C22:0- and C24:0-dihydroceramides confer mixed cytotoxicity in T-cell acute lymphoblastic leukemia cell lines.

Directory of Open Access Journals (Sweden)

Michael W Holliday

Full Text Available We previously reported that fenretinide (4-HPR was cytotoxic to acute lymphoblastic leukemia (ALL cell lines in vitro in association with increased levels of de novo synthesized dihydroceramides, the immediate precursors of ceramides. However, the cytotoxic potentials of native dihydroceramides have not been defined. Therefore, we determined the cytotoxic effects of increasing dihydroceramide levels via de novo synthesis in T-cell ALL cell lines and whether such cytotoxicity was dependent on an absolute increase in total dihydroceramide mass versus an increase of certain specific dihydroceramides. A novel method employing supplementation of individual fatty acids, sphinganine, and the dihydroceramide desaturase-1 (DES inhibitor, GT-11, was used to increase de novo dihydroceramide synthesis and absolute levels of specific dihydroceramides and ceramides. Sphingolipidomic analyses of four T-cell ALL cell lines revealed strong positive correlations between cytotoxicity and levels of C22:0-dihydroceramide (ρ = 0.74-0.81, P ≤ 0.04 and C24:0-dihydroceramide (ρ = 0.84-0.90, P ≤ 0.004, but not between total or other individual dihydroceramides, ceramides, or sphingoid bases or phosphorylated derivatives. Selective increase of C22:0- and C24:0-dihydroceramide increased level and flux of autophagy marker, LC3B-II, and increased DNA fragmentation (TUNEL assay in the absence of an increase of reactive oxygen species; pan-caspase inhibition blocked DNA fragmentation but not cell death. C22:0-fatty acid supplemented to 4-HPR treated cells further increased C22:0-dihydroceramide levels (P ≤ 0.001 and cytotoxicity (P ≤ 0.001. These data demonstrate that increases of specific dihydroceramides are cytotoxic to T-cell ALL cells by a caspase-independent, mixed cell death mechanism associated with increased autophagy and suggest that dihydroceramides may contribute to 4-HPR-induced cytotoxicity. The targeted increase of specific acyl chain dihydroceramides

77 FR 28865 - BMB Enterprises, Inc.; Notice of Application Accepted for Filing, Soliciting Motions To Intervene...

Science.gov (United States)

2012-05-16

...-kilowatt (kW) turbine generating units for a total installed capacity of 650 kW, the licensee proposes to construct a new powerhouse containing two 350-kW and two 330-kW turbine generating units for a total installed capacity of 1,360 kW. The hydraulic capacity of the project would increase from 20 to 40 cubic...

STP-ECRTS - THERMAL AND GAS ANALYSES FOR SLUDGE TRANSPORT AND STORAGE CONTAINER (STSC) STORAGE AT T PLANT

Energy Technology Data Exchange (ETDEWEB)

CROWE RD; APTHORPE R; LEE SJ; PLYS MG

2010-04-29

The Sludge Treatment Project (STP) is responsible for the disposition of sludge contained in the six engineered containers and Settler tank within the 105-K West (KW) Basin. The STP is retrieving and transferring sludge from the Settler tank into engineered container SCS-CON-230. Then, the STP will retrieve and transfer sludge from the six engineered containers in the KW Basin directly into a Sludge Transport and Storage Containers (STSC) contained in a Sludge Transport System (STS) cask. The STSC/STS cask will be transported to T Plant for interim storage of the STSC. The STS cask will be loaded with an empty STSC and returned to the KW Basin for loading of additional sludge for transportation and interim storage at T Plant. CH2MHILL Plateau Remediation Company (CHPRC) contracted with Fauske & Associates, LLC (FAI) to perform thermal and gas generation analyses for interim storage of STP sludge in the Sludge Transport and Storage Container (STSCs) at T Plant. The sludge types considered are settler sludge and sludge originating from the floor of the KW Basin and stored in containers 210 and 220, which are bounding compositions. The conditions specified by CHPRC for analysis are provided in Section 5. The FAI report (FAI/10-83, Thermal and Gas Analyses for a Sludge Transport and Storage Container (STSC) at T Plant) (refer to Attachment 1) documents the analyses. The process considered was passive, interim storage of sludge in various cells at T Plant. The FATE{trademark} code is used for the calculation. The results are shown in terms of the peak sludge temperature and hydrogen concentrations in the STSC and the T Plant cell. In particular, the concerns addressed were the thermal stability of the sludge and the potential for flammable gas mixtures. This work was performed with preliminary design information and a preliminary software configuration.

30-kW SEP Spacecraft as Secondary Payloads for Low-Cost Deep Space Science Missions

Science.gov (United States)

Brophy, John R.; Larson, Tim

2013-01-01

The Solar Array System contracts awarded by NASA's Space Technology Mission Directorate are developing solar arrays in the 30 kW to 50 kW power range (beginning of life at 1 AU) that have significantly higher specific powers (W/kg) and much smaller stowed volumes than conventional rigid-panel arrays. The successful development of these solar array technologies has the potential to enable new types of solar electric propulsion (SEP) vehicles and missions. This paper describes a 30-kW electric propulsion vehicle built into an EELV Secondary Payload Adapter (ESPA) ring. The system uses an ESPA ring as the primary structure and packages two 15-kW Megaflex solar array wings, two 14-kW Hall thrusters, a hydrazine Reaction Control Subsystem (RCS), 220 kg of xenon, 26 kg of hydrazine, and an avionics module that contains all of the rest of the spacecraft bus functions and the instrument suite. Direct-drive is used to maximize the propulsion subsystem efficiency and minimize the resulting waste heat and required radiator area. This is critical for packaging a high-power spacecraft into a very small volume. The fully-margined system dry mass would be approximately 1120 kg. This is not a small dry mass for a Discovery-class spacecraft, for example, the Dawn spacecraft dry mass was only about 750 kg. But the Dawn electric propulsion subsystem could process a maximum input power of 2.5 kW, and this spacecraft would process 28 kW, an increase of more than a factor of ten. With direct-drive the specific impulse would be limited to about 2,000 s assuming a nominal solar array output voltage of 300 V. The resulting spacecraft would have a beginning of life acceleration that is more than an order of magnitude greater than the Dawn spacecraft. Since the spacecraft would be built into an ESPA ring it could be launched as a secondary payload to a geosynchronous transfer orbit significantly reducing the launch costs for a planetary spacecraft. The SEP system would perform the escape

Design, performance, and economics of 50-kW and 500-kW vertical axis wind turbines

Science.gov (United States)

Schienbein, L. A.; Malcolm, D. J.

1983-11-01

A review of the development and performance of the DAF Indal 50-kW vertical axis Darrieus wind turbine shows that a high level of technical development and reliability has been achieved. Features of the drive train, braking and control systems are discussed and performance details are presented. Details are also presented of a 500-kW VAWT that is currently in production. A discussion of the economics of both the 50-kW and 500-kW VAWTs is included, showing the effects of charge rate, installed cost, operating cost, performance, and efficiency.

Spent fuel consolidation in the 105KW Building fuel storage basin

International Nuclear Information System (INIS)

Johnson, B.H.

1994-01-01

This study is one element of a larger engineering study effort by WHC to examine the feasibility of irradiated fuel and sludge consolidation in the KW Basin in response to TPA Milestone (target date) M-34-00-T03. The study concludes that up to 11,500 fuel storage canisters could be accommodated in the KW Basin with modifications. These modifications would include provisions for multi-tiered canister storage involving the fabrication and installation of new storage racks and installation of additional decay heat removal systems for control of basin water temperature. The ability of existing systems to control radionuclide concentrations in the basin water is examined. The study discusses requirements for spent nuclear fuel inventory given the proposed multi-tiered storage arrangement, the impact of the consolidated mass on the KW Basin structure, and criticality issues associated with multi-tiered storage

New 5 Kilowatt Free-piston Stirling Space Convertor Developments

Science.gov (United States)

Brandhorst, Henry W., Jr.; Chapman, Peter A., Jr.

2007-01-01

The NASA Vision for Exploration of the moon may someday require a nuclear reactor coupled with a free-piston Stirling convertor at a power level of 30-40 kW. In the 1990s, Mechanical Technology Inc. s Stirling Engine Systems Division (some of whose Stirling personnel are now at Foster-Miller, Inc.) developed a 25 kW free piston Stirling Space Power Demonstrator Engine under the SP-100 program. This system consisted of two 12.5 kW engines connected at their hot ends and mounted in tandem to cancel vibration. Recently, NASA and DoE have been developing dual 55 W and 80 W Stirling convertor systems for potential use with radioisotope heat sources. Total test times of all convertors in this effort exceed 120,000 hours. Recently, NASA began a new project with Auburn University to develop a 5 kW, single convertor for potential use in a lunar surface reactor power system. Goals of this development program include a specific power in excess of 140 W/kg at the convertor level, lifetime in excess of five years and a control system that will safely manage the convertors in case of an emergency. Auburn University awarded a subcontract to Foster-Miller, Inc. to undertake development of the 5 kW Stirling Convertor Assembly. The characteristics of the design along with progress in developing the system will be described.

PLC based development of control, monitoring and interlock for 100 kW, 45.6 MHz ICRH system

International Nuclear Information System (INIS)

Jadav, Hiralal; Joshi, Rameshkumar; Mali, Aniruddh K.; Kadia; Bhavesh; Parmar; Maganbhai, Kiritkumar; Kulkarni, S.V.

2015-01-01

This paper presents details of PLC based system development for 100KW at the rate 45.6 MHz. Presently in ICRH RF DAC (Data acquisition and control) system existing based on real time VME and linux operating system. The ICRH system consists of 1.5 MW RF generator operating at 22- 40MHz which is used for second harmonic heating and pre-ionization experiments on SST-1 Tokamak at 1.5T and 3T magnetic field operation respectively. The task of PLC system in RF ICRH is to control, monitoring and interlocks HVDC power supply signal. Voltage and current signal of 2 kW, 20 kW, tetrode for 100 kW RF tube electrode like Filament, Control grid, Plate, Screen grid, signal monitor and voltage set raised by PLC analog IO module. Acknowledgement of the HVDC supply Filament, Control grid, Plate, Screen grid power supply is monitor and interlocks by PLC Digital IO module to interlocks stop the RF pulse and off HV power supply. The RF pulse(shot) to trigger signal generator (5mw) RF power output feed to LPA then chain of 2 KW, 20 KW, 100 KW at the rate 45.6 MHz. The programming logic controller (PLC) software is written in ladder language for AH500 Delta make using ISP Soft 2.04 and GUI is in the table form to control and monitor the parameters. Communication of PLC to PC by ethernet LAN network. (author)

75 FR 2132 - Maine Maritime Academy; Notice of Declaration of Intention and Petition for Relief Filing and...

Science.gov (United States)

2010-01-14

... devices could include: (1) 4.9-foot-diameter, 19.7-foot-long 4 kilowatt (kW) Cross Flow Darrius style rotors; (2) 13.1-foot-diameter, 3.3-foot-high 4 kW Cross Flow Savonius type rotors; and (3) 13.1-foot-diameter, 3.3-foot- long 6 kW Axial Flow turbines with an average capacity up to 1.5 kW. The devices would...

77 FR 25998 - Carbon Zero, LLC; Notice of Application Accepted for Filing With the Commission, Intent To Waive...

Science.gov (United States)

2012-05-02

...-high, 35-foot-long and one 12-foot-high, 85-foot- long; (6) an existing powerhouse with two new Kaplan turbine generating units, a 215 kilowatt (kW) unit and a 145 kW unit, with a total installed capacity of...

78 FR 48155 - Rock River Beach, Inc.; Notice of Application Accepted for Filing With the Commission; Intent To...

Science.gov (United States)

2013-08-07

... wood-framed powerhouse housing a 3-kilowatt (kW) generating unit run by a water wheel and a 5-kW generating unit run by a 24-inch vertical-shaft propeller turbine for a total installed capacity of 8 kW; and... Edison generator that operates via the water wheel and is operated once a year. The applicant operates...

Combined Heat & Power Using the Infinia Concentrated Solar - CHP PowerDish System

Science.gov (United States)

2013-08-01

forward operating base FPSE Free Piston Stirling Engine GHG greenhouse gas IOU investor-owned utility kW kilowatt kWac kilowatt alternating...Free Piston Stirling Engine (FPSE) for military, commercial, and space applications for almost 30 years. As Infinia developed a commercial product...6 Figure 2. Free-piston Stirling generator. ................................................................................ 6 Figure 3

Kilowatt isotope power system, Phase II Plan. Volume IV. Teledyne FSCD vs GDS

Energy Technology Data Exchange (ETDEWEB)

1978-03-15

This Volume contains Teledyne's input to the Kilowatt Isotope Power System Phase II Plan. Included is a description of the Flight System Heat Generation System, Flight System Radiator, Thermal Insulation Stability, GDS Heat Generation System and GDS Radiator.

Multi-kilowatt modularized spacecraft power processing system development

International Nuclear Information System (INIS)

Andrews, R.E.; Hayden, J.H.; Hedges, R.T.; Rehmann, D.W.

1975-07-01

A review of existing information pertaining to spacecraft power processing systems and equipment was accomplished with a view towards applicability to the modularization of multi-kilowatt power processors. Power requirements for future spacecraft were determined from the NASA mission model-shuttle systems payload data study which provided the limits for modular power equipment capabilities. Three power processing systems were compared to evaluation criteria to select the system best suited for modularity. The shunt regulated direct energy transfer system was selected by this analysis for a conceptual design effort which produced equipment specifications, schematics, envelope drawings, and power module configurations

105KE and 105KW Basins fuel and sludge consolidation study, summary report

International Nuclear Information System (INIS)

Gant, R.G.

1994-01-01

This study is a summary report that examines and evaluates the feasibility of consolidating irradiated fuel and sludge currently in KE Basin with that in the KW Basin. This study was conducted in support of TPA Milestone (target date) M-34-00-T03. The report summarizes three supporting engineering studies involving: (1) spent fuel consolidation into the single basin, (2) transport of the encapsulated fuel between KE and KW Basins, and (3) dispositioning contaminated water remaining in KE Basin. From the three reports, and preferred storage method, transfer method and water disposition method were defined. These consolidation methods were then evaluated against the no action alternative of continued storage using both KE and KW Basins. The report concluded that the fuel and sludge currently stored in KE Basin not be consolidated in the KW Basin, primarily due to increased cost and radiation exposure required to consolidate the fuel and sludge. Consolidation is more attractive for storage periods beyond the year 2002, which is the study period of the report

Kilowatt isotope power system phase II plan. Volume II: flight System Conceptual Design (FSCD)

International Nuclear Information System (INIS)

1978-03-01

The Kilowatt Isotope Power System (KIPS) Flight System Conceptual Design (FSCD) is described. Included are a background, a description of the flight system conceptual design, configuration of components, flight system performance, Ground Demonstration System test results, and advanced development tests

Reliability program plan for the Kilowatt Isotope Power System (KIPS) technology verification phase

International Nuclear Information System (INIS)

1978-01-01

Ths document is an integral part of the Kilowatt Isotope Power System (KIPS) Program Plan. This document defines the KIPS Reliability Program Plan for the Technology Verification Phase. This document delineates the reliability assurance tasks that are to be accomplished by Sundstrand and its suppliers during the design, fabrication and testing of the KIPS

Renewable energies: A real option for the electrical generation in Mexico?; Energias renovables: opcion real para la generacion electrica en Mexico?

Energy Technology Data Exchange (ETDEWEB)

Huacuz V, Jorge M. [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

2003-07-01

The renewable energies offer additional benefits to the kilowatts (kW) and kilowatts-hour (kWh) that they produce, because they include the creation of new jobs, a cleaner mean of generation and power assurance, among others. In view of this, most of the countries of the Organization for Economic Cooperation and Development (OECD) and several developing nations have established goals for the renewable energies in their power plans. Many of these countries also have fomented the local development of industries of renewable energy and are penetrating aggressively in this new technology market. [Spanish] Las energias renovables ofrecen beneficios adicionales a los kilowatts (kW) y kilowatts-hora (kWh) que producen, pues incluyen la creacion de nuevos empleos, un medio mas limpio de generacion y seguridad energetica, entre otros. En vista de ello, la mayoria de los paises de la Organizacion de Cooperacion para el Desarrollo Economico (OCDE) y varias naciones en desarrollo han establecido metas para las energias renovables en sus planes energeticos. Muchos de estos paises tambien han fomentado el desarrollo local de industrias de energia renovable y estan penetrando agresivamente en este nuevo mercado de la tecnologia.

Design, performance and economics of the DAF Indal 50 kW and 375 kW vertical axis wind turbine

Science.gov (United States)

Schienbein, L. A.; Malcolm, D. J.

1982-03-01

A review of the development and performance of the DAF Indal 50 kW vertical axis Darrieus wind turbines shows that a high level of technical development and reliability has been achieved. Features of the drive train, braking and control systems are discussed and performance details are presented. A description is given of a wind-diesel hybrid presently being tested. Details are also presented of a 375 kW VAWT planned for production in late 1982. A discussion of the economics of both the 50 kW and 375 kW VAWTs is included, showing the effects of charge rate, installed cost, operating cost, performance and efficiency. The energy outputs are translated into diesel fuel cost savings for remote communities.

76 FR 7552 - Charles River Energy LLC; Notice of Preliminary Permit Application Accepted for Filing and...

Science.gov (United States)

2011-02-10

... owners' express permission. The proposed run-of-the river, low-hydraulic-head (approximately 10 to 12... over the dam and housing a 6-blade Gorlov Helical Turbine (GHT) turbine-generator unit with a nameplate capacity of 45 kilowatts (kW); (4) a new 25 kW floating turbine- generator unit situated at the end of a...

Development of 10kW SOFC module

Energy Technology Data Exchange (ETDEWEB)

Hisatome, N.; Nagata, K. [Mitsubishi Heavy Industries, Ltd., Nagasaki (Japan); Kakigami, S. [Electric Power Development Co., Inc., Tokyo (Japan)] [and others

1996-12-31

Mitsubishi Heavy industries, Ltd. (MHI) has been developing tubular type Solid Oxide Fuel Cells (SOFC) since 1984. A 1 kW module of SOFC has been continuously operated for 3,000 hours with 2 scheduled thermal cycles at Electric Power Development Co., Inc. (EPDC) Wakamatsu Power Station in 1993. We have obtained of 34% (HHV as H{sub 2}) module efficiency and deterioration rate of 2% Per 1,000 hours in this field test. As for next step, we have developed 10 kW module in 1995. The 10 kW module has been operated for 5,000 hours continuously. This module does not need heating support to maintain the operation temperature, and the module efficiency was 34% (HHV as H{sub 2}). On the other hand, we have started developing the technology of pressurized SOFC. In 1996, pressurized MW module has been tested at MHI Nagasaki Shipyard & Machinery, Works. We are now planning the development of pressurized 10 kW module.

Economical photovoltaic power generation with heat recovery

Science.gov (United States)

Ascher, G.

1977-01-01

Three designs for conversion of solar radiation to electricity and thermal energy are analyzed. The objective of these converters is to increase the electric and thermal output for each photovoltaic array so as to lower the cell cost relative to the amount of energy delivered. An analysis of the economical aspects of conversion by photovoltaic cells with heat recovery is carried out in terms of hypothetical examples. Thus, it is shown that the original cost of say $40,000 per generated kilowat can be reduced to $572.00 per kilowatt by increasing the original electric output of 1 kW to 10 kW in electricity and 60 kW in thermal energy. The newly derived specific cost is only 1.4 percent of the original one. It is expected that a cost reduction of roughly 2% of the present specific cost per kilowatt will greatly stimulate public acceptance of photovoltaic terrestrial conversion to electricity.

Electrically Heated Testing of the Kilowatt Reactor Using Stirling Technology (KRUSTY) Experiment Using a Depleted Uranium Core

Science.gov (United States)

Briggs, Maxwell H.; Gibson, Marc A.; Sanzi, James

2017-01-01

The Kilopower project aims to develop and demonstrate scalable fission-based power technology for systems capable of delivering 110 kW of electric power with a specific power ranging from 2.5 - 6.5 Wkg. This technology could enable high power science missions or could be used to provide surface power for manned missions to the Moon or Mars. NASA has partnered with the Department of Energys National Nuclear Security Administration, Los Alamos National Labs, and Y-12 National Security Complex to develop and test a prototypic reactor and power system using existing facilities and infrastructure. This technology demonstration, referred to as the Kilowatt Reactor Using Stirling TechnologY (KRUSTY), will undergo nuclear ground testing in the summer of 2017 at the Nevada Test Site. The 1 kWe variation of the Kilopower system was chosen for the KRUSTY demonstration. The concept for the 1 kWe flight system consist of a 4 kWt highly enriched Uranium-Molybdenum reactor operating at 800 degrees Celsius coupled to sodium heat pipes. The heat pipes deliver heat to the hot ends of eight 125 W Stirling convertors producing a net electrical output of 1 kW. Waste heat is rejected using titanium-water heat pipes coupled to carbon composite radiator panels. The KRUSTY test, based on this design, uses a prototypic highly enriched uranium-molybdenum core coupled to prototypic sodium heat pipes. The heat pipes transfer heat to two Advanced Stirling Convertors (ASC-E2s) and six thermal simulators, which simulate the thermal draw of full scale power conversion units. Thermal simulators and Stirling engines are gas cooled. The most recent project milestone was the completion of non-nuclear system level testing using an electrically heated depleted uranium (non-fissioning) reactor core simulator. System level testing at the Glenn Research Center (GRC) has validated performance predictions and has demonstrated system level operation and control in a test configuration that replicates the one

Toward high brightness, multi-kilowatt solid state lasers

International Nuclear Information System (INIS)

Zapata, L.E.; Manes, K.R.

1990-11-01

High average power (HAP) solid state laser output with improved beam quality has introduced new capabilities in materials processing. At the 500 W level and with a beam quality of a ''few'' times the diffraction limit, the General Electric NY slab is able to drill 5 cm of stainless steel in a few seconds. We expect that 2--3 kW of near infrared laser output in a low order spatial mode would enable metal working now unknown to industry. The HAP output of slab lasers is limited by the size of the available laser crystals and the pump power. Core free, six cm diameter NY boules have been grown on an experimental basis. High optical quality NG can be obtained up to 10 cm in diameter. We present the results of our modeling based on these crystals pumped by advanced arc-lamps or laser diode arrays. We project HAP laser outputs of 1.6 kW from an existing Vortek pumped NG oscillator and about 2 kW from diode pumped NY device. Several kW of laser output can be expected from two such slabs in a MOPA configuration before optical damage limits are reached. The three dimensional stress-optic code which we used to optimize our designs, was normalized to available experimental data obtained with the above NG slab at the 500 W level and a 40 W diode pumped NY test bed. Our calculations indicate the essential parameters for attainment of high beam quality. Cooling uniformity across the pumped faces of the slab is critical and the location of the transition between pumped and un-pumped regions towards the slab tips is very important. A flat pumping profile was found to be desirable and predicted one wave of distortion which should be correctable over about 75% of the aperture however, an even better wavefront was predicted over 90% of the aperture when the regions near the edges of the slab were slightly over-pumped relative to the central regions and the regions near to the ends were tapered to compensate for transition effects

1KW Power Transmission Using Wireless Acoustic-Electric Feed-Through (WAEF)

Science.gov (United States)

Sherrit, S.; Bao, X.; Badescu, M.; Aldrich, J.; Bar-Cohen, Y.; Biederman, W.

2008-01-01

A variety of space applications require the delivery of power into sealed structures. Since the structural integrity can be degraded by holes for cabling we present an alternative method of delivering power and information using stress waves to the internal space of a sealed structure. One particular application of this technology is in sample return missions where it is critical to preserve the sample integrity and to prevent earth contamination. Therefore, the container has to be hermetically sealed and the integrity of the seal must be monitored in order to insure to a high degree of reliability the integrity of the sample return vessel. In this study we investigated the use of piezoelectric acoustic-electric power feed-through devices to transfer electric power wirelessly through a solid wall by using elastic or acoustic waves. The technology is applicable to a range of space and terrestrial applications where power is required by electronic equipment inside sealed containers, vacuum or pressure vessels, etc., where holes in the wall are prohibitive or may result in significant structural performance degradation or unnecessarily complex designs. To meet requirements of higher power applications, the feasibility to transfer kilowatts level power was investigated. Pre-stressed longitudinal piezoelectric feed-through devices were analyzed by finite element models and an equivalent circuit model was developed to predict the power transfer characteristics to different electric loads. Based on the results of the analysis a prototype device was designed, fabricated and a demonstration of the transmission of electric power up to 1.068-kW was successfully conducted. Efficiencies in the 80-90% range were also demonstrated and methods to increase the efficiency further are currently being considered.

Development of super-synchronization speed control assembly for 2500 kW double-fed motor

International Nuclear Information System (INIS)

Li Huajun; Xuan Weimin; Peng Jianfei; Hu Haotian; Wang Shujing; Kang Li; Xu Lirong; Huang Zhaorong; Wang Xiaoping; Du Cang; Liu Ling

2007-01-01

The super-synchronization speed control assemblies for the two 2500 kW induction motors have been developed successfully in order to meet the need for toroidal field increasing in HL-2A tokamak. Based on the a.c./a.c. cycloconverter, the speed of each 2500 kW motor has been regulated by means of vector control technology for double-fed motor. The highest rotate speed of the two 80 MVA generator sets have been increased from 1488 rpm rated speed to 1650 rpm and the released energy of each generator set in one pulse discharge can reach 500 MJ. Therefore the toroidal field system is able to reach 2.8T for experiment. (authors)

DEC VT220

CERN Multimedia

1983-01-01

The DEC (Digital Equipment Corporation) VT220 is a text terminal which uses an redesigned keyboard(LK201). The VT220 improved on the earlier VT100 series of terminals with much smaller physical packaging and and a much faster microprocessor.

6kW class laser cutting equipment; 6kW daishutsuryoku laser setsudanki ni yoru atsuita setsudan

Energy Technology Data Exchange (ETDEWEB)

Nagata, Y.; Nagahori, M. [Tanaka Engineering Works Ltd., Saitama (Japan)

1994-11-01

Application of the laser cutting machine to the area of cutting steel plates of 5 mm thick or more was first enabled in 1990 by the 2 kW oscillator that was introduced in that year. The thick plate cutting industry has a short history. This paper describes the features and performance of the 6 kW laser cutting machine that was announced in April, 1994. The machine uses a newly developed high-speed axial flow type carbon dioxide laser oscillater with the rated output of 6 kW. As the discharge excitation method, the machine adopted the RF (radio frequency) method that causes low contamination in the discharge tube. The 6 kW laser cutting machine has a number of features such as a large cutting area provided by the oscillator contained in the cutting machine, cutting quality stabilized by the optical path length fixing unit, and automatic functions such as automatic setting of the cutting conditions and scheduled operation. The machine can cut mild steel plates of up to 40 mm thick (or up to 16 mm for stainless steel plates) at the cutting speed of 1600 mm/min for a 16 mm thick plate and 2200 mm/min for a 12 mm thick plate, with the good cut sectional surface. 5 figs., 1 tab.

1000kW phosphoric acid fuel cell power plant. Outline of the plant

Energy Technology Data Exchange (ETDEWEB)

Shinobe, Kenji; Suzuki, Kazuo; Kaneko, Hideo

1988-02-10

The outline of the 1000KW phosphoric acid fuel cell power plant, developed as part of the Moonlight plan, was described. The plant was composed of 4 stacks of 260KW DC output. They were devided into two train with 680V and 765A. The generation efficiency of the plant was 40% and more. Steam reforming of natural gas was used. As the fuel, fuel cell exhaust gas was used in composition with the natural gas. The DC-AC inverter had an efficiency of 96%. The capacity of hot water generator and demineralized water plant for cell cooling were 2t/h and 1.6t/h, respectively, and air-system was incorporated. In September of 1987, the plant has succeeded in 1000KW power generation, and put in operation now. Under the 100% loaded condition, each cell had a voltage of 0.7V with little variation, and the current was 200mA/cm/sup 2/. No problems were found in cooling conditions and in the control of interpole differential pressure. The reformer has been operated for 1200h scince its commisioning, and had experiences of 100 times on start up-shut down operations, the reformer also indicated good performances in the gas compositions. The starting time of 8h and the load follow-up rate 10%/min remain as the subjects for shortening. DC-AC conversion was good. The concentration of NOx and the noise level satisfied the target values. (12 figs, 1 tab)

Experimental Investigation of a Direct-drive Hall Thruster and Solar Array System at Power Levels up to 10 kW

Science.gov (United States)

Snyder, John S.; Brophy, John R.; Hofer, Richard R.; Goebel, Dan M.; Katz, Ira

2012-01-01

As NASA considers future exploration missions, high-power solar-electric propulsion (SEP) plays a prominent role in achieving many mission goals. Studies of high-power SEP systems (i.e. tens to hundreds of kilowatts) suggest that significant mass savings may be realized by implementing a direct-drive power system, so NASA recently established the National Direct-Drive Testbed to examine technical issues identified by previous investigations. The testbed includes a 12-kW solar array and power control station designed to power single and multiple Hall thrusters over a wide range of voltages and currents. In this paper, single Hall thruster operation directly from solar array output at discharge voltages of 200 to 450 V and discharge powers of 1 to 10 kW is reported. Hall thruster control and operation is shown to be simple and no different than for operation on conventional power supplies. Thruster and power system electrical oscillations were investigated over a large range of operating conditions and with different filter capacitances. Thruster oscillations were the same as for conventional power supplies, did not adversely affect solar array operation, and were independent of filter capacitance from 8 to 80 ?F. Solar array current and voltage oscillations were very small compared to their mean values and showed a modest dependence on capacitor size. No instabilities or anomalous behavior were observed in the thruster or power system at any operating condition investigated, including near and at the array peak power point. Thruster startup using the anode propellant flow as the power 'switch' was shown to be simple and reliable with system transients mitigated by the proper selection of filter capacitance size. Shutdown via cutoff of propellant flow was also demonstrated. A simple electrical circuit model was developed and is shown to have good agreement with the experimental data.

Europe's largest solar thermal power plant. [200 kw thermal output supplemented by two 10-kw windmills

Energy Technology Data Exchange (ETDEWEB)

Bossel, U

1976-03-01

An overview is given over the solar heating plant which has recently been commissioned in the Camargue (France). This is the largest plant in Europe, with a mean heat output of about 200 kW, for the production of thermal energy from solar energy. The plant consists of 108 parabolic collectors (200 sq. metres) and 48 flat collectors (110 sq. metres). Two windmills with outputs of 10 kW each complete the system. The heat energy produced by the solar collectors is given up to 3 different stores, which in turn are connected to various consumers.

77 FR 6555 - Alaska Village Electric Cooperative; Notice of Preliminary Permit Application Accepted for Filing...

Science.gov (United States)

2012-02-08

... (approximate) by 16-foot-high metal building or similar structure. The building would house the turbines and... equipment would consist of two Pelton 262 kilowatt (kW) units with a 480-volt, 3- phase synchronous...

Design study of wind turbines 50 kW to 3000 kW for electric utility applications. Volume 2: Analysis and design

Science.gov (United States)

1976-01-01

All possible overall system configurations, operating modes, and subsystem concepts for a wind turbine configuration for cost effective generation of electrical power were evaluated for both technical feasibility and compatibility with utility networks, as well as for economic attractiveness. A design optimization computer code was developed to determine the cost sensitivity of the various design features, and thus establish the configuration and design conditions that would minimize the generated energy costs. The preliminary designs of both a 500 kW unit and a 1500 kW unit operating in a 12 mph and 18 mph median wind speed respectively, were developed. The various design features and components evaluated are described, and the rationale employed to select the final design configuration is given. All pertinent technical performance data and component cost data is included. The costs of all major subassemblies are estimated and the resultant energy costs for both the 500 kW and 1500 kW units are calculated.

5 kW, 5 kHz class-A inverter for DC accelerator in CAT, Indore (Paper No. CP 19)

International Nuclear Information System (INIS)

Thakurta, A.C.; Krishnaswamy, B.

1990-01-01

The 5 kHz, 5kW inverter described here is meant for energizing a high voltage transformer feeding a 2-stage Cockcroft-Walton multipliers with 100 kVDC output. This output is to be used as the acceleration voltage in DC accelerator at CAT, Indore. The load is expected to draw few tens of mA current, which means that with the values of the capacitors readily available with voltage ratings of 50 kVDC and above, there will be considerable drop in multiplier output voltage and ripple voltage also will be quite high, if one goes in for line-frequency operation. The frequency of 5 kHz suggests a good compromise between low ripple and DC drop, and the availability of devices switching at high frequency and handling kilowatts of power. The class A type of inverter which has reasonably good load regulation and tolerance to reactive loads was deemed suitable for generating this 5 kHz AC voltage. The DC voltage needed for the inverter was obtained from a phase-controlled supply which was put in closed loop to achieve regulation with respect to line and load variation. The output could be varied with external setting of a reference voltage. (author). 3 figs

77 FR 10504 - Notice of Preliminary Permit Application Accepted for Filing and Soliciting Comments, Motions To...

Science.gov (United States)

2012-02-22

... (approximate) by 16-foot- high metal building or similar structure. The building would house the turbines and... equipment would consist of two Pelton 262 kilowatt (kW) units with a 480-volt, 3-phase synchronous generator...

Dicty_cDB: SLH220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLH220 (Link to dictyBase) - - - Contig-U15409-1 SLH220F (Link to Original site) SLH2...20F 510 - - - - - - Show SLH220 Library SL (Link to library) Clone ID SLH220 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-A/SLH220Q.Seq.d/ Representative seq. ID SLH22...0F (Link to Original site) Representative DNA sequence >SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/ GAAGA...gnificant alignments: (bits) Value SLH220 (SLH220Q) /CSM/SL/SLH2-A/SLH220Q.Seq.d/

7 CFR 1280.220 - Collections.

Science.gov (United States)

2010-01-01

... 7 Agriculture 10 2010-01-01 2010-01-01 false Collections. 1280.220 Section 1280.220 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Assessments § 1280.220 Collections. (a) Each first handler and each exporter responsible for the collection of assessments under this subpart shall...

14 CFR 13.220 - Discovery.

Science.gov (United States)

2010-01-01

... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...

7 CFR 220.3 - Administration.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 220.3 Section 220.3 Agriculture... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.3 Administration. (a) Within the Department, FNS shall act on behalf of the Department in the administration of the Program covered by this part. Within...

49 CFR 220.7 - Penalty.

Science.gov (United States)

2010-10-01

..., or has caused death or injury, a penalty not to exceed $100,000 per violation may be assessed; and... 49 Transportation 4 2010-10-01 2010-10-01 false Penalty. 220.7 Section 220.7 Transportation Other... TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.7 Penalty. Any person (including but not limited to a...

9 CFR 354.220 - Buildings.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Buildings. 354.220 Section 354.220... CERTIFICATION VOLUNTARY INSPECTION OF RABBITS AND EDIBLE PRODUCTS THEREOF Buildings and Plant Facilities § 354.220 Buildings. The buildings shall be of sound construction and kept in good repair, and shall be of...

30 CFR 220.032 - Inventories.

Science.gov (United States)

2010-07-01

... operations. The accumulation of surplus stocks shall be avoided by proper materiel control, inventory and... physical inventory that has not been credited to NPSL operations under § 220.015(a)(2) shall be credited to... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Inventories. 220.032 Section 220.032 Mineral...

