets in ten murine cell types and classified the peaks in each cell type in three groups according to binding occupancy as singletons (low-occupancy), combinatorials (mid-occupancy) and hotspots (high-occupancy). The peaks in the three groups clustered largely according to the occupancy, suggesting priming of genomic loci for mid occupancy irrespective of cell type. We then characterized hotspots for diverse structural functional properties. The genes neighbouring hotspots had a small overlap with hotspot genes in other cell types and were highly enriched for cell type specific function. Hotspots were enriched for sequence motifs of key TFs in that cell type and more than 90% of hotspots were occupied by pioneering factors. Though we did not find any sequence signature in the three groups, the H3K4me1 binding profile had bimodal peaks at hotspots, distinguishing hotspots from mono-modal H3K4me1 singletons. In ES cells, differentially expressed genes after perturbation of activators were enriched for hotspot genes suggesting hotspots primarily act as transcriptional activator hubs. Finally, we proposed that ES hotspots might be under control of SetDB1 and not DNMT for silencing. Transcriptional hotspots are enriched for tissue specific enhancers near cell type specific highly expressed genes. In ES cells, they are predicted to act as transcriptional activator hubs and might be under SetDB1 control for silencing.
A Novel PCR Assay for Listeria welshimeri Targeting Transcriptional Regulator Gene lwe1801
Transcriptional regulator genes encode a group of specialized molecules that play essential roles in microbial responses to changing external conditions. These genes have been shown to possess species or group specificity and are useful as detection targets for diagnostic application. The present st...
Mikolasch, Annett; Manda, Katrin; Schlüter, Rabea; Lalk, Michael; Witt, Sabine; Seefeldt, Simone; Hammer, Elke; Schauer, Frieder; Jülich, Wolf-Dieter; Lindequist, Ulrike
2012-01-01
Seven novel β-lactam antibiotics with activities against Gram-positive bacterial strains, among them methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci, were synthesized by amination of 2,5-dihydroxyphenylacetic acid in usable yields (30-60%). These products protected mice against an infection with S. aureus lethal to the control animals. The results show the usefulness of laccase for the synthesis of potential new antibiotics, in addition to the interdependence of the laccase substrates, the amino coupling partners, and the product formation, yield, and activity. The syntheses of β-lactam antibiotics with 2,5-dihydroxyaromatic acid substructures (para-substituted) are then compared with those of 3,4-dihydroxyaromatic acid substructures (ortho-substituted). Para-substituted laccase substrates were better reaction partners in these syntheses than ortho-substituted compounds. Copyright © 2012 International Union of Biochemistry and Molecular Biology, Inc.
Energy Technology Data Exchange (ETDEWEB)
Tsai, Fongying; Coruzzi, G. (Rockefeller Univ., New York, NY (United States))
1991-10-01
Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a normal light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants.
Exploring the Oxidation of Lignin-Derived Phenols by a Library of Laccase Mutants
Directory of Open Access Journals (Sweden)
Isabel Pardo
2015-09-01
Full Text Available Saturation mutagenesis was performed over six residues delimiting the substrate binding pocket of a fungal laccase previously engineered in the lab. Mutant libraries were screened using sinapic acid as a model substrate, and those mutants presenting increased activity were selected for exploring the oxidation of lignin-derived phenols. The latter comprised a battery of phenolic compounds of interest due to their use as redox mediators or precursors of added-value products and their biological activity. The new laccase variants were investigated in a multi-screening assay and the structural determinants, at both the substrate and the protein level, for the oxidation of the different phenols are discussed. Laccase activity greatly varied only by changing one or two residues of the enzyme pocket. Our results suggest that once the redox potential threshold is surpassed, the contribution of the residues of the enzymatic pocket for substrate recognition and binding strongly influence the overall rate of the catalytic reaction.
