LRSYS, PASCAL LR(1) Parser Generator System

International Nuclear Information System (INIS)

O'Hair, K.

1991-01-01

Description of program or function: LRSYS is a complete LR(1) parser generator system written entirely in a portable subset of Pascal. The system, LRSYS, includes a grammar analyzer program (LR) which reads a context-free (BNF) grammar as input and produces LR(1) parsing tables as output, a lexical analyzer generator (LEX) which reads regular expressions created by the REG process as input and produces lexical tables as output, and various parser skeletons that get merged with the tables to produce complete parsers (SMAKE). Current parser skeletons include Pascal, FORTRAN 77, and C. In addition, the CRAY1, DEC VAX11 version contains LRLTRAN and CFT- FORTRAN 77 skeletons. Other language skeletons can easily be added to the system. LRSYS is based on the LR program (NESC Abstract 822)

A prospective validation of the IOTA logistic regression models (LR1 and LR2) in comparison to subjective pattern recognition for the diagnosis of ovarian cancer.

Science.gov (United States)

Nunes, Natalie; Ambler, Gareth; Hoo, Wee-Liak; Naftalin, Joel; Foo, Xulin; Widschwendter, Martin; Jurkovic, Davor

2013-11-01

This study aimed to assess the accuracy of the International Ovarian Tumour Analysis (IOTA) logistic regression models (LR1 and LR2) and that of subjective pattern recognition (PR) for the diagnosis of ovarian cancer. This was a prospective single-center study in a general gynecology unit of a tertiary hospital during 33 months. There were 292 consecutive women who underwent surgery after an ultrasound diagnosis of an adnexal tumor. All examinations were by a single level 2 ultrasound operator, according to the IOTA guidelines. The malignancy likelihood was calculated using the IOTA LR1 and LR2. The women were then examined separately by an expert operator using subjective PR. These were compared to operative findings and histology. The sensitivity, specificity, area under the curve (AUC), and accuracy of the 3 methods were calculated and compared. The AUCs for LR1 and LR2 were 0.94 [95% confidence interval (CI), 0.92-0.97] and 0.93 (95% CI, 0.90-0.96), respectively. Subjective PR gave a positive likelihood ratio (LR+ve) of 13.9 (95% CI, 7.84-24.6) and a LR-ve of 0.049 (95% CI, 0.022-0.107). The corresponding LR+ve and LR-ve for LR1 were 3.33 (95% CI, 2.85-3.55) and 0.03 (95% CI, 0.01-0.10), and for LR2 were 3.58 (95% CI, 2.77-4.63) and 0.052 (95% CI, 0.022-0.123). The accuracy of PR was 0.942 (95% CI, 0.908-0.966), which was significantly higher when compared with 0.829 (95% CI, 0.781-0.870) for LR1 and 0.836 (95% CI, 0.788-0.872) for LR2 (P IOTA LR1 and LR2 were similar in nonexpert's hands when compared to the original and validation IOTA studies. The PR method was the more accurate test to diagnose ovarian cancer than either of the IOTA models.

Effects of microcystin-LR, cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture on growth, oxidative stress and mineral content in lettuce plants (Lactuca sativa L.).

Science.gov (United States)

Freitas, Marisa; Azevedo, Joana; Pinto, Edgar; Neves, Joana; Campos, Alexandre; Vasconcelos, Vitor

2015-06-01

Toxic cyanobacterial blooms are documented worldwide as an emerging environmental concern. Recent studies support the hypothesis that microcystin-LR (MC-LR) and cylindrospermopsin (CYN) produce toxic effects in crop plants. Lettuce (Lactuca sativa L.) is an important commercial leafy vegetable that supplies essential elements for human nutrition; thus, the study of its sensitivity to MC-LR, CYN and a MC-LR/CYN mixture is of major relevance. This study aimed to assess the effects of environmentally relevant concentrations (1, 10 and 100 µg/L) of MC-LR, CYN and a MC-LR/CYN mixture on growth, antioxidant defense system and mineral content in lettuce plants. In almost all treatments, an increase in root fresh weight was obtained; however, the fresh weight of leaves was significantly decreased in plants exposed to 100 µg/L concentrations of each toxin and the toxin mixture. Overall, GST activity was significantly increased in roots, contrary to GPx activity, which decreased in roots and leaves. The mineral content in lettuce leaves changed due to its exposure to cyanotoxins; in general, the mineral content decreased with MC-LR and increased with CYN, and apparently these effects are time and concentration-dependent. The effects of the MC-LR/CYN mixture were almost always similar to the single cyanotoxins, although MC-LR seems to be more toxic than CYN. Our results suggest that lettuce plants in non-early stages of development are able to cope with lower concentrations of MC-LR, CYN and the MC-LR/CYN mixture; however, higher concentrations (100 µg/L) can affect both lettuce yield and nutritional quality. Copyright © 2015 Elsevier Inc. All rights reserved.

Effect of calcium and magnesium on the antimicrobial action of enterocin LR/6 produced by Enterococcus faecium LR/6.

Science.gov (United States)

Kumar, Manoj; Srivastava, Sheela

2011-06-01

Enterococci are well-known producers of antimicrobial peptides (enterocins) that possess potential as biopreservatives in food. In this study, divalent cations and release of intracellular potassium were used to assess the mechanism of interaction and killing of enterocin LR/6 produced by Enterococcus faecium LR/6 on three target Gram-positive and Gram-negative bacteria, namely Micrococcus luteus, Enterococcus sp. strain LR/3 and Escherichia coli K-12. Whilst treatment with enterocin LR/6 in all cases led to a significant loss of viability, suggesting a bactericidal mode of action, E. coli K-12 showed better tolerance than the other two strains. Bacteriocins have generally been reported to create pores in the membrane of sensitive cells and this function is diminished by divalent cations. In this study it was shown that Ca(2+) and Mg(2+) markedly improved the viability of enterocin LR/6-treated cells in a concentration-dependent manner. K(+) release as a sign of membrane leakiness was higher in M. luteus compared with the other two test strains. In agreement with the viability response, pre-exposure to Ca(2+) and Mg(2+) substantially reduced the amount of K(+) leakage by M. luteus and Enterococcus sp.; in the case of E. coli K-12, no leakage of K(+) was recorded. These results suggest that enterocin LR/6, which possesses good antibacterial potential, may not be very effective as a preservative in foods containing high concentrations of calcium and magnesium. Copyright © 2011 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Approximate Solution of LR Fuzzy Sylvester Matrix Equations

Directory of Open Access Journals (Sweden)

Xiaobin Guo

2013-01-01

Full Text Available The fuzzy Sylvester matrix equation AX~+X~B=C~ in which A,B are m×m and n×n crisp matrices, respectively, and C~ is an m×n LR fuzzy numbers matrix is investigated. Based on the Kronecker product of matrices, we convert the fuzzy Sylvester matrix equation into an LR fuzzy linear system. Then we extend the fuzzy linear system into two systems of linear equations according to the arithmetic operations of LR fuzzy numbers. The fuzzy approximate solution of the original fuzzy matrix equation is obtained by solving the crisp linear systems. The existence condition of the LR fuzzy solution is also discussed. Some examples are given to illustrate the proposed method.

Accident dynamics of LR-0 reactor

International Nuclear Information System (INIS)

Vorisek, M.; Tinka, I.

1981-01-01

The results are given of calculating the accident dynamics of the LR-0 light water experimental zero power reactor. Calculations of the time dependence of power, the total released energy, the temperature of fuel and its cladding were made using program FATRAP for different values of the total inserted reactivity. Using the results, an analysis is made of hypothetic accident states of the LR-0 reactor. The results are shown graphically. (J.B.)

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Mueller, Donald E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division; Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Reactor and Nuclear Systems Division

2016-08-31

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 ⁷LiF-BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

Status Report on Scoping Reactor Physics and Sensitivity/Uncertainty Analysis of LR-0 Reactor Molten Salt Experiments

International Nuclear Information System (INIS)

Brown, Nicholas R.; Mueller, Donald E.; Patton, Bruce W.; Powers, Jeffrey J.

2016-01-01

Experiments are being planned at Research Centre Rež (RC Rež) to use the FLiBe (2 "7LiF-BeF_2) salt from the Molten Salt Reactor Experiment (MSRE) to perform reactor physics measurements in the LR-0 low power nuclear reactor. These experiments are intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems utilizing FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL) is performing sensitivity/uncertainty (S/U) analysis of these planned experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objective of these analyses is to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a status update on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. The S/U analyses will be used to inform design of FLiBe-based experiments using the salt from MSRE.

The hydration enthalpies of Md3+ and Lr3+

International Nuclear Information System (INIS)

Bruechle, W.; Schaedel, M.; Scherer, U.W.; Kratz, J.V.

1987-10-01

Lawrencium (3-min 260 Lr) and lighter actinides were produced in the bombardement of a 249 Bk target with 18 O ions and loaded onto a cation exchange column in 0.05 M α-hydroxy-isobutyrate solution at pH = 4.85 together with the radioactive lanthanide tracers 166 Ho, 171 Er, and 171 Tm. In elutions with 0.12 M α-hydroxy-isobutyrate solution (pH = 4.85) trivalent Lr was eluted exactly together with the Er tracer and Md close to Ho. Lr elutes much later than expected based on the known elution positions of the lighter actinides and the expected analogy to the elution positions of the homologous lanthanides. From the measured elution positions, ionic radii were calculated for Lr 3+ and Md 3+ . Semiempirical models allow the calculation of the heat of hydration from the ionic radii, resulting in ΔH hyd ≅ - 3654 kJ/mol for Md 3+ and ΔH hyd ≅ - 3689 kJ/mol for Lr 3+ . (orig.)

Partial pressure (or fugacity) of carbon dioxide, dissolved inorganic carbon, pH, alkalinity, temperature, salinity and other variables collected from discrete sample and profile observations using CTD, bottle and other instruments from NOAA Ship MALCOLM BALDRIGE in the Indian Ocean and Laccadive Sea from 1995-09-22 to 1995-10-25 (NODC Accession 0114478)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0114478 includes chemical, discrete sample, physical and profile data collected from NOAA Ship MALCOLM BALDRIGE in the Indian Ocean and Laccadive Sea...

Western Continental Margin of India - Re-look using potential field data

Science.gov (United States)

Rajaram, M.; S P, A.

2008-05-01

The Western Continental Margin of India (WCMI) evolved as a result of rifting between India and Madagascar that took place during mid Cretaceous (~88Ma).The WCMI is equally important in terms of natural resources as well as research point of view. The major tectonic elements in the western offshore includes the Laxmi and Chagos- Laccadive ridge dividing the WCMI and the adjoining Arabian sea into two basins, Pratap Ridge, Alleppey platform etc. Different theories have been proposed for the evolution of each of these tectonic elements. In the current paper we look at geopotential data on the west coast of India and the western off-shore. The data sets utilized include Satellite derived High Resolution Free Air Gravity data over the off-shore, Bouguer data onland, Champ Satellite Magnetic data, published Marine Magnetic data collected by ONGC, NIO, ground magnetic data over west cost collected by IIG and available aeromagnetic data. From the free air gravity anomaly the structural details of the western offshore can be delineated. The Euler depths of FAG depict deep solutions associated with Pratap Ridge, Comorin Ridge, the west coast fault and the Laxmi Ridge. These may be associated with continental margin and continental fragments. From the aeromagnetic and marine magnetic data it is evident that the West Coast Fault is dissected at several places. The shallow circular feature associated with Bombay High is evident both on the FAG and the analytic signal derived from satellite Magnetic data. The crustal magnetic thickness from MF5 lithospheric model of the Champ appears to suggest that the continental crust extends up to the Chagos- Laccadive ridge. Based on the analysis of these geopotential data sets the various theories for the evolution of the WCMI will be evaluated and these results will be presented.

L-R asymmetry in gut's

International Nuclear Information System (INIS)

Karadayi, H.R.

1982-01-01

An idea of L-R asymmetry is proposed for the grand unification schemes. The idea provides an intrinsic mechanism to obtain standard model charges of fermions in the case of more than one weak gauge boson. It is elaborated within a scheme based on the partial symmetry SU(4)sub(C)xSU(2)sub(L)xSU(2)sub(R) where the coupling constants gsub(L) and gsub(R) corresponding to the chiral SU(2) factors are assumed to be different from each other. Then, the embedding of this structure within the simple symmetry SO(10) is shown. In both cases, a consistent description of vector particle masses is given. These two schemes are considered as primary models to realize the L-R asymmetry idea due to the lack of family unification. However, in a subsequent work, we will show that the SO(14) unification of the three families can be obtained within the framework of L-R asymmetry. All formulations are carried out with the aid of a mathematical method that we recently proposed for the Lie algebra representations of classical groups. (author)

Roles of miRNAs in microcystin-LR-induced Sertoli cell toxicity

Energy Technology Data Exchange (ETDEWEB)

Zhou, Yuan [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Wang, Hui [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Wang, Cong [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Qiu, Xuefeng [Department of Urology, Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing 210008 (China); Benson, Mikael [The Centre for Individualized Medication, Linköping University Hospital, Linköping University, Linköping SE-58185 (Sweden); Yin, Xiaoqin [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); Xiang, Zou [Department of Microbiology and Immunology, Mucosal Immunobiology and Vaccine Research Center, Institute of Biomedicine, University of Gothenburg, Gothenburg (Sweden); Li, Dongmei, E-mail: lidm@nju.edu.cn [Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093 (China); Jiangsu Key Laboratory of Molecular Medicine, Nanjing University, Nanjing, Jiangsu 210093 (China); and others

2015-08-15

Microcystin (MC)-LR, a cyclic heptapeptide, is a potent reproductive system toxin. To understand the molecular mechanisms of MC-induced reproductive system cytotoxicity, we evaluated global changes of miRNA and mRNA expression in mouse Sertoli cells following MC-LR treatment. Our results revealed that the exposure to MC-LR resulted in an altered miRNA expression profile that might be responsible for the modulation of mRNA expression. Bio-functional analysis indicated that the altered genes were involved in specific cellular processes, including cell death and proliferation. Target gene analysis suggested that junction injury in Sertoli cells exposed to MC-LR might be mediated by miRNAs through the regulation of the Sertoli cell-Sertoli cell pathway. Collectively, these findings may enhance our understanding on the modes of action of MC-LR on mouse Sertoli cells as well as the molecular mechanisms underlying the toxicity of MC-LR on the male reproductive system. - Highlights: • miRNAs were altered in Sertoli cells exposed to MC-LR. • Alerted genes were involved in different cell functions including the cell morphology. • MC-LR adversely affected Sertoli cell junction formation through the regulating miRNAs.

Adaptive local surface refinement based on LR NURBS and its application to contact

Science.gov (United States)

Zimmermann, Christopher; Sauer, Roger A.

2017-12-01

A novel adaptive local surface refinement technique based on Locally Refined Non-Uniform Rational B-Splines (LR NURBS) is presented. LR NURBS can model complex geometries exactly and are the rational extension of LR B-splines. The local representation of the parameter space overcomes the drawback of non-existent local refinement in standard NURBS-based isogeometric analysis. For a convenient embedding into general finite element codes, the Bézier extraction operator for LR NURBS is formulated. An automatic remeshing technique is presented that allows adaptive local refinement and coarsening of LR NURBS. In this work, LR NURBS are applied to contact computations of 3D solids and membranes. For solids, LR NURBS-enriched finite elements are used to discretize the contact surfaces with LR NURBS finite elements, while the rest of the body is discretized by linear Lagrange finite elements. For membranes, the entire surface is discretized by LR NURBS. Various numerical examples are shown, and they demonstrate the benefit of using LR NURBS: Compared to uniform refinement, LR NURBS can achieve high accuracy at lower computational cost.

Synthesis of visible light sensitized S, N and C co-doped polymorphic TiO2 for Microcystin-LR MC-LR removal

Science.gov (United States)

Microcystin-LR (MC-LR) is considered as one of the most widespread and toxic cyanotoxins, which had been discovered to be hepatotoxic, cytotoxic and neurotoxic. It is the only cyanotoxin that has been proposed by Word Health Organization (WHO) for a provisional guideline (1 ppb) ...

Antioxidant Effect of Curcumin Against Microcystin- LR-Induced ...

African Journals Online (AJOL)

Purpose: To investigate the effect of curcumin on microcystin-LR (MC-LR)- induced renal oxidative damage in Balb/c mice. Methods: 40 male Balb/c mice were assigned randomly to 4 groups each having 10 mice. One group served as normal (saline treated) while another group was used as curcumin control. The third ...

Monitoring of microcystin-LR in Luvuvhu River catchment ...

African Journals Online (AJOL)

The main aim of this study is to assess the levels of microcystin-LR in Luvuvhu River catchment and to assess the physicochemical parameters that may promote the growth of cyanobacteria. The level of microcystin-LR in some of the sampling sites was <0.18 ìg/l except for one site (Luvuvhu River just before the confluence ...

Laboratory studies of dissolved radiolabelled microcystin-LR in lake water

DEFF Research Database (Denmark)

Hyenstrand, Per; Rohrlack, Thomas; Beattie, Kenneth A

2003-01-01

The fate of dissolved microcystin-LR was studied in laboratory experiments using surface water taken from a eutrophic lake. Based on initial range finding, a concentration of 50 microg l(-1) dissolved 14C-microcystin-LR was selected for subsequent time-course experiments. The first was performed ...... fractions. The study demonstrated that biodegradation of dissolved microcystin-LR occurred in water collected at a lake surface with carbon dioxide as a major end-product....

Assessment of co-seismic landslide susceptibility using LR and ...

Indian Academy of Sciences (India)

Suchita Shrestha

2018-03-28

Mar 28, 2018 ... statistical methods, namely Logistic Regression. (LR) and Analysis ... The LR method has been applied by various researchers ... many bivariate models need that the independent variables be .... through a point (per unit contour length), and tan β is the ..... by multivariate statistical techniques; Nat. Hazards ...

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Microcystin-LR equivalent concentrations in fish tissue during a ...

African Journals Online (AJOL)

The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence of microcystin-LR equivalent in the water and to determine the ...

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

International Nuclear Information System (INIS)

Zhang, Zongyao; Zhang, Xu-Xiang; Wu, Bing; Yin, Jinbao; Yu, Yunjiang; Yang, Liuyan

2016-01-01

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Comprehensive insights into microcystin-LR effects on hepatic lipid metabolism using cross-omics technologies

Energy Technology Data Exchange (ETDEWEB)

Zhang, Zongyao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Zhang, Xu-Xiang, E-mail: zhangxx@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Wu, Bing; Yin, Jinbao [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China); Yu, Yunjiang [Center for Environmental Health Research, South China Institute of Environmental Sciences, The Ministry of Environmental Protection of PRC, Guangzhou 510655 (China); Yang, Liuyan, E-mail: yangly@nju.edu.cn [State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210023 (China)

2016-09-05

Highlights: • Use of cross-omics technologies to evaluate toxic effects of microcystin-LR. • Disturbance of hepatic lipid metabolism by oral exposure to microcystin-LR. • Crucial roles of gut microbial community shift in the metabolic disturbance induced by microcystin-LR. - Abstract: Microcystin-LR (MC-LR) can induce hepatic tissue damages and molecular toxicities, but its effects on lipid metabolism remain unknown. This study investigated the effects of MC-LR exposure on mice lipid metabolism and uncovered the underlying mechanism through metabonomic, transcriptomic and metagenomic analyses after administration of mice with MC-LR by gavage for 28 d. Increased liver weight and abdominal fat weight, and evident hepatic lipid vacuoles accumulation were observed in the mice fed with 0.2 mg/kg/d MC-LR. Serum nuclear magnetic resonance analysis showed that MC-LR treatment altered the levels of serum metabolites including triglyceride, unsaturated fatty acid (UFA) and very low density lipoprotein. Digital Gene Expression technology was used to reveal differential expression of hepatic transcriptomes, demonstrating that MC-LR treatment disturbed hepatic UFA biosynthesis and activated peroxisome proliferator-activated receptor (PPAR) signaling pathways via Pparγ, Fabp1 and Fabp2 over-expression. Metagenomic analyses of gut microbiota revealed that MC-LR exposure also increased abundant ratio of Firmicutes vs. Bacteroidetes in gut and altered biosynthetic pathways of various microbial metabolic and pro-inflammatory molecules. In conclusion, oral MC-LR exposure can induce hepatic lipid metabolism disorder mediated by UFA biosynthesis and PPAR activation, and gut microbial community shift may play an important role in the metabolic disturbance.

Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

Science.gov (United States)

Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

2013-03-01

Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

International Nuclear Information System (INIS)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-01-01

Highlights: ► For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. ► The effects of factors on MC-LR degradation were analyzed based on kinetic study. ► Mass spectrometry was applied for identification of intermediates and products. ► Special intermediates involved in this study were identified. ► Degradation mechanisms were proposed according to the results of LC–MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO 2 ) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO 2 concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO 2 ; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO 2 . The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC–MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation.

Science.gov (United States)

Ma, Qingwei; Ren, Jing; Huang, Honghui; Wang, Shoubing; Wang, Xiangrong; Fan, Zhengqiu

2012-05-15

Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO(2)) under irradiation of 365nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO(2) concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO(2); enhanced degradation of MC-LR was observed with 365nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO(2). The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda. Copyright © 2012 Elsevier B.V. All rights reserved.

The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

Science.gov (United States)

Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

2015-10-01

The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Kinetic and mechanistic study of microcystin-LR degradation by nitrous acid under ultraviolet irradiation

Energy Technology Data Exchange (ETDEWEB)

Ma, Qingwei; Ren, Jing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Huang, Honghui [Key Laboratory of Fisheries Ecology Environment, Ministry of Agriculture, Guangzhou 510300 (China); Wang, Shoubing [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Wang, Xiangrong, E-mail: xrxrwang@vip.sina.com [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China); Fan, Zhengqiu, E-mail: zhqfan@fudan.edu.cn [Department of Environmental Science and Engineering, Fudan University, Shanghai 200433 (China)

2012-05-15

Highlights: Black-Right-Pointing-Pointer For the first time, degradation of MC-LR by nitrous acid under UV 365 nm was discovered. Black-Right-Pointing-Pointer The effects of factors on MC-LR degradation were analyzed based on kinetic study. Black-Right-Pointing-Pointer Mass spectrometry was applied for identification of intermediates and products. Black-Right-Pointing-Pointer Special intermediates involved in this study were identified. Black-Right-Pointing-Pointer Degradation mechanisms were proposed according to the results of LC-MS analysis. - Abstract: Degradation of microcystin-LR (MC-LR) in the presence of nitrous acid (HNO{sub 2}) under irradiation of 365 nm ultraviolet (UV) was studied for the first time. The influence of initial conditions including pH value, NaNO{sub 2} concentration, MC-LR concentration and UV intensity were studied. MC-LR was degraded in the presence of HNO{sub 2}; enhanced degradation of MC-LR was observed with 365 nm UV irradiation, caused by the generation of hydroxyl radicals through the photolysis of HNO{sub 2}. The degradation processes of MC-LR could well fit the pseudo-first-order kinetics. Mass spectrometry was applied for identification of the byproducts and the analysis of degradation mechanisms. Major degradation pathways were proposed according to the results of LC-MS analysis. The degradation of MC-LR was initiated via three major pathways: attack of hydroxyl radicals on the conjugated carbon double bonds of Adda, attack of hydroxyl radicals on the benzene ring of Adda, and attack of nitrosonium ion on the benzene ring of Adda.

Microcystin-LR Induces Apoptosis via NF-κB /iNOS Pathway in INS-1 Cells

Directory of Open Access Journals (Sweden)

Kai Shen

2011-07-01

Full Text Available Cyanobacterial toxins, especially the microcystins, are found in eutrophied waters throughout the world, and their potential to impact on human and animal health is a cause for concern. Microcystin-LR (MC-LR is one of the common toxic microcystin congeners and occurs frequently in diverse water systems. Recent work suggested that apoptosis plays a major role in the toxic effects induced by MC-LR in hepatocytes. However, the roles of MC-LR in pancreatic beta cells have not been fully established. The aim of the present study was to assess possible in vitro effects of MC-LR on cell apoptosis in the rat insulinoma cell line, INS-1. Our results demonstrated that MC-LR promoted selectively activation of NF-κB (increasing nuclear p50/p65 translocation and increased the mRNA and protein levels of induced nitric oxide synthase (iNOS. The chronic treatment with MC-LR stimulated nitric oxide (NO production derived from iNOS and induced apoptosis in a dose dependent manner in INS-1 cells. Meanwhile, this effect was inhibited by the NF-κB inhibitor PDTC, which reversed the apoptosis induced by MC-LR. Our observations indicate that MC-LR induced cell apoptosis via an iNOS-dependent pathway. A well-known nuclear transcription factor, NF-κB, is activated and mediates intracellular nitric oxide synthesis. We suggest that the apoptosis induced by chronic MC-LR in vivo presents a possible cause of β-cell dysfunction, as a key environmental factor in the development of diabetes mellitus.

Oxidação de microcistinas-LR em águas pelo íon ferrato(VI Aqueous oxidation of microcystin-LR by ferrate(VI

Directory of Open Access Journals (Sweden)

Sérgio João de Luca

2010-03-01

Full Text Available Toxinas de cianobactérias têm se tornado um grave problema na produção segura de água para consumo humano e animal. Técnicas convencionais de tratamento falham em atingir padrões de potabilidade. O ferrato(VI de potássio, um composto oxidante e coagulante, mostra potencialidade no tratamento de águas contaminadas. Neste trabalho, são apresentados resultados da oxidação pelo ferrato(VI de uma toxina gerada por cianobactérias, a microcistina-LR. Ensaios de cinética de oxidação e de teste de jarros mostram um valor médio de 0,012 min-1 para a constante de taxa de reação de pseudoprimeira ordem, para concentrações de MC-LR de 100 a 200 µg.L-1 na água bruta. Dosagens de 1,6 a 5,0 mg.L-1 de ferrato(VI sugerem o atendimento ao padrão de potabilidade para microcistinas, mostrando que o oxidante poderá ser empregado como coadjuvante no tratamento de água.Algae toxins are becoming a severe problem in the water treatment industry, especially for human and animal consumption. Traditional treatment processes have failed in complying with water supply standards. Potassium ferrate(VI is a powerful oxidant, disinfectant and, also, a coagulant. In this paper, the results of microcystin-LR oxidation by ferrate(VI ion are presented. Kinetic and jar tests showed a average value of 0,012 min-1 for the pseudo first order reaction rate constant, for 100 and 200 µg.L-1 concentration of MC-LR. Ferrate(VI dosages between 1.6 and 5.0 mg.L-1 suggest that water supply standards for MC-LR can be reached, which means that the oxidant may be employed as coadjuvant in water treatment.

The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.

Science.gov (United States)

Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans

2017-11-01

The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Microcystin-LR in surface water of Ponjavica river

Directory of Open Access Journals (Sweden)

Natić Dejan

2012-01-01

Full Text Available Background/Aim. Cyanobacterial toxins befall a group of various compounds according to chemical structure and health effects on people and animals. The most significant in this large group of compounds are microcystins. Their presence in water used for human consumption causes serious health problems, liver beeing the target organ. Microcystins are spread all over the world. Waterblooms of cyanobacterias and their cyanotoxins are also common in the majority of surface waters in Serbia. The aim of this study was to propose HPLC method for determination of mikrocystin-LR, to validate the method and to use it for determination of microcystin-LR in the surface water of the river Ponjavica. The Ponjavica is very eutrophic water and has ideal conditions for the cyanobacterial growth. Methods. Sample of water form the Ponjavica river were collected during the summer 2008. Coupled columns (HLB, Sep-Pak, were used for sample preparation and HPLC/PDA method was used for quantification of microcystin- LR. Results. Parameters of validation show that the proposed method is simple, fast, sensitive (0.1 mg/L and selective with the yield of 89%-92%. The measuring uncertainty of

Photocatalytic Cellulosic Electrospun Fibers for the Degradation of Potent Cyanobacteria Toxin Microcystin-LR

Science.gov (United States)

2012-01-01

visible light activated or UV light activated), the surface area of the fiber mat, and loading solution pH all have an effect on the distribution of...photocatalysis with nanoparticles (such as titania, TiO2 ) show tremendous promise as a simple and energy efficient tech- nology for water purification and...LR (MC-LR). MC- LR is one of the most commonly found cyanobacteria toxins generated by the more frequently occurring cyanobacteria algae blooms in

A novel photocatalytic material for removing microcystin-LR under visible light irradiation: degradation characteristics and mechanisms.

Directory of Open Access Journals (Sweden)

Xin Sui

Full Text Available Microcystin-LR (MC-LR, a common toxic species in contaminated aquatic systems, persists for long periods because of its cyclic structure. Ag3PO4 is an environment-friendly photocatalyst with relatively good degradation capacity for hazardous organic pollutants. This study aimed to investigate the degradation capacity of Ag3PO4 for MC-LR under visible light.An Ag3PO4 photocatalyst was synthesized by the ion-exchange method and characterized by X-ray diffraction, field-emission scanning electron microscope, and UV-Vis spectrophotometer. MC-LR was quantified in each sample through high-performance liquid chromatograph. The degradation efficiency of MC-LR was affected by initial pH, initial Ag3PO4 concentration, initial MC-LR concentration, and recycle experiments. The degradation intermediates of MC-LR were examined by liquid chromatography-mass spectrometry (LC/MS.The degradation process can be well fitted with the pseudo-first-order kinetic model. The maximum MC-LR degradation rate of 99.98% can be obtained within 5 h under the following optimum conditions: pH of 5.01, Ag3PO4 concentration of 26.67 g/L, and MC-LR concentration of 9.06 mg/L. Nine intermediates were detected and analyzed by LC/MS. Three main degradation pathways were proposed based on the molecular weight of the intermediates and the reaction mechanism: (1 hydroxylation on the aromatic ring of Adda, (2 hydroxylation on the diene bonds of Adda, and (3 internal interactions on the cyclic structure of MC-LR.Ag3PO4 is a highly efficient catalyst for MC-LR degradation in aqueous solutions.

Pitavastatin attenuates the PDGF-induced LR11/uPA receptor-mediated migration of smooth muscle cells

International Nuclear Information System (INIS)

Jiang, Meizi; Bujo, Hideaki; Zhu, Yanjuan; Yamazaki, Hiroyuki; Hirayama, Satoshi; Kanaki, Tatsuro; Shibasaki, Manabu; Takahashi, Kazuo; Schneider, Wolfgang J.; Saito, Yasushi

2006-01-01

Statins, inhibitors of HMG-CoA reductase, elicit various actions on vascular cells including the modulation of proliferation and migration of smooth muscle cells (SMCs). Here, we have elucidated the mechanism by which statins, in particular pitavastatin, attenuate the migration activity of SMCs. The expression of LR11, a member of the LDL receptor family and an enhancer of cell surface localization of urokinase-type plasminogen activator receptor (uPAR), is increased in cultured SMCs by treatment with PDGF-BB. Pitavastatin attenuates the PDGF-BB -induced surface expression of LR11 and uPAR. The increased migration of SMCs observed both upon overexpression of LR11 and via stimulation of secretion of soluble LR11 is not reversed by pitavastatin. In vivo studies showed that the SMCs expressing LR11 in plaques are almost congruent with intimal cells expressing nonmuscle myosin heavy chain (SMemb). Pitavastatin reduced the expression of LR11 and SMemb, and the levels of LR11, uPAR, and SMemb in cultured intimal SMCs were reduced to those seen in medial SMCs. We propose that this statin reduces PDGF-induced migration through the attenuation of the LR11/uPAR system in SMCs. Modulation of the LR11/uPAR system with statins suggests a novel treatment strategy for atherogenesis based on suppression of intimal SMC migration

LR-90 prevents methylglyoxal-induced oxidative stress and apoptosis in human endothelial cells

Science.gov (United States)

Figarola, James L.; Singhal, Jyotsana; Rahbar, Samuel; Awasthi, Sanjay

2014-01-01

Methylglyoxal (MGO) is a highly reactive dicarbonyl compound known to induce cellular injury and cytoxicity, including apoptosis in vascular cells. Vascular endothelial cell apoptosis has been implicated in the pathophysiology and progression of atherosclerosis. We investigated whether the advanced glycation end-product inhibitor LR-90 could prevent MGO-induced apoptosis in human umbilical vascular endothelial cells (HUVECs). HUVECs were pre-treated with LR-90 and then stimulated with MGO. Cell morphology, cytotoxicity and apoptosis were evaluated by light microscopy, MTT assay, and Annexin V-FITC and propidium iodide double staining, respectively. Levels of Bax, Bcl-2, cytochrome c, mitogen-activated protein kinases (MAPKs) and caspase activities were assessed by Western blotting. Reactive oxygen species (ROS) generation and mitochondrial membrane potential (MMP) were measured with fluorescent probes. LR-90 dose-dependently prevented MGO-associated HUVEC cytotoxicity and apoptotic biochemical changes such as loss of MMP, increased Bax/Bcl-2 protein ratio, mitochondrial cytochrome c release and activation of caspase-3 and 9. Additionally, LR-90 blocked intracellular ROS formation and MAPK (p44/p42, p38, JNK) activation, though the latter seem to be not directly involved in MGO-induced HUVEC apoptosis. LR-90 prevents MGO-induced HUVEC apoptosis by inhibiting ROS and associated mitochondrial-dependent apoptotic signaling cascades, suggesting that LR-90 possess cytoprotective ability which could be beneficial in prevention of diabetic related-atherosclerosis. PMID:24615331

Homogeneous time-resolved fluoroimmunoassay of microcystin-LR using layered WS2 nanosheets as a transducer

Science.gov (United States)

Qin, Xiaodan; Wang, Yuanxiu; Song, Bo; Wang, Xin; Ma, Hua; Yuan, Jingli

2017-06-01

A homogeneous time-resolved fluoroimmunoassay method for rapid and sensitive detection of microcystin-LR (MC-LR) in water samples was developed based on the interaction between water-soluble WS2 nanosheets and the conjugate of MC-LR with a luminescent Eu3+ complex BHHBCB-Eu3+ (BHHBCB: 1,2-bis[4‧-(1″,1″,1″,2″,2″,3″,3″-heptafluoro-4″,6″-hexanedion-6″-yl)- benzyl]-4-chlorosulfobenzene). The large lateral dimensions and high surface areas of two-dimensional layered WS2 nanosheets enable easy adsorption of the MC-LR-BHHBCB-Eu3+ conjugate, that lead to efficient quenching of the luminescence of Eu3+ complex via energy transfer or electron transfer process. However, the addition of monoclonal anti-MC-LR antibody can induce the formation of MC-LR-BHHBCB-Eu3+/antibody immune complex, which prevents the interaction between WS2 nanosheets and MC-LR-BHHBCB-Eu3+ to result in the restoration of Eu3+ luminescence. This signal transduction mechanism made it possible for analysis of the target MC-LR in a homogeneous system. The present method has advantages of rapidity and simplicity since the B/F (bound reagent/free reagent) separation steps, the solid-phase carrier and antibody labeling or modification process are not necessary. The proposed immunosensing system displayed a wide linear range, good precision and accuracy, and comparable sensitivity with a detection limit of 0.3 μg l-1, which satisfied the World Health Organization (WHO) provisional guideline limit of 1.0 μg l-1 for MC-LR in drinking water.

Adsorption of microcystin-LR on mesoporous carbons and its potential use in drinking water source.

Science.gov (United States)

Park, Jeong-Ann; Jung, Sung-Mok; Yi, In-Geol; Choi, Jae-Woo; Kim, Song-Bae; Lee, Sang-Hyup

2017-06-01

Microcystin-LR (MC-LR) is a common toxin derived from cyanobacterial blooms an effective, rapid and non-toxic method needs to be developed for its removal from drinking water treatment plants (DWTP). For an adsorption-based method, mesoporous carbon can be a promising supplemental adsorbent. The effect of mesoporous carbon (MC1, MC2, and MC3) properties and water quality parameters on the adsorption of MC-LR were investigated and the results were analyzed by kinetic, isotherm, thermodynamic, Derjaguin-Landau-Verwey-Overbeek (DLVO), and intraparticle diffusion models. MC1 was the most appropriate type for the removal of MC-LR with a maximum adsorption capacity of 35,670.49 μg/g. Adsorption of MC-LR is a spontaneous reaction dominated by van der Waals interactions. Pore sizes of 8.5-14 nm enhance the pore diffusion of MC-LR from the surface to the mesopores of MC1. The adsorption capacity was not sensitive to changes in the pH (3.2-8.0) and the existence of organic matter (2-5 mg/L). Furthermore, the final concentration of MC-LR was below the WHO guideline level after a 10-min reaction with 20 mg/L of MC1 in the Nak-Dong River, a drinking water source. The MC-LR adsorption mainly competed with humic substances (500-1000 g/mole); however, they did not have a great effect on adsorption. Copyright © 2017. Published by Elsevier Ltd.

Crystallization and preliminary crystallographic analysis of human LR11 Vps10p domain

International Nuclear Information System (INIS)

Nakata, Zenzaburo; Nagae, Masamichi; Yasui, Norihisa; Bujo, Hideaki; Nogi, Terukazu; Takagi, Junichi

2010-01-01

LR11/sorLA contains in its extracellular region a large (∼700-residue) Vps10p domain that is implicated in its intracellular protein-trafficking function. Here, the expression, purification, crystallization and preliminary crystallographic characterization of this domain are described. Low-density lipoprotein receptor (LDLR) relative with 11 binding repeats (LR11; also known as sorLA) is genetically associated with late-onset Alzheimer’s disease and is thought to be involved in neurodegenerative processes. LR11 contains a vacuolar protein-sorting 10 protein (Vps10p) domain. As this domain has been implicated in protein–protein interaction in other receptors, its structure and function are of great biological interest. Human LR11 Vps10p domain was expressed in mammalian cells and the purified protein was crystallized using the hanging-drop vapour-diffusion method. Enzymatic deglycosylation of the sample was critical to obtaining diffraction-quality crystals. Deglycosylated LR11 Vps10p-domain crystals belonged to the hexagonal space group P6 1 22. A diffraction data set was collected to 2.4 Å resolution and a clear molecular-replacement solution was obtained

Reactivation of precambrian faults on the southwestern continental margin of India: Evidence from gravity anomalies

Digital Repository Service at National Institute of Oceanography (India)

Subrahmanyam, V.; Ramana, M.V.; Rao, D.G.

con- fi~ration of the western continental margin, with various structural styles, has been considered as a single unit, even though there exists a difference of opinion about the origin and evolution of the Chagos-Laccadive Ridge complex...’tVATION OF PRECAMBRIAN FAULTS ON THE SW CON~~E~AL MARGIN OF INDIA 337 shelf break due to the steep topographic relief of shelf. Furthermore, the gradients might have played a dominant role in shaping the bathymetry when the block movement took place along the pre...

Life-cycle exposure to microcystin-LR interferes with the reproductive endocrine system of male zebrafish.

Science.gov (United States)

Su, Yujing; Li, Li; Hou, Jie; Wu, Ning; Lin, Wang; Li, Guangyu

2016-06-01

Recently, MC-LR reproductive toxicity drew great attention. Limited information was available on endocrine-disrupting effects of MC-LR on the reproduction system in fish. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30μg/L MC-LR for 90 d until they reached sexual maturity. Male zebrafish were selected, and changes in growth and developmental parameters, testicular histological structure as well as the levels of gonadal steroid hormones were studied along with the related-gene transcriptional responses in the hypothalamic-pituitary-gonadal axis (HPG-axis). The results, for the first time, show a life cycle exposure to MC-LR causes growth inhibition, testicular damage and delayed sperm maturation. A significant decrease in T/E2 ratio indicated that MC-LR disrupted sex steroid hormones balance. The changes in transcriptional responses of HPG-axis related genes revealed that MC-LR promoted the conversion of T to E2 in circulating blood. It was also noted that vtg1 mRNA expression in the liver was up-regulated, which implied that MC-LR could induce estrogenic-like effects at environmentally relevant concentrations and long-term exposure. Our findings indicated that a life cycle exposure to MC-LR causes endocrine disruption with organic and functional damage of the testis, which might compromise the quality of life for the survivors and pose a potent threat on fish reproduction and thus population dynamics in MCs-contaminated aquatic environments. Copyright © 2016 Elsevier B.V. All rights reserved.

Detoxification of microcystin-LR in water by Portulaca oleracea cv.

Science.gov (United States)

Isobe, Takatoshi; Okuhata, Hiroshi; Miyasaka, Hitoshi; Jeon, Bong-Seok; Park, Ho-Dong

2014-03-01

Microcystin-LR (0.02 μg/ml) in the hydroculture medium of Portulaca oleracea cv., became below the detection level (<0.0001 μg/ml) by HPLC analysis after 7 days. The toxicity of microcystin estimated with protein phosphatase inhibition assay, however, remained at 37% of the initial level, indicating that microcystin-LR was transformed by P. oleracea cv. into unknown compound(s) of lower toxicity. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Main: 1LR5 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available Aux311; Zea Mays Molecule: Auxin Binding Protein 1; Chain: A, B, C, D; Engineered: Yes; Mutation: Yes Protei...-.|EMBL; L08425; AAA33430.1; -.|PIR; S16262; S16262.|PDB; 1LR5; X-ray; A/B/C/D=39-201.|PDB; 1LRH; X-ray; A/B/C/D=39-201.|Mai

Some investigations and use of LR-115 track detectors for radon measurements

CERN Document Server

Amrani, D

2001-01-01

Closed passive integrating radon dosimeters based on the use of cellulose nitrate (LR-115 type II) have been developed for assessment of long term radon exposure. This paper presents and comments the results of investigations, of registration efficiency, calibration factors, linearity tests and lower limit of detection for LR-115 detectors from different batches.

A simple highly sensitive and selective aptamer-based colorimetric sensor for environmental toxins microcystin-LR in water samples.

Science.gov (United States)

Li, Xiuyan; Cheng, Ruojie; Shi, Huijie; Tang, Bo; Xiao, Hanshuang; Zhao, Guohua

2016-03-05

A simple and highly sensitive aptamer-based colorimetric sensor was developed for selective detection of Microcystin-LR (MC-LR). The aptamer (ABA) was employed as recognition element which could bind MC-LR with high-affinity, while gold nanoparticles (AuNPs) worked as sensing materials whose plasma resonance absorption peaks red shifted upon binding of the targets at a high concentration of sodium chloride. With the addition of MC-LR, the random coil aptamer adsorbed on Au NPs altered into regulated structure to form MC-LR-aptamer complexes and broke away from the surface of Au NPs, leading to the aggregation of AuNPs, and the color converted from red to blue due to the interparticle plasmon coupling. Results showed that our aptamer-based colorimetric sensor exhibited rapid and sensitive detection performance for MC-LR with linear range from 0.5 nM to 7.5 μM and the detection limit reached 0.37 nM. Meanwhile, the pollutants usually coexisting with MC-LR in pollutant water samples had not demonstrated disturbance for detecting of MC-LR. The mechanism was also proposed suggesting that high affinity interaction between aptamer and MC-LR significantly enhanced the sensitivity and selectivity for MC-LR detection. Besides, the established method was utilized in analyzing real water samples and splendid sensitivity and selectivity were obtained as well. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of an ELISA and Immunochromatographic Strip for Highly Sensitive Detection of Microcystin-LR

Directory of Open Access Journals (Sweden)

Liqiang Liu

2014-08-01

Full Text Available A monoclonal antibody for microcystin–leucine–arginine (MC-LR was produced by cell fusion. The immunogen was synthesized in two steps. First, ovalbumin/ bovine serum albumin was conjugated with 6-acetylthiohexanoic acid using a carbodiimide EDC (1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride/ NHS (N-hydroxysulfosuccinimide reaction. After dialysis, the protein was reacted with MC-LR based on a free radical reaction under basic solution conditions. The protein conjugate was used for immunization based on low volume. The antibodies were identified by indirect competitive (icELISA and were subjected to tap water and lake water analysis. The concentration causing 50% inhibition of binding of MC-LR (IC50 by the competitive indirect ELISA was 0.27 ng/mL. Cross-reactivity to the MC-RR, MC-YR and MC-WR was good. The tap water and lake water matrices had no effect on the detection limit. The analytical recovery of MC-LR in the water samples in the icELISA was 94%–110%. Based on this antibody, an immunochromatographic biosensor was developed with a cut-off value of 1 ng/mL, which could satisfy the requirement of the World Health Organization for MC-LR detection in drinking water. This biosensor could be therefore be used as a fast screening tool in the field detection of MC-LR.

Microcystin-LR induces anoikis resistance to the hepatocyte uptake transporter OATP1B3-expressing cell lines

International Nuclear Information System (INIS)

Takano, Hiroyuki; Takumi, Shota; Ikema, Satoshi; Mizoue, Nozomi; Hotta, Yuki; Shiozaki, Kazuhiro; Sugiyama, Yasumasa; Furukawa, Tatsuhiko; Komatsu, Masaharu

2014-01-01

Microcystin-LR is a cyclic peptide released by several bloom-forming cyanobacteria. Understanding the mechanism of microcystin-LR toxicity is important, because of the both potencies of its acute cytotoxicity and tumor-promoting activity in hepatocytes of animals and humans. Recently, we have reported that the expression of human hepatocyte uptake transporter OATP1B3 was critical for the selective uptake of microcystin-LR into hepatocytes and for induction of its fatal cytotoxicity. In this study, we demonstrated a novel function of microcystin-LR which induced bipotential changes including anoikis resistance and cytoskeleton reorganization to OATP1B3-transfected HEK293 cells (HEK293-OATP1B3). After exposure to microcystin-LR, HEK293-OATP1B3 cells were divided to the floating cells and remaining adherent cells. After collection and reseeding the floating cells into a fresh flask, cells were confluently proliferated (HEK293-OATP1B3-FL) under the microcystin-LR-free condition. Both the proliferated HEK293-OATP1B3-FL and remaining adherent HEK293-OATP1B3-AD cells changed the character with down- and up-regulation of E-cadherin, respectively. Additionally, these cells acquired resistance to microcystin-LR. These results suggest that microcystin-LR could be associated with not only tumor promotion, but also epithelial–mesenchymal transition-mediated cancer metastasis. Furthermore, microcystin-LR might induce the cytoskeleton reorganization be accompanied epithelial–mesenchymal transition

Analysis of WRKY transcription factors and characterization of two Botrytis cinerea-responsive LrWRKY genes from Lilium regale.

Science.gov (United States)

Cui, Qi; Yan, Xiao; Gao, Xue; Zhang, Dong-Mei; He, Heng-Bin; Jia, Gui-Xia

2018-06-01

A major constraint in producing lilies is gray mold caused by Botrytis elliptica and B. cinerea. WRKY transcription factors play important roles in plant immune responses. However, limited information is available about the WRKY gene family in lily plants. In this study, 23 LrWRKY genes with complete WRKY domains were identified from the Botrytis-resistant species Lilium regale. The putative WRKY genes were divided into seven subgroups (Group I, IIa-e, and III) according to their structural features. Sequence alignment revealed that LrWRKY proteins have a highly conserved WRKYGQK domain and a variant, the WRKYGKK domain, and these proteins generally contained similar motif compositions throughout the same subgroup. Functional annotation predicted they might be involved in biological processes related to abiotic and biotic stresses. A qRT-PCR analysis confirmed that expression of six LrWRKY genes in L. regale or the susceptible Asian hybrid 'Yale' was induced by B. cinerea infection. Among these genes, LrWRKY4, LrWRKY8 and LrWRKY10 were expressed at a higher level in L. regale than 'Yale', while the expression of LrWRKY6 and LrWRKY12 was lower in L. regale. Furthermore, LrWRKY4 and LrWRKY12 genes, which also respond to salicylic acid (SA) and methyl jasmonate (MeJA) treatments, were isolated from L. regale. Subcellular localization analysis determined that they were targeted to the nucleus. Constitutive expression of LrWRKY4 and LrWRKY12 in Arabidopsis resulted in plants that were more resistant to B. cinerea than wild-type plants. This resistance was coupled with the transcriptional changes of SA and JA-responsive genes. Overall, our study provides valuable information about the structural and functional characterization of LrWRKY genes that will not only deepen our understanding of the molecular mechanisms underlying the defense of lily against B. cinerea but also offer potential targets for cultivar improvement via biotechnology. Copyright © 2018 Elsevier Masson

Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

International Nuclear Information System (INIS)

Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

2016-01-01

Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

Application of DNA RFLP procedures in interspecific gene transfer: The Lr19 translocation of wheat

International Nuclear Information System (INIS)

Prins, R.; Marais, G.F.; Marais, A.S.; Pretorius, Z.A.; Janse, B.J.H.

1998-01-01

Twenty-nine lines with deletions in the Lr19 ('Indis') translocated chromosome segment were used to physically map Thinopyrum Restriction Fragment Length Polymorphism (RFLP) loci as well as the Sr25 and Sdl loci. The relative distances between marker loci on the translocation were then calculated. The information was then used as an aid to characterize several recombined forms of the translocation. The data confirmed the reported homoeology between the Lr19 segment and chromosome arm 7DL of wheat. Also, it seems that the Lr19 translocation in 'Indis' is very similar to the Lr19 segment in the T4 source and that the former may not derive from Thinopyrum distichum. Near-isogenic lines of the recombined segments were derived and used to study their expression of leaf rust resistance. It became evident that only one potentially useful recombinant was obtained in an earlier attempt to induce allosyndetic pairing between the Lr19 translocation and 7DL of wheat. (author)

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ("1"4C-MC-LR)

International Nuclear Information System (INIS)

Corbel, Sylvain; Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine; Bouaïcha, Noureddine

2016-01-01

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L"−"1 in a soil–plant system for 90 days or pure radiolabeled "1"4C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg"−"1 DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg"−"1 DW and between 0.29 and 0.55 μg kg"−"1 DW, respectively. By using radioactivity ("1"4C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration factors in organs of the

Evaluation of the transfer and the accumulation of microcystins in tomato (Solanum lycopersicum cultivar MicroTom) tissues using a cyanobacterial extract containing microcystins and the radiolabeled microcystin-LR ({sup 14}C-MC-LR)

Energy Technology Data Exchange (ETDEWEB)

Corbel, Sylvain [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France); Mougin, Christian; Nélieu, Sylvie; Delarue, Ghislaine [INRA, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); AgroParisTech, UMR1402 ECOSYS, F-78850 Thiverval-Grignon (France); Bouaïcha, Noureddine, E-mail: noureddine.bouaicha@u-psud.fr [Laboratoire Ecologie, Systématique et Evolution, UMR8079, Univ. Paris-Sud/CNRS/AgroParisTech, Université Paris-Sud, F-91405 Orsay (France)

2016-01-15

Microcystins are the most common cyanotoxins and may be expected wherever blooms of cyanobacteria occur in surface waters. Their persistence both in the irrigation water and in the soil can lead to their transfer and bioaccumulation into agricultural plants. The aim of this work was to investigate microcystin accumulation in Solanum lycopersicum cultivar MicroTom. The plant was exposed to either Microcystis aeruginosa crude extracts containing up to 100 μg eq. MC-LR L{sup −1} in a soil–plant system for 90 days or pure radiolabeled {sup 14}C-MC-LR in a hydroponic condition for 48 h. Toxin bioaccumulation in the soil and different plant tissues was assessed both by the PP2A inhibition assay and by liquid chromatography-mass spectrometry (LC/MS/MS). After 90 days of exposure, microcystins persisted in the soil and their free extractable concentrations accumulated were very low varying between 1.6 and 3.9 μg eq. MC-LR kg{sup −1} DW. Free MC-LR was detected only in roots and leaves with concentrations varying between 4.5 and 8.1 μg kg{sup −1} DW and between 0.29 and 0.55 μg kg{sup −1} DW, respectively. By using radioactivity ({sup 14}C-MC-LR), the results have reported a growing accumulation of toxins within the organs roots > leaves > stems and allowed them to confirm the absence of MC-LR in fruits after 48 h of exposure. The bioconcentration factor (BCF) was 13.6 in roots, 4.5 in leaves, and 1.4 in stems. On the other hand, the results highlight the presence of two radioactive fractions in different plant tissues. The non-extractable fraction of radioactivity, corresponding to the covalently bound MC-LR, was higher than that of the extractable fraction only in roots and leaves reaching 56% and 71% of the total accumulated toxin, respectively. Therefore, results raise that monitoring programs must monitor the presence of MCs in the irrigation water to avoid the transfer and accumulation of these toxins in crops. - Graphical abstract: Bioconcentration

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

Energy Technology Data Exchange (ETDEWEB)

Gomaa, M A [National Network of Radiation Physics, Atomic Energy Authority, Cairo (Egypt); Hafez, A F [Physics Department, Faculty of Science, Alexandria Univercity, Alexandria (Egypt); Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied.

Quality assurance for environmental radon measurements by LR115 nuclear track detectors

International Nuclear Information System (INIS)

Gomaa, M.A.; Hafez, A.F.; Hussein, A.S.

2007-01-01

Passive radon dosimeters based on LR115 nuclear track detectors are very attractive for assessment of radon exposure. For developing countries wishing to undertake national radon survey the most appropriate techniques are those making use of LR115 detectors. These detectors are small, cheap, simple, and non-hazardous and provide an entirely adequate tool for large scale use in assessing levels of radon over several months because of the short - term fluctuations in radon concentrations. In this paper, the principles and philosophy in order to improve the quality and reliability of radon exposure under a quality assurance (QA) program are presented . Also examples of how a QA program of radon measurements by LR115 detectors using the can-techniques are well defined and applied

Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate

Energy Technology Data Exchange (ETDEWEB)

Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental

2013-02-15

In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)

Combined toxicity of microcystin-LR and copper on lettuce (Lactuca sativa L.).

Science.gov (United States)

Cao, Qing; Steinman, Alan D; Wan, Xiang; Xie, Liqiang

2018-05-10

Microcystins and copper commonly co-exist in the natural environment, but their combined toxicity remains unclear, especially in terrestrial plants. The present study investigated the toxicity effects of microcystin-LR (0, 5, 50, 500, 1000 μg L -1 ) and copper (0, 50, 500, 1000, 2000 μg L -1 ), both individually and in mixture, on the germination, growth and oxidative response of lettuce. The bioaccumulation of microcystin-LR and copper was also evaluated. Results showed that the decrease in lettuce germination induced by copper alone was not significantly different from that induced by the mixture, and the combined toxicity assessment showed a simple additive effect. Lettuce growth was not significantly reduced by microcystin-LR alone, whereas it was significantly reduced by copper alone and the mixture when copper concentration was higher than 500 μg L -1 . High concentrations of microcystin-LR (1000 μg L -1 ) and copper (≥50 μg L -1 ),as well as their mixture (≥50 + 500 μg L -1 ), induced oxidative stress in lettuce. A synergistic effect on the growth and antioxidative system of lettuce was observed when exposed to low concentrations of the mixture (≤50 + 500 μg L -1 ), whereas an antagonistic effect was observed at high concentrations (≥1000 + 2000 μg L -1 ). Moreover, the interaction of microcystin-LR and copper can increase their accumulation in lettuce. Our results suggest that the toxicity effects of microcystin-LR and copper are exacerbated when they co-exist in the natural environment at low concentrations, which not only negatively affects plant growth but also poses a potential risk to human health via the food chain. Copyright © 2018. Published by Elsevier Ltd.

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment

International Nuclear Information System (INIS)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic–pituitary–gonadal–liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic

Prospective evaluation of IOTA logistic regression models LR1 and LR2 in comparison with subjective pattern recognition for diagnosis of ovarian cancer in an outpatient setting.

Science.gov (United States)

Nunes, N; Ambler, G; Foo, X; Widschwendter, M; Jurkovic, D

2018-06-01

To determine whether International Ovarian Tumor Analysis (IOTA) logistic regression models LR1 and LR2 developed for the preoperative diagnosis of ovarian cancer could also be used to differentiate between benign and malignant adnexal tumors in the population of women attending gynecology outpatient clinics. This was a single-center prospective observational study of consecutive women attending our gynecological diagnostic outpatient unit, recruited between May 2009 and January 2012. All the women were first examined by a Level-II ultrasound operator. In those diagnosed with adnexal tumors, the IOTA-LR1/2 protocol was used to evaluate the masses. The LR1 and LR2 models were then used to assess the risk of malignancy. Subsequently, the women were also examined by a Level-III examiner, who used pattern recognition to differentiate between benign and malignant tumors. Women with an ultrasound diagnosis of malignancy were offered surgery, while asymptomatic women with presumed benign lesions were offered conservative management with a minimum follow-up of 12 months. The initial diagnosis was compared with two reference standards: histological findings and/or a comparative assessment of tumor morphology on follow-up ultrasound scans. All women for whom the tumor classification on follow-up changed from benign to malignant were offered surgery. In the final analysis, 489 women who had either or both of the reference standards were included. Their mean age was 50 years (range, 16-91 years) and 45% were postmenopausal. Of the included women, 342/489 (69.9%) had surgery and 147/489 (30.1%) were managed conservatively. The malignancy rate was 137/489 (28.0%). Overall, sensitivities of LR1 and LR2 for the diagnosis of malignancy were 97.1% (95% CI, 92.7-99.2%) and 94.9% (95% CI, 89.8-97.9%) and specificities were 77.3% (95% CI, 72.5-81.5%) and 76.7% (95% CI, 71.9-81.0%), respectively (P > 0.05). In comparison with pattern recognition (sensitivity 94.2% (95% CI, 88

Inhibition of Microcystis aeruginosa and microcystin- LR with one ...

African Journals Online (AJOL)

Yomi

2State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin 150001,. China. ... industrial wastewater and domestic sewage. One of the .... LR detected by high performance liquid chromatography.

76 FR 60937 - Draft License Renewal Interim Staff Guidance LR-ISG-2011-02; Aging Management Program for Steam...

Science.gov (United States)

2011-09-30

...-2011-02; Aging Management Program for Steam Generators AGENCY: Nuclear Regulatory Commission. ACTION... License Renewal Interim Staff Guidance (LR-ISG), LR-ISG-2011-02, ``Aging Management Program for Steam... using Revision 3 of NEI 97-06 to manage steam generator aging. The Draft LR-ISG revises the NRC staff's...

The interactive effects of microcystin-LR and cylindrospermopsin on the growth rate of the freshwater algae Chlorella vulgaris.

Science.gov (United States)

Pinheiro, Carlos; Azevedo, Joana; Campos, Alexandre; Vasconcelos, Vítor; Loureiro, Susana

2016-05-01

Microcystin-LR (MC-LR) and cylindrospermopsin (CYN) are the most representative cyanobacterial cyanotoxins. They have been simultaneously detected in aquatic systems, but their combined ecotoxicological effects to aquatic organisms, especially microalgae, is unknown. In this study, we examined the effects of these cyanotoxins individually and as a binary mixture on the growth rate of the freshwater algae Chlorella vulgaris. Using the MIXTOX tool, the reference model concentration addition (CA) was selected to evaluate the combined effects of MC-LR and CYN on the growth of the freshwater green algae due to its conservative prediction of mixture effect for putative similar or dissimilar acting chemicals. Deviations from the CA model such as synergism/antagonism, dose-ratio and dose-level dependency were also assessed. In single exposures, our results demonstrated that MC-LR and CYN had different impacts on the growth rates of C. vulgaris at the highest tested concentrations, being CYN the most toxic. In the mixture exposure trial, MC-LR and CYN showed a synergistic deviation from the conceptual model CA as the best descriptive model. MC-LR individually was not toxic even at high concentrations (37 mg L(-1)); however, the presence of MC-LR at much lower concentrations (0.4-16.7 mg L(-1)) increased the CYN toxicity. From these results, the combined exposure of MC-LR and CYN should be considered for risk assessment of mixtures as the toxicity may be underestimated when looking only at the single cyanotoxins and not their combination. This study also represents an important step to understand the interactions among MC-LR and CYN detected previously in aquatic systems.

The uptake kinetics and immunotoxic effects of microcystin-LR in human and chicken peripheral blood lymphocytes in vitro

International Nuclear Information System (INIS)

Lankoff, Anna; Carmichael, Wayne W.; Grasman, Keith A.; Yuan, Moucun

2004-01-01

Microcystin-LR is a cyanobacterial heptapeptide that presents acute and chronic hazards to animal and human health. We investigated the influence of this toxin on human and chicken immune system modulation in vitro. Peripheral blood lymphocytes were treated with microcystin-LR at environmentally relevant doses of 1, 10 and 25 μg/ml for 12, 24, 48, 72 h (for proliferation assay cells were treated for 72 h). T-cell and B-cell proliferation as well as apoptosis and necrosis were determined in human and chicken samples. IL-2 and IL-6 production by human lymphocytes also was measured. In addition, uptake kinetics of microcystin-LR into human and chicken peripheral blood lymphocytes were calculated by Liquid Chromatography (LS) /Mass Spectrometry (MS) analysis. At the highest dose microcystin-LR decreased T-cell proliferation and all doses of microcystin-LR inhibited B-cell proliferation. The frequency of apoptotic and necrotic cells increased in a dose and time-dependent manner. Human lymphocytes responded to stimulation with microcystin-LR by increased production of IL-6 and decreased production of IL-2. Human lymphocytes were able to uptake from 0.014 to 1.663 μg/ml and chicken lymphocytes from 0.035 to 1.733 μg/ml of the microcystin-LR added to the cultures, depending on the treatment time and dose. In conclusion, microcystin-LR acted as an immunomodulator in cytokine production and down-regulated lymphocyte functions by induction of apoptosis and necrosis. However, further studies dealing with the influence of microcystin-LR on expression cytokine genes and transcription factors are necessary to confirm these hypotheses

Process optimization for microcystin-LR degradation by Response Surface Methodology and mechanism analysis in gas-liquid hybrid discharge system.