Kurokawa 150-kW wind turbine generator demonstration; 150 kW Kurokawa furyoku hatsudensho ni tsuite

Energy Technology Data Exchange (ETDEWEB)

Okamoto, M; Shinohara, M; Sugiyama, T [Kansai Electric Power Co. Inc., Osaka (Japan)

1996-10-27

This paper presents the 150kW wind turbine generator erected at a site near Kurokawa dam lake of Kansai Electric Power Co. in Hyogo prefecture. This generator is composed of a horizontal-axis propeller with 3 blades of 27m in diameter and 36/27rpm, and a tower of 30m high. Harmony with the environment was also considered because of the site in a natural park area. Its demonstration test started in Oct. 1996 at annual mean wind velocity of 2m/s. Soft start was realized by controlling inrush current and preventing voltage drop in system interconnection by use of a thyristor circuit. The dual operation system was adopted of a 30kW small generator at lower wind velocity and a 150kW large one at higher velocity. Two kinds of brakes are used, and rotor revolution was reduced by air brake (blade tip spoiler). Mechanical disk brake works for the stopped rotor or emergency stopping. Even if the wind turbine was stopped by exterior factor, if no anomaly of the turbine is found, it automatically re-starts after removal of the factor. The generator is controlled from a remote control station 150km apart through NTT communication line. 6 figs., 2 tabs.

Engineering design of 500KW CW collector

International Nuclear Information System (INIS)

Kumar, Ramesh; Mishra, Deepak; Prasad, M.; Hannuarakar, P.R.

2006-01-01

An electron beam collector for 500kW beam power has been designed to test the electron gun. The gun is designed for 250kW, 350MHz CW Klystron with 50% efficiency. This will also help in preliminary studies related to final collector design for Klystron. This paper presents the design parameters, thermal analysis and mechanical features of the design. Electron trajectory on inside wall of the collector is determined with EGUN and computational flow dynamics simulation was done on ANSYS for cooling requirements. (author)

Dicty_cDB: VHK220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available VH (Link to library) VHK220 (Link to dictyBase) - - - - - (Link to Original site) VHK2...20F 530 - - - - - - Show VHK220 Library VH (Link to library) Clone ID VHK220 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHK2-A/VHK2...20Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >VHK2...20 (VHK220Q) /CSM/VH/VHK2-A/VHK220Q.Seq.d/ AACTCTCGAGTGCAAAAAAAGTAAAGTACAAAATGGTTAATTTCA

49 CFR 220.2 - Preemptive effect.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Preemptive effect. 220.2 Section 220.2 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS General § 220.2 Preemptive effect. Link to an amendment...

77 FR 26537 - Fairlawn Hydroelectric Company, LLC; Notice of Availability of Final Environmental Assessment

Science.gov (United States)

2012-05-04

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Project No. 12715-003] Fairlawn Hydroelectric Company, LLC; Notice of Availability of Final Environmental Assessment In accordance with the... the proposed 14,000-kilowatt (kW) Jennings Randolph Hydroelectric Project located on the North Branch...

46 CFR 129.220 - Basic safety.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Basic safety. 129.220 Section 129.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS ELECTRICAL INSTALLATIONS General Requirements § 129.220 Basic safety. (a) Electrical equipment and installations must be suitable...

36 CFR 223.220 - Quantity determination.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Quantity determination. 223.220 Section 223.220 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE SALE AND DISPOSAL OF NATIONAL FOREST SYSTEM TIMBER Special Forest Products § 223.220 Quantity determination...

Information system design of inventory control spare parts maintenance (valuation class 5000) (case study: plant kw)

Science.gov (United States)

Fitriana, Rina; Moengin, Parwadi; Riana, Mega

2016-02-01

Plat KW hadn't using optimal inventory level planning yet and hadn't have an information system that well computerized. The research objective is to be able to design an information system related inventory control of spare parts maintenance. The study focused on five types of spare parts with the highest application rate during February 2013- March 2015 and included in the classification of fast on FSN analysis Grinding stones Cut 4". Cable Tie 15". Welding RB 26-32MM. Ring Plat ½" and Ring Plate 5/8 ". Inventory calculation used Economic Order Quantity (EOQ). Safety Stock (SS) and Reorder Point (ROP) methods. System analysis conducted using the framework PIECES with the proposed inventory control system. the performance of the plant KW relating to the supply of spare parts maintenance needs can be more efficient as well as problems at the company can be answered and can perform inventory cost savings amounting Rp.267.066. A computerized information system of inventory control spare parts maintenance provides a menu that can be accessed by each departments as the user needed.

Performance of a 10 kilowatt wind-electric water pumping system for irrigating crops

Energy Technology Data Exchange (ETDEWEB)

Vick, B.D.; Clark, R.N. [Conservation and Production Research Lab., Bushland, TX (United States); Molla, S. [Texas A& M Univ., College Station, TX (United States)

1997-12-31

A 10 kW wind-electric water pumping system was tested for field crop irrigation at pumping depths from 50 to 120 m. The wind turbine for this system used a permanent magnet alternator that powered off-the-shelf submersible motors and pumps without the use of an inverter. Pumping performance was determined at the USDA-Agricultural Research Service (ARS), Wind Energy Laboratory in Bushland, TX for the 10 kW wind turbine using a pressure valve and a pressure tank to simulate different pumping depths. Pumping performance was measured for two 10 kW wind turbines of the same type at farms near the cities of Garden City, TX and Stiles, TX. The pumping performance data collected at these actual wells compared favorably with the data collected at the USDA-ARS, Wind Energy Laboratory. If utility generated electricity was accessible, payback on the wind turbine depended on the cost of utility generated electricity and the transmission line extension cost.

Dicty_cDB: SFL220 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available 0Z (Link to Original site) Representative DNA sequence >SFL220 (SFL220Q) /CSM/SF/SFL2-A/SFL220Q.Seq.d/ XXXXXXXXXXGTCCANATTTCCATANA...end seq. - 3' end seq. ID SFL220Z 3' end seq. >SFL220Z.Seq ----------GTCCANATTTCCATANATGTGTTTAAAAACGTGGNGGNA

46 CFR 184.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Cooking equipment. 184.220 Section 184.220 Shipping...) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.220 Cooking equipment. (a) Doors on a cooking appliance must be provided with hinges and locking devices to prevent...

Moderator configuration options for a low-enriched uranium fueled Kilowatt-class Space Nuclear Reactor

Energy Technology Data Exchange (ETDEWEB)

King, Jeffrey C., E-mail: kingjc@mines.edu [Nuclear Science and Engineering Program, Colorado School of Mines (CSM), Golden, CO (United States); Mencarini, Leonardo de Holanda; Guimaraes, Lamartine N. F., E-mail: guimaraes@ieav.cta.br, E-mail: mencarini@ieav.cta.br [Instituto de Estudos Avancados (IEAV), Sao Jose dos Campos, SP (Brazil). Divisao de Energia Nuclear

2015-07-01

The Brazilian Air Force, through its Institute for Advanced Studies (Instituto de Estudos Avancados, IEAv/DCTA), and the Colorado School of Mines (CSM) are studying the feasibility of a space nuclear reactor with a power of 1-5 kW{sub e} and fueled with Low-Enriched Uranium (LEU). This type of nuclear reactor would be attractive to signatory countries of the Non-Proliferation Treaty (NPT) or commercial interests. A LEU-fueled space reactor would avoid the security concerns inherent with Highly Enriched Uranium (HEU) fuel. As an initial step, the HEU-fueled Kilowatt Reactor Using Stirling Technology (KRUSTY) designed by the Los Alamos National Laboratory serves as a basis for a similar reactor fueled with LEU fuel. Using the computational code MCNP6 to predict the reactor neutronics performance, the size of the resulting reactor fueled with 19.75 wt% enriched uranium-10 wt% molybdenum alloy fuel is adjusted to match the excess reactivity of KRUSTY. Then, zirconium hydride moderator is added to the core to reduce the size of the reactor. This work presents the preliminary results of the computational modeling, with special emphasis on the comparison between homogeneous and heterogeneous moderator systems, in terms of the core diameter required to meet a specific multiplication factor (k{sub eff} = 1.035). This comparison illustrates the impact of moderator configuration on the size and performance of a LEU-fueled kilowatt-class space nuclear reactor. (author)

45 CFR 148.220 - Excepted benefits.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 1 2010-10-01 2010-10-01 false Excepted benefits. 148.220 Section 148.220 Public... FOR THE INDIVIDUAL HEALTH INSURANCE MARKET Preemption; Excepted Benefits § 148.220 Excepted benefits... provision of the benefits described in paragraphs (a) and (b) of this section (or any combination of the...

49 CFR 179.220-10 - Welding.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...

7 CFR 58.220 - Drying systems.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Drying systems. 58.220 Section 58.220 Agriculture....220 Drying systems. (a) Spray dryers. Spray dryers shall be of a continuous discharge type and all... filter system shall comply with the applicable requirements of the 3-A Accepted Practices for Milk and...

76 FR 62802 - Fairlawn Hydroelectric Company, LLC; Notice of Availability of Environmental Assessment

Science.gov (United States)

2011-10-11

... Hydroelectric Company, LLC; Notice of Availability of Environmental Assessment In accordance with the National...,000-kilowatt (kW) Jennings Randolph Hydroelectric Project located on the North Branch Potomac River in..., Washington, DC 20426. Please affix ``Jennings Randolph Hydroelectric Project No. 12715-003'' to all comments...

2-kW single-mode fiber laser employing bidirectional-pump scheme

Science.gov (United States)

Zhang, Fan; Zheng, Wenyou; Shi, Pengyang; Zhang, Xinhai

2018-01-01

2kW single-mode fiber laser with two cascade home-made cladding light strippers (CLSs) by employing bidirectionalpump scheme has been demonstrated. 2.009 kW signal power is obtained when pump power is 2.63 kW and the slope efficiency is 76.6%. Raman Stokes light is less than -47 dB at 2.009 kW even with a 10-m delivery fiber with core/inner cladding diameter of 20/400um. The beam quality M2<=1.2 and the spectral FWHM bandwidth is 4.34nm. There is no transverse mode instability and the output power stability of +/-0.14% is achieved by special thermal management for a more uniform temperature distribution on the Yb-doped gain fiber.

Kilowatt isotope power system. Phase II plan. Volume V. Safety, quality assurance and reliability

International Nuclear Information System (INIS)

1978-01-01

The development of a Kilowatt Isotope Power System (KIPS) was begun in 1975 for the purpose of satisfying the power requirements of satellites in the 1980's. The KIPS is a 238 PuO 2 -fueled organic Rankine cycle turbine power system to provide a design output of 500 to 2000 W. Included in this volume are: launch and flight safety considerations; quality assurance techniques and procedures to be followed through system fabrication, assembly and inspection; and the reliability program made up of reliability prediction analysis, failure mode analysis and criticality analysis

46 CFR 121.220 - Cooking equipment.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Cooking equipment. 121.220 Section 121.220 Shipping... SYSTEMS AND EQUIPMENT Cooking and Heating § 121.220 Cooking equipment. (a) Doors on a cooking appliance... cooking appliance must be installed to prevent movement in heavy seas. (c) For a grill or similar type of...

High Input Voltage, Silicon Carbide Power Processing Unit Performance Demonstration

Science.gov (United States)

Bozak, Karin E.; Pinero, Luis R.; Scheidegger, Robert J.; Aulisio, Michael V.; Gonzalez, Marcelo C.; Birchenough, Arthur G.

2015-01-01

A silicon carbide brassboard power processing unit has been developed by the NASA Glenn Research Center in Cleveland, Ohio. The power processing unit operates from two sources: a nominal 300 Volt high voltage input bus and a nominal 28 Volt low voltage input bus. The design of the power processing unit includes four low voltage, low power auxiliary supplies, and two parallel 7.5 kilowatt (kW) discharge power supplies that are capable of providing up to 15 kilowatts of total power at 300 to 500 Volts (V) to the thruster. Additionally, the unit contains a housekeeping supply, high voltage input filter, low voltage input filter, and master control board, such that the complete brassboard unit is capable of operating a 12.5 kilowatt Hall effect thruster. The performance of the unit was characterized under both ambient and thermal vacuum test conditions, and the results demonstrate exceptional performance with full power efficiencies exceeding 97%. The unit was also tested with a 12.5kW Hall effect thruster to verify compatibility and output filter specifications. With space-qualified silicon carbide or similar high voltage, high efficiency power devices, this would provide a design solution to address the need for high power electric propulsion systems.

Design of Radial Inflow Turbine for 30 kW Microturbine

Directory of Open Access Journals (Sweden)

Sangsawangmatum Thanate

2017-01-01

Full Text Available Microturbines are small gas turbines that have the capacity range of 25-300 kW. The main components of microturbine are compressor, turbine, combustor and recuperator. This research paper focuses on the design of radial inflow turbine that operates in 30 kW microturbine. In order to operate the 30 kW microturbine with the back work ratio of 0.5, the radial inflow turbine should be designed to produce power at 60 kW. With the help of theory of turbo-machinery and the analytical methods, the design parameters are derived. The design results are constructed in 3D geometry. The 3D fluid-geometry is validated by computational fluid dynamics (CFD simulation. The simulation results show the airflow path, the temperature distribution, the pressure distribution and Mach number. According to the simulation results, there is no flow blockage between vanes and no shock flow occurs in the designed turbine.

21 CFR 189.220 - Flectol H.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Flectol H. 189.220 Section 189.220 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Addition to Human Food Through Food-Contact Surfaces § 189.220 Flectol H. (a) Flectol H is the chemical 1,2...

Kilowatt-Class Fission Power Systems for Science and Human Precursor Missions

Science.gov (United States)

Mason, Lee S.; Gibson, Marc Andrew; Poston, Dave

2013-01-01

Nuclear power provides an enabling capability for NASA missions that might otherwise be constrained by power availability, mission duration, or operational robustness. NASA and the Department of Energy (DOE) are developing fission power technology to serve a wide range of future space uses. Advantages include lower mass, longer life, and greater mission flexibility than competing power system options. Kilowatt-class fission systems, designated "Kilopower," were conceived to address the need for systems to fill the gap above the current 100-W-class radioisotope power systems being developed for science missions and below the typical 100-k We-class reactor power systems being developed for human exploration missions. This paper reviews the current fission technology project and examines some Kilopower concepts that could be used to support future science missions or human precursors.

Research on industrial 10kW CO2 laser achieves major breakthrough

Science.gov (United States)

1991-01-01

The industrial 10kW CO2 laser is one of the items which the industrially developed nations are competing to develop. This laser is capable of continuous output power of over 10kW and can operate continuously for more than 6 hours. The 10kW CO2 laser developed as a key task of China's 7th Five-Year Plan and all its technological targets such as output power, electrooptical conversion efficiency and primary charging continuous operating time, have reached the level of world advancement, allowing China to enter the ranks of international advancement in the area of laser technology. The industrial 10kW CO2 laser can have wide application in such areas of industry as heat treating, machining, welding and surface treatment in industries such as steel, automobiles, ship building and aircraft manufacturing. For instance, using the high-efficiency laser beams of this 10kW laser to treat rollers, fan blades and automotive cylinder blocks can increase the life of these parts and produce large economic benefits. At present, industrial tests of gear welding is already being done on this 10kW laser.

500 keV, 10 kW DC electron accelerator at BRIT, Vashi

International Nuclear Information System (INIS)

Sharma, D.K.; Rajan, R.N.; Bakhtsingh, R.I.; Acharya, S.; Rajawat, R.K.

2017-01-01

The 500 keV DC accelerator was indigenously designed and developed by Accelerator and Pulse Power Division, BARC during 1994-97 and commissioned at REPF Hall, BRIT, Vashi on 10"t"h August, 1998. The accelerator operation at 3kW beam power for 8 hour shifts was established in February 2001, confirming to industrial standards for EB treatment of plastic sheets as well as various surface-treatment processes for value addition of the products and materials. Since then, this EB facility is functional and being regularly utilized for various applications

2 CFR 801.220 - What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered...

Science.gov (United States)

2010-01-01

... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What contracts and subcontracts, in addition to those listed in 2 CFR 180.220, are covered transactions? 801.220 Section 801.220 Grants and... DEBARMENT AND SUSPENSION Covered Transactions § 801.220 What contracts and subcontracts, in addition to...

Microprocessor Control Design for a Low-Head Crossflow Turbine.

Science.gov (United States)

1985-03-01

Controllers For a Typical 10 KW Hydroturbine ............ 1-5 I-1 Ely’s Crossflow Turbine . ........ 11-2 11-2 Basic Turbine * * 0 * 0 11-5 11-3 Turbine...the systems. For example, a 25 kilowatt hydroturbine built and installed by Bell Hydroelectric would cost approximately $20,000 in 1978 (6:49). The...O Manual Controller S2 E- Microprocessor Controller 1 2 3 4 5 6 7 8 YEARS Fig. 1-2 Comparative Costs of Controllers For a Typical 10 KW Hydroturbine

40 CFR 91.207 - Credit calculation and manufacturer compliance with emission standards.

Science.gov (United States)

2010-07-01

... engine family in kW (sales weighted). The power of each configuration is the rated output in kilowatts as... emission standards. (a) For each engine family, certification emission credits (positive or negative) are... of nitrogen credit status for an engine family, whether generating positive credits or negative...

New 5 kW free-piston Stirling space convertor developments

Science.gov (United States)

Brandhorst, Henry W., Jr.; Chapman, Peter A., Jr.

2008-07-01

The NASA Vision for Exploration of the moon may someday require a nuclear reactor coupled with a free-piston Stirling convertor at a power level of 30-40 kW. In the 1990s, Mechanical Technology Inc.'s Stirling Engine Systems Division (some of whose Stirling personnel are now at Foster-Miller, Inc.) developed a 25 kW free-piston Stirling Space Power Demonstrator Engine under the SP-100 program. This system consisted of two 12.5 kW engines connected at their hot ends and mounted in tandem to cancel vibration. Recently, NASA and DoE have been developing dual 55 and 80 W Stirling convertor systems for potential use with radioisotope heat sources. Total test times of all convertors in this effort exceed 120,000 h. Recently, NASA began a new project with Auburn University to develop a 5 kW, single convertor for potential use in a lunar surface reactor power system. Goals of this development program include a specific power in excess of 140 W/kg at the convertor level, lifetime in excess of five years and a control system that will safely manage the convertors in case of an emergency. Auburn University awarded a subcontract to Foster-Miller, Inc. to undertake development of the 5 kW Stirling convertor assembly. The characteristics of the design along with progress in developing the system will be described.

Room/corner tests of wall linings with 100/300 kW burner

Science.gov (United States)

M. A. Dietenberger; O. Grexa; R. H. White; M. S. Sweet; M. Janssens

1995-01-01

Six room/comer tests of common wall linings were conducted with gypsum-lined ceiling exposed to propane burning at 100 kW for 10 min followed by 300 kW for 10 min. This test protocol is an option provided by ISO 9705. The flashover event occurred at 1,000 kW rate of heat release within several seconds of observing flames out the doorway. The time to flashover of the...

10 kW Contactless Power Transfer System for Rapid Charger of Electric Vehicle

OpenAIRE

Yamanaka, Tomohiro; Kaneko, Yasuyoshi; Abe, Shigeru; Yasuda, Tomio

2012-01-01

A contactless power transfer system for charging electric vehicles requires a high efficiency, a large air gap, and a good tolerance to lateral misalignment and needs to be compact and lightweight. A double-sided winding 10 kW transformer based on a 1.5 kW H-shaped core transformer was developed for a rapid charger. Even though the transformer capacity was increased, the dimensions of the 10 kW transformer were almost the same as those of the 1.5 kW transformer. In this paper, the design conc...

49 CFR 220.3 - Application.

Science.gov (United States)

2010-10-01

... general railroad system of transportation; or (2) Rapid transit operations in an urban area that are not... 49 Transportation 4 2010-10-01 2010-10-01 false Application. 220.3 Section 220.3 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION, DEPARTMENT OF...

3 kW Stirling engine for power and heat production

DEFF Research Database (Denmark)

Thorsen, Jan Eric; Bovin, Jonas Kabell; Carlsen, Henrik

1996-01-01

A new 3 kW Beta-type Stirling engine has been developed. The engine uses natural gas as fuel and is designed for use as a small combined heat and power plant for single family houses. The electrical power is supplied to the grid. The engine is made as a hermetic device, where the crank mechanism...... and the alternator are built into a pressurized crank casing. The engine produces 3 kW of shaft power corresponding to 2.4 kW of electric power. The heat input is 10 kW representing a shaft efficiency of 30% and an electric efficiency of 24%. Helium at 8 MPa mean pressure is used as the working gas. The crank...... for X-heads. A grease-lubricated needle and ball bearings are used in the kinematic crank mechanism. The burner includes an air preheater and a water jacket which makes it possible to utilize nearly all of the heat from the combustion gases. The performance of the engine has been tested as a function...

38 CFR 52.220 - Transportation.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Transportation. 52.220... FOR ADULT DAY HEALTH CARE OF VETERANS IN STATE HOMES Standards § 52.220 Transportation. Transportation... management must provide or contract for transportation to enable participants, including persons with...

Soil as a source of indoor 220Rn

International Nuclear Information System (INIS)

Li, Y.; Schery, S.D.; Turk, B.

1992-01-01

Two suggestions for sources of indoor 220Rn (thoron) have appeared in the literature: (1) building materials and outside air, and (2) soil beneath the house. Due to the difficulty of 220Rn measurement and limited data, both suggestions lack sufficient supporting evidence. We have investigated sources of indoor 220Rn in seven occupied houses in northern New Mexico, U.S. A two-filter system was used to measure indoor 220Rn levels continuously, and 220Rn progeny were measured with single filters and specialized alpha-track detectors. The amount of 220Rn entry from soil was curtailed by cutting off soil gas flow to the indoor air with subfloor depressurization mitigation systems. Four of the houses showed significant reductions in 220Rn with mitigation systems on. The average effect for these houses was to reduce indoor 220Rn levels by 70%. The other three houses had no clear reductions but in one of these houses, the mitigation system was not effective for stopping soil gas flow. Our results provide some of the most clear evidence to date supporting soil as an important source of indoor 220Rn

49 CFR 220.38 - Communication equipment failure.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Communication equipment failure. 220.38 Section 220.38 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... § 220.38 Communication equipment failure. (a) Any radio or wireless communication device found not to be...

24 CFR 220.801 - Initial insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Initial insurance endorsement. 220.801 Section 220.801 Housing and Urban Development Regulations Relating to Housing and Urban... AREAS Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.801 Initial...

Organic Rankine Kilowatt Isotope Power System. Final phase I report

International Nuclear Information System (INIS)

1978-01-01

On 1 August 1975 under Department of Energy Contract EN-77-C-02-4299, Sundstrand Energy Systems commenced development of a Kilowatt Isotope Power System (KIPS) directed toward satisfying the higher power requirements of satellites of the 1980s and beyond. The KIPS is a 238 PuO 2 fueled organic Rankine cycle turbine power system which will provide design output power in the range of 500 to 2000 W/sub (e)/ with a minimum of system changes. The principal objectives of the Phase 1 development effort were to: conceptually design a flight system; design a Ground Demonstration System (GDS) that is prototypic of the flight system in order to prove the feasibility of the flight system design; fabricate and assemble the GDS; and performance and endurance test the GDS using electric heaters in lieu of the isotope heat source. Results of the work performed under the Phase 1 contract to 1 July 1978 are presented

40 CFR 91.1307 - Credit calculation.

Science.gov (United States)

2010-07-01

... family in kW (sales weighted). The power of each configuration is the rated output in kilowatts as....1307 Credit calculation. For each participating engine family, emission credits (positive or negative... for an engine family whether generating positive or negative in-use emission credits: ER04oc96.053...

Compact Source of Electron Beam with Energy of 200 kEv and Average Power of 2 kW

CERN Document Server

Kazarezov, Ivan; Balakin, Vladimir E; Bryazgin, Alex; Bulatov, Alexandre; Glazkov, Ivan; Kokin, Evgeny; Krainov, Gennady; Kuznetsov, Gennady I; Molokoedov, Andrey; Tuvik, Alfred

2005-01-01

The paper describes a compact electron beam source with average electron energy of 200 keV. The source operates with pulse power up to 2 MW under average power not higher than 2 kW, pulsed beam current up to 10 A, pulse duration up to 2 mks, and repetition rate up to 5 kHz. The electron beam is extracted through aluminium-beryllium alloy foil. The pulse duration and repetition rate can be changed from control desk. High-voltage generator for the source with output voltage up to 220 kV is realized using the voltage-doubling circuit which consists of 30 sections. The insulation type - gas, SF6 under pressure of 8 atm. The cooling of the foil supporting tubes is provided by a water-alcohol mixture from an independent source. The beam output window dimensions are 180?75 mm, the energy spread in the beam +10/-30%, the source weight is 80 kg.

49 CFR 220.301 - Purpose and application.

Science.gov (United States)

2010-10-01

... being distracted by the inappropriate use of electronic devices, such as mobile telephones (cell phones... 49 Transportation 4 2010-10-01 2010-10-01 false Purpose and application. 220.301 Section 220.301..., DEPARTMENT OF TRANSPORTATION RAILROAD COMMUNICATIONS Electronic Devices § 220.301 Purpose and application. (a...

20 CFR 220.63 - Conflict of interest.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Conflict of interest. 220.63 Section 220.63 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.63 Conflict of interest. All implications of possible conflict of...

7 CFR 3052.220 - Frequency of audits.

Science.gov (United States)

2010-01-01

... 7 Agriculture 15 2010-01-01 2010-01-01 false Frequency of audits. 3052.220 Section 3052.220 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 3052.220...

12 CFR 19.220 - Scope.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Scope. 19.220 Section 19.220 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE Procedures for... the OCC pursuant to section 38 of the Federal Deposit Insurance Act and this part. ...

20 CFR 220.35 - Introduction.

Science.gov (United States)

2010-04-01

... term is defined in the Social Security Act. In making these decisions the Board must apply the... Services in making disability decisions under the Social Security Act. Regulations of the Social Security... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Introduction. 220.35 Section 220.35 Employees...

Development of 20 kW input power coupler for 1.3 GHz ERL main linac. Component test at 30 kW IOT test stand

International Nuclear Information System (INIS)

Sakai, Hiroshi; Umemori, Kensei; Sakanaka, Shogo; Takahashi, Takeshi; Furuya, Takaaki; Shinoe, Kenji; Ishii, Atsushi; Nakamura, Norio; Sawamura, Masaru

2009-01-01

We started to develop an input coupler for a 1.3 GHz ERL superconducting cavity. Required input power is about 20 kW for the cavity acceleration field of 20 MV/m and the beam current of 100 mA in energy recovery operation. The input coupler is designed based on the STF-BL input coupler and some modifications are applied to the design for the CW 20 kW power operation. We fabricated input coupler components such as ceramic windows and bellows and carried out the high-power test of the components by using a 30 kW IOT power source and a test stand constructed for the highpower test. In this report, we mainly describe the results of the high-power test of ceramic window and bellows. (author)

46 CFR 402.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 402.220 Section 402.220 Shipping... ORDERS Registration of Pilots § 402.220 Registration of pilots. (a) Each applicant pilot must complete the number of round trips specified in this section prior to registration as a U.S. registered pilot...

46 CFR 401.220 - Registration of pilots.

Science.gov (United States)

2010-10-01

... 46 Shipping 8 2010-10-01 2010-10-01 false Registration of pilots. 401.220 Section 401.220 Shipping... Registration of Pilots § 401.220 Registration of pilots. (a) The Director shall determine the number of pilots... waters of the Great Lakes and to provide for equitable participation of United States Registered Pilots...

29 CFR 99.220 - Frequency of audits.

Science.gov (United States)

2010-07-01

... 29 Labor 1 2010-07-01 2010-07-01 true Frequency of audits. 99.220 Section 99.220 Labor Office of the Secretary of Labor AUDITS OF STATES, LOCAL GOVERNMENTS, AND NON-PROFIT ORGANIZATIONS Audits § 99.220 Frequency of audits. Except for the provisions for biennial audits provided in paragraphs (a) and...

50 kW laser weapon demonstrator of Rheinmetall Waffe munition

Science.gov (United States)

Ludewigt, K.; Riesbeck, Th.; Graf, A.; Jung, M.

2013-10-01

We will present the setup of a 50 kW Laser Weapon Demonstrator (LWD) and results achieved with this system. The LWD is a ground based Air Defence system consisting of a Skyguard sensor unit for target acquisition and two laser equipped weapon turrets. The weapon turrets used are standard air defence turrets of Rheinmetall Air Defence which were equipped with several 10 kW Laser Weapon Modules (LWM). Each LWM consists of one 10 kW fiber laser and a beam forming unit (BFU). Commercial of the shelf fiber laser were modified for our defence applications. The BFU providing diffraction limited beam focusing, target imaging and fine tracking of the target was developed. The LWD was tested in a firing campaign at Rheinmetall test ground in Switzerland. All laser beams of both weapon turrets were superimposed on stationary and dynamic targets. Test results of the LWD for the scenarios Air Defence and C-RAMM (counter rockets, artillery, mortar and missiles) will be presented. An outlook for the next development stage towards a 100 kW class laser weapon on RWM will be given.

Evaluation of Suppression of Hydroprocessed Renewable Jet (HRJ) Fuel Fires with Aqueous Film Forming Foam (AFFF)

Science.gov (United States)

2011-07-01

Collecting particles from an open pan fire would preclude the consideration of isokinetic sampling usually required in Method 5, but this would...hydroprocessed renewable jet fuel in2 square inches JP-8 jet propellant 8, i.e. jet fuel kW kilowatts m2 square meters Mil-Spec Military Specification min

76 FR 63917 - Ocean Renewable Power Company, LLC; Notice of Application Accepted for Filing, Soliciting Motions...

Science.gov (United States)

2011-10-14

... Description: The primary project facilities would include: (1) A single, approximately 98.5-foot-long, cross-flow Kinetic System turbine generator unit (TGU) mounted on a bottom support frame, with a rated capacity of 60 kilowatts (kW), in Phase 1; (2) four, approximately 98.5-foot-long, cross-flow Kinetic...

12 CFR 220.101 - Transactions of customers who are brokers or dealers.

Science.gov (United States)

2010-01-01

... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Transactions of customers who are brokers or... OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.101 Transactions of customers who are brokers or dealers. The Board has recently considered certain questions...

24 CFR 220.811 - Date of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Date of default. 220.811 Section... and Obligations-Projects Insured Project Improvement Loans § 220.811 Date of default. For the purposes of §§ 220.800 et seq., the date of default shall be considered as: (a) The date of the first...

24 CFR 220.812 - Notice of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Notice of default. 220.812 Section... and Obligations-Projects Insured Project Improvement Loans § 220.812 Notice of default. (a) If the default as defined in § 220.810 is not cured within the 30 day grace period, the lender shall, within 30...

Design study of wind turbines, 50 kW to 3000 kW for electric utility applications: Executive summary

Science.gov (United States)

1977-01-01

Preliminary designs of low power (50 to 500 kW) and high power (500 to 3000 kW) wind generator systems (WGS) for electric utility applications were developed. These designs provide the bases for detail design, fabrication, and experimental demonstration testing of these units at selected utility sites. Several feasible WGS configurations were evaluated, and the concept offering the lowest energy cost potential and minimum technical risk for utility applications was selected. The selected concept was optimized utilizing a parametric computer program prepared for this purpose. The utility requirements evaluation task examined the economic, operational and institutional factors affecting the WGS in a utility environment, and provided additional guidance for the preliminary design effort. Results of the conceptual design task indicated that a rotor operating at constant speed, driving an AC generator through a gear transmission is the most cost effective WGS configuration.

Electric propulsion options for 10 kW class earth space missions

Science.gov (United States)

Patterson, M. J.; Curran, Francis M.

1989-01-01

Five and 10 kW ion and arcjet propulsion system options for a near-term space demonstration experiment have been evaluated. Analyses were conducted to determine first-order propulsion system performance and system component mass estimates. Overall mission performance of the electric propulsion systems was quantified in terms of the maximum thrusting time, total impulse, and velocity increment capability available when integrated onto a generic spacecraft under fixed mission model assumptions. Maximum available thrusting times for the ion-propelled spacecraft options, launched on a DELTA II 6920 vehicle, range from approximately 8,600 hours for a 4-engine 10 kW system to more than 29,600 hours for a single-engine 5 kW system. Maximum total impulse values and maximum delta-v's range from 1.2x10(7) to 2.1x10(7) N-s, and 3550 to 6200 m/s, respectively. Maximum available thrusting times for the arcjet propelled spacecraft launched on the DELTA II 6920 vehicle range from approximately 528 hours for the 6-engine 10 kW hydrazine system to 2328 hours for the single-engine 5 kW system. Maximum total impulse values and maximum delta-v's range from 2.2x10(6) to 3.6x10(6) N-s, and approximately 662 to 1072 m/s, respectively.

Electric Propulsion Options for 10 kW Class Earth-Space Missions

Science.gov (United States)

Patterson, M. J.; Curran, Francis M.

1989-01-01

Five and 10 kW ion and arcjet propulsion system options for a near-term space demonstration experiment were evaluated. Analyses were conducted to determine first-order propulsion system performance and system component mass estimates. Overall mission performance of the electric propulsion systems was quantified in terms of the maximum thrusting time, total impulse, and velocity increment capability available when integrated onto a generic spacecraft under fixed mission model assumptions. Maximum available thrusting times for the ion-propelled spacecraft options, launched on a DELTA 2 6920 vehicle, range from approximately 8,600 hours for a 4-engine 10 kW system to more than 29,600 hours for a single-engine 5 kW system. Maximum total impulse values and maximum delta-v's range from 1.2x10 (exp 7) to 2.1x10 (exp 7) N-s, and 3550 to 6200 m/s, respectively. Maximum available thrusting times for the arcjet propelled spacecraft launched on the DELTA 2 6920 vehicle range from approximately 528 hours for the 6-engine 10 kW hydrazine system to 2328 hours for the single-engine 5 kW system. Maximum total impulse values and maximum delta-v's range from 2.2x10 (exp 6) to 3.6x10 (exp 6) N-s, and approximately 662 to 1072 m/s, respectively.

Design study of wind turbines 50 kW to 3000 kW for electric utility applications. Volume 1: Summary report

Science.gov (United States)

1976-01-01

Wind turbine configurations that would lead to generation of electrical power in a cost effective manner were considered. All possible overall system configurationss, operating modes, and sybsystem concepts were evaluated for both technical feasibility and compatibility with utility networks, as well as for economic attractiveness. A design optimization computer code was developed to determine the cost sensitivity of the various design features, and thus establish the configuration and design conditions that would minimize the generated energy costs. The preliminary designs of both a 500 kW unit and a 1500 kW unit operating in a 12 mph and 18 mph median wind speed respectively, were developed. The rationale employed and the key findings are summarized.