Lei, Qin; Lee, EunKyoung; Keerthisinghe, Sandra; Lai, Lien; Li, Meng; Lucas, Jessica R; Wen, Xiaohong; Ren, Xiaolin; Sack, Fred D
2015-09-01
The FOUR LIPS (FLP) and MYB88 transcription factors, which are closely related in structure and function, control the development of stomata, as well as entry into megasporogenesis in Arabidopsis thaliana. However, other locations where these transcription factors are expressed are poorly described. Documenting additional locations where these genes are expressed might define new functions for these genes. Expression patterns were examined throughout vegetative and reproductive development. The expression from two transcriptional-reporter fusions were visualized with either β-glucuronidase (GUS) or green fluorescence protein (GFP). Both flp and myb88 genes were expressed in many, previously unreported locations, consistent with the possibility of additional functions for FLP and MYB88. Moreover, expression domains especially of FLP display sharp cutoffs or boundaries. In addition to stomatal and reproductive development, FLP and MYB88, which are R2R3 MYB transcription factor genes, are expressed in many locations in cells, tissues, and organs. © 2015 Botanical Society of America.
Alam, Tanvir
2012-07-01
Distinguishing transcription regulatory patterns of different gene groups is a common problem in various bioinformatics studies. In this work we developed a methodology to deal with such a problem based on machine learning techniques. We applied our method to two biologically important problems related to detecting a difference in transcription regulation of: a/ protein-coding and long non-coding RNAs (lncRNAs) in human, as well as b/ a difference between primate-specific and non-primate-specific long non-coding RNAs. Our method is capable to classify RNAs using various regulatory features of genes that transcribe into these RNAs, such as nucleotide frequencies, transcription factor binding sites, de novo sequence motifs, CpG islands, repetitive elements, histone modification marks, and others. Ten-fold cross-validation tests suggest that our model can distinguish protein-coding and non-coding RNAs with accuracy above 80%. Twenty-fold cross-validation tests suggest that our model can distinguish primate-specific from non-primate-specific promoters of lncRNAs with accuracy above 80%. Consequently, we can hypothesize that transcription of the groups of genes mentioned above are regulated by different mechanisms. Feature selection techniques allowed us to reduce the number of features significantly while keeping the accuracy around 80%. Consequently, we can conclude that selected features play significant role in transcription regulation of coding and non-coding genes, as well as primate-specific and non-primate-specific lncRNA genes.
International Nuclear Information System (INIS)
Enayatzamir, Kheirghadam; Alikhani, Hossein A.; Rodriguez Couto, Susana
2009-01-01
In this paper the production of laccase and the decolouration of the recalcitrant diazo dye Reactive Black 5 (RB5) by the white-rot fungus Trametes pubescens immobilised on stainless steel sponges in a fixed-bed reactor were studied. Laccase production was increased by 10-fold in the presence of RB5 and reached a maximum value of 1025 U/l. Enhanced laccase production in the presence of RB5 in this fungus is an added advantage during biodegradation of RB5-containing effluents. The decolouration of RB5 was due to two processes: dye adsorption onto the fungal mycelium and dye degradation by the laccase enzymes produced by the fungus. RB5 decolouration was performed during four successive batches obtaining high decolouration percentages (74%, 43% and 52% in 24 h for the first, third and four batch, respectively) without addition of redox mediators. Also, the in vitro decolouration of RB5 by the concentrated culture extract, containing mainly laccase, produced in the above bioreactor was studied. The decolouration percentages obtained were considerably lower (around 20% in 24 h) than that attained with the whole culture
Energy Technology Data Exchange (ETDEWEB)
Enayatzamir, Kheirghadam [Department of Chemical Engineering, Rovira i Virgili University, Av. Paisos Catalans 26, 43007 Tarragona (Spain); Department of Soil Science Engineering, University of Tehran, Karaj (Iran, Islamic Republic of); Alikhani, Hossein A. [Department of Soil Science Engineering, University of Tehran, Karaj (Iran, Islamic Republic of); Rodriguez Couto, Susana [Department of Chemical Engineering, Rovira i Virgili University, Av. Paisos Catalans 26, 43007 Tarragona (Spain)], E-mail: susana.rodriguez@urv.cat
2009-05-15
In this paper the production of laccase and the decolouration of the recalcitrant diazo dye Reactive Black 5 (RB5) by the white-rot fungus Trametes pubescens immobilised on stainless steel sponges in a fixed-bed reactor were studied. Laccase production was increased by 10-fold in the presence of RB5 and reached a maximum value of 1025 U/l. Enhanced laccase production in the presence of RB5 in this fungus is an added advantage during biodegradation of RB5-containing effluents. The decolouration of RB5 was due to two processes: dye adsorption onto the fungal mycelium and dye degradation by the laccase enzymes produced by the fungus. RB5 decolouration was performed during four successive batches obtaining high decolouration percentages (74%, 43% and 52% in 24 h for the first, third and four batch, respectively) without addition of redox mediators. Also, the in vitro decolouration of RB5 by the concentrated culture extract, containing mainly laccase, produced in the above bioreactor was studied. The decolouration percentages obtained were considerably lower (around 20% in 24 h) than that attained with the whole culture.