Science.gov (United States)

Zhang, Yi; Wei, Hanyu; Xin, Qing; Wang, Mingang; Wang, Qi; Wang, Qiang; Cong, Yanqing

2016-12-01

A gas-liquid hybrid discharge system was applied to microcystin-LR (MC-LR) degradation. MC-LR degradation was completed after 1 min under a pulsed high voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 160 L/h. The Box-Behnken Design was proposed in Response Surface Methodology to evaluate the influence of pulsed high voltage, electrode distance and oxygen flow rate on MC-LR removal efficiency. Multiple regression analysis, focused on multivariable factors, was employed and a reduced cubic model was developed. The ANOVA analysis shows that the model is significant and the model prediction on MC-LR removal was also validated with experimental data. The optimum conditions for the process are obtained at pulsed voltage of 16 kV, gas-liquid interface gap of 10 mm and oxygen flow rate of 120 L/h with ta removal efficiency of MC-LR of 96.6%. The addition of catalysts (TiO 2 or Fe 2+ ) in the gas-liquid hybrid discharge system was found to enhance the removal of MC-LR. The intermediates of MC-LR degradation were analyzed by liquid chromatography/mass spectrometry. The degradation pathway proposed envisaged the oxidation of hydroxyl radicals and ozone, and attack of high-energy electrons on the unsaturated double bonds of Adda and Mdha, with MC-LR finally decomposing into small molecular products. Copyright © 2016 Elsevier Ltd. All rights reserved.

Main: 1LR4 [RPSD[Archive

Lifescience Database Archive (English)

Full Text Available 1LR4 トウモロコシ Corn Zea mays L. Casein Kinase Ii, Alpha Chain Name=Ack2; Zea Mays Mole...cule: Protein Kinase Ck2; Chain: A; Synonym: Casein Kinase Ii, Alpha Chain; Engineered: Yes Transferase 2.7....ray; A=2-326.|PDB; 1M2Q; X-ray; A=2-328.|PDB; 1M2R; X-ray; A=2-328.|PDB; 1OM1; X-ray; A=1-332.|Mai

WWER-440 control assembly local power peaking investigation on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2002-01-01

This paper presents information concerning the local power peaking problem induced by the WWER-440 control assembly and the investigation possibilities on the light water, zero power reactor LR-0 at the Nuclear Research Institute (NRI) Rez plc. A brief description is given about the disposable control assembly model, experimental arrangement and conditions on the LR-0 reactor with regard to the earlier performed investigations as well as to the relevant measurements to be realized in the near future.(abstract)

A further study of the (CR-LR) difference technique for retrospective radon exposure assessment

International Nuclear Information System (INIS)

Nikezic, D.; Yip, C.W.Y.; Leung, S.Y.Y.; Leung, J.K.C.; Yu, K.N.

2006-01-01

The (CR-LR) difference technique, based on the CR-39 and LR 115 detectors, for the determination of implanted 210 Po in glass after deposition of short-lived radon progeny, was analyzed in details in this paper. The sensitivities of both detectors were calculated using the Monte Carlo method with V functions particularly derived in our previous works for the detectors used in the present experiments. The dependency of the sensitivity ratio on the removed layer of both detectors was determined and verified experimentally. The simulated sensitivity ratios correlate well with the experimental ones. A major finding of the present work is that the sensitivity ratio between the CR-39 and LR 115 detectors depends only weakly on the ratio between the 238 U and 232 Th concentrations in the glass samples. This is crucial for the application of the (CR-LR) difference technique for retrospective radon exposure assessments, since measurements of the 238 U and 232 Th concentrations in the relatively small real-life glass samples will make the retrospective radon exposure assessments impractical

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

International Nuclear Information System (INIS)

Woźny, Maciej; Lewczuk, Bogdan; Ziółkowska, Natalia; Gomułka, Piotr; Dobosz, Stefan; Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł

2016-01-01

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg −1 ) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg −1 ) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

Roles of piRNAs in microcystin-leucine-arginine (MC-LR) induced reproductive toxicity in testis on male offspring.

Science.gov (United States)

Zhang, Ling; Zhang, Hui; Zhang, Huan; Benson, Mikael; Han, Xiaodong; Li, Dongmei

2017-07-01

In the present study, we evaluated the toxic effects on the testis of the male offspring of MC-LR exposure during fetal and lactational periods. Pregnant females were distributed into two experimental groups: control group and MC-LR group which were exposed to 0 and 10 μg/L of MC-LR, respectively, through drinking water separately during fetal and lactational periods. At the age of 30 days after birth, the male offspring were euthanized. The body weight, testis index, and histomorphology change were observed and the global changes of piwi-interacting RNA (piRNA) expression were evaluated. The results revealed that MC-LR was found in the testis of male offspring, body weight and testis index decreased significantly, and testicular tissue structure was damaged in the MC-LR group. In addition, the exposure to MC-LR resulted in an altered piRNA expression profile and an increase of the cell apoptosis and a decrease of the cell proliferation in the testis of the male offspring. It was reasonable to speculate that the toxic effects on reproductive system of the male offspring in MC-LR group might be mediated by piRNAs through the regulation of the target genes. As far as we are aware, this is the first report showing that MC-LR could play a role in disorder of proliferative and cell apoptosis in the testis of the male offspring by the maternal transmission effect of toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ecological risk assessment of microcystin-LR in the upstream section of the Haihe River based on a species sensitivity distribution model.

Science.gov (United States)

Niu, Zhiguang; Du, Lei; Li, Jiafu; Zhang, Ying; Lv, Zhiwei

2018-02-01

The eutrophication of surface water has been the main problem of water quality management in recent decades, and the ecological risk of microcystin-LR (MC-LR), which is the by-product of eutrophication, has drawn more attention worldwide. The aims of our study were to determine the predicted no effect concentration (PNEC) of MC-LR and to assess the ecological risk of MC-LR in the upstream section of the Haihe River. HC 5 (hazardous concentration for 5% of biological species) and PNEC were obtained from a species sensitivity distribution (SSD) model, which was constructed with the acute toxicity data of MC-LR on aquatic organisms. The concentrations of MC-LR in the upstream section of the Haihe River from April to August of 2015 were analysed, and the ecological risk characteristics of MC-LR were evaluated based on the SSD model. The results showed that the HC 5 of MC-LR in freshwater was 17.18 μg/L and PNEC was 5.73 μg/L. The concentrations of MC-LR ranged from 0.68 μg/L to 32.21 μg/L and were obviously higher in summer than in spring. The values of the risk quotient (RQ) ranged from 0.12 to 5.62, suggesting that the risk of MC-LR for aquatic organisms in the river was at a medium or high level during the study period. Compared with other waterbodies in the world, the pollution level of MC-LR in the Haihe River was at a moderate level. This research could promote the study of the ecological risk of MC-LR at the ecosystem level. Copyright © 2017 Elsevier Ltd. All rights reserved.

Microcystin-LR induced reactive oxygen species mediate cytoskeletal disruption and apoptosis of hepatocytes in Cyprinus carpio L.

Directory of Open Access Journals (Sweden)

Jinlin Jiang

Full Text Available Microcystins (MCs are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR contains Leucine (L and Arginine (R in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A activities and induce excessive production of reactive oxygen species (ROS. The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L. remains largely unclear. In our present study, the hydroxyl radical (•OH was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12-48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity.

Microcystin-LR Induced Reactive Oxygen Species Mediate Cytoskeletal Disruption and Apoptosis of Hepatocytes in Cyprinus carpio L.

Science.gov (United States)

Jiang, Jinlin; Shan, Zhengjun; Xu, Weili; Wang, Xiaorong; Zhou, Junying; Kong, Deyang; Xu, Jing

2013-01-01

Microcystins (MCs) are a group of cyclic hepatotoxic peptides produced by cyanobacteria. Microcystin-LR (MC-LR) contains Leucine (L) and Arginine (R) in the variable positions, and is one of the most common and potently toxic peptides. MC-LR can inhibit protein phosphatase type 1 and type 2A (PP1 and PP2A) activities and induce excessive production of reactive oxygen species (ROS). The underlying mechanism of the inhibition of PP1 and PP2A has been extensively studied. The over-production of ROS is considered to be another main mechanism behind MC-LR toxicity; however, the detailed toxicological mechanism involved in over-production of ROS in carp (Cyprinus carpio L.) remains largely unclear. In our present study, the hydroxyl radical (•OH) was significantly induced in the liver of carp after a relatively short-term exposure to MC-LR. The elevated reactive oxygen species (ROS) production may play an important role in the disruption of microtubule structure. Pre-injection of the antioxidant N-acetyl-cysteine (NAC) provided significant protection to the cytoskeleton, however buthionine sulfoximine (BSO) exacerbated cytoskeletal destruction. In addition, the elevated ROS formation induced the expression of apoptosis-related genes, including p38, JNKa, and bcl-2. A significant increase in apoptotic cells was observed at 12 - 48 hours. Our study further supports evidence that ROS are involved in MC-LR induced damage to liver cells in carp, and indicates the need for further study of the molecular mechanisms behind MC-LR toxicity. PMID:24376844

Dynamics of Total Microcystin LR Concentration in Three Subtropical Hydroelectric Generation Reservoirs in Uruguay, South America.

Science.gov (United States)

González-Piana, Mauricio; Fabián, Daniel; Piccardo, Andrea; Chalar, Guillermo

2017-10-01

This study analyzed the temporal dynamics of total microcystin LR concentrations between the years of 2012 and 2015 in the Bonete, Baygorria and Palmar hydroelectric generation reservoirs in the central region of the Negro River, Uruguay. The three reservoirs showed differents total microcystin LR concentration, with no significant differences among them. Over 20 sampling dates, the three reservoirs exhibited total microcystin LR concentrations on eight occasions that corresponded to a slight to moderate human health risk according to WHO guideline values for recreational waters. By determining the concentration of microcystin LR in cyanobacterial biomass, we identified cyanobacterial populations that occurred over time with varying degrees of toxin production (maximal 85.4 µg/mm 3 ). The microcystin LR concentration in Bonete was positively correlated with temperature (r = 0.587) and cyanobacterial biomass (r = 0.736), in Baygorria with cyanobacterial biomass (r = 0.521), and in Palmar with temperature (r = 0.500) and negatively correlated with ammonia (r = -0.492). Action is needed to reduce the presence of toxic cyanobacteria in these systems. A decrease in the use of agrochemicals and management changes in the reservoir basins could be successful long-term measures.

A 3D graphene-based biosensor as an early microcystin-LR screening tool in sources of drinking water supply

International Nuclear Information System (INIS)

Zhang, Wei; Han, Changseok; Jia, Baoping; Saint, Christopher; Nadagouda, Mallikarjuna; Falaras, Polycarpos; Sygellou, Labrini; Vogiazi, Vasileia; Dionysiou, Dionysios D.

2017-01-01

Highlights: • 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity. • Good linear correlation between electron-transfer resistance and MC-LR concentration. • A detection limit of 0.04 μg/L MC-LR was accomplished. - Abstract: Recent advances in graphene synthesis and understanding of properties have led to enormous applications in a variety of areas. Graphene and its unique electrical properties can favor electrochemical biosensor applications for aqueous toxin monitoring. Graphene-based biosensors can be used as an alternative to time-consuming, expensive and non-portable conventional methods of analysis involved in water quality monitoring and assessment. In this work, we showcased a three-dimensional (3D) graphene-based biosensor for microcystin-LR (MC-LR) detection and quantification. We report the efficient functionalization and immobilization of microcystin-LR and its antibodies on the facile synthesized CVD 3D graphene. The modified graphene electrodes were characterized by X-ray photoelectron spectroscopy and micro-Raman spectroscopy. Cyclic voltammetry and electrochemical impedance spectroscopy were used to electrochemically characterize the biochemical events on the electrodes. Specifically, as-prepared 3D graphene-based biosensors can detect MC-LR with remarkable sensitivity due to its macro-porous structure and large surface area, and high conductivity. A very good linear correlation of the electron-transfer resistance (R"2 = 0.93) was achieved over 0.05 and 20 μg/L MC-LR concentration range. Also, a detection limit of 0.05 μg/L was accomplished, which is much lower than the World Health Organization (WHO) provisional guideline limit of MC-LR concentration (i.e. 1 μg/L) in drinking water.

Low-priced, time-saving, reliable and stable LR-115 counting system

International Nuclear Information System (INIS)

Tchorz-Trzeciakiewicz, D.E.

2015-01-01

Nuclear alpha particles leave etches (tracks) when they hit the surface of a LR-115 detector. The density of these tracks is used to measure radon concentration. Counting these tracks by human sense is tedious and time-consuming procedure and may introduce counting error, whereas most available automatic and semiautomatic counting systems are expensive or complex. An uncomplicated, robust, reliable and stable counting system using freely available on the Internet software as Digimizer™ and PhotoScape was developed and proposed. The effectiveness of the proposed procedure was evaluated by comparing the amount of tracks counted by software with the amount of tracks counted manually for 223 detectors. The percentage error for each analysed detector was obtained as a difference between automatic and manual counts divided by manual count. For more than 97% of detectors, the percentage errors oscillated between −3% and 3%. - Highlights: • Semiautomatic, uncomplicated procedure was proposed to count the amount of alpha tracks. • Freely available software on the Internet used as alpha tracks counting system for LR-115. • LR-115 detectors used to measure radon concentration and radon exhalation rate

Intraperitoneal exposure of whitefish to microcystin-LR induces rapid liver injury followed by regeneration and resilience to subsequent exposures

Energy Technology Data Exchange (ETDEWEB)

Woźny, Maciej, E-mail: maciej.wozny@uwm.edu.pl [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland); Lewczuk, Bogdan; Ziółkowska, Natalia [Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 13, 10-713 Olsztyn (Poland); Gomułka, Piotr [Department of Ichthyology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. M. Oczapowskiego 5, 10-719 Olsztyn (Poland); Dobosz, Stefan [Department of the Salmonid Research in Rutki, Inland Fisheries Institute in Olsztyn, Rutki, 83-330 Żukowo (Poland); Łakomiak, Alicja; Florczyk, Maciej; Brzuzan, Paweł [Department of Environmental Biotechnology, Faculty of Environmental Sciences, University of Warmia and Mazury in Olsztyn, ul. Słoneczna 45G, 10-709 Olsztyn (Poland)

2016-12-15

To date, there has been no systematic approach comprehensively describing the sequence of pathological changes in fish during prolonged exposure to microcystin-LR (MC-LR). Towards this aim, juvenile whitefish individuals received an intraperitoneal injection with pure MC-LR, and the injection was repeated every week to maintain continuous exposure for 28 days. During the exposure period, growth and condition of the fish were assessed based on biometric measurements. Additionally, selected biochemical markers were analysed in the fishes' blood, and their livers were carefully examined for morphological, ultrastructural, and molecular changes. The higher dose of MC-LR (100 μg·kg{sup −1}) caused severe liver injury at the beginning of the exposure period, whereas the lower dose (10 μg·kg{sup −1}) caused less, probably reversible injury, and its effects began to be observed later in the exposure period. These marked changes were accompanied by substantial MC-LR uptake by the liver. However, starting on the 7th day of exposure, cell debris began to be removed by phagocytes, then by 14th day, proliferation of liver cells had markedly increased, which led to reconstruction of the liver parenchyma at the end of the treatment. Surprisingly, despite weekly-repeated intraperitoneal injections, MC-LR did not accumulate over time of exposure which suggests its limited uptake in the later phase of exposure. In support, mRNA expression of the membrane transport protein oatp1d was decreased at the same time as the regenerative processes were observed. Our study shows that closing of active membrane transport may serve as one defence mechanism against further MC-LR intoxication. - Highlights: • The study presents pathological changes in whitefish during prolonged MC-LR exposure. • After early, severe injury, the damaged liver parenchyma of the fish regenerated. • Endoplasmic reticulum, cytoskeleton, and chromatin were the main targets for MC-LR. • MC-LR did not

LALR(1) : LL(1) = LR(0) : LL(0)

NARCIS (Netherlands)

Kruseman Aretz, F.E.J.; Emde Boas, van P.; Hemker, P.W.; Hoffman, W.; Houwen, van der P.J.; Pfluger, P.R.

1992-01-01

It is shown that LL(l) and LALR(l) acceptors can be obtained by restricting the action tables of the corresponding LL(O) and LR(O) acceptors to those entries that are accessed in at least one accepting sequence (of a sentence from the language). It follows that a number of properties that are easily

Reproduction impairment and endocrine disruption in female zebrafish after long-term exposure to MC-LR: A life cycle assessment.

Science.gov (United States)

Hou, Jie; Li, Li; Wu, Ning; Su, Yujing; Lin, Wang; Li, Guangyu; Gu, Zemao

2016-01-01

Microcystin-LR (MC-LR) has been found to cause reproductive and developmental impairments as well as to disrupt sex hormone homeostasis of fish during acute and sub-chronic toxic experiments. However, fish in natural environments are continuously exposed to MC-LR throughout their entire life cycle as opposed to short-term exposure. Here, we tested the hypothesis that the mechanism by which MC-LR harms female fish reproduction and development within natural water bodies is through interference of the reproductive endocrine system. In the present study, zebrafish hatchlings (5 d post-fertilization) were exposed to 0, 0.3, 3 and 30 μg/L MC-LR for 90 d until reaching sexual maturity. Female zebrafish were selected, and the changes in growth and developmental indicators, ovarian ultrastructure as well as the levels of gonadal steroid hormones and vitellogenin (VTG) were examined along with the transcription of related genes in the hypothalamic-pituitary-gonadal-liver axis (HPGL-axis). The results showed for the first time, a life cycle exposure to MC-LR caused growth inhibition, decreased ovary weight and ovarian ultra-pathological lesions. Decreased ovarian testosterone levels indicated that MC-LR disrupted sex steroid hormone balance. Significantly up-regulated transcription of brain FSHβ and LHβ along with ovarian ERα, FSHR and LHR suggested positive feedback regulation in the HPGL-axis was induced as a compensatory mechanism for MC-LR damage. It was also noted that ovarian VTG content and hepatic ERα and VTG1 expression were all down-regulated, which might be responsible for reduced vitellus storage noted in our histological observations. Our findings indicate that a life cycle exposure to MC-LR impairs the development and reproduction of female zebrafish by disrupting the transcription of related HPGL-axis genes, suggesting that MC-LR has potential adverse effects on fish reproduction and thus population dynamics in MCs-contaminated aquatic environment

Microcystin-LR nanobody screening from an alpaca phage display nanobody library and its expression and application.

Science.gov (United States)

Xu, Chongxin; Yang, Ying; Liu, Liwen; Li, Jianhong; Liu, Xiaoqin; Zhang, Xiao; Liu, Yuan; Zhang, Cunzheng; Liu, Xianjin

2018-04-30

Microcystin-LR (MC-LR) is a type of biotoxin that pollutes the ecological environment and food. The study aimed to obtain new nanobodies from phage nanobody library for determination of MC-LR. The toxin was conjugated to keyhole limpet haemocyanin (KLH) and bovine serum albumin (BSA), respectively, then the conjugates were used as coated antigens for enrichment (coated MC-LR-KLH) and screening (coated MC-LR-BSA) of MC-LR phage nanobodies from an alpaca phage display nanobody library. The antigen-specific phage particles were enriched effectively with four rounds of biopanning. At the last round of enrichment, total 20 positive monoclonal phage nanobodies were obtained from the library, which were analyzed after monoclonal phage enzyme linked immunosorbent assay (ELISA), colony PCR and DNA sequencing. The most three positive nanobody genes, ANAb12, ANAb9 and ANAb7 were cloned into pET26b vector, then the nanobodies were expressed in Escherichia coli BL21 respectively. After being purified, the molecular weight (M.W.) of all nanobodies were approximate 15kDa with sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified nanobodies, ANAb12, ANAb9 and ANAb7 were used to establish the indirect competitive ELISA (IC-ELISA) for MC-LR, and their half-maximum inhibition concentrations (IC 50 ) were 0.87, 1.17 and 1.47μg/L, their detection limits (IC 10 ) were 0.06, 0.08 and 0.12μg/L, respectively. All of them showed strong cross-reactivity (CRs) of 82.7-116.9% for MC-RR, MC-YR and MC-WR, and weak CRs of less than 4.56% for MC-LW, less than 0.1% for MC-LY and MC-LF. It was found that all the IC-ELISAs for MC-LR spiked in tap water samples detection were with good accuracy, stability and repeatability, their recoveries were 84.0-106.5%, coefficient of variations (CVs) were 3.4-10.6%. These results showed that IC-ELISA based on the nanobodies from the alpaca phage display antibody library were promising for high sensitive determination of multiple

Radon concentrations in some Egyptian dwellings using LR 115 detectors

International Nuclear Information System (INIS)

Hussein, A.S.

2007-01-01

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m 3 with an average of 40 Bq m 3 . Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65

Quantifying predictive capability of electronic health records for the most harmful breast cancer

Science.gov (United States)

Wu, Yirong; Fan, Jun; Peissig, Peggy; Berg, Richard; Tafti, Ahmad Pahlavan; Yin, Jie; Yuan, Ming; Page, David; Cox, Jennifer; Burnside, Elizabeth S.

2018-03-01

Improved prediction of the "most harmful" breast cancers that cause the most substantive morbidity and mortality would enable physicians to target more intense screening and preventive measures at those women who have the highest risk; however, such prediction models for the "most harmful" breast cancers have rarely been developed. Electronic health records (EHRs) represent an underused data source that has great research and clinical potential. Our goal was to quantify the value of EHR variables in the "most harmful" breast cancer risk prediction. We identified 794 subjects who had breast cancer with primary non-benign tumors with their earliest diagnosis on or after 1/1/2004 from an existing personalized medicine data repository, including 395 "most harmful" breast cancer cases and 399 "least harmful" breast cancer cases. For these subjects, we collected EHR data comprised of 6 components: demographics, diagnoses, symptoms, procedures, medications, and laboratory results. We developed two regularized prediction models, Ridge Logistic Regression (Ridge-LR) and Lasso Logistic Regression (Lasso-LR), to predict the "most harmful" breast cancer one year in advance. The area under the ROC curve (AUC) was used to assess model performance. We observed that the AUCs of Ridge-LR and Lasso-LR models were 0.818 and 0.839 respectively. For both the Ridge-LR and LassoLR models, the predictive performance of the whole EHR variables was significantly higher than that of each individual component (pbreast cancer, providing the possibility to personalize care for those women at the highest risk in clinical practice.

Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.

Science.gov (United States)

Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S

2014-04-01

We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

International Nuclear Information System (INIS)

Zhou, Shiqing; Shao, Yisheng; Gao, Naiyun; Deng, Yang; Qiao, Junlian; Ou, Huase; Deng, Jing

2013-01-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K + ) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ e ), photosynthetic efficiency (α) and maximal electron transport rate (rETR max ), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L −1 ), φ e , α and rETR max decreased from 0.46 to 0.19 (p −2 s −1 /μmol photons m −2 s −1 , and from 160.7 to 0.1 (p −2 s −1 compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO 4 > H 2 O 2 > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K + ) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate

Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-03-01

This document outlines the activities necessary to conduct a Remedial Investigation (RI) of the Chestnut Ridge Security Pits (CRSP) at the Oak Ridge Y-12 Plant. The CRSP, also designated Chestnut Ridge Operable Unit (OU) 1, is one of four OUs along Chestnut Ridge on the Oak Ridge Reservation (ORR). The purpose of the RI is to collect data to (1) evaluate the nature and extent of known and suspected contaminants, (2) support an Ecological Risk Assessment (ERA) and a Human Health Risk Assessment (HHRA), (3) support the feasibility study in the development and analysis of remedial alternatives, and (4) ultimately, develop a Record of Decision (ROD) for the site. This chapter summarizes the regulatory background of environmental investigation on the ORR and the approach currently being followed and provides an overview of the RI to be conducted at the CRSP. Subsequent chapters provide details on site history, sampling activities, procedures and methods, quality assurance (QA), health and safety, and waste management related to the RI

Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

1994-03-01

This document outlines the activities necessary to conduct a Remedial Investigation (RI) of the Chestnut Ridge Security Pits (CRSP) at the Oak Ridge Y-12 Plant. The CRSP, also designated Chestnut Ridge Operable Unit (OU) 1, is one of four OUs along Chestnut Ridge on the Oak Ridge Reservation (ORR). The purpose of the RI is to collect data to (1) evaluate the nature and extent of known and suspected contaminants, (2) support an Ecological Risk Assessment (ERA) and a Human Health Risk Assessment (HHRA), (3) support the feasibility study in the development and analysis of remedial alternatives, and (4) ultimately, develop a Record of Decision (ROD) for the site. This chapter summarizes the regulatory background of environmental investigation on the ORR and the approach currently being followed and provides an overview of the RI to be conducted at the CRSP. Subsequent chapters provide details on site history, sampling activities, procedures and methods, quality assurance (QA), health and safety, and waste management related to the RI.

An aerial radiological survey of the Oak Ridge Reservation, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Maurer, R.J.

1993-04-01

An aerial radiological survey of the Oak Ridge Reservation (ORR) and surrounding area in Oak Ridge, Tennessee, was conducted during the period March 30 to April 14,1992. The purpose of the survey was to measure and document the terrestrial radiological environment of the Oak Ridge Reservation for use in environmental management programs and emergency response planning. The aerial survey was flown at an altitude of 150 feet (46 meters) along a series of parallel lines 250 feet (76 meters) apart and included X-10 (Oak Ridge National Laboratory), K-25 (former Gaseous Diffusion Plant), Y-12 (Weapons Production Plant), the Freels Bend Area and Oak Ridge Institute for Science and Education, the East Fork Poplar Creek (100-year floodplain extending from K-25 to Y-12), Elza Gate (former uranium ore storage site located in the city of Oak Ridge), Parcel A, the Clinch River (river banks extending from Melton Hill Dam to the city of Kingston), and the CSX Railroad Tracks (extending from Y-12 to the city of Oak Ridge). The survey encompassed approximately 55 square miles (1 41 square kilometers) of the Oak Ridge Reservation and surrounding area

A Multi-Walled Carbon Nanotube-based Biosensor for Monitoring Microcystin-LR in Sources of Drinking Water Supplies

Science.gov (United States)

A multi-walled carbon nanotube-based electrochemical biosensor is developed for monitoring microcystin-LR (MC-LR), a toxic cyanobacterial toxin, in sources of drinking water supplies. The biosensor electrodes are fabricated using dense, mm-long multi-walled CNT (MWCNT) arrays gro...

Radon concentrations in some Egyptian dwellings using LR 115 detectors

Energy Technology Data Exchange (ETDEWEB)

Hussein, A S [Radiation Protection Department, Nuclear Power Plants Authority, Cairo (Egypt)

2007-06-15

Radon, a well-established risk factor for human lung cancer, is present at low concentrations in most homes. Consequently, many countries have established national guidelines for residential radon concentrations. This survey provides additional information about indoor radon concentrations in Egypt. Indoor radon survey of a total of 15 randomly selected houses in Qena city, Upper Egypt was carried out. LR 115 detectors were exposed for one year, covering all the seasons. The estimated indoor radon levels varied from 19 to 59 Bq m{sup 3} with an average of 40 Bq m{sup 3}. Using the bare and filtered LR 115 detectors, the average equilibrium factor F was assessed as 0.30 indoors. An average annual effective dose of 0.40 mSv has been estimated and was found to be lower than the ICRP-65.

Allelopathic effects of microcystin-LR on the germination, growth and metabolism of five charophyte species and a submerged angiosperm.

Science.gov (United States)

Rojo, Carmen; Segura, Matilde; Cortés, Francisco; Rodrigo, María A

2013-11-15

Microcystins (MCs) are produced by cyanobacteria in aquatic environments and adversely affect macrophytes at very high concentrations. However, the effects of MC on macrophytes at concentrations of environmental relevance are largely unknown. The main objective of this study was to analyze the allelopathic effects of MC-LR at natural concentrations (1, 8 and 16 μg MC-LR/L) on five charophyte species (Chara aspera, C. baltica, C. hispida, C. vulgaris and Nitella hyalina) and the angiosperm Myriophyllum spicatum. Macrophyte specimens were obtained from a restored area located in Albufera de València Natural Park, a protected coastal Mediterranean wetland. Two different experiments were conducted involving (i) the addition of MC-LR to natural sediment to evaluate its effects on seed germination and (ii) the addition of MC-LR to water cultures of macrophytes to evaluate its effects on growth and metabolic functions. In water, the MC-LR concentration decreased by 84% in two weeks; the loss was not significant in sediment. The first seedlings (all C. hispida) emerged from the wetland sediment following a delay of a few days in the presence of MC-LR. The germination rates in 8 and 16 μg MC-LR/L treatments were 44% and 11% of that occurring in the absence of MC, but these differences disappeared over time. The final density was 6-7 germlings/dm(3). Final germling length was unaffected by MC-LR. Rotifers (Lecane spp.) emerging from the natural sediment during the experiment were favored by MC-LR; the opposite pattern was observed in the cladoceran Daphnia magna. The growth rates of C. vulgaris, C. baltica and N. hyalina were unaffected by MC exposure, whereas those of C. hispida and C. aspera were reduced in the MC treatments relative to the control treatment. The concentration of chlorophyll-a and the in vivo net photosynthetic rate were lower in the presence of MC-LR, even at the lowest concentration, for all of the characeans tested. M. spicatum was sensitive to the

Determination of microcystin-LR in drinking water using UPLC tandem mass spectrometry-matrix effects and measurement.

Science.gov (United States)

Li, Wei; Duan, Jinming; Niu, Chaoying; Qiang, Naichen; Mulcahy, Dennis

2011-10-01

A simple detection method using ultra-performance liquid chromatography electrospray ionisation tandem mass spectrometry (UPLC-ESI-MS-MS) coupled with the sample dilution method for determining trace microcystin-LR (MC-LR) in drinking water is presented. The limit of detection (LOD) was 0.04 µg/L and the limit of quantitation (LOQ) was 0.1 µg/L. Water matrix effects of ionic strength, dissolved organic carbon (DOC) and pH were examined. The results indicate that signal detection intensity for MC-LR was significantly suppressed as the ionic strength increased from ultrapure water condition, whereas it increased slightly with solution pH and DOC at low concentrations. However, addition of methanol (MeOH) into the sample was able to counter the signal suppression effects. In this study, dilution of the tap water sample by adding 4% MeOH (v/v) was observed to be adequate to compensate for the signal suppression. The recoveries of the samples fortified with MC-LR (0.2, 1, and 10 µg/L) for three different tap water samples ranged from 84.4% to 112.9%.

A pM leveled photoelectrochemical sensor for microcystin-LR based on surface molecularly imprinted TiO2@CNTs nanostructure.

Science.gov (United States)

Liu, Meichuan; Ding, Xue; Yang, Qiwei; Wang, Yu; Zhao, Guohua; Yang, Nianjun

2017-06-05

A simple and highly sensitive photoelectrochemical (PEC) sensor towards Microcystin-LR (MC-LR), a kind of typical cyanobacterial toxin in water samples, was developed on a surface molecular imprinted TiO 2 coated multiwalled carbon nanotubes (MI-TiO 2 @CNTs) hybrid nanostructure. It was synthesized using a feasible two-step sol-gel method combining with in situ surface molecular imprinting technique (MIT). With a controllable core-shell tube casing structure, the resultant MI-TiO 2 @CNTs are enhanced greatly in visible-light driven response capacity. In comparison with the traditional TiO 2 (P25) and non-imprinted (NI-)TiO 2 @CNTs, the MI-TiO 2 @CNTs based PEC sensor showed a much higher photoelectric oxidation capacity towards MC-LR. Using this sensor, the determination of MC-LR was doable in a wide linear range from 1.0pM to 3.0nM with a high photocurrent response sensitivity. An outstanding selectivity towards MC-LR was further achieved with this sensor, proven by simultaneously monitoring 100-fold potential co-existing interferences. The superiority of the obtained MC-LR sensor in sensitivity and selectivity is mainly attributed to the high specific surface area and excellent photoelectric activity of TiO 2 @CNTs heterojunction structure, as well as the abundant active recognition sites on its functionalized molecular imprinting surface. A promising PEC analysis platform with high sensitivity and selectivity for MC-LR has thus been provided. Copyright © 2017 Elsevier B.V. All rights reserved.

Oxidation of microcystin-LR by the Fenton process : Kinetics, degradation intermediates, water quality and toxicity assessment

NARCIS (Netherlands)

Park, Jeong-Ann; Yang, Boram; Park, Chanhyuk; Choi, Jae-Woo; van Genuchten, Case M.|info:eu-repo/dai/nl/413489647; Lee, Sang-Hyup

2017-01-01

The Fenton process was assessed as a cost-effective technology for the removal of Microcystin-LR (MC-LR) among UV, UV/H2O2, and Fenton process according to efficiency and electrical energy per order (EE/O). The determined practical concentrations of the Fenton reagents were 5 mg/L Fe(II) and 5 mg/L

The calibration of the solid state nuclear track detector LR 115 for radon measurements

CERN Document Server

Gericke, C; Jönsson, G; Freyer, K; Treutler, H C; Enge, W

1999-01-01

An experimental calibration of indoor room and outdoor soil detector devices which are based on LR 115 as sensitive element has taken place at the Swedish Radiation Protection Institute in Stockholm (Sweden) in 1994 and 1996, at the Physikalisch-Technischen Bundesanstalt in Braunschweig (Germany) in 1997 and at the Umweltforschungszentrum Leipzig-Halle (Germany) in 1997. Special properties of the used solid state nuclear track detector (SSNTD) material LR 115 have been measured to define the application of the experimental calibration.

Effects of different algaecides on the photosynthetic capacity, cell integrity and microcystin-LR release of Microcystis aeruginosa

Energy Technology Data Exchange (ETDEWEB)

Zhou, Shiqing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Shao, Yisheng, E-mail: yishengshao@163.com [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); China Academy of Urban Planning and Design, Beijing 100037 (China); Gao, Naiyun [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China); Deng, Yang [Department of Earth and Environmental Studies, Montclair State University, Montclair NJ 07043 (United States); Qiao, Junlian; Ou, Huase; Deng, Jing [State Key Laboratory of Pollution Control and Resource Reuse, Tongji University, Shanghai 200092 (China)

2013-10-01

Bench scale tests were conducted to study the effects of four common algaecides, including copper sulfate, hydrogen peroxide, diuron and ethyl 2-methylacetoacetate (EMA) on the photosynthetic capacity, cell integrity and microcystin-LR (MC-LR) release of Microcystis aeruginosa. The release of potassium (K{sup +}) from cell membrane during algaecide exposure was also analyzed. The three typical photosynthetic parameters, including the effective quantum yield (φ{sub e}), photosynthetic efficiency (α) and maximal electron transport rate (rETR{sub max}), were measured by a pulse amplitude modulated (PAM) fluorometry. Results showed that the photosynthetic capacity was all inhibited by the four algaecides, to different degrees, by limiting the energy capture in photosynthesis, and blocking the electron transfer chain in primary reaction. For example, at high diuron concentration (7.5 mg L{sup −1}), φ{sub e}, α and rETR{sub max} decreased from 0.46 to 0.19 (p < 0.01), from 0.20 to 0.01 (p < 0.01) μmol electrons m{sup −2} s{sup −1}/μmol photons m{sup −2} s{sup −1}, and from 160.7 to 0.1 (p < 0.001) μmol m{sup −2} s{sup −1} compared with the control group after 96 h of exposure, respectively. Furthermore, the increase of algaecide dose could lead to the cell lysis, as well as release of intracellular MC-LR that enhanced the accumulation of extracellular MC-LR. The order of MC-LR release potential for the four algaecides was CuSO{sub 4} > H{sub 2}O{sub 2} > diuron > EMA. Highlights: • PAM was used to investigate the effects of algaecides on Microcystis aeruginosa. • We estimate the release of potassium (K{sup +}) from cell membrane for cell lysis. • The risk of microcystin-LR release was evaluated after algaecides exposure. • The order of MC-LR release potential was copper sulfate > hydrogen peroxide > diuron > ethyl 2-methylacetoacetate.

Diagnostics on LALR(k) conflicts based on a method for LR(k) testing

DEFF Research Database (Denmark)

Kristensen, Bent Bruun; Madsen, Ole Lehrmann

1981-01-01

A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts is prese......A user of an LALR(k) parser generator system may have difficulties in understanding how a given LALR(k) conflict is generated. This is especially difficult if the conflict does not correspond to an LR(k) conflict. A practical method for giving informative diagnostics on LALR(k) conflicts...

Solar photo-Fenton treatment of microcystin-LR in aqueous environment: Transformation products and toxicity in different water matrices

Science.gov (United States)

Transformation products and toxicity patterns of microcystin-LR (MC-LR), a common cyanotoxin in freshwaters, during degradation by solar photo-Fenton process were studied in the absence and presence of two major water components, namely fulvic acid and alkalinity. The transformat...

First successful ionization of Lr (Z = 103) by a surface-ionization technique

Energy Technology Data Exchange (ETDEWEB)

Sato, Tetsuya K., E-mail: sato.tetsuya@jaea.go.jp; Sato, Nozomi; Asai, Masato; Tsukada, Kazuaki; Toyoshima, Atsushi; Ooe, Kazuhiro; Miyashita, Sunao; Schädel, Matthias [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Kaneya, Yusuke; Nagame, Yuichiro [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Graduate School of Science and Engineering, Ibaraki University, 2-1-1, Bunkyo, Mito, Ibaraki 310-8512 (Japan); Osa, Akihiko [Department of Research Reactor and Tandem Accelerator, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Ichikawa, Shin-ichi [Advanced Science Research Center, Japan Atomic Energy Agency (JAEA), 2-4 Shirakata-shirane, Tokai-mura, Ibaraki 319-1195 (Japan); Nishina Center for Accelerator-Based Science, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Stora, Thierry [ISOLDE, CERN, CH-1211 Geneva 23 (Switzerland); Kratz, Jens Volker [Institut für Kernchemie, Universität Mainz, D-55099 Mainz (Germany)

2013-02-15

We have developed a surface ionization ion-source as part of the JAEA-ISOL (Isotope Separator On-Line) setup, which is coupled to a He/CdI{sub 2} gas-jet transport system to determine the first ionization potential of the heaviest actinide lawrencium (Lr, Z = 103). The new ion-source is an improved version of the previous source that provided good ionization efficiencies for lanthanides. An additional filament was newly installed to give better control over its operation. We report, here, on the development of the new gas-jet coupled surface ion-source and on the first successful ionization and mass separation of 27-s {sup 256}Lr produced in the {sup 249}Cf + {sup 11}B reaction.

Thickness of Knox Group overburden on Central Chestnut Ridge, Oak Ridge Reservation

International Nuclear Information System (INIS)

Staub, W.P.; Hopkins, R.A.

1984-05-01

The thickness of residual soil overlying the Knox Group along Central Chestnut Ridge was estimated by a conventional seismic refraction survey. The purpose of this survey was to identify sites on the Department of Energy's Oak Ridge Reservation where ample overburden exists above the water table for the shallow land burial of low-level radioactive waste. The results of the survey suggest that the upper slopes of the higher ridges in the area have a minimum of 16 to 26 m (52 to 85 ft) of overburden and that the crests of these ridges may have more than 30 m (100 ft). Therefore, it is unlikely that sound bedrock would be encountered during trench excavation [maximum of 10 m (32 ft)] along Central Chestnut Ridge. Also, the relatively low seismic wave velocities measured in the overburden suggest that the water table is generally deep. On the basis of these preliminary results, Central Chestnut Ridge appears to be suitable for further site characterization for the shallow land burial of low-level radioactive waste. 3 references, 5 figures, 1 table

Similar uptake profiles of microcystin-LR and -RR in an in vitro human intestinal model

International Nuclear Information System (INIS)

Zeller, P.; Clement, M.; Fessard, V.

2011-01-01

Highlights: → First description of in vitro cellular uptake of MCs into intestinal cells. → OATP 3A1 and OATP 4A1 are expressed in Caco-2 cell membranes. → MC-LR and MC-RR show similar uptake in Caco-2 cells. → MCs are probably excreted from Caco-2 cells by an active mechanism. -- Abstract: Microcystins (MCs) are cyclic hepatotoxins produced by various species of cyanobacteria. Their structure includes two variable amino acids (AA) leading to more than 80 MC variants. In this study, we focused on the most common variant, microcystin-LR (MC-LR), and microcystin-RR (MC-RR), a variant differing by only one AA. Despite their structural similarity, MC-LR elicits higher liver toxicity than MC-RR partly due to a discrepancy in their uptake by hepatic organic anion transporters (OATP 1B1 and 1B3). However, even though ingestion is the major pathway of human exposure to MCs, intestinal absorption of MCs has been poorly addressed. Consequently, we investigated the cellular uptake of the two MC variants in the human intestinal cell line Caco-2 by immunolocalization using an anti-MC antibody. Caco-2 cells were treated for 30 min to 24 h with several concentrations (1-50 μM) of both variants. We first confirmed the localization of OATP 3A1 and 4A1 at the cell membrane of Caco-2 cells. Our study also revealed a rapid uptake of both variants in less than 1 h. The uptake profiles of the two variants did not differ in our immunostaining study neither with respect to concentration nor the time of exposure. Furthermore, we have demonstrated for the first time the nuclear localization of MC-RR and confirmed that of MC-LR. Finally, our results suggest a facilitated uptake and an active excretion of MC-LR and MC-RR in Caco-2 cells. Further investigation on the role of OATP 3A1 and 4A1 in MC uptake should be useful to clarify the mechanism of intestinal absorption of MCs and contribute in risk assessment of cyanotoxin exposure.

Electrochemical Aptatoxisensor Responses on Nanocomposites Containing Electro-Deposited Silver Nanoparticles on Poly(Propyleneimine Dendrimer for the Detection of Microcystin-LR in Freshwater

Directory of Open Access Journals (Sweden)

Mawethu P. Bilibana

2016-11-01

Full Text Available A sensitive and reagentless electrochemical aptatoxisensor was developed on cobalt (II salicylaldiimine metallodendrimer (SDD–Co(II doped with electro-synthesized silver nanoparticles (AgNPs for microcystin-LR (L, l-leucine; R, l-arginine, or MC-LR, detection in the nanomolar range. The GCE|SDD–Co(II|AgNPs aptatoxisensor was fabricated with 5’ thiolated aptamer through self-assembly on the modified surface of the glassy carbon electrode (GCE and the electronic response was measured using cyclic voltammetry (CV. Specific binding of MC-LR with the aptamer on GCE|SDD–Co(II|AgNPs aptatoxisensor caused the formation of a complex that resulted in steric hindrance and electrostatic repulsion culminating in variation of the corresponding peak current of the electrochemical probe. The aptatoxisensor showed a linear response for MC-LR between 0.1 and 1.1 µg·L−1 and the calculated limit of detection (LOD was 0.04 µg·L−1. In the detection of MC-LR in water samples, the aptatoxisensor proved to be highly sensitive and stable, performed well in the presence of interfering analog and was comparable to the conventional analytical techniques. The results demonstrate that the constructed MC-LR aptatoxisensor is a suitable device for routine quantification of MC-LR in freshwater and environmental samples.

SR and LR Union Suture for the Treatment of Myopic Strabismus Fixus: Is Scleral Fixation Necessary?

Directory of Open Access Journals (Sweden)

Carol P. S. Lam

2015-01-01

Full Text Available Purpose. To evaluate and compare the effectiveness of scleral fixation SR and LR union suture and nonscleral fixation union suture for the treatment of myopic strabismus fixus. Methods. Retrospective review of 32 eyes of 22 patients with myopic strabismus fixus who had undergone union suture of superior rectus (SR and lateral rectus (LR with or without scleral fixation, and follow-up longer than 6 months at Hong Kong Eye Hospital from 2006 to 2013. Surgical techniques and outcomes in terms of ocular alignment are analyzed. Results. There is significant overall improvement both in postoperative angle of esodeviation (P0.05. Conclusions. Union suture of SR and LR is an effective procedure in correcting myopic strabismus fixus. Fixation of the union suture to the sclera does not improve surgical outcome.

Dynamics of microcystins-LR and -RR in the phytoplanktivorous silver carp in a sub-chronic toxicity experiment

International Nuclear Information System (INIS)

Xie Liqiang; Xie Ping; Ozawa, Kazuhiko; Honma, Takamitsu; Yokoyama, Atsushi; Park, Ho-Dong

2004-01-01

A sub-chronic toxicity experiment was conducted to examine tissue distribution and depuration of two microcystins (microcystin-LR and microcystin -RR) in the phytoplanktivorous filter-feeding silver carp during a course of 80 days. Two large tanks (A, B) were used, and in Tank A, the fish were fed naturally with fresh Microcystis viridis cells (collected from a eutrophic pond) throughout the experiment, while in Tank B, the food of the fish were M. viridis cells for the first 40 days and then changed to artificial carp feed. High Performance Liquid Chromatography (HPLC) was used to measure MC-LR and MC-RR in the M. viridis cells, the seston, and the intestine, blood, liver and muscle tissue of silver carp at an interval of 20 days. MC-RR and MC-LR in the collected Microcystis cells varied between 268-580 and 110-292 μg g -1 DW, respectively. In Tank A, MC-RR and MC-LR varied between 41.5-99.5 and 6.9-15.8 μg g -1 DW in the seston, respectively. The maximum MC-RR in the blood, liver and muscle of the fish was 49.7, 17.8 and 1.77 μg g -1 DW, respectively. No MC-LR was detectable in the muscle and blood samples of the silver carp in spite of the abundant presence of this toxin in the intestines (for the liver, there was only one case when a relatively minor quantity was detected). These findings contrast with previous experimental results on rainbow trout. Perhaps silver carp has a mechanism to degrade MC-LR actively and to inhibit MC-LR transportation across the intestines. The depuration of MC-RR concentrations occurred slowly than uptakes in blood, liver and muscle, and the depuration rate was in the order of blood>liver>muscle. The grazing ability of silver carp on toxic cyanobacteria suggests an applicability of using phytoplanktivorous fish to counteract cyanotoxin contamination in eutrophic waters. - Silver carp are tolerant of cyanobacterial toxins, and might be used to control toxic algal blooms in highly eutrophic lakes

太冲穴古代文献应用分析%Application Analysis of Taichong(LR3) in the Ancient Literatures

Institute of Scientific and Technical Information of China (English)

王文琴; 张永臣; 贾红玲

2013-01-01

目的：通过对太冲古代文献的整理，总结太冲的应用规律。方法：以《中华医典》（第四版）收录的中医古籍1000部为检索范围，对太冲的主治病症、腧穴配伍、配伍主治病症、刺灸法、刺激量等文献进行系统整理，并建立数据库。结果：太冲应用符合纳入标准的有752条，治疗病症共有689条，涉及87部古籍。太冲配伍的使用频次共有1433次，与太冲穴配伍的经穴为167个。结论：太冲单穴适应于临床各科，尤善于治疗中医内科病症，前7位的内科病症为咳嗽、黄疸、痫病、呕吐、痹症、厥症、淋证；配伍后主治前10位的病症为痹症、胸痹、腹痛、血证、虚劳、黄疸、痉证、水肿、腰痛、中风；太冲的腧穴配伍以合谷、足三里、三阴交、行间、昆仑、照海、悬钟、中封、大敦、百会等经穴频数为较多，常用的配伍“穴对”为太冲与行间、太冲与合谷、太冲与三阴交；常用的刺灸法为灸法，针刺深度为针三分，针刺时间为十呼，灸法刺激量为三壮。%Objective:To sum up the application regularity of Taichong ( LR3) through studying the ancient lit-eratures about Taichong (LR3).Methods:We searched 1000 TCM Ancient Books in the “Encyclopedia of Tra-ditional Chinese”( the Fourth Edition ) and organized the information systematically including the primary disea-ses and symptoms of Taichong (LR3),the compatibility of acupionts, the primary diseases and symptoms of Tai-chong ( LR3 ) with compatible effects , the methods of needling and moxibustion , the stimulating quantity of nee-dling and moxibustion , with which we built a data base .Results:A total of 752 relevant articles of Taichong ( LR3) on the application and 689 primary diseases and symptoms were collected in accordance with the inclu-sive criteria in 87 TCM ancient books .The results also showed that the occurrence frequency of Taichong ( LR3

Omega-3 fatty acid docosahexaenoic acid increases SorLA/LR11, a sorting protein with reduced expression in sporadic Alzheimer's disease (AD): relevance to AD prevention.

Science.gov (United States)

Ma, Qiu-Lan; Teter, Bruce; Ubeda, Oliver J; Morihara, Takashi; Dhoot, Dilsher; Nyby, Michael D; Tuck, Michael L; Frautschy, Sally A; Cole, Greg M

2007-12-26

Environmental and genetic factors, notably ApoE4, contribute to the etiology of late-onset Alzheimer's disease (LOAD). Reduced mRNA and protein for an apolipoprotein E (ApoE) receptor family member, SorLA (LR11) has been found in LOAD but not early-onset AD, suggesting that LR11 loss is not secondary to pathology. LR11 is a neuronal sorting protein that reduces amyloid precursor protein (APP) trafficking to secretases that generate beta-amyloid (Abeta). Genetic polymorphisms that reduce LR11 expression are associated with increased AD risk. However these polymorphisms account for only a fraction of cases with LR11 deficits, suggesting involvement of environmental factors. Because lipoprotein receptors are typically lipid-regulated, we postulated that LR11 is regulated by docosahexaenoic acid (DHA), an essential omega-3 fatty acid related to reduced AD risk and reduced Abeta accumulation. In this study, we report that DHA significantly increases LR11 in multiple systems, including primary rat neurons, aged non-Tg mice and an aged DHA-depleted APPsw AD mouse model. DHA also increased LR11 in a human neuronal line. In vivo elevation of LR11 was also observed with dietary fish oil in young rats with insulin resistance, a model for type II diabetes, another AD risk factor. These data argue that DHA induction of LR11 does not require DHA-depleting diets and is not age dependent. Because reduced LR11 is known to increase Abeta production and may be a significant genetic cause of LOAD, our results indicate that DHA increases in SorLA/LR11 levels may play an important role in preventing LOAD.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO2

International Nuclear Information System (INIS)

Triantis, T.M.; Fotiou, T.; Kaloudis, T.; Kontos, A.G.; Falaras, P.; Dionysiou, D.D.; Pelaez, M.; Hiskia, A.

2012-01-01

Highlights: ► N-TiO 2 exhibited effective degradation of MC-LR under UV-A, solar and visible light. ► Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. ► The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO 2 (N-TiO 2 ) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO 2 , Kronos and reference TiO 2 nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO 2 followed by N-TiO 2 with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO 2 nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO 2 for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO 2 displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO 2 − , NO 3 − and NH 4 + ) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Inactivation Kinetics of the Cyanobacterial Toxin Microcystin-LR by Free Chlorine

Science.gov (United States)

Worldwide, the increasing occurrence of toxins produced by cyanobacteria in water bodies used as source waters for drinking water has become an important public health issue. Microcystin-LR is one of the most commonly found cyanotoxins. A detailed evaluation of the free chlorine ...

Effect of Acupuncture at LR3 on Cerebral Glucose Metabolism in a Rat Model of Hypertension: A 18F-FDG-PET Study

Directory of Open Access Journals (Sweden)

Jing Li

2018-01-01

Full Text Available Our objective was to investigate the effect of acupuncture at LR3 on cerebral glucose metabolism in spontaneously hypertensive rats (SHRs. We used 18F-2-fluoro-deoxy-D-glucose positron emission tomography (18F-FDG-PET to examine the effects of acupuncture at LR3 on cerebral glucose metabolism in SHRs. SHRs were randomly allocated to receive no treatment (SHR group, needling at LR3 (SHR + LR3 group, or sham needling (SHR + sham group. Rats received 10 min acupuncture once per day for 7 days and were compared to normotensive Wistar Kyoto (WKY rats. Blood pressure (BP measurement and PET were performed after the first needling and the 7-day treatment period. BP was lower in the SHR + LR3 group compared to the other SHR groups between 30 and 60 min after the first needling and at 24 and 48 h after the 7-day treatment period. Glucose metabolism in the motor, sensory, and visual cortices was decreased in SHR group compared to WKY group. Needling at LR3 was associated with decreased glucose metabolism in the dorsal thalamus, thalamus, and hypothalamus and with increased metabolism in the cerebellar anterior and posterior lobes, medulla oblongata, and sensory cortex compared to the SHR group. These findings suggest that LR3 acupuncture improves hypertension through a mechanism involving altered brain activation in SHRs.

Comparative Studies on the pH Dependence of DOW of Microcystin-RR and -LR Using LC-MS

Directory of Open Access Journals (Sweden)

Gaodao Liang

2011-01-01

Full Text Available Microcystins (MCs are well known worldwide as hepatotoxins produced by cyanobacteria, but little is known about the physicochemical properties of these compounds. The dependence of the n-octanol/water distribution ratio (DOW of MC-RR and -LR to pH was measured by high-performance liquid chromatography combined with mass spectrometry (LC-MS. There was a remarkable difference in such relationships between MC-RR and -LR. The log DOW of MC-LR decreased from 1.63 at pH 1.0 to -1.26 at pH 6.5, and stabilized between -1.04 and -1.56 at a pH of 6.5~12.0; log DOW of MC-RR varied between -1.24 and -0.67 at a pH of 1.00~4.00, and stabilized between -1.20 and -1.54 at a pH of 4.00~12.00. The difference of hydrophobicity in acidic condition between MC-RR and -LR is important, not only for the analytical method of both toxins, but perhaps also for understanding the difference of toxicity to animals between the two toxins.

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

Bulk etch rate of LR-115 cellulose nitrate film

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

Bulk etch rate (V/sub b/) of Kodak LR-115 cellulose nitrate film has been studied, and values for the parameter are presented. An interesting variability of V/sub b/ has been found which has implications for microdosimetry using this type of integrating nuclear track detector. Short-term and longer-term thickness changes have been observed which may increase the uncertainty in estimations of dose using this type of detector

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Cell density dependence of Microcystis aeruginosa responses to copper algaecide concentrations: Implications for microcystin-LR release.

Science.gov (United States)

Kinley, Ciera M; Iwinski, Kyla J; Hendrikse, Maas; Geer, Tyler D; Rodgers, John H

2017-11-01

Along with mechanistic models, predictions of exposure-response relationships for copper are often derived from laboratory toxicity experiments with standardized experimental exposures and conditions. For predictions of copper toxicity to algae, cell density is a critical factor often overlooked. For pulse exposures of copper-based algaecides in aquatic systems, cell density can significantly influence copper sorbed by the algal population, and consequent responses. A cyanobacterium, Microcystis aeruginosa, was exposed to a copper-based algaecide over a range of cell densities to model the density-dependence of exposures, and effects on microcystin-LR (MC-LR) release. Copper exposure concentrations were arrayed to result in a gradient of MC-LR release, and masses of copper sorbed to algal populations were measured following exposures. While copper exposure concentrations eliciting comparable MC-LR release ranged an order of magnitude (24-h EC50s 0.03-0.3mg Cu/L) among cell densities of 10 6 through 10 7 cells/mL, copper doses (mg Cu/mg algae) were similar (24-h EC50s 0.005-0.006mg Cu/mg algae). Comparisons of MC-LR release as a function of copper exposure concentrations and doses provided a metric of the density dependence of algal responses in the context of copper-based algaecide applications. Combined with estimates of other site-specific factors (e.g. water characteristics) and fate processes (e.g. dilution and dispersion, sorption to organic matter and sediments), measuring exposure-response relationships for specific cell densities can refine predictions for in situ exposures and algal responses. These measurements can in turn decrease the likelihood of amending unnecessary copper concentrations to aquatic systems, and minimize risks for non-target aquatic organisms. Copyright © 2017 Elsevier Inc. All rights reserved.

Experimental study on the aging process of the LR 115 cellulose nitrate radon detector

International Nuclear Information System (INIS)

Siems, M.; Freyer, K.; Treutler, H.-C.; Joensson, G.; Enge, W.

2001-01-01

An experimental determination of the aging process of cellulose nitrate detector material was based on the examination of special properties of the LR 115 solid state nuclear track detectors (SSNTDs) of various ages up to 18 years. The examined relevant parameters are the bulk etching rate v b and the track etching rate v t . These parameters are responsible for the appearance, the size and the registration efficiency of tracks of α-particles from radon gas in the detector. To find a correlation between these material parameters and the detector sensitivity an experimental calibration of indoor room and outdoor soil detector devices based on LR 115 took place at the Umweltforschungszentrum Leipzig-Halle (Germany). To avoid routine calibration work in external radon exposure facilities a correction of the age dependent calibration factors with the material parameters measured in one's own laboratory was targeted. In this study a general age dependence, however, was not found. The following statements for practical applications can be made. (i) the bulk etching rate v b for detectors of the same batch has a depth dependence and this dependence is constant over 2 years (LR 115 September 1994). (ii) detectors of different batches older than 5 years and stored at room temperature show an odd v b behaviour when v b is used for describing track shapes. (iii) the calibration factor of detectors of different batches that were stored at about +4 deg. C is constant over 5 years (LR 115 September 1994 and February 1999, Table 2). The conclusion is that LR 115 detectors not older than 5 years and stored in a refrigerator at about +4 deg. C should be preferred for radon measurements. Furthermore these detectors should be recalibrated every year and the microscope work of this calibrations should be performed by the same person who performs the measurements. In addition, a phenomenon related to fundamental track formation mechanisms was found, that the time straggling of the

Detection of trace microcystin-LR on a 20 MHz QCM sensor coated with in situ self-assembled MIPs.

Science.gov (United States)

He, Hao; Zhou, Lianqun; Wang, Yi; Li, Chuanyu; Yao, Jia; Zhang, Wei; Zhang, Qingwen; Li, Mingyu; Li, Haiwen; Dong, Wen-fei

2015-01-01

A 20 MHz quartz crystal microbalance (QCM) sensor coated with in situ self-assembled molecularly imprinted polymers (MIPs) was presented for the detection of trace microcystin-LR (MC-LR) in drinking water. The sensor performance obtained using the in situ self-assembled MIPs was compared with traditionally synthesized MIPs on 20 MHz and normal 10 MHz QCM chip. The results show that the response increases by more than 60% when using the in situ self-assembly method compared using the traditionally method while the 20 MHz QCM chip provides four-fold higher response than the 10 MHz one. Therefore, the in situ self-assembled MIPs coated on a high frequency QCM chip was used in the sensor performance test to detect MC-LR in tap water. It showed a limit of detection (LOD) of 0.04 nM which is lower than the safety guideline level (1 nM MC-LR) of drinking water in China. The low sensor response to other analogs indicated the high specificity of the sensor to MC-LR. The sensor showed high stability and low signal variation less than 2.58% after regeneration. The lake water sample analysis shows the sensor is possible for practical use. The combination of the higher frequency QCM with the in situ self-assembled MIPs provides a good candidate for the detection of other small molecules. Copyright © 2014 Elsevier B.V. All rights reserved.

Complete Sensitivity/Uncertainty Analysis of LR-0 Reactor Experiments with MSRE FLiBe Salt and Perform Comparison with Molten Salt Cooled and Molten Salt Fueled Reactor Models

Energy Technology Data Exchange (ETDEWEB)

Brown, Nicholas R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Powers, Jeffrey J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mueller, Don [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, Bruce W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2016-12-01

In September 2016, reactor physics measurements were conducted at Research Centre Rez (RC Rez) using the FLiBe (2 ⁷LiF + BeF₂) salt from the Molten Salt Reactor Experiment (MSRE) in the LR-0 low power nuclear reactor. These experiments were intended to inform on neutron spectral effects and nuclear data uncertainties for advanced reactor systems using FLiBe salt in a thermal neutron energy spectrum. Oak Ridge National Laboratory (ORNL), in collaboration with RC Rez, performed sensitivity/uncertainty (S/U) analyses of these experiments as part of the ongoing collaboration between the United States and the Czech Republic on civilian nuclear energy research and development. The objectives of these analyses were (1) to identify potential sources of bias in fluoride salt-cooled and salt-fueled reactor simulations resulting from cross section uncertainties, and (2) to produce the sensitivity of neutron multiplication to cross section data on an energy-dependent basis for specific nuclides. This report provides a final report on the S/U analyses of critical experiments at the LR-0 Reactor relevant to fluoride salt-cooled high temperature reactor (FHR) and liquid-fueled molten salt reactor (MSR) concepts. In the future, these S/U analyses could be used to inform the design of additional FLiBe-based experiments using the salt from MSRE. The key finding of this work is that, for both solid and liquid fueled fluoride salt reactors, radiative capture in ⁷Li is the most significant contributor to potential bias in neutronics calculations within the FLiBe salt.

Degradation mechanisms of Microcystin-LR during UV-B photolysis and UV/H2O2 processes: Byproducts and pathways.