CompTIA A+ complete study guide exams 220-801 and 220-802

CERN Document Server

Docter, Quentin; Skandier, Toby

2012-01-01

CompTIA Authorized, fully updated Study Guide for the leading IT certification: CompTIA A+ CompTIA A+ is the de facto certification for IT technicians. Some vendors even require employees to achieve certification as part of their job training. This book prepares you for both required exams: 220-801 and 220-802. Totally updated to cover the 2012 exams, this popular prep guide covers all the exam objectives. Readers will also have access to additional study tools, including the Sybex Test Engine with bonus practice exams, electronic flashcards, and a glossary of important terms in searchable PD

78 FR 77765 - Self-Regulatory Organizations; NYSE Arca, Inc.; Notice of Filing and Immediate Effectiveness of...

Science.gov (United States)

2013-12-24

... kilowatts (``kWs'') of power.\\7\\ Consistent with existing pricing for dedicated cabinets, the Exchange would... power or limited cabinet space, as compared to pricing for a dedicated cabinet, whereas a dedicated...,500 per eight-rack unit. The monthly recurring fee would be $1,500 for one kW of allocated power and...

An assessment method of dose equivalent due to indoor 220Rn progeny by using 220Rn concentration measured at a 20 cm distance from wall

International Nuclear Information System (INIS)

Iida, T.; Ikebe, Y.; Okamoto, K.; Guo, Q.; Yamasaki, T.

1996-01-01

A pair of passive cup monitors with a different air exchange openings was developed for measuring simultaneously 222 Rn and 220 Rn concentrations. Indoor 220 Rn concentrations were very high in traditional Japanese dwellings with soil walls. The 220 Rn concentration decreases exponentially with the distance from wall. The effective diffusion coefficient of 220 Rn in dwelling and the exhalation rate of 220 Rn from wall were evaluated from the distribution of the 220 Rn concentrations. Then, indoor 220 Rn progeny concentration could be estimated from the 220 Rn concentration at a 20 cm distance from wall. From the results of the surveys. the average annual effective dose equivalent due to 220 Rn progeny was expected to be 0.67 mSv/year in the traditional Japanese dwellings. (author)

Engineering and erection of a 300kW high-flux solar simulator

Science.gov (United States)

Wieghardt, Kai; Laaber, Dmitrij; Hilger, Patrick; Dohmen, Volkmar; Funken, Karl-Heinz; Hoffschmidt, Bernhard

2017-06-01

German Aerospace Center (DLR) is currently constructing a new high-flux solar simulator synlight which shall be commissioned in late 2016. The new facility will provide three separately operated experimental spaces with expected radiant powers of about 300kW / 240kW / 240kW respectively. synlight was presented to the public for the first time at SolarPACES 2015 [1]. Its engineering and erection is running according to plan. The current presentation reports about the engineering and the ongoing erection of the novel facility, and gives an outlook on its new level of possibilities for solar testing and qualification.

40 CFR 300.220 - Related Title III issues.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Related Title III issues. 300.220 Section 300.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SUPERFUND, EMERGENCY... PLAN Planning and Preparedness § 300.220 Related Title III issues. Other related Title III requirements...

7 CFR 220.1 - General purpose and scope.

Science.gov (United States)

2010-01-01

... 7 Agriculture 4 2010-01-01 2010-01-01 false General purpose and scope. 220.1 Section 220.1 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.1 General purpose and scope. This part...

Efficient pump module coupling >1kW from a compact detachable fiber

Science.gov (United States)

Dogan, M.; Chin, R. H.; Fulghum, S.; Jacob, J. H.; Chin, A. K.

2018-02-01

In the most developed fiber amplifiers, optical pump power is introduced into the 400μm-diameter, 0.46NA first cladding of the double-clad, Yb-doped, gain fiber, using a (6+1):1 multi-mode fiber combiner. For this configuration, the core diameter and numerical aperture of the pump delivery fibers have maximum values of 225μm and 0.22, respectively. This paper presents the first fiber-coupled laser-diode pump module emitting more than 1kW of claddingmode- stripped power from a detachable 225μm, 0.22NA delivery fiber at 976nm. The electrical-to-optical power conversion efficiency at 1kW is 50%. The FWHM spectral width at 1kW output is 4nm and has an excellent overlap with the narrow absorption spectrum of ytterbium in glass. Six of these pump modules attached to a (6+1):1 multimode combiner enable a 5-6kW, single-mode, Yb-doped fiber amplifier.

Factorisation of RSA-220 with CADO-NFS

OpenAIRE

Bai , Shi; Gaudry , Pierrick; Kruppa , Alexander; Thomé , Emmanuel; Zimmermann , Paul

2016-01-01

We give details of the factorization of RSA-220 with CADO-NFS. This is a new record computation with this open-source software. We report on the factorization of RSA-220 (220 decimal digits), which is the 3rd largest integer factorization with the General Number Field Sieve (GNFS), after the factorization of RSA-768 (232 digits) in December 2009 [3], and that of 3 697 + 1 (221 digits) in February 2015 by NFS@home.

78 FR 77750 - Self-Regulatory Organizations; NYSE MKT LLC; Notice of Filing and Immediate Effectiveness of...

Science.gov (United States)

2013-12-24

...- rack unit up to two kilowatts (``kWs'') of power.\\7\\ Consistent with existing pricing for dedicated... pricing, the Exchange believes that the partial cabinet option would be selected by Users with power... kW of allocated power and $2,700 for two kWs of allocated power.\\8\\ \\5\\ For purposes of the Exchange...

78 FR 69402 - Lock 7 Hydro Partners, LLC; Notice of Application for Amendment of License and Soliciting...

Science.gov (United States)

2013-11-19

... Commission approval to replace the turbine runner for generating unit No. 2. The runner replacement would increase the installed and hydraulic capacities of the unit by 170 kilowatts (kW) and 157 cubic feet per... and its hydraulic capacity from 2,229 cfs to 2,386 cfs. l. Locations of the Application: This filing...

75 FR 32611 - Standards of Performance for Stationary Compression Ignition and Spark Ignition Internal...

Science.gov (United States)

2010-06-08

... marine CI engines at or above 600 kilowatt (KW) (800 horsepower (HP)), the second of which was based on... preamble. The first tier of standards divides these engines by displacement. The second divides the engines...-hr (12.7 g/HP-hr) when maximum engine speed is less than 130 revolutions per minute (rpm); 45 [middot...

24 CFR 91.220 - Action plan.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Action plan. 91.220 Section 91.220 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development..., evaluate and reduce lead-based paint hazards, reduce the number of poverty-level families, develop...

40 CFR 86.220-94 - [Reserved

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false [Reserved] 86.220-94 Section 86.220-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...

24 CFR 220.804 - Insurance premiums.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Insurance premiums. 220.804 Section... and Obligations-Projects Insured Project Improvement Loans § 220.804 Insurance premiums. (a) First premium. The lender, upon the initial endorsement of the loan for insurance, shall pay to the Commissioner...

Coupling of a 2.5 kW steam reformer with a 1 kW el PEM fuel cell

Science.gov (United States)

Mathiak, J.; Heinzel, A.; Roes, J.; Kalk, Th.; Kraus, H.; Brandt, H.

The University of Duisburg-Essen has developed a compact multi-fuel steam reformer suitable for natural gas, propane and butane. This steam reformer was combined with a polymer electrolyte membrane fuel cell (PEM FC) and a system test of the process chain was performed. The fuel processor comprises a prereformer step, a primary reformer, water gas shift reactors, a steam generator, internal heat exchangers in order to achieve an optimised heat integration and an external burner for heat supply as well as a preferential oxidation step (PROX) as CO purification. The fuel processor is designed to deliver a thermal hydrogen power output from 500 W to 2.5 kW. The PEM fuel cell stack provides about 1 kW electrical power. In the following paper experimental results of measurements of the single components PEM fuel cell and fuel processor as well as results of the coupling of both to form a process chain are presented.

Experimental and computational analysis of a 1.2 kW PEMFC designed for communications backup power applications

International Nuclear Information System (INIS)

Krishnan, K.J.; Claveria, J.; Varadharajan, L.; Kalam, A.

2011-01-01

Usage of Fuel Cells due to their high power density and low greenhouse gas emissions which combine H/sub 2/ and O/sub 2/ electrochemically to produce electricity and H/sub 2/O as the by-product will become widespread in the near future due to its quality, reliability and portability. Among all types of fuel cells, Proton Exchange Membrane Fuel Cells (PEMFC) is most attractive for residential and automotive industry use due to its low operating temperature, silent operation, quick start-up characteristics and better performance. The T-1000 1.2 kW PEMFC are mainly used for communications backup power applications because of its high reliability, simplicity and ease of maintenance in telecommunication sector, utility and government etc. This paper discuses the features of T- 1000 PEMFC and also the production losses due to power outages in US and different parts of the globe and the advantages of using it in different sectors to reduce the production loses occurred by the power outages. This work focuses on the experimental data and the computational data of load, P, V, A and H/sub 2/ consumed under laboratory conditions at Power Lab in Victoria University, Melbourne. The paper also describes various load, P, V and A curves recorded at regular intervals between the experimental and computational data. The work shows notably the benefit of using T-1000 1.2 kW PEMFC for residential, automobile, government and telecom sectors. (author)

Efficient 10 kW diode-pumped Nd:YAG rod laser

Science.gov (United States)

Akiyama, Yasuhiro; Takada, Hiroyuki; Sasaki, Mitsuo; Yuasa, Hiroshi; Nishida, Naoto

2003-03-01

As a tool for high speed and high precision material processing such as cutting and welding, we developed a rod-type all-solid-state laser with an average power of more than 10 kW, an electrical-optical efficiency of more than 20%, and a laser head volume of less than 0.05 m3. We developed a highly efficient diode pumped module, and successfully obtained electrical-optical efficiencies of 22% in CW operation and 26% in QCW operation at multi-kW output powers. We also succeeded to reduce the laser head volume, and obtained the output power of 12 kW with an efficiency of 23%, and laser head volume of 0.045 m3. We transferred the technology to SHIBAURA mechatronics corp., who started to provide the LD pumped Nd:YAG laser system with output power up to 4.5 kW. We are now continuing development for further high power laser equipment.

78 FR 26359 - Community of Elfin Cove, DBA Elfin Cove Utility Commission; Notice of Preliminary Permit...

Science.gov (United States)

2013-05-06

...-kilowatt (kW) power recovery turbine; (4) a 25-foot-long, 8-foot- wide, 3-foot-deep cobble-lined tailrace... 150-foot-long, 8- foot-wide, 3-foot-deep cobble-lined tailrace discharging flows into Port Althorp... electronically via the Internet. See 18 CFR 385.2001(a)(1)(iii) and the instructions on the Commission's Web site...

Energy Resiliency for Marine Corps Logistics Base Production Plant Barstow

Science.gov (United States)

2014-12-01

13 1. Biomass, Landfill Gas, and Biogas ...value in dollar per kilowatts ($/kW) peak of an outage cost obtained from the CDF curve for a specified duration of the interruption” (Giraldez, Booth...length of outages for inclusion in the VEES calculation, we needed to obtain power interruption and circuit reliability data from PPB’s utility

75 FR 33295 - Clark-Wiltz Mining; Notice of Declaration of Intention and Petition for Relief Filing and...

Science.gov (United States)

2010-06-11

...: (1) A 1.4-meter-diameter, 9.9-meter-long, 1.4-meter-high, 15 kilowatt (kW) Cycloidal cross-flow turbine; (2) a debris guard and fish screen at the inlet; (3) a flow reduction diffuser, (4) 6 anchor pins... mechanical power from the river flow into electrical power without constructing a dam, reservoir, penstock...

Beam Transport Devices for the 10 kW IR Free Electron Laser

International Nuclear Information System (INIS)

Lawrence Dillon-Townes; Michael Bevins; David Kashy; Stephanie Slachtouski; Ronald Lassiter; George Neil; Michelle Shinn; Joseph Gubeli; Christopher Behre; David Douglas; David W. Waldman; George Biallas; Lawrence Munk; Christopher Gould

2005-01-01

Beam transport components for the 10kW IR Free Electron Laser (FEL) at Thomas Jefferson National Accelerator Facility (Jefferson Lab) were designed to manage (1) electron beam transport and (2) photon beam transport. An overview of the components will be presented in this paper. The electron beam transport components were designed to address RF heating, maintain an accelerator transport vacuum of 1 x 10 -8 torr, deliver photons to the optical cavity, and provide 50 kW of beam absorption during the energy recovery process. The components presented include a novel shielded bellows, a novel zero length beam clipper, a one decade differential pumping station with a 7.62 cm (3.0 inch) aperture, and a 50 kW beam dump. The photon beam transport components were designed to address the management of photons delivered by the accelerator transport. The optical cavity manages the photons and optical transport delivers the 10 kW of laser power to experimental labs. The optical cavity component presented is a unique high reflector vessel and the optical transport component presented is a turning mirror cassette

Output characteristics of 40 kW photovoltaic power generation system in ICT; Ibaraki kosen ni okeru 40 kW taiyoko hatsuden shisutemu no shutsuryoku tokusei

Energy Technology Data Exchange (ETDEWEB)

Sekiguchi, N. [Ibaraki National College of Tech., Ibaraki (Japan); Tani, T. [Science University of Tokyo, Tokyo (Japan)

1999-11-25

The photovoltaic power generation system consists of photovoltaic array and power conditioner of the utility connected system. The photovoltaic array parallelly constitutes 18 serial 30 of the modules of 540 sheets, and there is the generating capacity of largest 40 kW. The power conditioner uses 10 kW four units, and it is tracking with function of the maximum output point. This report examined the unconformable rate of photovoltaic array maximum output operating voltage, current and power in simulation and power conditioner input. (author)

Demonstration of the 500 kW stoker burning system; 500 kW stokeripolttojaerjestelmaen demonstrointi

Energy Technology Data Exchange (ETDEWEB)

Oravainen, H. [VTT Energy, Jyvaeskylae (Finland); Kantalainen, K. [Hoegfors Laempoe Oy, Saarijaervi (Finland)

1995-12-31

The objective of the project is to demonstrate the operation of a 500 kW stoker-burning system in practice. The project is continuation of the previous projects of the Bioenergy research programme, 303 - Development of automatic heating system for wood chips and sod peat, carried out by VTT Energy, and Y301 - Development of heating boiler for wood chips and sod peat, carried out by Hoegfors Laempoe Oy. A 500 kW (nominal power) stoker-burner was constructed on the basis of the results of these projects. The burner was mounted on ETNA 500 bioenergy boiler. Screw-feeders, constructed by Maamiehen Saehkoe Oy, were used as fuel feeding system. Maamiehen Saehkoe Oy delivered also the automation system for the combustion equipment. Combustion air pre-heater was mounted on the boiler for promotion of the combustion of moist fuel. Testing of the equipment was carried out at the laboratory of VTT Energy in Jyvaeskylae in October-November 1994. In December 1994 the equipment was transported to Jalasjaervi, to heating station of the farmer Juha Jyrae. The actual heat generation started in the beginning of February 1995, when the greenhouses started to require heating. Sod peat has been used as the fuel. VTT Energy has carried out the efficiency and emission measurements in the heating station with sod peat in March 1995, and with reed canary grass in autumn 1995. The energy generation and fuel consumption have been followed all the time

Demonstration of the 500 kW stoker burning system; 500 kW stokeripolttojaerjestelmaen demonstrointi

Energy Technology Data Exchange (ETDEWEB)

Oravainen, H [VTT Energy, Jyvaeskylae (Finland); Kantalainen, K [Hoegfors Laempoe Oy, Saarijaervi (Finland)

1996-12-31

The objective of the project is to demonstrate the operation of a 500 kW stoker-burning system in practice. The project is continuation of the previous projects of the Bioenergy research programme, 303 - Development of automatic heating system for wood chips and sod peat, carried out by VTT Energy, and Y301 - Development of heating boiler for wood chips and sod peat, carried out by Hoegfors Laempoe Oy. A 500 kW (nominal power) stoker-burner was constructed on the basis of the results of these projects. The burner was mounted on ETNA 500 bioenergy boiler. Screw-feeders, constructed by Maamiehen Saehkoe Oy, were used as fuel feeding system. Maamiehen Saehkoe Oy delivered also the automation system for the combustion equipment. Combustion air pre-heater was mounted on the boiler for promotion of the combustion of moist fuel. Testing of the equipment was carried out at the laboratory of VTT Energy in Jyvaeskylae in October-November 1994. In December 1994 the equipment was transported to Jalasjaervi, to heating station of the farmer Juha Jyrae. The actual heat generation started in the beginning of February 1995, when the greenhouses started to require heating. Sod peat has been used as the fuel. VTT Energy has carried out the efficiency and emission measurements in the heating station with sod peat in March 1995, and with reed canary grass in autumn 1995. The energy generation and fuel consumption have been followed all the time

Processing with kW fibre lasers: advantages and limits

Science.gov (United States)

Kratky, A.; Schuöcker, D.; Liedl, G.

2008-10-01

Up-to-date fibre lasers produce multi-kw radiation with an excellent beam quality. Compared to CO2-lasers, fibre lasers have relatively low operational costs and offer a very high flexibility in production due to the beam delivery with process fibres. As a consequence, fibre lasers have attracted more and more attention. On the other hand, their use in industrial applications especially in the automotive industry is still limited to a certain extent and fibre lasers haven't replaced all other laser sources till now as it could be expected. In laser cutting, the small kerf width produced by fibre lasers should be advantageous since the heated volume is smaller compared to CO2-lasers. In fact, cutting velocities are usually much higher which is also caused by the higher absorption coefficient of most metals at the wavelength emitted by fibre lasers. Nevertheless, cutting with fibre lasers of some metals - e.g. stainless steels - is restricted to a small thicknesses of approx. 5mm. The reason for this is that the surface roughness of the edges increases dramatically with the thickness of the work piece. Applications of fibre lasers include e.g. remote welding or even remote cutting of a large variety of materials with usually excellent results. Due to the excellent beam quality the aspect ratio of the weld seam in relation to the penetration depth is quite good. In the case of thin sheet metal welding such a small beam waist is beneficial - but with thicker sheet metals it is very often disadvantageous since the preparation of samples is more complicated, costs increase and requirements on clamping devices rise. In this paper, advantages and disadvantages of fibre lasers are discussed briefly. Applications of a 1.5 kW fibre laser are presented and compared to classical laser systems.

Design study of wind turbines 50 kW to 3000 kW for electric utility applications: Analysis and design

Science.gov (United States)

1976-01-01

In the conceptual design task, several feasible wind generator systems (WGS) configurations were evaluated, and the concept offering the lowest energy cost potential and minimum technical risk for utility applications was selected. In the optimization task, the selected concept was optimized utilizing a parametric computer program prepared for this purpose. In the preliminary design task, the optimized selected concept was designed and analyzed in detail. The utility requirements evaluation task examined the economic, operational, and institutional factors affecting the WGS in a utility environment, and provided additional guidance for the preliminary design effort. Results of the conceptual design task indicated that a rotor operating at constant speed, driving an AC generator through a gear transmission is the most cost effective WGS configuration. The optimization task results led to the selection of a 500 kW rating for the low power WGS and a 1500 kW rating for the high power WGS.

Development of a 200kW multi-fuel type PAFC power plant

Energy Technology Data Exchange (ETDEWEB)

Take, Tetsuo; Kuwata, Yutaka; Adachi, Masahito; Ogata, Tsutomu [NTT Integrated Information & Energy System Labs., Tokyo (Japan)

1996-12-31

Nippon Telegraph and Telephone Corporation (NFT) has been developing a 200 kW multi-fuel type PAFC power plant which can generate AC 200 kW of constant power by switching fuel from pipeline town gas to liquefied propane gas (LPG) and vice versa. This paper describes the outline of the demonstration test plant and test results of its fundamental characteristics.

Kilowatt isotope power system. Phase II plan. Volume I. Phase II program plan

International Nuclear Information System (INIS)

1978-01-01

The development of a Kilowatt Isotope Power System (KIPS) was begun in 1975 for the purpose of satisfying the power requirements of satellites in the 1980's. The KIPS is a 238 PuO 2 -fueled organic Rankine cycle turbine power system to provide a design output of 500 to 2000 W. Phase II of the overall 3-phase KIPS program is described. This volume presents a program plan for qualifying the organic Rankine power system for flight test in 1982. The program plan calls for the design and fabrication of the proposed flight power system; conducting a development and a qualification program including both environmental and endurance testing, using an electrical and a radioisotope heat source; planning for flight test and spacecraft integration; and continuing ground demonstration system testing to act as a flight system breadboard and to accumulate life data

Gas liquid sampling for closed canisters in KW Basin - test plan

International Nuclear Information System (INIS)

Pitkoff, C.C.

1995-01-01

Test procedures for the gas/liquid sampler. Characterization of the Spent Nuclear Fuel, SNF, sealed in canisters at KW-Basin is needed to determine the state of storing SNF wet. Samples of the liquid and the gas in the closed canisters will be taken to gain characterization information. Sampling equipment has been designed to retrieve gas and liquid from the closed canisters in KW basin. This plan is written to outline the test requirements for this developmental sampling equipment

36 CFR 2.20 - Skating, skateboards, and similar devices.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Skating, skateboards, and similar devices. 2.20 Section 2.20 Parks, Forests, and Public Property NATIONAL PARK SERVICE, DEPARTMENT OF THE INTERIOR RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.20 Skating, skateboards, and...

Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2013-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment and considerable data is generated on the levels of 222 Rn in the environment across the worlds and is periodically reported by UNSCEAR. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. Many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. This component is not adequately estimated for any country so far on a national level. 220 Rn problem will also be a problem in industries which uses thorium nitrate. Including India lamps using thoriated gas mantles are being still used for indoor and outdoor lighting and hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this article current status of 220 Rn levels in the indoor environment workplaces as well as in other industries where large amount of 232 Th is being handled are being summarized. (author)

36 CFR 220.7 - Environmental assessment and decision notice.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental assessment and decision notice. 220.7 Section 220.7 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.7 Environmental assessment and decision notice. (a) Environmental assessment...

Environmental thoron (220Rn): a review

International Nuclear Information System (INIS)

Ramachandran, T.V.

2008-01-01

Studies on natural background radiation is a topic, which evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scare due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true from the recent studies resulted in observing high 220 Rn levels in living environments and work places in various countries and it is increasingly felt that it may be necessary to have data on 220 Rn levels in environment for obtaining a complete picture of inhalation dose. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products, like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54 % of the total natural background radiation dose received by the general population. Due to this it was necessary to supplement the external component with inhalation component. This component is not

20 CFR 220.132 - Physical exertion requirements.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Physical exertion requirements. 220.132 Section 220.132 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... of walking and standing is often necessary in carrying out job duties. Jobs are sedentary if walking...

Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV strain 220-90

Directory of Open Access Journals (Sweden)

LaPatra Scott E

2010-01-01

Full Text Available Abstract Background Infectious hematopoietic necrosis virus (IHNV is the type species of the genus Novirhabdovirus, within the family Rhabdoviridae, infecting several species of wild and hatchery reared salmonids. Similar to other rhabdoviruses, IHNV has a linear single-stranded, negative-sense RNA genome of approximately 11,000 nucleotides. The IHNV genome encodes six genes; the nucleocapsid, phosphoprotein, matrix protein, glycoprotein, non-virion protein and polymerase protein genes, respectively. This study describes molecular characterization of the virulent IHNV strain 220-90, belonging to the M genogroup, and its phylogenetic relationships with available sequences of IHNV isolates worldwide. Results The complete genomic sequence of IHNV strain 220-90 was determined from the DNA of six overlapping clones obtained by RT-PCR amplification of genomic RNA. The complete genome sequence of 220-90 comprises 11,133 nucleotides (GenBank GQ413939 with the gene order of 3'-N-P-M-G-NV-L-5'. These genes are separated by conserved gene junctions, with di-nucleotide gene spacers. An additional uracil nucleotide was found at the end of the 5'-trailer region, which was not reported before in other IHNV strains. The first 15 of the 16 nucleotides at the 3'- and 5'-termini of the genome are complementary, and the first 4 nucleotides at 3'-ends of the IHNV are identical to other novirhadoviruses. Sequence homology and phylogenetic analysis of the glycoprotein genes show that 220-90 strain is 97% identical to most of the IHNV strains. Comparison of the virulent 220-90 genomic sequences with less virulent WRAC isolate shows more than 300 nucleotides changes in the genome, which doesn't allow one to speculate putative residues involved in the virulence of IHNV. Conclusion We have molecularly characterized one of the well studied IHNV isolates, 220-90 of genogroup M, which is virulent for rainbow trout, and compared phylogenetic relationship with North American

7 CFR 220.5 - Method of payment to States.

Science.gov (United States)

2010-01-01

... reimbursement to School Food Authorities through presentation by designated State officials of a payment Voucher... 7 Agriculture 4 2010-01-01 2010-01-01 false Method of payment to States. 220.5 Section 220.5... AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.5 Method of payment to States. Funds to be...

Minimization of emissions. (CO and NO) on a 300 kW wood fuel boiler

International Nuclear Information System (INIS)

Johansson, Erik

1997-01-01

The purpose with this investigation was to study a 300 kW power plant in Ed, Dalsland that is using biomass as fuel and to reduce CO and NO-pollutants as much as possible. The experiments were performed according to statistical experimental design and the result was compared with similar studies. The most important results of the present work were: Today, the boiler is using biomass with too much moisture and that's the reason why the smoke contains a great quantity of CO. This could be reduced with a lower quantity of moisture in the biomass or rebuilding of the boiler. Doors and dampers should be fully closed so air can't pass through because that would reduce the energy losses in the smoke. The automatic control should be changed to reduce the time that biomass are not transported in to the boiler. Biomass with low content of moisture (about 15 %) are a good fuel in the boiler. The smoke needs to be measured continuously to reduce the pollutants because it is not possible to detect visually. If a low amount of oxygen in the smoke (7 %) and high amount of primary air (52 % of total air) and the plant is using low power (120 kW), pollutants is reduced. When using middle power (190 kW), a low amount of oxygen in the smoke is also needed (7%) but a smaller amount of air to the bed (40%) will reduce pollutants. The reason for this is probably that too much air in the bed will make it too cool. The result showed that by using statistical experimental design the amount of CO was reduced with 45 % to 263 ppm and the amount of NO reduced with 80 % to 30 ppm (51 mg/MJ NO 2 ) while using biomass with 34 % moisture Examination paper. 28 refs, 13 figs, 9 tabs, appendixes

40 CFR 91.104 - Exhaust emission standards for outboard and personal watercraft engines.

Science.gov (United States)

2010-07-01

... 2006 and later 81.00 (0.250 × (151 + 557/P0.9)) + 6.00 where: P = the average power of an engine family in kW (sales weighted). The power of each configuration is the rated output in kilowatts as... designate a Family Emission Limit (FEL) for HC+NOX for every engine family. The FEL may be equal to the...

OSR encapsulation basis -- 100-KW

International Nuclear Information System (INIS)

Meichle, R.H.

1995-01-01

The purpose of this report is to provide the basis for a change in the Operations Safety Requirement (OSR) encapsulated fuel storage requirements in the 105 KW fuel storage basin which will permit the handling and storing of encapsulated fuel in canisters which no longer have a water-free space in the top of the canister. The scope of this report is limited to providing the change from the perspective of the safety envelope (bases) of the Safety Analysis Report (SAR) and Operations Safety Requirements (OSR). It does not change the encapsulation process itself

1000kW on-site PAFC power plant development and demonstration

Energy Technology Data Exchange (ETDEWEB)

Satomi, Tomohide; Koike, Shunichi [Phosphoric Acid Fuel Cell Technology Research Association (PAFC-TRA), Osaka (Japan); Ishikawa, Ryou [New Energy and Industrial Technology Development Organization (NEDO), Tokyo (Japan)

1996-12-31

Phosphoric Acid Fuel Cell Technology Research Association (PAFC-TRA) and New Energy and Industrial Technology Development Organization (NEDO) have been conducting a joint project on development of a 5000kW urban energy center type PAFC power plant (pressurized) and a 1000kW on-site PAFC power plant (non-pressurized). The objective of the technical development of 1000kW on-site PAFC power plant is to realize a medium size power plant with an overall efficiency of over 70% and an electrical efficiency of over 36%, that could be installed in a large building as a cogeneration system. The components and system integration development work and the plant design were performed in 1991 and 1992. Manufacturing of the plant and installation at the test site were completed in 1994. PAC test was carried out in 1994, and generation test was started in January 1995. Demonstration test is scheduled for 1995 and 1996.

43 CFR 17.220 - Preschool, elementary, and secondary education.

Science.gov (United States)

2010-10-01

... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Preschool, elementary, and secondary education. 17.220 Section 17.220 Public Lands: Interior Office of the Secretary of the Interior NONDISCRIMINATION IN FEDERALLY ASSISTED PROGRAMS OF THE DEPARTMENT OF THE INTERIOR Nondiscrimination on the Basis of Handicap § 17.220 Preschool, elementary,...

1.8kW laser diode pumped YAG laser; Shutsuryoku 1.8kW no handotai laser reiki YAG laser

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-03-01

Toshiba Corporation, as a participant in Ministry of International Trade and Industry`s `photon measurement and processing technology project` since August, 1997, is engaged in the development of an energy-efficient LD (laser diode) pumped semiconductor YAG (yttrium-aluminum-garnet) laser device to be used for welding and cutting. It is a 5-year project and the goal is a mean output of 10kW and efficiency of 20%. In this article, a simulation program is developed which carries out calculation about element technology items such as the tracking of the beam from the pumping LD and the excitation distribution, temperature distribution, thermal stress distribution, etc., in the YAG rod. An oscillator is constructed, based on the results of the simulation, and it exhibits a world-high class continuous laser performance of a 1.8kW output and 13% efficiency. The record of 13% efficiency is five times higher than that achieved by the conventional lamp-driven YAG laser device. (translated by NEDO)

A 2.5-kW industrial CO2 laser

Science.gov (United States)

Golov, V. K.; Ivanchenko, A. I.; Krasheninnikov, V. V.; Ponomarenko, A. G.; Shepelenko, A. A.

1986-06-01

A fast-flow laser is reported in which the active medium is excited by a self-sustained dc discharge produced by an electric-discharge device with nonsectioned electrodes. In the laser, two discharge gaps are formed by a flat anode and two cathodes, one on each side of the anode. A gas mixture is driven through the gasdynamic channel by a centrifugal fan rotating at 6000 rpm/min. With a mixture of CO2:N2:He = 2.5:7.5:5 mm Hg, the rated power is 2.5 kW; the maximum power is 4 kW with the mixture 2.5:7.5:10 mm Hg. The general design of the laser is described, and its principal performance characteristics are given.

24 CFR 220.810 - Definition of default.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Definition of default. 220.810... Contract Rights and Obligations-Projects Insured Project Improvement Loans § 220.810 Definition of default... note or security instrument and such default continues for a period of 30 days, the note or security...

33 CFR 2.20 - Territorial sea baseline.

Science.gov (United States)

2010-07-01

... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Territorial sea baseline. 2.20... JURISDICTION Jurisdictional Terms § 2.20 Territorial sea baseline. Territorial sea baseline means the line.... Normally, the territorial sea baseline is the mean low water line along the coast of the United States...

Efficient IEC permanent-magnet motor (3 kW) - Final report; Effizienter IEC Permanent-Magnet-Motor (3 kW) - Schlussbericht

Energy Technology Data Exchange (ETDEWEB)

Lindegger, M. [Circle Motor AG, Guemligen (Switzerland); Biner, H. P.; Evequoz, B. [Haute Ecole valaisanne, Sion (Switzerland); Salathe, D. [Hochschule Luzern, Technik und Architektur, Horw (Switzerland)

2008-04-15

Efficient permanent-magnet motors achieve in the area up to 100 kW a higher efficiency than induction machines (standard motors). A simple and fast energy saving option is the exchange of inefficient standard motors. The objective of this work is to install a 3 kW permanent-magnet motor in a standard IEC housing and the optimization of the design for high efficiency. Another objective is the development and the realization of an efficient variable speed control. The efficiency of the motor and the inverter with the control system must be demonstrated by tests. These tasks have been split between Circle Motor AG and the universities of applied sciences of Valais and Lucerne. Considering high-efficiency and low manufacturing cost, a brushless DC solution was adopted. This resulted in an optimum design of the motor and the control system realized with a three-phase rectifier, a buck converter with variable DC voltage, and a three-phase inverter feeding full positive and negative current to two of the legs simultaneously. The maximum measured efficiency is about 96.5% for the inverter and 92% for the motor. With the advantage of the variable speed operation, the efficiency of the realized 3 kW permanent magnet motor together with the control system is always higher than the efficiency of a measured class EFF1 induction motor, even with a direct connection to the grid. The permanent-magnet motor is also about 10 kg lighter. The cost calculation shows that the permanent-magnet motor can be competitive with the induction motor when speed control is desired. This is also the domain with the largest potential for energy savings from variable speed pumps, compressors, fans. (author)

40 kW Stirling Engine for Solid Fuel

DEFF Research Database (Denmark)

Carlsen, Henrik; Trærup, Jens

1996-01-01

The external combustion in a Stirling engine makes it very attractive for utilisation of solid fuels in decentralised combined heat and power (CHP) plants. Only a few projects have concentrated on the development of Stirling engines specifically for biomass. In this project, a Stirling engine has...... been designed primarily for utilisation of wood chips. Maximum shaft power is 40 kW corresponding to an electric output of 36 kW. Biomass needs more space in the combustion chamber compared to gas and liquid fuels, and a large heat transfer area is necessary. The design of the new Stirling engine has...... been adapted to the special demands of combustion of wood chips, resulting in a large engine compared to engines for gas or liquid fuels. The engine has four-cylinders arranged in a square. The design is made as a hermetic unit, where the alternator is built into the pressurised crankcase so...

SWGELLA DYSENTERIAE TYPE 1 IN KwAZuLU-NATAL

African Journals Online (AJOL)

-control. 1995: 15. ure co. LABORATORY SURV~ILLAN.CEOF. SWGELLA DYSENTERIAE TYPE 1 IN. KwAZuLU- ... freeze-dried quality-eontrol specimens were prepared containing ... (National Committee for Clinical Laboratory Standards,.

Post-assembly magnetization of a 100 kW high speed permanent magnet rotor.

Science.gov (United States)

Lv, Yiliang; Wang, Guobin; Li, Liang

2015-03-01

A post-assembly magnetizing fixture has been designed and successfully used to magnetize the rotor of a 100 kW high speed permanent magnet synchronous motor. The rotor is a solid cylinder with outer diameter of 80 mm and total length of 515 mm. The permanent magnet material is samarium-cobalt (Sm2Co17) with saturation magnetizing field of 6 T. The mechanical stability of the magnetizing fixture has been studied as well as the general design methodology. The magnetizing coil is subdivided in order to reduce the electromagnetic force, and the coils are separately reinforced in different ways. The electromagnetic and structural optimization is performed by finite element analysis and verified by experiments.