Schubert, Mark; Ruedin, Pascal; Civardi, Chiara; Richter, Michael; Hach, André; Christen, Herbert
2015-01-01
Low-density wood fiber insulation boards are traditionally manufactured in a wet process using a closed water circuit (process water). The water of these industrial processes contains natural phenolic extractives, aside from small amounts of admixtures (e.g., binders and paraffin). The suitability of two fungal laccases and one bacterial laccase was determined by biochemical characterization considering stability and substrate spectra. In a series of laboratory scale experiments, the selected commercial laccase from Myceliophtora thermophila was used to catalyze the surface modification of thermo-mechanical pulp (TMP) using process water. The laccase catalyzed the covalent binding of the phenolic compounds of the process water onto the wood fiber surface and led to change of the surface chemistry directly via crosslinking of lignin moieties. Although a complete substitution of the binder was not accomplished by laccase, the combined use of laccase and latex significantly improved the mechanical strength properties of wood fiber boards. The enzymatically-treated TMP showed better interactions with the synthetic binder, as shown by FTIR-analysis. Moreover, the enzyme is extensively stable in the process water and the approach requires no fresh water as well as no cost-intensive mediator. By applying a second-order polynomial model in combination with the genetic algorithm (GA), the required amount of laccase and synthetic latex could be optimized enabling the reduction of the binder by 40%. PMID:26046652
Directory of Open Access Journals (Sweden)
Izumi Kaneko
2015-05-01
Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.
Nandal, Preeti; Ravella, Sreenivas Rao; Kuhad, Ramesh Chander
2013-01-01
Laccase production by Coriolopsis caperata RCK2011 under solid state fermentation was optimized following Taguchi design of experiment. An orthogonal array layout of L18 (21 × 37) was constructed using Qualitek-4 software with eight most influensive factors on laccase production. At individual level pH contributed higher influence, whereas, corn steep liquor (CSL) accounted for more than 50% of the severity index with biotin and KH2PO4 at the interactive level. The optimum conditions derived were; temperature 30°C, pH 5.0, wheat bran 5.0 g, inoculum size 0.5 ml (fungal cell mass = 0.015 g dry wt.), biotin 0.5% w/v, KH2PO4 0.013% w/v, CSL 0.1% v/v and 0.5 mM xylidine as an inducer. The validation experiments using optimized conditions confirmed an improvement in enzyme production by 58.01%. The laccase production to the level of 1623.55 Ugds−1 indicates that the fungus C. caperata RCK2011 has the commercial potential for laccase. PMID:23463372
Institute of Scientific and Technical Information of China (English)
Bingye Xue; Alejandro P. Rooney; Wendell L. Roelofs
2012-01-01
Acyl-coenzyme A (Acyl-CoA) desaturases play a key role in the biosynthesis of female moth sex pheromones.Desaturase genes are encoded by a large multigene family,and they have been divided into five subgroups on the basis of biochemical functionality and phylogenetic affinity.In this study both copy numbers and transcriptional levels of desaturase genes in the European corn borer (ECB),Ostrinia nubilalis,were investigated.The results from genome-wide screening of ECB bacterial artificial chromosome (BAC)library indicated there are many copies of some desaturase genes in the genome.An open reading frame (ORF) has been isolated for the novel desaturase gene ECB ezi-△11β from ECB gland complementary DNA and its functionality has been analyzed by two yeast expression systems.No functional activities have been detected for it.The expression levels of the four desaturase genes both in the pheromone gland and fat body of ECB and Asian corn borer (ACB),O.furnacalis,were determined by real-time polymerase chain reaction.In the ECB gland,△ 11 is the most abundant,although the amount of △14 is also considerable.In the ACB gland,△14 is the most abundant and is 100 times more abundant than all the other three combined.The results from the analysis of evolution of desaturase gene transcription in the ECB,ACB and other moths indicate that the pattern of △ 11 gene transcription is significantly different from the transcriptional patterns of other desaturase genes and this difference is tied to the underlying nucleotide composition bias of the genome.