Science.gov (United States)

Moon, Bo-Ram; Kim, Tae-Kyoung; Kim, Moon-Kyung; Choi, Jaewon; Zoh, Kyung-Duk

2017-10-01

The removal and degradation pathways of microcystin-LR (MC-LR, [M+H] +  = 995.6) in UV-B photolysis and UV-B/H 2 O 2 processes were examined using liquid chromatography-tandem mass spectrometry. The UV/H 2 O 2 process was more efficient than UV-B photolysis for MC-LR removal. Eight by-products were newly identified in the UV-B photolysis ([M+H] +  = 414.3, 417.3, 709.6, 428.9, 608.6, 847.5, 807.4, and 823.6), and eleven by-products were identified in the UV-B/H 2 O 2 process ([M+H] +  = 707.4, 414.7, 429.3, 445.3, 608.6, 1052.0, 313.4, 823.6, 357.3, 245.2, and 805.7). Most of the MC-LR by-products had lower [M+H] + values than the MC-LR itself during both processes, except for the [M+H] + value of 1052.0 during UV-B photolysis. Based on identified by-products and peak area patterns, we proposed potential degradation pathways during the two processes. Bond cleavage and intramolecular electron rearrangement by electron pair in the nitrogen atom were the major reactions during UV-B photolysis and UV-B/H 2 O 2 processes, and hydroxylation by OH radical and the adduct formation reaction between the produced by-products were identified as additional pathways during the UV-B/H 2 O 2 process. Meanwhile, the degradation by-products identified from MC-LR during UV-B/H 2 O 2 process can be further degraded by increasing H 2 O 2 dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

Photocatalytic degradation and mineralization of microcystin-LR under UV-A, solar and visible light using nanostructured nitrogen doped TiO{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Triantis, T.M.; Fotiou, T. [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Kaloudis, T. [Organic Micropollutants Laboratory, Athens Water Supply and Sewerage Company (EYDAP SA), WTP Aharnon, Menidi (Greece); Kontos, A.G.; Falaras, P. [Laboratory of Photo-redox Conversion and Storage of Solar Energy, Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece); Dionysiou, D.D.; Pelaez, M. [Environmental Engineering and Science Program, School of Energy, Environmental, Biological and Medical Engineering, University of Cincinnati, OH 45221-0012 (United States); Hiskia, A., E-mail: hiskia@chem.demokritos.gr [Laboratory of Catalytic - Photocatalytic Processes (Solar Energy - Environment), Institute of Physical Chemistry, National Center for Scientific Research ' Demokritos' , Neapoleos 25, 15310 Agia Paraskevi, Attiki (Greece)

2012-04-15

Highlights: Black-Right-Pointing-Pointer N-TiO{sub 2} exhibited effective degradation of MC-LR under UV-A, solar and visible light. Black-Right-Pointing-Pointer Complete photocatalytic mineralization of MC-LR was achieved under UV-A and solar light. Black-Right-Pointing-Pointer The organic nitrogen is mainly released as ammonium and nitrate ions. - Abstract: In an attempt to face serious environmental hazards, the degradation of microcystin-LR (MC-LR), one of the most common and more toxic water soluble cyanotoxin compounds released by cyanobacteria blooms, was investigated using nitrogen doped TiO{sub 2} (N-TiO{sub 2}) photocatalyst, under UV-A, solar and visible light. Commercial Degussa P25 TiO{sub 2}, Kronos and reference TiO{sub 2} nanopowders were used for comparison. It was found that under UV-A irradiation, all photocatalysts were effective in toxin elimination. The higher MC-LR degradation (99%) was observed with Degussa P25 TiO{sub 2} followed by N-TiO{sub 2} with 96% toxin destruction after 20 min of illumination. Under solar light illumination, N-TiO{sub 2} nanocatalyst exhibits similar photocatalytic activity with that of commercially available materials such as Degussa P25 and Kronos TiO{sub 2} for the destruction of MC-LR. Upon irradiation with visible light Degussa P25 practically did not show any response, while the N-TiO{sub 2} displayed remarkable photocatalytic efficiency. In addition, it has been shown that photodegradation products did not present any significant protein phosphatase inhibition activity, proving that toxicity is proportional only to the remaining MC-LR in solution. Finally, total organic carbon (TOC) and inorganic ions (NO{sub 2}{sup -}, NO{sub 3}{sup -} and NH{sub 4}{sup +}) determinations confirmed that complete photocatalytic mineralization of MC-LR was achieved under both UV-A and solar light.

Ultrasound-based logistic regression model LR2 versus magnetic resonance imaging for discriminating between benign and malignant adnexal masses: a prospective study.

Science.gov (United States)

Shimada, Kanane; Matsumoto, Koji; Mimura, Takashi; Ishikawa, Tetsuya; Munechika, Jiro; Ohgiya, Yoshimitsu; Kushima, Miki; Hirose, Yusuke; Asami, Yuka; Iitsuka, Chiaki; Miyamoto, Shingo; Onuki, Mamiko; Tsunoda, Hajime; Matsuoka, Ryu; Ichizuka, Kiyotake; Sekizawa, Akihiko

2018-06-01

The diagnostic performances of the International Ovarian Tumor Analysis (IOTA) ultrasound-based logistic regression model (LR2) and magnetic resonance imaging (MRI) in discriminating between benign and malignant adnexal masses have not been directly compared in a single study. Using the IOTA LR2 model and subjective interpretation of MRI findings by experienced radiologists, 265 consecutive patients with adnexal masses were preoperatively evaluated in two hospitals between February 2014 and December 2015. Definitive histological diagnosis of excised tissues was used as a gold standard. From the 265 study subjects, 54 (20.4%) tumors were histologically diagnosed as malignant (including 11 borderline and 3 metastatic tumors). Preoperative diagnoses of malignant tumors showed 91.7% total agreement between IOTA LR2 and MRI, with a kappa value of 0.77 [95% confidence interval (CI), 0.68-0.86]. Sensitivity of IOTA LR2 (0.94, 95% CI, 0.85-0.98) for predicting malignant tumors was similar to that of MRI (0.96, 95% CI, 0.87-0.99; P = 0.99), whereas specificity of IOTA LR2 (0.98, 95% CI, 0.95-0.99) was significantly higher than that of MRI (0.91, 95% CI, 0.87-0.95; P = 0.002). Combined IOTA LR2 and MRI results gave the greatest sensitivity (1.00, 95% CI, 0.93-1.00) and had similar specificity (0.91, 95% CI, 0.86-0.94) to MRI. The IOTA LR2 model had a similar sensitivity to MRI for discriminating between benign and malignant tumors and a higher specificity compared with MRI. Our findings suggest that the IOTA LR2 model, either alone or in conjunction with MRI, should be included in preoperative evaluation of adnexal masses.

Variational Ridging in Sea Ice Models

Science.gov (United States)

Roberts, A.; Hunke, E. C.; Lipscomb, W. H.; Maslowski, W.; Kamal, S.

2017-12-01

This work presents the results of a new development to make basin-scale sea ice models aware of the shape, porosity and extent of individual ridges within the pack. We have derived an analytic solution for the Euler-Lagrange equation of individual ridges that accounts for non-conservative forces, and therefore the compressive strength of individual ridges. Because a region of the pack is simply a collection of paths of individual ridges, we are able to solve the Euler-Lagrange equation for a large-scale sea ice field also, and therefore the compressive strength of a region of the pack that explicitly accounts for the macro-porosity of ridged debris. We make a number of assumptions that have simplified the problem, such as treating sea ice as a granular material in ridges, and assuming that bending moments associated with ridging are perturbations around an isostatic state. Regardless of these simplifications, the ridge model is remarkably predictive of macro-porosity and ridge shape, and, because our equations are analytic, they do not require costly computations to solve the Euler-Lagrange equation of ridges on the large scale. The new ridge model is therefore applicable to large-scale sea ice models. We present results from this theoretical development, as well as plans to apply it to the Regional Arctic System Model and a community sea ice code. Most importantly, the new ridging model is particularly useful for pinpointing gaps in our observational record of sea ice ridges, and points to the need for improved measurements of the evolution of porosity of deformed ice in the Arctic and Antarctic. Such knowledge is not only useful for improving models, but also for improving estimates of sea ice volume derived from altimetric measurements of sea ice freeboard.

Ridge regression estimator: combining unbiased and ordinary ridge regression methods of estimation

Directory of Open Access Journals (Sweden)

Sharad Damodar Gore

2009-10-01

Full Text Available Statistical literature has several methods for coping with multicollinearity. This paper introduces a new shrinkage estimator, called modified unbiased ridge (MUR. This estimator is obtained from unbiased ridge regression (URR in the same way that ordinary ridge regression (ORR is obtained from ordinary least squares (OLS. Properties of MUR are derived. Results on its matrix mean squared error (MMSE are obtained. MUR is compared with ORR and URR in terms of MMSE. These results are illustrated with an example based on data generated by Hoerl and Kennard (1975.

Large fault fabric of the Ninetyeast Ridge implies near-spreading ridge formation

Digital Repository Service at National Institute of Oceanography (India)

Sager, W.W.; Paul, C.F.; Krishna, K.S.; Pringle, M.S.; Eisin, A.E.; Frey, F.A.; Rao, D.G.; Levchenko, O.V.

of the high ridge. At 26°S, prominent NE-SW 97 oriented lineations extend southwest from the ridge. Some appear to connect with N-S fracture 98 zone troughs east of NER, implying that the NE-SW features are fracture zone scars formed after 99 the change... to the 105 ridge (Fig. 3). This is especially true for NER south of ~4°S. Where KNOX06RR crossed a 106 gravity lineation, negative gradient features correspond to troughs whereas positive gradient 107 features result from igneous basement highs (Fig. 3...

Influence of the datasets size on the stability of the LR in the lower region of the within source distribution

NARCIS (Netherlands)

Haraksim, Rudolf; Meuwly, Didier

2013-01-01

This article focuses on the statistical evaluation of the fingermark evidence using the likelihood ratio (LR) approach. It studies the influence of the quantity of data used to model the within (WS) and between (BS) source variability. The LR system built for the experiment uses an Automated

Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

African Journals Online (AJOL)

Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

Environmental baseline survey report for West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, West Pine Ridge and parcel 21D in the vicinity of the East Technology Park, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

King, David A. [Oak Ridge Institute for Science and Education (ORISE), Oak Ridge, TN (United States). Independent Environmental Assessment and Verification Program

2012-11-29

This environmental baseline survey (EBS) report documents the baseline environmental conditions of five land parcels located near the U.S. Department of Energy?s (DOE?s) East Tennessee Technology Park (ETTP), including West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, West Pine Ridge, and Parcel 21d. Preparation of this report included the detailed search of federal government records, title documents, aerial photos that may reflect prior uses, and visual inspections of the property and adjacent properties. Interviews with current employees involved in, or familiar with, operations on the real property were also conducted to identify any areas on the property where hazardous substances and petroleum products, or their derivatives, and acutely hazardous wastes may have been released or disposed. In addition, a search was made of reasonably obtainable federal, state, and local government records of each adjacent facility where there has been a release of any hazardous substance or any petroleum product or their derivatives, including aviation fuel and motor oil, and which is likely to cause or contribute to a release of any hazardous substance or any petroleum product or its derivatives, including aviation fuel or motor oil, on the real property. A radiological survey and soil/sediment sampling was conducted to assess baseline conditions of Parcel 21d that were not addressed by the soils-only no-further-investigation (NFI) reports. Groundwater sampling was also conducted to support a Parcel 21d decision. Based on available data West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, and West Pine Ridge are not impacted by site operations and are not subject to actions per the Federal Facility Agreement (FFA). This determination is supported by visual inspections, records searches and interviews, groundwater conceptual modeling, approved NFI reports, analytical data, and risk analysis results. Parcel 21d data, however, demonstrate impacts from site

Environmental baseline survey report for West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, West Pine Ridge and parcel 21D in the vicinity of the East Technology Park, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

King, David A.

2012-01-01

This environmental baseline survey (EBS) report documents the baseline environmental conditions of five land parcels located near the U.S. Department of Energy's (DOE's) East Tennessee Technology Park (ETTP), including West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, West Pine Ridge, and Parcel 21d. Preparation of this report included the detailed search of federal government records, title documents, aerial photos that may reflect prior uses, and visual inspections of the property and adjacent properties. Interviews with current employees involved in, or familiar with, operations on the real property were also conducted to identify any areas on the property where hazardous substances and petroleum products, or their derivatives, and acutely hazardous wastes may have been released or disposed. In addition, a search was made of reasonably obtainable federal, state, and local government records of each adjacent facility where there has been a release of any hazardous substance or any petroleum product or their derivatives, including aviation fuel and motor oil, and which is likely to cause or contribute to a release of any hazardous substance or any petroleum product or its derivatives, including aviation fuel or motor oil, on the real property. A radiological survey and soil/sediment sampling was conducted to assess baseline conditions of Parcel 21d that were not addressed by the soils-only no-further-investigation (NFI) reports. Groundwater sampling was also conducted to support a Parcel 21d decision. Based on available data West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, and West Pine Ridge are not impacted by site operations and are not subject to actions per the Federal Facility Agreement (FFA). This determination is supported by visual inspections, records searches and interviews, groundwater conceptual modeling, approved NFI reports, analytical data, and risk analysis results. Parcel 21d data, however, demonstrate impacts from site

alpha-particle radioactivity from LR 115 by two methods of analysis

CERN Document Server

Azkour, K; Adloff, J C; Pape, A

1999-01-01

LR115 track detectors were exposed to samples of Moroccan phosphate and phosphogypsum to measure their alpha-particle radioactivity. Then two formalisms were used for the dosimetry: simulation by a Monte Carlo method and determination of concentrations from a numerically integrated track registration equation. The results were compared with those deduced gamma-ray spectrometry.

WWER safety investigations on LR-0 reactor

International Nuclear Information System (INIS)

Mikus, J.

2001-01-01

A set of the measurement needed for the WWER-440 and WWER-1000 reactor lifetime assessment, verification of the methods, codes and input cross section libraries for the WWER reactor pressure vessel exposure evaluation has been performed on the LR-0 experimental reactor. The WWER Mock-ups (engineering benchmarks) has been carried out on the reactor, with the aim to investigate differential neutron spectra for reactor dosimetry purposes. Critical experiments have also been performed to determine the perturbation of the fission density distribution caused by the WWER-440 control assembly. Such assembly, partially inserted in the core, has significant influence on the space power distribution. A wide research program for sub-criticality investigations of the spent nuclear fuel storage has been realized on the LR-0 reactor. A benchmark experiment is realized on the reactor in corresponding geometry for CASTOR 440/84 container for storage and transportation of spent fuel. Critical experiments with new fuel assemblies including various burnable absorbers and different enrichments are performed. A set of critical experiments is performed using the fuel assemblies with 3,6% and 4,4% enrichment, arranged in the WWER-440 type cores with various lattice pitch. The critical high of the moderator level and the moderator level coefficient of reactivity are measured and the effect of the fuel assembly, placed in a hexagonal tube of stainless steel containing boron absorber (ATABOR - STANDARD) is investigated. The obtained results are used for the validation of the codes (MCNP, KENO and SCALE) in the frame of the contract 'Burn-up credit implementation for the storage and transport containers of the spent fuel'. Combined neutron-gamma spectra measurements in the WWER-1000 Mock-up are carried out during 2001

Western Indian Ocean - A glimpse of the tectonic scenario

Digital Repository Service at National Institute of Oceanography (India)

Bhattacharya, G.C.; Chaubey, A.K.

is the en echelon displacement of the NW-SE trending ridge axis by numerous NE-SW trending fracture Western Indian Ocean - A Glimpse of the Tectonic Scenario 693 Table 1. Some information from the scientific drilling campaigns in the western Indian Ocean...: Raman Seamount; P: Panikkar Seamount; W: Wadia Guyot; S: SagarKanya Seamount; SR: ShebaRidge; CR: Carlsberg Ridge; CIR: Central Indian Ridge; SWIR: Southwest Indian Ridge; RTJ: Rodrigues Triple Junction; OFZ: Owen Fracture Zone; LR: Laxmi Ridge; MR...

Lettuce (Lactuca sativa L.) leaf-proteome profiles after exposure to cylindrospermopsin and a microcystin-LR/cylindrospermopsin mixture: a concentration-dependent response.

Science.gov (United States)

Freitas, Marisa; Campos, Alexandre; Azevedo, Joana; Barreiro, Aldo; Planchon, Sébastien; Renaut, Jenny; Vasconcelos, Vitor

2015-02-01

The intensification of agricultural productivity is an important challenge worldwide. However, environmental stressors can provide challenges to this intensification. The progressive occurrence of the cyanotoxins cylindrospermopsin (CYN) and microcystin-LR (MC-LR) as a potential consequence of eutrophication and climate change is of increasing concern in the agricultural sector because it has been reported that these cyanotoxins exert harmful effects in crop plants. A proteomic-based approach has been shown to be a suitable tool for the detection and identification of the primary responses of organisms exposed to cyanotoxins. The aim of this study was to compare the leaf-proteome profiles of lettuce plants exposed to environmentally relevant concentrations of CYN and a MC-LR/CYN mixture. Lettuce plants were exposed to 1, 10, and 100 μg/l CYN and a MC-LR/CYN mixture for five days. The proteins of lettuce leaves were separated by two-dimensional electrophoresis (2-DE), and those that were differentially abundant were then identified by matrix-assisted laser desorption/ionization time of flight-mass spectrometry (MALDI-TOF/TOF MS). The biological functions of the proteins that were most represented in both experiments were photosynthesis and carbon metabolism and stress/defense response. Proteins involved in protein synthesis and signal transduction were also highly observed in the MC-LR/CYN experiment. Although distinct protein abundance patterns were observed in both experiments, the effects appear to be concentration-dependent, and the effects of the mixture were clearly stronger than those of CYN alone. The obtained results highlight the putative tolerance of lettuce to CYN at concentrations up to 100 μg/l. Furthermore, the combination of CYN with MC-LR at low concentrations (1 μg/l) stimulated a significant increase in the fresh weight (fr. wt) of lettuce leaves and at the proteomic level resulted in the increase in abundance of a high number of proteins. In

TNF-α-induced NF-κB activation promotes myofibroblast differentiation of LR-MSCs and exacerbates bleomycin-induced pulmonary fibrosis.

Science.gov (United States)

Hou, Jiwei; Ma, Tan; Cao, Honghui; Chen, Yabing; Wang, Cong; Chen, Xiang; Xiang, Zou; Han, Xiaodong

2018-03-01

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and irreversible lung disease of unknown cause. It has been reported that both lung resident mesenchymal stem cells (LR-MSCs) and tumor necrosis factor-α (TNF-α) play important roles in the development of pulmonary fibrosis. However, the underlying connections between LR-MSCs and TNF-α in the pathogenesis of pulmonary fibrosis are still elusive. In this study, we found that the pro-inflammatory cytokine TNF-α and the transcription factor nuclear factor kappa B (NF-κB) p65 subunit were both upregulated in bleomycin-induced fibrotic lung tissue. In addition, we discovered that TNF-α promotes myofibroblast differentiation of LR-MSCs through activating NF-κB signaling. Interestingly, we also found that TNF-α promotes the expression of β-catenin. Moreover, we demonstrated that suppression of the NF-κB signaling could attenuate myofibroblast differentiation of LR-MSCs and bleomycin-induced pulmonary fibrosis which were accompanied with decreased expression of β-catenin. Our data implicates that inhibition of the NF-κB signaling pathway may provide a therapeutic strategy for pulmonary fibrosis, a disease that warrants more effective treatment approaches. © 2017 Wiley Periodicals, Inc.

Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

1993-09-01

This Remedial Investigation (RI) Work Plan specifically addresses Chestnut Ridge Operable Unit 1, (OU1) which consists of the Chestnut Ridge Security Pits (CRSP). The CRSP are located {approximately}800 ft southeast of the central portion of the Y-12 Plant atop Chestnut Ridge, which is bounded to the northwest by Bear Creek Valley and to the southeast by Bethel Valley. Operated from 1973 to 1988, the CRSP consisted of a series of trenches used for the disposal of classified hazardous and nonhazardous waste materials. Disposal of hazardous waste materials was discontinued in December 1984, while nonhazardous waste disposal ended on November 8, 1988. An RI is being conducted at this site in response to CERCLA regulations. The overall objectives of the RI are to collect data necessary to evaluate the nature and extent of contaminants of concern (COC), support an ecological risk assessment (ERA) and a human health risk assessment (HHRA), support the evaluation of remedial alternatives, and ultimately develop a Record of Decision for the site. The purpose of this Work Plan is to outline RI activities necessary to define the nature and extent of suspected contaminants at Chestnut Ridge OU1. Potential migration pathways also will be investigated. Data collected during the RI will be used to evaluate the overall risk posed to human health and the environment by OU1.

Remedial Investigation Work Plan for Chestnut Ridge Operable Unit 1 (Chestnut Ridge Security Pits) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1993-09-01

This Remedial Investigation (RI) Work Plan specifically addresses Chestnut Ridge Operable Unit 1, (OU1) which consists of the Chestnut Ridge Security Pits (CRSP). The CRSP are located ∼800 ft southeast of the central portion of the Y-12 Plant atop Chestnut Ridge, which is bounded to the northwest by Bear Creek Valley and to the southeast by Bethel Valley. Operated from 1973 to 1988, the CRSP consisted of a series of trenches used for the disposal of classified hazardous and nonhazardous waste materials. Disposal of hazardous waste materials was discontinued in December 1984, while nonhazardous waste disposal ended on November 8, 1988. An RI is being conducted at this site in response to CERCLA regulations. The overall objectives of the RI are to collect data necessary to evaluate the nature and extent of contaminants of concern (COC), support an ecological risk assessment (ERA) and a human health risk assessment (HHRA), support the evaluation of remedial alternatives, and ultimately develop a Record of Decision for the site. The purpose of this Work Plan is to outline RI activities necessary to define the nature and extent of suspected contaminants at Chestnut Ridge OU1. Potential migration pathways also will be investigated. Data collected during the RI will be used to evaluate the overall risk posed to human health and the environment by OU1

Ridge Regression Signal Processing

Science.gov (United States)

Kuhl, Mark R.

1990-01-01

The introduction of the Global Positioning System (GPS) into the National Airspace System (NAS) necessitates the development of Receiver Autonomous Integrity Monitoring (RAIM) techniques. In order to guarantee a certain level of integrity, a thorough understanding of modern estimation techniques applied to navigational problems is required. The extended Kalman filter (EKF) is derived and analyzed under poor geometry conditions. It was found that the performance of the EKF is difficult to predict, since the EKF is designed for a Gaussian environment. A novel approach is implemented which incorporates ridge regression to explain the behavior of an EKF in the presence of dynamics under poor geometry conditions. The basic principles of ridge regression theory are presented, followed by the derivation of a linearized recursive ridge estimator. Computer simulations are performed to confirm the underlying theory and to provide a comparative analysis of the EKF and the recursive ridge estimator.

Preliminary results from the first InRidge cruise to the central Indian Ridge

Digital Repository Service at National Institute of Oceanography (India)

Mukhopadhyay, R.; Murthy, K.S.R.; Iyer, S.D.; Rao, M.M.M.; Banerjee, R.; Subrahmanyam, A.S.; Shirodkar, P.V.; Ghose, I.; Ganesan, P.; Rao, A.K.; Suribabu, A.; Ganesh, C.; Naik, G.P.

stream_size 1 stream_content_type text/plain stream_name Inter_Ridge_News_7_40.pdf.txt stream_source_info Inter_Ridge_News_7_40.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...

Greenland Fracture Zone-East Greenland Ridge(s) revisited: Indications of a C22-change in plate motion?

DEFF Research Database (Denmark)

Døssing, Arne; Funck, T.

2012-01-01

a reinterpretation of the Greenland Fracture Zone -East Greenland Ridge based on new and existing geophysical data. Evidence is shown for two overstepping ridge segments (Segments A and B) of which Segment A corresponds to the already known East Greenland Ridge while Segment B was not detected previously......Changes in the lithospheric stress field, causing axial rift migration and reorientation of the transform, are generally proposed as an explanation for anomalously old crust and/or major aseismic valleys in oceanic ridge-transform-ridge settings. Similarly, transform migration of the Greenland...... Fracture Zone and separation of the 200-km-long, fracture-zone-parallel continental East Greenland Ridge from the Eurasia plate is thought to be related to a major change in relative plate motions between Greenland and Eurasia during the earliest Oligocene (Chron 13 time). This study presents...

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

Energy Technology Data Exchange (ETDEWEB)

Machado, J.; Campos, A. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Vasconcelos, V. [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Department of Biology, Faculty of Sciences, University of Porto, Rua do Campo Alegre, P 4069-007 Porto (Portugal); Freitas, M., E-mail: maf@ess.ipp.pt [Interdisciplinary Centre of Marine and Environmental Research (CIIMAR/CIMAR), University of Porto, Rua dos Bragas 289, P 4050-123 Porto (Portugal); Polytechnic Institute of Porto, Department of Environmental Health, School of Allied Health Technologies, CISA/Research Center in Environment and Health, Rua de Valente Perfeito, 322, P 440-330 Gaia (Portugal)

2017-02-15

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Effects of microcystin-LR and cylindrospermopsin on plant-soil systems: A review of their relevance for agricultural plant quality and public health

International Nuclear Information System (INIS)

Machado, J.; Campos, A.; Vasconcelos, V.; Freitas, M.

2017-01-01

Toxic cyanobacterial blooms are recognized as an emerging environmental threat worldwide. Although microcystin-LR is the most frequently documented cyanotoxin, studies on cylindrospermopsin have been increasing due to the invasive nature of cylindrospermopsin-producing cyanobacteria. The number of studies regarding the effects of cyanotoxins on agricultural plants has increased in recent years, and it has been suggested that the presence of microcystin-LR and cylindrospermopsin in irrigation water may cause toxic effects in edible plants. The uptake of these cyanotoxins by agricultural plants has been shown to induce morphological and physiological changes that lead to a potential loss of productivity. There is also evidence that edible terrestrial plants can bioaccumulate cyanotoxins in their tissues in a concentration dependent-manner. Moreover, the number of consecutive cycles of watering and planting in addition to the potential persistence of microcystin-LR and cylindrospermopsin in the environment are likely to result in groundwater contamination. The use of cyanotoxin-contaminated water for agricultural purposes may therefore represent a threat to both food security and food safety. However, the deleterious effects of cyanotoxins on agricultural plants and public health seem to be dependent on the concentrations studied, which in most cases are non-environmentally relevant. Interestingly, at ecologically relevant concentrations, the productivity and nutritional quality of some agricultural plants seem not to be impaired and may even be enhanced. However, studies assessing if the potential tolerance of agricultural plants to these concentrations can result in cyanotoxin and allergen accumulation in the edible tissues are lacking. This review combines the most current information available regarding this topic with a realistic assessment of the impact of cyanobacterial toxins on agricultural plants, groundwater quality and public health. - Highlights: �

Isostatic response of the Laccadive Ridge from admittance analysis of gravity and bathymetry data

Digital Repository Service at National Institute of Oceanography (India)

Chaubey, A.K.; Srinivas, K.; Ashalatha, B.; Rao, D.G.

greater than 0.080 km sup(-1)) fits well with (1) the Airy model whose average crustal thickness (Tc) and density are 17 plus or minus 2 km and 2.7 + 10 sup(3) kg m sup(-3), respectively, and (2) the thin plate flexure model of isostasy with an effective...

Global survey of lunar wrinkle ridge formation times

Science.gov (United States)

Yue, Z.; Michael, G. G.; Di, K.; Liu, J.

2017-11-01

Wrinkle ridges are a common feature of the lunar maria and record subsequent contraction of mare infill. Constraining the timing of wrinkle ridge formation from crater counts is challenging because they have limited areal extent and it is difficult to determine whether superposed craters post-date ridge formation or have alternatively been uplifted by the deformation. Some wrinkle ridges do allow determination to be made. This is possible where a ridge shows a sufficiently steep boundary or scarp that can be identified as deforming an intersecting crater or the crater obliterates the relief of the ridge. Such boundaries constitute only a small fraction of lunar wrinkle ridge structures yet they are sufficiently numerous to enable us to obtain statistically significant crater counts over systems of structurally related wrinkle ridges. We carried out a global mapping of mare wrinkle ridges, identifying appropriate boundaries for crater identification, and mapping superposed craters. Selected groups of ridges were analyzed using the buffered crater counting method. We found that, except for the ridges in mare Tranquilitatis, the ridge groups formed with average ages between 3.5 and 3.1 Ga ago, or 100-650 Ma after the oldest observable erupted basalts where they are located. We interpret these results to suggest that local stresses from loading by basalt fill are the principal agent responsible for the formation of lunar wrinkle ridges, as others have proposed. We find a markedly longer interval before wrinkle ridge formation in Tranquilitatis which likely indicates a different mechanism of stress accumulation at this site.

Best management practices plan for the Chestnut Ridge-Filled Coal Ash Pond at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1996-05-01

The Chestnut Ridge Filled Coal Ash Pond (FCAP) Project has been established to satisfy Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) requirements for the Chestnut Ridge Operable Unit 2. FCAP is on Chestnut Ridge, approximately 0.5 miles south of the Y-12 Plant. A 62-foot high earthen dam across Upper McCoy Branch was constructed in 1955 to create a pond to serve as a settling basin for fly and bottom ashes generated by burning coal at the Y-12 Steam Plant. Ash from the steam was mixed with water to form a slurry and then pumped to the crest of Chestnut Ridge and released through a large pipe to flow across the Sluice Channel area and into the pond. The ash slurry eventually overtopped the dam and flowed along Upper McCoy Branch to Rogers Quarry. The purpose of this document is to provide a site-specific Best Management Practices (BMP) Plan for construction associated with environmental restoration activities at the FCAP Site

Ridge interaction features of the Line Islands

Science.gov (United States)

Konter, J. G.; Koppers, A. A. P.; Storm, L. P.

2016-12-01

The sections of Pacific absolute plate motion history that precede the Hawaii-Emperor and Louisville chains are based on three chains: the Line Islands-Mid-Pacific Mountains, the Hess Rise-Shatsky Rise, and the Marshall Islands-Wake Islands (Rurutu hotspot). Although it has been clear that the Line Islands do not define a simple age progression (e.g. Schlanger et al., 1984), the apparent similarity to the Emperor Seamount geographic trend has been used to extend the overall Hawaii-Emperor track further into the past. However, we show here that plate tectonic reconstructions suggest that the Mid-Pacific Mountains (MPMs) and Line Islands (LIs) were erupted near a mid-ocean ridge, and thus these structures do not reflect absolute plate motion. Moverover, the morphology and geochemistry of the volcanoes show similarities with Pukapuka Ridge (e.g. Davis et al., 2002) and the Rano Rahi seamounts, presumed to have a shallow origin. Modern 40Ar/39Ar ages show that the LIs erupted at various times along the entire volcanic chain. The oldest structures formed within 10 Ma of plate formation. Given the short distance to the ridge system, large aseismic volcanic ridges, such as Necker Ridge and Horizon Guyot may simply reflect a connection between MPMs and the ridge, similar to the Pukapuka Ridge. The Line Islands to the south (including Karin Ridge) define short subchains of elongated seamounts that are widespread, resembling the Rano Rahi seamount field. During this time, the plate moved nearly parallel to the ridge system. The change from few large ridges to many subchains may reflect a change in absolute plate motion, similar to the Rano Rahi field. Here, significant MPMs volcanism is no longer connected to the ridge along plate motion. Similar to Pukapuka vs. Rano Rahi, the difference in direction between plate motion and the closest ridge determines whether larger ridges or smaller seamount subchains are formed. The difference between the largest structures (MPMs and LIs

Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...

African Journals Online (AJOL)

Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...

Radiogenic isotopes in enriched mid-ocean ridge basalts from Explorer Ridge, northeast Pacific Ocean

Science.gov (United States)

Cousens, Brian; Weis, Dominique; Constantin, Marc; Scott, Steve

2017-09-01

Extreme gradients in topography related to variations in magma supply are observed on the Southern Explorer Ridge (SER), part of the northern Juan de Fuca ridge system. We report radiogenic isotope (Pb, Sr, Nd, Hf) and geochemical data for twenty-four basalt whole-rock and glass samples collected from the length of the SER and from Explorer Deep, a rift to the north of the SER. Lavas from the SER form a north-south geochemical gradient, dominated by E-MORB at the northern axial high, and range from T-MORB to N-MORB towards the southern deepest part of the ridge. Linear relationships between incompatible element ratios and isotopic ratios in MORB along the ridge are consistent with mixing of magmas beneath the ridge to generate the geographic gradient from E- to N-MORB. The E-MORB have high Sr and Pb, and low Nd and Hf isotopic ratios, typical of enriched mantle that includes a FOZO or HIMU isotopic component. The West Valley and Endeavour segments of the northern Juan de Fuca ridge also include this isotopic component, but the proportion of the FOZO or HIMU component is more extreme in the SER basalts. The FOZO or HIMU component may be garnet-bearing peridotite, or a garnet pyroxenite embedded in peridotite. Recycled garnet pyroxenite better explains the very shallow SER axial high, high Nb/La and La/Sm, and the ;enriched; isotopic compositions.

Modified CC-LR algorithm with three diverse feature sets for motor imagery tasks classification in EEG based brain-computer interface.

Science.gov (United States)

Siuly; Li, Yan; Paul Wen, Peng

2014-03-01

Motor imagery (MI) tasks classification provides an important basis for designing brain-computer interface (BCI) systems. If the MI tasks are reliably distinguished through identifying typical patterns in electroencephalography (EEG) data, a motor disabled people could communicate with a device by composing sequences of these mental states. In our earlier study, we developed a cross-correlation based logistic regression (CC-LR) algorithm for the classification of MI tasks for BCI applications, but its performance was not satisfactory. This study develops a modified version of the CC-LR algorithm exploring a suitable feature set that can improve the performance. The modified CC-LR algorithm uses the C3 electrode channel (in the international 10-20 system) as a reference channel for the cross-correlation (CC) technique and applies three diverse feature sets separately, as the input to the logistic regression (LR) classifier. The present algorithm investigates which feature set is the best to characterize the distribution of MI tasks based EEG data. This study also provides an insight into how to select a reference channel for the CC technique with EEG signals considering the anatomical structure of the human brain. The proposed algorithm is compared with eight of the most recently reported well-known methods including the BCI III Winner algorithm. The findings of this study indicate that the modified CC-LR algorithm has potential to improve the identification performance of MI tasks in BCI systems. The results demonstrate that the proposed technique provides a classification improvement over the existing methods tested. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Microcystis aeruginos strain [D-Leu1] Mcyst-LR producer, from Buenos Aires province, Argentina

Directory of Open Access Journals (Sweden)

Lorena Rosso

2014-04-01

Full Text Available Objective: To show the toxicological and phylogenetic characterization of a native Microcystis aeruginosa (M. aeruginosa strain (named CAAT 2005-3 isolated from a water body of Buenos Aires province, Argentine. Methods: A M. aeruginosa strain was isolated from the drainage canal of the sewage treatment in the town of Pila, Buenos Aires province, Argentina and acclimated to laboratory conditions. The amplification of cpcBA-IGS Phcocyanin (PC, intergenic spacer and flanking regions was carried out in order to build a phylogenetic tree. An exactive/orbitrap mass spectrometer equipped with an electrospray ionization source (Thermo Fisher Scientific, Bremen, Germany was used for the LC/ESI-HRMS microcystins analysis. The number of cell/mL and [D-Leu1] Mcyst-LR production obtained as a function of time was modelled using the Gompertz equation. Results: The phylogenetic analysis showed that the sequence clustered with others M. aeruginosa sequences obtained from NCBI. The first Argentinian strain of M. aeruginosa (CAAT 2005-3 growing under culture conditions maintains the typical colonial architecture of M. aeruginosa with profuse mucilage. M. aeruginosa CAAT 2005-3 expresses a toxin variant, that was identified by LC-HRMS/Orbitrapas as [D-Leu1] microcystin-LR ([M+H]+=1 037.8 m/z. Conclusions: [D-Leu1] microcystin-LR has been also detected in M. aeruginosa samples from Canada, Brazil and Argentina. This work provides the basis for technological development and production of analytical standards of toxins present in our region.

Neutron flux characterization using Lr-115 NTD and binary glass metal as converter

International Nuclear Information System (INIS)

Alvarado, R.; Palacios, D.; Sajo B, L.; Greaves, E.; Barros, H.; Nemeth, P.; Goncalves, I. F.

2010-01-01

The installed neutron irradiation cell at the Simon Bolivar University Laboratory is employed frequently for applications where the neutron field should be monitored. The ratio of epithermal and thermal neutron flux were determined by the cadmium difference method in three different irradiation locations of a graphite thermalized 252 Cf source. Monte Carlo simulation provided the expected thermal neutron field inside the irradiation cell and the nuclear trace detectors sensitivity. The passive device is a Kodak-Pathe Lr-115 externally coated with a thin (0,1 mm) binary glass metal strip Fe 75 B 25 where the 10 B(n,α) 7 Li reaction converts free neutrons into alpha particles that are registered as etched tracks. The results allow to determine the neutron flux in an easy, reproducible and effective way, with the advantage of a low self-absorption effect due to the converter material. Improved etching process of the Lr-115 nuclear track detectors and the software parameters for track analysis are included. (Author)

Bond scission cross sections for alpha-particles in cellulose nitrate (LR115)

CERN Document Server

Barillon, R; Chambaudet, A; Katz, R; Stoquert, J P; Pape, A

1999-01-01

Chemical damage created by alpha-particles in cellulose nitrate (LR115) have been studied by infrared spectroscopy. This technique enables identifying the sensitive bonds and giving an order of magnitude of their scission cross sections for given alpha-particle energies. The high cross sections observed suggest a new description of the track etch velocity in this material.

Bioleaching of Primary Nickel Ore Using Acidithiobacillus ferrooxidans LR Cells Immobilized in Glass Beads

Directory of Open Access Journals (Sweden)

Ellen Cristine Giese

2015-06-01

Full Text Available Sulphide minerals are one of the most important sources of value metals. For several years, a large number of hydrometallurgical and biotechnological processes have been developed to leach low-grade sulphide ores and the conditions are well established. However, the management of microorganisms in the bioleaching process is not easy to handle. In this paper, the use of immobilized cells of Acidithiobacillus ferrooxidans LR in glass beads in bioleaching of primary nickel ore was evaluated. The column experiments inoculated with immobilized cells of A. ferrooxidans LR showed the same efficiency than the conventional method using free cells and is promising for application on a larger scale as it ensuring integrity and activity of biomining microorganisms and reduce process costs. DOI: http://dx.doi.org/10.17807/orbital.v7i2.698 

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

International Nuclear Information System (INIS)

Lance, Emilie; Neffling, Milla-Riina; Gerard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-01-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 μg L -1 ) and ii) Planktothrix agardhii suspensions producing 5 and 33 μg MC-LR equivalents L -1 over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 μg total MCs g -1 dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 μg total MCs g -1 DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 μg g -1 DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure

Energy Technology Data Exchange (ETDEWEB)

Lance, Emilie, E-mail: emilie.lance@live.f [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Neffling, Milla-Riina [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Gerard, Claudia [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France); Meriluoto, Jussi [Department of Biochemistry and Pharmacy, Abo Akademi University, Tykistoekatu 6, FI-20520 Turku (Finland); Bormans, Myriam [UMR CNRS Ecobio 6553, University of Rennes 1, Campus de Beaulieu, 265 Avenue du General Leclerc, 35042 Rennes Cedex (France)

2010-03-15

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 mug L{sup -1}) and ii) Planktothrix agardhii suspensions producing 5 and 33 mug MC-LR equivalents L{sup -1} over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 mug total MCs g{sup -1} dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 mug total MCs g{sup -1} DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 mug g{sup -1} DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. - The study concerns accumulation and elimination of both free and bound microcystins (MCs) in tissues of a gastropod exposed to MCs producing cyanobacteria or dissolved MC-LR.

The beach ridges of India: A review

Digital Repository Service at National Institute of Oceanography (India)

Kunte, P.D.; Wagle, B.G.

, and is presented in a consolidated form. Beach ridges of the east and west coast of India are grouped in thirteen-beach ridge complexes based on their association. Review indicates that the beach ridges of India are not older than the Holocene age...

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS.

Science.gov (United States)

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, after true (sham) acupuncture in each group. Analysis of changes in connectivity among the brain areas was performed using the brain functional connectivity method. The right cerebrum temporal lobe was selected as the seed point to analyze the functional connectivity. It had a functional connectivity with right cerebrum superior frontal gyrus, limbic lobe cingulate gyrus and left cerebrum inferior temporal gyrus (BA 37), inferior parietal lobule compared by before vs. after acupuncture at LR3, and right cerebrum sub-lobar insula and left cerebrum middle frontal gyrus, medial frontal gyrus compared by true vs. sham acupuncture at LR3, and right cerebrum occipital lobe cuneus, occipital lobe sub-gyral, parietal lobe precuneus and left cerebellum anterior lobe culmen by acupuncture at LR3 vs. sham acupoint. Acupuncture at LR3 mainly specifically activated the brain functional network that participates in visual function, associative function, and emotion cognition, which are similar to the features on LR3 in tradition Chinese medicine. These brain areas constituted a neural network structure with specific functions that had specific reference values for the interpretation of the acupoint specificity of the Taichong acupoint.

Absolute Transition Rates in {sup 188}lr

Energy Technology Data Exchange (ETDEWEB)

Malmskog, S G; Berg, V

1969-09-15

Half-lives of several excited levels in {sup 188}lr have been measured using an electron-electron delayed coincidence spectrometer. Active {sup 188}Pt sources were prepared from spallation products using the ISOLDE on-line mass separator facility at CERN. The following half-lives were obtained: T{sub 1/2} (54.8 keV level) = (1.93 {+-} 0.10) nsec; T{sub 1/2} (96.7 keV level) = (0.59 {+-} 0.12) nsec; T{sub 1/2} (187.6 keV level) = (0.056 {+-} 0.013) nsec; T{sub 1/2} (195.1 keV level) = (0.051 {+-} 0.010) nsec; T{sub 1/2} (478. 3 keV level) {<=} 0.15 nsec The 54.8 keV transition was found to have an enhanced E2 transition probability indicating a collective character for this transition.

Experimental demonstration of CMOS-compatible long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs)

DEFF Research Database (Denmark)

Zektzer, Roy; Desiatov, Boris; Mazurski, Noa

2015-01-01

We demonstrate the design, fabrication and experimental characterization of long-range dielectric-loaded surface plasmon-polariton waveguides (LR-DLSPPWs) that are compatible with complementary metal-oxide semiconductor (CMOS) technology. The demonstrated waveguides feature good mode confinement...

Remedial Investigation Report on Chestnut Ridge Operable Unit 2 (Filled Coal Ash Pond/Upper McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Volume 1. Main Text

International Nuclear Information System (INIS)

1994-08-01

This document is a report on the remedial investigation (RI) of Chestnut Ridge Operable Unit (OU) 2 at the Oak Ridge Y-12 Plant. Chestnut Ridge OU 2 consists of Upper McCoy Branch (UMB), the Filled Coal Ash Pond (FCAP), and the area surrounding the Sluice Channel formerly associated with coal ash disposal in the FCAP. Chestnut Ridge OU 2 is located within the U.S. Department of Energy's (DOE's) Oak Ridge Reservation in Anderson County, Tennessee, approximately 24 miles west of Knoxville. The pond is an 8.5-acre area on the southern slope of Chestnut Ridge, 0.5 mile south of the main Y-12 Plant and geographically separated from the Y-12 Plant by Chestnut Ridge. The elevation of the FCAP is ∼ 950 ft above mean sea level (msl), and it is relatively flat and largely vegetated. Two small ponds are usually present at the northeast and northwest comers of the FCAP. The Sluice Channel Area extends ∼1000 ft from the northern margin of the FCAP to the crest of Chestnut Ridge, which has an elevation of ∼1100 ft above msl. The Sluice Channel Area is largely vegetated also. McCoy Branch runs from the top of Chestnut Ridge across the FCAP into Rogers Quarry and out of the quarry where it runs a short distance into Milton Hill Lake at McCoy Embayment, termed UMB. The portion south of Rogers Quarry, within Chestnut Ridge OU 4, is termed Lower McCoy Branch. The DOE Oak Ridge Y-12 Plant disposed of coal ash from its steam plant operations as a slurry that was discharged into an ash retention impoundment; this impoundment is the FCAP. The FCAP was built in 1955 to serve as a settling basin after coal ash slurried over Chestnut Ridge from the Y-12 Plant. The FCAP was constructed by building an earthen dam across the northern tributary of McCoy Branch. The dam was designed to hold 20 years of Y-12 steam plant ash. By July 1967, ash had filled up the impoundment storage behind the dam to within 4 ft of the top

Remedial Investigation Report on Chestnut Ridge Operable Unit 2 (Filled Coal Ash Pond/Upper McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. Volume 1. Main Text

Energy Technology Data Exchange (ETDEWEB)

1994-08-01

This document is a report on the remedial investigation (RI) of Chestnut Ridge Operable Unit (OU) 2 at the Oak Ridge Y-12 Plant. Chestnut Ridge OU 2 consists of Upper McCoy Branch (UMB), the Filled Coal Ash Pond (FCAP), and the area surrounding the Sluice Channel formerly associated with coal ash disposal in the FCAP. Chestnut Ridge OU 2 is located within the U.S. Department of Energy`s (DOE`s) Oak Ridge Reservation in Anderson County, Tennessee, approximately 24 miles west of Knoxville. The pond is an 8.5-acre area on the southern slope of Chestnut Ridge, 0.5 mile south of the main Y-12 Plant and geographically separated from the Y-12 Plant by Chestnut Ridge. The elevation of the FCAP is {approximately} 950 ft above mean sea level (msl), and it is relatively flat and largely vegetated. Two small ponds are usually present at the northeast and northwest comers of the FCAP. The Sluice Channel Area extends {approximately}1000 ft from the northern margin of the FCAP to the crest of Chestnut Ridge, which has an elevation of {approximately}1100 ft above msl. The Sluice Channel Area is largely vegetated also. McCoy Branch runs from the top of Chestnut Ridge across the FCAP into Rogers Quarry and out of the quarry where it runs a short distance into Milton Hill Lake at McCoy Embayment, termed UMB. The portion south of Rogers Quarry, within Chestnut Ridge OU 4, is termed Lower McCoy Branch. The DOE Oak Ridge Y-12 Plant disposed of coal ash from its steam plant operations as a slurry that was discharged into an ash retention impoundment; this impoundment is the FCAP. The FCAP was built in 1955 to serve as a settling basin after coal ash slurried over Chestnut Ridge from the Y-12 Plant. The FCAP was constructed by building an earthen dam across the northern tributary of McCoy Branch. The dam was designed to hold 20 years of Y-12 steam plant ash. By July 1967, ash had filled up the impoundment storage behind the dam to within 4 ft of the top.

Late-Middle Quaternary lithostratigraphy and sedimentation patterns on the Alpha Ridge, central Arctic Ocean: Implications for Arctic climate variability on orbital time scales

Science.gov (United States)

Wang, Rujian; Polyak, Leonid; Xiao, Wenshen; Wu, Li; Zhang, Taoliang; Sun, Yechen; Xu, Xiaomei

2018-02-01

We use sediment cores collected by the Chinese National Arctic Research Expeditions from the Alpha Ridge to advance Quaternary stratigraphy and paleoceanographic reconstructions for the Arctic Ocean. Our cores show a good litho/biostratigraphic correlation to sedimentary records developed earlier for the central Arctic Ocean, suggesting a recovered stratigraphic range of ca. 0.6 Ma, suitable for paleoclimatic studies on orbital time scales. This stratigraphy was tested by correlating the stacked Alpha Ridge record of bulk XRF manganese, calcium and zirconium (Mn, Ca, Zr), to global stable-isotope (LR04-δ18O) and sea-level stacks and tuning to orbital parameters. Correlation results corroborate the applicability of presumed climate/sea-level controlled Mn variations in the Arctic Ocean for orbital tuning. This approach enables better understanding of the global and orbital controls on the Arctic climate. Orbital tuning experiments for our records indicate strong eccentricity (100-kyr) and precession (∼20-kyr) controls on the Arctic Ocean, probably implemented via glaciations and sea ice. Provenance proxies like Ca and Zr are shown to be unsuitable as orbital tuning tools, but useful as indicators of glacial/deglacial processes and circulation patterns in the Arctic Ocean. Their variations suggest an overall long-term persistence of the Beaufort Gyre circulation in the Alpha Ridge region. Some glacial intervals, e.g., MIS 6 and 4/3, are predominated by material presumably transported by the Transpolar Drift. These circulation shifts likely indicate major changes in the Arctic climatic regime, which yet need to be investigated. Overall, our results demonstrate applicability of XRF data to paleoclimatic studies of the Arctic Ocean.

Preliminary Analysis of the Knipovich Ridge Segmentation - Influence of Focused Magmatism and Ridge Obliquity on an Ultraslow Spreading System

Science.gov (United States)

Okino, K.; Curewitz, D.; Asada, M.; Tamaki, K.

2002-12-01

Bathymetry, gravity and deep-tow sonar image data are used to define the segmentation of a 400 km long portion of the ultraslow-spreading Knipovich Ridge in the Norwegian-Greenland Sea, Northeast Atlantic Ocean. Discrete volcanic centers marked by large volcanic constructions and accompanying short wavelength mantle Bouguer anomaly (MBA) lows generally resemble those of the Gakkel Ridge and the easternmost Southwest Indian Ridge (SWIR). These magmatically robust segment centers are regularly spaced about 85-100 km apart along the ridge, and are characterized by accumulated hummocky terrain, high relief, off-axis seamount chains and significant MBA lows. We suggest that these eruptive centers correspond to areas of enhanced magma flux, and that their spacing reflects the geometry of underlying mantle upwelling cells. The large-scale thermal structure of the mantle primarily controls discrete and focused magmatism, and the relatively wide spacing of these segments may reflect cool mantle beneath the ridge. Segment centers along the southern Knipovich Ridge are characterized by lower relief and smaller MBA anomalies than along the northern section of the ridge. This suggests that ridge obliquity is a secondary control on ridge construction on the Knipovich Ridge, as the obliquity changes from 35° to 49° from north to south, respectively, while spreading rate and axial depth remain approximately constant. The increased obliquity may contribute to decreased effective spreading rates, lower upwelling magma velocity and melt formation, and limited horizontal dike propagation near the surface. We also identify small, magmatically weaker segments with low relief, little or no MBA anomaly, and no off axis expression. We suggest that these segments are either fed by lateral melt migration from adjacent magmatically stronger segments or represent smaller, discrete mantle upwelling centers with short-lived melt supply.

Preliminary analysis of the Knipovich Ridge segmentation: influence of focused magmatism and ridge obliquity on an ultraslow spreading system

Science.gov (United States)

Okino, Kyoko; Curewitz, Daniel; Asada, Miho; Tamaki, Kensaku; Vogt, Peter; Crane, Kathleen

2002-09-01

Bathymetry, gravity and deep-tow sonar image data are used to define the segmentation of a 400 km long portion of the ultraslow-spreading Knipovich Ridge in the Norwegian-Greenland Sea, Northeast Atlantic Ocean. Discrete volcanic centers marked by large volcanic constructions and accompanying short wavelength mantle Bouguer anomaly (MBA) lows generally resemble those of the Gakkel Ridge and the easternmost Southwest Indian Ridge. These magmatically robust segment centers are regularly spaced about 85-100 km apart along the ridge, and are characterized by accumulated hummocky terrain, high relief, off-axis seamount chains and significant MBA lows. We suggest that these eruptive centers correspond to areas of enhanced magma flux, and that their spacing reflects the geometry of underlying mantle upwelling cells. The large-scale thermal structure of the mantle primarily controls discrete and focused magmatism, and the relatively wide spacing of these segments may reflect cool mantle beneath the ridge. Segment centers along the southern Knipovich Ridge are characterized by lower relief and smaller MBA anomalies than along the northern section of the ridge. This suggests that ridge obliquity is a secondary control on ridge construction on the Knipovich Ridge, as the obliquity changes from 35° to 49° from north to south, respectively, while spreading rate and axial depth remain approximately constant. The increased obliquity may contribute to decreased effective spreading rates, lower upwelling magma velocity and melt formation, and limited horizontal dike propagation near the surface. We also identify small, magmatically weaker segments with low relief, little or no MBA anomaly, and no off-axis expression. We suggest that these segments are either fed by lateral melt migration from adjacent magmatically stronger segments or represent smaller, discrete mantle upwelling centers with short-lived melt supply.

Comprehensive integrated planning: A process for the Oak Ridge Reservation, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1998-05-01

The Oak Ridge Comprehensive Integrated Plan is intended to assist the US Department of Energy (DOE) and contractor personnel in implementing a comprehensive integrated planning process consistent with DOE Order 430.1, Life Cycle Asset Management and Oak Ridge Operations Order 430. DOE contractors are charged with developing and producing the Comprehensive Integrated Plan, which serves as a summary document, providing information from other planning efforts regarding vision statements, missions, contextual conditions, resources and facilities, decision processes, and stakeholder involvement. The Comprehensive Integrated Plan is a planning reference that identifies primary issues regarding major changes in land and facility use and serves all programs and functions on-site as well as the Oak Ridge Operations Office and DOE Headquarters. The Oak Ridge Reservation is a valuable national resource and is managed on the basis of the principles of ecosystem management and sustainable development and how mission, economic, ecological, social, and cultural factors are used to guide land- and facility-use decisions. The long-term goals of the comprehensive integrated planning process, in priority order, are to support DOE critical missions and to stimulate the economy while maintaining a quality environment

Comprehensive integrated planning: A process for the Oak Ridge Reservation, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-05-01

The Oak Ridge Comprehensive Integrated Plan is intended to assist the US Department of Energy (DOE) and contractor personnel in implementing a comprehensive integrated planning process consistent with DOE Order 430.1, Life Cycle Asset Management and Oak Ridge Operations Order 430. DOE contractors are charged with developing and producing the Comprehensive Integrated Plan, which serves as a summary document, providing information from other planning efforts regarding vision statements, missions, contextual conditions, resources and facilities, decision processes, and stakeholder involvement. The Comprehensive Integrated Plan is a planning reference that identifies primary issues regarding major changes in land and facility use and serves all programs and functions on-site as well as the Oak Ridge Operations Office and DOE Headquarters. The Oak Ridge Reservation is a valuable national resource and is managed on the basis of the principles of ecosystem management and sustainable development and how mission, economic, ecological, social, and cultural factors are used to guide land- and facility-use decisions. The long-term goals of the comprehensive integrated planning process, in priority order, are to support DOE critical missions and to stimulate the economy while maintaining a quality environment.

Direct determination of bulk etching rate for LR-115-II solid state ...

Indian Academy of Sciences (India)

The thickness of the removed layer of the LR-115-II solid state nuclear track detector during etching is measured directly with a rather precise instrument. Dependence of bulk etching rate on temperature of the etching solution is investigated. It has been found that the bulk etching rate is 3.2 m/h at 60°C in 2.5 N NaOH of ...

Oak Ridge Leadership Computing Facility (OLCF)

Data.gov (United States)

Federal Laboratory Consortium — The Oak Ridge Leadership Computing Facility (OLCF) was established at Oak Ridge National Laboratory in 2004 with the mission of standing up a supercomputer 100 times...

US Department of Energy Oak Ridge Operations Environmental Management Public Involvement Plan for the Oak Ridge Reservation

International Nuclear Information System (INIS)

1996-03-01

This document was prepared in accordance with CERCLA requirements for writing community relations plans. It includes information on how the DOE Oak Ridge Operations Office prepares and executes Environmental Management Community relations activities. It is divided into three sections: the public involvement plan, public involvement in Oak Ridge, and public involvement in 1995. Four appendices are also included: environmental management in Oak Ridge; community and regional overview; key laws, agreements, and policy; and principal contacts

InRidge program: Preliminary results from the first cruise

Digital Repository Service at National Institute of Oceanography (India)

Mukhopadhyay, R.; Murthy, K.S.R.; Iyer, S.D.; Rao, M.M.M.; Banerjee, R.; Subrahmanyam, A.S.; Shirodkar, P.V.; Ghose, I.

The first cruise under India's own Ridge research initiative, InRidge collected new data on bathymetry, free-air gravity and magnetic anomalies across the ridge axis between the Vema and Zhivago transform faults in the Central Indian Ridge...

Quality assurance project plan for the Chestnut Ridge Fly Ash Pond Stabilization Project at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1996-07-01

The Chestnut Ridge Fly Ash Pond Stabilization (CRFAPS) Project will stabilize a 19-m-high (62-ft-high) earthen embankment across Upper McCoy Branch situated along the southern slope of Chestnut Ridge. This task will be accomplished by raising the crest of the embankment, reinforcing the face of the embankment, removing trees from the face and top of the embankment, and repairing the emergency spillway. The primary responsibilities of the team members are: Lockheed Martin Energy Systems, Inc., (Energy Systems) will be responsible for project integration, technical support, Title 3 field support, environmental oversight, and quality assurance (QA) oversight of the project; Foster Wheeler Environmental Corporation (FWENC) will be responsible for design and home office Title 3 support; MK-Ferguson of Oak Ridge Company (MK-F) will be responsible for health and safety, construction, and procurement of construction materials. Each of the team members has a QA program approved by the US Department of Energy (DOE) Oak Ridge Operations. This project-specific QA project plan (QAPP), which is applicable to all project activities, identifies and integrates the specific QA requirements from the participant's QA programs that are necessary for this project

Volcanism and hydrothermalism on a hotspot-influenced ridge: Comparing Reykjanes Peninsula and Reykjanes Ridge, Iceland

Science.gov (United States)

Pałgan, Dominik; Devey, Colin W.; Yeo, Isobel A.

2017-12-01

Current estimates indicate that the number of high-temperature vents (one of the primary pathways for the heat extraction from the Earth's mantle) - at least 1 per 100 km of axial length - scales with spreading rate and should scale with crustal thickness. But up to present, shallow ridge axes underlain by thick crust show anomalously low incidences of high-temperature activity. Here we compare the Reykjanes Ridge, an abnormally shallow ridge with thick crust and only one high-temperature vent known over 900 km axial length, to the adjacent subaerial Reykjanes Peninsula (RP), which is characterized by high-temperature geothermal sites confined to four volcanic systems transected by fissure swarms with young (Holocene) volcanic activity, multiple faults, cracks and fissures, and continuous seismic activity. New high-resolution bathymetry (gridded at 60 m) of the Reykjanes Ridge between 62°30‧N and 63°30‧N shows seven Axial Volcanic Ridges (AVR) that, based on their morphology, geometry and tectonic regime, are analogues for the volcanic systems and fissure swarms on land. We investigate in detail the volcano-tectonic features of all mapped AVRs and show that they do not fit with the previously suggested 4-stage evolution model for AVR construction. Instead, we suggest that AVR morphology reflects the robust or weak melt supply to the system and two (or more) eruption mechanisms may co-exist on one AVR (in contrast to 4-stage evolution model). Our interpretations indicate that, unlike on the Reykjanes Peninsula, faults on and around AVRs do not cluster in orientation domains but all are subparallel to the overall strike of AVRs (orthogonal to spreading direction). High abundance of seamounts shows that the region centered at 62°47‧N and 25°04‧W (between AVR-5 and -6) is volcanically robust while the highest fault density implies that AVR-1 and southern part of AVR-6 rather undergo period of melt starvation. Based on our observations and interpretations we

Lr-Lp Stability of the Incompressible Flows with Nonzero Far-Field Velocity

Directory of Open Access Journals (Sweden)

Jaiok Roh

2011-01-01

Full Text Available We consider the stability of stationary solutions w for the exterior Navier-Stokes flows with a nonzero constant velocity u∞ at infinity. For u∞=0 with nonzero stationary solution w, Chen (1993, Kozono and Ogawa (1994, and Borchers and Miyakawa (1995 have studied the temporal stability in Lp spaces for 11 and obtain Lr-Lp stability as Kozono and Ogawa and Borchers and Miyakawa obtained for u∞=0.

Rapid Isolation of a Single-Chain Antibody against the Cyanobacterial Toxin Microcystin-LR by Phage Display and Its Use in the Immunoaffinity Concentration of Microcystins from Water

Science.gov (United States)

McElhiney, Jacqui; Drever, Mathew; Lawton, Linda A.; Porter, Andy J.

2002-01-01

A naïve (unimmunized) human semisynthetic phage display library was employed to isolate recombinant antibody fragments against the cyanobacterial hepatotoxin microcystin-LR. Selected antibody scFv genes were cloned into a soluble expression vector and expressed in Escherichia coli for characterization against purified microcystin-LR by competition enzyme-linked immunosorbent assay (ELISA). The most sensitive single-chain antibody (scAb) isolated was capable of detecting microcystin-LR at levels below the World Health Organization limit in drinking water (1 μg liter−1) and cross-reacted with three other purified microcystin variants (microcystin-RR, -LW, and -LF) and the related cyanotoxin nodularin. Extracts of the cyanobacterium Microcystis aeruginosa were assayed by ELISA, and quantifications of microcystins in toxic samples showed good correlation with analysis by high-performance liquid chromatography. Immobilized scAb was also used to prepare immunoaffinity columns, which were assessed for the ability to concentrate microcystin-LR from water for subsequent analysis by high-performance liquid chromatography. Anti-microcystin-LR scAb was immobilized on columns via a hexahistidine tag, ensuring maximum exposure of antigen binding sites, and the performance of the columns was evaluated by directly applying 150 ml of distilled water spiked with 4 μg of purified microcystin-LR. The procedure was simple, and a recovery rate of 94% was achieved following elution in 1 ml of 100% methanol. Large-scale, low-cost production of anti-microcystin-LR scAb in E. coli is an exciting prospect for the development of biosensors and on-line monitoring systems for microcystins and will also facilitate a range of immunoaffinity applications for the cleanup and concentration of these toxins from environmental samples. PMID:12406716

Petrological systematics of mid-ocean ridge basalts: Constraints on melt generation beneath ocean ridges

Science.gov (United States)

Langmuir, Charles H.; Klein, Emily M.; Plank, Terry

Mid-ocean ridge basalts (MORB) are a consequence of pressure-release melting beneath ocean ridges, and contain much information concerning melt formation, melt migration and heterogeneity within the upper mantle. MORB major element chemical systematics can be divided into global and local aspects, once they have been corrected for low pressure fractionation and interlaboratory biases. Regional average compositions for ridges unaffected by hot spots ("normal" ridges) can be used to define the global correlations among normalized Na2O, FeO, TiO2 and SiO2 contents, CaO/Al2O3 ratios, axial depth and crustal thickness. Back-arc basins show similar correlations, but are offset to lower FeO and TiO2 contents. Some hot spots, such as the Azores and Galapagos, disrupt the systematics of nearby ridges and have the opposite relationships between FeO, Na2O and depth over distances of 1000 km. Local variations in basalt chemistry from slow- and fast-spreading ridges are distinct from one another. On slow-spreading ridges, correlations among the elements cross the global vector of variability at a high angle. On the fast-spreading East Pacific Rise (EPR), correlations among the elements are distinct from both global and slow-spreading compositional vectors, and involve two components of variation. Spreading rate does not control the global correlations, but influences the standard deviations of axial depth, crustal thickness, and MgO contents of basalts. Global correlations are not found in very incompatible trace elements, even for samples far from hot spots. Moderately compatible trace elements for normal ridges, however, correlate with the major elements. Trace element systematics are significantly different for the EPR and the mid-Atlantic Ridge (MAR). Normal portions of the MAR are very depleted in REE, with little variability; hot spots cause large long wavelength variations in REE abundances. Normal EPR basalts are significantly more enriched than MAR basalts from normal

An aerial radiological survey of the Oak Ridge Reservation and surrounding area, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Maurer, R.J.