Post-assembly magnetization of a 100 kW high speed permanent magnet rotor

International Nuclear Information System (INIS)

Lv, Yiliang; Wang, Guobin; Li, Liang

2015-01-01

A post-assembly magnetizing fixture has been designed and successfully used to magnetize the rotor of a 100 kW high speed permanent magnet synchronous motor. The rotor is a solid cylinder with outer diameter of 80 mm and total length of 515 mm. The permanent magnet material is samarium-cobalt (Sm 2 Co 17 ) with saturation magnetizing field of 6 T. The mechanical stability of the magnetizing fixture has been studied as well as the general design methodology. The magnetizing coil is subdivided in order to reduce the electromagnetic force, and the coils are separately reinforced in different ways. The electromagnetic and structural optimization is performed by finite element analysis and verified by experiments

Post-assembly magnetization of a 100 kW high speed permanent magnet rotor

Energy Technology Data Exchange (ETDEWEB)

Lv, Yiliang; Wang, Guobin [Wuhan National High Magnetic Field Center, Huazhong University of Science and Technology, Wuhan (China); Li, Liang [Wuhan National High Magnetic Field Center, Huazhong University of Science and Technology, Wuhan (China); State Key Laboratory of Advanced Electromagnetic Engineering and Technology, Huazhong University of Science and Technology, Wuhan (China)

2015-03-15

A post-assembly magnetizing fixture has been designed and successfully used to magnetize the rotor of a 100 kW high speed permanent magnet synchronous motor. The rotor is a solid cylinder with outer diameter of 80 mm and total length of 515 mm. The permanent magnet material is samarium-cobalt (Sm{sub 2}Co{sub 17}) with saturation magnetizing field of 6 T. The mechanical stability of the magnetizing fixture has been studied as well as the general design methodology. The magnetizing coil is subdivided in order to reduce the electromagnetic force, and the coils are separately reinforced in different ways. The electromagnetic and structural optimization is performed by finite element analysis and verified by experiments.

12 CFR 220.128 - Treatment of simultaneous long and short positions in the same margin account when put or call...

Science.gov (United States)

2010-01-01

... OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T... Board was recently asked whether under Regulation T, “Credit by Brokers and Dealers” (12 CFR part 220...) The amount of any margin customarily required by the creditor in connection with his endorsement or...

THE EFFICACY OF THE CABLES OF 6–110 KW WITH XLPE INSULATION. Part 2

Directory of Open Access Journals (Sweden)

M. A. Korotkevich

2017-01-01

Full Text Available The assessment of the suitability of cables of 6–110 kW with XLPE insulation in comparison with cables of the same voltage but possessing paper-oil insulation has been fulfilled on the basis of the method of multi-objective optimization that makes it possible to account not only the quantitative characteristics (of reduced costs, but also qualitative ones. As an indicator of the reliability of the cable line the maximum mean time to failure (the value inversely proportional to the parameter of succession of failures, which is an order more for cable lines with XLPE insulation than for cable lines with paper insulation, is adopted. A comprehensive assessment of the convenience of installation of cable lines revealed that the installation of cable with XLPE insulation features a 1.2–1.6 times easier installation as compared to three-wire (voltage 10 kW and 1.4 times easier installation as compared to single-core oil-filled cables (voltage of 110 kW. The efficacy of the cables 6–110 kW with XLPE insulation is proved on the basis on the method of multi-objective optimization, that took into account as the costs for the construction and operation of cable lines and the reliability of its operation, ease of its installation and other quality indicators. If the goals taken into account are considered as equally important, the polyethylene-insulated cables for a voltage of 10–110 kW is more efficient as compared to three-wire (voltage 10 kW and solid (110 kW cables with paper insulation. Herewith, the cost of the cable with XLPE insulation may exceed the cost of cable with paper insulation up to two times. If the most important aim is to provide the minimum reduced costs for the construction and operation of the cable line, the use of cables with XLPE insulation for voltage of 10 kW is most advisable in individual cases.

Photoelectric installations in Tunisia

Energy Technology Data Exchange (ETDEWEB)

Darkazalli, G

1983-01-01

Four autonomous photoelectric power plants (FEU) have been in operation since February, 1983 in the village of Hamman Biadha. One of them based on a solar battery (SB) with a capacity of 29 kilowatts made of modules by the Solar Power Corporation (U.S.A.), has a storage battery (AB) with a capacity of 360 kilowatts per hour, and serves to supply alternating current, 220 volt voltage electric power to stores, a mill, a hospital, a school and streetlights near them and 22 houses. The solar battery is maintained in a maximal power mode which increases the energy production by 5 to 10 percent. As the charge of the storage battery is reduced below the assigned levels, the appropriate consumers are shut off. The daily energy productivity of the photoelectric power plant is 119 kilowatt hours per day in July and 65 kilowatt hours per day in December. A smaller variant of this photoelectric power plant with a capacity of 1.5 kilowatts provides electric power to a farm. The other two photoelectric power plants drive the irrigation systems for a greenhouse with an area of 10exp4 square meters and a fruit garden. The maximum productivity of each of them is 750 cubic meters per month with a delivery of 17 meters.

Review of 2 kW grid connected LOPF tests in Nissum Bredning

DEFF Research Database (Denmark)

Margheritini, Lucia

This report has been prepared by Per Resen and Aalborg University for the ForskVE project 10878: 2 kW grid connected LOPF test buoy. AAU has the role of reviewing and advise on the data analysis, besides compiling this report. The purpose of this project was to document the mechanical power...... production against a target power curve of a 2kW grid connected wave energy buoy in Nissum Bredning at Helligsø....

Design of 28 GHz, 200 kW Gyrotron for ECRH Applications

Science.gov (United States)

Yadav, Vivek; Singh, Udaybir; Kumar, Nitin; Kumar, Anil; Deorani, S. C.; Sinha, A. K.

2013-01-01

This paper presents the design of 28 GHz, 200 kW gyrotron for Indian TOKAMAK system. The paper reports the designs of interaction cavity, magnetron injection gun and RF window. EGUN code is used for the optimization of electron gun parameters. TE03 mode is selected as the operating mode by using the in-house developed code GCOMS. The simulation and optimization of the cavity parameters are carried out by using the Particle-in-cell, three dimensional (3-D)-electromagnetic simulation code MAGIC. The output power more than 250 kW is achieved.

50 CFR 665.220 - Hawaii coral reef ecosystem fisheries. [Reserved

Science.gov (United States)

2010-10-01

... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii coral reef ecosystem fisheries. [Reserved] 665.220 Section 665.220 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL... PACIFIC Hawaii Fisheries § 665.220 Hawaii coral reef ecosystem fisheries. [Reserved] ...

Performance of the 1 kW thermoelectric generator for diesel engines

International Nuclear Information System (INIS)

Bass, J.C.; Elsner, N.B.; Leavitt, F.A.

1994-01-01

Hi-Z Technology, Inc. (Hi-Z) has been developing a 1 kW thermoelectric generator for class eight Diesel truck engines under U.S. Department of Energy and California Energy Commission funding since 1992. The purpose of this generator is to replace the currently used shaft-driven alternator by converting part of the waste heat in the engine's exhaust directly to electricity. The preliminary design of this generator was reported at the 1992 meeting of the XI-ICT in Arlington, Texas. This paper will report on the final mechanical, thermal and thermoelectric design of this generator. The generator uses seventy-two of Hi-Z's 13 Watt bismuth-telluride thermoelectric modules for energy conversion. The number of modules and their arrangement has remained constant through the program. The 1 kW generator was tested on several engines during the development process. Many of the design features were changed during this development as more information was obtained. We have only recently reached our design goal of 1 kW output. The output parameters of the generator are reported. copyright 1995 American Institute of Physics

Generating a high brightness multi-kilowatt laser by dense spectral combination of VBG stabilized single emitter laser diodes

Science.gov (United States)

Fritsche, H.; Koch, Ralf; Krusche, B.; Ferrario, F.; Grohe, Andreas; Pflueger, S.; Gries, W.

2014-05-01

Generating high power laser radiation with diode lasers is commonly realized by geometrical stacking of diode bars, which results in high output power but poor beam parameter product (BPP). The accessible brightness in this approach is limited by the fill factor, both in slow and fast axis. By using a geometry that accesses the BPP of the individual diodes, generating a multi kilowatt diode laser with a BPP comparable to fiber lasers is possible. We will demonstrate such a modular approach for generating multi kilowatt lasers by combining single emitter diode lasers. Single emitter diodes have advantages over bars, mainly a simplified cooling, better reliability and a higher brightness per emitter. Additionally, because single emitters can be arranged in many different geometries, they allow building laser modules where the brightness of the single emitters is preserved. In order to maintain the high brightness of the single emitter we developed a modular laser design which uses single emitters in a staircase arrangement, then coupling two of those bases with polarization combination which is our basic module. Those modules generate up to 160 W with a BPP better than 7.5 mm*mrad. For further power scaling wavelength stabilization is crucial. The wavelength is stabilized with only one Volume Bragg Grating (VBG) in front of a base providing the very same feedback to all of the laser diodes. This results in a bandwidth of BPP better than 7.5 mm*mrad, which can easily coupled into a 100 μm fiber and 0.15 NA.

Dynamical Investigation of Asteroid 66391 (1999 KW4)

Science.gov (United States)

Scheeres, Daniel J.; Fahnestock, E. G.; Ostro, S. J.; Margot, J. L.; Benner, L. A.; Broschart, S. B.; Bellerose, J.; Giorgini, J. D.; Nolan, M. C.; Magri, C.; Pravec, P.; Scheirich, P.; Rose, R.; Jurgens, R. F.; Suzuki, S.; DeJong, E. M.

2006-09-01

Radar imaging and simulation of the binary near-Earth asteroid 66391 (1999 KW4) reveals a system with highly unusual physical and dynamical properties (Ostro et al., DPS 2006). Classical treatments and previous analyses of binary-system dynamics have made assumptions about the component shapes that are not valid for the KW4 system. We have explored the full dynamics of the KW4 system via numerical simulations that solve the equations of motion for the coupled evolution of orbit and rotation, using radar-derived physical models, and using dynamical constraints from the observations to guide our initial conditions. Our simulations model the translational (or orbital) dynamics as the relative motion between the body centers of mass and model the rotational dynamics using the Euler equations and attitude kinematic equations for each body. All the equations are driven by the mutual gravitational potential, which is an explicit function of the relative position and attitude of the two bodies. Propagation of the system's dynamical evolution over time spans of months has been made tractable by using a novel variational integrator that requires only one evaluation per time step but conserves the symplectic properties of the dynamical system, and by implementing the evaluations on a parallel computer, using up to 256 processors. Our simulations use the component shapes, masses, and average orbit as initial conditions for integrations of the components' spins and mutual orbit, taking into consideration the actual gravitational potentials produced by the model shapes and the coupling between the components' motions. Our results reveal this NEA to have extraordinary physical and dynamical properties, which suggest intriguing possibilities for formation and evolution mechanisms.

The MTX computer control system for the 400 kilowatt 140 Ghz gyrotron

International Nuclear Information System (INIS)

Jackson, M.C.; Ferguson, S.W.; Petersen, D.E.

1992-01-01

This paper reports on a 400 kilowatt, 140 Ghz gyrotron employed on MTX as a source of direct plasma heating and, additionally, as a driver for a free electron laser, which is used for plasma heating. The control system that operates this gyrotron uses a new graphics oriented software system called TACL (Thaumaturgic Automated Control Logic) developed by the Continuous Electron Beam Accelerator Facility (CEBAF) and owned by DOE. This control language does not require a software specialist, but is easily handled by the engineer or technician working on the system. All control logic and custom displays are entered via graphics oriented editors and no actual lines of code need to be written. The graphics displays make the gyrotron operation quite simple and allow individual users to define displays to meet their own needs or develop one for a specific set of tests to be run. The system, additionally, can be used for data logging functions, which have been found quite useful in tracking long term trends in vacion current and calorimetry of gyrotron cooling circuits

To future generations....

Energy Technology Data Exchange (ETDEWEB)

Drees, H.M. [Dutch Energy Corp., Rhenen (Netherlands)

1997-12-31

One of the world`s first 500 kW turbines was installed in the Netherlands in 1989. This forerunner of the current NedWind 500 kW range also represents the earliest predesign of the NedWind megawatt turbine. After the first turbines several design modifications followed, e.g. rotor diameter was increased and a tip brake was added. After that polyester blades were introduced and rotor diameter was further increased. The drive train was also redesigned. Improvements on the 500 kW turbine concept resulted in decreased cost and increased annual energy output. The 500 kW turbines serve in the first Dutch off-shore wind farm installed in 1994. This pilot project established proof that off-shore implementation is a promising option for the Dutch energy supply. Installation of megawatt turbines off-shore is currently being studied. Wind energy can substantially contribute to electricity supply. Maximum output in kilowatt-hours is the target.

42 CFR 403.220 - Supplemental Health Insurance Panel.

Science.gov (United States)

2010-10-01

... 42 Public Health 2 2010-10-01 2010-10-01 false Supplemental Health Insurance Panel. 403.220... Programs § 403.220 Supplemental Health Insurance Panel. (a) Membership. The Supplemental Health Insurance... determines whether or not a State regulatory program for Medicare supplemental health insurance policies...

Thermal simulation for 35 kW powered prototype radio frequency quadrapole

International Nuclear Information System (INIS)

Kothari, Ashok; Ahuja, Rajeev; Safvan, C.P.; Kumar, Sugam

2011-01-01

As part of the accelerator augmentation program at IUAC, a high current injector (HCI) is being developed to inject highly charged ions into the superconducting LINAC. The HCI consists of a superconducting (High T c ) ECR source operated on a high voltage deck, producing the high currents of highly charged ions. The ion beams produced by the ECR (PKDELIS) source will be injected into a Radio Frequency Quadrupole accelerator (RFQ) and be accelerated to 180 keV/u. RF power of about 100 kW at 48.5 MHz will be fed to the RFQ during it's actual working. Most of the power fed is dissipated in the system as heat. So a continuous removal of this heat is necessary to maintain tuning parameters and normal running of the RFQ. The IUAC RFQ is a four rod cavity structure consisting of individual, demountable vanes on vane posts. All the components are made of copper except the high vacuum chamber. High vacuum chamber is made of stainless steel and electroplated with 100 microns copper on the inner surface. To take out the heat from the system cooling holes for water circulation are provided in the design of the vanes and vane posts, which together form cooling circuits. There are fourteen vanes in three different lengths and these are mounted on five vane posts. Water enters and exits from the vane posts base. From each post it enters into two or three circuits in parallel and exits into the next vane post and the flow combines again. In effect five cooling circuits are further divided into fourteen circuits. Thermal design of the system is analyzed and optimized using a computational fluid dynamics (CFD) software. The CFD software simultaneously solves the equations of mass, momentum and energy with the given structure, material, fluid and applied boundary conditions. An actual 3-dimensional model of the assembly was made using Solidworks modelling software. To save on simulation time, small holes and minor components were suppressed during analysis. The software used for

49 CFR 220.23 - Publication of radio information.

Science.gov (United States)

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Publication of radio information. 220.23 Section... § 220.23 Publication of radio information. Each railroad shall designate where radio base stations are.... The publication shall indicate the periods during which base and wayside radio stations are...

Design and operational experience and testing of 50 kW/120 kHz oscillator for 3 MeV, 30 kW DC accelerator

International Nuclear Information System (INIS)

Srivastava, S.K.; Bakhtsingh, R.I.; Saroj, P.C.

2011-01-01

A 3 MeV, 30 kW dc industrial electron beam Accelerator is being developed at EBC, Kharghar, Navi Mumbai. The 3 MV dc is generated by parallel coupled voltage multiplier operating at 120 kHz. This requires an input voltage of 150 kV-0-150 kV at 120 kHz. This is achieved by 50 kW/120 kHz power oscillator in conjunction with a tuned air-core step-up transformer. Input primary voltage of 6 kV-0-6 kV at 120 kHz is generated by an oscillator using BW1121J2 water cooled triodes in push-pull Colpitts configuration. The tank circuit for the oscillator is formed by the secondary winding inductance of the step-up transformer and capacitance formed by RF feeder electrodes of the voltage multiplier column. Grid feedback for the oscillator is derived by arranging a set of electrodes in the feeder assembly in a capacitive divider configuration. The oscillator is operated in class-C mode with grid leak bias for better efficiency which also has the advantages of self-adjustment with varying load conditions. High power test has been conducted in a simulated test set-up on dummy load up to 30kW. Subsequently, the power oscillator has been tested with HV multiplier at 1MeV level satisfactorily. This paper describes the design, test results and operational experiences of the oscillator. (author)

20 CFR 404.220 - Average-monthly-wage method.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Average-monthly-wage method. 404.220 Section... INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Monthly-Wage Method of Computing Primary Insurance Amounts § 404.220 Average-monthly-wage method. (a) Who is eligible for this method. You must...

47 CFR 25.220 - Non-conforming transmit/receive earth station operations.

Science.gov (United States)

2010-10-01

... 47 Telecommunication 2 2010-10-01 2010-10-01 false Non-conforming transmit/receive earth station operations. 25.220 Section 25.220 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Technical Standards § 25.220 Non-conforming transmit/receive...

Development of 1 kW Stirling cryocooler using a linear compressor

International Nuclear Information System (INIS)

Ko, J; Kim, H; Hong, Y J; Yeom, H; In, S; Park, S J

2015-01-01

Cryogenic cooling systems for HTS electric power devices require a reliable and efficient high-capacity cryocooler. A Striling cryocooler with a linear compressor can be a good candidate. It has advantages of low vibration and long maintenance cycle compared with a kinematic-driven Stirling cryocooler. In this study, we developed a dual-opposed linear compressor of 12 kW electric input power with two 6 kW linear motors. Electrical performance of the fabricated linear compressor is verified by experimental measurement of thrust constant. The developed Stirling cryocooler has a gamma-type configuration. The piston and displacer are supported with a flexure spring. A slit-type heat exchanger is adopted for the cold and warm-end, and the generated heat is rejected by cooling water. In the cooling performance test, waveforms of voltage, current, displacement and pressure are obtained and their amplitude and phase difference are analysed. The developed cryocooler reaches 47.8 K within 23.4 min. with no-load. Heat load tests shows a cooling capacity of 440 W at 78.1 K with 6.45 kW of electric input power and 19.4 of % Carnot COP. (paper)

Efficiency Investigations of a 3 kW T-Type Inverter for Switching Frequencies up to 100 kHz

DEFF Research Database (Denmark)

Anthon, Alexander; Zhang, Zhe; Andersen, Michael A. E.

2014-01-01

This paper deals with a 3kW multilevel inverter used for PV applications. A comparison has been made based on simulations using IGBTs and SiC MOSFETs to see how much efficiency can be gained when SiC diodes are used. A prototype with the same IGBTs and SiC MOSFETs has been built but using regular...... soft-recovery Si diodes instead of SiC diodes. Efficiencies and switching transitions for different switching frequencies up to 100 kHz have been measured. Thermal investigations of both IGBTs and SiC MOSFETs have been conducted to analyze the feasibility of increased switching frequencies. When Si......C MOSFETs are used in combination with Si diodes, switching frequencies could be doubled achieving the same efficiencies than the IGBT converter....

110GHz-500kW long-pulse gyrotron with built-in quasi-optical mode converter

International Nuclear Information System (INIS)

Sakamoto, Keishi; Kariya, Tsuyoshi; Hayashi, Ken-ichi.

1994-01-01

We have designed, fabricated, and tested a 110 GHz-500 kW long-pulse gyrotron. The gyrotron incorporates a quasi-optical mode converter which transforms the oscillation mode, TE 22,2 , into a Gaussian radiation beam. The adoption of a built-in mode converter enabled us to design the electron beam collector so as to be capable of tolerating a 2 MW heat load. Attention was also paid to designing the gyrotron cavity and output window so as to permit long-pulse operations. In an experiment, we observed a maximum output power of 550 kW and achieved 1.3 s operation at a power level of 410 kW. (author)

EXTREME DUST DISKS IN Arp 220 AS REVEALED BY ALMA

Energy Technology Data Exchange (ETDEWEB)

Wilson, C. D. [Department of Physics and Astronomy, McMaster University, Hamilton, ON L8S 4M1 (Canada); Rangwala, N.; Glenn, J.; Maloney, P. R. [Center for Astrophysics and Space Astronomy, 389-UCB, University of Colorado, Boulder, CO 80303 (United States); Spinoglio, L.; Pereira-Santaella, M. [Istituto di Astrofisica e Planetologia Spaziali, INAF-IAPS, Via Fosso del Cavaliere 100, I-00133 Roma (Italy)

2014-07-10

We present new images of Arp 220 from the Atacama Large Millimeter/submillimeter Array with the highest combination of frequency (691 GHz) and resolution (0.''36 × 0.''20) ever obtained for this prototypical ultraluminous infrared galaxy. The western nucleus is revealed to contain warm (200 K) dust that is optically thick (τ{sub 434} {sub μm} = 5.3), while the eastern nucleus is cooler (80 K) and somewhat less opaque (τ{sub 434} {sub μm} = 1.7). We derive full width at half-maximum diameters of 76 × ≤ 70 pc and 123 × 79 pc for the western and eastern nucleus, respectively. The two nuclei combined account for (83{sub −38}{sup +65} (calibration) {sub −34}{sup +0} (systematic))% of the total infrared luminosity of Arp 220. The luminosity surface density of the western nucleus (log (σT{sup 4})=14.3±0.2{sub −0.7}{sup +0} in units of L {sub ☉} kpc{sup –2}) appears sufficiently high to require the presence of an active galactic nucleus (AGN) or a ''hot starburst'', although the exact value depends sensitively on the brightness distribution adopted for the source. Although the role of any central AGN remains open, the inferred mean gas column densities of (0.6-1.8) × 10{sup 25} cm{sup –2} mean that any AGN in Arp 220 must be Compton-thick.

Characteristics and uses of a 250 kW TRIGA reactor

International Nuclear Information System (INIS)

Dimic, V.

1985-01-01

The 250 kW TRIGA Mark II reactor is a light water reactor with solid fuel elements in which the zirconium hydride moderator is homogeneously distributed between enriched uranium. Therefore the reactor has the large prompt negative temperature coefficient of reactivity, the fuel also has very high retention of radioactive fission products. The reactor core is a cylindrical configuration with an annular graphite reflector. The experimental facilities include a rotary specimen rack, a central incore radiation thimble, a pneumatic transfer system, and pulsing capability. Other experimental facilities include two radial and two tangential beam tubes, a graphite thermal column, and a graphite thermalizing column. At the steady state power of 250 kW the peak flux is 1x10 13 n/cm 2 s in the central test position. In addition, pulsing to about 2000 MW is usually provided giving peak fluxes of about 2x10 16 n/cm 2 sec. All TRIGA reactors produce a core-average thermal neutron flux of about 10 7 n.v per watt. Only with very large accelerators could such a high neutron flux be achieved. In order to give an appreciation for the research conducted at research reactors, the types of research could be summarized as follows: thermal neutron scattering, neutron radiography, neutron and nuclear physics, activation analysis, radiochemistry, biology and medicine, and teaching and training. Typical applied research with a 250 kW reactor has been conducted in medicine in biology, archeology, metallurgy and materials science, engineering and criminology. It is well known that research reactors have been used routinely to produce isotopes for industry and medicine. In some instances, reactors are the preferred method of isotope production. We can conclude that the 250 kW TRIGA research reactor is a useful and wide ranging source of radiation for basic and applied research. The operation cost for this instrument is relatively low. (author)

Near-infrared light and the morphology of Arp 220

International Nuclear Information System (INIS)

Smith, J.; Grasdalen, G.L.; Gehrz, R.D.; Hackwell, J.A.; Dietz, R.D.

1988-01-01

This paper presents 2.2 micron imaging and a near-IR energy distribution for the luminous galaxy Arp 220. In the near-IR, Arp 220 appears as a single isolated galaxy with the projected axial symmetry of either a face-on disk or spheroid. The near-IR images contradict the original interpretation of the galaxy as the ongoing collision of two galaxies. No single component morphology can explain the galaxy adequately; this paper explains it as a hybrid galaxy form related to the class of radio galaxies with dust lanes. Some radio galaxies have properties in common with Arp 220. Hot stars are probable sources for heating of the diffuse dust in Arp 220 and perhaps some portion of a nuclear component. Heating by a nonstellar source of ultraviolet radiation is possible at the nucleus. 31 references

First Results of the IOT Based 300 kW 500 MHz Amplifier for the Diamond Light Source

CERN Document Server

Jensen, Morten; Maddock, Matt; Müller, Marc; Rains, Simon; Watkins, Alun V

2005-01-01

We present the first RF measurements of the IOT based 300 kW 500 MHz amplifier for the Diamond Light Source. Four 80 kW IOTs are combined using a waveguide combiner to achieve the RF requirement of up to 300 kW for each of three superconducting cavities for the main storage ring. The IOTs are protected by a full power circulator and a 300 kW ferrite RF load. This is the first time IOTs will be used for a synchrotron light source. This paper gives an overview of the design of the Thales amplifiers and IOTs with commissioning results including measurements of key components and overall RF performance following factory tests and the installation of the first unit

25 CFR 1000.220 - What regulations apply to self-governance Tribes?

Science.gov (United States)

2010-04-01

... 25 Indians 2 2010-04-01 2010-04-01 false What regulations apply to self-governance Tribes? 1000.220 Section 1000.220 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE...-DETERMINATION AND EDUCATION ACT Waiver of Regulations § 1000.220 What regulations apply to self-governance...

33 CFR 96.220 - What makes up a safety management system?

Science.gov (United States)

2010-07-01

... system? 96.220 Section 96.220 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.220 What makes up a safety management system? (a) The...

Design and implementation of a 38 kW dish-Stirling concentrated solar power system

Science.gov (United States)

Yan, J.; Peng, Y. D.; Cheng, Z. R.; Liu, F. M.; Tang, X. H.

2017-11-01

Dish-Stirling concentrated solar power system (DS-CSP) is an important pathway for converting solar energy into electricity at high efficiency. In this study, a rated power 38 kW DS-CSP system was developed (installed in Xiangtan Electric Manufacturing Group). The heat engine adopted the alpha-type four cylinders double-acting Stirling engine (Stirling Biopower Flexgen S260). The absorber flux distribution simulation was conducted using ray tracing method and then the 204 m2 parabolic dish concentrator system (diameter is 17.70 m and focal length is 9.49 m) with single concentrator plus single pillar supporting has been designed and built. A water-cooled disc target and an absorber imitation device were adopted to test the tracking performance of the dish concentrator system, homogeneity of the focal spot and flux distribution of the absorber. Finally, the S260 Stirling engine was installed on the focal position of the dish concentrator and then the net output power date of the 38 kW DS-CSP system was tested. The absorber overheating problem on the DS-CSP system performance was discussed when the DS-CSP system was installed in different locations. The testing result shows that this system achieved the net output power of 38 kW and solar-to-electricity efficiency (SEE) of 25.3% with the direct normal irradiation (DNI) at 750 W/m2. The net output power can further increase to 40.5 kW with the SEE of 26.6% when the DNI reaches up to the maximum of 761 W/m2. The net output power of the 38 kW DS-CSP system has a linear function relationship with the DNI. The fitting function is Net power output=0.1003×DNI－36.129, where DNI is at the range of 460∼761 W/m2. This function could be used to predict the amount of the 38 kW DS-CSP system annual generation power.

100KE/KW fuel storage basin surface volumetric factors

International Nuclear Information System (INIS)

Conn, K.R.

1996-01-01

This Supporting Document presents calculations of surface Volumetric factors for the 100KE and 100KW Fuel Storage Basins. These factors relate water level changes to basin loss or additions of water, or the equivalent water displacement volumes of objects added to or removed from the basin

20 CFR 220.131 - Work which exists in the national economy.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work which exists in the national economy. 220.131 Section 220.131 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT DETERMINING DISABILITY Vocational Considerations § 220.131 Work which exists in the national economy. (a) General. The Board considers...

Final report on 9 kW Stirling Engine for biogas and natural gas

DEFF Research Database (Denmark)

Carlsen, Henrik; Bovin, Jonas Kabell

2001-01-01

The need for a simple and robust engine for natural gas and low quality gas has resulted in the design of a single cylinder, hermetic Stirling engine, which has an electric power output of 9 kW. Two engines have been built. One engine is intended for natural gas as fuel and the other is intended...... eliminates guiding forces on the pistons and the need for X-heads. Grease lubricated needle and ball bearings are used in the kinematic crank mechanism in order to avoid oil penetrating into the cylinder volumes. Working gas is Helium at 8 MPa mean pressure. The engine produce up to 11 kW of shaft power...... corresponding to approximately 10 kW of electric power. The design target was an efficiency of 26 % based on lower heat content of the gas to electricity, but only 24% were obtained. The decrease of efficiency is caused by inhomogeneous capacity flows in the air preheater and insufficient insulation...

20 CFR 220.102 - Non-severe impairment(s), defined.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Non-severe impairment(s), defined. 220.102 Section 220.102 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT... these include— (1) Physical functions such as walking, standing, sitting, lifting, pushing, pulling...

Photovoltaic power system tests on an 8-kilowatt single-phase line-commutated inverter

Science.gov (United States)

Stover, J. B.

1978-01-01

Efficiency and power factor were measured as functions of solar array voltage and current. The effects of input shunt capacitance and series inductance were determined. Tests were conducted from 15 to 75 percent of the 8 kW rated inverter input power. Measured efficiencies ranged from 76 percent to 88 percent at about 50 percent of rated inverter input power. Power factor ranged from 36 percent to 72 percent.

45 CFR 400.220 - Counting time-eligibility of refugees.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Counting time-eligibility of refugees. 400.220 Section 400.220 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES REFUGEE RESETTLEMENT PROGRAM...

12 CFR 220.118 - Time of payment for mutual fund shares purchased in a special cash account.

Science.gov (United States)

2010-01-01

... recognize the fact that, when an issue of securities is to be issued at some fixed future date, a security... (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T...). (b) Section 220.4(c)(2) provides as follows: In case a customer purchases a security (other than an...

40 CFR 415.220 - Applicability; description of the titanium dioxide production subcategory.

Science.gov (United States)

2010-07-01

... titanium dioxide production subcategory. 415.220 Section 415.220 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Titanium Dioxide Production Subcategory § 415.220 Applicability; description of the titanium dioxide production subcategory. This subpart applies to discharges to waters of the United States...

220 Names/Faces 220 Dolch Words Are Too Many for Students with Memories Like Mine. AVKO "Great Idea" Reprint Series No. 601.

Science.gov (United States)

McCabe, Don

This booklet discusses a procedure to assist students experiencing difficulty in learning the "Dolch Basic Sight Vocabulary of 220 Words" and rearranges a list of 220 words to make it easier for students to learn. The procedure discussed in the booklet is based on the "word family" approach, in which words like "all call,…

A 50-kW Module Power Station of Directly Solar-Pumped Iodine Laser

Science.gov (United States)

Choi, S. H.; Lee, J. H.; Meador, W. E.; Conway, E. J.

1997-01-01

The conceptual design of a 50 kW Directly Solar-Pumped Iodine Laser (DSPIL) module was developed for a space-based power station which transmits its coherent-beam power to users such as the moon, Martian rovers, or other satellites with large (greater than 25 kW) electric power requirements. Integration of multiple modules would provide an amount of power that exceeds the power of a single module by combining and directing the coherent beams to the user's receiver. The model developed for the DSPIL system conservatively predicts the laser output power (50 kW) that appears much less than the laser output (93 kW) obtained from the gain volume ratio extrapolation of experimental data. The difference in laser outputs may be attributed to reflector configurations adopted in both design and experiment. Even though the photon absorption by multiple reflections in experimental cavity setup was more efficient, the maximum secondary absorption amounts to be only 24.7 percent of the primary. However, the gain volume ratio shows 86 percent more power output than theoretical estimation that is roughly 60 percent more than the contribution by the secondary absorption. Such a difference indicates that the theoretical model adopted in the study underestimates the overall performance of the DSPIL. This fact may tolerate more flexible and radical selection of design parameters than used in this design study. The design achieves an overall specific power of approximately 5 W/kg and total mass of 10 metric tons.

200 kW, 800 MHz transmitter system for lower hybrid heating

International Nuclear Information System (INIS)

Deitz, A.

1975-01-01

This paper describes a new rf heating system which has just been completed and is now operational on the ATC machine. The system utilizes four UHF TV klystrons to generate at least 200 kW of power at a frequency of 800 MHz. Pulse widths can be varied from 20 μsec up to 20 msec. A radar type floating deck modulator along with photo-optical transmitting and receiving devices have been incorporated into the system to provide the pulse fidelity and versatility which characterizes this equipment. Modular construction was emphasized in the design, when possible, to reduce maintenance and down time in the advent of component falilure. Hybrid combining techniques are utilized in order to provide two 100 kW feeds into the machine

Performance improvement of 100 kW high frequency transmitter for CW operation

International Nuclear Information System (INIS)

Kwak, J. G.; Yoon, J. S.; Bae, Y. D.; Cho, C. G.; Wang, S. J.; Lee, K. D.

2001-08-01

For the plasma heating of KSTAR(Korea Superconducting Tokamak Advanced Research)by using ICH(Ion Cyclotron Heating), it is designed that the selective ion heating and current drive are performed by the transmitter with the rf power of 8 MW in the frequency range of 25-60 MHz. 100 kW HF transmitter was constructed for the high voltage/current test of ICH antenna and HF transmission components. The output power is about 100 kW around 30 MHz. Thomson 581 tetrode is used for the final amplifier whose cavity type is ground cathode. Overall gain is above 15 dB and the bandwidth is about 100 kHz

5 CFR 591.220 - How does OPM calculate energy utility cost indexes?

Science.gov (United States)

2010-01-01

... cost indexes? 591.220 Section 591.220 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS ALLOWANCES AND DIFFERENTIALS Cost-of-Living Allowance and Post Differential-Nonforeign Areas Cost-Of-Living Allowances § 591.220 How does OPM calculate energy utility cost indexes? (a) OPM...

Test result of 5 GHz, 500 kW CW prototype klystron for KSTAR LHCD system

Energy Technology Data Exchange (ETDEWEB)

Do, H., E-mail: heejindo@nfri.re.kr [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Park, S. [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Jeong, J.H.; Bae, Y.S.; Yang, H.L. [National Fusion Research Institute, Daejeon 350-333 (Korea, Republic of); Delpech, L.; Magne, R.; Hoang, G.T. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Park, H.; Cho, M.H.; Namkung, W. [Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of)

2011-10-15

A 5 GHz LHCD system is being designed for current drive and profile modification necessary for AT mode and steady-state operation of the KSTAR tokamak. A prototype 500 kW CW klystron operating at 5 GHz was developed for the steady-state RF source. In this klystron, a multi-cell cavity is introduced to reduce cavity voltage and ohmic power loss. The klystron is designed with a triode system for optimization of gain, efficiency and beam control. The high voltage for the cathode is turned by using a thyristor switching system at the low voltage transformer unit. For anode voltage control, a mod-anode voltage divider system is used which utilize the parallel-circuit of the FET switch and Zener diodes. The RF output power of the klystron was 300 kW for 800 s and 450 kW for 20 s. The maximal temperature at collector top surface was 83 deg. C and power loss at the tube body did not exceed 10 kW, the interlock level for the protection of the klystron. Detailed results of the klystron system test and commissioning are presented.

Construction of a 35 GHz 100 kW gyrotron; Construcao de um girotron de 35 GHz e de 100 kW

Energy Technology Data Exchange (ETDEWEB)

Aso, Y; Barroso, J J; Castro, P J; Correa, R A; Ludwing, G O; Montes, A; Morgado, U T.F.; Nono, M C.A.; Rossi, J O; Silva, P R

1989-09-01

In this work a description of a 35 GHz 100 kW gyrocon is described which is under construction at the National Space Research Institute Plasma Laboratory. Project conceptual aspects are emphasized, specifically high current density thermionic cathodes, high time and spatial resolution intense magnetic fields generation, high-vacuum systems, techniques of ceramic-metal sealing, and high-voltage electrical modulator circuits. (author). 8 refs., 9 figs., 1 tab.