Singh, Gursharan; Ahuja, Naveen; Batish, Mona; Capalash, Neena; Sharma, Prince
2008-11-01
An alkalophilic laccase from gamma-proteobacterium JB was applied to wheat straw-rich soda pulp to check its bleaching potential by using response surface methodology based on central composite design. The design was employed by selecting laccase units, ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) concentration and pH as model factors. The results of second order factorial design experiments showed that all three independent variables had significant effect on brightness and kappa number of laccase-treated pulp. Optimum conditions for biobleaching of pulp with laccase preparation (specific activity, 65 nkat mg(-1) protein) were 20 nkat g(-1) of pulp, 2mM ABTS and pH 8.0 which enhanced brightness by 5.89% and reduced kappa number by 21.1% within 4h of incubation at 55 degrees C, without further alkaline extraction of pulp. Tear index (8%) and burst index (18%) also improved for laccase-treated pulp as compared to control raw pulp. Treatment of chemically (CEH1H2) bleached pulp with laccase showed significant effect on release of chromophores, hydrophobic and reducing compounds. Laccase-prebleaching of raw pulp reduced the use of hypochlorite by 10% to achieve brightness of resultant hand sheets similar to the fully chemically bleached pulp.
Directory of Open Access Journals (Sweden)
Dan Zhao
Full Text Available A novel 'white' laccase was purified from the deuteromycete fungus, Myrothecium verrucaria NF-05, which was a high laccase-producing strain (40.2 U·ml(-1 on the thirteenth day during fermentation. SDS-PAGE and native-PAGE revealed a single band with laccase activity corresponding to a molecular weight of approximately 66 kDa. The enzyme had three copper and one iron atoms per protein molecule determined by ICP-AES. Furthermore, both UV/visible and EPR spectroscopy remained silence, indicating the enzyme a novel laccase with new metal compositions of active centre and spectral properties. The N-terminal amino acid sequence of the purified protein was APQISPQYPM. Together with MALDI-TOF analysis, the protein revealed a high homology of the protein with that from reported M. verrucaria. The highest activity was detected at pH 4.0 and at 30°C. The enzyme activity was significantly enhanced by Na(+, Mn(2+, Cu(2+ and Zn(2+ while inhibited by DTT, NaN(3 and halogen anions. The kinetic constant (Km showed the enzyme was more affinitive to ABTS than other tested aromatic substrates. Twelve structurally different dyes could be effectively decolourised by the laccase within 10 min. The high production of the strain and novel properties of the laccase suggested its potential for biotechnological applications.
Laccase production by Pleurotus ostreatus and its application in synthesis of gold nanoparticles
Directory of Open Access Journals (Sweden)
Ahmed I. El-Batal
2015-03-01
Optimization of production conditions yielded an enzyme with activity over 32,450 IU/g of fermented substrate. Factorial design was capable of establishing the conditions that multiplied the activity of the enzyme several folds, consequently, reducing the cost of production. The enzyme was capable of decolorizing several dyes with over 80% reduction in color confirming the aromatic degrading capability of laccase. The enzyme was also used in the synthesis of gold nanoparticles, proving that laccase from Pleurotus ostreatus has a strong potential in several industrial applications.