1989-09-01

An aerial radiological survey of the Oak Ridge Reservation (ORR) and surrounding area in Oak Ridge, Tennessee, was conducted from September 12--29, 1989. The purpose of the survey was to measure and document the site's terrestrial radiological environment for use in effective environmental management and emergency response planning. The aerial survey was flown at an altitude of 91 meters (300 feet) along a series of parallel lines 152 meters (500 feet) apart. The survey encompassed an area of 440 square kilometers (170 square miles) as defined by the Tennessee Valley Authority Map S-16A of the entire Oak Ridge Reservation and adjacent area. The results of the aerial survey are reported as inferred exposure rates at 1 meter above ground level (AGL) in the form of a radiation contour map. Typical background exposure rates were found to vary from 5 to 14 microroentgens per hour (μR/h). The man-made radionuclides, cobalt-60, cesium-137, and protactinium-234m (a radioisotope indicative of depleted uranium), were detected at several facilities on the site. In support of the aerial survey, ground-based exposure rate and soil sample measurements were obtained at several locations within the survey boundary. In addition to the large scale aerial survey, two special flyovers were requested by the Department of Energy. The first request was to conduct a survey of a 1-mile x 2-mile area in south Knoxville, Tennessee. The area had been used previously to store contaminated scrap metals from operations at the Oak Ridge site. The second request was to fly several passes over a 5-mile length of railroad tracks leading from the Oak Ridge Y-12 Plant, north through the city of Oak Ridge. The railroad tracks had been previously used in the transport of cesium-137

Occurrence of rhyolytic tuffs at deep sea drilling project site 219 on the Laccadive Ridge

Digital Repository Service at National Institute of Oceanography (India)

Siddiquie, H.N.; Sukheswala, R.N.

A study of thin sections from the lower and middle parts of Unit 5 (Paleocene) from Site 219 shows that these largely consist of acidic or rhyolitic tuffs. The overlying limestones in Unit 5 (Paleocene) and Unit 4 (Lower Eocene) also contain...

Oak Ridge Reservation environmental report for 1991

International Nuclear Information System (INIS)

Mucke, P.C.

1992-10-01

The Oak Ridge Reservation Environmental Report for 1991 is the 21st in a series that began in 1971. The report documents the annual results of a comprehensive program to estimate the impact of the US Department of Energy (DOE) Oak Ridge operations upon human health and the environment. The report is organized into ten sections that address various aspects of effluent monitoring, environmental surveillance, dose assessment, waste management, and quality assurance. A compliance summary gives a synopsis of the status of each facility relative to applicable state and federal regulations. Data are included for the following: Oak Ridge Y-12 Plant; Oak Ridge National Laboratory (ORNL); and Oak Ridge K-25 Site. Effluent monitoring and environmental surveillance programs are intended to serve as effective indicators of contaminant releases and ambient contaminant concentrations that have the potential to result in adverse impacts to human health and the environment

IRT-LR-DIF with Estimation of the Focal-Group Density as an Empirical Histogram

Science.gov (United States)

Woods, Carol M.

2008-01-01

Item response theory-likelihood ratio-differential item functioning (IRT-LR-DIF) is used to evaluate the degree to which items on a test or questionnaire have different measurement properties for one group of people versus another, irrespective of group-mean differences on the construct. Usually, the latent distribution is presumed normal for both…

Sex-dependent effects of microcystin-LR on hypothalamic-pituitary-gonad axis and gametogenesis of adult zebrafish

Science.gov (United States)

Liu, Wanjing; Chen, Chuanyue; Chen, Liang; Wang, Li; Li, Jian; Chen, Yuanyuan; Jin, Jienan; Kawan, Atufa; Zhang, Xuezhen

2016-03-01

While microcystins (MCs) have been reported to exert reproductive toxicity on fish with a sex-dependent effect, the underlying mechanism has been rarely investigated. In the present study, zebrafish were exposed to 1, 5 and 20 μg/L MC-LR for 30 d. The gonad-somatic index declined in all treated males. 17β-estradiol (E2), testosterone (T), 11-keto testosterone (11-KT) and follicle-stimulating hormone (FSH) levels increased in serum from all treated females, while T, FSH and luteinizing hormone (LH) levels changed in all treated males. Histomorphological observation showed that MC-LR exposure evidently retarded oogenesis and spermatogenesis. Transcriptional changes of 22 genes of the hypothalamic-pituitary-gonad (HPG) axis exhibited sex-specific responses, and the relationship between gene transcriptions and gametogenesis was evaluated by principle component analysis (PCA). Major contributors to PC1 (gnrh2, gnrhr3, ar, lhr, hmgra, hmgrb and cyp19a) were positively correlated with the number of post-vitellogenic oocytes, while PC1 (gnrh2, lhβ, erβ, fshr, cyp11a and 17βhsd) were positively correlated with the number of spermatozoa. The protein levels of 17βHSD and CYP19a were affected in both females and males. In conclusion, this study first investigated the sex-dependent effects of microcystins on fish reproduction and revealed some important molecular biomarkers related to gametogenesis in zebrafish suffered from MC-LR.

Dynamical instability produces transform faults at mid-ocean ridges.

Science.gov (United States)

Gerya, Taras

2010-08-27

Transform faults at mid-ocean ridges--one of the most striking, yet enigmatic features of terrestrial plate tectonics--are considered to be the inherited product of preexisting fault structures. Ridge offsets along these faults therefore should remain constant with time. Here, numerical models suggest that transform faults are actively developing and result from dynamical instability of constructive plate boundaries, irrespective of previous structure. Boundary instability from asymmetric plate growth can spontaneously start in alternate directions along successive ridge sections; the resultant curved ridges become transform faults within a few million years. Fracture-related rheological weakening stabilizes ridge-parallel detachment faults. Offsets along the transform faults change continuously with time by asymmetric plate growth and discontinuously by ridge jumps.

High performance sulfur, nitrogen and carbon doped mesoporous anatase–brookite TiO2 photocatalyst for the removal of microcystin-LR under visible light irradiation

International Nuclear Information System (INIS)

El-Sheikh, Said M.; Zhang, Geshan; El-Hosainy, Hamza M.; Ismail, Adel A.; O'Shea, Kevin E.; Falaras, Polycarpos; Kontos, Athanassios G.; Dionysiou, Dionysios D.

2014-01-01

Graphical abstract: - Highlights: • Synthesis of tailor-designed C, N and S doped titania anatase–brookite nano-heterojunction photocatalyst. • Microcystin-LR was completely removed in the presence of doped sample under visible light. • The MC-LR degradation rate achieved by the doped sample was much better than that of un-doped sample under visible light. - Abstract: Carbon, nitrogen and sulfur (C, N and S) doped mesoporous anatase–brookite nano-heterojunction titania photocatalysts have been synthesized through a simple sol–gel method in the presence of triblock copolymer Pluronic P123. XRD and Raman spectra revealed the formation of anatase and brookite mixed phases. XPS spectra indicated the presence of C, N and S dopants. The TEM images demonstrated the formation of almost monodisperse titania nanoparticles with particle sizes of approximately 10 nm. N 2 isotherm measurements confirmed that both doped and undoped titania anatase–brookite materials have mesoporous structure. The photocatalytic degradation of the cyanotoxin microcystin-LR (MC-LR) has been investigated using these novel nanomaterials under visible light illumination. The photocatalytic efficiency of the mesoporous titania anatase–brookite photocatalyst dramatically increased with the addition of the C, N and S non-metal, achieving complete degradation (∼100%) of MC-LR. The results demonstrate the advantages of the synthetic approach and the great potential of the visible light activated C, N, and S doped titania photocatalysts for the treatment of organic micropollutants in contaminated waters under visible light

Wrinkle Ridges and Young Fresh Crater

Science.gov (United States)

2002-01-01

(Released 10 May 2002) The Science Wrinkle ridges are a very common landform on Mars, Mercury, Venus, and the Moon. These ridges are linear to arcuate asymmetric topographic highs commonly found on smooth plains. The origin of wrinkle ridges is not certain and two leading hypotheses have been put forth by scientists over the past 40 years. The volcanic model calls for the extrusion of high viscosity lavas along linear conduits. This thick lava accumulated over these conduits and formed the ridges. The other model is tectonic and advocates that the ridges are formed by compressional faulting and folding. Today's THEMIS image is of the ridged plains of Lunae Planum located between Kasei Valles and Valles Marineris in the northern hemisphere of the planet. Wrinkle ridges are found mostly along the eastern side of the image. The broadest wrinkle ridges in this image are up to 2 km wide. A 3 km diameter young fresh crater is located near the bottom of the image. The crater's ejecta blanket is also clearly seen surrounding the sharp well-defined crater rim. These features are indicative of a very young crater that has not been subjected to erosional processes. The Story The great thing about the solar system is that planets are both alike and different. They're all foreign enough to be mysterious and intriguing, and yet familiar enough to be seen as planetary 'cousins.' By comparing them, we can learn a lot about how planets form and then evolve geologically over time. Crinkled over smooth plains, the long, wavy raised landforms seen here are called 'wrinkle ridges,' and they've been found on Mars, Mercury, Venus, and the Moon - that is, on rocky bodies that are a part of our inner solar system. We know from this observation that planets (and large-enough moons) follow similar processes. What we don't know for sure is HOW these processes work. Scientists have been trying to understand how wrinkle ridges form for 40 years, and they still haven't reached a conclusion. That

MACVIA-LR (Fighting Chronic Diseases for Active and Healthy Ageing in Languedoc-Roussillon): A Success Story of the European Innovation Partnership on Active and Healthy Ageing.

Science.gov (United States)

Bousquet, J; Bourret, R; Camuzat, T; Augé, P; Bringer, J; Noguès, M; Jonquet, O; de la Coussaye, J E; Ankri, J; Cesari, M; Guérin, O; Vellas, B; Blain, H; Arnavielhe, S; Avignon, A; Combe, B; Canovas, G; Daien, C; Dray, G; Dupeyron, A; Jeandel, C; Laffont, I; Laune, D; Marion, C; Pastor, E; Pélissier, J Y; Galan, B; Reynes, J; Reuzeau, J C; Bedbrook, A; Granier, S; Adnet, P A; Amouyal, M; Alomène, B; Bernard, P L; Berr, C; Caimmi, D; Claret, P G; Costa, D J; Cristol, J P; Fesler, P; Hève, D; Millot-Keurinck, J; Morquin, D; Ninot, G; Picot, M C; Raffort, N; Roubille, F; Sultan, A; Touchon, J; Attalin, V; Azevedo, C; Badin, M; Bakhti, K; Bardy, B; Battesti, M P; Bobia, X; Boegner, C; Boichot, S; Bonnin, H Y; Bouly, S; Boubakri, C; Bourrain, J L; Bourrel, G; Bouix, V; Bruguière, V; Cade, S; Camu, W; Carre, V; Cavalli, G; Cayla, G; Chiron, R; Coignard, P; Coroian, F; Costa, P; Cottalorda, J; Coulet, B; Coupet, A L; Courrouy-Michel, M C; Courtet, P; Cros, V; Cuisinier, F; Danko, M; Dauenhauer, P; Dauzat, M; David, M; Davy, J M; Delignières, D; Demoly, P; Desplan, J; Dujols, P; Dupeyron, G; Engberink, O; Enjalbert, M; Fattal, C; Fernandes, J; Fouletier, M; Fraisse, P; Gabrion, P; Gellerat-Rogier, M; Gelis, A; Genis, C; Giraudeau, N; Goucham, A Y; Gouzi, F; Gressard, F; Gris, J C; Guillot, B; Guiraud, D; Handweiler, V; Hayot, M; Hérisson, C; Heroum, C; Hoa, D; Jacquemin, S; Jaber, S; Jakovenko, D; Jorgensen, C; Kouyoudjian, P; Lamoureux, R; Landreau, L; Lapierre, M; Larrey, D; Laurent, C; Léglise, M S; Lemaitre, J M; Le Quellec, A; Leclercq, F; Lehmann, S; Lognos, B; Lussert, Cj M; Makinson, A; Mandrick, K; Mares, P; Martin-Gousset, P; Matheron, A; Mathieu, G; Meissonnier, M; Mercier, G; Messner, P; Meunier, C; Mondain, M; Morales, R; Morel, J; Mottet, D; Nérin, P; Nicolas, P; Nouvel, F; Paccard, D; Pandraud, G; Pasdelou, M P; Pasquié, J L; Patte, K; Perrey, S; Pers, Y M; Portejoie, F; Pujol, J L E; Quantin, X; Quéré, I; Ramdani, S; Ribstein, J; Rédini-Martinez, I; Richard, S; Ritchie, K; Riso, J P; Rivier, F; Robine, J M; Rolland, C; Royère, E; Sablot, D; Savy, J L; Schifano, L; Senesse, P; Sicard, R; Stephan, Y; Strubel, D; Tallon, G; Tanfin, M; Tassery, H; Tavares, I; Torre, K; Tribout, V; Uziel, A; Van de Perre, P; Venail, F; Vergne-Richard, C; Vergotte, G; Vian, L; Vialla, F; Viart, F; Villain, M; Viollet, E; Ychou, M; Mercier, J

2016-01-01

The Région Languedoc Roussillon is the umbrella organisation for an interconnected and integrated project on active and healthy ageing (AHA). It covers the 3 pillars of the European Innovation Partnership on Active and Healthy Ageing (EIP on AHA): (A) Prevention and health promotion, (B) Care and cure, (C) and (D) Active and independent living of elderly people. All sub-activities (poly-pharmacy, falls prevention initiative, prevention of frailty, chronic respiratory diseases, chronic diseases with multimorbidities, chronic infectious diseases, active and independent living and disability) have been included in MACVIA-LR which has a strong political commitment and involves all stakeholders (public, private, patients, policy makers) including CARSAT-LR and the Eurobiomed cluster. It is a Reference Site of the EIP on AHA. The framework of MACVIA-LR has the vision that the prevention and management of chronic diseases is essential for the promotion of AHA and for the reduction of handicap. The main objectives of MACVIA-LR are: (i) to develop innovative solutions for a network of Living labs in order to reduce avoidable hospitalisations and loss of autonomy while improving quality of life, (ii) to disseminate the innovation. The three years of MACVIA-LR activities are reported in this paper.

Oak Ridge Reservation environmental report for 1989

International Nuclear Information System (INIS)

Jacobs, V.A.; Wilson, A.R.

1990-10-01

This two-volume report, the Oak Ridge Reservation Environmental Report for 1989, is the nineteenth in an annual series that began in 1971. It reports the results of a comprehensive, year-round program to monitor the impact of operations at the three major US Department of Energy (DOE) production and research installations in Oak Ridge on the immediate areas' and surrounding region's groundwater and surface waters, soil, air quality, vegetation and wildlife, and through these multiple and varied pathways, the resident human population. Information is presented for the environmental monitoring Quality Assurance (QA) Program, audits and reviews, waste management activities, land special environmental studies. Data are included for the Oak Ridge Y-12 Plant, Oak Ridge National Laboratory (ORNL), and Oak Ridge Gaseous Diffusion Plant (ORGDP). Volume 1 presents narratives, summaries, and conclusions based on environmental monitoring at the three DOE installations and in the surrounding environs during calendar year (CY) 1989. Volume 1 is intended to be a ''stand-alone'' report about the Oak Ridge Reservation (ORR) for the reader who does not want an in-depth review of 1989 data. Volume 2 presents the detailed data from which these conclusions have been drawn and should be used in conjunction with Volume 1

Oak Ridge Reservation environmental report for 1989

Energy Technology Data Exchange (ETDEWEB)

Jacobs, V.A.; Wilson, A.R. (eds.)

1990-10-01

This two-volume report, the Oak Ridge Reservation Environmental Report for 1989, is the nineteenth in an annual series that began in 1971. It reports the results of a comprehensive, year-round program to monitor the impact of operations at the three major US Department of Energy (DOE) production and research installations in Oak Ridge on the immediate areas' and surrounding region's groundwater and surface waters, soil, air quality, vegetation and wildlife, and through these multiple and varied pathways, the resident human population. Information is presented for the environmental monitoring Quality Assurance (QA) Program, audits and reviews, waste management activities, land special environmental studies. Data are included for the Oak Ridge Y-12 Plant, Oak Ridge National Laboratory (ORNL), and Oak Ridge Gaseous Diffusion Plant (ORGDP). Volume 1 presents narratives, summaries, and conclusions based on environmental monitoring at the three DOE installations and in the surrounding environs during calendar year (CY) 1989. Volume 1 is intended to be a stand-alone'' report about the Oak Ridge Reservation (ORR) for the reader who does not want an in-depth review of 1989 data. Volume 2 presents the detailed data from which these conclusions have been drawn and should be used in conjunction with Volume 1.

Alveolar ridge rehabilitation to increase full denture retention and stability

Directory of Open Access Journals (Sweden)

Mefina Kuntjoro

2010-12-01

Full Text Available Background: Atrophic mandibular alveolar ridge generally complicates prostetic restoration expecially full denture. Low residual alveolar ridge and basal seat can cause unstable denture, permanent ulcer, pain, neuralgia, and mastication difficulty. Pre-proshetic surgery is needed to improve denture retention and stability. Augmentation is a major surgery to increase vertical height of the atrophic mandible while vestibuloplasty is aimed to increase the denture bearing area. Purpose: The augmentation and vestibuloplasty was aimed to provide stability and retentive denture atrophic mandibular alveolar ridge. Case: A 65 years old woman patient complained about uncomfortable denture. Clinical evaluate showed flat ridge in the anterior mandible, flabby tissue and candidiasis, while residual ridge height was classified into class IV. Case management: Augmentation using autograph was conducted as the mandible vertical height is less than 15 mm. Autograph was used to achieve better bone quantity and quality. Separated alveolar ridge was conducted from left to right canine region and was elevated 0.5 mm from the previous position to get new ridge in the anterior region. The separated alveolar ridge was fixated by using T-plate and ligature wire. Three months after augmentation fixation appliances was removed vestibuloplasty was performed to increase denture bearing area that can make a stable and retentive denture. Conclusion: Augmentation and vestibuloplasty can improve flat ridge to become prominent.Latar belakang: Ridge mandibula yang atrofi pada umumnya mempersulit pembuatan restorasi prostetik terutama gigi tiruan lengkap (GTL. Residual alveolar ridge dan basal seat yang rendah menyebabkan gigi tiruan menjadi tidak stabil, menimbulkan ulser permanen, nyeri, neuralgia, dan kesulitan mengunyah. Tujuan: Augmentasi dan vestibuloplasti pada ridge mandibula yang atrofi dilakukan untuk menciptakan gigi tiruan yang stabil dan retentive. Kasus: Pasien wanita

Ridge and Furrow Fields

DEFF Research Database (Denmark)

Møller, Per Grau

2016-01-01

Ridge and furrow is a specific way of ploughing which makes fields of systematic ridges and furrows like a rubbing washboard. They are part of an overall openfield system, but the focus in this paper is on the functionality of the fields. There are many indications that agro-technological reasons...... systems and the establishment of basic structures like villages (with churches) and townships and states (in northern Europe). The fields can be considered as a resilient structure lasting for 800 years, along with the same basic physical structures in society....

Geology along the Blue Ridge Parkway in Virginia

Science.gov (United States)

Carter, Mark W.; Southworth, C. Scott; Tollo, Richard P.; Merschat, Arthur J.; Wagner, Sara; Lazor, Ava; Aleinikoff, John N.

2017-01-01

Detailed geologic mapping and new SHRIMP (sensitive high-resolution ion microprobe) U-Pb zircon, Ar/Ar, Lu-Hf, 14C, luminescence (optically stimulated), thermochronology (fission-track), and palynology reveal the complex Mesoproterozoic to Quaternary geology along the ~350 km length of the Blue Ridge Parkway in Virginia. Traversing the boundary of the central and southern Appalachians, rocks along the parkway showcase the transition from the para-autochthonous Blue Ridge anticlinorium of northern and central Virginia to the allochthonous eastern Blue Ridge in southern Virginia. From mile post (MP) 0 near Waynesboro, Virginia, to ~MP 124 at Roanoke, the parkway crosses the unconformable to faulted boundary between Mesoproterozoic basement in the core of the Blue Ridge anticlinorium and Neoproterozoic to Cambrian metasedimentary and metavolcanic cover rocks on the western limb of the structure. Mesoproterozoic basement rocks comprise two groups based on SHRIMP U-Pb zircon geochronology: Group I rocks (1.2-1.14 Ga) are strongly foliated orthogneisses, and Group II rocks (1.08-1.00 Ga) are granitoids that mostly lack obvious Mesoproterozoic deformational features.Neoproterozoic to Cambrian cover rocks on the west limb of the anticlinorium include the Swift Run and Catoctin Formations, and constituent formations of the Chilhowee Group. These rocks unconformably overlie basement, or abut basement along steep reverse faults. Rocks of the Chilhowee Group are juxtaposed against Cambrian rocks of the Valley and Ridge province along southeast- and northwest-dipping, high-angle reverse faults. South of the James River (MP 64), Chilhowee Group and basement rocks occupy the hanging wall of the nearly flat-lying Blue Ridge thrust fault and associated splays.South of the Red Valley high-strain zone (MP 144.5), the parkway crosses into the wholly allochthonous eastern Blue Ridge, comprising metasedimentary and meta-igneous rocks assigned to the Wills Ridge, Ashe, and Alligator

Glacial modulation of mid-ocean ridge magmatism and anomalous Pacific Antarctic Ridge volcanism during Termination II

Science.gov (United States)

Asimow, P. D.; Lewis, M.; Lund, D. C.; Seeley, E.; McCart, S.; Mudahy, A.

2017-12-01

Glacially-driven sea level rise and fall may modulate submarine volcanism by superposing pressure changes on the tectonic decompression that causes melt production in the mantle below mid-ocean ridges. A number of recent studies have considered whether this effect is recorded in the periodicity of ridge flank bathymetry (Tolstoy, 2015; Crowley et al., 2015) but interpretation of the bathymetric data remains controversial (Goff, 2016; Olive et al., 2016). We have pursued an independent approach using hydrothermal metals in well-dated near-ridge sediment cores. Along the full length of the East Pacific Rise, in areas of the ocean with widely variable biologic productivity, there are large and consistent rises in Fe, Mn, and As concentrations during the last two glacial terminations. We interpret these cores as records of excess hydrothermal flux due to delayed delivery to the axis of excess melt generated by the preceding falls in sea level. Here we discuss the potentially related discovery, in a core near the Pacific Antarctic Ridge (PAR), of a 10 cm thick layer of basaltic ash shards up to 250 mm in size, coincident with the penultimate deglaciation (Termination II). Although the site was 8 km off-axis at the time, the glasses have major element, volatile, and trace element composition consistent with more evolved members of the axial MORB suite from the nearby ridge axis. Their morphologies are typical of pyroclastic deposits created by explosive submarine volcanism (Clague et al., 2009). We propose that a period of low magmatic flux following a sea-level rise caused cooling of crustal magmatic systems, more advanced fractionation in the axial magma chamber, and increases in viscosity and volatile concentration. We hypothesize subsequent arrival of high magmatic flux during Termination II then reactivated the system and triggered an unusually vigorous series of explosive eruptions along this segment of the PAR. Ash layers recording large eruptions such as this one

Ridge Orientations of the Ridge-Forming Unit, Sinus Meridiani, Mars-A Fluvial Explanation

Science.gov (United States)

Wilkinson, M. Justin; Herridge, A.

2013-01-01

Imagery and MOLA data were used in an analysis of the ridge-forming rock unit (RFU) exposed in Sinus Meridiani (SM). This unit shows parallels at different scales with fluvial sedimentary bodies. We propose the terrestrial megafan as the prime analog for the RFU, and likely for other members of the layered units. Megafans are partial cones of fluvial sediment, with radii up to hundreds of km. Although recent reviews of hypotheses for the RFU units exclude fluvial hypotheses [1], inverted ridges in the deserts of Oman have been suggested as putative analogs for some ridges [2], apparently without appreciating The wider context in which these ridges have formed is a series of megafans [3], a relatively unappreciated geomorphic feature. It has been argued that these units conform to the megafan model at the regional, subregional and local scales [4]. At the regional scale suites of terrestrial megafans are known to cover large areas at the foot of uplands on all continents - a close parallel with the setting of the Meridiani sediments at the foot of the southern uplands of Mars, with its incised fluvial systems leading down the regional NW slope [2, 3] towards the sedimentary units. At the subregional scale the layering and internal discontinuities of the Meridiani rocks are consistent, inter alia, with stacked fluvial units [4]. Although poorly recognized as such, the prime geomorphic environment in which stream channel networks cover large areas, without intervening hillslopes, is the megafan [see e.g. 4]. Single megafans can reach 200,000 km2 [5]. Megafans thus supply an analog for areas where channel-like ridges (as a palimpsest of a prior landscape) cover the intercrater plains of Meridiani [6]. At the local, or river-reach scale, the numerous sinuous features of the RFU are suggestive of fluvial channels. Cross-cutting relationships, a common feature of channels on terrestrial megafans, are ubiquitous. Desert megafans show cemented paleo-channels as inverted

Removal of microcystin-LR from drinking water using a bamboo-based charcoal adsorbent modified with chitosan.

Science.gov (United States)

Zhang, Hangjun; Zhu, Guoying; Jia, Xiuying; Ding, Ying; Zhang, Mi; Gao, Qing; Hu, Ciming; Xu, Shuying

2011-01-01

A new kind of low-cost syntactic adsorbent from bamboo charcoal and chitosan was developed for the removal of microcystin-LR from drinking water. Removal efficiency was higher for the syntactic adsorbent when the amount of bamboo charcoal was increased. The optimum dose ratio of bamboo charcoal to chitosan was 6:4, and the optimum amount was 15 mg/L; equilibrium time was 6 hr. The adsorption isotherm was non-linear and could be simulated by the Freundlich model (R2 = 0.9337). Adsorption efficiency was strongly affected by pH and natural organic matter (NOM). Removal efficiency was 16% higher at pH 3 than at pH 9. Efficiency rate was reduced by 15% with 25 mg/L NOM (UV254 = 0.089 cm(-1)) in drinking water. This study demonstrated that the bamboo charcoal modified with chitosan can effectively remove microcystin-LR from drinking water.

Aerodynamic roughness length related to non-aggregated tillage ridges

Directory of Open Access Journals (Sweden)

M. Kardous

2005-11-01

Full Text Available Wind erosion in agricultural soils is dependent, in part, on the aerodynamic roughness length (z₀ produced by tillage ridges. Although previous studies have related z₀ to ridge characteristics (ridge height (RH and spacing (RS, these relationships have not been tested for tillage ridges observed in the North African agricultural fields. In these regions, due to climate and soil conditions, small plowing tools are largely used. Most of these tools produce non-aggregated and closely-spaced small ridges. Thus, experiments were conducted in a 7-m long wind tunnel to measure z₀ for 11 ridge types covering the range of geometric characteristics frequently observed in south Tunisia. Experimental results suggest that RH²/RS is the first order parameter controlling z₀. A strong relationship between z₀ and RH²/RS is proposed for a wide range of ridge characteristics.

Calendar year 1995 groundwater quality report for the Chestnut Ridge Hydrogeological Regime, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. 1995 Groundwater quality data and calculated rate of contaminant migration

International Nuclear Information System (INIS)

1996-02-01

This annual groundwater quality report (GWQR) contains groundwater quality data obtained during the 1995 calendar year (CY) at several hazardous and nonhazardous waste management facilities associated with the U.S. Department of Energy (DOE) Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. These sites are located south of the Y-12 Plant in the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime), which is one of three regimes defined for the purposes of groundwater quality monitoring at the Y-12 Plant. The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability (HSEA) Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The U.S. Environmental Protection Agency (EPA) identification number for the Y-12 Plant is TN

A Case Report of Ridge Augmentation using Onlay Interpositional Graft: An Approach to Improve Prosthetic Prognosis of a Deficit Ridge

Directory of Open Access Journals (Sweden)

Devanand Shetty

2014-01-01

Full Text Available Background: Periodontal therapy has developed beyond the scope of the treatment of periodontal pathoses. Periodontal plastic surgery consists of the reconstructive procedures designed to enhance the both function and esthetics. Deficient ridges pose a severe problem to the restorative dentist in restoring the natural form, function and esthetics of the prosthesis replacing the natural dentition. Depending upon the severity, location of these defects and the prosthetic option chosen, hard and soft tissue ridge augmentation or non-surgical approach or a combination may help to address them. The present clinical report describes a soft tissue ridge augmentation of a localized ridge defect in maxillary aesthetic region using onlay interpositional graft followed by fixed partial denture.

ENVIRONMENTAL BASELINE SURVEY REPORT FOR WEST BLACK OAK RIDGE, EAST BLACK OAK RIDGE, MCKINNEY RIDGE, WEST PINE RIDGE, AND PARCEL 21D IN THE VICINITY OF THE EAST TENNESSEE TECHNOLOGY PARK, OAK RIDGE, TENNESSEE

Energy Technology Data Exchange (ETDEWEB)

David A. King

2012-11-29

This environmental baseline survey (EBS) report documents the baseline environmental conditions of five land parcels located near the U.S. Department of Energy’s (DOE’s) East Tennessee Technology Park (ETTP), including West Black Oak Ridge, East Black Oak Ridge, McKinney Ridge, West Pine Ridge, and Parcel 21d. The goal is to obtain all media no-further-investigation (NFI) determinations for the subject parcels considering existing soils. To augment the existing soils-only NFI determinations, samples of groundwater, surface water, soil, and sediment were collected to support all media NFI decisions. The only updates presented here are those that were made after the original issuance of the NFI documents. In the subject parcel where the soils NFI determination was not completed for approval (Parcel 21d), the full process has been performed to address the soils as well. Preparation of this report included the detailed search of federal government records, title documents, aerial photos that may reflect prior uses, and visual inspections of the property and adjacent properties. Interviews with current employees involved in, or familiar with, operations on the real property were also conducted to identify any areas on the property where hazardous substances and petroleum products, or their derivatives, and acutely hazardous wastes may have been released or disposed. In addition, a search was made of reasonably obtainable federal, state, and local government records of each adjacent facility where there has been a release of any hazardous substance or any petroleum product or their derivatives, including aviation fuel and motor oil, and which is likely to cause or contribute to a release of any hazardous substance or any petroleum product or its derivatives, including aviation fuel or motor oil, on the real property. A radiological survey and soil/sediment sampling was conducted to assess baseline conditions of Parcel 21d that were not addressed by the soils-only NFI

In vitro translocation experiments with RxLR-reporter fusion proteins of Avr1b from Phytophthora sojae and AVR3a from Phytophthora infestans fail to demonstrate specific autonomous uptake in plant and animal cells.

Science.gov (United States)

Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter

2013-05-01

Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.

Accumulation of free and covalently bound microcystins in tissues of Lymnaea stagnalis (Gastropoda) following toxic cyanobacteria or dissolved microcystin-LR exposure.

Science.gov (United States)

Lance, Emilie; Neffling, Milla-Riina; Gérard, Claudia; Meriluoto, Jussi; Bormans, Myriam

2010-03-01

Accumulation of free microcystins (MCs) in freshwater gastropods has been demonstrated but accumulation of MCs covalently bound to tissues has never been considered so far. Here, we follow the accumulation of total (free and bound) MCs in Lymnaea stagnalis exposed to i) dissolved MC-LR (33 and 100 microg L(-1)) and ii) Planktothrix agardhii suspensions producing 5 and 33 microg MC-LR equivalents L(-1) over a 5-week period, and after a 3-week depuration period. Snails exposed to dissolved MC-LR accumulated up to 0.26 microg total MCs g(-1) dry weight (DW), with no detection of bound MCs. Snails exposed to MCs producing P. agardhii accumulated up to 69.9 microg total MCs g(-1) DW, of which from 17.7 to 66.7% were bound. After depuration, up to 15.3 microg g(-1) DW of bound MCs were detected in snails previously exposed to toxic cyanobacteria, representing a potential source of MCs transfer through the food web. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

siRNA - Mediated LRP/LR knock-down reduces cellular viability of malignant melanoma cells through the activation of apoptotic caspases.

Science.gov (United States)

Rebelo, Thalia M; Vania, Leila; Ferreira, Eloise; Weiss, Stefan F T

2018-07-01

The 37 kDa/67 kDa laminin receptor (LRP/LR) is over-expressed in tumor cells and has been implicated in several tumourigenic processes such as metastasis and telomerase activation, however, more importantly the focus of the present study is on the maintenance of cellular viability and the evasion of apoptosis. The aim of the study was to investigate the role of LRP/LR on the cellular viability of early (A375) and late stage (A375SM) malignant melanoma cells. Flow cytometry and western blot analysis revealed that A375SM cells contain more cell-surface and total LRP/LR levels in comparison to the A375 cells, respectively. In order to determine the effect of LRP/LR on cell viability and apoptosis, LRP was down-regulated via siRNA technology. MTT assays revealed that LRP knock-down led to significant reductions in the viability of A375 and A375SM cells. Confocal microscopy indicated nuclear morphological changes suggestive of apoptotic induction in both cell lines and Annexin-V FITC/PI assays confirmed this observation. Additionally, caspase-3 activity assays revealed that apoptosis was induced in both cell lines after siRNA-mediated down-regulation of LRP. Caspase-8 and -9 activity assays suggested that post LRP knock-down; A375 cells undergo apoptosis solely via the extrinsic pathway, while A375SM cells undergo apoptosis via the intrinsic pathway. siRNAs mediated LRP knock-down might represent a powerful alternative therapeutic strategy for the treatment of malignant melanoma through the induction of apoptosis. Copyright © 2018. Published by Elsevier Inc.

The NACA Exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden

Science.gov (United States)

1956-01-01

The NASA exceptional Service Medal presented at the NACA High Speed Flight Station. L-R: Hugh Dryden, Joe Walker (X-1A research pilot), Stan Butchart (pilot of the B-29 mothership), Richard Payne (X-1A crew chief).

A deep structural ridge beneath central India

Science.gov (United States)

Agrawal, P. K.; Thakur, N. K.; Negi, J. G.

A joint-inversion of magnetic satellite (MAGSAT) and free air gravity data has been conducted to quantitatively investigate the cause for Bouguer gravity anomaly over Central Indian plateaus and possible fold consequences beside Himalayan zone in the Indian sub-continent due to collision between Indian and Eurasian plates. The appropriate inversion with 40 km crustal depth model has delineated after discriminating high density and magnetisation models, for the first time, about 1500 km long hidden ridge structure trending NW-SE. The structure is parallel to Himalayan fold axis and the Indian Ocean ridge in the Arabian Sea. A quantitative relief model across a representative anomaly profile confirms the ridge structure with its highest point nearly 6 km higher than the surrounding crustal level in peninsular India. The ridge structure finds visible support from the astro-geoidal contours.

Metallogenesis along the Indian Ocean Ridge System

Digital Repository Service at National Institute of Oceanography (India)

Banerjee, R.; Ray, Dwijesh

including India. Among these studies majority were concentrated around the Central Indian Ridge and the Southwest Indian Ridge areas, while a few observations were made around the rest of the areas in the IORS. The findings of these studies are discussed...

Ridge Waveguide Structures in Magnesium-Doped Lithium Niobate

Science.gov (United States)

Himmer, Phillip; Battle, Philip; Suckow, William; Switzer, Greg

2011-01-01

This work proposes to establish the feasibility of fabricating isolated ridge waveguides in 5% MgO:LN. Ridge waveguides in MgO:LN will significantly improve power handling and conversion efficiency, increase photonic component integration, and be well suited to spacebased applications. The key innovation in this effort is to combine recently available large, high-photorefractive-damage-threshold, z-cut 5% MgO:LN with novel ridge fabrication techniques to achieve high-optical power, low-cost, high-volume manufacturing of frequency conversion structures. The proposed ridge waveguide structure should maintain the characteristics of the periodically poled bulk substrate, allowing for the efficient frequency conversion typical of waveguides and the high optical damage threshold and long lifetimes typical of the 5% doped bulk substrate. The low cost and large area of 5% MgO:LN wafers, and the improved performance of the proposed ridge waveguide structure, will enhance existing measurement capabilities as well as reduce the resources required to achieve high-performance specifications. The purpose of the ridge waveguides in MgO:LN is to provide platform technology that will improve optical power handling and conversion efficiency compared to existing waveguide technology. The proposed ridge waveguide is produced using standard microfabrication techniques. The approach is enabled by recent advances in inductively coupled plasma etchers and chemical mechanical planarization techniques. In conjunction with wafer bonding, this fabrication methodology can be used to create arbitrarily shaped waveguides allowing complex optical circuits to be engineered in nonlinear optical materials such as magnesium doped lithium niobate. Researchers here have identified NLO (nonlinear optical) ridge waveguide structures as having suitable value to be the leading frequency conversion structures. Its value is based on having the low-cost fabrication necessary to satisfy the challenging pricing

Some improved classification-based ridge parameter of Hoerl and ...

African Journals Online (AJOL)

Some improved classification-based ridge parameter of Hoerl and Kennard estimation techniques. ... This assumption is often violated and Ridge Regression estimator introduced by [2]has been identified to be more efficient than ordinary least square (OLS) in handling it. However, it requires a ridge parameter, K, of which ...

Parameters of calibration of the measurement system of {sup 222} Rn based in LR-115; Parametros de calibracion del sistema de medicion de {sup 222} Rn basado en LR-115

Energy Technology Data Exchange (ETDEWEB)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L. [CREN-UAZ, 98068 Zacatecas (Mexico); Chavez, A. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)]. e-mail: mluisagb@hotmail.com

2003-07-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of {sup 222} Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Design assessment for the Bethel Valley FFA Upgrades at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1995-09-01

This report describes the proposed upgrades to Building 3025 and the Evaporator Area at Oak Ridge National Laboratory. Design assessments, specifications and drawings are provided. Building 3025 is a general purpose research facility utilized by the Materials and Ceramics Division to conduct research on irradiated materials. The Evaporator Area, building 2531, serves as the collection point for all low-level liquid wastes generated at the Oak Ridge National Laboratory

Microcystin-LR equivalent concentrations in fish tissue during a postbloom Microcystis exposure in Loskop Dam, South Africa

CSIR Research Space (South Africa)

Nchabeleng, T

2014-12-01

Full Text Available The effects of a decomposing cyanobacteria bloom on water quality and the accumulation of microcystin-LR equivalent toxin in fish at Loskop Dam were studied in May 2012. Enzyme-linked immunosorbent assay [ELISA] was used to confirm the presence...

Geomorphological investigation of multiphase glacitectonic composite ridge systems in Svalbard

Science.gov (United States)

Lovell, Harold; Benn, Douglas I.; Lukas, Sven; Spagnolo, Matteo; Cook, Simon J.; Swift, Darrel A.; Clark, Chris D.; Yde, Jacob C.; Watts, Tom

2018-01-01

Some surge-type glaciers on the High-Arctic archipelago of Svalbard have large glacitectonic composite ridge systems at their terrestrial margins. These have formed by rapid glacier advance into proglacial sediments during the active surge phase, creating multicrested moraine complexes. Such complexes can be formed during single surge advances or multiple surges to successively less-extensive positions. The few existing studies of composite ridge systems have largely relied on detailed information on internal structure and sedimentology to reconstruct their formation and links to surge processes. However, natural exposures of internal structure are commonly unavailable, and the creation of artificial exposures is often problematic in fragile Arctic environments. To compensate for these issues, we investigate the potential for reconstructing composite ridge system formation based on geomorphological evidence alone, focusing on clear morphostratigraphic relationships between ridges within the moraine complex and relict meltwater channels/outwash fans. Based on mapping at the margins of Finsterwalderbreen (in Van Keulenfjorden) and Grønfjordbreen (in Grønfjorden), we show that relict meltwater channels that breach outer parts of the composite ridge systems are in most cases truncated upstream within the ridge complex by an inner pushed ridge or ridges at their ice-proximal extents. Our interpretation of this relationship is that the entire composite ridge system is unlikely to have formed during the same glacier advance but is instead the product of multiple advances to successively less-extensive positions, whereby younger ridges are emplaced on the ice-proximal side of older ridges. This indicates that the Finsterwalderbreen composite ridge system has been formed by multiple separate advances, consistent with the cyclicity of surges. Being able to identify the frequency and magnitude of former surges is important as it provides insight into the past behaviour of

Oak Ridge reservation land-use plan

Energy Technology Data Exchange (ETDEWEB)

Bibb, W. R.; Hardin, T. H.; Hawkins, C. C.; Johnson, W. A.; Peitzsch, F. C.; Scott, T. H.; Theisen, M. R.; Tuck, S. C.

1980-03-01

This study establishes a basis for long-range land-use planning to accommodate both present and projected DOE program requirements in Oak Ridge. In addition to technological requirements, this land-use plan incorporates in-depth ecological concepts that recognize multiple uses of land as a viable option. Neither environmental research nor technological operations need to be mutually exclusive in all instances. Unique biological areas, as well as rare and endangered species, need to be protected, and human and environmental health and safety must be maintained. The plan is based on the concept that the primary use of DOE land resources must be to implement the overall DOE mission in Oak Ridge. This document, along with the base map and overlay maps, provides a reasonably detailed description of the DOE Oak Ridge land resources and of the current and potential uses of the land. A description of the land characteristics, including geomorphology, agricultural productivity and soils, water courses, vegetation, and terrestrial and aquatic animal habitats, is presented to serve as a resource document. Essentially all DOE land in the Oak Ridge area is being fully used for ongoing DOE programs or has been set aside as protected areas.

Calendar year 1993 groundwater quality report for the Chestnut Ridge Hydrogeologic Regime, Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-02-01

This annual groundwater report contains groundwater quality data obtained during the 1993 calendar year (CY) at several hazardous and non-hazardous waste-management facilities associated with the US Department of Energy (DOE) Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. These sites are located south of the Y-12 Plant in the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime), which is one of three regimes defined for the purposes of groundwater quality monitoring at the Y-12 Plant. The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The annual groundwater report for the Chestnut Ridge Regime is completed in two-parts; Part 1 (this report) containing the groundwater quality data and Part 2 containing a detailed evaluation of the data. The primary purpose of this report is to serve as a reference for the groundwater quality data obtained each year under the lead of the Y-12 Plant GWPP. However, because it contains information needed to comply with Resource Conservation and Recovery Act (RCRA) interim status assessment monitoring and reporting requirements, this report is submitted to the Tennessee Department of Health and Environment (TDEC) by the RCRA reporting deadline

Evaluation of LR-115 cellulose nitrate film for use in bone autoradiography

International Nuclear Information System (INIS)

Harris, M.J.; Schlenker, R.A.

1977-01-01

An evaluation of Kodak LR-115 cellulose nitrate (CN) film for alpha autoradiography of radium-burdened bone was undertaken. Comparison of the registration efficiency between a plaster of Paris radiator and bone samples on NTA nuclear track emulsion and on the CN film is presented. CN film was observed to record as etched-through holes 11 percent and as tracks only 32 percent of the events detected by NTA emulsion. Potential advantages and disadvantages of using CN film in microdosimetry and for adapting it to automated analysis are discussed

Application of the LR-56 at DOE Facilities in the United States

International Nuclear Information System (INIS)

Smith, A.C.

1998-05-01

The ability to ship Type B liquid packages will be necessary for the nuclear industry to meet the energy production requirements of the next century. There are no packages licensed in the United States for transportation of large quantities of such liquids at present. Packages designed for transporting liquids must address technical challenges and incorporate features which are not common to packages designed for solid contents. These issues and the methods of addressing them are illustrated by the safety analysis performed for utilization of the LR-56 Liquid Package at US DOE facilities

Oak Ridge low-level waste disposal facility designs

International Nuclear Information System (INIS)

Van Hoesen, S.D.; Jones, L.S.

1991-01-01

The strategic planning process that culuminates in the identification, selection, construction, and ultimate operation of treatment, storage, and disposal facilities for all types of low-level waste (LLW) generated on the Oak Ridge Reservation (ORR) was conducted under the Low-Level Waste Disposal Development and Demonstration (LLWDDD) Program. This program considered management of various concentrations of short half-life radionuclides generated principally at Oak Ridge National Laboratory (ORNL) and long half-life radionuclides (principally uranium) generated at the Oak Ridge Y-12 Plant and the Oak Ridge K-25 Plant. The LLWDDD Program is still ongoing and involves four phases: (1) alternative identification and evaluation, (2) technology demonstration, (3) limited operational implementation, and (4) full operational implementation. This document provides a discussion of these phases

Lateral ridge split and immediate implant placement in moderately resorbed alveolar ridges: How much is the added width?

Directory of Open Access Journals (Sweden)

Amin Rahpeyma

2013-01-01

Full Text Available Background: Lateral ridge split technique is a way to solve the problem of the width in narrow ridges with adequate height. Simultaneous insertion of dental implants will considerably reduce the edentulism time. Materials and Methods: Twenty-five patients who were managed with ridge splitting technique were enrolled. Thirty-eight locations in both jaws with near equal distribution in quadrants received 82 dental fixtures. Beta Tricalcium phosphate (Cerasorb® was used as biomaterial to fill the intercortical space. Submerged implants were used and 3 months later healing caps were placed. Direct bone measurements before and after split were done with a Collis. Patients were clinically re-evaluated at least 6 months after implant loading. All the data were analyzed by Statistical Package for Social Sciences (SPSS software version 11.5 (SPSS Inc, Chicago Illinois, USA. Frequency of edentulous spaces and pre/post operative bone width was analyzed. Paired t-test was used for statistical analysis. Difference was considered significant if P value was less than 0.05. Results: Mean value for presplit width was 3.2 ± 0.34 mm while post-split mean width was 5.57 ± 0.49 mm. Mean gain in crest ridge after ridge splitting was 2 ± 0.3 mm. Statistical analysis showed significant differences in width before and after operation ((P < 0.05. All implants (n = 82 survived and were in full function at follow up (at least 6 months after implant loading. Conclusion: Ridge splitting technique in both jaws showed the predictable outcomes, if appropriate cases selected and special attention paid to details; then the waiting time between surgery and beginning of prosthodontic treatment can be reduced to 3 month.

Mid-Ocean Ridge Melt Supply and Glacial Cycles: A 3D EPR Study of Crustal Thickness, Layer 2A, and Bathymetry

Science.gov (United States)

Boulahanis, B.; Aghaei, O.; Carbotte, S. M.; Huybers, P. J.; Langmuir, C. H.; Nedimovic, M. R.; Carton, H. D.; Canales, J. P.

2017-12-01

Recent studies suggest that eustatic sea level fluctuations induced by glacial cycles in the Pleistocene may influence mantle-melting and volcanic eruptions at mid-ocean ridges (MOR), with models predicting variation in oceanic crustal thickness linked to sea level change. Previous analyses of seafloor bathymetry as a proxy for crustal thickness show significant spectral energy at frequencies linked to Milankovitch cycles of 1/23, 1/41, and 1/100 ky-1, however the effects of faulting in seafloor relief and its spectral characteristics are difficult to separate from climatic signals. Here we investigate the hypothesis of climate driven periodicity in MOR magmatism through spectral analysis, time series comparisons, and statistical characterization of bathymetry data, seismic layer 2A thickness (as a proxy for extrusive volcanism), and seafloor-to-Moho thickness (as a proxy for total magma production). We utilize information from a three-dimensional multichannel seismic study of the East Pacific Rise and its flanks from 9°36`N to 9°57`N. We compare these datasets to the paleoclimate "LR04" benthic δ18O stack. The seismic dataset covers 770 km2 and provides resolution of Moho for 92% of the imaged region. This is the only existing high-resolution 3-D image across oceanic crust, making it ideal for assessing the possibility that glacial cycles modulate magma supply at fast spreading MORs. The layer 2A grid extends 9 km (170 ky) from the ridge axis, while Moho imaging extends to a maximum of 16 km (310 ky). Initial results from the East Pacific Rise show a relationship between sea level and both crustal thickness and sea floor depth, consistent with the hypothesis that magma supply to MORs may be modulated by glacial cycles. Analysis of crustal thickness and bathymetry data reveals spectral peaks at Milankovitch frequencies of 1/100 ky-1 and 1/41 ky-1 where datasets extend sufficiently far from the ridge. The layer 2A grid does not extend sufficiently far from the

Remedial investigation work plan for Chestnut Ridge Operable Unit 4 (Rogers Quarry/Lower McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

1993-09-01

The Oak Ridge Y-12 Plant includes - 800 acres near the northeast comer of the reservation and adjacent to the city of Oak Ridge (Fig. 1-1). The plant is a manufacturing and developmental engineering facility that produced components for various nuclear weapons systems and provides engineering support to other Energy Systems facilities. More than 200 contaminated sites have been identified at the Y-12 Plant that resulted from past waste management practices. Many of the sites have operable units (OUs) based on priority and on investigative and remediation requirements. This Remedial Investigation RI work plan specifically addresses Chestnut Ridge OU 4. Chestnut Ridge OU 4 consists of Rogers Quarry and Lower McCoy Branch (MCB). Rogers Quarry, which is also known as Old Rogers Quarry or Bethel Valley Quarry was used for quarrying from the late 1940s or early 1950s until about 1960. Since that time, the quarry has been used for disposal of coal ash and materials from Y-12 production operations, including classified materials. Disposal of coal ash ended in July 1993. An RI is being conducted at this site in response to CERCLA regulations. The overall objectives of the RI are to collect data necessary to evaluate the nature and extent of contaminants of concern, support an Ecological Risk Assessment and a Human Health Risk Assessment, support the evaluation of remedial alternatives, and ultimately develop a Record of Decision for the site. The purpose of this work plan is to outline RI activities necessary to define the nature and extent of suspected contaminants at Chestnut Ridge OU 4. Potential migration pathways also will be investigated. Data collected during the RI will be used to evaluate the risk posed to human health and the environment by OU 4.

Effects of serotonin on expression of the LDL receptor family member LR11 and 7-ketocholesterol-induced apoptosis in human vascular smooth muscle cells

Energy Technology Data Exchange (ETDEWEB)

Nagayama, Daiji; Ishihara, Noriko [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Bujo, Hideaki [Department of Clinical Laboratory Medicine, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Shirai, Kohji [Department of Vascular Function, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan); Tatsuno, Ichiro, E-mail: ichiro.tatsuno@med.toho-u.ac.jp [Center of Diabetes, Endocrinology and Metabolism, Toho University, Sakura Medical Center, 564-1, Shimoshizu, Sakura-City, Chiba 285-8741 (Japan)

2014-04-18

Highlights: • The dedifferentiation of VSMCs in arterial intima is involved in atherosclerosis. • 5-HT showed proliferative effect on VSMCs which was abolished by sarpogrelate. • 5-HT enhanced expression of LR11 mRNA in VSMCs which was abolished by sarpogrelate. • 5-HT suppressed 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. • The mechanisms explain the 5-HT-induced remodeling of arterial structure. - Abstract: Serotonin (5-HT) is a known mitogen for vascular smooth muscle cells (VSMCs). The dedifferentiation and proliferation/apoptosis of VSMCs in the arterial intima represent one of the atherosclerotic changes. LR11, a member of low-density lipoprotein receptor family, may contribute to the proliferation of VSMCs in neointimal hyperplasia. We conducted an in vitro study to investigate whether 5-HT is involved in LR11 expression in human VSMCs and apoptosis of VSMCs induced by 7-ketocholesterol (7KCHO), an oxysterol that destabilizes plaque. 5-HT enhanced the proliferation of VSMCs, and this effect was abolished by sarpogrelate, a selective 5-HT2A receptor antagonist. Sarpogrelate also inhibited the 5-HT-enhanced LR11 mRNA expression in VSMCs. Furthermore, 5-HT suppressed the 7KCHO-induced apoptosis of VSMCs via caspase-3/7-dependent pathway. These findings provide new insights on the changes in the differentiation stage of VSMCs mediated by 5-HT.

Orientationally ordered ridge structures of aluminum films on hydrogen terminated silicon

DEFF Research Database (Denmark)

Quaade, Ulrich; Pantleon, Karen

2006-01-01

Films of aluminum deposited onto Si(100) substrates show a surface structure of parallel ridges. On films deposited on oxidized silicon substrates the direction of the ridges is arbitrary, but on films deposited on hydrogen-terminated Si(100) the ridges are oriented parallel to the < 110 > direct......Films of aluminum deposited onto Si(100) substrates show a surface structure of parallel ridges. On films deposited on oxidized silicon substrates the direction of the ridges is arbitrary, but on films deposited on hydrogen-terminated Si(100) the ridges are oriented parallel to the ... > directions on the silicon substrate. The ridge structure appears when the film thickness is above 500 nm, and increasing the film thickness makes the structure more distinct. Anodic oxidation enhances the structure even further. X-ray diffraction indicates that grains in the film have mostly (110) facets...

Tectonics of ridge-transform intersections at the Kane fracture zone

Science.gov (United States)

Karson, J. A.; Dick, H. J. B.

1983-03-01

The Kane Transform offsets spreading-center segments of the Mid-Atlantic Ridge by about 150 km at 24° N latitude. In terms of its first-order morphological, geological, and geophysical characteristics it appears to be typical of long-offset (>100 km), slow-slipping (2 cm yr-1) ridge-ridge transform faults. High-resolution geological observations were made from deep-towed ANGUS photographs and the manned submersible ALVIN at the ridge-transform intersections and indicate similar relationships in these two regions. These data indicate that over a distance of about 20 km as the spreading axes approach the fracture zone, the two flanks of each ridge axis behave in very different ways. Along the flanks that intersect the active transform zone the rift valley floor deepens and the surface expression of volcanism becomes increasingly narrow and eventually absent at the intersection where only a sediment-covered ‘nodal basin’ exists. The adjacent median valley walls have structural trends that are oblique to both the ridge and the transform and have as much as 4 km of relief. These are tectonically active regions that have only a thin (young volcanics passes laterally into median valley walls with a simple block-faulted character where only volcanic rocks have been found. Along strike toward the fracture zone, the youngest volcanics form linear constructional volcanic ridges that transect the entire width of the fracture zone valley. These volcanics are continuous with the older-looking, slightly faulted volcanic terrain that floors the non-transform fracture zone valleys. These observations document the asymmetric nature of seafloor spreading near ridge-transform intersections. An important implication is that the crust and lithosphere across different portions of the fracture zone will have different geological characteristics. Across the active transform zone two lithosphere plate edges formed at ridge-transform corners are faulted against one another. In the non

Internal doses in Oak Ridge. The Internet beams

International Nuclear Information System (INIS)

Passchier, W.F.

1997-01-01

A brief overview is given of the information, presented by the Radiation Internal Dose Information Center (RIDIC) of the Oak Ridge Associated Universities in Oak Ridge, TN, USA, via Internet (www.orau.gov/ehsd/ridic.htm)

Optical dating of dune ridges on Rømø

DEFF Research Database (Denmark)

Madsen, Anni Tindahl; Murray, A. S.; Andersen, Thorbjørn Joest

2007-01-01

The application of optically stimulated luminescence (OSL) to the dating of recent aeolian sand ridges on Rømø, an island off the southwest coast of Denmark, is tested. These sand ridges began to form approximately 300 years ago, and estimates of the ages are available from historical records....... Samples for OSL dating were taken ~0.5 m below the crests of four different dune ridges; at least five samples were recovered from each ridge to test the internal consistency of the ages. Additional samples were recovered from the low lying areas in the swales and from the scattered dune formations......-defined building phases separated by inactive periods and the first major ridge formed ~235 years ago. This study demonstrates that optical dating can be successfully applied to these young aeolian sand deposits, and we conclude that OSL dating is a powerful chronological tool in studies of coastal change....

Normalization Ridge Regression in Practice I: Comparisons Between Ordinary Least Squares, Ridge Regression and Normalization Ridge Regression.

Science.gov (United States)

Bulcock, J. W.

The problem of model estimation when the data are collinear was examined. Though the ridge regression (RR) outperforms ordinary least squares (OLS) regression in the presence of acute multicollinearity, it is not a problem free technique for reducing the variance of the estimates. It is a stochastic procedure when it should be nonstochastic and it…

Hydrodynamic role of longitudinal ridges in a leatherback turtle swimming

Science.gov (United States)

Bang, Kyeongtae; Kim, Jooha; Lee, Sang-Im; Choi, Haecheon

2015-11-01

The leatherback sea turtle (Dermochelys coriacea), the fastest swimmer and the deepest diver among marine turtles, has five longitudinal ridges on its carapace. These ridges are the most remarkable morphological features distinguished from other marine turtles. To investigate the hydrodynamic role of these ridges in the leatherback turtle swimming, we model a carapace with and without ridges by using three dimensional surface data of a stuffed leatherback turtle in the National Science Museum, Korea. The experiment is conducted in a wind tunnel in the ranges of the real leatherback turtle's Reynolds number (Re) and angle of attack (α). The longitudinal ridges function differently according to the flow condition (i.e. Re and α). At low Re and negative α that represent the swimming condition of hatchlings and juveniles, the ridges significantly decrease the drag by generating streamwise vortices and delaying the main separation. On the other hand, at high Re and positive α that represent the swimming condition of adults, the ridges suppress the laminar separation bubble near the front part by generating streamwise vortices and enhance the lift and lift-to-drag ratio. Supported by the NRF program (2011-0028032).

Equatorial segment of the mid-atlantic ridge

Energy Technology Data Exchange (ETDEWEB)

NONE

1997-12-31

The Equatorial Segment of the Mid-Atlantic Ridge is a part of this mid-oceanic ridge limited by a cluster of fracture zones - Cape Verde, Marathon, Mercury, Vema, Doldrums, Vernadsky and Sierra Leone - in the North, and a similar cluster of fracture zones - St Paul, Romanche and Chain - in the South. During recent decades, following the publication of the 5. edition of the General Bathymetric Chart of the Oceans (GEBCO), there has been a great deal of geological-geophysical research and mapping of the World Ocean. The results have led to the development of a number of theories concerning the essential heterogeneity of the structure of the ocean floor and, in particular, the heterogeneity of the structure and segmentation of mid-oceanic ridges. Research on the nature of such segmentation is of great importance for an understanding of the processes of development of such ridges and oceanic basins as a whole. Chapter 20 is dedicated to the study of the atlantic ocean mantle by using (Th.U)Th, (Th/U)pb and K/Ti systematics 380 refs.

Equatorial segment of the mid-atlantic ridge

International Nuclear Information System (INIS)

1996-01-01

The Equatorial Segment of the Mid-Atlantic Ridge is a part of this mid-oceanic ridge limited by a cluster of fracture zones - Cape Verde, Marathon, Mercury, Vema, Doldrums, Vernadsky and Sierra Leone - in the North, and a similar cluster of fracture zones - St Paul, Romanche and Chain - in the South. During recent decades, following the publication of the 5. edition of the General Bathymetric Chart of the Oceans (GEBCO), there has been a great deal of geological-geophysical research and mapping of the World Ocean. The results have led to the development of a number of theories concerning the essential heterogeneity of the structure of the ocean floor and, in particular, the heterogeneity of the structure and segmentation of mid-oceanic ridges. Research on the nature of such segmentation is of great importance for an understanding of the processes of development of such ridges and oceanic basins as a whole. Chapter 20 is dedicated to the study of the atlantic ocean mantle by using (Th.U)Th, (Th/U)pb and K/Ti systematics

Equatorial segment of the mid-atlantic ridge

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-12-31

The Equatorial Segment of the Mid-Atlantic Ridge is a part of this mid-oceanic ridge limited by a cluster of fracture zones - Cape Verde, Marathon, Mercury, Vema, Doldrums, Vernadsky and Sierra Leone - in the North, and a similar cluster of fracture zones - St Paul, Romanche and Chain - in the South. During recent decades, following the publication of the 5. edition of the General Bathymetric Chart of the Oceans (GEBCO), there has been a great deal of geological-geophysical research and mapping of the World Ocean. The results have led to the development of a number of theories concerning the essential heterogeneity of the structure of the ocean floor and, in particular, the heterogeneity of the structure and segmentation of mid-oceanic ridges. Research on the nature of such segmentation is of great importance for an understanding of the processes of development of such ridges and oceanic basins as a whole. Chapter 20 is dedicated to the study of the atlantic ocean mantle by using (Th.U)Th, (Th/U)pb and K/Ti systematics 380 refs.