An assessment of KW Basin radionuclide activity when opening SNF canisters

International Nuclear Information System (INIS)

Bergmann, D.W.; Mollerus, F.J.; Wray, J.L.

1995-01-01

N Reactor spent fuel is being stored in sealed canisters in the KW Basin. Some of the canisters contain damaged fuel elements. There is the potential for release of Cs 137, Kr 85, H3, and other fission products and transuranics (TRUs) when canisters are opened. Canister opening is required to select and transfer fuel elements to the 300 Area for examination as part of the Spent Nuclear Fuel (SNF) Characterization program. This report estimates the amount of radionuclides that can be released from Mark II spent nuclear fuel (SNF) canisters in KW Basin when canisters are opened for SNF fuel sampling as part of the SNF Characterization Program. The report also assesses the dose consequences of the releases and steps that can be taken to reduce the impacts of these releases

Infrared face recognition based on LBP histogram and KW feature selection

Science.gov (United States)

Xie, Zhihua

2014-07-01

The conventional LBP-based feature as represented by the local binary pattern (LBP) histogram still has room for performance improvements. This paper focuses on the dimension reduction of LBP micro-patterns and proposes an improved infrared face recognition method based on LBP histogram representation. To extract the local robust features in infrared face images, LBP is chosen to get the composition of micro-patterns of sub-blocks. Based on statistical test theory, Kruskal-Wallis (KW) feature selection method is proposed to get the LBP patterns which are suitable for infrared face recognition. The experimental results show combination of LBP and KW features selection improves the performance of infrared face recognition, the proposed method outperforms the traditional methods based on LBP histogram, discrete cosine transform(DCT) or principal component analysis(PCA).

7 CFR 220.17 - Prohibitions.

Science.gov (United States)

2010-01-01

..., curriculum, instructions, methods of instruction, and materials of instruction in any school as a condition... CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.17 Prohibitions. (a) In carrying out the... limited to, laws relating to taxation, welfare, and public assistance programs. Expenditure of funds from...

High brightness KW-class direct diode laser

Science.gov (United States)

Xu, Dan; Guo, Zhijie; Ma, Di; Zhang, Tujia; Guo, Weirong; Wang, Baohua; Xu, Ray; Chen, Xiaohua

2018-02-01

With certain emitter beam quality and BPP allowed by fiber, we have derived a spatial beam combination structure that approaches the BPP limit of the fiber. Using the spatial beam combination structure and polarization beam combination, BWT has achieved 1.1KW output from a fiber (one end coated) with NA 0.22 and core diameter of 200μm. The electro- optical efficiency is nearly 47%. Multiple emitters with wavelength of 976nm are packaged in a module with size of 600 ×350×80mm3.

Development of an aerosol chamber for calibration of 220Rn progeny detectors

Science.gov (United States)

Sorimachi, Atsuyuki; Ishikawa, Tetsuo; Tokonami, Shinji

2014-09-01

This paper describes an aerosol chamber system that can be used for calibrations and performance experiments of passive 220Rn progeny detectors. For the purpose of this study, an aerosol generation system using carnauba wax as the aerosol material was mounted into the 220Rn chamber. We used the chamber to measure characteristics of the equilibrium factor (F) of 220Rn and unattached fraction (fp) of 220Rn progeny, which are important parameters for dose estimation. The first experiment showed that continuous and stable generation of the unattached and aerosol-attached 220Rn progeny concentrations was obtained. We observed that the spatial distributions in the chamber of the vertical profiles of the unattached and aerosol-attached 220Rn progeny concentrations were homogeneous, as were the particle number concentration and count median diameter. The values of F and fp and their characteristics observed in this study were in the same range as the values reported from indoor measurements. We found that the characteristics of F and fp were dependent on the aerosol conditions (particle diameter and particle number concentration).

20 CFR 405.220 - Decision by the Federal reviewing official.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Decision by the Federal reviewing official. 405.220 Section 405.220 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW... Medical and Vocational Expert System before making a decision. At all times, the Federal reviewing...

Mountain restaurant 'Kuklos' on the Berneuse: A revolution. Bergrestaurant 'Kuklos' auf der Berneuse: Den Dreh gefunden

Energy Technology Data Exchange (ETDEWEB)

Stadelmann, M

1990-11-01

The restaurant on the Berneuse offers catering possibilities for up to 500 guests on five storeys. Natural gas is used for the energy supply of the complex for heating as well as cooking purposes. For this a central boiler plant with a 420 kW cast iron boiler is located on the topmost storey. The boiler is fired with a gas blower burner. The total power of the cookers, ovens, steamers and microwave ovens installed in the kitchen amounts to approx. 100 kW. As the kilowatt hour rate of natural gas is lower than that of electric power the use of gas appliances result in considerable cost savings in addition to higher flexibility and efficiency, shorter readiness periods and heating-up times. (BWI).

Primary measuring of equipment factor of 222Rn/220Rn indoor

International Nuclear Information System (INIS)

Liu Yanyang; Liu Fudong; Wang Chunhong; Sheng Mingwei

2010-01-01

The activity concentration of 222 Rn, 220 Rn and their progenies of certain working places and dwellings in Baotou city were measured simultaneously. Based on these results, the equipment factor of 222 Rn is 0.35 for working places and 0.43 for dwellings, while equipment factor of 220 Rn measured at 20 cm distance from wall is 0.030 for both working places and dwellings. Preliminary results show that the temporal change of 220 Rn equilibrium equivalent concentration is same as 222 Rn which is high in midnight and low in afternoon,and significant difference between instant and accumulated measure result of 222 Rn, 220 Rn activity concentration is found, with the factor of 2.1 and 1.7. (authors)

Study on a charcoal-based monitor for Rn-220 in air

International Nuclear Information System (INIS)

Yu Yiqiao; Solomon, S.B.

1993-01-01

Activated charcoal has been used in both passive monitors (Cohen, Pondy et al. 1987) and active monitors (Solomon and Gan, 1989) for the measurements of 222 Rn in air. Cooled, charcoal-impregnated filters, viewed in-situ by a solid state alpha detector, have been used for 220 Rn-in-breath studies. In general, γ ray counting of 220 Rn samples collected on activated charcoal has not been used. This paper describes the development and calibration of a charcoal based monitor designed to measure 220 Rn levels down to a lower limit of 10 Bq m -3 over sampling periods of 4 to 15 h. The activity of 212 Pb (10.6 h) produced from 220 Rn (55.6 s) collected in an activated charcoal-based sampler is 1/700 the total 220 Rn activity. A typical Hp-Ge detector has a MDL for a two-hours count of approximately 0.1 Bq of 212 Pb for the 239 keV γ-ray. For a MDL of 10 Bq·m -3 of 220 Rn in air, a volume of at least 7 m 3 must be sampled, assuming no breakthrough. The present charcoal-based 220 Rn monitor is designed to maximize the path length through the activated charcoal while sufficient cross-sectional area is retained to allow flow rates up to 0.03 m 3 ·kg -1 is packed into a specially designed aluminum container. The container is modeled on a Marinelli beaker to maximize the counting efficiency, while the sample flow through the chambers of the monitor is optimized to maintain radial symmetry. experiments demonstrated that 94% of 220 Rn was adsorbed by the charcoal in the monitor under a flow rate of 0.03 m 3 ·min -1 at 25 degree C and 85%. RH in 15 h. The monitor is designed to fit over a 70 mm diameter Hp-Ge detector. Preliminary measurements of 220 Rn in two buildings and a cave, using the active monitors and 'grabing' samples under a flow rate of 0.03 m 3 ·min -1 and a period of 4 h, indicated concentrations of between 18.6 and 142.0 Bq·m 3

Development program for a 200 kW, CW, 28 GHz gyroklystron. Final report, April 1976-September 1980

International Nuclear Information System (INIS)

Shively, J.; Conner, C.; Evans, S.

1980-01-01

The objective of this program was to develop a microwave amplifier or oscillator capable of producing 200 kW, CW power output at 28 GHz. The use of the gyrotron or cyclotron resonance interaction was pursued. A room temperature hollow core solenoid magnet with an iron case was designed to produce the magnetic field required for electron cyclotron resonance. Three pulsed gyroklystron amplifiers were built providing increasing stable output powers of 6, 65 and 76 kW. A back-up pulsed gyrotron oscillator produced 248 kW. A ceramic cone broadband water load was developed. Tests are described for the various tubes that were developed

Wind turbine test Vestas V27-225 kW

Energy Technology Data Exchange (ETDEWEB)

Markkilde Petersen, S

1990-10-15

The report describes fundamental measurements performed on a Vestas-V27-225 kW pitch regulated wind turbine. The measurements carried out and reported here comprises the power output, system efficiency, energy production, transmission efficiency, rotor power, rotor efficiency, air-brakes efficiency, structural dynamics, loads at cut-in and braking, yaw error statistics, flapwise root bending moment and rotor thrust. (author).

Kidins220/ARMS as a functional mediator of multiple receptor signalling pathways.

Science.gov (United States)

Neubrand, Veronika E; Cesca, Fabrizia; Benfenati, Fabio; Schiavo, Giampietro

2012-04-15

An increasing body of evidence suggests that several membrane receptors--in addition to activating distinct signalling cascades--also engage in substantial crosstalk with each other, thereby adjusting their signalling outcome as a function of specific input information. However, little is known about the molecular mechanisms that control their coordination and integration of downstream signalling. A protein that is likely to have a role in this process is kinase-D-interacting substrate of 220 kDa [Kidins220, also known as ankyrin repeat-rich membrane spanning (ARMS), hereafter referred to as Kidins220/ARMS]. Kidins220/ARMS is a conserved membrane protein that is preferentially expressed in the nervous system and interacts with the microtubule and actin cytoskeleton. It interacts with neurotrophin, ephrin, vascular endothelial growth factor (VEGF) and glutamate receptors, and is a common downstream target of several trophic stimuli. Kidins220/ARMS is required for neuronal differentiation and survival, and its expression levels modulate synaptic plasticity. Kidins220/ARMS knockout mice show developmental defects mainly in the nervous and cardiovascular systems, suggesting a crucial role for this protein in modulating the cross talk between different signalling pathways. In this Commentary, we summarise existing knowledge regarding the physiological functions of Kidins220/ARMS, and highlight some interesting directions for future studies on the role of this protein in health and disease.

20 CFR 220.11 - Definitions as used in this subpart.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Definitions as used in this subpart. 220.11 Section 220.11 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT..., mobility, endurance and capacity to perform physically demanding tasks, such as standing, walking, lifting...

2 CFR 220.15 - Policy.

Science.gov (United States)

2010-01-01

... Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST PRINCIPLES FOR EDUCATIONAL INSTITUTIONS (OMB CIRCULAR A-21) § 220.15 Policy. The principles in this part are designed to provide that the... accounting principles, except where restricted or prohibited by law. Agencies are not expected to place...

Performance evaluation of 1 kw PEFC

Energy Technology Data Exchange (ETDEWEB)

Komaki, Hideaki [Ishikawajima-Harima Heavy Industries Co., Ltd. Tokyo (Japan); Tsuchiyama, Syozo [Shipbuilding Research Association, Minato-ky, Tokyo (Japan)

1996-12-31

This report covers part of a joint study on a PEFC propulsion system for surface ships, summarized in a presentation to this Seminar, entitled {open_quote}Study on a PEFC Propulsion System for Surface Ships{close_quotes}, and which envisages application to a 1,500 DWT cargo vessel. The aspect treated here concerns the effects brought on PEFC operating performance by conditions particular to shipboard operation. The performance characteristics were examined through tests performed on a 1 kw stack and on a single cell (Manufactured by Fuji Electric Co., Ltd.). The tests covered the items (1) to (4) cited in the headings of the sections that follow. Specifications of the stack and single cell are as given.

2.43 kW narrow linewidth linearly polarized all-fiber amplifier based on mode instability suppression

Science.gov (United States)

Su, Rongtao; Tao, Rumao; Wang, Xiaolin; Zhang, Hanwei; Ma, Pengfei; Zhou, Pu; Xu, Xiaojun

2017-08-01

We demonstrate an experimental study on scaling mode instability (MI) threshold in fiber amplifiers based on fiber coiling. The experimental results show that coiling the active fiber in the cylindrical spiral shape is superior to the coiling in the plane spiral shape. When the polarization maintained Yb-doped fiber (PM YDF: with a core/inner-cladding diameter of 20/400 µm) is coiled on an aluminous plate with a bend diameter of 9-16 cm, the MI threshold is ~1.55 kW. When such a PM YDF is coiled on an aluminous cylinder with diameter of 9 cm, no MI is observed at the output power of 2.43 kW, which is limited by the available pump power. The spectral width and polarization extinction ratio is 0.255 nm and 18.3 dB, respectively, at 2.43 kW. To the best of our knowledge, this is the highest output power from a linear polarized narrow linewidth all-fiberized amplifier. By using a theoretical model, the potential MI-free scaling capability in such an amplifier is estimated to be 3.5 kW.

Compact Design of 10 kW Proton Exchange Membrane Fuel Cell Stack Systems with Microcontroller Units

Directory of Open Access Journals (Sweden)

Hsiaokang Ma

2014-04-01

Full Text Available In this study, fuel, oxidant supply and cooling systems with microcontroller units (MCU are developed in a compact design to fit two 5 kW proton exchange membrane fuel cell (PEMFC stacks. At the initial stage, the testing facility of the system has a large volume (2.0 m × 2.0 m × 1.5 m with a longer pipeline and excessive control sensors for safe testing. After recognizing the performance and stability of stack, the system is redesigned to fit in a limited space (0.4 m × 0.5 m × 0.8 m. Furthermore, the stack performance is studied under different hydrogen recycling modes. Then, two similar 5 kW stacks are directly coupled with diodes to obtain a higher power output and safe operation. The result shows that the efficiency of the 5 kW stack is 43.46% with a purge period of 2 min with hydrogen recycling and that the hydrogen utilization rate µf is 66.31%. In addition, the maximum power output of the twin-coupled module (a power module with two stacks in electrical cascade/parallel arrangement is 9.52 kW.

Learning from the neighbours: Denmark

Energy Technology Data Exchange (ETDEWEB)

Toeller, G.

1983-03-01

In Denmark the owners of wind power plants monthly notify, on a volunteer basis, what number of kilowatt hours they have produced during the past weeks. From the first beginnings in 1979, the number of Danish wind power plants, which take part in the capacity statistics, has now increased to about 300. In the windy month of November in 1982, a quarter per cent of the total Danish electrical power generation has been achieved by wind power plants according to statistics and estimates. It can also be seen from the statistics which types of plants were not ready for operation or which plants generate how much capacity. A seperate calculation also shows how many operation hours a wind energy plant achieves per annum. Plants which are in the power range of 10 kW to 30 kW reach, on average, 6000 working hours. The plants of the 55 kw-type which are equipped with higher towers reach an average value of 6300 hours per annum.

Wind energy developments in the 20th century

Science.gov (United States)

Vargo, D. J.

1974-01-01

Wind turbine systems for generating electrical power have been tested in many countries. Representative examples of turbines which have produced from 100 to 1250 kW are described. The advantages of wind energy consist of its being a nondepleting, nonpolluting, and free fuel source. Its disadvantages relate to the variability of wind and the high installation cost per kilowatt of capacity of wind turbines when compared to other methods of electric-power generation. High fuel costs and potential resource scarcity have led to a five-year joint NASA-NSF program to study wind energy. The program will study wind energy conversion and storage systems with respect to cost effectiveness, and will attempt to estimate national wind-energy potential and develop techniques for generator site selection. The studies concern a small-systems (50-250 kW) project, a megawatt-systems (500-3000 kW) project, supporting research and technology, and energy storage. Preliminary economic analyses indicate that wind-energy conversion can be competitive in high-average-wind areas.

49 CFR 220.49 - Radio communication used in shoving, backing or pushing movements.

Science.gov (United States)

2010-10-01

... pushing movements. 220.49 Section 220.49 Transportation Other Regulations Relating to Transportation... Wireless Communication Procedures § 220.49 Radio communication used in shoving, backing or pushing movements. When radio communication is used in connection with the shoving, backing or pushing of a train...

Structural analysis of a 1kW Darrieus turbine spoke

DEFF Research Database (Denmark)

Belloni, Federico; Bedon, Gabriele; Castelli, Marco Raciti

A structural study of a 1 kW Darrieus turbine spoke was performed in order to study stress distribution on the piece and make it more light. The VAWT turbine, originally intended for urban operation, is provided with 3 blades and 6 spokes. Since turbine initial tests showed relevant balancing...

Measured performance of a 1.72 kW rooftop grid connected photovoltaic system in Ireland

International Nuclear Information System (INIS)

Ayompe, L.M.; Duffy, A.; McCormack, S.J.; Conlon, M.

2011-01-01

This paper presents results obtained from monitoring a 1.72 kW p photovoltaic system installed on a flat roof of a 12 m high building in Dublin, Ireland (latitude 53.4 o N and longitude 6.3 o E). The system was monitored between November 2008 and October 2009 and all the electricity generated was fed into the low voltage supply to the building. Monthly average daily and annual performance parameters of the PV system evaluated include: final yield, reference yield, array yield, system losses, array capture losses, cell temperature losses, PV module efficiency, system efficiency, inverter efficiency, performance ratio and capacity factor. The maximum solar radiation, ambient temperature and PV module temperature recorded were 1241 W/m 2 in March, 29.5 o C and 46.9 o C in June respectively. The annual total energy generated was 885.1 kW h/kW p while the annual average daily final yield, reference yield and array yield were 2.41 kW h/kW p /day, 2.85 kW h/kW p /day and 2.62 kW h/kW p /day respectively. The annual average daily PV module efficiency, system efficiency and inverter efficiency were 14.9%, 12.6% and 89.2% respectively while the annual average daily performance ratio and capacity factor were 81.5% and 10.1% respectively. The annual average daily system losses, capture losses and cell temperature losses were 0.23 h/day, 0.22 h/day and 0.00 h/day respectively. Comparison of this system with other systems in different locations showed that the system had the highest annual average daily PV module efficiency, system efficiency and performance ratio of 14.9%, 12.6% and 81.5% respectively. The PV system's annual average daily final yield of 2.4 kW h/kW p /day is higher than those reported in Germany, Poland and Northern Ireland. It is comparable to results from some parts of Spain but it is lower than the reported yields in most parts of Italy and Spain. Despite low insolation levels, high average wind speeds and low ambient temperature improve Ireland

20 CFR 220.130 - Work experience as a vocational factor.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Work experience as a vocational factor. 220.130 Section 220.130 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD... amount of walking, standing, sitting, lifting and carrying the claimant did during the work day, as well...

A 1-kW power demonstration from the advanced free electron laser

International Nuclear Information System (INIS)

Sheffield, R.L.; Conner, C.A.; Fortgang, C.M.

1997-01-01

This is the final report of a one-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The main objective of this project was to engineer and procure an electron beamline compatible with the operation of a 1-kW free-electron laser (FEL). Another major task is the physics design of the electron beam line from the end of the wiggler to the electron beam dump. This task is especially difficult because electron beam is expected to have 20 kW of average power and to simultaneously have a 25% energy spread. The project goals were accomplished. The high-power electron design was completed. All of the hardware necessary for high-power operation was designed and procured

New 200 kW, 800 MHz transmitter system for lower hybrid heating

International Nuclear Information System (INIS)

Deitz, A.

1975-07-01

A new rf heating system which has just been completed and is being installed on the ATC machine is described. The system utilizes four uhf TV klystrons to generate at least 200 kW of power at a frequency of 800 MHz. Pulse widths can be varied from 20 μsec. up to 20 msec. A radar type floating deck modulator along with photo-optical transmitting and receiving devices have been incorporated into the system to provide the pulse fidelity and versatility which characterizes this equipment. Modular construction was emphasized in the design, when possible, to reduce maintenance and down time in the advent of component failure. Hybrid combining techniques are utilized in order to provide two 100 kW feeds into the machine. (U.S.)

Repeated 0.5 Gy gamma-ray irradiation attenuates autoimmune disease in MRL-lpr/lpr mice with up-regulation of regulatory T cells

International Nuclear Information System (INIS)

Mitsutoshi Tsukimoto; Fumitoshi Tago; Hiroko Nakatsukasa; Shuji Kojima

2007-01-01

Complete text of publication follows. MRL-lpr/lpr mice present a single gene mutation on the Fas (CD95) gene that leads to reduced signaling for apoptosis. With aging, these mice spontaneously develop autoimmune disease and are used as a model of systemic lupus erythematosus. We previously reported attenuation of autoimmune disease in MRL-lpr/lpr mice by repeated γ-ray irradiation (0.5 Gy each time). In this study, we investigated the mechanisms of this attenuation focusing the highly activated CD3 + CD4 - CD8 - B220 + T cells, which are characteristically involved in autoimmune pathology in these mice. We measured the weight of the spleen and the population of CD3 + CD4 - CD8 - B220 + T cells. Splenomegaly and increase in percentage of CD3 + CD4 - CD8 - B220 + T cells, which occur with aging in non-irradiated mice, were suppressed in irradiated mice. To investigate the function of CD3 + CD4 - CD8 - B220 + T cells, we isolated these cells from splenocytes by magnetic cell sorting. Isolated CD3 + CD4 - CD8 - B220 + T cells were more resistant to irradiation-induced cell death than isolated CD4 + T cells. Although high proliferation rate and IL-6 production were observed in isolated CD3 + CD4 - CD8 - B220 + T cells, the proliferation rate and IL-6 production were lower in the cells isolated from the irradiated mice. Moreover, the production of autoantibodies (anti-collagen antibody and anti-single strand DNA antibody) was also lowered by irradiation. These results indicate that activation of CD3 + CD4 - CD8 - B220 + T cells and progression of pathology would be suppressed by repeated 0.5 Gy γ-ray irradiation. To uncover the mechanism of the immune suppression, we analyzed population of regulatory T cells (CD4 + CD25 + Foxp3 + ), which suppress activated T cells and excessive autoimmune responses. Intriguingly, significant increase of the percentage of regulatory T cells was observed in irradiated mice. In conclusion, we found that repeated 0.5 Gy γ-ray irradiation

42 CFR 412.220 - Special treatment of certain hospitals located in Puerto Rico.

Science.gov (United States)

2010-10-01

... Puerto Rico. 412.220 Section 412.220 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT... SERVICES Prospective Payment System for Inpatient Operating Costs for Hospitals Located in Puerto Rico § 412.220 Special treatment of certain hospitals located in Puerto Rico. Subpart G of this part sets...

46 CFR 185.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 185.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) OPERATIONS Marine Casualties and Voyage Records § 185.220 Records of a... officer, or person responsible for the custody thereof, shall make these records available upon request...

46 CFR 122.220 - Records of a voyage resulting in a marine casualty.

Science.gov (United States)

2010-10-01

....220 Section 122.220 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER... OPERATIONS Marine Casualties and Voyage Records § 122.220 Records of a voyage resulting in a marine casualty... custody thereof, shall make these records available upon request, to a duly authorized investigating...

Design of a high efficiency 30 kW boost composite converter

Energy Technology Data Exchange (ETDEWEB)

Kim, Hyeokjin [Univ. of Colorado, Boulder, CO (United States); Chen, Hua [Univ. of Colorado, Boulder, CO (United States); Maksimovic, Dragan [Univ. of Colorado, Boulder, CO (United States); Erickson, Robert W. [Univ. of Colorado, Boulder, CO (United States)

2015-09-20

An experimental 30 kW boost composite converter is described in this paper. The composite converter architecture, which consists of a buck module, a boost module, and a dual active bridge module that operates as a DC transformer (DCX), leads to substantial reductions in losses at partial power points, and to significant improvements in weighted efficiency in applications that require wide variations in power and conversion ratio. A comprehensive loss model is developed, accounting for semiconductor conduction and switching losses, capacitor losses, as well as dc and ac losses in magnetic components. Based on the developed loss model, the module and system designs are optimized to maximize efficiency at a 50% power point. Experimental results for the 30 kW prototype demonstrate 98.5%peak efficiency, very high efficiency over wide ranges of power and voltage conversion ratios, as well as excellent agreements between model predictions and measured efficiency curves.

75 FR 36471 - Seventh Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-06-25

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Committee 220: Automatic Flight Guidance and [[Page 36472

Development of a 3 kW double-acting thermoacoustic Stirling electric generator

International Nuclear Information System (INIS)

Wu, Zhanghua; Yu, Guoyao; Zhang, Limin; Dai, Wei; Luo, Ercang

2014-01-01

Highlights: • A 3 kW double-acting thermoacoustic Stirling electric generator is introduced. • 1.57 kW electric power with 16.8% thermal-to-electric efficiency was achieved. • High mechanical damping coefficient greatly decreases the system performance. • Performance difference is significant, which also decreased system performance. - Abstract: In this paper, a double-acting thermoacoustic Stirling electric generator is proposed as a new device capable of converting external heat into electric power. In the system, at least three thermoacoustic Stirling heat engines and three linear alternators are used to build a multiple-cylinder electricity generator. In comparison with the conventional thermoacoustic electricity generation system, the double-acting thermoacoustic Stirling electric generator has advantages on efficiency, power density and power capacity. In order to verify the idea, a prototype of 3 kW three-cylinder double-acting thermoacoustic Stirling electric generator is designed, built and tested. Based on the classic thermoacoustic theory, numerical simulation is performed to obtain the thermodynamic parameters of the engine. And distributions of key parameters are presented for a better understanding of the energy conversion process in the engine. In the experiments, a maximum electric power of about 1.57 kW and a maximum thermal-to-electric conversion efficiency of 16.8% were achieved with 5 MPa pressurized helium and 86 Hz working frequency. However, we find that the mechanical damping coefficient of the piston is dramatically increased due to the deformation of the cylinder wall caused by high thermal stress during the experiments. Thereby, the system performance was greatly reduced. Additionally, the performance differences between three engines and three alternators are significant, such as the heating temperature difference between three heater blocks of the engines, the piston displacement and the output electric power differences between

20 CFR 220.184 - If the annuitant becomes disabled by another impairment(s).

Science.gov (United States)

2010-04-01

... impairment(s). 220.184 Section 220.184 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE... Activity or Medical Improvement § 220.184 If the annuitant becomes disabled by another impairment(s). If a new severe impairment(s) begins in or before the month in which the last impairment(s) ends, the Board...

Performance and life time test on a 5 kW SOFC system for distributed cogeneration

Energy Technology Data Exchange (ETDEWEB)

Barrera, Rosa; De Biase, Sabrina; Ginocchio, Stefano [Edison S.p.A, Via Giorgio La Pira, 2, 10028 Trofarello (Italy); Bedogni, Stefano; Montelatici, Lorenzo [Edison S.p.A, Foro Bonaparte 31, 20121 Milano (Italy)

2008-06-15

Edison R and D Centre is committed to test a wide range of commercial and prototypal fuel cell systems. The activities aim to evaluate the available state of the art of these technologies and their maturity for the relevant market. The laboratory is equipped with ad hoc test benches designed to study single cells, stacks and systems. The characterization of commercial and new generation PEMFC, also for high temperatures (160 C), together with the analysis of the behaviour of SOFC represent the core activities of the laboratory. On January 2007 a new 5 kW SOFC system supplied by Acumentrics was installed. The claimed electrical power output is 5 kW and thermal power is 3 kW. The aim of the test is the achievement of technical and economical assessment for future applications of small SOFC plants for distributed cogeneration. Performance and life time test of the system are shown. (author)

Construction of a 35 GHz 100 kW gyrotron

International Nuclear Information System (INIS)

Aso, Y.; Barroso, J.J.; Castro, P.J.; Correa, R.A.; Ludwing, G.O.; Montes, A.; Morgado, U.T.F.; Nono, M.C.A.; Rossi, J.O.; Silva, P.R.

1989-09-01

In this work a description of a 35 GHz 100 kW gyrocon is described which is under construction at the National Space Research Institute Plasma Laboratory. Project conceptual aspects are emphasized, specifically high current density thermionic cathodes, high time and spatial resolution intense magnetic fields generation, high-vacuum systems, techniques of ceramic-metal sealing, and high-voltage electrical modulator circuits. (author). 8 refs., 9 figs., 1 tab

Development of a 10 kW PEM fuel cell for stationary applications

Energy Technology Data Exchange (ETDEWEB)

Barthels, H.; Mergel, J.; Oetjen, H.F. [Institute fuer Energieverfahrenstechnik (IEV), Juelich (Germany)] [and others

1996-12-31

A 10 kW Proton Exchange Membrane Fuel Cell (PEMFC) is being developed as part of a long-term energy storage path for electricity in the photovoltaic demonstration plant called PHOEBUS at the Forschungszentrum Julich.

A 25-kW Series-Resonant Power Converter

Science.gov (United States)

Frye, R. J.; Robson, R. R.

1986-01-01

Prototype exhibited efficiency of 93.9 percent. 25-kW resonant dc/dc power converter designed, developed, fabricated, and tested, using Westinghouse D7ST transistors as high-power switches. D7ST transistor characterized for use as switch in series-resonant converters, and refined base-drive circuit developed. Technical base includes advanced switching magnetic, and filter components, mathematical circuit models, control philosophies, and switch-drive strategies. Power-system benefits such as lower losses when used for high-voltage distribution, and reduced magnetics and filter mass realized.

Failure analysis at a 2 kW helium liquefaction facility; Fehleranalyse bei einer 2kW- Heliumverfluessigungsanlage

Energy Technology Data Exchange (ETDEWEB)

Klenk, Rafael; Bobien, Steffen; Neumann, Holger [KIT Campus Nord, Eggenstein-Leopoldshafen (Germany). Bereich Kryotechnik

2016-07-01

At the Institute for Technical Physics of the KIT Campus Nord helium is cooled respectively liquefied by means of the Claude process. This process is beside the Brayton and Joule-Thomson process meanwhile a standard process for the liquefaction of helium. As example here a 2 kW low-temperature helium facility shall be evaluated by means of different, superordinated failure sources. This consists of condensers, heat exchangers, expansion turbines and a Joule-Thomson valve. The facility respectively component failures are divided in failures of the condenser, turbine units and failures by external factors. For this entries of the last twelve years are token. This listing shall give information about repeating events, so that here directed facility improvements can be token up.

Economic analysis of a 20 kW gasifier; Analise economica de um gaseificador de 20 kW

Energy Technology Data Exchange (ETDEWEB)

Silva, Marcos Vinicius Miranda da; Rocha, Brigida Ramati Pereira da [Universidade Federal do Para (NEDS/UFPA), Belem, PA (Brazil). Nucleo de Energia para o Desenvolvimento Sustentavel], e-mail: neds@ufpa.br

2006-07-01

The gasification of biomass residues has been pointed as an alternative in electricity supplying for small communities of the Amazon region, because it promotes a significant substitution of the diesel oil in the electric power generation. This paper presents an economic analysis of an electricity generation system (gasifier and generator set) of 20 kw that is installed in the community of Jenipauba, in the State of Para. That analysis confirms the economic attractiveness of that energy alternative on the generator sets that operate exclusively with diesel oil. It also shows the impact of the labor law on electricity generation cost, as well as the need of subsidizing the electric power generation, because the community of Jenipauba is very poor. (author)

75 FR 59326 - Eighth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-09-27

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The... Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include: Welcome...

End-to-end simulation of a visible 1 kW FEL

International Nuclear Information System (INIS)

Parazzoli, Claudio G.; Koltenbah, Benjamin E.C.

2000-01-01

In this paper we present the complete numerical simulation of the 1 kW visible Free Electron Laser under construction in Seattle. We show that the goal of producing 1.0 kW at 0.7 μm is well within the hardware capabilities. We simulate in detail the evolution of the electron bunch phase space in the entire e-beam line. The e-beam line includes the photo-injector cavities, the 433.33 MHz accelerator, the magnetic buncher, the 1300 MHz accelerator, the 180 deg. bend and the matching optics into the wiggler. The computed phase space is input for a three-dimensional time-dependent code that predicts the FEL performance. All the computations are based on state of the art software, and the limitations of the current software are discussed. We believe that this is the first time that such a thorough numerical simulation has been carried out and that such a realistic electron phase space has been used in FEL performance calculations

24 CFR 180.220 - Separation of functions.

Science.gov (United States)

2010-04-01

... AND BUSINESS OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Administrative Law Judge § 180.220 Separation of functions. No officer, employee, or agent of the Federal Government...

76 FR 22163 - Tenth Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-04-20

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control. SUMMARY: The FAA is... hereby given for a Special Committee 220, Automatic Flight Guidance and Control. Agenda Tuesday May 10...

75 FR 15770 - Sixth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-03-30

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... hereby given for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will...

75 FR 80886 - Ninth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-12-23

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is... for a Special Committee 220: Automatic Flight Guidance and Control meeting. The agenda will include...

Techno-economic analysis of a 2.1 kW rooftop photovoltaic-grid-tied system based on actual performance

International Nuclear Information System (INIS)

Adaramola, Muyiwa S.

2015-01-01

Highlights: • The economic analysis of rooftop PV grid-tied installation is examined. • Based on actual performance, the LCOE of the system is estimated as US$0.246/kW h. • Feed-in-tariff of US$0.356/kW h is estimated with no financial support. • To encourage installation of PV system, financial support of up to 40% of the investment is suggested. - Abstract: As more attention is being focus on the development of renewable energy resources globally, technical and economic assessments of these resources are crucial to ascertain their viability. These assessments can be more meaningful, if they are based on field and actual performance of the renewable energy conversion systems. This study presents the economic analysis of a rooftop 2.07 kW grid-connected photovoltaic energy system installation located in Ås (59.65°N and longitude 10.76°E, and about 105 m above sea level), Norway. Both the annual and monthly costs of energy produced by the system are determined. In addition, the feed-in tariff that can give internal rate of return of about 7.5% on investment on this installation was examined. Based on assumptions used in this study, feed-in-tariff of US$0.356/kW h is estimated for a project with economic life of 25 years with no other financial support. This translates to US$0.110/kW h premium over the levelized cost of energy of US$0.246/kW h generated by the system. However, if the financial support is more than 45% of the initial investment cost, no further premium fee is necessary to support this type of system

Basic research using the 250 kW research reactor of the Jozef Stefan Institute

International Nuclear Information System (INIS)

Dimic, V.

1984-01-01

The 250 kW TRIGA Mark II reactor is a light water reactor with solid fuel elements in which the zirconium hydride moderator is homogeneously distributed between enriched uranium. The reactor therefore has a large prompt negative temperature coefficient of reactivity; the fuel also has a very high retention of radioactive fission products. The experimental facilities include a rotary specimen rack, a central in-core radiation thimble, a pneumatic transfer system and pulsing capability. Other experimental facilities include two radial and two tangential beam tubes, a graphite thermal column and a graphite thermalizing column. At the steady state power of 250 kW the peak flux is 1x10 13 n/cm 2 in the central test position. In addition, pulsing to about 2000 MW is usually provided giving peak fluxes of about 2x10 16 n/cm 2 sec. All TRIGA reactors produce a core-average thermal neutron flux of about 10 7 n.v. per watt. Only with very large accelerators can such high fluxes be achieved. The types of research could be summarized as follows: thermal neutron scattering, neutron radiography, neutron and nuclear physics, activation analysis, radiochemistry, biology and medicine, and teaching and training. Typical applied research with a 250 kW reactor has been conducted in medicine, in biology, archaeology, metallurgy and materials science, engineering and criminology. It is well known that research reactors have been used routinely to produce isotopes for industry and medicine. We can conclude that the 250 kW TRIGA reactor is a useful and wide ranging source of radiation for basic and applied research. The operation cost for this instrument is relatively low. (author)

A conceptual study of the potential for automotive-derived and free-piston Stirling engines in 30- to 400-kilowatt stationary power applications

Science.gov (United States)

Vatsky, A.; Chen, H. S.; Dineen, J.