Directory of Open Access Journals (Sweden)
Matthias Gunne
Full Text Available Fungal laccases are well investigated enzymes with high potential in diverse applications like bleaching of waste waters and textiles, cellulose delignification, and organic synthesis. However, they are limited to acidic reaction conditions and require eukaryotic expression systems. This raises a demand for novel laccases without these constraints. We have taken advantage of the laccase engineering database LccED derived from genome mining to identify and clone the laccase Ssl1 from Streptomyces sviceus which can circumvent the limitations of fungal laccases. Ssl1 belongs to the family of small laccases that contains only few characterized enzymes. After removal of the twin-arginine signal peptide Ssl1 was readily expressed in E. coli. Ssl1 is a small laccase with 32.5 kDa, consists of only two cupredoxin-like domains, and forms trimers in solution. Ssl1 oxidizes 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS and phenolic substrates like 2,6-dimethoxy phenol, guaiacol, and syringaldazine. The k(cat value for ABTS oxidation was at least 20 times higher than for other substrates. The optimal pH for oxidation reactions is substrate dependent: for phenolic substrates the highest activities were detected at alkaline conditions (pH 9.0 for 2,6-dimethoxy phenol and guaiacol and pH 8.0 for syringaldazine, while the highest reaction rates with ABTS were observed at pH 4.0. Though originating from a mesophilic organism, Ssl demonstrates remarkable stability at elevated temperatures (T(1/2,60°C = 88 min and in a wide pH range (pH 5.0 to 11.0. Notably, the enzyme retained 80% residual activity after 5 days of incubation at pH 11. Detergents and organic co-solvents do not affect Ssl1 stability. The described robustness makes Ssl1 a potential candidate for industrial applications, preferably in processes that require alkaline reaction conditions.
Dill, Kariena K; Amacher, Sharon L
2005-11-15
We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.
Energy Technology Data Exchange (ETDEWEB)
Horiguchi, J.; Spriggs, D.; Imamura, K.; Stone, R.; Luebbers, R.; Kufe, D.
1989-01-01
The treatment of human HL-60 promyelocytic leukemia cells with 12-0 tetradecanoylphorbol-13-acetate (TPA) is associated with induction of tumor necrosis factor (TNF) transcripts. The study reported here has examined TPA-induced signaling mechanisms responsible for the regulation of TNF gene expression in these cells. Run-on assays demonstrated that TPA increases TNS mRNA levels by transcriptional activation of this gene. The induction of TNF transcripts by TPA was inhibited by the isoquinolinesulfonamide derivative H7 but not by HA1004, suggesting that this effect of TPA is mediated by activation of protein kinase C. TPA treatment also resulted in increased arachidonic acid release. Moreover, inhibitors of phospholipase, A/sub 2/ blocked both the increase in arachidonic acid release and the induction of TNF transcripts. These findings suggest that TPA induces TNF gene expression through the formation of arachidonic acid metabolites. Although indomethacin had no detectable effect on this induction of TNF transcripts, ketoconazole, an inhibitor of 5-lipoxygenase, blocked TPA-induced increases in TNF mRNA levels. Moreover, TNF mRNA levels were increased by the 5-lipoxygenase metabolite leukotriene B/sub 4/. In contrast, the cyclooxygenase metabolite prostaglandin E/sub 2/ inhibited the induction of TNF transcripts by TPA. Taken together, these results suggest that TPA induces TNF gene expression through the arachidonic acid cascade and that the level of TNF transcripts is regulated by metabolites of the pathway, leukotriene B/sub 4/ and prostaglandin E/sub 2/.
Directory of Open Access Journals (Sweden)
Lee Yeon-Su
2010-05-01
Full Text Available Abstract Background Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR is a powerful method for the analysis of gene expression. Target gene expression levels are usually normalized to a consistently expressed reference gene also known as internal standard, in the same sample. However, much effort has not been expended thus far in the search for reference genes suitable for the study of stomach cancer using RT-qPCR, although selection of optimal reference genes is critical for interpretation of results. Methods We assessed the suitability of six possible reference genes, beta-actin (ACTB, glyceraldehydes-3-phosphate dehydrogenase (GAPDH, hypoxanthine phosphoribosyl transferase 1 (HPRT1, beta-2-microglobulin (B2M, ribosomal subunit L29 (RPL29 and 18S ribosomal RNA (18S rRNA in 20 normal and tumor stomach tissue pairs of stomach cancer patients and 6 stomach cancer cell lines, by RT-qPCR. Employing expression stability analyses using NormFinder and geNorm algorithms we determined the order of performance of these reference genes and their variation values. Results This RT-qPCR study showed that there are statistically significant (p Conclusion This study validated RPL29 and RPL29-B2M as the best single reference genes and combination, for RT-qPCR analysis of 'all stomach tissues', and B2M and B2M-GAPDH as the best single reference gene and combination, for 'stomach cancer cell lines'. Use of these validated reference genes should provide more exact interpretation of differential gene expressions at transcription level in stomach cancer.