Does the lateral intercondylar ridge disappear in ACL deficient patients?

NARCIS (Netherlands)

van Eck, C.F.; Martins, C.A.Q.; Vyas, S.M.; Celentano, U.; van Dijk, C.N.; Fu, F.H.

2010-01-01

The aim of this study was to determine whether there is a difference in the presence of the lateral intercondylar ridge and the lateral bifurcate ridge between patients with sub-acute and chronic ACL injuries. We hypothesized that the ridges would be present less often with chronic ACL deficiency.

Mantle Convection beneath the Aegir Ridge, a Shadow in the Iceland Hotspot

Science.gov (United States)

Howell, S. M.; Ito, G.; Breivik, A. J.; Hanan, B. B.; Mjelde, R.; Sayit, K.; Vogt, P. R.

2012-12-01

The Iceland Hotspot has produced extensive volcanism spanning much of the ocean basin between Greenland and Norway, forming one of the world's largest igneous provinces. However, an apparent igneous "shadow" in hotspot activity is located at the fossil Aegir Ridge, which formed anomalously thin crust, despite this ridge being near the Iceland hotspot when it was active. The Aegir Ridge accommodated seafloor spreading northeast of present-day Iceland from the time of continental breakup at ~55 Ma until ~25 Ma, at which point spreading shifted west to the Kolbeinsey Ridge. To address the cause of the anomalously thin crust produced by the Aegir Ridge, we use three-dimensional numerical models to simulate the interaction between a mantle plume beneath the Iceland hotspot, rifting continental lithosphere, and the time-evolving North Atlantic ridge system. Two end-member hypotheses were investigated: (1) Material emanating from the Iceland mantle plume was blocked from reaching the Aegir Ridge by the thick lithosphere of the Jan Mayen Microcontinent as the Kolbeinsey Ridge began rifting it from Greenland at ~30 Ma, just east of the plume center; (2) Plume material was not blocked and did reach the Aegir Ridge, but had already experienced partial melting closer to the hotspot. This material was then unable to produce melt volumes at the Aegir Ridge comparable to those of pristine mantle. To test these hypotheses, we vary the volume flux and viscosity of the plume, and identify which conditions do and do not lead to the Aegir Ridge forming anomalously thin crust. Results show that the combination of plume material being drawn into the lithospheric channels beneath the Reykjanes Ridge and Kolbeinsey Ridge after their respective openings, and the impedance of plume flow by the Jan Mayen Microcontinent (hypothesis 1), can deprive the Aegir Ridge of plume influence. This leads to low crustal thicknesses that are comparable to those observed. We have yet to produce a model

Sex Determination from Fingerprint Ridge Density | Gungadin ...

African Journals Online (AJOL)

This study was conducted with an aim to establish a relationship between sex and fingerprint ridge density. The fingerprints were taken from 500 subjects (250 males and 250 females) in the age group of 18-60 years. After taking fingerprints, the ridges were counted in the upper portion of the radial border of each print for all ...

Activity and Transcriptional Responses of Hepatopancreatic Biotransformation and Antioxidant Enzymes in the Oriental River Prawn Macrobrachium nipponense Exposed to Microcystin-LR

Directory of Open Access Journals (Sweden)

Julin Yuan

2015-10-01

Full Text Available Microcystins (MCs are a major group of cyanotoxins with side effects in many organisms; thus, compounds in this group are recognized as potent stressors and health hazards in aquatic ecosystems. In order to assess the toxicity of MCs and detoxification mechanism of freshwater shrimp Macrobrachium nipponense, the full-length cDNAs of the glutathione S-transferase (gst and catalase (cat genes were isolated from the hepatopancreas. The transcription level and activity changes in the biotransformation enzyme (glutathione S-transferase (GST and antioxidant enzymes (superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx in the hepatopancreas of M. nipponense exposed to MC-LR (0.2, 1, 5, and 25 μg/L for 12, 24, 72 and 96 h were analyzed. The results showed that the isolated full-length cDNAs of cat and gst genes from M. nipponense displayed a high similarity to other crustaceans, and their mRNAs were mainly expressed in the hepatopancreas. MC-LR caused significant increase of GST activity following 48–96 h (p < 0.05 and an increase in SOD activity especially in 24- and 48-h exposures. CAT activity was activated when exposed to MC-LR in 12-, 24- and 48-h exposures and then it was inhibited at 96-h exposure. There was no significant effect on GPx activity after the 12- and 24-h exposures, whereas it was significantly stimulated after the 72- and 96-h exposures (p < 0.05. The transcription was altered similarly to enzyme activity, but the transcriptional response was generally more immediate and had greater amplitude than enzymatic response, particularly for GST. All of the results suggested that MC-LR can induce antioxidative modulation variations in M. nipponense hepatopancreas in order to eliminate oxidative damage.

Bioinspired design of a ridging shovel with anti-adhesive and drag reducing

Directory of Open Access Journals (Sweden)

Zhijun Zhang

2015-03-01

Full Text Available Learning from the microstructure of the convex (concave and ridging (triangle and arc-shaped shapes of fresh lotus leaves and shark skin, bionic ridging shovels was designed with the characteristics of adhesion and resistance reduction. Ten ridging shovel models were established, and the interaction process with the soil by ANSYS is discussed. Stress analysis results showed that the bionic ridging shovel was more obvious in visbreaking and in the resistance reduction effect. An indoor soil bin experiment with the bionic ridging shovel and the prototype ridging shovel was operated as follows: the ridging resistance of the three types of ridging shovel was tested under the condition of two soil moistures (18.61% and 20.9% and three different ridging speeds (0.68, 0.87, and 1.11 m/s. In this article, the structure, the mechanism, and their relationship to the functions are discussed. The results of this study will be useful in practical application in the field of agricultural machinery toward practical use and industrialization.

Calendar year 1996 annual groundwater monitoring report for the Chestnut Ridge Hydrogeologic Regime at the U.S. Department of Energy Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1997-02-01

This annual monitoring report contains groundwater and surface water monitoring data obtained in the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime) during calendar year (CY) 1996. The Chestnut Ridge Regime encompasses a section of Chestnut Ridge west of Scarboro Road and east of an unnamed drainage feature southwest of the US Department of Energy (DOE) Oak Ridge Y-12 Plant (unless otherwise noted, directions are in reference to the Y-12 Plant administrative grid). The Chestnut Ridge Regime contains several sites used for management of hazardous and nonhazardous wastes associated with plant operations. Groundwater and surface water quality monitoring associated with these waste management sites is performed under the auspices of the Y-12 Plant Groundwater Protection Program (GWPP). Included in this annual monitoring report are the groundwater monitoring data obtained in compliance with the Resource Conservation and Recovery Act (RCRA) Post-Closure Permit for the Chestnut Ridge Regime (post-closure permit) issued by the Tennessee Department of Environment and Conservation (TDEC) in June 1996. Besides the signed certification statement and the RCRA facility information summarized below, condition II.C.6 of the post-closure permit requires annual reporting of groundwater monitoring activities, inclusive of the analytical data and results of applicable data evaluations, performed at three RCRA hazardous waste treatment, storage, or disposal (TSD) units: the Chestnut Ridge Sediment Disposal Basin (Sediment Disposal Basin), the Chestnut Ridge Security Pits (Security Pits), and Kerr Hollow Quarry

Europan double ridge morphometry as a test of formation models

Science.gov (United States)

Dameron, Ashley C.; Burr, Devon M.

2018-05-01

Double ridges on the Jovian satellite Europa consist of two parallel ridges with a central trough. Although these features are nearly ubiquitous on Europa, their formation mechanism(s) is (are) not yet well-understood. Previous hypotheses for their formation can be divided into two groups based on 1) the expected interior slope angles and 2) the magnitude of interior/exterior slope symmetry. The published hypotheses in the first ("fracture") group entail brittle deformation of the crust, either by diapirism, shear heating, or buckling due to compression. Because these mechanisms imply uplift of near-vertical fractures, their predicted interior slopes are steeper than the angle of repose (AOR) with shallower exterior slopes. The second ("flow") group includes cryosedimentary and cryovolcanic processes - explosive or effusive cryovolcanism and tidal squeezing -, which are predicted to form ridge slopes at or below the AOR. Explosive cryovolcanism would form self-symmetric ridges, whereas effusive cryolavas and cryo-sediments deposited during tidal squeezing would likely not exhibit slope symmetry. To distinguish between these two groups of hypothesized formation mechanisms, we derived measurements of interior slope angle and interior/exterior slope symmetry at multiple locations on Europa through analysis of data from the Galileo Solid State Imaging (SSI) camera. Two types of data were used: i) elevation data from five stereo-pair digital elevation models (DEMs) covering four ridges (580 individual measurements), and ii) ridge shadow length measurements taken on individual images over 40 ridges (200 individual measurements). Our results shows that slopes measured on our DEMs, located in the Cilix and Banded Plains regions, typically fall below the AOR, and slope symmetry is dominant. Two different shadow measurement techniques implemented to calculate interior slopes yielded slope angles that also fall below the AOR. The shallow interior slopes derived from both

The thermal structure of a wind-driven Reynolds ridge

Energy Technology Data Exchange (ETDEWEB)

Phongikaroon, Supathorn; Peter Judd, K.; Smith, Geoffrey B.; Handler, Robert A. [Remote Sensing Division, Naval Research Laboratory, 20375, Washington, DC (United States)

2004-08-01

In this study, we investigate the nature of a Reynolds ridge formed by wind shear. We have simultaneously imaged the water surface, with a deposit of a monolayer of the surfactant, oleyl alcohol, subject to different wind shears, by using a high-resolution infrared (IR) detector and a high-speed (HS) digital camera. The results reveal that the regions around the wind-driven Reynolds ridge, which have subtle manifestations in visual imagery, possess surprisingly complex hydrodynamical and thermal structures when observed in the infrared. The IR measurements reveal a warm, clean region upstream of the ridge, which is composed of the so called fishscale structures observed in earlier investigations. The region downstream of the ridge is composed of colder fluid which forms two counter-rotating cells. A region of intermediate temperature, which we call the mixing (wake) region, forms immediately downstream of the ridge near the channel centerline. By measuring the velocity of the advected fishscales, we have determined a surface drift speed of about 2% of the wind speed. The spanwise length-scale of the structures has also been used to estimate the wind shear. In addition, a comparison of IR and visual imagery shows that the thermal field is a very sensitive indicator of the exact position of the ridge itself. (orig.)

Development of COS-SNP and HRM markers for high-throughput and reliable haplotype-based detection of Lr14a in durum wheat (Triticum durum Desf.).

Science.gov (United States)

Terracciano, Irma; Maccaferri, Marco; Bassi, Filippo; Mantovani, Paola; Sanguineti, Maria C; Salvi, Silvio; Simková, Hana; Doležel, Jaroslav; Massi, Andrea; Ammar, Karim; Kolmer, James; Tuberosa, Roberto

2013-04-01

Leaf rust (Puccinia triticina Eriks. & Henn.) is a major disease affecting durum wheat production. The Lr14a-resistant gene present in the durum wheat cv. Creso and its derivative cv. Colosseo is one of the best characterized leaf-rust resistance sources deployed in durum wheat breeding. Lr14a has been mapped close to the simple sequence repeat markers gwm146, gwm344 and wmc10 in the distal portion of the chromosome arm 7BL, a gene-dense region. The objectives of this study were: (1) to enrich the Lr14a region with single nucleotide polymorphisms (SNPs) and high-resolution melting (HRM)-based markers developed from conserved ortholog set (COS) genes and from sequenced Diversity Array Technology (DArT(®)) markers; (2) to further investigate the gene content and colinearity of this region with the Brachypodium and rice genomes. Ten new COS-SNP and five HRM markers were mapped within an 8.0 cM interval spanning Lr14a. Two HRM markers pinpointed the locus in an interval of HRM designed for agarose gel electrophoresis/KASPar(®) assays and high-resolution melting analysis, respectively, as well as the double-marker combinations ubw14/ubw18, ubw14/ubw35 and wPt-4038-HRM-ubw35 will be useful for germplasm haplotyping and for molecular-assisted breeding.

Addition of phosphotungstic acid to ethanol for dehydration improves both the ultrastructure and antigenicity of pituitary tissue embedded in LR White acrylic resin.

Science.gov (United States)

Sakai, Yuko; Hosaka, Masahiro; Hira, Yoshiki; Watanabe, Tsuyoshi

2005-12-01

Although hydrophilic acrylic resins including LR White have been widely utilized as embedding media for immunocytochemical use, the constituents of tissues are often extracted by the resin monomer during the infiltration process of the embedment, resulting in a discernible impairment of the ultrastructure when the tissue is weakly fixed only with aldehydes. To minimize the extraction by the resin monomer, the embedding procedure with LR White resin was reexamined in the present study. Among the treatments tested, a partial dehydration with 70% ethanol containing 2% phosphotungstic acid (PTA) well preserved the ultrastructure of the pituitary tissue without spoiling the antigenicity of LHbeta and other representative markers for the Golgi apparatus. In addition, treatment with 1% tannic acid (TA) prior to the dehydration described above synergistically improved both the ultrastructure and antigenicity of the tissue so that the orientation of the Golgi apparatus could be determined by double immunogold labeling with commercially available anti-GM130 and anti-TGN38 antibodies. The ultrathin sections from the LR White-embedded tissue treated with TA and dehydrated in 70% ethanol containing 2% PTA also enhanced contrast without conventional heavy-metal staining with uranyl acetate and lead citrate. Our findings further suggest that the precipitation of TA and PTA protected the tissue from being extracted during the embedment, probably because an insoluble complex was transiently formed with the constituents of the tissue. This simple modification of the LR White embedment can extend the application of post-embedding immunocytochemistry as an alternative to pre-embedding immunolabeling with frozen ultrathin sections.

IMAGING OF BRAIN FUNCTION BASED ON THE ANALYSIS OF FUNCTIONAL CONNECTIVITY - IMAGING ANALYSIS OF BRAIN FUNCTION BY FMRI AFTER ACUPUNCTURE AT LR3 IN HEALTHY INDIVIDUALS

OpenAIRE

Zheng, Yu; Wang, Yuying; Lan, Yujun; Qu, Xiaodong; Lin, Kelin; Zhang, Jiping; Qu, Shanshan; Wang, Yanjie; Tang, Chunzhi; Huang, Yong

2016-01-01

Objective: This Study observed the relevant brain areas activated by acupuncture at the Taichong acupoint (LR3) and analyzed the functional connectivity among brain areas using resting state functional magnetic resonance imaging (fMRI) to explore the acupoint specificity of the Taichong acupoint. Methods: A total of 45 healthy subjects were randomly divided into the Taichong (LR3) group, sham acupuncture group and sham acupoint group. Subjects received resting state fMRI before acupuncture, a...

Strongly coupled interaction between a ridge of fluid and an inviscid airflow

KAUST Repository

Paterson, C.

2015-07-01

© 2015 AIP Publishing LLC. The behaviour of a steady thin sessile or pendent ridge of fluid on an inclined planar substrate which is strongly coupled to the external pressure gradient arising from an inviscid airflow parallel to the substrate far from the ridge is described. When the substrate is nearly horizontal, a very wide ridge can be supported against gravity by capillary and/or external pressure forces; otherwise, only a narrower (but still wide) ridge can be supported. Classical thin-aerofoil theory is adapted to obtain the governing singular integro-differential equation for the profile of the ridge in each case. Attention is focused mainly on the case of a very wide sessile ridge. The effect of strengthening the airflow is to push a pinned ridge down near to its edges and to pull it up near to its middle. At a critical airflow strength, the upslope contact angle reaches the receding contact angle at which the upslope contact line de-pins, and continuing to increase the airflow strength beyond this critical value results in the de-pinned ridge becoming narrower, thicker, and closer to being symmetric in the limit of a strong airflow. The effect of tilting the substrate is to skew a pinned ridge in the downslope direction. Depending on the values of the advancing and receding contact angles, the ridge may first de-pin at either the upslope or the downslope contact line but, in general, eventually both contact lines de-pin. The special cases in which only one of the contact lines de-pins are also considered. It is also shown that the behaviour of a very wide pendent ridge is qualitatively similar to that of a very wide sessile ridge, while the important qualitative difference between the behaviour of a very wide ridge and a narrower ridge is that, in general, for the latter one or both of the contact lines may never de-pin.

Site descriptions of environmental restoration units at Oak Ridge National Laboratory, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Kuhaida, A.J. Jr.; Parker, A.F.

1997-02-01

This report provides summary information on Oak Ridge National Laboratory (ORNL) Environmental Restoration (ER) sites as listed in the Oak Ridge Reservation Federal Facility Agreement (FFA), dated January 1, 1992, Appendix C. The Oak Ridge National Laboratory was built in 1943 as part of the World War II Manhattan Project. The original mission of ORNL was to produce and chemically separate the first gram-quantities of plutonium as part of the national effort to produce the atomic bomb. The current mission of ORNL is to provide applied research and development in support of the U.S. Department of Energy (DOE) programs in nuclear fusion and fission, energy conservation, fossil fuels, and other energy technologies and to perform basic scientific research in selected areas of the physical, life, and environmental sciences. ER is also tasked with clean up or mitigation of environmental impacts resulting from past waste management practices on portions of the approximately 37,000 acres within the Oak Ridge Reservation (ORR). Other installations located within the ORR are the Gaseous Diffusion Plant (K-25) and the Y-12 plant. The remedial action strategy currently integrates state and federal regulations for efficient compliance and approaches for both investigations and remediation efforts on a Waste Area Grouping (WAG) basis. As defined in the ORR FFA Quarterly Report July - September 1995, a WAG is a grouping of potentially contaminated sites based on drainage area and similar waste characteristics. These contaminated sites are further divided into four categories based on existing information concerning whether the data are generated for scoping or remedial investigation (RI) purposes. These areas are as follows: (1) Operable Units (OU); (2) Characterization Areas (CA); (3) Remedial Site Evaluation (RSE) Areas; and (4) Removal Site Evaluation (RmSE) Areas.

Parameters of calibration of the measurement system of 222 Rn based in LR-115

International Nuclear Information System (INIS)

Garcia, M.L.; Mireles, F.; Quirino, L.; Davila, I.; Lugo, F.; Pinedo, J.L.; Chavez, A.

2003-01-01

Since the SSNTD technique (Solid State Nuclear Track Detection) it was discovered it has been used as passive method for the detection of subnuclear particles in great variety of fields of the science. The use of the technique in measurements of 222 Rn in air have already been established implying better methodologies in the exhibition to the environment until their engraving and reading processes. The SSNTD technique is since a method by comparison since the material it can be used a single time, therefore it requires of calibration in one controlled radon atmosphere, using gauged standards. The objective of this work is to show the calibration of the devices used as radon monitors based on SSNTD. The material used as SSNTD is LR-115 Il. The standardization of the parameters used in the exhibition to radon in air, engraving and reading process, its are based on the response of the LR-115 Il, the one arrangement of the device, engraving speed and mainly the calibration factor. They are considered two types of monitors: Open camera and Closed camera, the difference among the calibration factors of both cameras is the percentage of the descendants of radon in the open camera. The standardized parameters are operation voltage of the counting system; temperature, time and concentration of the engraving solution; and thickness. (Author)

Maxillary anterior ridge augmentation with recombinant human bone morphogenetic protein 2.

Science.gov (United States)

Edmunds, Ryan K; Mealey, Brian L; Mills, Michael P; Thoma, Daniel S; Schoolfield, John; Cochran, David L; Mellonig, Jim

2014-01-01

No human studies exist on the use of recombinant human bone morphogenetic protein 2 (rhBMP-2) on an absorbable collagen sponge (ACS) as a sole graft material for lateral ridge augmentation in large ridge defect sites. This series evaluates the treatment outcome of maxillary anterior lateral ridge augmentation with rhBMP-2/ACS. Twenty patients were treated with rhBMP-2/ACS and fixation screws for space maintenance. Cone beam volumetric tomography measurements were used to determine gain in ridge width, and a bone core biopsy was obtained. The mean horizontal ridge gain was 1.2 mm across sites, and every site gained width.

The effects of ridging, row-spacing and seeding rate on carrot yield

Directory of Open Access Journals (Sweden)

S. TAIVALMAA

2008-12-01

Full Text Available Cool, wet spring weather often delays the early growth of carrots (Daucus carota L. in northern Europe. This effect may be partly obviated by sowing in ridges. Many types of ridges are used, but the most suitable for carrot cultivation under the conditions prevailing in northern Europe has yet to be determined. The effects of ridging, seeding rate and sowing system on the yield and visible quality of carrots were therefore studied in the field during three years. The highest yields were recorded for carrots sown in double rows on a narrow ridge. The effect of sowing system on mean root weight differed depending on the ridging regime. The mean weight of roots was higher for carrots cultivated on broad ridges than in other systems. Seeding rate had the most significant effect on mean root weight. For industrial purposes it is recommended that carrots be cultivated on broad ridges in double rows at low seeding rates with irrigation. The optimal cultivation technique for carrots destined for the fresh vegetable market would be narrow ridges sown in double rows at high seeding rates. The ridging system, seeding rate and row spacing did not appear to affect the external quality of roots. More detailed studies should be carried out to establish the effects of abiotic growth factors under different ridging regimes.;

The effects of ridging, row-spacing and seeding rate on carrot yield

Directory of Open Access Journals (Sweden)

Sanna-Liisa Taivalmaa

1997-12-01

Full Text Available Cool, wet spring weather often delays the early growth of carrots (Daucus carota L. in northern Europe. This effect may be partly obviated by sowing in ridges. Many types of ridges are used, but the most suitable for carrot cultivation under the conditions prevailing in northern Europe has yet to be determined. The effects of ridging, seeding rate and sowing system on the yield and visible quality of carrots were therefore studied in the field during three years. The highest yields were recorded for carrots sown in double rows on a narrow ridge. The effect of sowing system on mean root weight differed depending on the ridging regime. The mean weight of roots was higher for carrots cultivated on broad ridges than in other systems. Seeding rate had the most significant effect on mean root weight. For industrial purposes it is recommended that carrots be cultivated on broad ridges in double rows at low seeding rates with irrigation. The optimal cultivation technique for carrots destined for the fresh vegetable market would be narrow ridges sown in double rows at high seeding rates. The ridging system, seeding rate and row spacing did not appear to affect the external quality of roots. More detailed studies should be carried out to establish the effects of abiotic growth factors under different ridging regimes.

Unfaulting the Sardarapat Ridge, Southwest Armenia

Science.gov (United States)

Wetmore, P.; Connor, C.; Connor, L. J.; Savov, I. P.; Karakhanyan, A.

2012-12-01

Armenia is located near the core of contractional deformation associated with the collision between the Arabian and Eurasian tectonic plates. Several studies of this region, including portions of adjacent Georgia, Iran, and Turkey, have indicated that 1-2 mm/yr of intra-plate, north-south shortening is primarily accommodated by a network of E-W trending thrust faults, and NW-trending (dextral) and NE-trending (sinistral) strike-slip faults. One proposed fault in this network, the Sardarapat Fault (SF), was investigated as part of a regional seismic hazard assessment ahead of the installation of a replacement reactor at the Armenian Nuclear Power Plant (ANPP). The SF is primarily defined by the Sardarapat Ridge (SR), which is a WNW-trending, 40-70 m high topographic feature located just north of the Arax River and the Turkey-Armenia border. The stratigraphy comprising this ridge includes alluvium overlying several meters of lacustrine deposits above a crystal-rich basaltic lava flow that yields an Ar-Ar age of 0.9 +/- 0.02 Ma. The alluvial sediments on the ridge contain early Bronze age (3832-3470 BP) artifacts at an elevation 25 m above those of the surrounding alluvial plane. This has lead to the suggestion that the SR is bound to the south (the steepest side) by the SF, which is uplifting the ridge at a rate of 0.7 mm/yr. However, despite the prominence and trend of the ridge there are no unequivocal observations, such as scarps or exposures of fault rocks, to support the existence of the SF. The goal of the investigation of the SR area was to test various models for the formation of the ridge including faulting and combined volcanic and erosional processes. We therefore collected gravimetric, magnetic, magneto-tellurics (MT), and transient electromagnetic (TEM) data across an area of ~400 km2, and used correlations of stratigraphic data from coreholes drilled proximal to the study area to define the geometry of the contact between the basement and basin fill to

Type B liquid package technical issues -- Experience with LR-56 safety analysis

International Nuclear Information System (INIS)

Smith, A.C.; Alstine, M.N. van; Gromada, R.J.; Hensel, S.J.; Gupta, N.K.

1997-01-01

In the course of the development of nuclear industry in France, shipment of Type B quantities (i.e., quantities having significant radiological consequences) of radioactive liquids between different, sites became necessary. Based on the experience acquired at the Commissariat a l'Energie Atomique (CEA) nuclear centers, a series of tanker trailers has been developed to meet this need. Similarly, as part of the ongoing program to process wastes to stable end forms, a need exists to move radioactive liquids at several DOE sites. The LR-56, developed by CEA to transport liquids of medium to high activity, was selected for these US applications, based on its design features and successful operating experience in France. No comparable Type B liquid packages are certified in the US Packages employed in transport of Type B quantities of liquids are either only suitable for small volumes, or are used within site boundaries with extensive administrative controls employed to insure that an adequate level of safety is maintained. The requirement is to provide safety equivalent to the level established by federal regulations in 10 CFR 71. Type B radioactive materials packages (RAM packages) are typically simple, rugged containers which are designed and fabricated in accordance with the ASME Boiler and Pressure Vessel Code to provide containment under the normal conditions of transport (NCT) and hypothetical accident conditions (HAC) established by the regulations. Packages designed for liquid contents must address a number of technical issues which are not common to packages for solid contents. This paper reviews the technical issues associated with Type B liquid packages from the perspective of the experience gained from the evaluation of the LR-56 for use at DOE sites

Perturbation measurements in reactor LR-0 and their evaluation

International Nuclear Information System (INIS)

Rypar, W.; Faehrmann, K.H.

1988-07-01

To investigate space-dependent kinetic effects in reactors of the WWER-1000 type, two central and one eccentric perturbation measurements were performed in the zero power reactor LR-0 of the UJV Rez (CSSR) by trapeze-form movements of an absorber cluster. The measurements were based ona computer aided CAMAC system for the simultaneous data acquisition of 20 spatially distributed neutron detectors and for cluster movement control. The measurements were followed by a detailed evaluation in the ZfK Rossendorf (GDR) with respect to the calculation results of flux response obtained by nodal code HEXDYN3D, the aim of which was to demostrate the limits of the point reactor model and to account for space-dependent effects by approximative methods. A sensitive check of the calculation methods was made possible especially by the eccentric perturbation where the space dependent effects,due to a larger distance of cluster movement, were most significant. (author). 17 figs., 9 refs

Influence of management of variables, sampling zones and land units on LR analysis for landslide spatial prevision

Directory of Open Access Journals (Sweden)

R. Greco

2013-09-01

Full Text Available Several authors, according to different methodological approaches, have employed logistic Regression (LR, a multivariate statistical analysis adopted to assess the spatial probability of landslide, even though its fundamental principles have remained unaltered. This study aims at assessing the influence of some of these methodological approaches on the performance of LR, through a series of sensitivity analyses developed over a test area of about 300 km2 in Calabria (southern Italy. In particular, four types of sampling (1 – the whole study area; 2 – transects running parallel to the general slope direction of the study area with a total surface of about 1/3 of the whole study area; 3 – buffers surrounding the phenomena with a 1/1 ratio between the stable and the unstable area; 4 – buffers surrounding the phenomena with a 1/2 ratio between the stable and the unstable area, two variable coding modes (1 – grouped variables; 2 – binary variables, and two types of elementary land (1 – cells units; 2 – slope units units have been tested. The obtained results must be considered as statistically relevant in all cases (Aroc values > 70%, thus confirming the soundness of the LR analysis which maintains high predictive capacities notwithstanding the features of input data. As for the area under investigation, the best performing methodological choices are the following: (i transects produced the best results (0 P(y ≤ 93.4%; Aroc = 79.5%; (ii as for sampling modalities, binary variables (0 P(y ≤ 98.3%; Aroc = 80.7% provide better performance than ordinated variables; (iii as for the choice of elementary land units, slope units (0 P(y ≤ 100%; Aroc = 84.2% have obtained better results than cells matrix.

Microgravity survey of the Oak Ridge K-25 Site, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Kaufmann, R.D.

1996-05-01

Karst features are known to exist within the carbonate bedrock of the Oak Ridge K-25 Site and may play an important role in groundwater flow and contaminant migration. This report discusses the results of a microgravity survey of the Oak Ridge K-25 Site. The main objective of the survey is to identify areas containing bedrock cavities. Secondary objectives included correlating the observed gravity to the geology and to variations in overburden thickness. The analysis includes 11 profile lines that are oriented perpendicular to the geologic strike and major structures throughout the K-25 Site. The profile lines are modeled in an effort to relate gravity anomalies to karst features such as concentrations of mud-filled cavities. Regolith thickness and density data provided by boreholes constrain the models. Areally distributed points are added to the profile lines to produce a gravity contour map of the site. In addition, data from the K-901 area are combined with data from previous surveys to produce a high resolution map of that site. The K-25 Site is located in an area of folded and faulted sedimentary rocks within the Appalachian Valley and Ridge physiographic province. Paleozoic age rocks of the Rome Formation, Knox Group, and Chickamauga Supergroup underlie the K-25 Site and contain structures that include the Whiteoak Mountain Fault, the K-25 Fault, a syncline, and an anticline. The mapped locations of the rock units and complex structures are currently derived from outcrop and well log analysis

Rod drop in the LR-0 reactor core comprising 55 fuel assemblies

International Nuclear Information System (INIS)

Hadek, J.; Grundmann, U.

1989-09-01

Data from the third stage of kinetic measurements on the LR-0 reactor, performed in 1988, were employed for additional calculations using the 3-dimensional neutron kinetics code HEXDYN3D. The reactor consists of subassemblies similar to those in the WWER-1000 (PWR) reactor. The theoretical and experimental results are compared for the time behavior of the neutron flux caused by drop of the control rod cluster in various subassemblies of the reactor. The results demonstrate that the HEXDYN3D code is well suited to the treatment of the space-time behavior of the neutron flux. (author). 21 figs., 2 tabs., 16 refs

Response of LR-115 type II and CR-39 plastic track detectors to Am-Be and 14.1-MeV neutrons

International Nuclear Information System (INIS)

Bradley, D.A.; Chong, C.S.; Saat, Ahmat; Sidik, A.G.; Ghose, A.M.

1987-01-01

The fast-neutron response of the plastic LR-115 type II and CR-39 track detectors have been compared, using a 14.1-MeV neutron generator and a radionuclide Am-Be neutron source (effective primary neutron energy 4.5-MeV). The distribution of track diameters for a range of etching times has been evaluated, taking into account track registration efficiency and the relevant fast neutron scattering cross-sections. The efficiency of etched-track formation in LR-115 type II due to neutron irradiation is approximately double that in CR-39. The 14.1-MeV neutrons also tend to produce tracks in both materials with somewhat greater efficiency than do the lower energy neutrons from the radionuclide source, for a given etching time. (author)

Removal action report on the Building 3001 canal at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1997-05-01

Oak Ridge National Laboratory (ORNL) is a federal facility managed by Lockheed Martin C, Energy Research, Inc., for the U.S. Department of Energy (DOE). ORNL on the Oak Ridge Reservation in East Tennessee at the Anderson and Roane County lines, approximately 38 km (24 miles) west of Knoxville, Tennessee, and 18 km (11 miles) southwest of downtown Oak Ridge. The Oak Ridge Graphite Reactor and its storage and transfer canal are located in Bldg. 3001 in the approximate center of Waste Area Grouping I in the ORNL main complex. 4:1 The Bldg. 3001 Storage Canal is an L-shaped, underground, reinforced-concrete structure running from the back and below the Graphite Reactor in Bldg. 3001 to a location beneath a hot cell in the adjacent Bldg. 3019. The Graphite Reactor was built in 1943 to produce small quantities of plutonium and was subsequently used to produce other isotopes for medical research before it was finally shut down in 1963. The associated canal was used to transport, under water, spent fuel slugs and other isotopes from the back of the reactor to the adjacent Bldg. 31319 hot cell for further processing. During its operation and years subsequent to operation, the canal's concrete walls and floor became contaminated with radioisotopes from the water.This report documents the activities involved with replacing the canal water with a solid, controlled, low-strength material (CLSM) in response to a Comprehensive Environmental Response, Compensation, and Liability Act non-time-critical removal action

Transitions in axial morphology along the Southeast Indian Ridge

Science.gov (United States)

Ma, Ying; Cochran, James R.

1996-07-01

Shipboard bathymetric and magnetic profiles across the Southeast Indian Ridge (SEIR) were analyzed in order to examine the nature of along-axis variations in axial morphology at this intermediate spreading rate ridge. Three types of axial morphology are observed along the SEIR: an axial high, a shallow (200-700 m deep) axial valley and a deep (>1000 m deep) axial valley. An axial high is found to the east of the Australian-Antarctic Discordance (AAD) (east of 128°E) and between 82°E and 104°E. A shallow rift valley is found from 104°E to 114°E and from 82°E westward past the Amerstdam/St. Paul hotspot (ASP) to about 30°S, 75°E. Deep rift valleys are found from 114°E to 128°E in the vicinity of the AAD and from the Indian Ocean Triple Junction (IOTJ) at 25°S, 70°E to about 30°S, 75°E. The transition near 30°S occurs in an area of constant zero-age depth and does not appear to result from an increase in mantle temperature. It could be the result of the rapid increase in spreading rate along that portion of the SEIR. The most likely cause of the other transitions in axial morphology is variations in mantle temperature. The transitions between the different types of axial morphology are well defined and occur over a limited distance. Transitions in axial morphology are accompanied by significant changes in ridge flank topographic roughness. The transitions from axial valleys to axial highs are also accompanied by changes in the amplitude of the seafloor magnetic anomalies. Our observations suggest that there are distinct modes rather than a continuum of axial morphology on the SEIR and that there appears to be a "threshold" mechanism for a rapid change between different states of axial morphology. The ASP has only a limited influence on the SEIR. The ridge axis is marked by an axial valley for the entire distance from the IOTJ up to and past the ASP. The ridge axis becomes shallower as the ASP is approached from the northwest but only by about 300 m over

Accretion mode of oceanic ridges governed by axial mechanical strength

Science.gov (United States)

Sibrant, A. L. R.; Mittelstaedt, E.; Davaille, A.; Pauchard, L.; Aubertin, A.; Auffray, L.; Pidoux, R.

2018-04-01

Oceanic spreading ridges exhibit structural changes as a function of spreading rate, mantle temperature and the balance of tectonic and magmatic accretion. The role that these or other processes have in governing the overall shape of oceanic ridges is unclear. Here, we use laboratory experiments to simulate ridge spreading in colloidal aqueous dispersions whose rheology evolves from purely viscous to elastic and brittle when placed in contact with a saline water solution. We find that ridge shape becomes increasingly linear with spreading rate until reaching a minimum tortuosity. This behaviour is predicted by the axial failure parameter ΠF, a dimensionless number describing the balance of brittle and plastic failure of axial lithosphere. Slow-spreading, fault-dominated and fast-spreading, fluid intrusion-dominated ridges on Earth and in the laboratory are separated by the same critical ΠF value, suggesting that the axial failure mode governs ridge geometry. Values of ΠF can also be calculated for different mantle temperatures and applied to other planets or the early Earth. For higher mantle temperatures during the Archaean, our results preclude the predicted formation of large tectonic plates at high spreading velocity.

Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips

Directory of Open Access Journals (Sweden)

Alessandro Moro

2017-01-01

Full Text Available The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips.

Science.gov (United States)

Moro, Alessandro; Gasparini, Giulio; Foresta, Enrico; Saponaro, Gianmarco; Falchi, Marco; Cardarelli, Lorenzo; De Angelis, Paolo; Forcione, Mario; Garagiola, Umberto; D'Amato, Giuseppe; Pelo, Sandro

2017-01-01

The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

Alveolar Ridge Carcinoma. Two Cases Report

International Nuclear Information System (INIS)

Pupo Triguero, Raul J; Vivar Bauza, Miriam; Alvarez Infante, Elisa

2008-01-01

Two cases with alveolar ridge carcinoma due to prosthetist traumatism are discussed in this paper, after 9 and 10 years of using dental prosthesis. Both patients began with disturbance in the alveolar ridge. The clinical examination and biopsy showed a well differenced carcinoma. The treatment was radical surgery and radiotherapy in the first patient, and conservative surgery with radiotherapy in the second case .The patients had xerostomia after radiotherapy and the woman had difficulties with mastication. The advantages and disadvantages of the treatment were discussed, focused on the prevention and treatment for oral

ORLANDO - Oak Ridge Large Neutrino Detector

International Nuclear Information System (INIS)

Bugg, W.; Cohn, H.; Efremenko, Yu.; Fazely, A.; Gabriel, T.; Kamyshkov, Yu.; Plasil, F.; Svoboda, R.

1999-01-01

We discuss a proposal for construction of an Oak Ridge LArge Neutrino DetectOr (ORLANDO) to search for neutrino oscillations at the Spallation Neutron Source (SNS). A 4 MW SNS is proposed to be built at the Oak Ridge National Laboratory with the first stage to be operative around 2006. It will have two target stations, which makes it possible with a single detector to perform a neutrino oscillation search at two different distances. Initial plans for the placement of the detector and the discovery potential of such a detector are discussed

Using RNA-sequencing and in silico subtraction to identify resistance gene analog markers for Lr16 in wheat

Science.gov (United States)

Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

International Nuclear Information System (INIS)

Lahodova, Zdena; Viererbl, Ladislav; Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech

2008-01-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

Evaluation of activation detectors for the SPHINX project at the LR-0 experimental reactor

Energy Technology Data Exchange (ETDEWEB)

Lahodova, Zdena; Viererbl, Ladislav [Research Center Rez Ltd (Czech Republic); Novak, Evzen; Svadlenkova, Marie; Rypar, Vojtech [Nuclear Power and Safety Division, Nuclear Research Institute Rez plc (Czech Republic)

2008-07-01

This article summarizes the measurements of neutron fluence distributions carried out at the LR-0 research reactor (Czech Republic) in the frame of the SPHINX project. The influence of fluoride-salts or graphite filling in the SR-0 modules on neutron spectrum was studied using activation detectors. The activation detectors (Mn, Ni, In and Au) were evaluated to determine the changes in neutron field. The In and Au detectors were also irradiated with a cadmium cover. Five different configurations of reactor core (EROS) were realized. (authors)

The Mozambique Ridge: a document of massive multistage magmatism

Science.gov (United States)

Fischer, Maximilian D.; Uenzelmann-Neben, Gabriele; Jacques, Guillaume; Werner, Reinhard

2017-01-01

The Mozambique Ridge, a prominent basement high in the southwestern Indian Ocean, consists of four major geomorphological segments associated with numerous phases of volcanic activity in the Lower Cretaceous. The nature and origin of the Mozambique Ridge have been intensely debated with one hypothesis suggesting a Large Igneous Province origin. High-resolution seismic reflection data reveal a large number of extrusion centres with a random distribution throughout the southern Mozambique Ridge and the nearby Transkei Rise. Intrabasement reflections emerge from the extrusion centres and are interpreted to represent massive lava flow sequences. Such lava flow sequences are characteristic of eruptions leading to the formation of continental and oceanic flood basalt provinces, hence supporting a Large Igneous Province origin of the Mozambique Ridge. We observe evidence for widespread post-sedimentary magmatic activity that we correlate with a southward propagation of the East African Rift System. Based on our volumetric analysis of the southern Mozambique Ridge we infer a rapid sequential emplacement between ˜131 and ˜125 Ma, which is similar to the short formation periods of other Large Igneous Provinces like the Agulhas Plateau.

Beach ridge sedimentology: field observation and palaeoenvironmental interpretation for Anegada Island, British Virgin Islands.

Science.gov (United States)

Cescon, Anna Lisa; Cooper, J. Andrew G.; Jackson, Derek W. T.

2014-05-01

Beach ridge landforms have been observed in different environments and in settings that range from polar to tropical. Their stratigraphy and sedimentology has received a limited amount of discussion in the literature (Tamura, 2012). In coastal geomorphology a beach ridge can be seen as a transitional deposit between onshore and offshore environments. They are regarded as representing high level wave action along a coastline. In the Caribbean the origin of beach ridges has been variously attributed to one of three extreme wave events: extreme swell, extreme storm or tsunami waves. Beach ridges are arranged in beach ridge plains where there is succession of the landforms and can be several kilometres long. Beach ridge accumulation is not continuous and the coast shows alternating accretion and erosion periods. The use of beach ridges as palaeostorm archives is therefore not straightforward. The temporal continuity of beach ridge formation is being assessed on the beach ridge plains of Anegada, British Virgin Islands (Lesser Antilles). This carbonate platform surrounded by a fringing reef contains two beach ridge plains. There are more than 30 ridges in the Atlantic facing- coast and around 10 in the south, Caribbean- facing coast. The sediments of the modern beaches are dominated by the sand fraction and are 100% biogenic origin due to the isolation of Anegada from terrestrial sediment sources. The beach ridge sections have been studied in different area of Anegada beach ridge plains and present low angle seaward-dipping bedding. The sand fraction is dominant in the stratigraphy with a few intact shells. At only one site were coral pebbles deposited in association with the sand fraction. Aeolian deposits represent the upper part of the beach ridges and reflect the stabilization of the beach ridges with ongoing accretion. The sedimentology of the contemporary beach and dunes will be discussed in terms of their implications for understanding beach ridge genesis and its

Ridge Distance Estimation in Fingerprint Images: Algorithm and Performance Evaluation

Directory of Open Access Journals (Sweden)

Tian Jie

2004-01-01

Full Text Available It is important to estimate the ridge distance accurately, an intrinsic texture property of a fingerprint image. Up to now, only several articles have touched directly upon ridge distance estimation. Little has been published providing detailed evaluation of methods for ridge distance estimation, in particular, the traditional spectral analysis method applied in the frequency field. In this paper, a novel method on nonoverlap blocks, called the statistical method, is presented to estimate the ridge distance. Direct estimation ratio (DER and estimation accuracy (EA are defined and used as parameters along with time consumption (TC to evaluate performance of these two methods for ridge distance estimation. Based on comparison of performances of these two methods, a third hybrid method is developed to combine the merits of both methods. Experimental results indicate that DER is 44.7%, 63.8%, and 80.6%; EA is 84%, 93%, and 91%; and TC is , , and seconds, with the spectral analysis method, statistical method, and hybrid method, respectively.

One Piece Orbitozygomatic Approach Based on the Sphenoid Ridge Keyhole

DEFF Research Database (Denmark)

Spiriev, Toma; Poulsgaard, Lars; Fugleholm, Kåre

2016-01-01

The one-piece orbitozygomatic (OZ) approach is traditionally based on the McCarty keyhole. Here, we present the use of the sphenoid ridge keyhole and its possible advantages as a keyhole for the one-piece OZ approach. Using transillumination technique the osteology of the sphenoid ridge...... was examined on 20 anatomical dry skull specimens. The results were applied to one-piece OZ approaches performed on freshly frozen cadaver heads. We defined the center of the sphenoid ridge keyhole as a superficial projection on the lateral skull surface of the most anterior and thickest part of the sphenoid...... ridge. It was located 22 mm (standard deviation [SD], 0.22 mm) from the superior temporal line; 10.7 mm (SD, 0.08 mm) posterior and 7.1 mm (SD, 0.22 mm) inferior to the frontozygomatic suture. The sphenoid ridge burr hole provides exposure of frontal, temporal dura as well as periorbita, which...

Significance testing in ridge regression for genetic data

Directory of Open Access Journals (Sweden)

De Iorio Maria

2011-09-01

Full Text Available Abstract Background Technological developments have increased the feasibility of large scale genetic association studies. Densely typed genetic markers are obtained using SNP arrays, next-generation sequencing technologies and imputation. However, SNPs typed using these methods can be highly correlated due to linkage disequilibrium among them, and standard multiple regression techniques fail with these data sets due to their high dimensionality and correlation structure. There has been increasing interest in using penalised regression in the analysis of high dimensional data. Ridge regression is one such penalised regression technique which does not perform variable selection, instead estimating a regression coefficient for each predictor variable. It is therefore desirable to obtain an estimate of the significance of each ridge regression coefficient. Results We develop and evaluate a test of significance for ridge regression coefficients. Using simulation studies, we demonstrate that the performance of the test is comparable to that of a permutation test, with the advantage of a much-reduced computational cost. We introduce the p-value trace, a plot of the negative logarithm of the p-values of ridge regression coefficients with increasing shrinkage parameter, which enables the visualisation of the change in p-value of the regression coefficients with increasing penalisation. We apply the proposed method to a lung cancer case-control data set from EPIC, the European Prospective Investigation into Cancer and Nutrition. Conclusions The proposed test is a useful alternative to a permutation test for the estimation of the significance of ridge regression coefficients, at a much-reduced computational cost. The p-value trace is an informative graphical tool for evaluating the results of a test of significance of ridge regression coefficients as the shrinkage parameter increases, and the proposed test makes its production computationally feasible.

Efficiency of local surface plasmon polariton excitation on ridges

DEFF Research Database (Denmark)

Radko, Ilya; Bozhevolnyi, Sergey I.; Boltasseva, Alexandra

2008-01-01

We investigate experimentally and numerically the efficiency of surface plasmon polariton excitation by a focused laser beam using gold ridges. The dependence of the efficiency on geometrical parameters of ridges and wavelength dependence are examined. The experimental measurements accomplished...

Storminess-related rhythmic ridge patterns on the coasts of Estonia

Directory of Open Access Journals (Sweden)

Ülo Suursaar

2017-11-01

Full Text Available Buried or elevated coastal ridges may serve as archives of past variations in sea level and climate conditions. Sometimes such ridges or coastal scarps appear in patterns, particularly on uplifting coasts with adequate sediment supply. Along the seacoasts of Estonia, where relative-to-geoid postglacial uplift can vary between 1.7 and 3.4 mm/yr, at least 27 areas with rhythmic geomorphic patterns have been identified from LiDAR images and elevation data. Such patterns were mainly found on faster emerging and well-exposed, tideless coasts. These are mostly located at heights between 1 and 21 m above sea level, the formation of which corresponds to a period of up to 7500 years. Up to approximately 150 individual ridges were counted on some cross-shore sections. Ten of these ridge patterns that formed less than 4500 years ago were chosen for detailed characterization and analysis in search of possible forcing mechanisms. Among these more closely studied cases, the mean ridge spacing varied between 19 and 28 m. Using land uplift rates from the late Holocene period, the timespans of the corresponding cross sections were calculated. The average temporal periodicity of the ridges was between 23 and 39 years with a gross mean value of 31 years. Considering the regular nature of the ridges, they mostly do not reflect single extreme events, but rather a decadal-scale periodicity in storminess in the region of the Baltic Sea. Although a contribution from some kind of self-organization process is possible, the rhythmicity in ancient coastal ridge patterns is likely linked to quasi-periodic 25−40-year variability, which can be traced to Estonian long-term sea level records and wave hindcasts, as well as in regional storminess data and the North Atlantic Oscillation index.

Melton Valley Storage Tanks Capacity Increase Project, Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1995-04-01

The US Department of Energy (DOE) proposes to construct and maintain additional storage capacity at Oak Ridge National Laboratory (ORNL), Oak Ridge, Tennessee, for liquid low-level radioactive waste (LLLW). New capacity would be provided by a facility partitioned into six individual tank vaults containing one 100,000 gallon LLLW storage tank each. The storage tanks would be located within the existing Melton Valley Storage Tank (MVST) facility. This action would require the extension of a potable water line approximately one mile from the High Flux Isotope Reactor (HFIR) area to the proposed site to provide the necessary potable water for the facility including fire protection. Alternatives considered include no-action, cease generation, storage at other ORR storage facilities, source treatment, pretreatment, and storage at other DOE facilities

The Effects of Ridge Axis Width on Mantle Melting at Mid-Ocean Ridges

Science.gov (United States)

Montesi, L.; Magni, V.; Gaina, C.

2017-12-01

Mantle upwelling in response to plate divergence produces melt at mid-ocean ridges. Melt starts when the solidus is crossed and stops when conductive cooling overcomes heat advection associated with the upwelling. Most mid-ocean ridge models assume that divergence takes place only in a narrow zone that defines the ridge axis, resulting in a single upwelling. However, more complex patterns of divergence are occasionally observed. The rift axis can be 20 km wide at ultraslow spreading center. Overlapping spreading center contain two parallel axes. Rifting in backarc basins is sometimes organized as a series of parallel spreading centers. Distributing plate divergence over several rifts reduces the intensity of upwelling and limits melting. Can this have a significant effect on the expected crustal thickness and on the mode of melt delivery at the seafloor? We address this question by modeling mantle flow and melting underneath two spreading centers separated by a rigid block. We adopt a non-linear rheology that includes dislocation creep, diffusion creep and yielding and include hydrothermal cooling by enhancing thermal conductivity where yielding takes place. The crustal thickness decreases if the rifts are separated by 30 km or more but only if the half spreading rate is between 1 and 2 cm/yr. At melting depth, a single upwelling remains the norm until the separation of the rifts exceeds a critical value ranging from 15 km in the fastest ridges to more than 50 km at ultraslow spreading centers. The stability of the central upwelling is due to hydrothermal cooling, which prevents hot mantle from reaching the surface at each spreading center. When hydrothermal cooling is suppressed, or the spreading centers are sufficiently separated, the rigid block becomes extremely cold and separates two distinct, highly asymmetric upwellings that may focus melt beyond the spreading center. In that case, melt delivery might drive further and further the divergence centers, whereas

Oak Ridge Reservation Site Management Plan for the Environmental Restoration Program

Energy Technology Data Exchange (ETDEWEB)

1994-06-01

This site management plan for the Oak Ridge Reservation (ORR) describes the overall approach for addressing environmental contamination problems at the ORR Superfund site located in eastern Tennessee. The ORR consists of three major US Department of Energy (DOE) installations constructed in the early to mid 1940s as research, development, and process facilities in support of the Manhattan Project. In addition to the three installations -- Oak Ridge National Laboratory (ORNL), the Oak Ridge Y-12 Plant, and the Oak Ridge K-25 Site (formerly the Oak Ridge Gaseous Diffusion Plant) -- the ORR Superfund Site also includes areas outside the installations, land used by the Oak Ridge Associated Universities and waterways that have been contaminated by releases from the DOE installations. To date, {approximately} 400 areas (Appendix A) requiring evaluation have been identified. Cleanup of the ORR is expected to take two to three decades and cost several billion dollars. This site management plan provides a blueprint to guide this complex effort to ensure that the investigation and cleanup activities are carried out in an efficient and cost-effective manner.

Oak Ridge Reservation Site Management Plan for the Environmental Restoration Program

International Nuclear Information System (INIS)

1994-06-01

This site management plan for the Oak Ridge Reservation (ORR) describes the overall approach for addressing environmental contamination problems at the ORR Superfund site located in eastern Tennessee. The ORR consists of three major US Department of Energy (DOE) installations constructed in the early to mid 1940s as research, development, and process facilities in support of the Manhattan Project. In addition to the three installations -- Oak Ridge National Laboratory (ORNL), the Oak Ridge Y-12 Plant, and the Oak Ridge K-25 Site (formerly the Oak Ridge Gaseous Diffusion Plant) -- the ORR Superfund Site also includes areas outside the installations, land used by the Oak Ridge Associated Universities and waterways that have been contaminated by releases from the DOE installations. To date, ∼ 400 areas (Appendix A) requiring evaluation have been identified. Cleanup of the ORR is expected to take two to three decades and cost several billion dollars. This site management plan provides a blueprint to guide this complex effort to ensure that the investigation and cleanup activities are carried out in an efficient and cost-effective manner

Intrinsic efficiency of LR-115 in alpha particles detection: simulations and experiments

International Nuclear Information System (INIS)

Aharmim, B.; Sabir, A.; Marah, H.

2002-01-01

A numerical simulation is developed to characterize the response of the cellulose nitrate detector ''LR-115 type II'' to alpha particles of different incidence angles and energies. It permits to know whether an alpha particle at a given energy and direction is able to produce a visible etched track or not. For this purpose, a V t -variable track etch rate model is used. We have considered that the track etch rate is a function of the ionization rate and the defect created by delta rays along the alpha particle trajectory. Validation of the model is presented in the form of comparisons between theoretically computed values of the sensitive energy range and the track diameters and experimentally determined ones

Geophysical investigations over a segment of the Central Indian Ridge, Indian Ocean

Digital Repository Service at National Institute of Oceanography (India)

KameshRaju, K.A.; Ramprasad, T.; Subrahmanyam, C.

Swath bathymetric, gravity, and magnetic studies were carried out over a 55 km long segment of the Central Indian Ridge. The ridge is characterized by 12 to 15 km wide rift valley bounded by steep walls and prominent volcanic constructional ridges...

Nonlinear Forecasting With Many Predictors Using Kernel Ridge Regression

DEFF Research Database (Denmark)

Exterkate, Peter; Groenen, Patrick J.F.; Heij, Christiaan

This paper puts forward kernel ridge regression as an approach for forecasting with many predictors that are related nonlinearly to the target variable. In kernel ridge regression, the observed predictor variables are mapped nonlinearly into a high-dimensional space, where estimation of the predi...

Site characterization of the West Chestnut Ridge site

International Nuclear Information System (INIS)

Ketelle, R.H.; Huff, D.D.

1984-09-01

This report summarizes the results of investigations performed to date on the West Chestnut Ridge Site, on the Department of Energy (DOE) Oak Ridge Reservation. The investigations performed include geomorphic observations, areal geologic mapping, surficial soil mapping, subsurface investigations, soil geochemical and mineralogical analyses, geohydrologic testing, groundwater fluctuation monitoring, and surface water discharge and precipitation monitoring. 33 references, 32 figures, 24 tables

Multimode Interference: Identifying Channels and Ridges in Quantum Probability Distributions

OpenAIRE

O'Connell, Ross C.; Loinaz, Will

2004-01-01

The multimode interference technique is a simple way to study the interference patterns found in many quantum probability distributions. We demonstrate that this analysis not only explains the existence of so-called "quantum carpets," but can explain the spatial distribution of channels and ridges in the carpets. With an understanding of the factors that govern these channels and ridges we have a limited ability to produce a particular pattern of channels and ridges by carefully choosing the ...

Theoretical analysis of ridge gratings for long-range surface plasmon polaritons

DEFF Research Database (Denmark)

Søndergaard, Thomas; Bozhevolnyi, Sergey I.; Boltasseva, Alexandra

2006-01-01

Optical properties of ridge gratings for long-range surface plasmon polaritons (LRSPPs) are analyzed theoretically in a two-dimensional configuration via the Lippmann-Schwinger integral equation method. LRSPPs being supported by a thin planar gold film embedded in dielectric are considered...... to be scattered by an array of equidistant gold ridges on each side of the film designed for in-plane Bragg scattering of LRSPPs at the wavelength ~1550 nm. Out-of-plane scattering (OUPS), LRSPP transmission, reflection, and absorption are investigated with respect to the wavelength, the height of the ridges...... peak it is preferable to use longer gratings with smaller ridges compared to gratings with larger ridges, because the former result in a smaller OUPS from the grating facets than the latter. The theoretical analysis and its conclusions are supported with experimental results on the LRSPP reflection...

Wind tunnel experiments on the effects of tillage ridge features on wind erosion horizontal fluxes

Directory of Open Access Journals (Sweden)

M. Kardous

2005-11-01

Full Text Available In addition to the well-known soil factors which control wind erosion on flat, unridged surfaces, two specific processes affect the susceptibility of tillage ridged surfaces to wind erosion: ridge-induced roughness and ridge- trapping efficiency. In order to parameterize horizontal soil fluxes produced by wind over tillage ridges, eight-ridge configurations composed of sandy soil and exhibiting ridge heights to ridge spacing (RH/RS ratios ranging from 0.18 to 0.38 were experimented in a wind tunnel. These experiments are used to develop a parameterization of the horizontal fluxes over tillage ridged surfaces based only on the geometric characteristics of the ridges. Indeed, the key parameters controlling the horizontal flux, namely the friction velocity, threshold friction velocity and the adjustment coefficient, are derived through specific expressions, from ridge heights (RH and ridge spacing (RS. This parameterization was evaluated by comparing the results of the simulations to an additional experimental data set and to the data set obtained by Hagen and Armbrust (1992. In both cases, predicted and measured values are found to be in a satisfying agreement. This parameterization was used to evaluate the efficiency of ridges in reducing wind erosion. The results show that ridged surfaces, when compared to a loose, unridged soil surface, lead to an important reduction in the horizontal fluxes (exceeding 60%. Moreover, the effect of ridges in trapping particles contributes for more than 90% in the flux reduction while the ridge roughness effect is weak and decreases when the wind velocity increases.

Magnetic Anomalies over the Mid-Atlantic Ridge near 27{degrees}N.

Science.gov (United States)

Phillips, J D

1967-08-25

Ten magnetic profiles across the mid-Atlantic ridge near 27 degrees N show trends that are parallel to the ridge axis and symmetrical about the ridge axis. The configuration of magnetic bodies that could account for the pattern supports the Vine and Matthews hypothesis for the origin of magnetic anomalies over oceanic ridges. A polarity-reversal time scale inferred from models for sea-floor spreading in the Pacific-Antarctic ridge and radiometrically dated reversals of the geomagnetic field indicates a spreading rate of 1.25 centimeters per year during the last 6 million years and a rate of 1.65 centimeters per year between 6 and 10 million years ago. A similar analysis of more limited data over the mid-Atlantic ridge near 22 degrees N also indicates a change in the spreading rate. Here a rate of 1.4 centimeters per year appears to have been in effect during the last 5 million years; between 5 and 9 million years ago, an increased rate of 1.7 centimeters per year is indicated. The time of occurrence and relative magnitude of these changes in the spreading rate, about 5 to 6 million years ago and 18 to 27 percent, respectively, accords with the spreading rate change implied for the Juan de Fuca ridge in the northeast Pacific.

Site characterization plan for groundwater in Waste Area Grouping 1 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Lee, R.R.; Curtis, A.H.; Houlberg, L.M.; Purucker, S.T.; Singer, M.L.; Tardiff, M.F.; Wolf, D.A.

1994-07-01

The Waste Area Grouping (WAG) 1 Groundwater Operable Unit (OU) at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, is undergoing a site characterization to identify environmental contamination that may be present. This document, Site Characterization Report for Groundwater in Waste Area Grouping I at Oak Ridge National Laboratory, Oak Ridge, Tennessee, identifies areas of concern with respect to WAG 1 groundwater and presents the rationale, justification, and objectives for conducting this continuing site characterization. This report summarizes the operations that have taken place at each of the areas of concern in WAG 1, summarizes previous characterization studies that have been performed, presents interpretations of previously collected data and information, identifies contaminants of concern, and presents an action plan for further site investigations and early actions that will lead to identification of contaminant sources, their major groundwater pathways, and reduced off-site migration of contaminated groundwater to surface water. Site characterization Activities performed to date at WAG I have indicated that groundwater contamination, principally radiological contamination, is widespread. An extensive network of underground pipelines and utilities have contributed to the dispersal of contaminants to an unknown extent. The general absence of radiological contamination in surface water at the perimeter of WAG 1 is attributed to the presence of pipelines and underground waste storage tank sumps and dry wells distributed throughout WAG 1 which remove more than about 40 million gal of contaminated groundwater per year.

Site characterization plan for groundwater in Waste Area Grouping 1 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Lee, R.R.; Curtis, A.H.; Houlberg, L.M.; Purucker, S.T.; Singer, M.L.; Tardiff, M.F.; Wolf, D.A.

1994-07-01

The Waste Area Grouping (WAG) 1 Groundwater Operable Unit (OU) at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee, is undergoing a site characterization to identify environmental contamination that may be present. This document, Site Characterization Report for Groundwater in Waste Area Grouping I at Oak Ridge National Laboratory, Oak Ridge, Tennessee, identifies areas of concern with respect to WAG 1 groundwater and presents the rationale, justification, and objectives for conducting this continuing site characterization. This report summarizes the operations that have taken place at each of the areas of concern in WAG 1, summarizes previous characterization studies that have been performed, presents interpretations of previously collected data and information, identifies contaminants of concern, and presents an action plan for further site investigations and early actions that will lead to identification of contaminant sources, their major groundwater pathways, and reduced off-site migration of contaminated groundwater to surface water. Site characterization Activities performed to date at WAG I have indicated that groundwater contamination, principally radiological contamination, is widespread. An extensive network of underground pipelines and utilities have contributed to the dispersal of contaminants to an unknown extent. The general absence of radiological contamination in surface water at the perimeter of WAG 1 is attributed to the presence of pipelines and underground waste storage tank sumps and dry wells distributed throughout WAG 1 which remove more than about 40 million gal of contaminated groundwater per year

Extraction of lead and ridge characteristics from SAR images of sea ice

Science.gov (United States)

Vesecky, John F.; Smith, Martha P.; Samadani, Ramin

1990-01-01

Image-processing techniques for extracting the characteristics of lead and pressure ridge features in SAR images of sea ice are reported. The methods are applied to a SAR image of the Beaufort Sea collected from the Seasat satellite on October 3, 1978. Estimates of lead and ridge statistics are made, e.g., lead and ridge density (number of lead or ridge pixels per unit area of image) and the distribution of lead area and orientation as well as ridge length and orientation. The information derived is useful in both ice science and polar operations for such applications as albedo and heat and momentum transfer estimates, as well as ship routing and offshore engineering.