1982-01-01

The technical feasibility of applying automotive-derived kinematic and free-piston Stirling engine concepts for stationary applications was explored. Automotive-derived engines offer cost advantages by providing a mature and developd engine technology base with downrating and parts commonality options for specific applications. Two engine sizes (30 and 400 kW), two Stirling engine configurations (kinematic and free-piston), and two output systems (crankshaft and hydraulic pump) were studied. The study includes the influences of using either hydrogen or helium as the working gas. The first kinematic configuration selects an existing Stirling engine design from an automotive application and adapts it to stationary requirements. A 50,000-hour life requirement was established by downrating the engine to 40 kW and reducing auxiliary loads. Efficiency improvements were gained by selective material and geometric variations and peak brake efficiency of 36.8 percent using helium gas was achieved. The second design was a four-cylinder, 400 kW engine, utilizing a new output drive system known as the z-crank, which provides lower friction losses and variable stroke power control. Three different material and working gas combinations were considered. Brake efficiency levels varied from 40.5 percent to 45.6 percent. A 37.5 kW single-cycle, free-piston hydraulic output design was generated by scaling one cylinder of the original automotive engine and mating it to a counterbalanced reciprocal hydraulic pump. Metallic diaphragms were utilized to transmit power.

A conceptual study of the potential for automotive-derived and free-piston Stirling engines in 30- to 400-kilowatt stationary power applications

Science.gov (United States)

Vatsky, A.; Chen, H. S.; Dineen, J.

1982-05-01

The technical feasibility of applying automotive-derived kinematic and free-piston Stirling engine concepts for stationary applications was explored. Automotive-derived engines offer cost advantages by providing a mature and developd engine technology base with downrating and parts commonality options for specific applications. Two engine sizes (30 and 400 kW), two Stirling engine configurations (kinematic and free-piston), and two output systems (crankshaft and hydraulic pump) were studied. The study includes the influences of using either hydrogen or helium as the working gas. The first kinematic configuration selects an existing Stirling engine design from an automotive application and adapts it to stationary requirements. A 50,000-hour life requirement was established by downrating the engine to 40 kW and reducing auxiliary loads. Efficiency improvements were gained by selective material and geometric variations and peak brake efficiency of 36.8 percent using helium gas was achieved. The second design was a four-cylinder, 400 kW engine, utilizing a new output drive system known as the z-crank, which provides lower friction losses and variable stroke power control. Three different material and working gas combinations were considered. Brake efficiency levels varied from 40.5 percent to 45.6 percent. A 37.5 kW single-cycle, free-piston hydraulic output design was generated by scaling one cylinder of the original automotive engine and mating it to a counterbalanced reciprocal hydraulic pump. Metallic diaphragms were utilized to transmit power.

Design of 500kW grate fired test facility using CFD

DEFF Research Database (Denmark)

Rosendahl, Lasse Aistrup; Kær, Søren Knudsen; Jørgensen, K.

2005-01-01

A 500kW vibrating grate fired test facility for solid biomass fuels has been designed using numerical models including CFD. The CFD modelling has focussed on the nozzle layout and flowpatterns in the lower part of the furnace, and the results have established confidence in the chosen design...

Coarsening of AA6013-T6 Precipitates During Sheet Warm Forming Applications

Science.gov (United States)

Di Ciano, M.; DiCecco, S.; Esmaeili, S.; Wells, M. A.; Worswick, M. J.

2018-03-01

The use of warm forming for AA6xxx-T6 sheet is of interest to improve its formability; however, the effect warm forming may have on the coarsening of precipitates and the mechanical strength of these sheets has not been well studied. In this research, the coarsening behavior of AA6013-T6 precipitates has been explored, in the temperature range of 200-300 °C, and time of 30 s up to 50 h. Additionally, the effect of warm deformation on coarsening behavior was explored using: (1) simulated warm forming tests in a Gleeble thermo-mechanical simulator and (2) bi-axial warm deformation tests. Using a strong obstacle model to describe the yield strength (YS) evolution of the AA6013-T6 material, and a Lifshitz, Slyozov, and Wagner (LSW) particle coarsening law to describe the change in precipitate size with time, the coarsening kinetics were modeled for this alloy. The coarsening kinetics in the range of 220-300 °C followed a trend similar to that previously found for AA6111 for the 180-220 °C range. There was strong evidence that coarsening kinetics were not altered due to warm deformation above 220 °C. For warm forming between 200 and 220 °C, the YS of the AA6013-T6 material increased slightly, which could be attributed to strain hardening during warm deformation. Finally, a non-isothermal coarsening model was used to assess the potential reduction in the YS of AA6013-T6 for practical processing conditions related to auto-body manufacturing. The model calculations showed that 90% of the original AA6013-T6 YS could be maintained, for warm forming temperatures up to 280 °C, if the heating schedule used to get the part to the warm forming temperature was limited to 1 min.

75 FR 3959 - Fifth Meeting-RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2010-01-25

... 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220: Automatic Flight Guidance and Control meeting. SUMMARY: The FAA is issuing this notice to advise the public of a meeting of RTCA Special Committee 220: Automatic Flight...

First lasing of the Dutch Fusion-FEM: 730 kW, 200 GHz

Energy Technology Data Exchange (ETDEWEB)

Urbanus, W.H. E-mail: urbanus@rijnh.nl; Bongers, W.A.; Geer, C.A.J. van der; Manintveld, P.; Plomp, J.; Pluygers, J.; Poelman, A.J.; Smeets, P.H.M.; Schueller, F.C.; Verhoeven, A.G.A.; Bratman, V.L.; Denisov, G.G.; Savilov, A.V.; Shmelyov, M.Yu.; Caplan, M.; Varfolomeev, A.A

1999-06-01

A high-power electrostatic free-electron maser is operated at various frequencies. An output power of 730 kW at 206 GHz is generated with a 7.2 A, 1.77 MeV electron beam, and 360 kW at 167 GHz is generated with a 7.0 A, 1.61 MeV electron beam. It is shown experimentally and by simulations that, depending on the electron beam energy, the FEM can operate in single-frequency regime. First experiments were done without electron beam energy recovery system, and the pulse length was limited to 12 {mu}s. Nevertheless, many aspects of generation of mm-wave power have been explored, such as the dependency on the electron beam energy and beam current and cavity settings such as the feedback coefficient. The achieved parameters and the FEM dynamics are in good accordance with simulations.

Effects of potassium iodide in concentrations of TSH, tT3 and tT4 in serum of subjects with sporotrichosis.

Science.gov (United States)

Ramírez Soto, Max Carlos

2014-08-01

The saturated potassium iodide solution (SSKI) as treatment for sporotrichosis may cause hypothyroidism by suppressing the synthesis of thyroid hormones (tT3 and tT4 ) and the iodine excess could lead to thyrotoxicosis. Evaluating the changes in serum levels of TSH, tT3 and tT4 in euthyroid patients with sporotrichosis treated with SSKI. For the selection of euthyroid patients, TSH, tT3 and tT4 concentrations were measured for those adults and children diagnosed with sporotrichosis. Each paediatric patient was administered SSKI orally in increasing doses of 2-20 drops/3 times/day and 4-40 drops/3 times/day in adults. Serum concentrations of TSH, tT3 and tT4 were measured 20 days after started the treatment and 15 days posttreatment. Eight euthyroid patients aged between 2 to 65 years old were included. After 20 days of treatment, two suffered subclinical hypothyroidism, one developed subclinical hyperthyroidism, and one hyperthyroxinaemia euthyroid. At 15 days posttreatment only four patients were evaluated and all serum levels of TSH, tT3 and tT4 were normal. Some euthyroid patients with sporotrichosis can develop hyperthyroidism or subclinical iodine-induced hypothyroidism, during the administration of 3 or 6 g SSKI/day. © 2014 Blackwell Verlag GmbH.

1000 kW ICRH amplifiers for MFTF-B

International Nuclear Information System (INIS)

Boksberger, U.

1986-01-01

For the startup of the MFTF-B ICRH heating will be applied. Two commercial amplifiers derived from standard broadcast transmitters provide 1000 kW RF power each into a matching system for any VSWR as high as 1.5. Emphasis is put on the specific environment of magnetic fields and seismic loads as well as to the particular RF power control requirements and remote operation. Also addressed is the amplifier's performance into a typical load. The load variations due to the MFTF-B plasma coupling were calculated by TRW

7 CFR 220.7 - Requirements for participation.

Science.gov (United States)

2010-01-01

... items such a grade, purchase units, style, condition, weight, ingredients, formulations, and delivery... citations affecting § 220.7, see the List of CFR Sections Affected, which appears in the Finding Aids...

Thermal power calibration of the TRIGA Mark I IPR-R1 reactor during the upgrading tests to 250 kW

International Nuclear Information System (INIS)

Mesquita, Amir Zacarias; Maretti, Fausto Junior; Rezende, Hugo Cesar

2002-01-01

This paper presents the results and the methodology used to calibrate the thermal power of the TRIGA MARK I IPR-R1 Reactor in CDTN, Belo Horizonte, Brazil. This calibration was realized during the operation tests carried out to allow the reactor power upgrade from the current 100 kW to 250 kW. The methodology consisted in the measurement of the inlet and outlet temperature and the water flow in the primary cooling loop. The thermal balance together with the thermal losses gave the thermal power. There were made three sequences of tests. The first rising of the thermal power was made with the usual configuration of the core (59 fuel elements). After the changing of the ion chambers position and the control rod and the increase of the number of fuels (63 fuel elements), a new evaluation of the thermal power was accomplished, having been obtained a thermal power of 234 kW, for an indication of 250 kW in the lineal channel. After the return of the core to the initial configuration (59 fuel elements), it took place a new test, getting back the reactor to the power level of 100 kW. (author)

A maximum power point tracking scheme for a 1kw stand-alone ...

African Journals Online (AJOL)

A maximum power point tracking scheme for a 1kw stand-alone solar energy based power supply. ... Nigerian Journal of Technology ... A method for efficiently maximizing the output power of a solar panel supplying a load or battery bus under ...

Thoron (220Rn) in the indoor environment and work places

Science.gov (United States)

Ramachandran, T. V.; Sahoo, B. K.

2009-08-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222Rn and its progeny, there was a great upsurge of interest in the measurement of 222Rn in the environment. Subsequently, considerable data is being generated on the levels of 222Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220Rn in indoors and workplace environment is scaree due to the genral perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon (222Rn), and thoron (220Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222Rn, 220Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232Th is being handled is being summarized. Methods of measurement and

Thoron (220Rn) in the indoor environment and work places

International Nuclear Information System (INIS)

Ramchandran, T.V.; Sahoo, B.K.

2009-01-01

Ever since studies on uranium miners established the presence of a positive risk coefficient for the occurrence of lung cancer in miners exposed to elevated levels of 222 Rn and its progeny, there was a great upsurge of interest in the measurement of 222 Rn in the environment. Subsequently, considerable data is being generated on the levels of 222 Rn in the environment across the worlds and is being periodically reported by UNSCEAR reports. In contrast to this, data pertaining to 220 Rn in indoors and workplace environment is scaree due to the general perception that its levels are negligible due to its shorter half life, and subsequently its contribution to the total inhalation dose is ignored, in the presence of other significant sources of natural radiation. This may not be true. Globally many locations have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It is estimated that inhalation of 222 Rn, 220 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. 220 Rn problem exists in industries which use thorium nitrate. Including India, lamps using thoriated gas mantles are still being used for indoor and outdoor lighting and by hawkers in rural as well as urban areas. Considering the fact that large amount of thorium nitrate is being handled by these industries, contribution to the inhalation dose of workers from 220 Rn gas emanated and build up of the progeny in ambient air may also be quite significant. In this paper current status of 220 Rn levels in the indoor environment and workplaces as well as in other industries where large amount of 232 Th is being handled is being summarized. Methods of

Thoron (220Rn) in the indoor atmospheric environment

International Nuclear Information System (INIS)

Ramachandran, T.V.

2006-01-01

Naturally occurring background radiation is a topic, which has evoked curiosity and concern between the scientist and layman alike in recent years due to the shift in focus of health effects due to exposure of radiation from acute high level to chronic low level. Many locations around the world have higher levels of natural background radiation due to elevated levels of primordial radio nuclides in the soil and their decay products like radon ( 222 Rn), and thoron ( 220 Rn) in the environment. Of late, technologically enhanced naturally occurring radioactive material has also contributed to the burden of background radiation. It has been estimated that inhalation of 222 Rn, 2 20 Rn and their short lived progenies contribute more than 54% of the total natural background radiation dose received by the general population. In the Indian context, in an earlier national survey, the external gamma radiation dose rates have been more or less well mapped using thermo luminescent dosimeters covering more than 214 locations, which has yielded a national average of 775 mGy/y. Of this, nearly 48.7% contribution of the dose rate is from 40 K and the rest from the uranium (33.6%) and thorium (17.7%) series. A good database pertaining to the country wide levels of uranium, thorium and potassium in geological materials also exists. Thus, there exists a good database on the total external gamma radiation level across the country. Since the contribution from inhalation of 222 Rn, 220 Rn and their short lived progenies contributes more than 54% of the total background radiation dose, it was necessary to supplement the external component with inhalation component. This component is not adequately estimated for the country so far on national level. With this in mind, a national survey has been executed by this center involving a large number of universities and other allied research institutions from different parts of the country for the estimation of inhalation component of the dose

36 CFR 220.4 - General requirements.

Science.gov (United States)

2010-07-01

... natural and physical environment and the relationship of people with that environment (see 40 CFR 1508.14... for environmental assessments, findings of no significant impact and categorical exclusions (FSM 1950... ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.4 General requirements. (a) Proposed actions subject to the...

22 CFR 1508.220 - Are any procurement contracts included as covered transactions?

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Are any procurement contracts included as covered transactions? 1508.220 Section 1508.220 Foreign Relations AFRICAN DEVELOPMENT FOUNDATION.... (3) The contract is for federally-required audit services. ...

Power ramp rate capabilities of a 5 kW proton exchange membrane fuel cell system with discrete ejector control

Science.gov (United States)

Nikiforow, K.; Pennanen, J.; Ihonen, J.; Uski, S.; Koski, P.

2018-03-01

The power ramp rate capabilities of a 5 kW proton exchange membrane fuel cell (PEMFC) system are studied theoretically and experimentally for grid support service applications. The fuel supply is implemented with a fixed-geometry ejector and a discrete control solution without any anode-side pressure fluctuation suppression methods. We show that the stack power can be ramped up from 2.0 kW to 4.0 kW with adequate fuel supply and low anode pressure fluctuations within only 0.1 s. The air supply is implemented with a centrifugal blower. Air supply ramp rates are studied with a power increase executed within 1 and 0.2 s after the request, the time dictated by grid support service requirements in Finland and the UK. We show that a power ramp-up from 2.0 kW to 3.7 kW is achieved within 1 s with an initial air stoichiometry of 2.5 and within 0.2 s with an initial air stoichiometry of 7.0. We also show that the timing of the power ramp-up affects the achieved ancillary power capacity. This work demonstrates that hydrogen fueled and ejector-based PEMFC systems can provide a significant amount of power in less than 1 s and provide valuable ancillary power capacity for grid support services.

100-kW hingeless metal wind turbine blade design, analysis and fabrication

Science.gov (United States)

Donham, R. E.; Schmidt, J.; Linscott, B. S.

1975-01-01

The design, fabrication and analysis of aluminum wind turbine rotor blades is discussed. The blades are designed to meet criteria established for a 100-kilowatt wind turbine generator operating between 8 and 60-mile-per-hour speeds at 40 revolutions per minute. The design wind speed is 18 miles per hour. Two rotor blades are used on a new facility which includes a hingeless hub and its shaft, gearbox, generator and tower. Experience shows that, for stopped rotors, safe wind speeds are strongly dependent on blade torsional and bending rigidities which the basic D spar structural blade design provides. The 0.25-inch-thick nose skin is brake/bump formed to provide the basic 'D' spar structure for the tapered, twisted blades. Adequate margins for flutter and divergence are predicted from the use of existing, correlated stopped rotor and helicopter rotor analysis programs.

Dynamic interaction of p220NPAT and CBP/p300 promotes S-phase entry

International Nuclear Information System (INIS)

Wang, Aiyan; Ikura, Tsuyoshi; Eto, Kazuhiro; Ota, Masato S.

2004-01-01

Cajal bodies contain cyclin E/cdk2 and the substrate p220 NPAT to regulate the transcription of histones, which is essential for cell proliferation, however, recent mouse knockout studies indicate that cyclin E and cdk2 are dispensable for these events. Because the CBP/p300 histone acetyltransferase are also known to be involved in cell proliferation, we examined the molecular and functional interactions of p220 NPAT with the CBP/p300 at the G1/S boundary as cell cycle regulators. The subnuclear localization of p220 NPAT and CBP/p300 proteins showed that their foci partially overlapped in a cell cycle dependent manner. Overexpression of p220 NPAT and CBP/p300 cooperatively enhanced G1/S transition and DNA synthesis even without cdk2 phosphorylation site. Finally, molecular alignment analysis indicated that p220 NPAT contains several potential substrate sites for CBP/p300. Overall, our findings demonstrate that p220 NPAT and CBP/p300 form a transient complex at the G1/S boundary to play cooperative roles to promote the S-phase entry

A 10-kW series resonant converter design, transistor characterization, and base-drive optimization

Science.gov (United States)

Robson, R. R.; Hancock, D. J.

1982-01-01

The development, components, and performance of a transistor-based 10 kW series resonant converter for use in resonant circuits in space applications is described. The transistors serve to switch on the converter current, which has a half-sinusoid waveform when the transistor is in saturation. The goal of the program was to handle an input-output voltage range of 230-270 Vdc, an output voltage range of 200-500 Vdc, and a current limit range of 0-20 A. Testing procedures for the D60T and D7ST transistors are outlined and base drive waveforms are presented. The total device dissipation was minimized and found to be independent of the regenerative feedback ratio at lower current levels. Dissipation was set at within 10% and rise times were found to be acceptable. The finished unit displayed a 91% efficiency at full power levels of 500 V and 20 A and 93.7% at 500 V and 10 A.

Wind Turbine Generator System Acoustic Noise Test Report for the Gaia Wind 11-kW Wind Turbine

Energy Technology Data Exchange (ETDEWEB)

Huskey, A.

2011-11-01

This report details the acoustic noise test conducted on the Gaia-Wind 11-kW wind turbine at the National Wind Technology Center. The test turbine is a two- bladed, downwind wind turbine with a rated power of 11 kW. The test turbine was tested in accordance with the International Electrotechnical Commission standard, IEC 61400-11 Ed 2.1 2006-11 Wind Turbine Generator Systems -- Part 11 Acoustic Noise Measurement Techniques.

Modeling and Simulation for an 8 kW Three-Phase Grid-Connected Photo-Voltaic Power System

OpenAIRE

Cen Zhaohui

2017-01-01

Gird-connected Photo-Voltaic (PV) systems rated as 5-10 kW level have advantages of scalability and energy-saving, so they are very typical for small-scale household solar applications. In this paper, an 8 kW three-phase grid-connected PV system model is proposed and studied. In this high-fidelity model, some basic PV system components such as solar panels, DC-DC converters, DC-AC inverters and three-phase utility grids are mathematically modelled and organized as a complete simulation model....

Engineering aspects of a thermal control subsystem for the 25 kW power module

Science.gov (United States)

Schroeder, P. E.

1979-01-01

The paper presents the key trade study results, analysis results, and the recommended thermal control approach for the 25 kW power module defined by NASA. Power conversion inefficiencies and component heat dissipation results in a minimum heat rejection requirement of 9 kW to maintain the power module equipment at desired temperature levels. Additionally, some cooling capacity should be provided for user payloads in the sortie and free-flying modes. The baseline thermal control subsystem includes a dual-loop-pumped Freon-21 coolant with the heat rejected from deployable existing orbiter radiators. Thermal analysis included an assessment of spacecraft orientations, radiator shapes and locations, and comparison of hybrid heat pipe and all liquid panels.

22 CFR 1006.220 - Are any procurement contracts included as covered transactions?

Science.gov (United States)

2010-04-01

... covered transactions? 1006.220 Section 1006.220 Foreign Relations INTER-AMERICAN FOUNDATION GOVERNMENTWIDE... the consent of a(n) Inter-American Foundation official. In that case, the contract, regardless of the... appendix to this part. (3) The contract is for federally-required audit services. ...

5 MeV 300 kW electron accelerator project

International Nuclear Information System (INIS)

Auslender, V.L.; Cheskidov, V.G.; Gornakov, I.V.

2004-01-01

The paper presents a project of a high power linear accelerator for industrial applications. The accelerator has a modular structure and consists of the chain of accelerating cavities connected by the axis-located coupling cavities with coupling slots in the common walls. Main parameters of the accelerator are: operating frequency of 176 MHz, electron energy of up to 5 MeV, average beam power of 300 kW. The required RF pulse power can be supplied by the TH628 diacrode

The MOD-OA 200 kilowatt wind turbine generator design and analysis report

Science.gov (United States)

Andersen, T. S.; Bodenschatz, C. A.; Eggers, A. G.; Hughes, P. S.; Lampe, R. F.; Lipner, M. H.; Schornhorst, J. R.

1980-01-01

The project requirements, approach, system description, design requirements, design, analysis, system tests, installation safety considerations, failure modes and effects analysis, data acquisition, and initial performance for the MOD-OA 200 kw wind turbine generator are discussed. The components, the rotor, driven train, nacelle equipment, yaw drive mechanism and brake, tower, foundation, electrical system, and control systems are presented. The rotor includes the blades, hub and pitch change mechanism. The drive train includes the low speed shaft, speed increaser, high speed shaft, and rotor brake. The electrical system includes the generator, switchgear, transformer, and utility connection. The control systems are the blade pitch, yaw, and generator control, and the safety system. Manual, automatic, and remote control and Dynamic loads and fatigue are analyzed.

Scientific Opinion on Flavouring Group Evaluation 220 Revision 3 (FGE.220Rev3): Consideration of genotoxic potential for α,β-unsaturated 3(2H)-Furanones from subgroup 4.4 of FGE.19

DEFF Research Database (Denmark)

Beltoft, Vibe Meister; Nørby, Karin Kristiane

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from FGE.19 subgroup 4.4, in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided...... into two subgroups: subgroup 4.4a containing [FL-no: 13.089, 13.117, 13.119, 13.157 and 13.175] and subgroup 4.4b containing [13.010, 13.084 and 13.085, 13.099 and 13.176]. For both subgroups the Panel concluded that the genotoxicity alert could not be ruled out based on the data available and accordingly...... additional genotoxicity data were requested. In FGE.220, Revision 1, the Panel concluded that for the substances in subgroup 4.4b there is no concern for genotoxicity. In FGE.220, Revision 2, the Panel evaluated genotoxicity studies on two representative substances of subgroup 4.4a: 2,5-dimethylfuran-3(2H...

Organic Rankine kilowatt isotope power system. First annual summary report, August 1, 1975--August 1, 1976

International Nuclear Information System (INIS)

1976-01-01

Sundstrand Energy Systems is developing a Kilowatt Isotope Power System (KIPS) directed toward satisfying the higher power requirements of satellites of the 1980's. The KIPS is a plutonium oxide fueled organic Rankine cycle turbine power system which will provide design output power in the range of 500 to 2000 W(e) with a minimum of system changes. Research progress is reported on Phase I comprising: (1) flight system conceptual design and ground demonstration; (2) flight system design and ground qualification; and (3) flight system production, acceptance testing and delivery. The principal objectives of Phase I are to: (1) conceptually design the flight system, (2) based on the flight system concept, design and build the ground demonstration system (GDS), (3) conduct performance and endurance testing using electric heaters to simulate the radioisotope heat source, (4) identify and initiate long lead development efforts required to achieve the initial flight qualification hardware availability date of April 1981, and (5) finalize the flight concept design and prepare the program plan for the Phase II effort

Development of a Wood Powder Fuelled 35 kW Stirling CHP Unit

DEFF Research Database (Denmark)

Pålsson, M.; Carlsen, Henrik

2003-01-01

For biomass fuelled CHP in sizes below 100 kW, Stirling engines are the only feasible alternative today. Using wood powder as fuel, the Stirling engine can be heated directly by the flame like when using a gaseous or liquid fuel burner. However, the combustion chamber will have to be much larger...... recirculation (CGR) a smaller air preheater can be used, while system efficiency will increase compared with using excess air for flame cooling. In a three-year project, a wood powder fuelled Stirling engine CHP unit will be developed and run in field test. The project will use the double-acting four......-cylinder Stirling engine SM3D with an electric output of 35 kW. This engine is a further development of the engine SM3B that has been developed at the Technical University of Denmark. The engine heater is being adapted for use with wood powder as fuel. During a two-year period a combustion system for this engine...

Producer gas fuelling of a 20kW output engine by gasification of solid biomass

Energy Technology Data Exchange (ETDEWEB)

Hollingdale, A C; Breag, G R; Pearce, D

1988-11-01

Motive power requirements in the range up to 100 kW shaft power are common in developing country processing operations. Producer gas-fuelled systems based upon a relatively cheap and simple manually operated gasifier or reactor using readily available biomass feedstock can offer in some cases an attractive alternative to fossil-fuelled power units. This bulletin outlines research and development work by the Industrial Development Department of the Overseas Development Natural Resources Institute for 20 kW shaft power output from producer gas derived from solid biomass. Biomass materials such as wood or shells can be carbonized to form charcoal or left in the natural uncarbonized state. In this work both carbonized and uncarbonized biomass fuel has been used to provide producer gas to fuel a Ford 2274E engine, an industrial version of a standard vehicle spark-ignition engine. Cross-draught and down-draught reactor designs were evaluated during trials with this engine. Also different gas cleaning and cooling arrangements were tested. Particular emphasis was placed on practical aspects of reactor/engine operation. This work follows earlier work with a 4 kW shaft power output system using charcoal-derived producer gas. (author).

GIS-Based KW-GIUH hydrological model of semiarid catchments: The case of Faria Catchment, Palestine

International Nuclear Information System (INIS)

Shadeed, S.; Shaheen, H.; Jayyousi, A.

2007-01-01

Among the most basic challenges of hydrology are the quantitative understanding of the processes of runoff generation and prediction of flow hydrographs. Traditional techniques have been widely applied for the estimation of runoff hydrographs of gauged catchments using historical rainfall-runoff data and unit hydrographs. Such procedures are questioned as to their reliability and their application to ungauged, arid and semiarid catchments. To overcome such difficulties, the use of physically based rainfall-runoff process of Faria Catchment using the lately developed KW-GIUH. Faria catchment, located in the northeastern part of the West Bank, Palestine, is characterized as a semiarid region with annual rainfall depths ranging on average from 150 to 640 mm at both ends of the catchment. The Geographical Information System (GIS) techniques were used to shape the geomorphological features of the catchment. A GIS based KW-GIUH hydrological model was used to stimulate the rainfall-runoff process in the three sub-catchments of Faria, namely: Al-Badan, Al-Faria and Al-Malaqi. The simulated runoff hydrographs proved that the GIS-based KW-GIUH model is applicable to semiarid regions and can be used to estimate the unit hydrographs in the West Bank catchments. (author)

The Development of a Control System for a 5 Kilowatt Free Piston Stirling Engine Convertor

Science.gov (United States)

Kirby, Raymond L.; Vitale, Nick

2008-01-01

The new NASA Vision for Exploration, announced by President Bush in January 2004, proposes an ambitious program that plans to return astronauts to the moon by the 2018 time frame. A recent NASA study entitled "Affordable Fission Surface Power Study" recommended a 40 kWe, 900 K, NaK-cooled, Stirling convertors for 2020 launch. Use of two of the nominal 5 kW convertors allows the system to be dynamically balanced. A group of four dual-convertor combinations that would yield 40 kWe can be tested to validate the viability of Stirling technology for space fission surface power systems. The work described in this paper deals specifically with the control system for the 5 kW convertor described in the preceding paragraph. This control system is responsible for maintaining piston stroke to a setpoint in the presence of various disturbances including electrical load variations. Pulse starting of the Free Piston Stirling Engine (FPSE) convertor is also an inherent part of such a control system. Finally, the ability to throttle the engine to match the required output power is discussed in terms of setpoint control. Several novel ideas have been incorporated into the piston stroke control strategy that will engender a stable response to disturbances in the presence of midpoint drift while providing useful data regarding the position of both the power piston and displacer.

The Development of a Control System for a 5 Kilowatt Free Piston Stirling Space Convertor

International Nuclear Information System (INIS)

Kirby, Raymond L.; Vitale, N.

2008-01-01

The new NASA Vision for Exploration, announced by President Bush in January 2004, proposes an ambitious program that plans to return astronauts to the moon by the 2018 time frame. A recent NASA study entitled 'Affordable Fission Surface Power Study' recommended a 40 kWe, 900 K, NaK-cooled, Stirling conversion for 2020 launch. Use of two of the nominal 5 kW converters allows the system to be dynamically balanced. A group of four dual-converter combinations that would yield 40 kWe can be tested to validate the viability of Stirling technology for space fission surface power systems. The work described in this paper deals specifically with the control system for the 5 kW convertor described in the preceding paragraph. This control system is responsible for maintaining piston stroke to a setpoint in the presence of various disturbances including electrical load variations. Pulse starting of the FSPE convertor is also an inherent part of such a control system. Finally, the ability to throttle the engine to match the required output power is discussed in terms of setpoint control. Several novel ideas have been incorporated into the piston stroke control strategy that will engender a stable response to disturbances in the presence of midpoint drift while providing useful data regarding the position of both the power piston and displacer

40 CFR 80.220 - What are the downstream standards for GPA gasoline?

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 16 2010-07-01 2010-07-01 false What are the downstream standards for GPA gasoline? 80.220 Section 80.220 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... downstream location other than at a retail outlet or wholesale purchaser-consumer facility, and during the...

Power to the people

Energy Technology Data Exchange (ETDEWEB)

Lawton, G.

2002-03-02

The Harrison family from Chester in north-west England are currently testing a 'personal' combined heat and power (CHP) plant in their garage. The CHP plant, which was supplied by the New Zealand-based company WhisperTech, produces electricity and provides space heating and hot water. The floor-mounted WhisperTech unit produces about 6 kW of heat and 1 kW of electricity. A similar wall-mounted unit developed by BG Group produces up to 15 kW of heat and 1.1 kilowatt of electricity. These personal CHP plants are based on Stirling engines built using advanced materials that can cope with the high temperatures necessary for the efficient operation required to achieve energy savings compared with conventional boilers. Some 20 WhisperTech units and 12 BG Group units have been installed in UK homes. Units have also been fitted in houses in the Netherlands. The advantages of personal CHP systems, the operation of Stirling engines and the need to remain connected to the mains are explained.

32 CFR 37.220 - How involved should the Government program official be in the project?

Science.gov (United States)

2010-07-01

... official be in the project? 37.220 Section 37.220 National Defense Department of Defense OFFICE OF THE... Technology Investment Agreements § 37.220 How involved should the Government program official be in the project? (a) TIAs are used to carry out cooperative relationships between the Federal Government and the...

Stand-alone version of the 11kW Gaia wind turbine

DEFF Research Database (Denmark)

Bindner, H.; Rosas, P.A.C.; Teodorescu, R.

2004-01-01

This report describes the development of a stand-alone version of the 11kW Gaia wind turbine. Various possible configurations are investigated and a configuration using a back-to-back converter is chosen. A model is developed for controller design of thefast controllers of the unit. Controllers...... assessment and controller design a dynamic performance assessment model has been developed....

The MTX computer control system for the 400 kilowatt 140 GHz gyrotron

International Nuclear Information System (INIS)

Jackson, M.C.; Ferguson, S.W.; Petersen, D.E.

1991-09-01

A 400 kilowatt, 140 Ghz gyrotron is employed on MTX as a source of direct plasma heating and, additionally, as a driver for a free electron laser, which is used for plasma heating. The control system that operates this gyrotron uses a new graphics oriented software system called TACL (Thaumaturgic Automated Control Logic) developed by the Continuous Electron Beam Accelerator Facility (CEBAF) and owned by DOE. This control language does not require a software specialist, but is easily handled by the engineer or technician working on the system. All control logic and custom displays are entered via graphics oriented editors and no actual lines of code need to be written. The graphics displays make the gyrotron operation quite simple and allow individual users to define displays to meet their own needs or develop one for a specific set of tests to be run. The system, additionally, can be used for logging functions, which have been found quite useful in tracking long term trends in vacion current and calorimetry of gyrotron cooling circuits. The system is composed of one computer (HP 9000 series 300) controlling multiple CAMAC crates located at the various components used in the system. A second series 300 computer is used as a supervisor and is located in the main tokamak control room. This supervisory computer provides remote operation of the gyrotron, and also provides a link to the microwave transport vacuum control (also TACL). The supervisory computer, additionally, is used as a subsystem status summary point for permissives to the gyrotron control system

Uji kinerja Turbin arus laut-Twin Hull 10 Kilowatt di Jembatan Suramadu

Directory of Open Access Journals (Sweden)

Afian Kasharjanto

2017-11-01

Full Text Available Abstrak Melalui Program Pengembangan Teknologi Industri (PPTI - Ristekdikti tahun 2016 telah di lakukan uji fungsi Turbin arus laut Twin Turbine -10 Kilowatt selama 1 (satu bulan sejak 28 Nopember sampai dengan 30 Desember 2016. Turbin yang di gunakan adalah turbin yang pernah di uji pada tahun 2015 dilokasi yang sama  yaitu di bawah Jembatan Suramadu – Pile   56 tetapi rasio transmisi yang pada awalnya di buat 1 : 22,5 di turunkan menjadi 1: 12. Perubahan di lakukan karena putaran generator melebihi putaran maksimum yang di ijinkan generator sehingga terjadi beban arus besar (melebihi kapasitas Inverter sehingga Inverter dapat terbakar. Tujuan dari kegiatan adalah untuk mengetahui daya listrik yang dapat di hasilkan oleh turbin tipe dua rotor (Twin Turbine untuk operasional di bawah Jembatan.  Melalui pengukuran langsung selama 30 hari siang dan malam, akan di dapat data daya listrik maksimal sebagai fungsi dari kecepatan arus laut dan ukuran rotor Tubin. Data kemudian di olah untuk mendapatkan nilai besaran daya listrik dan efisiensi. Cutt-in speed terjadi pada kecepatan arus 0,6 m/dt dan menghasilkan daya minimal pada masing – masing generator sebesar 480 Watt dan kecepatan arus maksimal terjadi pada 1,10 m/dt , menghasilkan daya maksimal 2,230 watt.Beban lampu di distribusikan bukan hanya di dalam turbin tetapi juga di tempelkan pada tiang Plie – 56 sebagai uji coba untuk penerangan di sepanjang jalan raya pada Pile-56 Jembatan Suramadu.           Kata kunci : Uji Fungsi turbin, Jembatan Suramadu, Rasio transmisi mekanik, Cutt-in speed

12 MeV, 4.3 kW electron linear accelerator irradiation application

International Nuclear Information System (INIS)

Hang Desheng; Lai Qiji

2000-01-01

Characteristics of an electron linear accelerator, which has 6-12 MeV energy, 4.2 kW average beam power is introduced. Results show that it has advantages on improving the characteristics of semiconductor devices such as diodes, triodes, SCR, preventing garlic from sprout, preservation of food, and so on

3 kW single stage all-fiber Yb-doped single-mode fiber laser for highly reflective and highly thermal conductive materials processing

Science.gov (United States)

Ikoma, S.; Nguyen, H. K.; Kashiwagi, M.; Uchiyama, K.; Shima, K.; Tanaka, D.