Directory of Open Access Journals (Sweden)
F. Bettin
2014-06-01
Full Text Available Laccase enzymes are now commercially available, and a laccase/mediator combination is currently marketed for indigo dye bleaching in textile manufacturing; replacing traditional chemical-based processes with enzymatic technology reduces the need for effluent treatment. However, an inexpensive source of these enzymes will be needed to enable wider application of this technology. In the present work, the main objective was to increase laccase production by the mushroom Pleurotus sajor-caju strain PS-2001 grown on sucrose derived from sugar cane, one of most economical carbon sources known, by the addition of compounds that are known to affect laccase production. High laccase activities (45-62 U mL-1 were obtained with additions of syringaldazine, benzoic acid, gallic acid, and vanillin. When CuSO4 was used in conjunction with these aromatic compounds, the levels of laccase activity were further improved, reaching 58-80 U mL-1. These laccase activities indicate the potential of this strain as an enzyme producer, which has also been detected in media containing glucose, but with activity lower than that observed with sucrose.
Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.
Directory of Open Access Journals (Sweden)
Shan Goh
Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.
Hahn, Veronika; Mikolasch, Annett; Schauer, Frieder
2014-02-01
Laccases are able to mediate both cleavage and synthesis processes. The basis for this dual reaction capability lies in the property of the enzyme laccase to oxidize phenolic, and to some extent non-phenolic substances, to reactive radicals which can undergo on the one hand separations of small substitutents or large molecule parts from the parent compound and on the other hand coupling reactions with other radicals or molecules which are not themselves oxidizable by laccase. The cleavage of the non-phenolic compound 4-morpholinoaniline as well as the deamination of 4-aminophenol and the dechlorination of 4-chlorophenol resulted in the formation of 1,4-hydroquinone which is immediately oxidized by laccase to 1,4-benzoquinone. The formation of the 1,4-hydroquinone/1,4-benzoquinone is the rate limiting step for the synthesis of the heteromolecular dimers and trimers composed of 1,4-benzoquinone and one or two molecules of morpholine. In addition to the synthesis of new compounds from the cleavage products, 4-morpholinoaniline polymerized probably via azo groups and C-N bonds to a homomolecular dimer and trimer. Similarities and differences in cleavage and synthesis reactions catalyzed by the low redox potential laccase of Myceliophthora thermophila (0.46 V) and the high redox potential laccase of Pycnoporus cinnabarinus (0.79 V) were determined. In addition, the dependency of the cleavage and synthesis efficiencies on the (a) structure and redox potential of the laccase, (b) structure and redox potential of the substrate, (c) pH value of the buffer used, (d) incubation temperature, (e) solvent concentration, and (f) laccase activity is discussed in general.
Energy Technology Data Exchange (ETDEWEB)
Catapane, Maria [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Nicolucci, Carla; Menale, Ciro; Mita, Luigi [National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy); Rossi, Sergio [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); Mita, Damiano G., E-mail: mita@igb.cnr.it [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy); Diano, Nadia [Institute of Genetics and Biophysics “ABT”, Via P. Castellino, 111, 80131 Naples (Italy); National Institute of Biostructures and Biosystems (INBB), Viale Medaglie d’Oro, 305, 00136 Rome (Italy); Department of Experimental Medicine, Second University of Naples, Via S. M. di Costantinopoli, 16, 80138 Naples (Italy)
2013-03-15
Highlights: ► Endocrine disruptors cause adverse effects in living organisms. ► Nonylphenol and Octylphenol are alkylphenols recognized as endocrine disruptors. ► It is necessary to remove or reduce their presence in the environment. ► Waters polluted by these pollutants have been bioremediated by immobilized laccase from Trametes versicolor. ► Laccase treated solutions were found to have lost any estrogenic activity. -- Abstract: A fluidized bed reactor, filled with laccase-based beads, has been employed to bioremediate aqueous solutions polluted by endocrine disruptors belonging to the alkylphenols (APs) class. In particular Octylphenol and Nonylphenol have been studied. The catalytic activity of free and immobilized laccase from Trametes versicolor has been characterized as a function of pH, temperature and substrate concentration in the reaction medium. In view of practical applications for each substrate concentration the removal efficiency (RE), the time to halve the initial concentration (τ{sub 50}), and the t{sub c=0}, i.e. the time to reach complete pollutant removal, have been calculated. The immobilized laccase exhibited a lower affinity for octylphenol (K{sub m} = 1.11 mM) than for Nonylphenol (K{sub m} = 0.72 mM), but all the other parameters of applicative interest resulted more significant for octylphenol. For example, the times to reach the complete removal of octylphenol compared to those for nonylphenol at the same concentration is shorter of about 15% (at low concentrations) up to 40% (at high concentrations). The study of cell proliferation with MPP89 cells, a human mesothelioma cell line, and the assay with the YES test indicated the loss of estrogenic activity of the APs solutions after laccase treatment.