Explicit Determinants of the RFPrLrR Circulant and RLPrFrL Circulant Matrices Involving Some Famous Numbers

Directory of Open Access Journals (Sweden)

Tingting Xu

2014-01-01

Full Text Available Circulant matrices may play a crucial role in solving various differential equations. In this paper, the techniques used herein are based on the inverse factorization of polynomial. We give the explicit determinants of the RFPrLrR circulant matrices and RLPrFrL circulant matrices involving Fibonacci, Lucas, Pell, and Pell-Lucas number, respectively.

Mapping and characterization of the new adult plant leaf rust resistance gene Lr77 derived from Santa Fe winter wheat.

Science.gov (United States)

Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman

2018-04-25

A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.

Bear Creek Valley Floodplain Hot Spot Removal Action Project Plan, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1998-01-01

The Bear Creek Valley Floodplain Hot Spot Removal Action Project Plan, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee (Y/ER-301) was prepared (1) to safely, cost-effectively, and efficiently evaluate the environmental impact of solid material in the two debris areas in the context of industrial land uses (as defined in the Bear Creek Valley Feasibility Study) to support the Engineering Evaluation/Cost Assessment and (2) to evaluate, define, and implement the actions to mitigate these impacts. This work was performed under Work Breakdown Structure 1.x.01.20.01.08

Submarine sand ridges and sand waves in the eastern part of the China Sea

Science.gov (United States)

Wu, Ziyin; Li, Shoujun; Shang, Jihong; Zhou, Jieqiong; Zhao, Dineng; Liang, Yuyang

2016-04-01

Integrated with multi-beam and single-beam echo sounding data, as well as historical bathymetric data, submarine bathymetric maps of the eastern part of the China Sea, including the Bohai Sea, Huanghai Sea, and East China Sea, are constructed to systematically study submarine sand ridges and sand waves in the eastern part of the China Sea, combined with high-resolution seismic, sub-bottom profile and borehole data. Submarine sand ridges are extraordinarily developed in the eastern part of the China Sea, and 7 sand ridge areas can be divided from north to south, that is, the Laotieshan Channel sand ridge area in the Bohai Sea, the Korea Bay sand ridge area in the southern Huanghai Sea, the sand ridge area in the eastern Huanghai islands and the Huanghai Troughs, the Jianggang sand ridge area in the western Huanghai Sea, the sand ridge area in the East China Sea shelf, and the sand ridge and sand wave area in the Taiwan Strait and Taiwan Banks. The distribution area of the sand ridges and sand waves covers more than 450,000 km2, wherein ~10,000 km2 in the Bohai Bay, ~200,000 km2 in the Huanghai Sea, ~200,000 km2 in the East China Sea shelf, and ~40,000 km2 in the Taiwan Strait and Taiwan Banks, respectively. The great mass of sand ridges are distributed within water depth of 5-160 m, with a total length of over 160 km and a main width of 5-10 km. The inner structure of the sand ridges presents features of high-angle inclined beddings, with main lithology of sands, sand-mud alternations partly visible, and a small number of mud cores. Dating results indicate that the sand ridges in the eastern part of the China Sea are mainly developed in the Holocene. Sea-level variation dominates the sand ridge evolution in the eastern part of the China Sea since the LGM, and the sand ridges developed in the area of < 60m water depth are appeared in bad activity, meanwhile sand ridges with good activity are still developed in large scale.

Wind tunnel experiments on the effects of tillage ridge features on wind erosion horizontal fluxes

Directory of Open Access Journals (Sweden)

M. Kardous

2005-11-01

Full Text Available In addition to the well-known soil factors which control wind erosion on flat, unridged surfaces, two specific processes affect the susceptibility of tillage ridged surfaces to wind erosion: ridge-induced roughness and ridge- trapping efficiency.

In order to parameterize horizontal soil fluxes produced by wind over tillage ridges, eight-ridge configurations composed of sandy soil and exhibiting ridge heights to ridge spacing (RH/RS ratios ranging from 0.18 to 0.38 were experimented in a wind tunnel. These experiments are used to develop a parameterization of the horizontal fluxes over tillage ridged surfaces based only on the geometric characteristics of the ridges. Indeed, the key parameters controlling the horizontal flux, namely the friction velocity, threshold friction velocity and the adjustment coefficient, are derived through specific expressions, from ridge heights (RH and ridge spacing (RS. This parameterization was evaluated by comparing the results of the simulations to an additional experimental data set and to the data set obtained by Hagen and Armbrust (1992. In both cases, predicted and measured values are found to be in a satisfying agreement.

This parameterization was used to evaluate the efficiency of ridges in reducing wind erosion. The results show that ridged surfaces, when compared to a loose, unridged soil surface, lead to an important reduction in the horizontal fluxes (exceeding 60%. Moreover, the effect of ridges in trapping particles contributes for more than 90% in the flux reduction while the ridge roughness effect is weak and decreases when the wind velocity increases.

Geophysical survey work plan for White Wing Scrap Yard (Waste Area Grouping 11) at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-02-01

The White Wing Scrap Yard, located on the U.S. Department of Energy's Oak Ridge Reservation, served as an aboveground storage and disposal area for contaminated debris and scrap from the Oak Ridge K-25 Site, the Oak Ridge Y-12 Plant, and the Oak Ridge National laboratory. The site is believed to have been active from the early 1950s until the mid-1960s. A variety of materials were disposed of at the site, including contaminated steel tanks and vehicles. As an interim corrective action, a surface debris removal effort was initiated in November 1993 to reduce the potential threat to human health and the environment from the radionuclide-contaminated debris. Following this removal effort, a geophysical survey will be conducted across the site to locate and determine the lateral extent of buried nonindigenous materials. This survey will provide the data necessary to prepare a map showing areas of conductivity and magnetic intensity that vary from measured background values. These anomalies represent potential buried materials and therefore can be targeted for further evaluation. This work plan outlines the activities necessary to conduct the geophysical survey

Circulation in the region of the Reykjanes Ridge in June-July 2015

Science.gov (United States)

Tillys, Petit; Herle, Mercier; Virginie, Thierry

2017-04-01

The Reykjanes Ridge is a major topographic feature of the North-Atlantic Ocean lying south of Iceland that strongly influences the pathways of the upper and lower limbs of the meridional overturning cell. The circulation in the vicinity of the Reykjanes Ridge is anticyclonic and characterized by a southwestward flow (the East Reykjanes Ridge Current, ERRC) along the eastern flank and a northeastward flow (the Irminger Current, IC) along the western flank. Even if it is admitted that the ERRC feeds the IC through a cross-ridge flow, details and magnitude of this circulation remain unclear. In this study, the circulation in the region of the Reykjanes Ridge was investigated based on ADCP and CTDO2 measurements carried out from the R/V Thalassa during the RREX cruise, which provided a snapshot of the water mass distribution and circulation during summer 2015. One hydrographic section followed the top of the Reykjanes Ridge between Iceland and 50˚ N and three other sections were carried out perpendicularly to the ridge at 62˚ N, 58.5˚ N and 56˚ N. Geostrophic transports were estimated by combining ADCP and hydrographic data. Those observations were used to provide an estimate of the circulation around the Ridge and to discuss the meridional evolutions of the ERRC and IC transports along the Ridge and their connection to the cross-Ridge flows. The section along the top of the Reykjanes Ridge allowed us to describe the cross ridge exchanges. A westward flow crossed the Ridge between Iceland and 53˚ N. Its top to bottom integrated transport was estimated at 17.7 Sv. Two main passages were identified for the westward crossing. A first passage is located near 57˚ N (Bight Fracture Zone, BFZ) in agreement with previous studies. More surprisingly, a second passage is located near 59˚ N. The top-to-bottom transports of those two main flows were estimated at 6.5 and 8 Sv respectively. The IC and ERRC top-to-bottom integrated transports were maximum at 58.5˚ N and

Some Improved Classification-Based Ridge Parameter Of Hoerl And ...

African Journals Online (AJOL)

Of Hoerl And Kennard Estimation Techniques. 1Adewale F. Lukmanand 1Kayode Ayinde. 1 Department of Statistics, ... ordinary least square (OLS) in handling it. However, it requires a ridge parameter, K, of which many have ... handle the problem of multicollinearity. They suggested the addition of ridge parameter K to the ...

Surface radiological investigation of Trench 5 in Waste Area Grouping 7 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Goff, D.D.

1991-08-01

A surface radiological investigation of areas encompassing Trench 5 on the Oak Ridge Reservation (ORR) was conducted from May 1990 through November 1990. This survey was led by the author, assisted by various members of the Measurement Applications and Development (MAD) group of the Health and Safety Research Division (HASRD) of Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The purpose of the investigation was to determine the presence, nature, and extent of surface radiological contamination at Trench 5, the Homogeneous Reactor Experiment fuel wells, and surrounding areas. Based on the data obtained in the field, interim corrective measures were recommended to limit human exposure to radioactivity and to minimize insult to the environment. It should be stressed that this project was not intended to be a complete site characterization but rather to be a preliminary investigation into the potential contamination problem that might exist as a result of past operations at Trench 5

Morphotectonic and petrological variations along the southern Central Indian Ridge

Digital Repository Service at National Institute of Oceanography (India)

Mukhopadhyay, R.; Iyer, S.D.; Ray, Dwijesh; Karisiddaiah, S.M.; Drolia, R.K.

above the DM and Enriched Mantle (EM2) end member and resemble a linear mixing with Indian Ocean pelagic sediments (Fig. 4a, b). By contrast, the isotope data of IOTJ-MORB occupy a distinct field in the radiogenic Pb-Pb and Sr-Pb binary plots... EM, Karsten JL, 1995 Ocean-ridge basalts with convergent-margin geochemical affinities from the Chile Ridge. Nature 374:52-57 Klein EM, Langmuir CH, 1987 Global correlations of ocean ridge basalt chemistry with axial depth and crustal chemistry...

Track counting and thickness measurement of LR115 radon detectors using a commercial image scanner

International Nuclear Information System (INIS)

De Cicco, F.; Pugliese, M.; Roca, V.; Sabbarese, C.

2014-01-01

An original optical method for track counting and film thickness determination of etched LR115 radon detectors was developed. The method offers several advantages compared with standard techniques. In particular, it is non-destructive, very simple and rather inexpensive, since it uses a commercial scanner and a free software. The complete analysis and the calibration procedure carried out for the determination of radon specific activity are reported. A comparison with the results of spark counting defines the accuracy and the precision of the new technique. (authors)

Testing models for the formation of the equatorial ridge on Iapetus via crater counting

Science.gov (United States)

Damptz, Amanda L.; Dombard, Andrew J.; Kirchoff, Michelle R.

2018-03-01

Iapetus's equatorial ridge, visible in global views of the moon, is unique in the Solar System. The formation of this feature is likely attributed to a key event in the evolution of Iapetus, and various models have been proposed as the source of the ridge. By surveying imagery from the Cassini and Voyager missions, this study aims to compile a database of the impact crater population on and around Iapetus's equatorial ridge, assess the relative age of the ridge from differences in cratering between on ridge and off ridge, and test the various models of ridge formation. This work presents a database that contains 7748 craters ranging from 0.83 km to 591 km in diameter. The database includes the study area in which the crater is located, the latitude and longitude of the crater, the major and minor axis lengths, and the azimuthal angle of orientation of the major axis. Analysis of crater orientation over the entire study area reveals that there is no preference for long-axis orientation, particularly in the area with the highest resolution. Comparison of the crater size-frequency distributions show that the crater distribution on the ridge appears to be depleted in craters larger than 16 km with an abruptly enhanced crater population less than 16 km in diameter up to saturation. One possible interpretation is that the ridge is a relatively younger surface with an enhanced small impactor population. Finally, the compiled results are used to examine each ridge formation hypothesis. Based on these results, a model of ridge formation via a tidally disrupted sub-satellite appears most consistent with our interpretation of a younger ridge with an enhanced small impactor population.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr; Shihada, Basem

2015-01-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Blind void filling in LR-EPONs: How efficient it can be?

KAUST Repository

Elrasad, Amr

2015-07-01

This work proposes a novel blind void (idle periods) filling in Long-Reach Ethernet Passive Optical Networks (LR-EPONs) namely Size Controlled Batch Void Filling (SCBVF). We emphasize on reducing grant delays and hence reducing the average packet delay. SCBVF delay reduction is achieved by early flushing data during the idle time periods (voids) between allocated grants. The proposed approach can be integrated with almost all of the previously reported dynamic bandwidth allocation schemes. SCBVF is less sensitive to differential distance between ONUs and can work well in case of small differential distances compared to previously reported void filling schemes. We support our work by extensive simulation study considering bursty traffic with long range dependency. Numerical results show a delay reduction up to 35% compared to non-void filling scheme outperforming its main competitors that can achieve up to 7% delay reduction.

Seismic imaging of the Formosa Ridge cold seep site offshore of southwestern Taiwan

Science.gov (United States)

Hsu, Ho-Han; Liu, Char-Shine; Morita, Sumito; Tu, Shu-Lin; Lin, Saulwood; Machiyama, Hideaki; Azuma, Wataru; Ku, Chia-Yen; Chen, Song-Chuen

2017-12-01

Multi-scale reflection seismic data, from deep-penetration to high-resolution, have been analyzed and integrated with near-surface geophysical and geochemical data to investigate the structures and gas hydrate system of the Formosa Ridge offshore of southwestern Taiwan. In 2007, dense and large chemosynthetic communities were discovered on top of the Formosa Ridge at water depth of 1125 m by the ROV Hyper-Dolphin. A continuous and strong BSR has been observed on seismic profiles from 300 to 500 ms two-way-travel-time below the seafloor of this ridge. Sedimentary strata of the Formosa Ridge are generally flat lying which suggests that this ridge was formed by submarine erosion processes of down-slope canyon development. In addition, some sediment waves and mass wasting features are present on the ridge. Beneath the cold seep site, a vertical blanking zone, or seismic chimney, is clearly observed on seismic profiles, and it is interpreted to be a fluid conduit. A thick low velocity zone beneath BSR suggests the presence of a gas reservoir there. This "gas reservoir" is shallower than the surrounding canyon floors along the ridge; therefore as warm methane-rich fluids inside the ridge migrate upward, sulfate carried by cold sea water can flow into the fluid system from both flanks of the ridge. This process may drive a fluid circulation system and the active cold seep site which emits both hydrogen sulfide and methane to feed the chemosynthetic communities.

Global Models of Ridge-Push Force, Geoid, and Lithospheric Strength of Oceanic plates

Science.gov (United States)

Mahatsente, Rezene

2017-12-01

An understanding of the transmission of ridge-push related stresses in the interior of oceanic plates is important because ridge-push force is one of the principal forces driving plate motion. Here, I assess the transmission of ridge-push related stresses in oceanic plates by comparing the magnitude of the ridge-push force to the integrated strength of oceanic plates. The strength is determined based on plate cooling and rheological models. The strength analysis includes low-temperature plasticity (LTP) in the upper mantle and assumes a range of possible tectonic conditions and rheology in the plates. The ridge-push force has been derived from the thermal state of oceanic lithosphere, seafloor depth and crustal age data. The results of modeling show that the transmission of ridge-push related stresses in oceanic plates mainly depends on rheology and predominant tectonic conditions. If a lithosphere has dry rheology, the estimated strength is higher than the ridge-push force at all ages for compressional tectonics and at old ages (>75 Ma) for extension. Therefore, under such conditions, oceanic plates may not respond to ridge-push force by intraplate deformation. Instead, the plates may transmit the ridge-push related stress in their interior. For a wet rheology, however, the strength of young lithosphere (stress may dissipate in the interior of oceanic plates and diffuses by intraplate deformation. The state of stress within a plate depends on the balance of far-field and intraplate forces.

THE STATISTICAL MODEL OF PRESSURE RIDGE MORPHOMETRY ON THE NORTHEAST SHELF OF SAKHALIN ISLAND

Directory of Open Access Journals (Sweden)

E. U. Mironov

2012-01-01

Full Text Available The work presents characteristics on geometry and inner structure of ice ridges investigated at offshore the northeast coast of SakhalinIsland. A formula was obtained which allows one to calculate the ice ridge keel depth by the height of its sail. Plots of the probability distribution density for ice ridge characteristics are given. A model of morphometry of a mean statistical ice ridge was constructed, and its mass is determined. Factors influencing the hydrostatic ice ridge equilibrium are considered.

Active spreading processes at ultraslow mid-ocean ridges: The 1999-2001 seismo-volcanic episode at 85°E Gakkel ridge, Arctic Ocean

Science.gov (United States)

Schlindwein, Vera; Riedel, Carsten; Korger, Edith; Läderach, Christine

2010-05-01

The rate of magma and crustal production at mid-ocean ridges is thought to decrease with decreasing spreading rate. At ultraslow spreading rates below 10-20 mm/y full rate, heat loss by conduction greatly reduces melt production with less melt produced at increasingly greater depths. Gakkel Ridge, the actively spreading mid-ocean ridge in the Arctic Ocean, opens at rates of 14 mm/y in the west decreasing to less than 6 mm/y at its eastern termination and demonstrates that magma production is not only a function of spreading rate. Whereas amagmatic spreading takes place at rates of about 12-10 mm/y, focussed melt production occurs at even lower spreading rates in long-lived discrete volcanic centres. One such centre is the 85°E volcanic complex at eastern Gakkel ridge where in 1999 a teleseismically recorded earthquake swarm consisting of more than 250 earthquakes over 9 months signalled the onset of an active spreading episode. The earthquake swarm is believed to be associated with volcanic activity although no concurrent lava effusion was found. We analysed the teleseismic earthquake swarm together with visual observation and microseismic data recorded at this site in 2001 and 2007 and noted the following characteristics which may be indicative for volcanic spreading events at the still poorly explored ultraslow spreading ridges: - unusual duration: The 1999 earthquake swarm lasted over 9 months rather than a few weeks as observed on faster spreading ridges. In addition, in 2001 seismoacoustic sounds which we interpret as gas discharge in Strombolian eruptions and a giant event plume maintained over more than one year indicate waxing and waning volcanic activity since 1999. - unusual strength: The earthquake swarm was detected at teleseismic distances of more than 1000 km and included 11 events with a magnitude >5. No other confirmed mid-ocean ridge eruption released a comparable seismic moment. Rather than focussing in a narrow area or showing pronounced

Hot subduction: Magmatism along the Hunter Ridge, SW Pacific

International Nuclear Information System (INIS)

Crawford, A.J.; Verbeeten, A.; Danyushevsky, L.V.; Sigurdsson, I.A.; Maillet, P.; Monzier, M.

1997-01-01

The Hunter 'fracture zone' is generally regarded as a transform plate boundary linking the oppositely dipping Tongan and Vanuatu subduction systems. Dredging along the Hunter Ridge and sampling of its northernmost extent, exposed as the island of Kadavu in Fiji, has yielded a diversity of magmatic suites, including arc tholeiites and high-Ca boninites, high-Mg lavas with some affinities to boninites and some affinities to adakites, and true adakitic lavas associated with remarkable low-Fe, high-Na basalts with 8-16 ppm Nb (herein high-Nb basalts). Lavas which show clear evidence of slab melt involvement in their petrogenesis occur at either end of the Hunter Ridge, whereas the arc tholeiites and high-Ca boninites appear to be restricted to the south central part of the ridge. Mineralogical and whole rock geochemical data for each of these suites are summarized, and a tectono-magmatic model for their genesis and distribution is suggested. Trace element features and radiogenic isotope data for the Hunter Ridge lavas indicate compositions analogue to Pacific MORB-like mantle

Crustal structure and tectonics of the Ninetyeast Ridge from seismic and gravity studies

Digital Repository Service at National Institute of Oceanography (India)

Krishna, K.S.; Neprochnov, Y.P.; Rao, D.G.; Grinko, B.N.

Seismic reflection and refraction, gravity, and bathymetric data across and along the central part of the Ninetyeast Ridge were analyzed to determine the crustal structure of the ridge and to understand its tectonics. The ridge in the study area...

Microcystin-LR removal from aqueous solutions using a magnetically separable N-doped TiO2 nanocomposite under visible light irradiation

Science.gov (United States)

The performance of magnetically separable N-doped TiO2 was found to be significantly improved when compared with a non-magnetic N-doped TiO2 for the aqueous removal of cyanotoxin Microcystin-LR. The observed enhanced photocatalytic activity may be related to the presence of ferri...

Holifield Heavy-Ion Research Facility at Oak Ridge

International Nuclear Information System (INIS)

Jones, C.M.

1977-01-01

A new heavy-ion accelerator facility is now under construction at the Oak Ridge National Laboratory. A brief description of the scope and schedule of this project is given, and the new large tandem accelerator, which will be a major element of the facility is discussed in some detail. Several studies which have been made or are in progress in Oak Ridge in preparation for operation of the tandem accelerator are briefly described

Mid Ocean Ridge Processes at Very Low Melt Supply : Submersible Exploration of Smooth Ultramafic Seafloor at the Southwest Indian Ridge, 64 degree E

Science.gov (United States)

Cannat, M.; Agrinier, P.; Bickert, M.; Brunelli, D.; Hamelin, C.; Lecoeuvre, A.; Lie Onstad, S.; Maia, M.; Prampolini, M.; Rouméjon, S.; Vitale Brovarone, A.; Besançon, S.; Assaoui, E. M.

2017-12-01

Mid-ocean ridges are the Earth's most extensive and active volcanic chains. They are also, particularly at slow spreading rates, rift zones, where plate divergence is in part accommodated by faults. Large offset normal faults, also called detachments, are characteristic of slow-spreading ridges, where they account for the widespread emplacement of mantle-derived rocks at the seafloor. In most cases, these detachments occur together with ridge magmatism, with melt injection and faulting interacting to shape the newly formed oceanic lithosphere. Here, we seek to better understand these interactions and their effects on oceanic accretion by studying the end-member case of a ridge where magmatism is locally almost absent. The portion of the Southwest Indian ridge we are studying has an overal low melt supply, focused to discrete axial volcanoes, leaving almost zero melt to intervening sections of the axial valley. One of these nearly amagmatic section of the ridge, located at 64°E, has been the focus of several past cruises (sampling, mapping and seismic experiments). Here we report on the most recent cruise to the area (RV Pourquoi Pas? with ROV Victor; dec-jan 2017), during which we performed high resolution mapping, submersible exploration and sampling of the ultramafic seafloor and of sparse volcanic formations. Our findings are consistent with the flip-flop detachment hypothesis proposed for this area by Sauter et al. (Nature Geosciences, 2013; ultramafic seafloor forming in the footwall of successive detachment faults, each cutting into the footwall of the previous fault, with an opposite polarity). Our observations also document the extent and geometry of deformation in the footwall of a young axial detachment, the role of mass-wasting for the evolution of this detachment, and provide spectacular evidence for serpentinization-related hydrothermal circulation and for spatial links between faults and volcanic eruptions.

An aerial radiological survey of the White Oak Creek Floodplain, Oak Ridge Reservation, Oak Ridge, Tennessee: Date of survey: September-October 1986

International Nuclear Information System (INIS)

Fritzsche, A.E.

1987-06-01

An aerial radiological survey was conducted over the White Oak Creek Floodplain of the Oak Ridge Reservation during the period 30 September through 3 October 1986. The survey was performed at the request of the United States Department of Energy (DOE), Oak Ridge Operations Office, by EG and G Energy Measurements, Inc. (EG and G/EM), a contractor of the DOE. The survey results will be utilized in support of the Remedial Action Program being conducted at the site by Martin Marietta Energy Systems, Inc., operator of the Oak Ridge National Laboratory (ORNL). A flight line spacing of 37 meters (120 feet) and a survey altitude of 46 meters (150 feet) yielded the maximum data density and sensitivity achievable by the aerial system, which was greater than that achieved from prior surveys of the entire Oak Ridge Reservation. Isopleth maps of Cs-137, Co-60, Ti-208 implied concentrations, and exposure rates provided an estimate of the location and magnitude of the man-made activity. These maps, overlaid on a current photograph of the area, combine to yield a view of the radiological condition of the White Oak Creek Floodplain. 5 refs., 40 figs., 3 tabs

The Northern Central Indian Ridge: Geology and tectonics of fracture zones-dominated spreading ridge segments

Digital Repository Service at National Institute of Oceanography (India)

Drolia, R.K.; Iyer, S.D.; Chakraborty, B.; Kodagali, V.N.; Ray, Dwijesh; Misra, S.; Andrade, R.; Sarma, K.V.L.N.S.; Rajasekhar, R.P.; Mukhopadhyay, R.

Multi-beam and single-beam bathymetric, gravity and magnetic data, across seven ridge segments (length varying between 37 and 84 km), offset by six transform discontinuities (ranging in dislocation length between 48 and 344 km) of the Northern...

Results of 1995 characterization of Gunite and Associated Tanks at Oak Ridge National Laboratory, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-02-01

This technical memorandum (TM) documents the 1995 characterization of eight underground radioactive waste tanks at Oak Ridge National Laboratory (ORNL). These tanks belong to the Gunite and Associated Tanks (GAAT) operable unit, and the characterization is part of the ongoing GAAT remedial investigation/feasibility study (RI/FS) process. This TM reports both field observations and analytical results; analytical results are also available from the Oak Ridge Environmental Information System (OREIS) data base under the project name GAAT (PROJ-NAME = GAAT). This characterization effort (Phase II) was a follow-up to the {open_quotes}Phase I{close_quotes} sampling campaign reported in Results of Fall 1994 Sampling of Gunite and Associated Tanks at the Oak Ridge National Laboratory, Oak Ridge, Tennessee, ORNL/ER/Sub/87-99053/74, June 1995. The information contained here should be used in conjunction with that in the previous TM. The sampling plan is documented in ORNL Inactive Waste Tanks Sampling and Analysis Plan, ORNL/RAP/LTR-88/24, dated April 1988, as amended by Addendum 1, Revision 2: ORNL Inactive Tanks Sampling and Analysis Plan, DOE/OR/02-1354&D2, dated February 1995. Field team instructions are found in ORNL RI/FS Project Field Work Guides 01-WG-20, Field Work Guide for Sampling of Gunite and Associated Tanks, and 01-WG-21, Field Work Guide for Tank Characterization System Operations at ORNL. The field effort was conducted under the programmatic and procedural umbrella of the ORNL RI/FS Program, and the analysis was in accordance with ORNL Chemical and Analytical Sciences Division (CASD) procedures. The characterization campaign is intended to provide data for criticality safety, engineering design, and waste management as they apply to the GAAT treatability study and remediation. The Department of Energy (DOE) Carlsbad office was interested in results of this sampling campaign and provided funding for certain additional sample collection and analysis.

Site descriptions of environmental restoration units at the Oak Ridge K-25 Site, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Goddard, P.L.; Legeay, A.J.; Pesce, D.S.; Stanley, A.M.

1995-11-01

This report, Site Descriptions of Environmental Restoration Units at the Oak Ridge K-25 Site, Oak Ridge, Tennessee, is being prepared to assimilate information on sites included in the Environmental Restoration (ER) Program of the K-25 Site, one of three major installations on the Oak Ridge Reservation (ORR) built during World War III as part of the Manhattan Project. The information included in this report will be used to establish program priorities so that resources allotted to the K-25 ER Program can be best used to decrease any risk to humans or the environment, and to determine the sequence in which any remedial activities should be conducted. This document will be updated periodically in both paper and Internet versions. Units within this report are described in individual data sheets arranged alphanumerically. Each data sheet includes entries on project status, unit location, dimensions and capacity, dates operated, present function, lifecycle operation, waste characteristics, site status, media of concern, comments, and references. Each data sheet is accompanied by a photograph of the unit, and each unit is located on one of 13 area maps. These areas, along with the sub-area, unit, and sub-unit breakdowns within them, are outlined in Appendix A. Appendix B is a summary of information on remote aerial sensing and its applicability to the ER program

Site descriptions of environmental restoration units at the Oak Ridge K-25 Site, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Goddard, P.L.; Legeay, A.J.; Pesce, D.S.; Stanley, A.M.

1995-11-01

This report, Site Descriptions of Environmental Restoration Units at the Oak Ridge K-25 Site, Oak Ridge, Tennessee, is being prepared to assimilate information on sites included in the Environmental Restoration (ER) Program of the K-25 Site, one of three major installations on the Oak Ridge Reservation (ORR) built during World War III as part of the Manhattan Project. The information included in this report will be used to establish program priorities so that resources allotted to the K-25 ER Program can be best used to decrease any risk to humans or the environment, and to determine the sequence in which any remedial activities should be conducted. This document will be updated periodically in both paper and Internet versions. Units within this report are described in individual data sheets arranged alphanumerically. Each data sheet includes entries on project status, unit location, dimensions and capacity, dates operated, present function, lifecycle operation, waste characteristics, site status, media of concern, comments, and references. Each data sheet is accompanied by a photograph of the unit, and each unit is located on one of 13 area maps. These areas, along with the sub-area, unit, and sub-unit breakdowns within them, are outlined in Appendix A. Appendix B is a summary of information on remote aerial sensing and its applicability to the ER program.

Source document for waste area groupings at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Osborne, P.L.; Kuhaida, A.J., Jr.

1996-09-01

This document serves as a source document for Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) and other types of documents developed for and pertaining to Environmental Restoration (ER) Program activities at Oak Ridge National Laboratory (ORNL). It contains descriptions of the (1) regulatory requirements for the ORR ER Program, (2) Oak Ridge Reservation (ORR) ER Program, (3) ORNL site history and characterization, and (4) history and characterization of Waste Area Groupings (WAGS) 1-20. This document was created to save time, effort, and money for persons and organizations drafting documents for the ER Program and to improve consistency in the documents prepared for the program. By eliminating the repetitious use of selected information about the program, this document will help reduce the time and costs associated with producing program documents. By serving as a benchmark for selected information about the ER Program, this reference will help ensure that information presented in future documents is accurate and complete

Oak Ridge Health Studies phase 1 report, Volume 1: Oak Ridge Phase 1 overview

International Nuclear Information System (INIS)

Yarbrough, M.I.; Van Cleave, M.L.; Turri, P.; Daniel, J.

1993-09-01

In July 1991, the State of Tennessee initiated the Health Studies Agreement with the United States Department of Energy to carry out independent studies of possible adverse health effects in people living in the vicinity of the Oak Ridge Reservation. The health studies focus on those effects that could have resulted or could result from exposures to chemicals and radioactivity released at the Reservation since 1942. The major focus of the first phase was to complete a Dose Reconstruction Feasibility Study. This study was designed to find out if enough data exist about chemical and radionuclide releases from the Oak Ridge Reservation to conduct a second phase. The second phase will lead to estimates of the actual amounts or the ''doses'' of various contaminants received by people as a result of off-site releases. Once the doses of various contaminants have been estimated, scientists and physicians will be better able to evaluate whether adverse health effects could have resulted from the releases

Oak Ridge Health Studies phase 1 report, Volume 1: Oak Ridge Phase 1 overview

Energy Technology Data Exchange (ETDEWEB)

Yarbrough, M.I.; Van Cleave, M.L.; Turri, P.; Daniel, J.

1993-09-01

In July 1991, the State of Tennessee initiated the Health Studies Agreement with the United States Department of Energy to carry out independent studies of possible adverse health effects in people living in the vicinity of the Oak Ridge Reservation. The health studies focus on those effects that could have resulted or could result from exposures to chemicals and radioactivity released at the Reservation since 1942. The major focus of the first phase was to complete a Dose Reconstruction Feasibility Study. This study was designed to find out if enough data exist about chemical and radionuclide releases from the Oak Ridge Reservation to conduct a second phase. The second phase will lead to estimates of the actual amounts or the ``doses`` of various contaminants received by people as a result of off-site releases. Once the doses of various contaminants have been estimated, scientists and physicians will be better able to evaluate whether adverse health effects could have resulted from the releases.

Oak Ridge Reservation Physical Characteristics and Natural Resources

Energy Technology Data Exchange (ETDEWEB)

Parr, P.D.; Hughes, J.F.

2006-09-19

The topography, geology, hydrology, vegetation, and wildlife of the Oak Ridge Reservation (ORR) provide a complex and intricate array of resources that directly impact land stewardship and use decisions (Fig. 1). The purpose of this document is to consolidate general information regarding the natural resources and physical characteristics of the ORR. The ORR, encompassing 33,114 acres (13,401 ha) of federally owned land and three Department of Energy (DOE) installations, is located in Roane and Anderson Counties in east Tennessee, mostly within the corporate limits of the city of Oak Ridge and southwest of the population center of Oak Ridge. The ORR is bordered on the north and east by the population center of the city of Oak Ridge and on the south and west by the Clinch River/Melton Hill Lake impoundment. All areas of the ORR are relatively pristine when compared with the surrounding region, especially in the Valley and Ridge Physiographic Province (Fig. 2). From the air, the ORR is clearly a large and nearly continuous island of forest within a landscape that is fragmented by urban development and agriculture. Satellite imagery from 2006 was used to develop a land-use/land-cover cover map of the ORR and surrounding lands (Fig. 3). Following the acquisition of the land comprising the ORR in the early 1940s, much of the Reservation served as a buffer for the three primary facilities: the X-10 nuclear research facility (now known as the Oak Ridge National Laboratory [ORNL]), the first uranium enrichment facility or Y-12 (now known as the Y-12 National Security Complex [Y-12 Complex]), and a gaseous diffusion enrichment facility (now known as the East Tennessee Technology Park [ETTP]). Over the past 60 years, this relatively undisturbed area has evolved into a rich and diverse eastern deciduous forest ecosystem of streams and reservoirs, hardwood forests, and extensive upland mixed forests. The combination of a large land area with complex physical characteristics

Oak Ridge Y-12 Plant groundwater protection program management plan

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-06-01

The Oak Ridge Y- 1 2 Plant (Y-12 Plant) is owned by the United States Department of Energy (DOE) and managed by Lockheed Martin Energy Systems, Inc. (Energy Systems) under contract No. DE-AC05-84OR21400. The Y-12 Plant Groundwater Protection Program (GWPP), which was initiated in 1975, provides for the protection of groundwater resources consistent with Federal, State, and local regulations, and in accordance with DOE orders and Energy Systems policies and procedures. The Y-12 Plant is located in Anderson County, Tennessee, and is within the corporate limits of the City of Oak Ridge. The Y-12 Plant is one of three major DOE complexes that comprise the 37,000-acre Oak Ridge Reservation (ORR) located in Anderson and Roane counties. The Y-12 Plant is located in Bear Creek Valley at an elevation of about 950 feet (ft) above sea level. Bear Creek Valley is bounded on the northwest and southeast, and is isolated from populated areas of Oak Ridge, by parallel ridges that rise about 300 ft above the valley floor. The Y-12 Plant and its fenced buffer area are about 0.6 mile wide by 3.2 miles long and cover approximately 4,900 acres. The main industrialized section encompasses approximately 800 acres.

Oak Ridge Y-12 Plant groundwater protection program management plan

International Nuclear Information System (INIS)

1996-06-01

The Oak Ridge Y- 1 2 Plant (Y-12 Plant) is owned by the United States Department of Energy (DOE) and managed by Lockheed Martin Energy Systems, Inc. (Energy Systems) under contract No. DE-AC05-84OR21400. The Y-12 Plant Groundwater Protection Program (GWPP), which was initiated in 1975, provides for the protection of groundwater resources consistent with Federal, State, and local regulations, and in accordance with DOE orders and Energy Systems policies and procedures. The Y-12 Plant is located in Anderson County, Tennessee, and is within the corporate limits of the City of Oak Ridge. The Y-12 Plant is one of three major DOE complexes that comprise the 37,000-acre Oak Ridge Reservation (ORR) located in Anderson and Roane counties. The Y-12 Plant is located in Bear Creek Valley at an elevation of about 950 feet (ft) above sea level. Bear Creek Valley is bounded on the northwest and southeast, and is isolated from populated areas of Oak Ridge, by parallel ridges that rise about 300 ft above the valley floor. The Y-12 Plant and its fenced buffer area are about 0.6 mile wide by 3.2 miles long and cover approximately 4,900 acres. The main industrialized section encompasses approximately 800 acres

Oak Ridge Reservation Annual Site environmental report summary for 1994

International Nuclear Information System (INIS)

1995-09-01

This document presents a summary of the information collected for the Oak Ridge Reservation 1994 site environmental report. Topics discussed include: Oak Ridge Reservation mission; ecology; environmental laws; community participation; environmental restoration; waste management; radiation effects; chemical effects; risk to public; environmental monitoring; and radionuclide migration

Oak Ridge National Laboratory site data for safety-analysis report

International Nuclear Information System (INIS)

Fitzpatrick, F.C.

1982-12-01

The Oak Ridge National Laboratory site data contained herein were compiled in support of the United States Department of Energy (USDOE) Oak Ridge Operations Office Order OR 5481.1. That order sets forth assignment of responsibilities for safety analysis and review responsibilities and provides guidance relative to the content and format of safety analysis reports. The information presented in this document is intended for use by reference in individual safety analysis reports where applicable to support accident analyses or the establishment of design bases of significance to safety, and it is applicable only to Oak Ridge National Laboratory facilities in Bethel and Melton Valleys. This information includes broad descriptions of the site characteristics, radioactive waste handling and monitoring practices, and the organization and operating policies at Oak Ridge National Laboratory. The historical background of the Laboratory is discussed briefly and the overall physical situation of the facilities is described in the following paragraphs

Oak Ridge National Laboratory site data for safety-analysis report

Energy Technology Data Exchange (ETDEWEB)

Fitzpatrick, F.C.

1982-12-01

The Oak Ridge National Laboratory site data contained herein were compiled in support of the United States Department of Energy (USDOE) Oak Ridge Operations Office Order OR 5481.1. That order sets forth assignment of responsibilities for safety analysis and review responsibilities and provides guidance relative to the content and format of safety analysis reports. The information presented in this document is intended for use by reference in individual safety analysis reports where applicable to support accident analyses or the establishment of design bases of significance to safety, and it is applicable only to Oak Ridge National Laboratory facilities in Bethel and Melton Valleys. This information includes broad descriptions of the site characteristics, radioactive waste handling and monitoring practices, and the organization and operating policies at Oak Ridge National Laboratory. The historical background of the Laboratory is discussed briefly and the overall physical situation of the facilities is described in the following paragraphs.

Calendar Year 1997 Annual Groundwater Monitoring Report For The Chestnut Ridge Hydrogeologic Regime At The U.S. Department of Energy Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Jones, S.B.

1998-02-01

This report contains the groundwater monitoring data obtained during calendar year (CY) 1997 in compliance with the Resource Conservation and Recovery Act (RCRA) post-closure permit (PCP) for the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime). In July 1997, the Tennessee Department of Environment and Conservation (TDEC) approved modifications to several of the permit conditions that address RCRA pow-closure corrective action groundwater monitoring at the Chestnut Ridge Security Pits (Security Pits), and RCIU4 post-closure detection groundwater monitoring at the Chestnut Ridge Sediment Disposal Basin (Sediment Disposal Basin) and Kerr Hollow Quarry. This report has been prepared in accordance with these modified permit requirements. Also included in this report are the groundwater and surface water monitoring data obtained during CY 1997 for the purposes ofi (1) detection monitoring at nonhazardous solid waste disposal facilities (SWDFS) in accordance with operating permits and applicable regulations, (2) monitoring in accordance with Comprehensive Environmental Response, Compensation, and Recove~ Act Records of Decision (now pefiormed under the Integrated Water Quality Program for the Oak Ridge Reservation), and (3) monitoring needed to comply with U.S. Department of Energy Order 5400.1.

Characterization of plastic nuclear track detectors on solid state, CR-39 and LR-115 and its possibilities application on thermal and fast neutron dosimetry

International Nuclear Information System (INIS)

Vallejo Delgado, L.R.

1989-01-01

This work is an study about the use feasibility of plastic nuclear track detectors, LR 115, II-B (of Eastmann Kodak Co) and CR-39 (of American Acrylics and Plastics), for thermal and fast neutron dosimetry, respectively. The LR-115 with converter (n, alpha) was exposed to thermal neutrons with energy of 0,046 e V, proceeding from nuclear reactor RECH-1 of Nuclear Energy Chilean Commission. The irradiated films were submited to a chemical etching with NaOH, plus a washing and brushing. The CR-39 with polyethylene irradiator, was exposed to fast neutrons proceeding of calibrated sources of Am-Se. The irradiated plates were submited to a chemical pre-etching with KOH and a electrochemical post-etching. (author)

Sandy berm and beach-ridge formation in relation to extreme sea-levels

DEFF Research Database (Denmark)

Bendixen, Mette; Clemmensen, Lars B; Kroon, Aart

2013-01-01

The formation of berms and their transformation into beach ridges in a micro-tidal environment is coupled to wave run-up and overtopping during extreme sea levels. A straight-forward comparison between extreme sea levels due to storm-surges and active berm levels is impossible in the semi...... prograding spit on the south-eastern Baltic shores of Zealand, Denmark. The modern, sandy beach at this location consists of a beachface with a shallow incipient berm, a mature berm, and a dune-covered beach ridge. It borders a beach-ridge plain to the west, where more than 20 N–S oriented beach ridges...... and swales are present. Measured water-level data from 1991 to 2012 and topographical observations, carried out during fair weather period and during a storm event, provided the basis for a conceptual model exhibiting berm formation and transformation into the local beach-ridge system. The character...

An enhanced structure tensor method for sea ice ridge detection from GF-3 SAR imagery

Science.gov (United States)

Zhu, T.; Li, F.; Zhang, Y.; Zhang, S.; Spreen, G.; Dierking, W.; Heygster, G.

2017-12-01

In SAR imagery, ridges or leads are shown as the curvilinear features. The proposed ridge detection method is facilitated by their curvilinear shapes. The bright curvilinear features are recognized as the ridges while the dark curvilinear features are classified as the leads. In dual-polarization HH or HV channel of C-band SAR imagery, the bright curvilinear feature may be false alarm because the frost flowers of young leads may show as bright pixels associated with changes in the surface salinity under calm surface conditions. Wind roughened leads also trigger the backscatter increasing that can be misclassified as ridges [1]. Thus the width limitation is considered in this proposed structure tensor method [2], since only shape feature based method is not enough for detecting ridges. The ridge detection algorithm is based on the hypothesis that the bright pixels are ridges with curvilinear shapes and the ridge width is less 30 meters. Benefited from GF-3 with high spatial resolution of 3 meters, we provide an enhanced structure tensor method for detecting the significant ridge. The preprocessing procedures including the calibration and incidence angle normalization are also investigated. The bright pixels will have strong response to the bandpass filtering. The ridge training samples are delineated from the SAR imagery in the Log-Gabor filters to construct structure tensor. From the tensor, the dominant orientation of the pixel representing the ridge is determined by the dominant eigenvector. For the post-processing of structure tensor, the elongated kernel is desired to enhance the ridge curvilinear shape. Since ridge presents along a certain direction, the ratio of the dominant eigenvector will be used to measure the intensity of local anisotropy. The convolution filter has been utilized in the constructed structure tensor is used to model spatial contextual information. Ridge detection results from GF-3 show the proposed method performs better compared to the

Microbial diversity in subseafloor fluids from Explorer Ridge, Northeast Pacific

Science.gov (United States)

Bolton, S.; Huber, J. A.; Embley, R.; Butterfield, D. A.; Baross, J. A.

2003-12-01

The Gorda, Juan de Fuca and Explorer Ridges are first order spreading centers located in the northeast Pacific. While the Gorda and Juan de Fuca Ridges have been extensively sampled for chemical and microbiological analyses, what little is known about the Explorer Ridge is from preliminary observations made in the mid-1980's. A cruise in 2002 revisited the area and discovered vigorous hydrothermal activity at Magic Mountain, a site located outside the primary rift valley. Explorer Ridge is an important site to compare with other well-described vent sites on the Juan de Fuca Ridge. Our research has focused on describing the phylogenetic and physiological diversity of bacteria and archaea in low temperature hydrothermal fluids in an effort to identify subseafloor indicator organisms and to use the physiological characteristics of these organisms to help constrain subseafloor habitat characteristics. We have previously established that there are microbial taxa that are unique to subseafloor habitats associated with diffuse flow fluids at Axial Seamount and at Endeavour both located on the Juan de Fuca Ridge. These included cultured anaerobic, thermophilic and hyperthermophilic heterotrophs, methanogens and sulfur metabolizers. Moreover, results from molecular phylogeny analyses using the 16S rRNA sequences identified a phylogenetically diverse group of bacteria belonging to the epsilon-proteobacteria. While anaerobic hyperthermophiles were cultured from some diffuse-flow vent sites at Explorer, they were less abundant than at Axial Volcano and Endeavour, and curiously, no methanogens were cultured or detected in 16S rRNA clonal libraries. Like Axial, a diverse group of epsilon-proteobacterial clones were found with many similar to those identified from Axial Seamount and other hydrothermal vent sites, although there appears to be some unique species. The overall bacterial diversity at Explorer appears different than at Axial, possibly linked to temperature or chemical

Data Sharing Report Characterization of Isotope Row Facilities Oak Ridge National Laboratory Oak Ridge TN

Energy Technology Data Exchange (ETDEWEB)

Weaver, Phyllis C. [Oak Ridge Inst. for Science and Education (ORISE), Oak Ridge, TN (United States)

2013-12-12

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (EM-OR) requested that Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, provide technical and independent waste management planning support using funds provided by the American Recovery and Reinvestment Act (ARRA). Specifically, DOE EM-OR requested ORAU to plan and implement a survey approach, focused on characterizing the Isotope Row Facilities located at the Oak Ridge National Laboratory (ORNL) for future determination of an appropriate disposition pathway for building debris and systems, should the buildings be demolished. The characterization effort was designed to identify and quantify radiological and chemical contamination associated with building structures and process systems. The Isotope Row Facilities discussed in this report include Bldgs. 3030, 3031, 3032, 3033, 3033A, 3034, 3036, 3093, and 3118, and are located in the northeast quadrant of the main ORNL campus area, between Hillside and Central Avenues. Construction of the isotope production facilities was initiated in the late 1940s, with the exception of Bldgs. 3033A and 3118, which were enclosed in the early 1960s. The Isotope Row facilities were intended for the purpose of light industrial use for the processing, assemblage, and storage of radionuclides used for a variety of applications (ORNL 1952 and ORAU 2013). The Isotope Row Facilities provided laboratory and support services as part of the Isotopes Production and Distribution Program until 1989 when DOE mandated their shutdown (ORNL 1990). These facilities performed diverse research and developmental experiments in support of isotopes production. As a result of the many years of operations, various projects, and final cessation of operations, production was followed by inclusion into the surveillance and maintenance (S&M) project for eventual decontamination and decommissioning (D&D). The

Geospatializing The Klang Gate Quartz Ridge in Malaysia: A Technological Perspective

Science.gov (United States)

Azahari Razak, Khamarrul; Mohamad, Zakaria; Zaki Ibrahim, Mohd; Azad Rosle, Qalam; Hattanajmie Abd Wahab, Mohd; Abu Bakar, Rabieahtul; Mohd Akib, Wan Abdul Aziz Wan

2015-04-01

Establishment of inventories on geological heritage, or geoheritage resources is a step forward for a comprehensive geoheritage management leading to a better conservation at national and global levels. Compiling and updating inventory of geoheritage is a tedious process and even so in a tropical environment. Malaysia has a tremendous list of geodiversity and generating its national database is a multi-institutional effort and worthwhile investment. However, producing accurate and reliable characteristics of such landform and spectacular geological features remained elusive. The advanced and modern mapping techniques have revolutionized the mapping, monitoring and modelling of the earth surface processes and landforms. Yet the methods for quantification of geodiversity physical features are not fully utilized in Malaysia for a better understanding its processes and activity. This study provides a better insight into the use of advanced active remote sensing technology for characterizing the forested Quartz Ridge in Malaysia. We have developed the novel method and tested in the Klang Gates Quartz Ridge, Selangor. The granitic country rock made up by quartz mineral is known as the longest quartz ridge in Malaysia and characterized by rugged topography, steep slopes, densely vegetated terrain and also rich-biodiversity area. This study presents an integrated field methodological framework and processing scheme by taking into account the climatic, topographic, geologic, and anthropogenic challenges in an equatorial region. Advanced terrestrial laser scanning system was used to accurately capture, map and model the ridge carried out within a relatively stringent time period. The high frequency Global Navigation Satellite System and modern Total Station coupled with the optical satellite and radar imageries and also advanced spatial analysis were fully utilized in the field campaign and data assessment performed during the recent monsoon season. As a result, the mapping

Oak Ridge Reservation, annual site environmental report for 1993

Energy Technology Data Exchange (ETDEWEB)

1994-11-01

The US DOE currently oversees activities on the Oak Ridge Reservation, a government-owned, contractor-operated facility. Three sites compose the reservation; Y-12, Oak Ridge National Laboratory, and K-25. This document contains a summary of environmental monitoring activities on the Oak Ridge Reservation (ORR) and its surroundings. The results summarized in this report are based on the data collected during calendar year (CY) 1993 and compiled in; Environmental Monitoring in the Oak Ridge Reservation: CY 1993 Results. Annual environmental monitoring on the ORR consists of two major activities: effluent monitoring and environmental surveillance. Effluent monitoring is the collection and analysis of samples or measurements of liquid, gaseous, or airborne effluents for the purpose of characterizing and quantifying contaminants and process stream characteristics, assessing radiation and chemical exposures to members of the public, and demonstrating compliance with applicable standards. Environmental surveillance is the collection and analysis of samples of air, water, soil, foodstuffs, biota, and other media from DOE sites and their environs and the measurement of external radiation for purposes of demonstrating compliance with applicable standards, assessing radiation and chemical exposures to members of the public, and assessing effects, if any, on the local environment.

Oak Ridge Reservation, annual site environmental report for 1993

International Nuclear Information System (INIS)

1994-11-01

The US DOE currently oversees activities on the Oak Ridge Reservation, a government-owned, contractor-operated facility. Three sites compose the reservation; Y-12, Oak Ridge National Laboratory, and K-25. This document contains a summary of environmental monitoring activities on the Oak Ridge Reservation (ORR) and its surroundings. The results summarized in this report are based on the data collected during calendar year (CY) 1993 and compiled in; Environmental Monitoring in the Oak Ridge Reservation: CY 1993 Results. Annual environmental monitoring on the ORR consists of two major activities: effluent monitoring and environmental surveillance. Effluent monitoring is the collection and analysis of samples or measurements of liquid, gaseous, or airborne effluents for the purpose of characterizing and quantifying contaminants and process stream characteristics, assessing radiation and chemical exposures to members of the public, and demonstrating compliance with applicable standards. Environmental surveillance is the collection and analysis of samples of air, water, soil, foodstuffs, biota, and other media from DOE sites and their environs and the measurement of external radiation for purposes of demonstrating compliance with applicable standards, assessing radiation and chemical exposures to members of the public, and assessing effects, if any, on the local environment

Proposed plan for the United Nuclear Corporation Disposal Site at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1991-03-01

The US Department of Energy (DOE) in compliance with Section 117(a) of the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended by the Superfund Amendments and Reauthorization Act (SARA) of 1986, is releasing the proposed plan for remedial action at the United Nuclear Corporation (UNC) Disposal Site located at the DOE Oak Ridge Operations (ORO) Y-12 Plant, Oak Ridge, Tennessee. The purpose of this document is to present and solicit for comment to the public and all interested parties the ''preferred plan'' to remediate the UNC Disposal Site. However, comments on all alternatives are invited

Surface radiological investigations along State Highway 95, Lagoon Road, and Melton Valley Drive, Oak Ridge Reservation, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Tiner, P.F.; Uziel, M.S.; Rice, D.E.; Williams, J.K.

1995-08-01

The surface radiological investigation along State Highway 95, Lagoon Road, and Melton Valley Drive at the Oak Ridge Reservation was conducted as part of the Oak Ridge National Laboratory Environmental Restoration Program Surveillance and Maintenance activities. This report was prepared to document results of the investigation and subsequent remedial actions. The report details surface gamma radiation levels including gamma anomalies; surface beta radiation levels including beta anomalies; results of analysis of soil, water, and vegetation samples and smear samples collected from paved surfaces; remediation activities conducted as a result of the survey; and recommendations for further corrective measures

Magdalena Ridge Observatory Interferometer: Status Update

National Research Council Canada - National Science Library

Creech-Eakman, M. J; Bakker, E. J; Buscher, D. F; Coleman, T. A; Haniff, C. A; Jurgenson, C. A; Klinglesmith, III, D. A; Parameswariah, C. B; Romero, V. D; Shtromberg, A. V; Young, J. S

2006-01-01

The Magdalena Ridge Observatory Interferometer (MROI) is a ten element optical and near-infrared imaging interferometer being built in the Magdalena mountains west of Socorro, NM at an altitude of 3230 m...

Prediction of the transition energies of atomic No and Lr by the intermediate Hamiltonian coupled cluster method

International Nuclear Information System (INIS)

Borschevsky, A.; Eliav, E.; Kaldor, U.; Vilkas, M.J.; Ishikawa, Y.

2007-01-01

Complete text of publication follows: Measurements of the spectroscopic properties of the superheavy elements present a serious challenge to the experimentalist. Their short lifetimes and the low quantities of their production necessitate reliable prediction of transition energies to avoid the need for broad wavelength scans and to assist in identifying the lines. Thus, reliable high-accuracy calculations are necessary prior and parallel to experimental research. Nobelium and Lawrencium are at present the two most likely candidates for spectroscopic measurements, with the first experiments planned at GSI, Darmstadt. The intermediate Hamiltonian (IH) coupled cluster method is applied to the ionization potentials, electron affinities, and excitation energies of atomic nobelium and lawrencium. Large basis sets are used (37s31p26d21f16g11h6i). All levels of a particular atom are obtained simultaneously by diagonalizing the IH matrix. The matrix elements correspond to all excitations from correlated occupied orbitals to virtual orbitals in a large P space, and are 'dressed' by folding in excitations to higher virtual orbitals (Q space) at the coupled cluster singles-and-doubles level. Lamb-shift corrections are included. The same approach was applied to the lighter homologues of Lr and No, lutetium and ytterbium, for which many transition energies are experimentally known, in order to assess the accuracy of the calculation. The average absolute error of 20 excitation energies of Lu is 423 cm -1 , and the error limits for Lr are therefore put at 700 cm -1 . Predicted Lr excitations with large transition moments in the prime range for the planned experiment, 20,000-30,000 cm -1 , are 7p → 8s at 20,100 cm -1 and 7p →p 7d at 28,100 cm -1 . In case of Yb, the calculated ionization potential was within 20 cm -1 of the experiment, and the average error of the 20 lowest calculated excitations was about 300 cm -1 . Hence, the error limits of nobelium are set to 800 cm -1

a comparative study of some robust ridge and liu estimators

African Journals Online (AJOL)

Dr A.B.Ahmed

estimation techniques such as Ridge and Liu Estimators are preferable to Ordinary Least Square. On the other hand, when outliers exist in the data, robust estimators like M, MM, LTS and S. Estimators, are preferred. To handle these two problems jointly, the study combines the Ridge and Liu Estimators with Robust.

Studying the Indian Ocean Ridge System: Agenda for the new century

Digital Repository Service at National Institute of Oceanography (India)

Mukhopadhyay, R.; Iyer, S.D.; Banerjee, R.; Drolia, R.K.

Studies on the Indian Ocean Ridge System, though sporadic, was aimed to map the complete IORS petrologically and tectonically. Three areas are placed for immediate investigation; one in the slow spreading Carlsberg Ridge area, the second, along...

Soil sampling and analysis plan for the Bear Creek Valley Floodplain at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1995-03-01

This Sampling and Analysis Plan (SAP) for the Bear Creek Valley (BCV) Floodplain presents the approach and rationale for characterizing potentially contaminated soils and sediments of the Bear Creek floodplain and the impact of any contaminants on the floodplain ecosystem. In addition to this SAP, the Remedial Investigation Work Plan for Bear Creek (Y02-S600) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee (ES/ER-19&D2) presents background information pertaining to this floodplain investigation.

In-Process Analysis Program for the Isolock sampler at the Gunite and Associated Tanks, Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1998-05-01

The In-Process Analysis Program documents the requirements for handling, transporting, and analyzing waste slurry samples gathered by the Bristol Isolock slurry sampler from the Gunite and Associated Tanks at Oak Ridge National Laboratory in Oak Ridge, Tennessee. Composite samples will be gathered during sludge retrieval operations, labeled, transported to the appropriate laboratory, and analyzed for physical and radiological characteristics. Analysis results will be used to support occupational exposure issues, basic process control management issues, and prediction of radionuclide flow

Soil sampling and analysis plan for the Bear Creek Valley Floodplain at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1995-03-01

This Sampling and Analysis Plan (SAP) for the Bear Creek Valley (BCV) Floodplain presents the approach and rationale for characterizing potentially contaminated soils and sediments of the Bear Creek floodplain and the impact of any contaminants on the floodplain ecosystem. In addition to this SAP, the Remedial Investigation Work Plan for Bear Creek (Y02-S600) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee (ES/ER-19 ampersand D2) presents background information pertaining to this floodplain investigation

Contaminated scrap metal management on the Oak Ridge Reservation

International Nuclear Information System (INIS)

Hayden, H.W.; Stephenson, M.J.; Bailey, J.K.; Weir, J.R.; Gilbert, W.C.

1993-01-01

Large quantities of scrap metal are accumulating at the various Department of Energy (DOE) installations across the country as a result of ongoing DOE programs and missions in concert with present day waste management practices. DOE Oak Ridge alone is presently storing around 500,000 tons of scrap metal. The local generation rate, currently estimated at 1,400 tons/yr, is expected to increase sharply over the next couple of years as numerous environmental restoration and decommissioning programs gain momentum. Projections show that 775,000 tons of scrap metal could be generated at the K-25 Site over the next ten years. The Y-12 Plant and Oak Ridge National Laboratory (ORNL) have similar potentials. The history of scrap metal management at Oak Ridge and future challenges and opportunities are discussed

Ridge-like lava tube systems in southeast Tharsis, Mars

Science.gov (United States)

Zhao, Jiannan; Huang, Jun; Kraft, Michael D.; Xiao, Long; Jiang, Yun

2017-10-01

Lava tubes are widely distributed in volcanic fields on a planetary surface and they are important means of lava transportation. We have identified 38 sinuous ridges with a lava-tube origin in southeast Tharsis. The lengths vary between 14 and 740 km, and most of them occur in areas with slopes rate, low lava viscosity, and sustained magma supply during a long period. Besides, lava flow inflation is also important in the formation of the ridge-like lava tubes and some associated features. These lava tubes provide efficient lateral pathways for magma transportation over the relatively low topographic slopes in southeast Tharsis, and they are important for the formation of long lava flows in this region. The findings of this study provide an alternative formation mechanism for sinuous ridges on the martian surface.

76 FR 48927 - RidgeWorth Funds and RidgeWorth Capital Management, Inc.; Notice of Application

Science.gov (United States)

2011-08-09

... the best interests of the Fund and its shareholders, and does not involve a conflict of interest from... enter into and materially amend subadvisory agreements without shareholder approval. Applicants: Ridge... hearing. Interested persons may request a hearing by writing to the Commission's Secretary and serving...

Implementation Plan for Liquid Low-Level Radioactive Waste tank systems at Oak Ridge National Laboratory under the Federal Facility Agreement, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-09-01

This document summarizes the progress that has been made to date in implementing the plans and schedules for meeting the Federal Facility Agreement (FFA) commitments for the Liquid Low-Level Waste (LLLW) System at Oak Ridge National Laboratory (ORNL). These commitments were initially submitted in ES/ER-17 ampersand Dl, Federal Facility Agreement Plans and Schedules for Liquid Low-Level Radioactive Waste Tank Systems at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Information presented in this document provides a comprehensive summary to facilitate understanding of the FFA compliance program for LLLW tank systems and to present plans and schedules associated with remediation, through the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) process, of LLLW tank systems that have been removed from service. ORNL has a comprehensive program underway to upgrade the LLLW system as necessary to meet the FFA requirements. The tank systems that are removed from service are being investigated and remediated through the CERCLA process. Waste and risk characterizations have been submitted. Additional data will be prepared and submitted to EPA/TDEC as tanks are taken out of service and as required by the remedial investigation/feasibility study (RI/FS) process. The plans and schedules for implementing the FFA compliance program that were submitted in ES/ER-17 ampersand Dl, Federal Facility Agreement Plans and Schedules for Liquid Low-Level Radioactive Waste tanks Systems at Oak Ridge National Laboratory, Oak Ridge, Tennessee, are updated in this document. Chapter 1 provides general background information and philosophies that lead to the plans and schedules that appear in Chaps. 2 through 5

Chemical and Mineralogical Characterization of a Hematite-bearing Ridge on Mauna Kea, Hawaii: A Potential Mineralogical Process Analog for the Mount Sharp Hematite Ridge

Science.gov (United States)

Graff, T. G.; Morris, R. V.; Ming, D. W.; Hamilton, J. C.; Adams, M.; Fraeman, A. A.; Arvidson, R. E.; Catalano, J. G.; Mertzman, S. A.