2017-02-01

A 3 kW single stage all-fiber Yb-doped single-mode fiber laser with bi-directional pumping configuration has been demonstrated. Our newly developed high-power LD modules are employed for a high available pump power of 4.9 kW. The length of the delivery fiber is 20 m which is long enough to be used in most of laser processing machines. An output power of 3 kW was achieved at a pump power of 4.23 kW. The slope efficiency was 70%. SRS was able to be suppressed at the same output power by increasing ratio of backward pump power. The SRS level was improved by 5dB when 57% backward pump ratio was adopted compared with the case of 50%. SRS was 35dB below the laser power at the output power of 3 kW even with a 20-m delivery fiber. The M-squared factor was 1.3. Single-mode beam quality was obtained. To evaluate practical utility of the 3 kW single-mode fiber laser, a Bead-on-Plate (BoP) test onto a pure copper plate was executed. The BoP test onto a copper plate was made without stopping or damaging the laser system. That indicates our high power single-mode fiber lasers can be used practically in processing of materials with high reflectivity and high thermal conductivity.

MW-Class Electric Propulsion System Designs for Mars Cargo Transport

Science.gov (United States)

Gilland, James H.; LaPointe, Michael R.; Oleson, Steven; Mercer, Carolyn; Pencil, Eric; Maosn, Lee

2011-01-01

Multi-kilowatt electric propulsion systems are well developed and have been used on commercial and military satellites in Earth orbit for several years. Ion and Hall thrusters have also propelled robotic spacecraft to encounters with asteroids, the Moon, and minor planetary bodies within the solar system. High power electric propulsion systems are currently being considered to support piloted missions to near earth asteroids, as cargo transport for sustained lunar or Mars exploration, and for very high-power piloted missions to Mars and the outer planets. Using NASA Mars Design Architecture 5.0 as a reference, a preliminary parametric analysis was performed to determine the suitability of a nuclear powered, MW-class electric propulsion system for Mars cargo transport. For this initial analysis, high power 100-kW Hall thrusters and 250-kW VASIMR engines were separately evaluated to determine optimum vehicle architecture and estimated performance. The DRA 5.0 cargo mission closed for both propulsion options, delivering a 100 t payload to Mars orbit and reducing the number of heavy lift launch vehicles from five in the baseline DRA 5.0 architecture to two using electric propulsion. Under an imposed single engine-out mission success criteria, the VASIMR system took longer to reach Mars than did the Hall system, arising from the need to operate the VASIMR thrusters in pairs during the spiral out from low Earth orbit.

Operation result of 40kW class MCFC pilot plant

Energy Technology Data Exchange (ETDEWEB)

Saitoh, H.; Hatori, S.; Hosaka, M.; Uematsu, H. [Ishikawajima-Harima Heavy Industries Co., Ltd., Tokyo (Japan)

1996-12-31

Ishikawajima-Harima Heavy Industries Co., Ltd. developed unique Molten Carbonate Fuel Cell (MCFC) system based on our original concept. To demonstrate the possibility of this system, based on MCFC technology of consigned research from New Energy and Industrial Technology Development Organization (NEDO) in Japan, we designed 40kW class MCFC pilot plant which had all equipments required as a power plant and constructed in our TO-2 Technical Center. This paper presents the test results of the plant.

25 CFR 166.220 - What are the basic steps for acquiring a permit through negotiation?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false What are the basic steps for acquiring a permit through negotiation? 166.220 Section 166.220 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER GRAZING PERMITS Permit Requirements Obtaining A Permit § 166.220 What are the basic steps for acquiring a permit through negotiation? The...

Measurement of airborne concentrations of radon-220 daughter products by alpha-particle spectrometry

International Nuclear Information System (INIS)

Kerr, G.D.; Ryan, M.T.; Perdue, P.T.

1978-01-01

The decay of naturally occurring uranium-238 and thorium-232 produces radon-222 and radon-220 isotopes which can escape into the atmosphere. If these radon gases become concentrated in air, their daughter products may present an inhalation hazard to man. The airborne concentrations of radon-222 can usually be measured very accurately in the presence of normal airborne concentrations of radon-220 and its daughters. In contrast, the measurements of the airborne concentrations of radon-220 daughters are usually complicated by the presence of radon-222 and its daughters even at normally occurring airborne concentrations. The complications involved in these measurements can be overcome in most situations by using an alpha particle spectrometer to distinguish the activity of radon-222 daughters from that due to radon-220 daughters collected on a filter. A practical spectrometer for field measurements of alpha particle activity on a filter is discussed

Características e desempenho agronômico no Paraná da cultivar de trigo BRS 220 Characteristics and agronomic performance in Paraná State of wheat cultivar BRS 220

Directory of Open Access Journals (Sweden)

Manoel Carlos Bassoi

2005-02-01

Full Text Available A cultivar BRS 220, indicada para todas as regiões tritícolas do Paraná, apresenta elevado potencial de rendimento, ampla adaptação e é dotada de força de glúten que a inclui na classe de trigo pão. É resistente às ferrugens e moderadamente resistente às manchas foliares, à brusone e ao vírus-do-mosaico. É moderadamente suscetível à giberela e ao oídio. Apresenta ciclo de precoce a médio, altura média de planta, boa resistência ao acamamento e moderada tolerância ao alumínio tóxico. É moderadamente tolerante à debulha e suscetível à germinação pré-colheita. Apresentou, nos cinco anos de experimentação, média de rendimento de grãos da ordem de 4.853 kg ha-1, na região 6, 3.794 kg ha-1, na região 7, e 4.039 kg ha-1, na região 8, superando a média das cultivares testemunhas em 5%, 13% e 8%, respectivamente.The cultivar BRS 220, recommended for all wheat growing regions in the Paraná State, has shown a high yield potential, wide adaptation and resistance to the main diseases, presenting a gluten suitable for baking. The cultivar belongs to medium maturity group and presents medium height, high resistance to lodging, moderate tolerance to toxic aluminium, moderate tolerance to natural dehiscence but it is susceptible to preharvest sprouting (PHS. In the experimentation over five years, BRS 220 presented a grain yield average of 4,853 kg ha-1 in the region 6, 3,794 kg ha-1 in the region 7 and 4,039 kg ha-1 in the region 8, surpassing 5%, 13% and 8% the average of the local cultivars, respectively.

Numerical investigation into premixed hydrogen combustion within two-stage porous media burner of 1 kW solid oxide fuel cell system

Energy Technology Data Exchange (ETDEWEB)

Yen Tzu-Hsiang; Chen Bao-Dong [Refining and Manufacturing Research Institute, CPC Corporation, Chia-Yi City 60036, Taiwan (China); Hong Wen-Tang; Tsai Yu-Ching; Wang Hung-Yu; Huang Cheng-Nan; Lee Chien-Hsiung [Institute of Nuclear Energy Research Atomic Energy Council, Taoyuan County 32546, Taiwan (China)

2010-07-01

Numerical simulations are performed to analyze the combustion of the anode off-gas / cathode off-gas mixture within the two-stage porous media burner of a 1 kW solid oxide fuel cell (SOFC) system. In performing the simulations, the anode gas is assumed to be hydrogen and the combustion of the gas mixture is modeled using a turbulent flow model. The validity of the numerical model is confirmed by comparing the simulation results for the flame barrier temperature and the porous media temperature with the corresponding experimental results. Simulations are then performed to investigate the effects of the hydrogen content and the burner geometry on the temperature distribution within the burner and the corresponding operational range. It is shown that the maximum flame temperature increases with an increasing hydrogen content. In addition, it is found that the burner has an operational range of 1.2--6.5 kW when assigned its default geometry settings (i.e. a length and diameter of 0.17 m and 0.06 m, respectively), but increases to 2--9 kW and 2.6--11.5 kW when the length and diameter are increased by a factor of 1.5, respectively. Finally, the operational range increases to 3.5--16.5 kW when both the diameter and the length of the burner are increased by a factor of 1.5.

30 CFR 70.220 - Status change reports.

Science.gov (United States)

2010-07-01

... MANDATORY HEALTH STANDARDS-UNDERGROUND COAL MINES Sampling Procedures § 70.220 Status change reports. (a) If there is a change in operational status that affects the respirable dust sampling requirements of this... produced. (iii) Abandoned—the work of all miners has been terminated and production activity has ceased. (2...

40 CFR 1065.220 - Fuel flow meter.

Science.gov (United States)

2010-07-01

... follows: (1) Use the actual value of calculated raw exhaust flow rate in the following cases: (i) For... ENGINE-TESTING PROCEDURES Measurement Instruments Flow-Related Measurements § 1065.220 Fuel flow meter. (a) Application. You may use fuel flow in combination with a chemical balance of carbon (or oxygen...

Determining chance coincidence, survival factor and decay factor in 220Rn delayed coincidence measurement

International Nuclear Information System (INIS)

Huang Derong; Yan Yongjun; Zhou Jianliang; Qiu Shoukang

2013-01-01

The method and calculation formulas to determine the chance coincidence in the 220 Rn coincidence measurement are introduced in this paper. The poisson distribution is introduced to correct the chance coincidence. The relative deviation of the true coincidence between the method and the Giffin's is within 5% after the correction of the cohance coincidence. The measurement of 220 Rn is done by comparative measurement with RAD7. The results shows that 220 Rn can be measured by the method with a relative deviation of 14%. Mean while, for the 220 Rn flow regime is difficult to meet the condition of calculation formulas, a solution to solve the survival factor and decay factor is proposed and the error come from the useage of theoretical calculation formula is avoided. (authors)

Manufacturing of 380/220 V 63 A power supply panel on UO2 kernel coating unit

International Nuclear Information System (INIS)

Triyono; Mudjiman, Supardjono; Hidayat, Nur

2013-01-01

The panel 380/220 Volts voltage source current 63 Amperes relay AC output on UO 2 kernel coating unit has been manufactured. The activities include: installation and function panel test. The electrical installation of load includes : 220 Volts temperature monitor/controller, 220 Volts scraber pump, 220 Volts vacuum pump, 220 Volts solenoid valve gas and 380 Volts induction furnace. The component of installation includes: 380 Volts earth leakage circuit breaker, 380 Volts relay AC, 220 Volts magnetic circuit breaker, 100/5 Amperes current transformator ratio, voltmeter, ampermeter and push button normally open-close and temperature monitor/control in the box size 70x50x20 cm. The testing of voltage source has been unload and full load to determine the performance of the tool. The result of manufacture and function test voltage source 380/220 Volts at the UO 2 kernel coating unit showed that: the voltage source can work without load and full load safely. The load includes: voltage 380-382 Volts current 4-4,1 Amperes of induction furnace, voltage 223 Volts current 0,5 Amperes of vacuum pump, voltage 223 Volts current 4 Amperes of scraber pump, voltage 223 Volts current 0,3 Amperes of solenoid valve gas and 222 Volts current 0,03 Amperes temperature monitor/control. (author)

1-kilowatt CW all-fiber laser oscillator pumped with wavelength-beam-combined diode stacks.

Science.gov (United States)

Xiao, Y; Brunet, F; Kanskar, M; Faucher, M; Wetter, A; Holehouse, N

2012-01-30

We have demonstrated a monolithic cladding-pumped ytterbium-doped single all-fiber laser oscillator generating 1 kW of CW signal power at 1080 nm with 71% slope efficiency and near diffraction-limited beam quality. Fiber components were highly integrated on "spliceless" passive fibers to promote laser efficiency and alleviate non-linear effects. The laser was pumped through a 7:1 pump combiner with seven 200-W 91x nm fiber-pigtailed wavelength-beam-combined diode-stack modules. The signal power of such a single all-fiber laser oscillator showed no evidence of roll-over, and the highest output was limited only by available pump power.

24 CFR 220.802 - Final insurance endorsement.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Final insurance endorsement. 220... insurance endorsement. When all advances of loan proceeds have been made, and all the terms and conditions... on the original credit instrument the total of advances he has approved for insurance and again...

50 CFR 600.220 - Oath of office.

Science.gov (United States)

2010-10-01

..., DEPARTMENT OF COMMERCE MAGNUSON-STEVENS ACT PROVISIONS Council Membership § 600.220 Oath of office. Link to... United States of America by carrying out the business of the Council for the greatest overall benefit of... conduct prescribed by the Secretary of Commerce. This oath is given freely and without mental reservation...

30 CFR 90.220 - Status change reports.

Science.gov (United States)

2010-07-01

... MANDATORY HEALTH STANDARDS-COAL MINERS WHO HAVE EVIDENCE OF THE DEVELOPMENT OF PNEUMOCONIOSIS Sampling Procedures § 90.220 Status change reports. If there is a change in the status of a part 90 miner that affects the respirable dust sampling requirements of this part (such as entering a terminated, injured or ill...

Early Intervention of Intravenous KB220IV- Neuroadaptagen Amino-Acid Therapy (NAAT)™ Improves Behavioral Outcomes in a Residential Addiction Treatment Program: A Pilot Study

Science.gov (United States)

Miller, Merlene; Chen, Amanda LC; Stokes, Stan D.; Silverman, Susan; Bowirrat, Abdalla; Manka, Matthew; Manka, Debra; Miller, David K.; Perrine, Kenneth; Chen, Thomas JH; Bailey, John A.; Downs, William; Waite, Roger L.; Madigan, Margaret A.; Braverman, Eric R.; Damle, Uma; Kerner, Mallory; Giordano, John; Morse, Siobhan; Oscar-Berman, Marlene; Barh, Debmalya; Blum, Kenneth

2014-01-01

Substance use disorders (SUD) are inheritable and the culprit is hypodopaminergic function regulated by reward genes. We evaluated a natural dopaminergic agonist; KB220 intravenous (IV) and oral variants, to improve dopaminergic function in SUD. Our pilot experiment found a significant reduction of chronic symptoms, measured by the Chronic Abstinence Symptom Severity (CASS) Scale. The combined group (IV and oral) did significantly better than the oral-only group over the first week and 30-day follow-up period. Next, the combination was given to129 subjects and three factors; Emotion, Somatic, and Impaired Cognition, with eigenvalues greater than one were extracted for baseline CASS-Revised (CASS-R) variables. Paired sample t-tests for pre and post-treatment scales showed significant declines (p = .00001) from pre- to post-treatment: t = 19.1 for Emotion, t = 16.1 for Somatic, and t = 14.9 for Impaired Cognition. In a two-year follow-up of 23 subjects who underwent KB220IV therapy (at least five IV treatments over seven days) plus orals for 30+ days: 21 (91%) were sober at six months, 19 (82%) having no relapse; 19 (82%) were sober at one year, 18 (78%) having no relapse; and 21 (91%) were sober two-years post-treatment, 16 (70%) having no relapse. We await additional research and advise caution in interpreting these encouraging results. PMID:23457891

Heterozygous KIDINS220/ARMS nonsense variants cause spastic paraplegia, intellectual disability, nystagmus, and obesity

NARCIS (Netherlands)

Josifova, Dragana J.; Monroe, Glen R.; Tessadori, Federico; de Graaff, Esther; van der Zwaag, Bert; Mehta, Sarju G.; Harakalova, Magdalena; Duran, Karen J.; Savelberg, Sanne M. C.; Nijman, Isaäc J.; Jungbluth, Heinz; Hoogenraad, Casper C.; Bakkers, Jeroen; Knoers, Nine V.; Firth, Helen V.; Beales, Philip L.; van Haaften, Gijs; van Haelst, Mieke M.

2016-01-01

We identified de novo nonsense variants in KIDINS220/ARMS in three unrelated patients with spastic paraplegia, intellectual disability, nystagmus, and obesity (SINO). KIDINS220 is an essential scaffold protein coordinating neurotrophin signal pathways in neurites and is spatially and temporally

Radioactive Air Emissions Notice of Construction for the 105-KW Basin integrated water treatment system filter vessel sparging vent

Energy Technology Data Exchange (ETDEWEB)

Kamberg, L.D.

1998-02-23

This document serves as a notice of construction (NOC), pursuant to the requirements of Washington Administrative Code (WAC) 246-247-060, and as a request for approval to construct, pursuant to 40 Code of Federal Regulations (CFR) 61.07, for the Integrated Water Treatment System (IWTS) Filter Vessel Sparging Vent at 105-KW Basin. Additionally, the following description, and references are provided as the notices of startup, pursuant to 40 CFR 61.09(a)(1) and (2) in accordance with Title 40 Code of Federal Regulations, Part 61, National Emission Standards for Hazardous Air Pollutants. The 105-K West Reactor and its associated spent nuclear fuel (SNF) storage basin were constructed in the early 1950s and are located on the Hanford Site in the 100-K Area about 1,400 feet from the Columbia River. The 105-KW Basin contains 964 Metric Tons of SNF stored under water in approximately 3,800 closed canisters. This SNF has been stored for varying periods of time ranging from 8 to 17 years. The 105-KW Basin is constructed of concrete with an epoxy coating and contains approximately 1.3 million gallons of water with an asphaltic membrane beneath the pool. The IWTS, which has been described in the Radioactive Air Emissions NOC for Fuel Removal for 105-KW Basin (DOE/RL-97-28 and page changes per US Department of Energy, Richland Operations Office letter 97-EAP-814) will be used to remove radionuclides from the basin water during fuel removal operations. The purpose of the modification described herein is to provide operational flexibility for the IWTS at the 105-KW basin. The proposed modification is scheduled to begin in calendar year 1998.

Performance Evaluation of the T6 Ion Engine

Science.gov (United States)

Snyder, John Steven; Goebel, Dan M.; Hofer, Richard R.; Polk, James E.; Wallace, Neil C.; Simpson, Huw

2010-01-01

The T6 ion engine is a 22-cm diameter, 4.5-kW Kaufman-type ion thruster produced by QinetiQ, Ltd., and is baselined for the European Space Agency BepiColombo mission to Mercury and is being qualified under ESA sponsorship for the extended range AlphaBus communications satellite platform. The heritage of the T6 includes the T5 ion thruster now successfully operating on the ESA GOCE spacecraft. As a part of the T6 development program, an engineering model thruster was subjected to a suite of performance tests and plume diagnostics at the Jet Propulsion Laboratory. The engine was mounted on a thrust stand and operated over its nominal throttle range of 2.5 to 4.5 kW. In addition to the typical electrical and flow measurements, an E x B mass analyzer, scanning Faraday probe, thrust vector probe, and several near-field probes were utilized. Thrust, beam divergence, double ion content, and thrust vector movement were all measured at four separate throttle points. The engine performance agreed well with published data on this thruster. At full power the T6 produced 143 mN of thrust at a specific impulse of 4120 seconds and an efficiency of 64%; optimization of the neutralizer for lower flow rates increased the specific impulse to 4300 seconds and the efficiency to nearly 66%. Measured beam divergence was less than, and double ion content was greater than, the ring-cusp-design NSTAR thruster that has flown on NASA missions. The measured thrust vector offset depended slightly on throttle level and was found to increase with time as the thruster approached thermal equilibrium.

Decreased expression of thyroid receptor-associated protein 220 in temporal lobe tissue of patients with refractory epilepsy

International Nuclear Information System (INIS)

Li Jinmei; Wang Xuefeng; Xi Zhiqin; Gong Yun; Liu Fengying; Sun Jijun; Wu Yuan; Luan Guoming; Wang Yuping; Li Yunlin; Zhang Jianguo; Lu Yong; Li Hongwei

2006-01-01

Purpose: TRAP220 (thyroid hormone receptor-associated protein) functions as a coactivator for nuclear receptors and stimulates transcription by recruiting the TRAP mediator complex to hormone responsive promoter regions. Thus, TRAP220 enhances the function of thyroid/steroid hormone receptors such as thyroid hormone and oestrogen receptors. This study investigated the expression of TRAP220 mRNA and protein level in epileptic brains comparing with human control. Methods: We examined the expression of TRAP220 mRNA and protein levels in temporal lobes from patients with chronic pharmacoresistant epilepsy who have undergone surgery. Results: Expression of TRAP220 mRNA and protein was shown to be decreased significantly in the temporal cortex of the patients with epilepsy. Conclusions: Our work showed that a decrease in TRAP220 mRNA and protein levels may be involved in the pathophysiology of epilepsy and may be associated with impairment of the brain caused by frequent seizures

Survey of the small (300 W to 300 kW) wind turbine market in Canada

International Nuclear Information System (INIS)

2005-01-01

The significant growth in the Canadian wind power industry over the past decade has resulted in an increased number of large utility-scale wind farms appearing across Canada. Although large wind turbines are often acknowledged as a mature technology that can provide clean, reliable and economically competitive power, smaller wind turbines have had relatively little documentation in comparison. The aim of this report was to provide a profile of the Canadian market for small wind turbines (SWTs), divided into 3 categories: mini wind turbines with a rated power output from 300 watts to 1000 watts; small wind turbines up to 30 kW; and medium-sized wind turbines up to 300 kW. Study findings were based on interviews with industry experts and a comprehensive survey of 135 companies involved in the Canadian SWT industry. Details of annual sales and total installed capacity were provided, as well as a summary of key SWT markets. An overview of Canadian market demand and international SWT manufacturing capacity was presented. Opportunities and barriers were examined. It was observed that experiences in the United States have indicated that SWTs are more successful when combined with enabling policies, market incentives, and education and awareness raising. The U.S. small wind industry has estimated that in the near future, the SWT industry could supply 50,000 MW, employ 10,000 people and generate $1 billion per year. A number of opportunities for the promotion of the small wind industry in Canada were reviewed, including the niche manufacturing sector in the 20 kW to 50 kW range. Issues concerning the economic benefits of a SWT manufacturing industry were examined. It was suggested that as the SWT markets grow and mature, turbine prices are expected to fall and turbine effectiveness and reliability will increase. An SWT promotional strategy was outlined with incentives in 4 areas: (1) market development; (2) policy development; (3) technology development; and (4) education

Prototype of an electric 'integral-ecomotor' for the power range up to 1 kW; Funktionsmuster eines Integral-Sparmotors im Leistungsbereich kleiner 1 kW

Energy Technology Data Exchange (ETDEWEB)

Lindegger, M.

2006-11-15

Numerous electric motors of our daily use, with power ratings of about 1 kW operate at rather low efficiencies. Their share in the overall electric consumption is considerable. The aim of the research project consisted in the development of an efficient electric motor with incorporated electronic control ('integral-ecomotor'), which may serve as a substitute for usual variable speed squirrel cage three-phase motor. It was shown that the cost of these new motors of 1 kW power output, built with normalised casings, remain similar to those of squirrel cage three phase motors with inverters. Since 2004, the cost of raw materials as copper or aluminium increased considerably, whereas the cost of Neodymium-Iron-Boron magnets remained rather stable. These facts advocate for energy saving motors making use of permanent magnets, requiring much less copper or aluminium than squirrel cage three phase motors. With integral ecomotors, higher efficiencies are achieved at lower masses as compared to usual squirrel cage three-phase motors. In 2004, a first prototype of this ecomotor using permanent magnets, was built. The advantages of improved performances at lower weight were confirmed. During 2005 and 2006, the technology was then improved and matured in a joint research project with 3 industrial partners. (author)

24 CFR 220.830 - Debenture interest rate.

Science.gov (United States)

2010-04-01

... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Debenture interest rate. 220.830... rate. Debentures shall bear interest from the date of issue, payable semiannually on the first day of... rates of interest will be published twice each year as a notice in the Federal Register. [47 FR 26125...

27 CFR 28.220 - Notice of return.

Science.gov (United States)

2010-04-01

... OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220 Notice of return. If an exporter desires to return wine to a bonded wine cellar or wholesale liquor... wine cellar from which withdrawn; (b) Date and serial number of the Form 1582-A (5120.24) on which the...

Consideration concerning the costs of the 300 kW wind units developed in Romania

International Nuclear Information System (INIS)

Gyulai, F.; Bej, A.

1995-01-01

A demonstrative wind farm with four research units, 300 kW each, is in developing stage in Romania. The article shows economic analysis of these experimental wind units and their cost structure focusing in component costs, performance, manufacturing technology and installing work. (author)

Consideration concerning the costs of the 300 kW wind units developed in Romania

Energy Technology Data Exchange (ETDEWEB)

Gyulai, F; Bej, A [Technical Univ. of Timisoara (Romania). Wind Energy Research Center

1996-12-31

A demonstrative wind farm with four research units, 300 kW each, is in developing stage in Romania. The article shows economic analysis of these experimental wind units and their cost structure focusing in component costs, performance, manufacturing technology and installing work. (author)

Consideration concerning the costs of the 300 kW wind units developed in Romania

Energy Technology Data Exchange (ETDEWEB)

Gyulai, F.; Bej, A. [Technical Univ. of Timisoara (Romania). Wind Energy Research Center

1995-12-31

A demonstrative wind farm with four research units, 300 kW each, is in developing stage in Romania. The article shows economic analysis of these experimental wind units and their cost structure focusing in component costs, performance, manufacturing technology and installing work. (author)

Cooling system upgrading from 250 kW to 1 MW

International Nuclear Information System (INIS)

Anderson, T.V.; Johnson, A.G.; Ringle, J.C.

1972-01-01

The Oregon State TRIGA reactor (OSTR) power capability was upgraded from 250 KW to 1 MW in 1969; however, funds were not available for simultaneous upgrading of the cooling system. Since then, the OSTR has been selectively operating at full power with the original 250 KW cooling system. After funds were made available in 1971 the construction on the new heat exchanger building began. The new cooling system was installed, equipment was checked out, corrections were made, and acceptance tests were run. In addition, several days were required to clean up the primary system water, since increased water flow (350 gpm) swirled 4 year's collection of sediment off the reactor tank bottom and into the primary system. Three interesting items have been noticed, which are apparently a result of the cooling system upgrading: (1) the radiation levels above the reactor tank have been reduced by a factor of 2 to 3, (2) a low resonance vibration in the reactor core occurs at 1 MW. The vibration is attributed to a combination of increased water turbulence and subcooled (surface) nucleate boiling, and (3) direct radiation levels from the demineralizer tank have increased approximately 8-fold. This resulted in a relocation of the tank and the use of supplemental shielding. Increased operating time at higher average power levels, plus disturbance of; sediment on the bottom of the reactor tank are believed to be the main sources of the higher radiation levels

Engineering study: 105KE to 105KW Basin fuel and sludge transfer. Final report

International Nuclear Information System (INIS)

Gant, R.G.

1994-01-01

In the last five years, there have been three periods at the 105KE fuel storage basin (KE Basin) where the reported drawdown test rates were in excess of 25 gph. Drawdown rates in excess of this amount have been used during past operations as the primary indicators of leaks in the basin. The latest leak occurred in March, 1993. The reported water loss from the KE Basin was estimated at 25 gph. This engineering study was performed to identify and recommend the most feasible and practical method of transferring canisters of irradiated fuel and basin sludge from the KE Basin to the 105KW fuel storage basin (KW Basin). Six alternatives were identified during the performance of this study as possible methods for transferring the fuel and sludge from the KE Basin to the KW Basin. These methods were then assessed with regard to operations, safety, radiation exposure, packaging, environmental concerns, waste management, cost, and schedule; and the most feasible and practical methods of transfer were identified. The methods examined in detail in this study were based on shipment without cooling water except where noted: Transfer by rail using the previously used transfer system and water cooling; Transfer by rail using the previously used transfer system (without water cooling); Transfer by truck using the K Area fuel transfer cask (K Area cask); Transfer by truck using a DOE shipping cask; Transfer by truck using a commercial shipping cask; and Transfer by truck using a new fuel shipping cask

Reference Model 5 (RM5): Oscillating Surge Wave Energy Converter

Energy Technology Data Exchange (ETDEWEB)

Yu, Y. H. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Jenne, D. S. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Thresher, R. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Copping, A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Geerlofs, S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hanna, L. A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

2015-01-01

This report is an addendum to SAND2013-9040: Methodology for Design and Economic Analysis of Marine Energy Conversion (MEC) Technologies. This report describes an Oscillating Water Column Wave Energy Converter (OSWEC) reference model design in a complementary manner to Reference Models 1-4 contained in the above report. A conceptual design for a taut moored oscillating surge wave energy converter was developed. The design had an annual electrical power of 108 kilowatts (kW), rated power of 360 kW, and intended deployment at water depths between 50 m and 100 m. The study includes structural analysis, power output estimation, a hydraulic power conversion chain system, and mooring designs. The results were used to estimate device capital cost and annual operation and maintenance costs. The device performance and costs were used for the economic analysis, following the methodology presented in SAND2013-9040 that included costs for designing, manufacturing, deploying, and operating commercial-scale MEC arrays up to 100 devices. The levelized cost of energy estimated for the Reference Model 5 OSWEC, presented in this report, was for a single device and arrays of 10, 50, and 100 units, and it enabled the economic analysis to account for cost reductions associated with economies of scale. The baseline commercial levelized cost of energy estimate for the Reference Model 5 device in an array comprised of 10 units is $1.44/kilowatt-hour (kWh), and the value drops to approximately $0.69/kWh for an array of 100 units.

76 FR 38742 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-07-01

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of RTCA Special Committee 220 Meeting: Automatic Flight Guidance and Control. SUMMARY: The..., Automatic Flight Guidance and Control. Agenda Tuesday August 9-Thursday, August 11, 2011 Tuesday, August 9...

Calibration of gamma cell 220 excel irradiator using Fricke and alanine dosimeters

International Nuclear Information System (INIS)

Rushdi, M. A. H.

2006-06-01

Using of gamma cell 220 excel irradiators is widely spread in many countries. This type of irradiators is being used for research purposes. Gamma cell 220 excel was provided by the International Atomic Energy Agency (IAEA) to the radiation processing laboratory of Sudan Atomic Energy Commission (SAEC). It is a self-contained gamma irradiator and self shielded, this makes it operates safely. Dose calibration for this cell is important for samples irradiation. In this work, a dosimetry system for the GC220E of SAEC was established using Fricke dosimeter. Fricke dosimeter has a confidence 95% in the rang not exceed 400 Gy. To establish routine dosimetry at high doses up to 5000 Gy, alanine dosimeter was used. This range can demonstrate the ability of GC220E to deliver known controllable doses in reproducible manner for high doses. The irradiation specifications often include a lower and upper limit of absorbed dose or central target dose. Absorbed dose mapping was carried out by both dosimeters to determine the magnitude and locations of D.max and D.min in the irradiation chamber. The results are in good agreement with dose distribution given in the machine manual. A comparison between the tow dosimeters was done and explained.(Author)

ETV/COMBINED HEAT AND POWER AT A COMMERCIAL SUPERMARKET CAPSTONE 60 KW MICROTURBINE SYSTEM

Science.gov (United States)

The Environmental Technology Verification report discusses the technology and performance of the Capstone 60 Microturbine CHP System manufactured by Capstone Microturbine Corporation. This system is a 60 kW electrical generator that puts out 480 v AC at 60 Hz and that is driven b...

Design and construction of a 1 kw fuel. Proceedings of the third national energy congress

International Nuclear Information System (INIS)

Rowshanzamir, S.; Eikani, M.H.

2001-05-01

Results on the research and development of a one kilowatt phosphotungstic acid fuel cell stack including the assembly of a single cell and module of 17-cells are presented. The important characteristics of the systems are: (i) Phosphotungstic acid, H 3 PW 12 O 40 . 29H 2O , (i.e.; PWA) is introduced as a solid electrolyte; (II) Bipolar plates were fabricated using Au-plated Aluminum and internal manifold ing was employed for distribution of gases into the cells; (III) internal distribution of gases to the cells was done using parallel manifold ing; (IV) air cooling plates distributed every two cells throughout the stack for heat exchanging purpose; (v) the reactant gases were externally humidified using temperature controlled humidification vessels. Results indicate with a proper stack design, good performance efficiencies are possible

The 25 kW resonant dc/dc power converter

Science.gov (United States)

Robson, R. R.

1983-01-01

The feasibility of processing 25-kW of power with a single, transistorized, series resonant converter stage was demonstrated by the successful design, development, fabrication, and testing of such a device which employs four Westinghouse D7ST transistors in a full-bridge configuration and operates from a 250-to-350 Vdc input bus. The unit has an overall worst-case efficiency of 93.5% at its full rated output of 1000 V and 25 A dc. A solid-state dc input circuit breaker and output-transient-current limiters are included in and integrated into the design. Full circuit details of the converter are presented along with the test data.

Sub-arcsecond imaging of the water emission in Arp 220⋆ ⋆⋆

Science.gov (United States)

König, S.; Martín, S.; Muller, S.; Cernicharo, J.; Sakamoto, K.; Zschaechner, L. K.; Humphreys, E. M. L.; Mroczkowski, T.; Krips, M.; Galametz, M.; Aalto, S.; Vlemmings, W. H. T.; Ott, J.; Meier, D. S.; Fuente, A.; García-Burillo, S.; Neri, R.

2017-01-01

Aims Extragalactic observations of water emission can provide valuable insights into the excitation of the interstellar medium. In particular they allow us to investigate the excitation mechanisms in obscured nuclei, i.e. whether an active galactic nucleus or a starburst dominate. Methods We use sub-arcsecond resolution observations to tackle the nature of the water emission in Arp 220. ALMA Band 5 science verification observations of the 183 GHz H2O 313−220 line, in conjunction with new ALMA Band 7 H2O 515−422 data at 325 GHz, and supplementary 22 GHz H2O 616 − 523 VLA observations, are used to better constrain the parameter space in the excitation modelling of the water lines. Results We detect 183 GHz H2O and 325 GHz water emission towards the two compact nuclei at the center of Arp 220, being brighter in Arp 220 West. The emission at these two frequencies is compared to previous single-dish data and does not show evidence of variability. The 183 and 325 GHz lines show similar spectra and kinematics, but the 22 GHz profile is significantly different in both nuclei due to a blend with an NH3 absorption line. Conclusions Our findings suggest that the most likely scenario to cause the observed water emission in Arp 220 is a large number of independent masers originating from numerous star-forming regions. PMID:29151605

18 CFR 2.20 - Good faith requests for transmission services and good faith responses by transmitting utilities.

Science.gov (United States)

2010-04-01

... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Good faith requests for transmission services and good faith responses by transmitting utilities. 2.20 Section 2.20 Conservation of... Power Act § 2.20 Good faith requests for transmission services and good faith responses by transmitting...

27 CFR 28.220a - Responsibility for return of wine withdrawn for export with benefit of drawback.

Science.gov (United States)

2010-04-01

... of wine withdrawn for export with benefit of drawback. 28.220a Section 28.220a Alcohol, Tobacco... EXPORTATION OF ALCOHOL Exportation of Wine With Benefit of Drawback § 28.220a Responsibility for return of wine withdrawn for export with benefit of drawback. The exporter shall be responsible for arranging the...