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
Misra, Vikram A; Wang, Yu; Timko, Michael P
2017-11-22
Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed
International Nuclear Information System (INIS)
Zhou Pingkun; Sui Jianli
2002-01-01
Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response
CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.
Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria
2018-01-01
A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.
Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie
2016-11-01
After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
John F Allen
Full Text Available In photosynthesis in chloroplasts, two related regulatory processes balance the actions of photosystems I and II. These processes are short-term, post-translational redistribution of light-harvesting capacity, and long-term adjustment of photosystem stoichiometry initiated by control of chloroplast DNA transcription. Both responses are initiated by changes in the redox state of the electron carrier, plastoquinone, which connects the two photosystems. Chloroplast Sensor Kinase (CSK is a regulator of transcription of chloroplast genes for reaction centres of the two photosystems, and a sensor of plastoquinone redox state. We asked whether CSK is also involved in regulation of absorbed light energy distribution by phosphorylation of light-harvesting complex II (LHC II. Chloroplast thylakoid membranes isolated from a CSK T-DNA insertion mutant and from wild-type Arabidopsis thaliana exhibit similar light- and redox-induced (32P-labelling of LHC II and changes in 77 K chlorophyll fluorescence emission spectra, while room-temperature chlorophyll fluorescence emission transients from Arabidopsis leaves are perturbed by inactivation of CSK. The results indicate indirect, pleiotropic effects of reaction centre gene transcription on regulation of photosynthetic light-harvesting in vivo. A single, direct redox signal is transmitted separately to discrete transcriptional and post-translational branches of an integrated cytoplasmic regulatory system.
Directory of Open Access Journals (Sweden)
Ronne Hans
2008-11-01
Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.
Orgeur, Mickael; Martens, Marvin; Leonte, Georgeta; Nassari, Sonya; Bonnin, Marie-Ange; Börno, Stefan T; Timmermann, Bernd; Hecht, Jochen; Duprez, Delphine; Stricker, Sigmar
2018-03-29
Connective tissues support organs and play crucial roles in development, homeostasis and fibrosis, yet our understanding of their formation is still limited. To gain insight into the molecular mechanisms of connective tissue specification, we selected five zinc-finger transcription factors - OSR1, OSR2, EGR1, KLF2 and KLF4 - based on their expression patterns and/or known involvement in connective tissue subtype differentiation. RNA-seq and ChIP-seq profiling of chick limb micromass cultures revealed a set of common genes regulated by all five transcription factors, which we describe as a connective tissue core expression set. This common core was enriched with genes associated with axon guidance and myofibroblast signature, including fibrosis-related genes. In addition, each transcription factor regulated a specific set of signalling molecules and extracellular matrix components. This suggests a concept whereby local molecular niches can be created by the expression of specific transcription factors impinging on the specification of local microenvironments. The regulatory network established here identifies common and distinct molecular signatures of limb connective tissue subtypes, provides novel insight into the signalling pathways governing connective tissue specification, and serves as a resource for connective tissue development. © 2018. Published by The Company of Biologists Ltd.
Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T
2015-12-01
The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Xing, Lei; Liu, Xue-Mei
2012-02-01
Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.