2014-01-01

The Mars Science Laboratory (MSL) rover Curiosity landed in Gale Crater in August 2012 and is currently roving towards the layered central mound known as Mount Sharp [1]. Compact Reconnaissance Imaging Spectrometer for Mars (CRISM) hyperspectral data indicate Mount Sharp contains an 5 km stratigraphic sequence including Fe-Mg smectites, hematite, and hydrated sulfates in the lower layers separated by an unconformity from the overlying anhydrous strata [1,2,3]. Hematite was initially detected in CRISM data to occur in the lower sulfate layers on the north side of the mound [2]. [3] further mapped a distinct hematite detection occurring as part of a 200 m wide ridge that extends 6.5 km NE-SW, approximately parallel with the base of Mount Sharp. It is likely a target for in-situ analyses by Curiosity. We document here the occurrence of a stratum of hematite-bearing breccia that is exposed on the Puu Poliahu cinder cone near the summit of Mauna Kea volcano (Hawaii) (Fig.1). The stratum is more resistant to weathering than surrounding material, giving it the appearance of a ridge. The Mauna Kea hematite ridge is thus arguably a potential terrestrial mineralogical and process analog for the Gale Crater hematite ridge. We are acquiring a variety of chemical and mineralogical data on the Mauna Kea samples, with a focus on the chemical and mineralogical information already available or planned for the Gale hematite ridge.

Improved voltage performance of the Oak Ridge 25URC tandem accelerator

International Nuclear Information System (INIS)

Meigs, M.J.; Jones, C.M.; Haynes, D.L.; Juras, R.C.; Ziegler, N.F.; Roatz, J.E.; Rathmell, R.D.

1989-01-01

This paper reports on the Oak Ridge 25URC tandem electrostatic accelerator one of two accelerators operated by the Holifield Heavy Ion Research Facility (HHIRF) at the Oak Ridge National Laboratory. Placed into routine service in 1982, the accelerator has provided a wide range of heavy ion beams for research in nuclear and atomic physics. These beams have been provided both directly and after further acceleration by the Oak Ridge Isochronous Cyclotron (ORIC). Show schematically in this paper, the tandem accelerator is a model 25URC Pelletron accelerator

Calendar year 1993 groundwater quality report for the Chestnut Ridge Hydrogeologic Regime Y-12 Plant, Oak Ridge, Tennessee. 1993 Groundwater quality data interpretations and proposed program modifications

Energy Technology Data Exchange (ETDEWEB)

NONE

1994-09-01

This groundwater quality report (GWQR) contains an evaluation of the groundwater quality data obtained during the 1993 calendar year (CY) at several hazardous and non-hazardous waste management facilities associated with the US DOE Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. The groundwater quality data are presented in Part 1 of the GWQR submitted by Martin Marietta Energy Systems, Inc. to the Tennessee Department of Environment and Conservation (TDEC) in February 1994. Groundwater quality data evaluated in this report were obtained at several hazardous and non-hazardous waste management sites located within the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime). The Chestnut Ridge Regime encompasses a section of Chestnut Ridge south of the Y-12 Plant and is one of three hydrogeologic regimes defined for the purposes of groundwater quality monitoring at the plant. The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The annual GWQR for the Chestnut Ridge Regime is completed in two parts. Part 1 consists primarily of data appendices and serves as a reference for the groundwater quality data obtained each CY under the lead of the Y-12 Plant GWPP. Because it contains information needed to comply with Resource Conservation and Recovery Act (RCRA) interim status assessment monitoring and reporting requirements, the Part 1 GWQR is submitted to the TDEC by the RCRA reporting deadline (March 1 of the following CY). Part 2 (this report) contains an evaluation of the data with respect to regime-wide groundwater quality, presents the findings and status of ongoing hydrogeologic studies, describes changes in monitoring priorities, and presents planned modifications to the groundwater sampling and analysis activities.

Calendar year 1993 groundwater quality report for the Chestnut Ridge Hydrogeologic Regime Y-12 Plant, Oak Ridge, Tennessee. 1993 Groundwater quality data interpretations and proposed program modifications

International Nuclear Information System (INIS)

1994-09-01

This groundwater quality report (GWQR) contains an evaluation of the groundwater quality data obtained during the 1993 calendar year (CY) at several hazardous and non-hazardous waste management facilities associated with the US DOE Y-12 Plant located on the DOE Oak Ridge Reservation (ORR) southeast of Oak Ridge, Tennessee. The groundwater quality data are presented in Part 1 of the GWQR submitted by Martin Marietta Energy Systems, Inc. to the Tennessee Department of Environment and Conservation (TDEC) in February 1994. Groundwater quality data evaluated in this report were obtained at several hazardous and non-hazardous waste management sites located within the Chestnut Ridge Hydrogeologic Regime (Chestnut Ridge Regime). The Chestnut Ridge Regime encompasses a section of Chestnut Ridge south of the Y-12 Plant and is one of three hydrogeologic regimes defined for the purposes of groundwater quality monitoring at the plant. The Environmental Management Department of the Y-12 Plant Health, Safety, Environment, and Accountability Organization manages the groundwater monitoring activities in each regime as part of the Y-12 Plant Groundwater Protection Program (GWPP). The annual GWQR for the Chestnut Ridge Regime is completed in two parts. Part 1 consists primarily of data appendices and serves as a reference for the groundwater quality data obtained each CY under the lead of the Y-12 Plant GWPP. Because it contains information needed to comply with Resource Conservation and Recovery Act (RCRA) interim status assessment monitoring and reporting requirements, the Part 1 GWQR is submitted to the TDEC by the RCRA reporting deadline (March 1 of the following CY). Part 2 (this report) contains an evaluation of the data with respect to regime-wide groundwater quality, presents the findings and status of ongoing hydrogeologic studies, describes changes in monitoring priorities, and presents planned modifications to the groundwater sampling and analysis activities

Summary review of the chemical characterization of liquid and sludge contained in the Old Hydrofracture tanks, Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Francis, C.W.; Herbes, S.E.

1997-02-01

This report presents analytical data developed from samples collected from the five inactive tanks located at the Old Hydrofracture Facility (OHF) at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The samples were collected during December 1995 and January 1996. The purpose of the sampling and analysis project was (1) to determine whether the tank contents meet ORNL waste acceptance criteria, as specified in the Oak Ridge National Laboratory, Liquid Waste Treatment Systems, Waste Evaluation Criteria; (2) to determine various physical properties of the tank contents that would affect the design of a sludge mobilization system; and (3) to gather information to support a baseline risk assessment. The report focuses on the analytical results used to evaluate the tank contents with regard to nuclear criticality safety requirements and to regulatory waste characterization

Model selection in kernel ridge regression

DEFF Research Database (Denmark)

Exterkate, Peter

2013-01-01

Kernel ridge regression is a technique to perform ridge regression with a potentially infinite number of nonlinear transformations of the independent variables as regressors. This method is gaining popularity as a data-rich nonlinear forecasting tool, which is applicable in many different contexts....... The influence of the choice of kernel and the setting of tuning parameters on forecast accuracy is investigated. Several popular kernels are reviewed, including polynomial kernels, the Gaussian kernel, and the Sinc kernel. The latter two kernels are interpreted in terms of their smoothing properties......, and the tuning parameters associated to all these kernels are related to smoothness measures of the prediction function and to the signal-to-noise ratio. Based on these interpretations, guidelines are provided for selecting the tuning parameters from small grids using cross-validation. A Monte Carlo study...

Observation of pressure ridges in SAR images of sea ice: Scattering theory and comparison with observations

Science.gov (United States)

Vesecky, J. F.; Daida, J. M.; Shuchman, R. A.; Onstott, R. H.; Camiso, J. C.

1993-01-01

Ridges and keels (hummocks and bummocks) in sea ice flows are important in sea ice research for both scientific and practical reasons. Sea ice movement and deformation is driven by internal and external stresses on the ice. Ridges and keels play important roles in both cases because they determine the external wind and current stresses via drag coefficients. For example, the drag coefficient over sea ice can vary by a factor of several depending on the fluid mechanical roughness length of the surface. This roughness length is thought to be strongly dependent on the ridge structures present. Thus, variations in ridge and keel structure can cause gradients in external stresses which must be balanced by internal stresses and possibly fracture of the ice. Ridging in sea ice is also a sign of fracture. In a practical sense, large ridges form the biggest impediment to surface travel over the ice or penetration through sea ice by ice-strengthened ships. Ridges also play an important role in the damage caused by sea ice to off-shore structures. Hence, observation and measurement of sea ice ridges is an important component of sea ice remote sensing. The research reported here builds on previous work, estimating the characteristics of ridges and leads in sea ice from SAR images. Our objective is to develop methods for quantitative measurement of sea ice ridges from SAR images. To make further progress, in particular, to estimate ridge height, a scattering model for ridges is needed. Our research approach for a ridge scattering model begins with a survey of the geometrical properties of ridges and a comparison with the characteristics of the surrounding ice. For this purpose we have used airborne optical laser (AOL) data collected during the 1987 Greenland Sea Experiment. These data were used to generate a spatial wavenumber spectrum for height variance for a typical ridge - the typical ridge is the average over 10 large ridges. Our first-order model radar scattering includes

Optimum Design of LLC Resonant Converter using Inductance Ratio (Lm/Lr)

Science.gov (United States)

Palle, Kowstubha; Krishnaveni, K.; Ramesh Reddy, Kolli

2017-06-01

The main benefits of LLC resonant dc/dc converter over conventional series and parallel resonant converters are its light load regulation, less circulating currents, larger bandwidth for zero voltage switching, and less tuning of switching frequency for controlled output. An unique analytical tool, called fundamental harmonic approximation with peak gain adjustment is used for designing the converter. In this paper, an optimum design of the converter is proposed by considering three different design criterions with different values of inductance ratio (Lm/Lr) to achieve good efficiency at high input voltage. The optimum design includes the analysis in operating range, switching frequency range, primary side losses of a switch and stability. The analysis is carried out with simulation using the software tools like MATLAB and PSIM. The performance of the optimized design is demonstrated for a design specification of 12 V, 5 A output operating with an input voltage range of 300-400 V using FSFR 2100 IC of Texas instruments.

Wetland Survey of Selected Areas in the Oak Ridge Y-12 Plant Area of Responsibilty, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Rosensteel.

1997-01-01

This document was prepared to summarize wetland surveys performed in the Y- 1 2 Plant area of responsibility in June and July 1994. Wetland surveys were conducted in three areas within the Oak Ridge Y- 12 Plant area of responsibility in June and July 1994: the Upper East Fork Poplar Creek (UEFPC) Operable Unit (OU), part of the Bear Creek Valley OU (the upper watershed of Bear Creek from the culvert under Bear Creek Road upstream through the Y-12 West End Environmental Management Area, and the catchment of Bear Creek North Tributary 1), and part of Chestnut Ridge OU 2 (the McCoy Branch area south of Bethel Valley Road). Using the criteria and methods set forth in the Wetlands Delineation Manual, 18 wetland areas were identified in the 3 areas surveyed; these areas were classified according to the system developed by Cowardin. Fourteen wetlands and one wetland/pond area that are associated with disturbed or remnant stream channels and seeps were identified in the UEFPC OU. Three wetlands were identified in the Bear Creek Valley OU portion of the survey area. One wetland was identified in the riparian zone of McCoy Branch in the southern portion of Chestnut Ridge OU 2

Effects of ridge and furrow rainfall harvesting system on Elymus ...

African Journals Online (AJOL)

ARL

2012-05-10

May 10, 2012 ... A ridge-furrow rainfall harvesting system (RFRHS) was designed to increase the available soil water for .... The solar energy passed through the plastic-film and heated up the air and the surface soil of ridge and then the heat was trapped by the greenhouse effect (Zhou et al., 2009). Meanwhile, the.

Retrospective success and survival rates of dental implants placed after a ridge preservation procedure.

Science.gov (United States)

Apostolopoulos, Peter; Darby, Ivan

2017-04-01

Ridge preservation is any procedure that takes place at the time of, or shortly after an extraction, to minimise resorption of the ridge and maximise bone formation within the socket. The aim of this project is to investigate the outcome of implant treatment following ridge preservation and compare it to an ungrafted implant control group. Following ethics approval, an electronic and manual search of patient records was conducted, and appropriate cases of implant placement following a ridge preservation procedure were identified. Forty-two patients with 51 implants at ridge-preserved sites were examined by one author (PA) with the following parameters assessed at each implant: pocket probing depth, bleeding on probing, presence/absence of plaque and radiographic bone loss. Clinical and radiographic findings were compared to an ungrafted implant control group and analysed by years in function. There was a 100% survival rate of implants in ridge-preserved sites. In the majority of cases, ridge preservation was performed in the anterior maxilla with a flap raised and the use of deproteinised bovine bone mineral and collagen membrane materials. The mean time in function was 31 (±24) months with a range of 2-102 months. Differences in the mean PPD, BOP, plaque index and radiographic bone loss were not statistically significant between implants at ridge-preserved or ungrafted sites. The overall success rate was around 58% for ungrafted implants and around 51% for implants in ridge-preserved sites. However, this difference was not statistically significant. In this retrospective study, implant placement at ridge-preserved sites was a predictable procedure that led to very high survival rates and similar success rates to implant placement at ungrafted sites. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Feasibility studies of colorless LR 115 SSNTD for alpha-particle radiobiological experiments

International Nuclear Information System (INIS)

Chan, K.F.; Tse, A.K.W.; Fong, W.F.; Yu, K.N.

2006-01-01

The feasibility of using the active layer of the colorless LR 115 SSNTD for alpha-particle radiobiological experiments was studied. The track revelation time on the bottom side (the side attached to the polyester base) was much longer than that on the top side (the side not attached to the polyester base) of the active layer so track formation on the top side was more desirable. In relation to this, culture of HeLa cells on the bottom side of the active layer was found feasible although the cultured cell number was relatively smaller. The feasibility of using this SSNTD for alpha-particle radiobiological experiments was demonstrated by culturing cells on the bottom side while performing alpha-particle irradiation and chemical etching on the top side, and by taking photographs of the cells and alpha-particle tracks together under the optical microscope

Jumping spark evaluation of α-radiograms taken on strippable LR-115 film

International Nuclear Information System (INIS)

Somogyi, G.; Hunyadi, I.; Varga, Zs.

1978-01-01

Jumping spark counting was used for the automatic measurement of α-ray tracks on Kodak Pathe LR-115 type special cellulose nitrate films. The effect of temperature and interruptions on the etching rate was observed during the etching of the α track detectors. The recommended parameters for the etching are the following: 10% NaOH solution, 60 +- 0.1 deg C, 1.5 h etching time, 20 rotations/min. The final thickness is 6-7 μm. The counting efficiency of the jumping spark evaluation in the function of the track density and the α energy was carefully studied. The angular distribution of the α particles from the Al(p, α) 24 Mg reaction was determined. This method can be effectively used for the measurement of environmental α activity as for 222 Rn release from 226 Ra. (V.N.)

Curvilinear ridges and related features in southwest Cydonia Mensae, Mars

Science.gov (United States)

Parker, Timothy J.; Schneeberger, Dale M.; Pieri, David C.; Saunders, R. Stephen

1987-01-01

Examined is a region on Mars in southwest Cydonia Mensae (32 deg lat., 17 deg long.) just northwest of the lowland/upland boundary escarpment. The dominant morphological features in this region are the clusters of large massifs and plateau outliers (PI), knobby material (K), and smooth lowland plains (Ps). Surrounding the clusters and linking many isolated knobs is a system of curvilinear ridges and arcuate terrain boundaries which tend to separate the massifs and knobs from the smooth plains. Curvilinear ridges are arcuate to nearly linear and smoother in plan than wrinkle ridges and show no apparent correlation with regional structural grain. They are typically 5 to 10 km long but can range from as little as 2 or 3 km to greater than 50 km long. The widths vary from about 100 m to as much as 2 km. Curvilinear ridges are most numerous within 100 km of the lowland/upland boundary escarpment and are associated with massifs and knobby terrain. Arcuate terrain boundaries appear between units of different apparent albedo or arcuate breaks in slope.

Ridge Width Correlations between Inked Prints and Powdered Latent Fingerprints.

Science.gov (United States)

De Alcaraz-Fossoul, Josep; Barrot-Feixat, Carme; Zapico, Sara C; Mancenido, Michelle; Broatch, Jennifer; Roberts, Katherine A; Carreras-Marin, Clara; Tasker, Jack

2017-10-03

A methodology to estimate the time of latent fingerprint deposition would be of great value to law enforcement and courts. It has been observed that ridge topography changes as latent prints age, including the widths of ridges that could be measured as a function of time. Crime suspects are commonly identified using fingerprint databases that contain reference inked tenprints (flat and rolled impressions). These can be of interest in aging studies as they provide baseline information relating to the original (nonaged) ridges' widths. In practice, the age of latent fingerprints could be estimated following a comparison process between the evidentiary aged print and the corresponding reference inked print. The present article explores possible correlations between inked and fresh latent fingerprints deposited on different substrates and visualized with TiO 2 . The results indicate that the ridge width of flat inked prints is most similar to fresh latent fingerprints , and these should be used as the comparison standard for future aging studies. © 2017 American Academy of Forensic Sciences.

Department of Energy Environmental Management Plan for Oak Ridge Reservation

International Nuclear Information System (INIS)

1984-01-01

The Environmental Program Management Plan for the Oak Ridge Complex was prepared in response to recommendations made at the Congressional hearing held in Oak Ridge on July 11, 1983, to discuss the extent and impact of mercury and other pollutants from DOE's Oak Ridge facilities. While this is a planning document and not a commitment of funds, this effort will help to focus DOE resources toward resolving environmental problems at Oak Ridge in a timely and cost-effective manner. The plan includes: (1) an environmental planning basis; (2) a brief description of the problems and proposed resolutions for each plant; (3) research and development requirements and funding schedules; (4) funding schedule summaries; and (5) continuing analyses and unresolved issues. The planning basis provides the foundation for identifying the environmental problems and their potential resolutions. While applicable environmental standards must be met, there is considerable latitude for interpretation of existing regulations and projection of future requirements. This latitude can have a significant impact on funding and scheduling. 11 figures, 8 tables

Detailed analysis of a RCRA landfill for the United Nuclear Corporation Disposal Site at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1991-04-01

The purpose of this detailed analysis is to provide a preliminary compilation of data, information, and estimated costs associated with a RCRA landfill alternative for UNC Disposal Site. This is in response to Environmental Protection Agency (EPA) comment No. 6 from their review of a open-quotes Feasibility Study for the United Nuclear Corporation Disposal Site at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee.close quotes

Environmental Compliance and Protection Program Description Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Bechtel Jacobs

2009-02-26

The objective of the Environmental Compliance and Protection (EC and P) Program Description (PD) is to establish minimum environmental compliance requirements and natural resources protection goals for the Bechtel Jacobs Company LLC (BJC) Oak Ridge Environmental Management Cleanup Contract (EMCC) Contract Number DE-AC05-98OR22700-M198. This PD establishes the work practices necessary to ensure protection of the environment during the performance of EMCC work activities on the US Department of Energy's (DOE's) Oak Ridge Reservation (ORR) in Oak Ridge, Tennessee, by BJC employees and subcontractor personnel. Both BJC and subcontractor personnel are required to implement this PD. A majority of the decontamination and demolition (D and D) activities and media (e.g., soil and groundwater) remediation response actions at DOE sites on the ORR are conducted under the authority of the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA). CERCLA activities are governed by individual CERCLA decision documents (e.g., Record of Decision [ROD] or Action Memorandum) and according to requirements stated in the Federal Facility Agreement for the Oak Ridge Reservation (DOE 1992). Applicable or relevant and appropriate requirements (ARARs) for the selected remedy are the requirements for environmental remediation responses (e.g., removal actions and remedial actions) conducted under CERCLA.

Phase 2 Sampling Plan for Chestnut Ridge Operable Unit 2 (Filled Coal Ash Pond/Upper McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1992-08-01

CDM Federal Programs Corporation (CDM Federal) was contracted by Martin Marietta Energy Systems, Inc. to prepare a Phase H Sampling Plan to describe field investigation work necessary to address regulatory agency review comments on the Remedial Investigation of Filled Coal Ash Pond (FCAP)/Upper McCoy Branch, Chestnut Ridge Operable Unit 2 at the Y-12 Plant, conducted by CH2M Hill in 1990. The scope and approach of the field investigation described in this plan specifically focus on deficiencies noted by the regulators in discussions at the comment resolution meeting of May 8, 1992, in Oak Ridge, Tennessee. This Phase II Sampling Plan includes a field sampling plan, a field and laboratory quality assurance project plan, a health and safety plan, a waste management plan, and appendixes providing an update to applicable or relevant and appropriate requirements for this site and field and laboratory testing methods and procedures. To address deficiencies noted by the regulators, the following activities will be conducted: Background surface soil and surface water/sediment samples will be collected based on statistical considerations for comparison to site data. Existing and new data to be collected will be used to support a human health risk assessment that includes the future homesteader scenario. Biological surveys, samples, and measurements will be collected/conducted to augment existing data and support an ecological risk assessment. Another round of groundwater sampling will be conducted, including on-site wells and the wells on Chestnut Ridge downgradient of the Security Pits. Borings will be completed in the FCAP to collect samples from below the surface depth to describe the chemical characteristics and volume of the ash. The volume of ash associated with sluice channel on Chestnut Ridge will be determined. Soil samples will be corrected below the coal ash in the FCAP and adjacent to sluice channel to evaluate soil contamination and migration of contaminants

Site characterization summary report for dry weather surface water sampling upper East Fork Poplar Creek characterization area Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-08-01

This report describes activities associated with conducting dry weather surface water sampling of Upper East Fork Poplar Creek (UEFPC) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee. This activity is a portion of the work to be performed at UEFPC Operable Unit (OU) 1 [now known as the UEFPC Characterization Area (CA)], as described in the RCRA Facility Investigation Plan for Group 4 at the Oak- Ridge Y-12 Plant, Oak Ridge, Tennessee and in the Response to Comments and Recommendations on RCRA Facility Investigation Plan for Group 4 at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee, Volume 1, Operable Unit 1. Because these documents contained sensitive information, they were labeled as unclassified controlled nuclear information and as such are not readily available for public review. To address this issue the U.S. Department of Energy (DOE) published an unclassified, nonsensitive version of the initial plan, text and appendixes, of this Resource Conservation and Recovery Act (RCRA) Facility Investigation (RFI) Plan in early 1994. These documents describe a program for collecting four rounds of wet weather and dry weather surface water samples and one round of sediment samples from UEFPC. They provide the strategy for the overall sample collection program including dry weather sampling, wet weather sampling, and sediment sampling. Figure 1.1 is a schematic flowchart of the overall sampling strategy and other associated activities. A Quality Assurance Project Plan (QAPJP) was prepared to specifically address four rounds of dry weather surface water sampling and one round of sediment sampling. For a variety of reasons, sediment sampling has not been conducted and has been deferred to the UEFPC CA Remedial Investigation (RI), as has wet weather sampling.

The Oak Ridge Reservation Annual Site Environmental Report, 2007

Energy Technology Data Exchange (ETDEWEB)

Hughes, Joan [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thompson, Sharon [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Page, David [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2008-09-30

The Oak Ridge Reservation (ORR) consists of three major government-owned, contractor-operated facilities: the Y-12 National Security Complex, Oak Ridge National Laboratory, and East Tennessee Technology Park. The ORR was established in the early 1940s as part of the Manhattan Project, a secret undertaking that produced materials for the first atomic bombs. The reservation’s role has evolved over the years, and it continues to adapt to meet the changing defense, energy, and research needs of the United States. Both the work carried out for the war effort and subsequent research, development, and production activities have involved, and continue to involve, the use of radiological and hazardous materials. The Oak Ridge Reservation Annual Site Environmental Report and supporting data are available at Http://www.ornl.gov/sci/env_rpt or from the project director.

Implementation plan for Liquid Low-Level Radioactive Waste Tank Systems at Oak Ridge National Laboratory under the Federal Facility Agreement, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-06-01

Plans and schedules for meeting the Federal Facility Agreement (FFA) commitments for the Liquid Low-Level Waste (LLLW) System at Oak Ridge National Laboratory (ORNL) were initially submitted in ES/ER-17 ampersand D1, Federal Facility Agreement Plans and Schedules for Liquid Low-Level Radioactive Waste Tank Systems at Oak Ridge National Laboratory, Oak Ridge, Tennessee. The information presented in the current document summarizes the progress that has been made to date and provides a comprehensive summary to facilitate understanding of the FFA compliance program for LLLW tank systems and to present the plans and schedules associated with the remediation, through the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) process, of LLLW tank systems that have been removed from service. A comprehensive program is under way at ORNL to upgrade the LLLW system as necessary to meet the FFA requirements. The tank systems that are removed from service are being investigated and remediated through the CERCLA process. Waste and risk characterizations have been submitted. Additional data will be submitted to the US Environmental Protection Agency and the Tennessee Department of Environment and Conservation (EPA/TDEC) as tanks are taken out of service and as required by the remedial investigation/feasibility study (RI/FS) process. The plans and schedules for implementing the FFA compliance program that were originally submitted in ES/ER-17 ampersand D 1, Federal Facility Agreement Plans and Schedules for Liquid Low-Level Radioactive Waste tanks Systems at Oak Ridge National Laboratory, Oak Ridge, Tennessee, are updated in the present document. Chapter I provides general background information and philosophies that lead to the plans and schedules that appear in Chaps. 2 through 5

Resource Management Plan for the Oak Ridge Reservation: Volume 22, Resource information and site analysis for planning on the Oak Ridge Reservation

Energy Technology Data Exchange (ETDEWEB)

Chance, W.W.

1986-12-01

The Department of Energy's (DOE's) Oak Ridge Reservation (ORR) consists of approximately 15,000 ha (37,000 acres) of federally owned lands; it contains three major facilities (Oak Ridge Gaseous Diffusion Plant, Oak Ridge National Laboratory, and the Oak Ridge Y-12 Plant) operated by a single contractor and a number of other facilities operated either by DOE or under contract to others. This report documents the various land use elements, land use constraints (physical, programmatic, and geopolitical), and site potential capabilities and provides current documentation of related data for making land use and site development decisions. The ORR has physical, programmatic, and geopolitical constraints that have been identified, measured, and mapped. The constraints and opportunities map was used to identify developable land areas. Many of these sites have only remote potential for meeting any planned needs for expansion of existing facilities. However, stand-alone research functions or other facilities are possible on these sites. These studied and measured findings lead to the conclusion that extreme care must be taken in the evaluation of future use or disposition of available land. Furthermore, it is time to consider and evaluate the feasibility for renewal. The potential for recycling lands formerly used by programs and functions that have been completed or terminated is very real, considering the age, condition, and obsolescence of these facilities.

Oak Ridge Dose Reconstruction Project Summary Report; Reports of the Oak Ridge Dose Reconstruction, Vol. 7

International Nuclear Information System (INIS)

Widner, Thomas E.; email = twidner@jajoneses.com

1999-01-01

In the early 1990s, concern about the Oak Ridge Reservation's past releases of contaminants to the environment prompted Tennessee's public health officials to pursue an in-depth study of potential off-site health effects at Oak Ridge. This study, the Oak Ridge dose reconstruction, was supported by an agreement between the U.S. Department of Energy (DOE) and the State of Tennessee, and was overseen by a 12-member panel of individuals appointed by Tennessee's Commissioner of Health. The panel requested that the principal investigator for the project prepare the following report, ''Oak Ridge Dose Reconstruction Project Summary Report,'' to serve the following purposes: (1) summarize in a single, less technical report, the methods and results of the various investigations that comprised the Phase II of the dose reconstruction; (2) describe the systematic searching of classified and unclassified historical records that was a vital component of the project; and (3) summarize the less detailed, screening-level assessments that were performed to evaluate the potential health significance of a number of materials, such a uranium, whose priority did not require a complete dose reconstruction effort. This report describes each major step of the dose reconstruction study: (1) the review of thousands of historical records to obtain information relating to past operations at each facility; (2) estimation of the quantity and timing of releases of radioiodines from X-10, of mercury from Y-12, of PCB's from all facilities, and of cesium-137 and other radionuclides from White Oak Creek; (3) evaluation of the routes taken by these contaminants through the environment to nearby populations; and (4) estimation of doses and health risks to exposed groups. Calculations found the highest excess cancer risks for a female born in 1952 who drank goat milk; the highest non-cancer health risk was for children in a farm family exposed to PCBs in and near East Fork Poplar Creek. More detailed

Levels of the soluble LDL receptor-relative LR11 decrease in overweight individuals with type 2 diabetes upon diet-induced weight loss

NARCIS (Netherlands)

K.A.C. Berk (Kirsten); R. Vongpromek (Ranitha); M. Jiang (Meizi); W.J. Schneider (Wolfgang); R. Timman (Reinier); A.J.M. Verhoeven; H. Bujo (Hideaki); E.J.G. Sijbrands (Eric); M.T. Mulder (Monique)

2016-01-01

markdownabstract__Background and aims__ Cardiovascular disease (CVD) is a major complication in patients with type 2 diabetes (T2D), especially in those with obesity. Plasma soluble low density lipoprotein receptor-relative with 11 ligand-binding repeats (sLR11) plays a role in the development of

Magma plumbing system and seismicity of an active mid-ocean ridge volcano.

Science.gov (United States)

Schmid, Florian; Schlindwein, Vera; Koulakov, Ivan; Plötz, Aline; Scholz, John-Robert

2017-02-20

At mid-ocean ridges volcanism generally decreases with spreading rate but surprisingly massive volcanic centres occur at the slowest spreading ridges. These volcanoes can host unexpectedly strong earthquakes and vigorous, explosive submarine eruptions. Our understanding of the geodynamic processes forming these volcanic centres is still incomplete due to a lack of geophysical data and the difficulty to capture their rare phases of magmatic activity. We present a local earthquake tomographic image of the magma plumbing system beneath the Segment 8 volcano at the ultraslow-spreading Southwest Indian Ridge. The tomography shows a confined domain of partial melt under the volcano. We infer that from there melt is horizontally transported to a neighbouring ridge segment at 35 km distance where microearthquake swarms and intrusion tremor occur that suggest ongoing magmatic activity. Teleseismic earthquakes around the Segment 8 volcano, prior to our study, indicate that the current magmatic spreading episode may already have lasted over a decade and hence its temporal extent greatly exceeds the frequent short-lived spreading episodes at faster opening mid-ocean ridges.

Issues relating to spent nuclear fuel storage on the Oak Ridge Reservation

International Nuclear Information System (INIS)

Klein, J.A.; Turner, D.W.

1994-01-01

Currently, about 2,800 metric tons of spent nuclear fuel (SNF) is stored in the US, 1,000 kg of SNF (or about 0.03% of the nation's total) are stored at the US Department of Energy (DOE) complex in Oak Ridge, Tennessee. However small the total quantity of material stored at Oak Ridge, some of the material is quite singular in character and, thus, poses unique management concerns. The various types of SNF stored at Oak Ridge will be discussed including: (1) High-Flux Isotope Reactor (HFIR) and future Advanced Neutron Source (ANS) fuels; (2) Material Testing Reactor (MTR) fuels, including Bulk Shielding Reactor (BSR) and Oak Ridge Research Reactor (ORR) fuels; (3) Molten Salt Reactor Experiment (MSRE) fuel; (4) Homogeneous Reactor Experiment (HRE) fuel; (5) Miscellaneous SNF stored in Oak Ridge National Laboratory's (ORNL's) Solid Waste Storage Areas (SWSAs); (6) SNF stored in the Y-12 Plant 9720-5 Warehouse including Health. Physics Reactor (HPRR), Space Nuclear Auxiliary Power (SNAP-) 10A, and DOE Demonstration Reactor fuels

Environmental Monitoring Report - United States Department of Energy, Oak Ridge Facilities, Calendar Year 1984

Energy Technology Data Exchange (ETDEWEB)

Jordan, R.G.

1999-01-01

Each year since 1972, a report has been prepared on the environmental monitoring activities for the DOE facilities in oak Ridge, Tennessee, for the previous calendar year. previously, the individual facilities published quarterly and annual progress reports that contained some environmental monitoring data. The environmental monitoring program for 1984 includes sampling and analysis of air, water from surface streams, groundwater, creek sediment, biota, and soil for both radioactive and nonradioactive (including hazardous) materials. Special environmental studies that have been conducted in the Oak Ridge area are included in this report, primarily as abstracts or brief summaries. The annual report for 1984 on environmental monitoring and surveillance of the Oak Ridge community by Oak Ridge Associated Universities (ORAU) is included as an appendix. A brief description of the topography and climate of the Oak Ridge area and a short description of the three DOE facilities are provided below to enhance the reader's understanding of the direction and contents of the environmental monitoring program for Oak Ridge.

Prediction of facial height, width, and ratio from thumbprints ridge count and its possible applications

Directory of Open Access Journals (Sweden)

Lawan Hassan Adamu

2017-01-01

Full Text Available The fingerprints and face recognition are two biometric processes that comprise methods for uniquely recognizing humans based on certain number of intrinsic physical or behavioral traits. The objectives of the study were to predict the facial height (FH, facial width, and ratios from thumbprints ridge count and its possible applications. This was a cross-sectional study. A total of 457 participants were recruited. A fingerprint live scanner was used to capture the plain thumbprint. The facial photograph was captured using a digital camera. Pearson's correlation analysis was used for the relationship between thumbprint ridge density and facial linear dimensions. Step-wise linear multiple regression analysis was used to predict facial distances from thumbprint ridge density. The result showed that in males the right ulnar ridge count correlates negatively with lower facial width (LFW, upper facial width/upper FH (UFW/UFH, lower FH/FH (LFH/FH, and positively with UFH and UFW/LFW. The right and left proximal ridge counts correlate with LFW and UFH, respectively. In males, the right ulnar ridge count predicts LFW, UFW/LFW, UFW/UFH, and LFH/FH. Special upper face height I, LFW, height of lower third of the face, UFW/LFW was predicted by right radial ridge counts. LFH, height of lower third of the face, and LFH/FH were predicted from left ulnar ridge count whereas left proximal ridge count predicted LFW. In females only, the special upper face height I was predicted by right ulnar ridge count. In conclusion, thumbprint ridge counts can be used to predict FH, width, ratios among Hausa population. The possible application of fingerprints in facial characterization for used in human biology, paleodemography, and forensic science was demonstrated.

New geological-geophysical data on the structure of the Ninetyeast Ridge

Digital Repository Service at National Institute of Oceanography (India)

Levchenko, O.V.; Sager, W.W.; Frey, F.A.; Pringle, M.S.; Krishna, K.S.; Rao, D.G.; Gauntlett, E.; Mervine, E.E.; Marinova, Y.G.; Piotrowski, A.A.; Paul, S.F.; Huang, S.; Eisin, A.E.

The Ninetyeast (or East Indian) Ridge is one of the longest aseismic volcanic ridges in the World Ocean and one of the longest linear structures of the Earth. It is 200 km wide on average, and it extends in the meridional direction via the entire...

Action memorandum for the Waste Area Grouping 1 Tank WC-14 removal action at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1994-11-01

This action memorandum documents approval for a Comprehensive Environmental Response, Compensation, and Liability Act of 1980, as amended (CERCLA), time-critical action. The action will remove radiologically contaminated water from Tank WC-14. The water contains a polychlorinated biphenyl (PCB) at a level below regulatory concern. Tank WC-14 is located in the Waste Area Grouping (WAG) 1 WC-10 Tank Farm at the Oak Ridge National Laboratory (ORNL), Oak Ridge, Tennessee. Contaminated sludge remaining in the tank after removal of the liquid will be the subject of a future action

Investigations into the biodegradation of microcystin-LR in wastewaters

International Nuclear Information System (INIS)

Ho, Lionel; Hoefel, Daniel; Palazot, Sebastien; Sawade, Emma; Newcombe, Gayle; Saint, Christopher P.; Brookes, Justin D.

2010-01-01

Microcystins are potent hepatotoxins that can be produced by cyanobacteria. These organisms can proliferate in wastewaters due to a number of factors including high concentrations of nutrients for growth. As treated wastewaters are now being considered as supplementary drinking water sources, in addition to their frequent use for irrigated agriculture, it is imperative that these wastewaters are free of toxins such as microcystins. This study investigated the potential for biodegradation of microcystin-LR (MCLR) in wastewaters through a biological sand filtration experiment and in static batch reactor experiments. MCLR was effectively removed at a range of concentrations and at various temperatures, with degradation attributed to the action of microorganisms indigenous to the wastewaters. No hepatotoxic by-products were detected following the degradation of MCLR as determined by a protein phosphatase inhibition assay. Using TaqMan polymerase chain reaction, the first gene involved in bacterial degradation of MCLR (mlrA) was detected and the responsible bacteria shown to increase with the amount of MCLR being degraded. This finding suggested that the degradation of MCLR was dependent upon the abundance of MCLR-degrading organisms present within the wastewater, and that MCLR may provide bacteria with a significant carbon source for proliferation; in turn increasing MCLR removal.

Reconstructing paleo-discharge from geometries of fluvial sinuous ridges on Earth and Mars

Science.gov (United States)

Hayden, A.; Lamb, M. P.; Mohrig, D. C.; Williams, R. M. E.; Myrow, P.; Ewing, R. C.; Cardenas, B. T.; Findlay, C. P., III

2017-12-01

Sinuous, branching networks of topographic ridges resembling river networks are common across Mars, and show promise for quantifying ancient martian surface hydrology. There are two leading formation mechanisms for ridges with a fluvial origin. Inverted channels are ridges that represent casts (e.g., due to lava fill) of relict river channel topography, whereas exhumed channel deposits are eroded remnants of a more extensive fluvial deposit, such as a channel belt. The inverted channel model is often assumed on Mars; however, we currently lack the ability to distinguish these ridge formation mechanisms, motivating the need for Earth-analog study. To address this issue, we studied the extensive networks of sinuous ridges in the Ebro basin of northeast Spain. The Ebro ridges stand 3-15 meters above the surrounding plains and are capped by a cliff-forming sandstone unit 3-10 meters thick and 20-50 meters in breadth. The caprock sandstone bodies contain bar-scale cross stratification, point-bar deposits, levee deposits, and lenses of mudstone, indicating that these are channel-belt deposits, rather than casts of channels formed from lateral channel migration, avulsion and reoccupation. In plan view, ridges form segments branching outward to the north resembling a distributary network; however, crosscutting relationships indicate that ridges cross at different stratigraphic levels. Thus, the apparent network in planview reflects non-uniform exhumation of channel-belt deposits from multiple stratigraphic positions, rather than an inverted coeval river network. As compared to the inverted channel model, exhumed fluvial deposits indicate persistent fluvial activity over geologic timescales, indicating the potential for long-lived surface water on ancient Mars.

Coral-rubble ridges as dynamic coastal features - short-term reworking and weathering processes

Science.gov (United States)

Spiske, Michaela

2016-02-01

A coral-rubble ridge built by storm waves at Anegada (British Virgin Islands) underwent remarkable changes in shape and weathering in a 23-month period. The ridge is located along the island's north shore, in the lee of a fringing reef and a reef flat. This coarse-clast ridge showed two major changes between March 2013, when first examined, and February 2015, when revisited. First, a trench dug in 2013, and intentionally left open for further examination, was found almost completely infilled in 2015, and the ridge morphology was modified by slumping of clasts down the slope and by reworking attributable to minor storm waves. In size, composition and overall condition, most of the clasts that filled the trench resemble reworked clasts from the ridge itself; only a small portion had been newly brought ashore. Second, a dark gray patina formed on the whitish exteriors of the carbonate clasts that had been excavated in 2013. These biologically weathered, darkened clasts had become indistinguishable from clasts that had been at the ridge surface for a much longer time. The findings have two broader implications. First, coastal coarse-clast ridges respond not solely to major storms, but also to tropical storms or minor hurricanes. The modification and reworking of the ridge on Anegada most probably resulted from hurricane Gonzalo which was at category 1-2 as it passed about 60 km north of the island in October 2014. Second, staining of calcareous clasts by cyanobacteria in the supralittoral zone occurs within a few months. In this setting, the degree of darkening quickly saturates as a measure of exposure age.

High resolution bathymetric and sonar images of a ridge southeast of Terceira Island (Azores plateau)

Science.gov (United States)

Lourenço, N.; Miranda, J. M.; Luis, J.; Silva, I.; Goslin, J.; Ligi, M.

2003-04-01

The Terceira rift is a oblique ultra-slow spreading system where a transtensive regime results from differential movement between Eurasian and African plates. So far no classical ridge segmentation pattern has here been observed. The predominant morphological features are fault controlled rhombic shaped basins and volcanism related morphologies like circular seamounts and volcanic ridges. We present SIMRAD EM300 (bathymetry + backscatter) images acquired over one of these ridges located SE of Terceira Island, during the SIRENA cruise (PI J. Goslin), which complements previous TOBI mosaics performed over the same area during the AZZORRE99 cruise (PI M. Ligi). The ridge presents a NW-SE orientation, it is seismically active (a seismic crisis was documented in 1997) and corresponds to the southern branch of a V shape bathymetric feature enclosing the Terceira Island and which tip is located west of the Island near the 1998 Serreta ridge eruption site. NE of the ridge, the core of the V, corresponds to the North Hirondelle basin. All this area corresponds mainly to Brunhes magnetic epoch. The new bathymetry maps reveal a partition between tectonic processes, centred in the ridge, and volcanism present at the bottom of the North Hirondelle basin. The ridge high backscatter surface is cut by a set of sub-parallel anastomosed normal faults striking between N130º and N150º. Some faults present horse-tail terminations. Fault splays sometimes link to neighbour faults defining extensional duplexes and fault wedge basins and highs of rhombic shape. The faulting geometry suggests that a left-lateral strike slip component should be present. The top of the ridge consists on an arched demi-.horst, and it is probably a volcanic structure remnant (caldera system?), existing prior to onset of the tectonic stage in the ridge. Both ridge flanks display gullies and mass wasting fans at the base of the slope. The ridge vicinities are almost exclusively composed of a grayish homogeneous

Data sharing report characterization of population 7: Personal protective equipment, dry active waste, and miscellaneous debris, surveillance and maintenance project Oak Ridge National Laboratory Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Harpenau, Evan M. [Oak Ridge Inst. for Science and Education (ORISE), Oak Ridge, TN (United States)

2013-10-10

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (EM-OR) requested that Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, provide technical and independent waste management planning support under the American Recovery and Reinvestment Act (ARRA). Specifically, DOE EM-OR requested that ORAU plan and implement a sampling and analysis campaign targeting certain URS|CH2M Oak Ridge, LLC (UCOR) surveillance and maintenance (S&M) process inventory waste. Eight populations of historical and reoccurring S&M waste at the Oak Ridge National Laboratory (ORNL) have been identified in the Waste Handling Plan for Surveillance and Maintenance Activities at the Oak Ridge National Laboratory, DOE/OR/01-2565&D2 (WHP) (DOE 2012) for evaluation and processing to determine a final pathway for disposal. Population 7 (POP 7) consists of 56 containers of aged, low-level and potentially mixed S&M waste that has been staged in various locations around ORNL. Several of these POP 7 containers primarily contain personal protective equipment (PPE) and dry active waste (DAW), but may contain other miscellaneous debris. This data sharing report addresses the Comprehensive Environmental Response, Compensation, and Liability Act of 1980 (CERCLA) specified waste in a 13-container subpopulation (including eight steel boxes, three 55-gal drums, one sealand, and one intermodal) that lacked sufficient characterization data for possible disposal at the Environmental Management Waste Management Facility (EMWMF) using the approved Waste Lot (WL) 108.1 profile.

Development of measuring system with self-powered neutron detectors for the LR-0 reactor

International Nuclear Information System (INIS)

Erben, O.; Horinek, K.; Szasz, Z.

1989-01-01

A measuring channel with self-powered detectors was developed for measuring neutron fluxs density in the reactor core. The measuring channel consists of a measuring probe with standard self-powered detectors of Soviet make, a signal pathway, a current/voltage converter and a measuring and recording unit. Neutron flux density in the LR-0 reactor core reaches a maximum of 10 13 m -2 s -1 . Experiments using the channel were carried out both in steady-state operation and after emergency shutdown of the reactor, this from power levels of 2,096 W and 1,830 W. The results of the experiments are tabulated and briefly analyzed. (Z.M.). 4 figs., 3 tabs., 5 refs

Variability of footprint ridge density and its use in estimation of sex in forensic examinations.

Science.gov (United States)

Krishan, Kewal; Kanchan, Tanuj; Pathania, Annu; Sharma, Ruchika; DiMaggio, John A

2015-10-01

The present study deals with a comparatively new biometric parameter of footprints called footprint ridge density. The study attempts to evaluate sex-dependent variations in ridge density in different areas of the footprint and its usefulness in discriminating sex in the young adult population of north India. The sample for the study consisted of 160 young adults (121 females) from north India. The left and right footprints were taken from each subject according to the standard procedures. The footprints were analysed using a 5 mm × 5 mm square and the ridge density was calculated in four different well-defined areas of the footprints. These were: F1 - the great toe on its proximal and medial side; F2 - the medial ball of the footprint, below the triradius (the triradius is a Y-shaped group of ridges on finger balls, palms and soles which forms the basis of ridge counting in identification); F3 - the lateral ball of the footprint, towards the most lateral part; and F4 - the heel in its central part where the maximum breadth at heel is cut by a perpendicular line drawn from the most posterior point on heel. This value represents the number of ridges in a 25 mm(2) area and reflects the ridge density value. Ridge densities analysed on different areas of footprints were compared with each other using the Friedman test for related samples. The total footprint ridge density was calculated as the sum of the ridge density in the four areas of footprints included in the study (F1 + F2 + F3 + F4). The results show that the mean footprint ridge density was higher in females than males in all the designated areas of the footprints. The sex differences in footprint ridge density were observed to be statistically significant in the analysed areas of the footprint, except for the heel region of the left footprint. The total footprint ridge density was also observed to be significantly higher among females than males. A statistically significant correlation

A System with Intelligent Editing for Extracting Ridge and Ravine Terrain Features

National Research Council Canada - National Science Library

Schmidt, Greg; Swan, J. E., II; Rosenblum, Lawrence; Tomlin, Erik B; Overby, Derek

2005-01-01

We describe a system for extracting ridges and ravines from elevation data. The application context is a map-based military planning tool, which allows users to select ridges and ravines by simple mouse clicks...

Clinical management of highly resorbed mandibular ridge without fibrous tissue

Directory of Open Access Journals (Sweden)

Veeramalai N Devaki

2012-01-01

Full Text Available Alveolar ridge atrophy poses a clinical challenge toward the fabrication of successful prosthesis. Resorption of mandibular denture bearing areas results in unstable non-retentive dentures associated with pain and discomfort. This article describes rehabilitation procedure of a patient with resorbed ridge with maximal areas of coverage to improve support and neutral zone arrangement of teeth to improve stability of denture.

Phase 2 confirmatory sampling data report, Lower East Fork Poplar Creek, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1998-01-01

A Remedial Investigation of East Fork Poplar Creek (EFPC) concluded that mercury is the principal contaminant of concern in the EFPC floodplain. The highest concentrations of mercury were found to be in a visually distinct black layer of soil that typically lies 15 to 30 cm (6 to 12 in.) below the surface. Mercury contamination was found to be situated in distinct areas along the floodplain, and generally at depths > 20 cm (8 in.) below the surface. In accordance with Comprehensive, Environmental Response, Compensation, and Liability Act (CERCLA), a feasibility study was prepared to assess alternatives for remediation, and a proposed plan was issued to the public in which a preferred alternative was identified. In response to public input, the plan was modified and US Department of Energy (DOE) issued a Record of Decision in 1995 committing to excavating all soil in the EFPC floodplain exceeding a concentration of 400 parts per million (ppm) of mercury. The Lower East Fork Poplar Creek (LEFPC) remedial action (RA) focuses on the stretch of EFPC flowing from Lake Reality at the Y-12 Plant, through the city of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation (ORR) and its associated floodplain. Specific areas were identified that required remediation at the National Oceanographic and Atmospheric Administration (NOAA) Site along Illinois Avenue and at the Bruner Site along the Oak Ridge Turnpike. The RA was conducted in two separate phases. Phase 2, conducted from February to October 1997, completed the remediation efforts at the NOAA facility and fully remediated the Bruner Site. During both phases, data were collected to show that the remedial efforts performed at the NOAA and Bruner sites were successful in implementing the Record of Decision and had no adverse impact on the creek water quality or the city of Oak Ridge publicly owned treatment works.

Phase II confirmatory sampling data report, Lower East Fork Poplar Creek, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1998-01-01

A Remedial Investigation of East Fork Poplar Creek (EFPC) concluded that mercury is the principal contaminant of concern in the EFPC floodplain. The highest concentrations of mercury were found to be in a visually distinct black layer of soil that typically lies 15 to 30 cm (6 to 12 in.) below the surface. Mercury contamination was found to be situated in distinct areas along the floodplain, and generally at depths > 20 cm (8 in.) below the surface. In accordance with Comprehensive, Environmental Response, Compensation, and Liability Act (CERCLA), a feasibility study was prepared to assess alternatives for remediation, and a proposed plan was issued to the public in which a preferred alternative was identified. In response to public input, the plan was modified and US Department of Energy (DOE) issued a Record of Decision in 1995 committing to excavating all soil in the EFPC floodplain exceeding a concentration of 400 parts per million (ppm) of mercury. The Lower East Fork Poplar Creek (LEFPC) remedial action (RA) focuses on the stretch of EFPC flowing from Lake Reality at the Y-12 Plant, through the city of Oak Ridge, to Poplar Creek on the Oak Ridge Reservation (ORR) and its associated floodplain. Specific areas were identified that required remediation at the National Oceanographic and Atmospheric Administration (NOAA) Site along Illinois Avenue and at the Bruner Site along the Oak Ridge Turnpike. The RA was conducted in two separate phases. Phase 2, conducted from February to October 1997, completed the remediation efforts at the NOAA facility and fully remediated the Bruner Site. During both phases, data were collected to show that the remedial efforts performed at the NOAA and Bruner sites were successful in implementing the Record of Decision and had no adverse impact on the creek water quality or the city of Oak Ridge publicly owned treatment works

Fluvial Channel Networks as Analogs for the Ridge-Forming Unit, Sinus Meridiani, Mars

Science.gov (United States)

Wilkinson, M. J.; du Bois, J. B.

2010-01-01

Fluvial models have been generally discounted as analogs for the younger layered rock units of Sinus Meridiani. A fluvial model based on the large fluvial fan provides a possibly close analog for various features of the sinuous ridges of the etched, ridge-forming unit (RFU) in particular. The close spacing of the RFU ridges, their apparently chaotic orientations, and their organization in dense networks all appear unlike classical stream channel patterns. However, drainage patterns on large fluvial fans low-angle, fluvial aggradational features, 100s of km long, documented worldwide by us provide parallels. Some large fan characteristics resemble those of classical floodplains, but many differences have been demonstrated. One major distinction relevant to the RFU is that channel landscapes of large fans can dominate large areas (1.2 million km2 in one S. American study area). We compare channel morphologies on large fans in the southern Sahara Desert with ridge patterns in Sinus Meridiani (fig 1). Stream channels are the dominant landform on large terrestrial fans: they may equate to the ubiquitous, sinuous, elongated ridges of the RFU that cover areas region wide. Networks of convergent/divergent and crossing channels may equate to similar features in the ridge networks. Downslope divergence is absent in channels of terrestrial upland erosional landscapes (fig. 1, left), whereas it is common to both large fans (fig. 1, center) and RFU ridge patterns (fig 1, right downslope defined as the regional NW slope of Sinus Meridiani). RFU ridge orientation, judged from those areas apparently devoid of impact crater control, is broadly parallel with the regional slope (arrow, fig. 1, right), as is mean orientation of major channels on large fans (arrow, fig. 1, center). High densities per unit area characterize fan channels and martian ridges reaching an order of magnitude higher than those in uplands just upstream of the terrestrial study areas fig. 1. In concert with

Fast Neutron Transport in the Biological Shielding Model and Other Regions of the VVER-1000 Mock-Up on the LR-0 Research Reactor

Directory of Open Access Journals (Sweden)

Košťál Michal

2016-01-01

Full Text Available A set of benchmark experiments was carried out in the full scale VVER-1000 mock-up on the reactor LR-0 in order to validate neutron transport calculation methodologies and to perform the optimization of the shape and locations of neutron flux operation monitors channels inside the shielding of the new VVER-1000 type reactors. Compared with previous experiments on the VVER-1000 mock-up on the reactor LR-0, the fast neutron spectra were measured in the extended neutron energy interval (0.1–10 MeV and new calculations were carried out with the MCNPX code using various nuclear data libraries (ENDF/B VII.0, JEFF 3.1, JENDL 3.3, JENDL 4, ROSFOND 2009, and CENDL 3.1. Measurements and calculations were carried out at different points in the mock-up. The calculation and experimental data are compared.

Geophysical Investigation of Upper Mantle Anomalies of the Australian-Antarctic Ridge

Science.gov (United States)

Park, S. H.; Choi, H.; Kim, S. S.; Lin, J.

2017-12-01

Australian-Antarctic Ridge (AAR) is situated between the Pacific-Antarctic Ridge (PAR) and Southeast Indian Ridge (SEIR), extending eastward from the Australian-Antarctic Discordance (AAD). Much of the AAR has been remained uncharted until 2011 because of its remoteness and harsh weather conditions. Since 2011, four multidisciplinary expeditions initiated by the Korea Polar Research Institute (KOPRI) have surveyed the little-explored eastern ends of the AAR and investigated the tectonics, geochemistry, and hydrothermal activity of this intermediate spreading system. Recent isotope studies using the new basalt samples from the AAR have led to the new hypothesis of the Southern Ocean mantle domain (SOM), which may have originated from the super-plume activity associated with the Gondwana break-up. In this study, we characterize the geophysics of the Southern Ocean mantle using the newly acquired shipboard bathymetry and available geophysical datasets. First, we computed residual mantle Bouguer gravity anomalies (RMBA), gravity-derived crustal thickness, and residual topography along the AAR in order to obtain a geological proxy for regional variations in magma supply. The results of these analyses revealed that the southern flank of the AAR is associated with shallower seafloor, more negative RMBA, thicker crust, and/or less dense mantle in comparison to the conjugate northern flank. Furthermore, this north-south asymmetry becomes more prominent toward the central ridge segments of the AAR. Interestingly, the along-axis depths of the entire AAR are significantly shallower than the neighboring ridge systems and the global ridges of intermediate spreading rates. Such shallow depths are also correlated with regional negative geoid anomalies. Furthermore, recent mantle tomography models consistently showed that the upper mantle (< 250 km) below the AAR has low S-wave velocities, suggesting that it may be hotter than the nearby ridges. Such regional-scale anomalies of the

European temperature responses to blocking and ridge regional patterns

Science.gov (United States)

Sousa, Pedro M.; Trigo, Ricardo M.; Barriopedro, David; Soares, Pedro M. M.; Santos, João A.

2018-01-01

Blocking occurrence and its impacts on European temperature have been studied in the last decade. However, most previous studies on blocking impacts have focused on winter only, disregarding its fingerprint in summer and differences with other synoptic patterns that also trigger temperature extremes. In this work, we provide a clear distinction between high-latitude blocking and sub-tropical ridges occurring in three sectors of the Euro-Atlantic region, describing their climatology and consequent impacts on European temperature during both winter and summer. Winter blocks (ridges) are generally associated to colder (warmer) than average conditions over large regions of Europe, in some areas with anomalies larger than 5 °C, particularly for the patterns occurring in the Atlantic and Central European sectors. During summer, there is a more regional response characterized by above average temperature for both blocking and ridge patterns, especially those occurring in continental areas, although negative temperature anomalies persist in southernmost areas during blocking. An objective analysis of the different forcing mechanisms associated to each considered weather regime has been performed, quantifying the importance of the following processes in causing the temperature anomalies: horizontal advection, vertical advection and diabatic heating. While during winter advection processes tend to be more relevant to explain temperature responses, in summer radiative heating under enhanced insolation plays a crucial role for both blocking and ridges. Finally, the changes in the distributions of seasonal temperature and in the frequencies of extreme temperature indices were also examined for specific areas of Europe. Winter blocking and ridge patterns are key drivers in the occurrence of regional cold and warm extreme temperatures, respectively. In summer, they are associated with substantial changes in the frequency of extremely warm days, but with different signatures in

Work plan for the High Ranking Facilities Deactivation Project at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1996-03-01

The High Ranking Facilities Deactivation Project (HRFDP), commissioned by the US Department of Energy Nuclear Materials and Facility Stabilization Program, is to place four primary high-risk surplus facilities with 28 associated ancillary facilities at Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition as rapidly and economically as possible. The facilities will be deactivated and left in a condition suitable for an extended period of minimized surveillance and maintenance (S and M) prior to decontaminating and decommissioning (D and D). These four facilities include two reactor facilities containing spent fuel. One of these reactor facilities also contains 55 tons of sodium with approximately 34 tons containing activated sodium-22, 2.5 tons of lithium hydride, approximately 100 tons of potentially contaminated lead, and several other hazardous materials as well as bulk quantities of contaminated scrap metals. The other two facilities to be transferred include a facility with a bank of hot cells containing high levels of transferable contamination and also a facility containing significant quantities of uranyl nitrate and quantities of transferable contamination. This work plan documents the objectives, technical requirements, and detailed work plans--including preliminary schedules, milestones, and conceptual FY 1996 cost estimates--for the Oak Ridge National Laboratory (ORNL). This plan has been developed by the Environmental Restoration (ER) Program of Lockheed Martin Energy Systems (Energy Systems) for the US Department of Energy (DOE) Oak Ridge Operations Office (ORO)

Porosity development in the Copper Ridge Dolomite and Maynardville Limestone, Bear Creek Valley and Chestnut Ridge, Tennessee

International Nuclear Information System (INIS)

Goldstrand, P.M.; Menefee, L.S.; Dreier, R.B.

1995-12-01

Matrix porosity data from deep core obtained in Bear Creek Valley indicate that porosities in the Maynardville Limestone are lithology and depth dependent. Matrix porosities are greater in the Cooper Ridge Dolomite than in the Maynardville Limestone, yet there is no apparent correlation with depth. Two interrelated diagenetic processes are the major controlling factors on porosity development in the Copper Ridge Dolomite and Maynardville Limestone; dissolution of evaporate minerals and dedolomitization. Both of these diagenetic processes produce matrix porosities between 2.1 and 1.3% in the Copper Ridge Dolomite and upper part of the Maynardville Limestone (Zone 6) to depths of approximately 600 ft bgs. Mean matrix porosities in Zones 5 through 2 of the Maynardville Limestone range from 0.8 to 0.5%. A large number of cavities have been intersected during drilling activities in nearly all zones of the Maynardville Limestone in Bear Creek Valley. Therefore, any maynardville Limestone zone within approximately 200 ft of the ground surface is likely to contain cavities that allow significant and rapid flow of groundwater. Zone 6 could be an important stratigraphic unit in the Maynardville Limestone for groundwater flow and contaminant transport because of the abundance of vuggy and moldic porosities. There are large variations in the thickness and lithology in the lower part of the Maynardville (Zones 2, 3, and 4 in the Burial Grounds region). The direction and velocity of strike-parallel groundwater flow may be altered in this area within the lower Maynardville Limestone

Work plan for the High Ranking Facilities Deactivation Project at Oak Ridge National Laboratory, Oak Ridge, Tennessee

Energy Technology Data Exchange (ETDEWEB)

NONE

1996-03-01

The High Ranking Facilities Deactivation Project (HRFDP), commissioned by the US Department of Energy Nuclear Materials and Facility Stabilization Program, is to place four primary high-risk surplus facilities with 28 associated ancillary facilities at Oak Ridge National Laboratory in a safe, stable, and environmentally sound condition as rapidly and economically as possible. The facilities will be deactivated and left in a condition suitable for an extended period of minimized surveillance and maintenance (S and M) prior to decontaminating and decommissioning (D and D). These four facilities include two reactor facilities containing spent fuel. One of these reactor facilities also contains 55 tons of sodium with approximately 34 tons containing activated sodium-22, 2.5 tons of lithium hydride, approximately 100 tons of potentially contaminated lead, and several other hazardous materials as well as bulk quantities of contaminated scrap metals. The other two facilities to be transferred include a facility with a bank of hot cells containing high levels of transferable contamination and also a facility containing significant quantities of uranyl nitrate and quantities of transferable contamination. This work plan documents the objectives, technical requirements, and detailed work plans--including preliminary schedules, milestones, and conceptual FY 1996 cost estimates--for the Oak Ridge National Laboratory (ORNL). This plan has been developed by the Environmental Restoration (ER) Program of Lockheed Martin Energy Systems (Energy Systems) for the US Department of Energy (DOE) Oak Ridge Operations Office (ORO).

RCRA Facility Investigation report for Waste Area Grouping 6 at Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1991-09-01

This report presents data and information related to remedial investigation studies for Oak Ridge National Laboratory (ORNL). Information is included on a soil gas survey, surface radiological investigations of waste areas, and well installation for ground water monitoring

Data base dictionary for the Oak Ridge Reservation Hydrology and Geology Study Groundwater Data Base

Energy Technology Data Exchange (ETDEWEB)

Thompson, B.K.

1993-04-01

The Oak Ridge Reservation Hydrology and Geology Study (ORRHAGS) Groundwater Data Base has been compiled to consolidate groundwater data from the three US Department of Energy facilities located on the Oak Ridge Reservation: the Oak Ridge K-25 Site, the Oak Ridge National Laboratory, and the Oak Ridge Y-12 Plant. Each of these facilities maintains its own groundwater and well construction data bases. Data were extracted from the existing data bases, converted to a consistent format, and integrated into the ORRHAGS Groundwater Data Base structures. This data base dictionary describes the data contained in the ORRHAGS Groundwater Data Base and contains information on data base structure, conventions, contents, and use.

Buckling of an Elastic Ridge: Competition between Wrinkles and Creases

Science.gov (United States)

Lestringant, C.; Maurini, C.; Lazarus, A.; Audoly, B.

2017-04-01

We investigate the elastic buckling of a triangular prism made of a soft elastomer. A face of the prism is bonded to a stiff slab that imposes an average axial compression. We observe two possible buckling modes which are localized along the free ridge. For ridge angles ϕ below a critical value ϕ⋆≈9 0 ° , experiments reveal an extended sinusoidal mode, while for ϕ above ϕ⋆, we observe a series of creases progressively invading the lateral faces starting from the ridge. A numerical linear stability analysis is set up using the finite-element method and correctly predicts the sinusoidal mode for ϕ ≤ϕ⋆, as well as the associated critical strain ɛc(ϕ ). The experimental transition at ϕ⋆ is found to occur when this critical strain ɛc(ϕ ) attains the value ɛc(ϕ⋆)=0.44 corresponding to the threshold of the subcritical surface creasing instability. Previous analyses have focused on elastic crease patterns appearing on planar surfaces, where the role of scale invariance has been emphasized; our analysis of the elastic ridge provides a different perspective, and reveals that scale invariance is not a sufficient condition for localization.

The mechanical design and fabrication of a ridge-loaded waveguide for an RFQ

International Nuclear Information System (INIS)

Valdiviez, R.; Roybal, P.; Clark, B.; Martinez, F.; Casillas, D.; Gonzales, G.; Tafoya, J.

1998-01-01

A Radio Frequency Quadrupole (RFQ) accelerator with an RF power input of 2 MW and an H + beam output current of 100 mAmps at 6.7 MeV, continuous duty factor utilizes twelve nearly identical ridge-loaded waveguides. The ridge-loaded, vacuum waveguides couple the RF power to the RFQ accelerating cavity. The mechanical design and fabrication of the ridge-loaded waveguides are the topics of this paper

The effect of high leverage points on the logistic ridge regression estimator having multicollinearity

Science.gov (United States)

Ariffin, Syaiba Balqish; Midi, Habshah

2014-06-01

This article is concerned with the performance of logistic ridge regression estimation technique in the presence of multicollinearity and high leverage points. In logistic regression, multicollinearity exists among predictors and in the information matrix. The maximum likelihood estimator suffers a huge setback in the presence of multicollinearity which cause regression estimates to have unduly large standard errors. To remedy this problem, a logistic ridge regression estimator is put forward. It is evident that the logistic ridge regression estimator outperforms the maximum likelihood approach for handling multicollinearity. The effect of high leverage points are then investigated on the performance of the logistic ridge regression estimator through real data set and simulation study. The findings signify that logistic ridge regression estimator fails to provide better parameter estimates in the presence of both high leverage points and multicollinearity.

Temperature profile and water depth data collected from USS MERRILL using BT and XBT casts in the Indian Ocean and other seas from 17 May 1988 to 01 June 1988 (NODC Accession 8800181)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Temperature profile and water depth data were collected using BT and XBT casts from the USS MERRILL in Arabian Sea, Indian Ocean, Gulf of Oman, Laccadive Sea, and...

On two new species of Siriella (Mysidacea)

Digital Repository Service at National Institute of Oceanography (India)

Panampunnayil, S.U.

Descriptions of two new mysids, Siriella africana ap. nov. collected from Agulhas Bank and S. intermedia sp. nov. collected from Laccadives are given. The present paper contains observations on two species of mysidacea collected from the Indian...

On the mean squared error of the ridge estimator of the covariance and precision matrix

NARCIS (Netherlands)

van Wieringen, Wessel N.

2017-01-01

For a suitably chosen ridge penalty parameter, the ridge regression estimator uniformly dominates the maximum likelihood regression estimator in terms of the mean squared error. Analogous results for the ridge maximum likelihood estimators of covariance and precision matrix are presented.

Decadal prediction skill in the ocean with surface nudging in the IPSL-CM5A-LR climate model

OpenAIRE

Mignot , Juliette; García-Serrano , Javier; Swingedouw , Didier; Germe , Agathe; Nguyen , Sébastien; Ortega , Pablo; Guilyardi , Éric; Ray , Sulagna

2016-01-01

International audience; Two decadal prediction ensembles, based on the same climate model (IPSL-CM5A-LR) and the same surface nudging initialization strategy are analyzed and compared with a focus on upper-ocean variables in different regions of the globe. One ensemble consists of 3-member hindcasts launched every year since 1961 while the other ensemble benefits from 9 members but with start dates only every 5 years. Analysis includes anomaly correlation coefficients and root mean square err...

Is there a sex difference in palm print ridge density?

Science.gov (United States)

Kanchan, Tanuj; Krishan, Kewal; Aparna, K R; Shyamsundar, S

2013-01-01

Analysis of fingerprints and palm prints at the crime scene is vital to identify the suspect and establish a crime. Dermatoglyphics can even be valuable in identification of a dismembered hand during medicolegal investigations to establish the identity of an individual in cases of mass disasters/mass homicides. The present research studies the variation in ridge density in different areas of the palm prints among men and women. The four prominent areas were analysed on the palm prints that included central prominent part of the thenar eminence (P1), hypothenar region; inner to the proximal axial triradius (P2), medial mount; proximal to the triradius of the second digit (P3) and lateral mount; proximal to the triradius of the fifth digit (P4). The mean palm print ridge density was significantly higher among women than men in all the designated areas in both hands except for the P3 area in the right hand. Statistically significant differences were observed in the palm print ridge density between the different palm areas in men and women in right and left hands. No significant right-left differences were observed in the palm print ridge density in any of the four areas of palm prints among men. In women, right-left differences were observed only in the P3 and P4 areas of palm prints. This preliminary study indicates that though the palm print ridge density is a sexually dimorphic variable, its utility for estimation of sex in forensic identification may be limited owing to significant overlapping of values.

Absolute migration of Pacific basin mid-ocean ridges since 85 Ma ...

African Journals Online (AJOL)

Mid-ocean ridges are major physiographic features that dominate the world seafloor. Their absolute motion and tectonics are recorded in magnetic lineations they created. The absolute migration of mid-ocean ridges in the Pacific basin since 85 Ma and their tectonic implications was investigated in this work and the results ...

UV laser-assisted fabrication of ridge waveguides in lithium niobate crystals

OpenAIRE

Sones, C.L.; Ying, C.Y.J.; Eason, R.W.; Mailis, S.; Ganguly, P.; Soergel, E.

2010-01-01

We present a UV laser-assisted method for the fabrication of ridge waveguides in lithium niobate. The UV laser irradiation step provides the refractive index change required for the vertical light confinement in the waveguide and also defines the ferroelectric domain pattern which produces the ridge structures after chemical etching.

Alveolar ridge rehabilitation to increase full denture retention and stability

OpenAIRE

Mefina Kuntjoro; Rostiny Rostiny; Wahjuni Widajati

2010-01-01

Background: Atrophic mandibular alveolar ridge generally complicates prostetic restoration expecially full denture. Low residual alveolar ridge and basal seat can cause unstable denture, permanent ulcer, pain, neuralgia, and mastication difficulty. Pre-proshetic surgery is needed to improve denture retention and stability. Augmentation is a major surgery to increase vertical height of the atrophic mandible while vestibuloplasty is aimed to increase the denture bearing area. Purpose: The augme...

System for the chemical professing and evaluation gives the residual thickness the gives detecting for gives appearances LR115 type 2

International Nuclear Information System (INIS)

Carrazana Gonzalez, J.A.; Tomas Zerquera, J.; Prendes Alonso, M.

1998-01-01

In this work the system is described built in the CPHR for the homogeneous chemical processing gives detecting gives nuclear appearances. A new developed method is exposed, based on the application gives the technique optical densitometry, for the precise estimate gives the residual thickness, gives detecting, gives nuclear appearances LR115 type 2 after the process gives chemical engraving

Oak Ridge Geochemical Reconnaissance Program

International Nuclear Information System (INIS)

Arendt, J.W.

1977-03-01

The Oak Ridge reconnaissance program is responsible for the geochemical survey in a 12-state area covering Texas, Oklahoma, Kansas, Nebraska, South Dakota, North Dakota, Minnesota, Wisconsin, Michigan, Iowa, Indiana, and Illinois as part of the National Uranium Resource Evaluation Program. The program concept is outlined and the planning and organization of the program is discussed

DEVELOPMENT OF A RIDGE PROFILE WEEDER

African Journals Online (AJOL)

ES Obe

1980-03-01

driven rotating horizontal short shaft which is connected by universal joints to two gangs of rotary hoe weeders. With the short shaft nearly at the bottom of a furrow between two ridges, the gangs of weeders lie on the sides of ...

Origin of the Louisville Ridge and its relationship to the Eltanin Fracture Zone System

Science.gov (United States)

Watts, A. B.; Weissel, J. K.; Duncan, R. A.; Larson, R. L.

1988-04-01

We have combined shipboard and Seasat altimeter derived data in an intergrated geological and geophysical study of the Louisville Ridge; a 3500-km-long seamount chain extending from the Tonga trench to the Eltanin Fracture Zone. A break in the smooth trend of the ridge at latitude 37.5°S has been recognized in both bathymetric and altimetric data. The 40Ar-39Ar dating of rocks dredged either side of the break suggest that it is analogous to the bend in the Hawaiian-Emperor seamount chain. Although the general trend of the ridge can be fit by small circles about Pacific absolute motion poles determined from other seamount chains, the new bathymetric and age data allow us to refine Pacific absolute motion poles. The continuity in smooth trend of the ridge and the Eltanin Fracture Zone suggests some relationship between them. However, a major offset developed on this transform between 60 and 80 Ma, prior to the oldest dated rocks from the ridge. Although magmatism was more or less continuous on the ridge during 28-60 Ma, it probably occurred on crust with little or no offset. Thus magmatism appears to have been little influenced by the developing fracture zone. By 28 Ma, the distance between the magmatic source and the fracture zone had decreased sufficiently for a portion of the ridge to have been emplaced on crust with an offset. After about 12 Ma, however, volcanic activity on the Louisville Ridge apparently waned, despite a possible influence on the magmatism of the fracture zone.

Inactive tanks remediation program strategy and plans for Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1997-11-01

This report presents plans and strategies for remediation of the liquid low-level waste (LLLW) tanks that have been removed from service (also known as inactive tanks) at Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. These plans and strategies will be carried out by the Environmental Restoration Program's Inactive LLLW Tank Program at ORNL. The approach to remediation of each tank or tank farm must be adapted in response to the specific circumstances of individual tank sites. The approach will be tailored to accommodate feedback on lessons learned from previous tank remediation activities and will not be a rigid step-by-step approach that must be conducted identically for every tank system. However, the approach will follow a multistep decision process. The overall objective of the Inactive Tank Program is to remediate all LLLW tanks that have been removed from service to the extent practicable in accordance with the FFA requirements. The Inactive Tank Program will focus on the remediation of the tank residues and tank shell. This strategy is discussed in detail in this report

Geophysical studies of aseismic ridges in northern Indian Ocean-crustal structure and isostatic models

Digital Repository Service at National Institute of Oceanography (India)

Sreejith, K.M.

. The important conclusions derived from this study are as follows. 1. The Comorin Ridge extends for about 500 km in NNW-SSE direction in north central Indian Ocean, close to the southern tip of India and western continental margin of Sri Lanka. The ridge... topography has variable reliefs along its strike and uneven gradients on both sides of the ridge flanks. The southern part of the ridge (between 1.5°N and 3°N) has an elevation of up to 0.5 km from the adjacent seafloor of about 4 km deep; in the central...

Bathymetry and oceanic flow structure at two deep passages crossing the Lomonosov Ridge

Science.gov (United States)

Björk, Göran; Jakobsson, Martin; Assmann, Karen; Andersson, Leif G.; Nilsson, Johan; Stranne, Christian; Mayer, Larry

2018-01-01

The Lomonosov Ridge represents a major topographical feature in the Arctic Ocean which has a large effect on the water circulation and the distribution of water properties. This study presents detailed bathymetric survey data along with hydrographic data at two deep passages across the ridge: a southern passage (80-81° N), where the ridge crest meets the Siberian continental slope, and a northern passage around 84.5° N. The southern channel is characterized by smooth and flat bathymetry around 1600-1700 m with a sill depth slightly shallower than 1700 m. A hydrographic section across the channel reveals an eastward flow with Amundsen Basin properties in the southern part and a westward flow of Makarov Basin properties in the northern part. The northern passage includes an approximately 72 km long and 33 km wide trough which forms an intra-basin in the Lomonosov Ridge morphology (the Oden Trough). The eastern side of the Oden Trough is enclosed by a narrow and steep ridge rising 500-600 m above a generally 1600 m deep trough bottom. The deepest passage (the sill) is 1470 m deep and located on this ridge. Hydrographic data show irregular temperature and salinity profiles indicating that water exchange occurs as midwater intrusions bringing water properties from each side of the ridge in well-defined but irregular layers. There is also morphological evidence that some rather energetic flows may occur in the vicinity of the sill. A well expressed deepening near the sill may be the result of seabed erosion by bottom currents.

Distribution of planktonic foraminifera in waters of the submarine coral banks in southeast Arabian Sea during winter

Digital Repository Service at National Institute of Oceanography (India)

Rao, K.K.; Jayalakshmy, K.V.; Balasubramanian, T.

Twentyfive species of planktonic foraminifera are recorded from 36 plankton tows collected from waters of the submerged coral banks- Bassas de Pedro, Sesostris and Cora Divh-located at northern end of the Laccadive group of islands in southeastern...

Integration of Environmental Restoration and Waste Management Activities for a More Cost-Effective Tank Remediation Program Oak Ridge National Laboratory, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

Brill, A.; Clark, R.; Stewart, R.

1998-01-01

This paper presents plans and strategies for remediation of the liquid low-level radioactive waste (LLLW) tanks that have been removed from service (also known as inactive tanks) at Oak Ridge National Laboratory (ORNL), Oak Ridge, Tennessee. Much of the LLLW system at ORNL was installed more than 50 years ago. The overall objective of the Inactive Tank Program is to remediate all LLLW tanks that have been removed from service to the extent practicable in accordance with the regulatory requirements

Dynamics of Protein Phosphatase Gene Expression in Corbicula fluminea Exposed to Microcystin-LR and to Toxic Microcystis aeruginosa Cells

Directory of Open Access Journals (Sweden)

Vitor Vasconcelos

2011-12-01

Full Text Available This study investigated the in vivo effects of microcystins on gene expression of several phosphoprotein phosphatases (PPP in the freshwater clam Corbicula fluminea with two different exposure scenarios. Clams were exposed for 96 h to 5 µg L−1 of dissolved microcystin-LR and the relative changes of gene expression of three different types of PPP (PPP1, 2 and 4 were analyzed by quantitative real-time PCR. The results showed a significant induction of PPP2 gene expression in the visceral mass. In contrast, the cyanotoxin did not cause any significant changes on PPP1 and PPP4 gene expression. Based on these results, we studied alterations in transcriptional patterns in parallel with enzymatic activity of C. fluminea for PPP2, induced by a Microcystis aeruginosa toxic strain (1 × 105 cells cm−3 during 96 h. The relative changes of gene expression and enzyme activity in visceral mass were analyzed by quantitative real-time PCR and colorimetric assays respectively. The clams exhibited a significant reduction of PPP2 activity with a concomitant enhancement of gene expression. Considering all the results we can conclude that the exposure to an ecologically relevant concentration of pure or intracellular microcystins (-LR promoted an in vivo effect on PPP2 gene expression in C. fluminea.

Deep-sea exploration of the Central Indian Ridge at 19 degrees S

Digital Repository Service at National Institute of Oceanography (India)

Dyment, J.; Hemond, C.; Asada, M.; Bassoullet, C.; Benoit, M.; Briais, A.; Chaubey, A.K.; Horen, H.; Huot, F.; Kitazawa, M.; Le Gall, B.; Leven, J.H.; Maia, M.; Oldra, J.-P.; Ravilly, M.; Sondroon, V.

stream_size 4 stream_content_type text/plain stream_name InterRidge_News_9_29.pdf.txt stream_source_info InterRidge_News_9_29.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...

The RxLR effector Avh241 from Phytophthora sojae requires plasma membrane localization to induce plant cell death.

Science.gov (United States)

Yu, Xiaoli; Tang, Junli; Wang, Qunqing; Ye, Wenwu; Tao, Kai; Duan, Shuyi; Lu, Chenchen; Yang, Xinyu; Dong, Suomeng; Zheng, Xiaobo; Wang, Yuanchao

2012-10-01

• The Phytophthora sojae genome encodes hundreds of RxLR effectors predicted to manipulate various plant defense responses, but the molecular mechanisms involved are largely unknown. Here we have characterized in detail the P. sojae RxLR effector Avh241. • To determine the function and localization of Avh241, we transiently expressed it on different plants. Silencing of Avh241 in P. sojae, we determined its virulence during infection. Through the assay of promoting infection by Phytophthora capsici to Nicotiana benthamiana, we further confirmed this virulence role. • Avh241 induced cell death in several different plants and localized to the plant plasma membrane. An N-terminal motif within Avh241 was important for membrane localization and cell death-inducing activity. Two mitogen-activated protein kinases, NbMEK2 and NbWIPK, were required for the cell death triggered by Avh241 in N. benthamiana. Avh241 was important for the pathogen's full virulence on soybean. Avh241 could also promote infection by P. capsici and the membrane localization motif was not required to promote infection. • This work suggests that Avh241 interacts with the plant immune system via at least two different mechanisms, one recognized by plants dependent on subcellular localization and one promoting infection independent on membrane localization. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

Growth of Gypsophila paniculata According to the Pruning Time and Ridge Position in Sub-alpine Area

International Nuclear Information System (INIS)

Cheong, D.C.; Lim, H.C.; Song, Y.J.; Park, H.B.

2008-01-01

This study was carried out to investigate the growth of Gypsophila paniculata affected by pruning time (July 10, July 18, and July 25) and ridge position (middle or window side) under south-north oriented plastic house in sub-alpine area. The average night temperature was similar between the two ridges, but the average day temperature and soil temperature were higher at the middle ridge; particularly, there was distinct difference after late October. Also the accumulative solar radiation was higher at the middle ridge than the window side ridge owing to the shading by neighboring plastic house and the structure of plastic house. The root activity, photosynthetic rate and transpiration rate of plants surveyed in late October were inclined to be more increased at the middle than the window side ridge. The flowering traits at the pruning time of July 10 and July 18 were similar between the two ridges, but the flower malformation rate was higher at the middle ridge. On the other hand, in case of the pruning time of July 25, the blooming was advanced by 13 days, and the flowering traits such as flower stalk length and branch number were better; also, the flower malformation and rosette formation rate decreased at the middle ridge, because of its higher air and soil temperature and the accumulative solar radiation

The comparison between several robust ridge regression estimators in the presence of multicollinearity and multiple outliers

Science.gov (United States)

Zahari, Siti Meriam; Ramli, Norazan Mohamed; Moktar, Balkiah; Zainol, Mohammad Said

2014-09-01

In the presence of multicollinearity and multiple outliers, statistical inference of linear regression model using ordinary least squares (OLS) estimators would be severely affected and produces misleading results. To overcome this, many approaches have been investigated. These include robust methods which were reported to be less sensitive to the presence of outliers. In addition, ridge regression technique was employed to tackle multicollinearity problem. In order to mitigate both problems, a combination of ridge regression and robust methods was discussed in this study. The superiority of this approach was examined when simultaneous presence of multicollinearity and multiple outliers occurred in multiple linear regression. This study aimed to look at the performance of several well-known robust estimators; M, MM, RIDGE and robust ridge regression estimators, namely Weighted Ridge M-estimator (WRM), Weighted Ridge MM (WRMM), Ridge MM (RMM), in such a situation. Results of the study showed that in the presence of simultaneous multicollinearity and multiple outliers (in both x and y-direction), the RMM and RIDGE are more or less similar in terms of superiority over the other estimators, regardless of the number of observation, level of collinearity and percentage of outliers used. However, when outliers occurred in only single direction (y-direction), the WRMM estimator is the most superior among the robust ridge regression estimators, by producing the least variance. In conclusion, the robust ridge regression is the best alternative as compared to robust and conventional least squares estimators when dealing with simultaneous presence of multicollinearity and outliers.

Geophysical survey of the Eggvin Bank and Logi Ridge - Greenland Sea

Science.gov (United States)

Breivik, A. J.; Mjelde, R.; Rai, A. K.; Frassetto, A.

2012-12-01

The northern Greenland Sea has a number of features associated with excess volcanism. These include the Jan Mayen island, the Jan Mayen Plateau north of, and the Eggvin Bank west of Jan Mayen, and the Vesteris Seamount far to the north. In the summer of 2011, we colleced an Ocean Bottom Seismometer (OBS) profile across the Eggvin Bank, returning four good data sets. We also collected single-channel reflection seismic (SCS) data along the OBS line. The profile crosses the transform part of the West Jan Mayen Fracture Zone (WJMFZ), which connects seafloor spreading between the Kolbeinsey and Mohn ridges. Between the WJMFZ and the Vesteris Seamount there is a narrow ridge 170-180 km long, ending in a few seamounts in the east. It disturbs the magnetic seafloor anomalies, and has no conjugate on the Norwegian margin. It thus appears to be younger than the Eocene seafloor it lies on. Trend and position points to Traill Ø in East Greenland, which had magmatism at ~36 Ma. We name it the Logi Ridge after Norse mythology, where Logi is the master of fire, brother of Aegir, master of the sea. We have collected five SCS profiles across this ridge in order to study the surrounding sedimentation pattern. We also collected gravity and magnetic data along all profiles. Initial results show two flat-topped seamounts on the Eggvin Bank, and a flat-topped Logi Ridge, indicating that these have been at sealevel. The sedimentary strata show recent vertical movement north of the WJMFZ near the Jan Mayen Plateau, and compression around the Logi Ridge. Sailing line of R/V Håkon Mosby of Bergen. Survey lines are in bold, and OBS positions are marked by circles.

Displacement-length ratios and contractional strains of lunar wrinkle ridges in Mare Serenitatis and Mare Tranquillitatis

Science.gov (United States)

Li, Bo; Ling, Zongcheng; Zhang, Jiang; Chen, Jian; Ni, Yuheng; Liu, Chunli

2018-04-01

Wrinkle ridges are complex thrust faults commonly found in lunar mare basalts and caused by compressional stresses from both local basin and global Moon. In this paper, we select 59 single wrinkle ridges in Mare Serenitatis and 39 single wrinkle ridges in Mare Tranquillitatis according to WAC mosaic image. For each wrinkle ridge, several topographic profiles near its midpoint are generated to measure its height and maximum displacement (Dmax) through LOLA DEM data. Then we make 2D plots of displacement-length (L) for ridge population in the two maria. The Dmax-L ratios (γ) are derived by a linear fit method according to the D-L data. The γ value (2.13 × 10-2) of ridges in Mare Tranquillitatis is higher than the γ value (1.73 × 10-2) of ridges in Mare Serenitatis. In the last, the contractional strains (ε) in Mare Serenitatis and Mare Tranquillitatis are estimated to be ∼0.36% and 0.14% (assuming the fault plane dip θ is 25°). The values of the free-air gravity anomalies in Mare Serenitatis range from 78 to 358 mGal higher than those of the gravity anomalies in Mare Tranquillitatis which range from -70 to 120 mGal. The average thickness of basalts in Mare Tranquillitatis is 400 m, while that of basalts in Mare Serenitatis is 798 m. Moreover, the average age for ridge group in Mare Serenitatis is bigger than the wrinkle ridge's age in Mare Tranquillitatis. The formation of ridge group in Mare Serenitatis takes longer time than that in Mare Serenitatis. Therefore, we think the higher value of gravity anomalies, thicker basaltic units and longer formation time for wrinkle ridge in Mare Serenitatis maybe result in the higher value of contractional strain, although the formation of Tranquillitatis basin is earlier than that of Serenitatis basin.

On asymptotic behavior of anisotropic branes with induced gravity inspired by L(R) term

International Nuclear Information System (INIS)

Heydari-Fard, Malihe

2010-01-01

The DGP brane-world scenario provides the accelerated expansion of the universe at late-time by large-distance modification of general relativity without any need for dark energy. Using the method in reference [33], we investigate the asymptotic behavior of homogeneous and anisotropic cosmologies on a generalization of DGP scenario where the effective theory of gravity induced on the brane is given by a L(R) term. We show that for a constant induced curvature term on the brane all Bianchi models except type IX isotropize, like general relativity, if the effective energy density and E ab term satisfy some energy conditions. Finally, we compare the result of the model with the result of anisotropic DGP branes and general relativity

Efficiency of local surface plasmon polariton excitation on ridges

DEFF Research Database (Denmark)

Radko, I.P.; Bozhevolnyi, S.I.; Brucoli, G.

2008-01-01

The issue of efficient local coupling of light into surface plasmon polariton (SPP) modes is an important concern in miniaturization of plasmonic components. Here we present experimental and numerical investigations of efficiency of local SPP excitation on gold ridges of rectangular profile...... positioned on a gold film. The excitation is accomplished by illuminating the metal surface normally with a focused laser beam. Wavelength dependence and dependence of the efficiency on geometrical parameters of ridges are examined. Using leakage radiation microscopy, the efficiency of ˜20% is demonstrated...

Architectural/historical assessment of the Oak Ridge National Laboratory, Oak Ridge Reservation, Anderson and Roane Counties, Tennessee

Energy Technology Data Exchange (ETDEWEB)

Carver, M.; Slater, M.

The Department of Energy (DOE) is required by the National Historic Preservation Act (NHPA) of 1966, as amended, to identify any properties under its jurisdiction that are included in or eligible for inclusion in the National Register of Historic Places (National Register). In March 1993 Duvall & Associates, Inc., was engaged to survey the Oak Ridge National Laboratory (ORNL), a DOE facility located on the Oak Ridge Reservation (ORR) in Anderson and Roane Counties, Tennessee, and to prepare a determination of National Register eligibility for all ORNL properties. The purpose of this report is to summarize the results of research into the historical context of ORNL and at to identify historic properties at ORNL that are included in present or eligible for inclusion in the National Register. The identification of archaeological properties at ORNL that are included and eligible for inclusion in the National Register Clinton is addressed in a separate report.

Small scale morphodynamics of shoreface-connected ridges and their impact on benthic macrofauna

Science.gov (United States)

Markert, Edith; Kröncke, Ingrid; Kubicki, Adam

2015-05-01

The first interdisciplinary analysis (biological and sedimentological) of macrofauna communities influenced by long-term morphodynamics of shoreface-connected ridges in the German Bight on a small scale is presented in this study. The study area covering 4 km2 was located off the island of Spiekeroog, in an area known as a Tellina fabula community. Sediment samples taken at 27 sample sites were coupled with side-scan sonar data to draw a precise sediment map of the area, as well as with high-resolution multi-beam bathymetry data to understand the morphodynamic changes of the seabed between 2003 and 2010. The macrofauna data acquired at the same 27 sites were analysed for community structure using non-metric multidimensional scaling, the ANOSIM and PERMANOVA tests. Correlations between biological and environmental variables were examined with the BIOENV procedure. The study revealed a shore-parallel sediment zonation with clear and sharp borders induced by local morphodynamics, which together with specific local bathymetry affected the formation of three different macrofauna affinity groups. One group was located on the shoreface and in the troughs (dominant species: Scoloplos armiger, Lanice conchilega, Notomastus latericeus), one on the landward flanks of the ridges (dominant species: Aonides paucibranchiata, Goniadella bobretzkii), and one on the ridge crests (dominant species: Ophelia spp. juv., Spio goniocephala). The spatial distribution of the affinity groups, their taxa number and abundance of species was dependent on a surface sediment pattern resulting from local hydrodynamics, which in turn is known to influence the food availability. A seaward steepening of ridges took place and was an effect of erosion up to 0.34 m on landward flanks in and accumulation up to 0.29 m on seaward flanks in seven years. The studied shoreface-connected ridges migrated seawards with a pace of 5 m/year for the large ridge and 20 m/year for the small ridge. Elongated mud

Oak Ridge Dose Reconstruction Project Summary Report; Reports of the Oak Ridge Dose Reconstruction, Vol. 7

Energy Technology Data Exchange (ETDEWEB)

Thomas E. Widner; et. al.

1999-07-01

In the early 1990s, concern about the Oak Ridge Reservation's past releases of contaminants to the environment prompted Tennessee's public health officials to pursue an in-depth study of potential off-site health effects at Oak Ridge. This study, the Oak Ridge dose reconstruction, was supported by an agreement between the U.S. Department of Energy (DOE) and the State of Tennessee, and was overseen by a 12-member panel of individuals appointed by Tennessee's Commissioner of Health. The panel requested that the principal investigator for the project prepare the following report, ''Oak Ridge Dose Reconstruction Project Summary Report,'' to serve the following purposes: (1) summarize in a single, less technical report, the methods and results of the various investigations that comprised the Phase II of the dose reconstruction; (2) describe the systematic searching of classified and unclassified historical records that was a vital component of the project; and (3) summarize the less detailed, screening-level assessments that were performed to evaluate the potential health significance of a number of materials, such a uranium, whose priority did not require a complete dose reconstruction effort. This report describes each major step of the dose reconstruction study: (1) the review of thousands of historical records to obtain information relating to past operations at each facility; (2) estimation of the quantity and timing of releases of radioiodines from X-10, of mercury from Y-12, of PCB's from all facilities, and of cesium-137 and other radionuclides from White Oak Creek; (3) evaluation of the routes taken by these contaminants through the environment to nearby populations; and (4) estimation of doses and health risks to exposed groups. Calculations found the highest excess cancer risks for a female born in 1952 who drank goat milk; the highest non-cancer health risk was for children in a farm family exposed to PCBs in and near

Phase 2 Sampling Plan for Chestnut Ridge Operable Unit 2 (Filled Coal Ash Pond/Upper McCoy Branch) at the Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

International Nuclear Information System (INIS)

1993-01-01

CDM Federal Programs Corporation (CDM Federal) was contracted by Energy Systems to prepare a Phase II Sampling Plan to describe the field investigation work necessary to address regulatory agency review comments on the Remedial Investigation of the Filled Coal Ash Pond (FCAP)/Upper McCoy Branch, Chestnut Ridge Operable Unit 2 at the Y-12 Plant, conducted by CH2M Hill in 1990. The scope and approach of the field investigation described in this plan specifically focus on deficiencies noted by the regulators in discussions at the comment resolution meeting of May 8, 1992, in Oak Ridge, Tennessee. This Phase II Sampling Plan includes a field sampling plan, a field and laboratory quality assurance project plan, a health and safety plan, a waste management plan, and appendixes providing an update to the applicable or relevant and appropriate requirements for this site and field and laboratory testing methods and procedures

Autopsy on a dead spreading center: The Phoenix Ridge, Drake Passage, Antarctica

Science.gov (United States)

Livermore, Roy; Balanyá, Juan Carlos; Maldonado, Andrés; Martínez, José Miguel; Rodríguez-Fernández, José; Sanz de Galdeano, Carlos; Galindo Zaldívar, Jesús; Jabaloy, Antonio; Barnolas, Antonio; Somoza, Luis; Hernández-Molina, Javier; Suriñach, Emma; Viseras, César

2000-07-01

New bathymetric and magnetic anomaly data from the Phoenix Ridge, Antarctica, show that extinction of all three remaining segments occurred at the time of magnetic chron C2A (3.3 ± 0.2 Ma), synchronous with a ridge-trench collision south of the Hero Fracture Zone. This implies that the ultimate cause of extinction was a change in plate boundary forces occasioned by this collision. Spreading rates slowed abruptly at the time of chron C4 (7.8 ± 0.3 Ma), probably as a result of extinction of the West Scotia Ridge, which would have led to an increase in slip rate and transpressional stress across the Shackleton Fracture Zone. Spectacular, high-relief ridges flanking the extinct spreading center, mapped for the first time using multibeam swath bathymetry, are interpreted as a consequence of a reduction in spreading rate, involving a temporary magma oversupply immediately prior to extinction.

Phononic Crystal Made of Multilayered Ridges on a Substrate for Rayleigh Waves Manipulation

Directory of Open Access Journals (Sweden)

Mourad Oudich

2017-12-01

Full Text Available We present a phononic crystal to achieve efficient manipulation of surface acoustic waves (SAW. The structure is made of finite phononic micro-ridges arranged periodically in a substrate surface. Each ridge is constructed by staking silicon and tungsten layers so that it behaves as one-dimensional phononic crystal which exhibits band gaps for elastic waves. The band gap allows the existence of resonance modes where the elastic energy is either confined within units in the free end of the ridge or the ones in contact with the substrate. We show that SAW interaction with localized modes in the free surface of the ridge gives rise to sharp attenuation in the SAW transmission, while the modes confined within the ridge/substrate interface cause broad band attenuations of SAW. Furthermore, we demonstrate that the coupling between the two kinds of modes within the band gap gives high SAW transmission amplitude in the form of Fano-like peaks with high quality factor. The structure could provide an interesting solution for accurate SAW control for sensing applications, for instance.

Southern high latitude squat lobsters II: description of Uroptychus macquariae sp. nov. from Macquarie Ridge.

Science.gov (United States)

Schnabel, Kareen E; Burghardt, Ingo; Ahyong, Shane T

2017-11-23

Squat lobsters have only recently been recorded from the Macquarie Ridge, which extends south between New Zealand and Antarctica. Among these, Uroptychus insignis (Henderson, 1885) was recorded for the first time outside the western Indian Ocean, exhibiting only subtle morphological differences. Reexamination of the Macquarie Ridge and Indian Ocean specimens attributed to U. insignis using morphological and molecular data revealed the Macquarie Ridge form to represent a separate species. Subtle but consistent morphological differences are evident and partial CO1 sequence data indicates that the specimens collected on Macquarie Ridge differ from those collected in the Indian Ocean by more than 7%. The Macquarie Ridge species is described herein as Uroptychus macquariae n.sp. Subtle morphological differences between the new species and U. insignis are discussed.

Etched-hole formation in LR-115 cellulose nitrate detector irradiated with fast neutrons

International Nuclear Information System (INIS)

Sawamura, Teruko; Yamazaki, Hatsuo

1988-01-01

This paper deals with the neutron detection sensitivity of LR-115 cellulose nitrate by counting the etched holes of α-tracks produced by the (n,α) reactions of the constituent nuclei of the cellulose nitrate. A formula for the etched-hole formation efficiency is derived, and applied to obtain the efficiency for each of the (n,α) reactions of 14 N, 16 O and 12 C by using an experimental expression relating the track-to-bulk etch-rate ratio to the residual range of the α-particle. From the efficiencies obtained, and the reaction cross sections, the neutron detection sensitivity is evaluated against neutron energy up to 11 MeV, and compared with the experimental values in the energy region between 2.2 and 5 MeV; the agreement is fairly good in the region. (author)

Is ridge preservation/augmentation at periodontally compromised extraction sockets safe? A retrospective study.

Science.gov (United States)

Kim, Jung-Ju; Ben Amara, Heithem; Schwarz, Frank; Kim, Hae-Young; Lee, Jung-Won; Wikesjö, Ulf M E; Koo, Ki-Tae

2017-10-01

This study aimed to evaluate the safety of ridge preservation/augmentation procedures when performed at compromised extraction sockets. Patients subject to ridge preservation/augmentation at periodontally compromised sockets at Seoul National University Dental Hospital (SNUDH) were evaluated in a chart review. Tooth extractions due to acute infection were not included in our study as chronically formed lesions are the only lesions that can be detected from radiographic images. If inflammatory symptoms persisted following ridge preservation/augmentation and antimicrobial and anti-inflammatory therapy, the patient was categorized as a re-infection case and implanted biomaterial removed. Of 10,060 patients subject to tooth extractions at SNUDH, 2011 through 2015, 297 cases meeting inclusion criteria were reviewed. The severity and type of lesions were not specific because extracting data was only done by radiographic images and chart records. The review identified eight patients exhibiting inflammatory symptoms that required additional antimicrobial and anti-inflammatory therapy. Within this group, re-infection occurred in two patients requiring biomaterials removal. The final safety rate for the ridge preservation/augmentation was 99.3%. None of the demographic factors, systemic conditions or choice of biomaterial affected the safety of ridge preservation/augmentation. Alveolar ridge preservation/augmentation at periodontally compromised sockets appears safe following thorough removal of infectious source. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Oak Ridge Health Studies Phase 1 report, Volume 2: Part D, Dose Reconstruction Feasibility Study. Tasks 6, Hazard summaries for important materials at the Oak Ridge Reservation

Energy Technology Data Exchange (ETDEWEB)

Bruce, G.M.; Walker, L.B.; Widner, T.E.

1993-09-01

The purpose of Task 6 of Oak Ridge Phase I Health Studies is to provide summaries of current knowledge of toxic and hazardous properties of materials that are important for the Oak Ridge Reservation. The information gathered in the course of Task 6 investigations will support the task of focussing any future health studies efforts on those operations and emissions which have likely been most significant in terms of off-site health risk. The information gathered in Task 6 efforts will likely also be of value to individuals evaluating the feasibility of additional health,study efforts (such as epidemiological investigations) in the Oak Ridge area and as a resource for citizens seeking information on historical emissions.

The Conserved Arginine Cluster in the Insert of the Third Cytoplasmic Loop of the Long Form of the D2 Dopamine Receptor (D2L-R Acts as an Intracellular Retention Signal

Directory of Open Access Journals (Sweden)

Valentina Kubale

2016-07-01

Full Text Available This study examined whether the conserved arginine cluster present within the 29-amino acid insert of the long form of the D2 dopamine receptor (D2L-R confers its predominant intracellular localization. We hypothesized that the conserved arginine cluster (RRR located within the insert could act as an RXR-type endoplasmic reticulum (ER retention signal. Arginine residues (R within the cluster at positions 267, 268, and 269 were charge-reserved to glutamic acids (E, either individually or in clusters, thus generating single, double, and triple D2L-R mutants. Through analyses of cellular localization by confocal microscopy and enzyme-linked immunosorbent assay (ELISA, radioligand binding assay, bioluminescence resonance energy transfer (BRET2 β-arrestin 2 (βarr2 recruitment assay, and cAMP signaling, it was revealed that charge reversal of the R residues at all three positions within the motif impaired their colocalization with ER marker calnexin and led to significantly improved cell surface expression. Additionally, these data demonstrate that an R to glutamic acid (E substitution at position 2 within the RXR motif is not functionally permissible. Furthermore, all generated D2L-R mutants preserved their functional integrity regarding ligand binding, agonist-induced βarr2 recruitment and Gαi-mediated signaling. In summary, our results show that the conserved arginine cluster within the 29-amino acid insert of third cytoplasmic loop (IC3 of the D2L-R appears to be the ER retention signal.

Ridge formation induced by jets in pp collisions at 7 TeV

International Nuclear Information System (INIS)

Hwa, Rudolph C.; Yang, C. B.

2011-01-01

An interpretation of the ridge phenomenon found in pp collisions at 7 TeV is given in terms of enhancement of soft partons due to energy loss of semihard jets. A description of ridge formation in nuclear collisions can directly be extended to pp collisions since hydrodynamics is not used and azimuthal anisotropy is generated by semihard scattering. The observed ridge structure is then understood as a manifestation of soft-soft transverse correlation induced by semihard partons without long-range longitudinal correlation. Both the p T and multiplicity dependencies are well reproduced. Some predictions are made about other observables.

Localized ridge defect augmentation using human pericardium membrane and demineralized bone matrix.

Science.gov (United States)

Vidyadharan, Arun Kumar; Ravindran, Anjana

2014-01-01

Patient wanted to restore her lost teeth with implants in the lower left first molar and second premolar region. Cone beam computerized tomography (CBCT) revealed inadequate bone width and height around future implant sites. The extraction socket of second premolar area revealed inadequate socket healing with sparse bone fill after 4 months of extraction. To evaluate the clinical feasibility of using a collagen physical resorbable barrier made of human pericardium (HP) to augment localized alveolar ridge defects for the subsequent placement of dental implants. Ridge augmentation was done in the compromised area using Puros® demineralized bone matrix (DBM) Putty with chips and an HP allograft membrane. Horizontal (width) and vertical hard tissue measurements with CBCT were recorded on the day of ridge augmentation surgery, 4 month and 7 months follow-up. Intra oral periapical taken 1 year after implant installation showed minimal crestal bone loss. Bone volume achieved through guided bone regeneration was a gain of 4.8 mm horizontally (width) and 6.8 mm vertically in the deficient ridge within a period of 7 months following the procedure. The results suggested that HP Allograft membrane may be a suitable component for augmentation of localized alveolar ridge defects in conjunction with DBM with bone chips.

Effect of Flow on Cultured Cell at Micro-Pattern of Ridge Lines

Directory of Open Access Journals (Sweden)

Haruka Hino

2017-10-01

Full Text Available A flow channel with a micro-pattern of ridge lines of a scaffold has been designed to study quantitatively the effect of flow on an oriented cell in vitro. The lines of parallel micro ridges (0.001 mm height, 0.003 mm width, and 0.003 mm interval are made by the lithography technique on the lower surface of the channel as the scaffold to make orientation of each cell. Variation is made about the angle between the longitudinal direction of the ridge line and the direction of the flow: zero, 0.79 and 1.6 rad. The suspension of C2C12 (mouse myoblast cell line was injected to the channel, and incubated for two hours on the micro ridges before the flow test for four hours. The flow rate of 3/hour is controlled by a syringe pump to make variation of the wall shear stress of < 3 Pa. The action of each cell adhered on the micro pattern was analyzed at the time lapse images. The experimental results show that both the migration and the deformation of each myoblast along the micro ridge are restricted by the wall shear stress higher than 3 Pa.

Validity of the MMPI-2-RF (Restructured Form) L-r and K-r Scales in Detecting Underreporting in Clinical and Nonclinical Samples

Science.gov (United States)

Sellbom, Martin; Bagby, R. Michael

2008-01-01

In the current investigation, the authors examined the validity of the L-r and K-r scales on the recently developed Minnesota Multiphasic Personality Inventory-2-Restructured Form (MMPI-2-RF; Y. S. Ben-Porath & A. Tellegen, in press) in measuring underreported response bias. Three archival samples previously collected for examining MMPI-2…

Tubular Initial Conditions and Ridge Formation

Directory of Open Access Journals (Sweden)

M. S. Borysova

2013-01-01

Full Text Available The 2D azimuth and rapidity structure of the two-particle correlations in relativistic A+A collisions is altered significantly by the presence of sharp inhomogeneities in superdense matter formed in such processes. The causality constraints enforce one to associate the long-range longitudinal correlations observed in a narrow angular interval, the so-called (soft ridge, with peculiarities of the initial conditions of collision process. This study's objective is to analyze whether multiform initial tubular structures, undergoing the subsequent hydrodynamic evolution and gradual decoupling, can form the soft ridges. Motivated by the flux-tube scenarios, the initial energy density distribution contains the different numbers of high density tube-like boost-invariant inclusions that form a bumpy structure in the transverse plane. The influence of various structures of such initial conditions in the most central A+A events on the collective evolution of matter, resulting spectra, angular particle correlations and vn-coefficients is studied in the framework of the hydrokinetic model (HKM.

The Oak Ridge Reservation Annual Site Environmental Report Summary, 2007

Energy Technology Data Exchange (ETDEWEB)

None, None

2009-02-28

The Oak Ridge Reservation Annual Site Environmental Report is prepared and published each year to inform the public of the environmental activities that take place on the reservation and in the surrounding areas. It is written to comply with DOE Order 231.1A, Environment, Safety, and Health Reporting. This document has been prepared to present the highlights of the Oak Ridge Reservation Annual Site Environmental Report 2007 in an easy-to-read, summary format.

Dacite petrogenesis on mid-ocean ridges: Evidence for oceanic crustal melting and assimilation

Science.gov (United States)

Wanless, V.D.; Perfit, M.R.; Ridley, W.I.; Klein, E.

2010-01-01

Whereas the majority of eruptions at oceanic spreading centers produce lavas with relatively homogeneous mid-ocean ridge basalt (MORB) compositions, the formation of tholeiitic andesites and dacites at mid-ocean ridges (MORs) is a petrological enigma. Eruptions of MOR high-silica lavas are typically associated with ridge discontinuities and have produced regionally significant volumes of lava. Andesites and dacites have been observed and sampled at several locations along the global MOR system; these include propagating ridge tips at ridge-transform intersections on the Juan de Fuca Ridge and eastern Gal??pagos spreading center, and at the 9??N overlapping spreading center on the East Pacific Rise. Despite the formation of these lavas at various ridges, MOR dacites show remarkably similar major element trends and incompatible trace element enrichments, suggesting that similar processes are controlling their chemistry. Although most geochemical variability in MOR basalts is consistent with low-pressure fractional crystallization of various mantle-derived parental melts, our geochemical data for MOR dacitic glasses suggest that contamination from a seawater-altered component is important in their petrogenesis. MOR dacites are characterized by elevated U, Th, Zr, and Hf, low Nb and Ta concentrations relative to rare earth elements (REE), and Al2O3, K2O, and Cl concentrations that are higher than expected from low-pressure fractional crystallization alone. Petrological modeling of MOR dacites suggests that partial melting and assimilation are both integral to their petrogenesis. Extensive fractional crystallization of a MORB parent combined with partial melting and assimilation of amphibole-bearing altered crust produces a magma with a geochemical signature similar to a MOR dacite. This supports the hypothesis that crustal assimilation is an important process in the formation of highly evolved MOR lavas and may be significant in the generation of evolved MORB in

Interpretation of bathymetric and magnetic data from the easternmost segment of Australian-Antarctic Ridge, 156°-161°E

Science.gov (United States)

Choi, H.; Kim, S.; Park, S.

2013-12-01

From 2011 to 2013, Korea Polar Research Institute (KOPRI) conducted a series of geophysical and geochemical expeditions on the longest and easternmost segment of Australian-Antarctic Ridge, located at 61°-63°S, and 156°-161°E. This ridge segment plays an important role in constraining the tectonics of the Antarctic plate. Using IBRV ARAON, the detailed bathymetric data and eleven total magnetic profiles were collected. The studied ridge has spread NNW-SSE direction and tends to be shallower to the west and deeper to the east. The western side of the ridge (156°-157.50°E) shows a broad axial high and a plenty of seamounts as an indicative of massive volcanism. Near the center of the ridge (158°-159°E), a seamount chain is formed stretching toward the south from the ridge. Also, the symmetric seafloor fabric is clearly observed at the eastern portion (158.50°-160°E) of the seamount chain. From the topographic change along the ridge axis, the western part of the ridge appears to have a sufficient magma supply. On the contrary, the eastern side of the ridge (160°-161°E) is characterized by axial valley and relatively deeper depth. Nevertheless, the observed total magnetic field anomalies exhibit symmetric patterns across the ridge axis. Although there have not been enough magnetic survey lines, the spreading rates of the ridge are estimated as the half-spreading rate of 37.7 mm/y and 35.3 mm/y for the western portion of the ridge and 42.3 mm/y for the eastern portion. The studied ridge can be categorized as an intermediate spreading ridge, confirming previous studies based on the spreading rate of global ridge system. Here we will present the preliminary results on bathymetric changes along the ridge axis and its relationship with melt supply distribution, and detailed magnetic properties of the ridge constrained by the observed total field anomalies.

Slow spreading ridges of the Indian Ocean: An overview of marine geophysical investigations

Digital Repository Service at National Institute of Oceanography (India)

KameshRaju, K.A.; Mudholkar, A.V.; Samudrala, K.

Sparse and non-availability of high resolution geophysical data hindered the delineation of accurate morphology, structural configuration, tectonism and spreading history of Carlsberg Ridge (CR) and Central Indian Ridges (CIR) in the Indian Ocean...

Response of the everglades ridge and slough landscape to climate variability and 20th-century water management

Science.gov (United States)

Bernhardt, C.E.; Willard, D.A.

2009-01-01

The ridge and slough landscape of the Florida Everglades consists of a mosaic of linear sawgrass ridges separated by deeper-water sloughs with tree islands interspersed throughout the landscape. We used pollen assemblages from transects of sediment cores spanning sawgrass ridges, sloughs, and ridge-slough transition zones to determine the timing of ridge and slough formation and to evaluate the response of components of the ridge and slough landscape to climate variability and 20th-century water management. These pollen data indicate that sawgrass ridges and sloughs have been vegetationally distinct from one another since initiation of the Everglades wetland in mid-Holocene time. Although the position and community composition of sloughs have remained relatively stable throughout their history, modern sawgrass ridges formed on sites that originally were occupied by marshes. Ridge formation and maturation were initiated during intervals of drier climate (the Medieval Warm Period and the Little Ice Age) when the mean position of the Intertropical Convergence Zone shifted southward. During these drier intervals, marsh taxa were more common in sloughs, but they quickly receded when precipitation increased. Comparison with regional climate records suggests that slough vegetation is strongly influenced by North Atlantic Oscillation variability, even under 20th-century water management practices. ?? 2009 by the Ecological Society of America.

Department of Energy Air Emissions Annual Report Oak Ridge Reservation, Oak Ridge, Tennessee 40 Code of Federal Regulations (CFR) 61, Subpart H Calendar Year 2016

Energy Technology Data Exchange (ETDEWEB)

Martin, Richard [Oak Ridge Y-12 Plant (Y-12), Oak Ridge, TN (United States)

2017-06-30

As defined in the preamble of the final rule, the entire DOE facility on the Oak Ridge Reservation (ORR) must meet the 10 mrem/yr ED standard.1 In other words, the combined ED from all radiological air emission sources from Y-12 National Security Complex (Y-12 Complex), Oak Ridge National Laboratory (ORNL), East Tennessee Technology Park (ETTP), Oak Ridge Institute for Science and Education (ORISE) and any other DOE operation on the reservation must meet the 10 mrem/yr standard. Compliance with the standard is demonstrated through emission sampling, monitoring, calculations and radiation dose modeling in accordance with approved EPA methodologies and procedures. DOE estimates the ED to many individuals or receptor points in the vicinity of ORR, but it is the dose to the maximally exposed individual (MEI) that determines compliance with the standard.

III/V nano ridge structures for optical applications on patterned 300 mm silicon substrate

Energy Technology Data Exchange (ETDEWEB)

Kunert, B.; Guo, W.; Mols, Y.; Pantouvaki, M.; Van Campenhout, J.; Langer, R.; Barla, K. [imec, Kapeldreef 75, 3001 Heverlee (Belgium); Tian, B.; Wang, Z.; Shi, Y.; Van Thourhout, D. [Photonics Research Group, Ghent University, Technologiepark-Zwijnaarde 15, 9052 Gent (Belgium)

2016-08-29

We report on an integration approach of III/V nano ridges on patterned silicon (Si) wafers by metal organic vapor phase epitaxy (MOVPE). Trenches of different widths (≤500 nm) were processed in a silicon oxide (SiO{sub 2}) layer on top of a 300 mm (001) Si substrate. The MOVPE growth conditions were chosen in a way to guarantee an efficient defect trapping within narrow trenches and to form a box shaped ridge with increased III/V volume when growing out of the trench. Compressively strained InGaAs/GaAs multi-quantum wells with 19% indium were deposited on top of the fully relaxed GaAs ridges as an active material for optical applications. Transmission electron microcopy investigation shows that very flat quantum well (QW) interfaces were realized. A clear defect trapping inside the trenches is observed whereas the ridge material is free of threading dislocations with only a very low density of planar defects. Pronounced QW photoluminescence (PL) is detected from different ridge sizes at room temperature. The potential of these III/V nano ridges for laser integration on Si substrates is emphasized by the achieved ridge volume which could enable wave guidance and by the high crystal quality in line with the distinct PL.

BioTwist : overcoming severe distortions in ridge-based biometrics for succesful identification

NARCIS (Netherlands)

Kotzerke, J.

2016-01-01

This thesis focuses on ridge-based and highly distorted biometrics, the different chal-lenges involved in a verification of identity scenario, and how to overcome them. More specifically, we work on ridge-based biometrics in two different contexts: (i) newborn and infant biometrics and (ii) quality

Validation of the polysemen admixture on viability and acrosomal morphology of boar spermatozoa

Directory of Open Access Journals (Sweden)

Ogbuewu IP

2007-07-01

Full Text Available Semen were collected using artificial vagina (AV, from 5 large white boars aged 2-2.5 years twice a week for 16 weeks in each of the two seasons, early rainy (ER and late rainy (LR seasons, to determine the effects of multiple semen pool admixture on the viability and acrosomal morphology. The semen qualities studied were sperm motility, live sperm and sperm concentration, while the acrosomal parameters includes normal apical ridge (NAR, damaged apical ridge (DAR, missing apical ridge (MAR and loose apical ridge (LAC. There were no significant (P>0.05 seasonal effects. Three-boar semen admixture gave the highest percentage NAR, motility, live sperm concentration and least DAR and LAC, although these were not significantly (P>0.05 different from the 2-boar semen admixture. The result of this study suggests that 3-boar semen admixture is most suitable for use in artificial insemination program.

Data sharing report characterization of the surveillance and maintenance project miscellaneous process inventory waste items Oak Ridge National Laboratory, Oak Ridge, TN

Energy Technology Data Exchange (ETDEWEB)

Weaver, Phyllis C. [Oak Ridge Inst. for Science and Education (ORISE), Oak Ridge, TN (United States)

2013-12-12

The U.S. Department of Energy (DOE) Oak Ridge Office of Environmental Management (EM-OR) requested Oak Ridge Associated Universities (ORAU), working under the Oak Ridge Institute for Science and Education (ORISE) contract, to provide technical and independent waste management planning support under the American Recovery and Reinvestment Act (ARRA). Specifically, DOE EM-OR requested ORAU to plan and implement a sampling and analysis campaign to target certain items associated with URS|CH2M Oak Ridge, LLC (UCOR) surveillance and maintenance (S&M) process inventory waste. Eight populations of historical and reoccurring S&M waste at the Oak Ridge National Laboratory (ORNL) have been identified in the Waste Handling Plan for Surveillance and Maintenance Activities at the Oak Ridge National Laboratory, DOE/OR/01-2565&D2 (WHP) (DOE 2012) for evaluation and processing for final disposal. This waste was generated during processing, surveillance, and maintenance activities associated with the facilities identified in the process knowledge (PK) provided in Appendix A. A list of items for sampling and analysis were generated from a subset of materials identified in the WHP populations (POPs) 4, 5, 6, 7, and 8, plus a small number of items not explicitly addressed by the WHP. Specifically, UCOR S&M project personnel identified 62 miscellaneous waste items that would require some level of evaluation to identify the appropriate pathway for disposal. These items are highly diverse, relative to origin; composition; physical description; contamination level; data requirements; and the presumed treatment, storage, and disposal facility (TSDF). Because of this diversity, ORAU developed a structured approach to address item-specific data requirements necessary for acceptance in a presumed TSDF that includes the Environmental Management Waste Management Facility (EMWMF)—using the approved Waste Lot (WL) 108.1 profile—the Y-12 Sanitary Landfill (SLF) if appropriate; Energy

Oak Ridge Reservation Waste Management Plan

International Nuclear Information System (INIS)

Turner, J.W.

1995-02-01

This report presents the waste management plan for the Oak Ridge Reservation facilities. The primary purpose is to convey what facilities are being used to manage wastes, what forces are acting to change current waste management systems, and what plans are in store for the coming fiscal year

Oak Ridge Reservation Waste Management Plan

Energy Technology Data Exchange (ETDEWEB)

Turner, J.W. [ed.

1995-02-01

This report presents the waste management plan for the Oak Ridge Reservation facilities. The primary purpose is to convey what facilities are being used to manage wastes, what forces are acting to change current waste management systems, and what plans are in store for the coming fiscal year.

Continuing Clean-up at Oak Ridge, Portsmouth and Paducah-Successes and Near-Term Plans

Energy Technology Data Exchange (ETDEWEB)

Fritz, L. L.; Houser, S. M.; Starling, D. A.

2002-02-26

This paper describes the complexities and challenges associated with the Oak Ridge Environmental Management (EM) cleanup program and the steps that DOE and Bechtel Jacobs Company LLC (the Oak Ridge EM team) have collaboratively taken to make significant physical progress and get the job done. Maintaining significant environmental cleanup progress is a daunting challenge for the Oak Ridge EM Team. The scale and span of the Oak Ridge Operations (ORO) cleanup is immense-five major half-century-old installations in three states (three installations are complete gaseous diffusion plants), with concurrent cleanup at the fully operational Oak Ridge National Laboratory and Y-12 National Security Complex, and with regulatory oversight from three states and two United States (US) Environmental Protection Agency (EPA) Regions. Potential distractions arising from funding fluctuations and color-of-money constraints, regulatory negotiations, stakeholder issues, or any one of a number of other potential delay phenomena can not reduce the focus on safely achieving project objectives to maintain cleanup momentum.

Lost salt technique for severely resorbed alveolar ridges: An innovative approach

Directory of Open Access Journals (Sweden)

Himanshi Aggarwal

2012-01-01

Full Text Available The success of a complete denture relies on the principles of retention, stability and support. The prosthodontist skill lies in applying these principles efficiently in critical situations. Severely resorbed maxillary edentulous ridges that are narrow and constricted with increased inter ridge space provide decreased support, retention and stability. The consequent weight of the processed denture only compromises them further. This article describes a case report of an edentulous patient with resorbed ridges where a simplified technique of fabricating a hollow maxillary complete denture using lost salt technique was used for preservation of denture bearing areas. The hollowing of the denture reduces the weight of the denture, thereby enhancing stability and retention, reducing the further resorption of the jaws.

Exploring tectonomagmatic controls on mid-ocean ridge faulting and morphology with 3-D numerical models

Science.gov (United States)

Howell, S. M.; Ito, G.; Behn, M. D.; Olive, J. A. L.; Kaus, B.; Popov, A.; Mittelstaedt, E. L.; Morrow, T. A.

2016-12-01

Previous two-dimensional (2-D) modeling studies of abyssal-hill scale fault generation and evolution at mid-ocean ridges have predicted that M, the ratio of magmatic to total extension, strongly influences the total slip, spacing, and rotation of large faults, as well as the morphology of the ridge axis. Scaling relations derived from these 2-D models broadly explain the globally observed decrease in abyssal hill spacing with increasing ridge spreading rate, as well as the formation of large-offset faults close to the ends of slow-spreading ridge segments. However, these scaling relations do not explain some higher resolution observations of segment-scale variability in fault spacing along the Chile Ridge and the Mid-Atlantic Ridge, where fault spacing shows no obvious correlation with M. This discrepancy between observations and 2-D model predictions illuminates the need for three-dimensional (3-D) numerical models that incorporate the effects of along-axis variations in lithospheric structure and magmatic accretion. To this end, we use the geodynamic modeling software LaMEM to simulate 3-D tectono-magmatic interactions in a visco-elasto-plastic lithosphere under extension. We model a single ridge segment subjected to an along-axis gradient in the rate of magma injection, which is simulated by imposing a mass source in a plane of model finite volumes beneath the ridge axis. Outputs of interest include characteristic fault offset, spacing, and along-axis gradients in seafloor morphology. We also examine the effects of along-axis variations in lithospheric thickness and off-axis thickening rate. The main objectives of this study are to quantify the relative importance of the amount of magmatic extension and the local lithospheric structure at a given along-axis location, versus the importance of along-axis communication of lithospheric stresses on the 3-D fault evolution and morphology of intermediate-spreading-rate ridges.

Gondwana subduction-modified mantle domain prevents magmatic seafloor generation in the Central Indian Ridge

Science.gov (United States)

Morishita, T.; Nakamura, K.; Senda, R.; Suzuki, K.; Kumagai, H.; Sato, H.; Sato, T.; Shibuya, T.; Minoguchi, K.; Okino, K.

2013-12-01

The creation of oceanic crust at mid-ocean ridges is essential to understanding the genesis of oceanic plate and the evolution of the Earth. Detailed bathymetric measurements coupled with dense sample recovery at mid-ocean ridge revealed a wide range of variations in the ridge and seafloor morphologies, which cannot be simply explained by a spreading rate, but also by ridge geometry, mantle compositions and thermal structure (Dick et al., 2003 Nature; Cannat et al. 2006 Geology). It is now widely accepted that very limited magmatic activity with tectonic stretching generates oceanic core complex and/or smooth seafloor surface in the slow to ultraslow-spreading ridges, where serpentinized peridotite and gabbros are expected to be exposed associated with detachment faults (Cann et al., 1997 Nature; Cannat et al., 2006), although magmatism might be an essential role for the formation of oceanic core complexes (Buck et al., 2005 Nature; Tucholke et al 2008 JGR). A rising question is why magmatic activity is sometimes prevented during the oceanic plate formation. Ancient melting domain, that are too refractory to melt even in adiabatically upwelling to the shallow upper mantle, might cause the amagmatic spreading ridges (Harvey et al., 2006 EPSL, Liu et al.,2008 Nature). Its origin and effect on seafloor generations are, however, not well understood yet. We report an oceanic hill as an example of an ancient subduction-modified mantle domain, probably formed at continental margin of the Gondwanaland~Pangea supercontinent, existing beneath the Central Indian Ridge. This domain is the most likely to have prevented magmatic seafloor generation, resulting in creation of very deep oceanic valley and serpentine diaper (now the studied oceanic hill) at the present Central Indian ridge.

Bose enhancement and the ridge