Development of a 0.1 kW thermoelectric power generator for military applications

International Nuclear Information System (INIS)

Menchen, W.R.

1986-01-01

A man-portable thermoelectric power source is being developed for the U.S. Army. Initially used as a dedicated power supply for the XM-21 Chemical Agent Alarm System, the set can also meet a variety of general purpose user requirements. Development of a thermoelectric power conversion device is being undertaken by the U.S. Army LABCOM Electronics Technology and Devices Laboratory to fill a need for a generator that is silent, lightweight, multi-fueled and reliable. The 0.1 kW Power Generator is rectangular in configuration and consists of a power module, electronic control assembly and fuel delivery system housed within a tubular structural frame. The generator operates on military fuels ranging from kerosene to diesel oil. Multi-fuel capability is achieved using an ultrasonic atomizer and regenerative burner developed specifically for this application. This paper provides the first public presentation of results achieved during the Advanced Development Phase of the 0.1 kW Power Generator. The development process is briefly traced with emphasis on a description of the system and test results obtained to date

Design aspects of 13.56MHz, 1kW, CW-RF oscillator for plasma production

International Nuclear Information System (INIS)

Kumar, Sunil; Kadia, Bhavesh; Singh, Raj; Varia, Atul; Srinivas, Y S S; Kulkarni, S V

2010-01-01

RF produced plasma has many applications in plasma processing and also it is useful in studying the fundamental characteristics of the plasma. A 1KW RF Hartley oscillator is designed and tested at 13.56 MHz. This has been built at RF section of Institute for Plasma Research by using EIMAC (3CX1200A7) triode tube. The RF source is operated in the grounded cathode mode. Triode 3CX1200A7 is operated in class AB and the feedback is Cathode grounded. The tube has sufficient margin in terms of plate dissipation and Grid dissipation that makes it suitable to withstand momentarily load mismatch. To optimize the RF source along with HVDC power supply many mechanical and electrical aspects have been thought of to enhance the overall quality of the system. This source mainly has three sections (The RF section, HVDC Power supply and soft start Filament Power supply). The system is compact and is housed in a 80 cm x 60 cm x 1800 cm aluminum panel. This paper describes the specifications, design criteria, circuit used, operating parameters of 1KW Oscillator along with HVDC power supply with necessary interlocks, tests conducted and results obtained of this 1 KW grounded grid Hartley Oscillator on 50 ohm dummy load. This system has been tested for 8 hours of continuous operation without any appreciable deterioration of the RF output power.

Designing Distributed Generation in Mexico

Energy Technology Data Exchange (ETDEWEB)

Linvill, Carl [Regulatory Assistance Project, Montepelier, VT (United States); Brutkoski, Donna [Regulatory Assistance Project, Montepelier, VT (United States)

2017-05-15

Mexico's energy reform will have far-reaching effects on how people produce and consume electricity in the country. Market liberalization will open the door to an increasing number of options for Mexican residential, commercial, and industrial consumers, and distributed generation (DG), which for Mexico includes generators of less than 500 kilowatts (kW) of capacity connected to the distribution network. Distributed generation is an option for consumers who want to produce their own electricity and provide electricity services to others. This report seeks to provide guidance to Mexican officials on designing DG economic and regulatory policies.

Expanding Rural Access to Renewable Energy

DEFF Research Database (Denmark)

Sovacool, Benjamin

2013-01-01

megawatts (MW) of grid-connected mini-hydro capacity, 574 kilowatts (kW) of off-grid village hydroelectric systems serving 2,897 households, and a 3MW grid-connected wind farm from 1997 to 2002. By the end of 2004, two years after the ESDP’s close, the Sri Lankan renewable energy industry boasted more than...... 40 mini-hydro developers, 10 registered solar companies, 22 registered village hydro developers and 12 village hydro equipment suppliers compared to less than three of each before the ESDP began. This study explores the dynamics of the ESDP, and investigates its structure, benefits, challenges...

76 FR 50809 - Eleventh Meeting: RTCA Special Committee 220: Automatic Flight Guidance and Control

Science.gov (United States)

2011-08-16

... Committee 220: Automatic Flight Guidance and Control AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Correction of Notice of RTCA Special Committee 220 meeting: Automatic Flight Guidance and Control...: Automatic Flight Guidance and Control DATES: The meeting will be held September 13-15, 2011, from 9 a.m. to...

2 CFR 220.40 - Relationship to previous issuance.

Science.gov (United States)

2010-01-01

...) The Attachment to the circular, entitled “Principles For Determining Costs Applicable to Grants... attachment to the circular, entitled “CASB's Cost Accounting Standards (CAS),” Attachment A, CASB's Cost... Section 220.40 Grants and Agreements OFFICE OF MANAGEMENT AND BUDGET CIRCULARS AND GUIDANCE Reserved COST...

Présentation d'une boucle prototype de pompe à chaleur à absorption haute température industrielle de 100 kW Description of a 100-Kw Prototype Loop for an Industrial High-Temperature Absorption Heat-Pump

Directory of Open Access Journals (Sweden)

Thomas D.

2006-11-01

Full Text Available II apparait indispensable, dans le contexte énergétique actuel, de mettre au point de nouvelles techniques de revalorisation d'énergie. Les pompes à chaleur à absorption peuvent, dans certains secteurs industriels, apporter des solutions particulièrement intéressantes par rapport aux pompes à chaleur à compression notamment, en particulier dans le domaine des hautes températures de revalorisation (120-150 °C. Pour mener à bien les études entreprises sur ce thème, le Gaz de France travaille en étroite collaboration avec l'Institut du Génie Chimique de Toulouse et la Société Creusot-Loire. Dans une première partie, les auteurs rappellent les principes de fonctionnement des pompes à chaleurs à absorption et leurs caractères spécifiques. Quelques exemples d'applications industrielles sont proposés. Ils présentent, dans une deuxième partie, la boucle prototype de 100 kW qui a été réalisée et décrivent ses caractéristiques, son cycle de fonctionnement et le programme des essais. Ce pilote de taille semi-industrielle utilise le couple eau-bromure de lithium. La définition d'un prototype industriel de pompe à chaleur à absorption haute température et les compléments de recherche entrepris dans ce domaine constituent la troisième partie de la communication. In the present energy context, it seems absolutely necessary to develop new techniques for energy upgrading. In some industrial sectors, absorption heat pumps may bring particularly interesting solutions compared, in particular, to compression heat pumps, especially in the field of high-temperature upgrading (120-150°C. Reasearch is being done in this field by Gaz de France in close collaboration with the Institut du Génie Chimique in Toulouse and with Creusot-Loire. ,The first part of this article reviews the operating principles of absorption heat pumps and their specific features. Some examples of industrial applications are then proposed. The second part

Design and Control of a 3 kW Wireless Power Transfer System for Electric Vehicles

Directory of Open Access Journals (Sweden)

Zhenshi Wang

2015-12-01

Full Text Available This paper aims to study a 3 kW wireless power transfer system for electric vehicles. First, the LCL-LCL topology and LC-LC series topology are analyzed, and their transfer efficiencies under the same transfer power are compared. The LC-LC series topology is validated to be more efficient than the LCL-LCL topology and thus is more suitable for the system design. Then a novel q-Zsource-based online power regulation method which employs a unique impedance network (two pairs of inductors and capacitors to couple the cascaded H Bridge to the power source is proposed. By controlling the shoot-through state of the H Bridge, the charging current can be adjusted, and hence, transfer power. Finally, a prototype is implemented, which can transfer 3 kW wirelessly with ~95% efficiency over a 20 cm transfer distance.

Results of 200 KW fuel cell evaluation programs

Energy Technology Data Exchange (ETDEWEB)

Torrey, J.M.; Merten, G.P. [SAIC, San Diego, CA (United States); Binder, M.J. [Army Construction Engineering Research Labs., Champaign, IL (United States)] [and others

1996-12-31

Science Applications International Corporation (SAIC) has installed six monitoring systems on ONSI Corporation 200 kW phosphoric acid fuel cells. Three of the systems were installed for the U.S. Army Construction Engineering Research Laboratories (USACERL) which is coordinating the Department of Defense (DoD) fuel cell Demonstration Program and three were installed under a contract with the New York State Energy Research and Development Authority (NYSERDA). Monitoring of the three NYSERDA sites has been completed. Monitoring systems for the DoD fuel cells were installed in August, 1996 and thus no operating data was available at the time of this writing, but will be presented at the Fuel Cell Seminar. This paper will present the monitoring configuration and research approach for each program. Additionally, summary performance data is presented for the completed NYSERDA program.

Numerical Simulation of MIG for 42 GHz, 200 kW Gyrotron

Science.gov (United States)

Singh, Udaybir; Bera, Anirban; Kumar, Narendra; Purohit, L. P.; Sinha, Ashok K.

2010-06-01

A triode type magnetron injection gun (MIG) of a 42 GHz, 200 kW gyrotron for an Indian TOKAMAK system is designed by using the commercially available code EGUN. The operating voltages of the modulating anode and the accelerating anode are 29 kV and 65 kV respectively. The operating mode of the gyrotron is TE03 and it is operated in fundamental harmonic. The simulated results of MIG obtained with the EGUN code are validated with another trajectory code TRAK.

Design of diode electron gun for 250 kW CW klystron

International Nuclear Information System (INIS)

Prasad, M.; Pande, S.A.; Hannurkar, P.R.

2005-01-01

A 250 kW CW klystron at frequencies 350 MHz and 700 MHz is being developed at Centre for Advanced Technology. These klystrons are required for forthcoming project like 100 MeV proton Linac for Spallation Neutron Source (SNS) as a main rf sources. In order to develop klystrons, we have designed the diode electron gun, which delivers more than 10 A beam current at 50 kV. This paper describes the simulation results of electron gun with computer code EGUN. (author)

Electron beam welding of heavy thicknesses with a 200 KW gun

International Nuclear Information System (INIS)

Binard, J.; Ducrot, A.

1986-09-01

In this report, we describe our 200 kW gun, 100 m 3 vacuum chamber E B welding equipment, implemented since 1985 to increase the process development in the heavy mechanics; to score the goal, we study the influence of parameters as: welding positions, chemical analysis of the material and workpiece thickness. Simultaneously, we carry out welding tests of branch pipes or nozzles on tubes and shells. Some results are shown and good mechanical properties are obtained on thicknesses up to 300 mm

Analysis and evaluation of ZPPR critical experiments for a 100 kilowatt-electric space reactor

International Nuclear Information System (INIS)

McFarlane, H.F.; Collins, P.J.; Carpenter, S.G.; Olsen, D.N.; Smith, D.M.; Schaefer, R.W.; Doncals, R.A.; Andre, S.V.; Porter, C.A.; Cowan, C.L.; Stewart, S.L.; Protsik, R.

1990-01-01

ZPPR critical experiments were used for physics testing the reactor design of the SP-100, a 100-kW thermoelectric LMR that is being developed to provide electrical power for space applications. These tests validated all key physics characteristics of the design, including the ultimate safety in the event of a launch or re-entry accident. Both the experiments and the analysis required the use of techniques not previously needed for fast reactor designs. A few significant discrepancies between the experimental and calculated results leave opportunities for further reductions in the mass of the SP-100. An initial investigation has been made into application of the ZPPR-20 results, along with those of other relevant integral data, to the SP-100 design

20 CFR 220.37 - When a child's disability determination is governed by the regulations of the Social Security...

Science.gov (United States)

2010-04-01

...) Inclusion as a disabled child in the employee's annuity rate under the social security overall minimum. (2... governed by the regulations of the Social Security Administration. 220.37 Section 220.37 Employees... Disability Determinations Governed by the Regulations of the Social Security Administration § 220.37 When a...

ETL 1 kW redox flow cell

International Nuclear Information System (INIS)

Nozaki, K.; Ozawa, T.

1984-01-01

A 1 kW scale redox flow cell system was set up in the laboratory (ETL), while three different types of batteries were also assembled by private companies in early 1983. In this article, this cell system is described. The concept of a modern type redox flow cell is based on a couple of fully soluble redox ions and a highly selective ion-exchange membrane. In the cell, the redox ion stored in a tank is flowed to and reduced on the electrode, while the other ion is also flowed to and oxidized on the other electrode. This electrochemical reaction produces electronic current in the external circuit and ionic current through the membrane sandwiched as a separator between the two electrodes. The reverse reaction proceeds in the charging process. In ETL, the concept was preliminarily tested, and conceptual design and cost estimation of the redox flow cells were carried out to confirm the feasibility; the R and D started on these bases in 1975

Performance and Facility Background Pressure Characterization Tests of NASAs 12.5-kW Hall Effect Rocket with Magnetic Shielding Thruster

Science.gov (United States)

Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Shastry, Rohit; Thomas, Robert; Yim, John; Herman, Daniel; Williams, George; Myers, James; Hofer, Richard;

The influence of soil water status on Oryza Sativa Var. MR220 in KADA rice agroecosystem

International Nuclear Information System (INIS)

Nashriyah Mat; Ismail Che Haron; Mazleha Maskin; Mohd Razi Ismail

2006-01-01

A study to determine the influence of soil water status on rice plant Oryza sativa var. MR220 after panicle initiation stage was carried out at Ladang Merdeka Mulong Lating in the Kemubu Agricultural Development Authority (KADA) area, Kelantan. Five water management treatments imposed on direct seeded rice were; T1. Continuous flooding, T2. Early flooding up to panicle initiation stage followed by saturated (F55-saturated), T3. Early flooding for the first month followed by saturated (F-30 saturated), T4. Continuous saturated, and T5. Continuous field capacity condition throughout the growth stage. The treatments were arranged in Randomized Complete Block Design (RCBD) with four replicates. Results showed significant differences in soil moisture content in the order of T1>T2>T3>T4>T5. Significant differences were also observed in rice plant water content at 68 DAS (days after seeding) in the order of T2>T3>T4>T1>T5. Moisture content also showed significant differences between replicates in the order of R1>R2>R3>R4 and R2>R1>R3>R4; in rice plant and ricefield soil, respectively. Results however showed no significant difference in leaf stomatal conductance due to water stress. Rice plant moisture, soil moisture and leaf stomatal conductance showed no interaction. Published results show that even though overall crop yield was reduced by sheath blight and panicle blast incidence that occur at later stage in 2004-2005 field trials, highest grain yields were obtained from T2 (off season) and T4 (main season). Saturated condition seems to be the most suitable method of growing rice under minimal water input in KADA rice agroecosystem. (Author)

Development of 750 keV/20kW DC accelerator

International Nuclear Information System (INIS)

Bapna, S.C.; Banwari, R.; Venkateswaran, S.V.; Tripathi, Alok; Kasliwal, Apollo; Pramod, R.; Kumar, Pankaj

2001-01-01

This paper discusses development of a DC accelerator at CAT for industrial applications. This accelerator is housed in two floors; first floor having the accelerator and the ground floor is an irradiation cell. It will operate in the voltage range of 300kV to 750kV and will give maximum beam power of 20kW. The electron gun, acceleration column, focusing coil, high voltage multiplier stack, filament power supply and the control unit are housed in a 1.5 m diameter 3.2 m high pressure vessel which will be pressurized to 5.5 bar of SF 6 gas

A 10kW series resonant converter design, transistor characterization, and base-drive optimization

Science.gov (United States)

Robson, R.; Hancock, D.

1981-01-01

Transistors are characterized for use as switches in resonant circuit applications. A base drive circuit to provide the optimal base drive to these transistors under resonant circuit conditions is developed and then used in the design, fabrication and testing of a breadboard, spaceborne type 10 kW series resonant converter.

49 CFR 179.220-11 - Postweld heat treatment.

Science.gov (United States)

2010-10-01

... 49 Transportation 2 2010-10-01 2010-10-01 false Postweld heat treatment. 179.220-11 Section 179... Postweld heat treatment. (a) Postweld heat treatment of the inner container is not a specification requirement. (b) Postweld heat treatment of the cylindrical portions of the outer shell to which the anchorage...

[The maximum heart rate in the exercise test: the 220-age formula or Sheffield's table?].

Science.gov (United States)

Mesquita, A; Trabulo, M; Mendes, M; Viana, J F; Seabra-Gomes, R

1996-02-01

To determine in the maximum cardiac rate in exercise test of apparently healthy individuals may be more properly estimated through 220-age formula (Astrand) or the Sheffield table. Retrospective analysis of clinical history and exercises test of apparently healthy individuals submitted to cardiac check-up. Sequential sampling of 170 healthy individuals submitted to cardiac check-up between April 1988 and September 1992. Comparison of maximum cardiac rate of individuals studied by the protocols of Bruce and modified Bruce, in interrupted exercise test by fatigue, and with the estimated values by the formulae: 220-age versus Sheffield table. The maximum cardiac heart rate is similar with both protocols. This parameter in normal individuals is better predicted by the 220-age formula. The theoretic maximum cardiac heart rate determined by 220-age formula should be recommended for a healthy, and for this reason the Sheffield table has been excluded from our clinical practice.

Modeling and Simulation for an 8 kW Three-Phase Grid-Connected Photo-Voltaic Power System

Science.gov (United States)

Cen, Zhaohui

2017-09-01

Gird-connected Photo-Voltaic (PV) systems rated as 5-10 kW level have advantages of scalability and energy-saving, so they are very typical for small-scale household solar applications. In this paper, an 8 kW three-phase grid-connected PV system model is proposed and studied. In this high-fidelity model, some basic PV system components such as solar panels, DC-DC converters, DC-AC inverters and three-phase utility grids are mathematically modelled and organized as a complete simulation model. Also, an overall power controller with Maximum Power Point Control (MPPT) is proposed to achieve both high-efficiency for solar energy harvesting and grid-connection stability. Finally, simulation results demonstrate the effectiveness of the PV system model and the proposed controller, and power quality issues are discussed.

Modeling and Simulation for an 8 kW Three-Phase Grid-Connected Photo-Voltaic Power System

Directory of Open Access Journals (Sweden)

Cen Zhaohui

2017-09-01

Full Text Available Gird-connected Photo-Voltaic (PV systems rated as 5-10 kW level have advantages of scalability and energy-saving, so they are very typical for small-scale household solar applications. In this paper, an 8 kW three-phase grid-connected PV system model is proposed and studied. In this high-fidelity model, some basic PV system components such as solar panels, DC-DC converters, DC-AC inverters and three-phase utility grids are mathematically modelled and organized as a complete simulation model. Also, an overall power controller with Maximum Power Point Control (MPPT is proposed to achieve both high-efficiency for solar energy harvesting and grid-connection stability. Finally, simulation results demonstrate the effectiveness of the PV system model and the proposed controller, and power quality issues are discussed.

Analysis of power curves of Danish and foreign wind turbines

International Nuclear Information System (INIS)

Petersen, H.

1995-12-01

This report describes an analysis of power curves for a number of wind turbines, 30 Danish and 17 foreign - European - wind turbines. The investigation is limited to wind turbines of 150 kW capacity and greater, and to wind turbines for which a power curve is available. The power curves are transformed into a common, uniform presentation in order to facilitate the succeeding treatment, which primarily is the calculation of the production of electrical energy yielded per year. From the known data of the wind turbine, equipped generator power and rotor area and the area swept by the blades, the specific electrical production is calculated in three terms: yield per square meter of rotor area, yield per kW generator power and yield per square meter and per kilowatt generator power. Based on these findings a number of comparisons are established, such as comparisons of conceptual designs and technical- economical evaluations. (au)

Multi-kW coherent combining of fiber lasers seeded with pseudo random phase modulated light

Science.gov (United States)

Flores, Angel; Ehrehreich, Thomas; Holten, Roger; Anderson, Brian; Dajani, Iyad

2016-03-01

We report efficient coherent beam combining of five kilowatt-class fiber amplifiers with a diffractive optical element (DOE). Based on a master oscillator power amplifier (MOPA) configuration, the amplifiers were seeded with pseudo random phase modulated light. Each non-polarization maintaining fiber amplifier was optically path length matched and provides approximately 1.2 kW of near diffraction-limited output power (measured M2polarization control. A low power sample of the combined beam after the DOE provided an error signal for active phase locking which was performed via Locking of Optical Coherence by Single-Detector Electronic-Frequency Tagging (LOCSET). After phase stabilization, the beams were coherently combined via the 1x5 DOE. A total combined output power of 4.9 kW was achieved with 82% combining efficiency and excellent beam quality (M2splitter loss was 5%. Similarly, losses due in part to non-ideal polarization, ASE content, uncorrelated wavefront errors, and misalignment errors contributed to the efficiency reduction.

32 CFR 220.11 - Special rules for automobile liability insurance and no-fault automobile insurance.

Science.gov (United States)

2010-07-01

... and no-fault automobile insurance. 220.11 Section 220.11 National Defense Department of Defense... insurance and no-fault automobile insurance. (a) Active duty members covered. In addition to Uniformed.... 1095 and this part. (c) Exclusion of automobile liability insurance and no-fault automobile insurance...

20 CFR 725.220 - Determination of relationship; child.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of relationship; child. 725.220... Determination of relationship; child. For purposes of determining whether an individual may qualify for benefits as the child of a deceased miner, the provisions of § 725.208 shall be applicable. As used in this...

Physics design of a 10 MeV, 6 kW travelling wave electron linac

Indian Academy of Sciences (India)

We present the physics design of a 10 MeV, 6 kW S-band (2856 MHz) electron linear accelerator (linac), which has been recently built and successfully operated at Raja Ramanna Centre for Advanced Technology, Indore. The accelerating structure is a 2 π / 3 mode constant impedance travelling wave structure, which ...

MegaFlex Scale-Up Cost & Risk Reduction for >50kW Future Power Demands, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — As the MegaFlex solar array is scaled for power demands greater than 50kW over the next 20 years and deployed load requirements remain high or increase, advanced...

Field Testing of Telemetry for Demand Response Control of Small Loads

Energy Technology Data Exchange (ETDEWEB)

Lanzisera, Steven [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Weber, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Liao, Anna [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Schetrit, Oren [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Kiliccote, Sila [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piette, Mary Ann [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

2018-01-30

The electricity system in California, from generation through loads, must be prepared for high renewable penetration and increased electrification of end uses while providing increased resilience and lower operating cost. California has an aggressive renewable portfolio standard that is complemented by world-leading greenhouse gas goals. The goal of this project was to evaluate methods of enabling fast demand response (DR) signaling to small loads for low-cost site enablement. We used OpenADR 2.0 to meet telemetry requirements for providing ancillary services, and we used a variety of low-cost devices coupled with open-source software to enable an end-to-end fast DR. The devices, architecture, implementation, and testing of the system is discussed in this report. We demonstrate that the emerging Internet of Things (IoT) and Smart Home movements provide an opportunity for diverse small loads to provide fast, low-cost demand response. We used Internet-connected lights, thermostats, load interruption devices, and water heaters to demonstrate an ecosystem of controllable devices. The system demonstrated is capable of providing fast load shed for between 20 dollars and $300 per kilowatt (kW) of available load. The wide range results from some loads may have very low cost but also very little shed capability (a 10 watt [W] LED light can only shed a maximum of 10 W) while some loads (e.g., water heaters or air conditioners) can shed several kilowatts but have a higher initial cost. These costs, however, compare well with other fast demand response costs, with typically are over $100/kilowatt of shed. We contend these loads are even more attractive than their price suggests because many of them will be installed for energy efficiency or non-energy benefits (e.g., improved lighting quality or controllability), and the ability to use them for fast DR is a secondary benefit. Therefore the cost of enabling them for DR may approach zero if a software-only solution can be

Analysis of Initial Performance of Solergy's HCPV/T System at Rome-Fiumicino International Airport

Energy Technology Data Exchange (ETDEWEB)

Kurtz, Sarah [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Micheli, Leonardo [Colorado School of Mines; v, Giuseppe [Solergy Italia Srl.; Liani, Martina [Aeroporti di Roma; Poli, Ruggero [Aeroporti di Roma; Banin, Yoav [Solergy, Inc.; Lanzara, Giovanni [Solergy, Inc.

2017-09-06

A commercial HCPV/T system, developed by Solergy, is installed at the airport of Rome, in Italy, as part of a prototype smart grid. The system is rated at 15 kW AC electric and 20 kW thermal and is used to provide both electricity for charging electric vehicles and heat for a conventional thermal power plant. This paper presents an analysis of the performance of the system, operating since March 2017, which achieves a combined peak efficiency of 48%. This study incorporates also an investigation on the improvements that can benefit the system, including a new type of receiver with improved heat dissipation.

20 CFR 670.220 - Are we responsible for the protection and maintenance of center facilities?

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are we responsible for the protection and maintenance of center facilities? 670.220 Section 670.220 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB CORPS UNDER TITLE I OF THE WORKFORCE INVESTMENT ACT Site Selection...

APLIKASI MODEL QUAL2Kw UNTUK MENENTUKAN STRATEGI PENANGGULANGAN PENCEMARAN AIR SUNGAI GAJAHWONG YANG DISEBABKAN OLEH BAHAN ORGANIK (Aplication of Qual2Kw Model to Determine the Strategy in Solving Gajahwong River Water Pollution Caused by Organic Matter

Directory of Open Access Journals (Sweden)

Agnes Dyah Novitasari Lestari

2013-11-01

Full Text Available ABSTRAK Telah dilakukan pemodelan kualitas air terhadap Sungai Gajahwong menggunakan model QUAL2Kw untuk parameter DO-BOD. Diselidiki dinamika DO-BOD sungai tersebut pada kondisi eksisting tahun 2011. Oleh karena beban pencemar pada kondisi hujan dan tanpa hujan berbeda, maka prediksi dilakukan pada kedua kondisi tersebut. Hasil pemodelan QUAL2Kw untuk kondisi eksisting Sungai Gajahwong tahun 2011 menunjukkan bahwa pada kondisi hujan dan tanpa hujan, konsentrasi BOD sungai telah melebihi bakumutu air kelas II. Hasil simulasi menunjukkan bahwa (1 Pembangunan perumahan yang membuang limbah cairnya ke Sungai Gajahwong pada debit total 0,1 m3/s dengan konsentrasi BOD 10 mg/L dapat meningkatkan BOD serta menurunkan DO Sungai Gajahwong, dan (2 Pengelolaan kualitas air dan penanggulangan pencemaran air oleh bahan organik pada Sungai Gajahwong dapat dilakukan dengan strategi pembuatan IPAL komunal di setiap kabupaten dengan penurunan konsentrasi BOD hulu hingga 2 mg/L.   ABSTRACT Water quality modelling of Gajahwong River has been done using QUAL2Kw model for DO-BOD parameters. The dynamics of DO-BOD of the river on the existing conditions in 2011 has been investigated. Because of  the load of pollutants in the rainy condition and no rain condition was different, then the predictions made on both conditions. QUAL2Kw modelling results for Gajahwong River in year 2011 showed that the BOD concentration of the river on both conditions has exceeded water quality standards class II. The simulation results showed that: (1 Housing construction that discharge its liquid waste into Gajahwong River on total discharge 0,1 m3/s with concentration of BOD 10 mg/L, increased the BOD and decreased the DO of Gajahwong River, and (2 Water quality management and organic pollution control of Gajahwong River can be done by a strategy of making communal WWTP in each district with reduction of the upstream BOD concentration to 2 mg /L.

Enerji bitkisi olarak farklı kamış türlerinin briketlenmesi üzerine bir araştırma

OpenAIRE

BİLGİN, Sefai; ERTEKİN, Can; KÜRKLÜ, Ahmet

2014-01-01

Bu araştırmada, enerji bitkisi olarak dev kamış (Arundo donax) ve sazlık kamış (Phragmites australis) bitkilerinin briketlenmesi ve briketlerin fiziksel özelliklerinin belirlenmesi amaçlanmıştır. Materyallerin briketlenmesi için 15 kW gücünde konik kalıplı ve kalıp ısıtmalı konik helezon tip briketleme makinesi kullanılmıştır. Briketlerin fiziksel özellikleri ile ilgili olarak yoğunluk, dayanıklılık direnci, kırılma direnci, su alma direnci, nem içeriği ve eşdeğer nem içeriği değerleri belirl...

First 200 kW CW operation of a 60 GHz gyrotron

International Nuclear Information System (INIS)

Jory, H.; Bier, R.; Evans, S.; Felch, K.; Fox, L.; Huey, H.; Shively, J.; Spang, S.

1983-01-01

The gyrotron is a microwave tube which employs the electron cyclotron maser interaction to produce high power output at millimeter wavelengths. It has important and growing applications for heating of plasmas in controlled thermonuclear fusion experiments. The Varian 60 GHz gyrotron has recently generated microwave power in excess of 200 kW during CW operation, wth excellent dynamic range and operating stability. This is the highest average power ever produced by a microwave tube in the millimeter wave region. A description of the gyrotron design and test results are presented

EBT-S 28-GHz, 200-kW, CW, mixed-mode, quasi-optical plasma heating system

International Nuclear Information System (INIS)

White, T.L.; Kimrey, H.D.; Bigelow, T.S.; Bates, D.D.; Eason, H.O.

1984-07-01

The ELMO Bumpy Torus-Scale (EBT-S) 28-GHz, 200-kW, cw, plasma heating system consists of a gyrotron oscillator, an oversized waveguide two-bend transmission system, and a quasi-optical mixed-mode microwave distribution manifold that feeds microwave power to the 24 plasma loads of the EBT-S fusion experiment. Balancing power to the 24 loads of the EBT-S fusion experiment. Balancing power to the 24 loads was achieved by adjusting the areas at 24 coupling irises. System performance is easily measured using system calorimetry. The distribution manifold mixed-mode power transmission, reflection, and loss coefficients are 89%, 6%, and 5%, respectively. The overall system efficiency (plasma power/gyrotron power) is 80%, but with some modifications to the distribution manifold we believe the ultimate efficiency can approach 90%. The system reliability is outstanding with a world's record 1 x 10 5 kW h of 28-GHz energy delivered to the EBT-S device with well over 1 x 10 3 operating hours

JAERI 10kW High Power ERL-FEL and Its Applications in Nuclear Energy Industries

CERN Document Server

Minehara, E J; Iijima, H; Kikuzawa, N; Nagai, R; Nishimori, N; Nishitani, T; Sawamura, M; Yamauchi, T

2005-01-01

The JAERI high power ERL-FEL has been extended to the more powerful and efficient free-electron laser (FEL) than 10kW for nuclear energy industries, and other heavy industries like defense, shipbuilding, chemical industries, environmental sciences, space-debris, and power beaming and so on. In order to realize such a tunable, highly-efficient, high average power, high peak power and ultra-short pulse FEL, we need the efficient and powerful FEL driven by the JAERI compact, stand-alone and zero boil-off super-conducting RF linac with an energy-recovery geometry. Our discussions on the ERL-FEL will cover the current status of the 10kW upgrading and its applications of non-thermal peeling, cutting, and drilling to decommission the nuclear power plants, and to demonstrate successfully the proof of principle prevention of cold-worked stress-corrosion cracking failures in nuclear power reactors under routine operation using small cubic low-Carbon stainless steel samples.

1?10 kW Stationary Combined Heat and Power Systems Status and Technical Potential: Independent Review

Energy Technology Data Exchange (ETDEWEB)

Maru, H. C.; Singhal, S. C.; Stone, C.; Wheeler, D.

2010-11-01

This independent review examines the status and technical potential of 1-10 kW stationary combined heat and power fuel cell systems and analyzes the achievability of the DOE cost, efficiency, and durability targets for 2012, 2015, and 2020.

Development of a coupled reactor with a catalytic combustor and steam reformer for a 5 kW solid oxide fuel cell system

International Nuclear Information System (INIS)

Kang, Sanggyu; Lee, Kanghun; Yu, Sangseok; Lee, Sang Min; Ahn, Kook-Young

2014-01-01

Highlights: • Proposes the scale-up strategy to develop a large-scale coupled reactor. • Investigation of performance of steam reformer coupled with catalytic combustor. • Experimental parameters are inlet temp., air excess ratio, SCR, fuel utilization. • Evaluation of the heat transfer distribution along the gas flow direction. • The mean value of methane conversion rate is approximately 93.4%. - Abstract: The methane (CH 4 ) conversion rate of a steam reformer can be increased by thermal integration with a catalytic combustor, called a coupled reactor. In the present study, a 5 kW coupled reactor has been developed based on a 1 kW coupled reactor in previous work. The geometric parameters of the space velocity, diameter and length of the coupled reactor selected from the 1 kW coupled reactor are tuned and applied to the design of the 5 kW coupled reactor. To confirm the scale-up strategy, the performance of 5 kW coupled reactor is experimentally investigated with variations of operating parameters such as the fuel utilization in the solid oxide fuel cell (SOFC) stack, the inlet temperature of the catalytic combustor, the excess air ratio of the catalytic combustor, and the steam to carbon ratio (SCR) in the steam reformer. The temperature distributions of coupled reactors are measured along the gas flow direction. The gas composition at the steam reformer outlet is measured to find the CH 4 conversion rate of the coupled reactor. The maximum value of the CH 4 conversion rate is approximately 93.4%, which means the proposed scale-up strategy can be utilized to develop a large-scale coupled reactor

Design and development of 75 MHz 1 kW RF system with micro-controller based protection and control

International Nuclear Information System (INIS)

Rosily, Sherry; Pande, Manjiri; Handu, V.K.

2011-01-01

A 75 MHz, 1 kW Radio Frequency (RF) system has been successfully tested on a 50 ohm load, along with a microcontroller based protection circuit for protection of the system against the possible problems that may occur during RF power coupling to Radio Frequency Quadrapole (RFQ) load. This paper describes major challenges faced during the development and methods by which they have been overcome. Measurement of the tube anode temperature which is at 4 kV dc and 1 kW RF power is one of these. Confidence provided by these successful experiences has inspired an exploration of possibilities for further enhancement of the present system. These are also discussed in the paper. (author)

Fixing hydro - The forgotten renewable

International Nuclear Information System (INIS)

Nalder, N.

1992-01-01

Since the dawn of civilization, man has captured the energy potential of falling water, from the water wheels in the fertile crescent of ancient times to today's highly sophisticated conventional and pumped storage projects. As we approach the 21st century, electric energy captured from falling water provides 2.0 trillion kilowatt-hours (21.23 quadrillion Btu), roughly 20% of the world's electric energy. Of the 2.56 billion kilowatts of the world's installed electric generating capacity, hydropower accounts for 24%. Between 1980 and 1989, world generation of hydroelectric power rose from 1.7 trillion kWh to 2.0 trillion kWh. As of January 1, 1988, the US has 90.5 million kW of installed hydro capacity - 70.8 million kW of it under license by the Federal Energy Regulatory Commission - with annual generation estimated at just under 300 billion kWh. Hydro's share, which not long ago comprised 13% of the nation's total capacity, now is just a 9% share. The US has the option to choose one or another path for hydro. If policy makers are willing to coast on a cushion of cheap natural gas, they will continue to shun hydro and put obstacles in its path. But if they come to regard hydro as an attractive resource - as they did only recently - economically and environmentally, they will encourage more balance in resource policies. Believing that interest in a balanced national resource portfolio will grow, the author reviews the past and suggests a possible future course of reasonable development for hydro. The article concludes with some suggested principles that will be needed if the appropriate balance is to be found

Note: Proton irradiation at kilowatt-power and neutron production from a free-surface liquid-lithium target

Energy Technology Data Exchange (ETDEWEB)

Halfon, S.; Feinberg, G. [Soreq NRC, Yavne 81800 (Israel); Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel); Arenshtam, A.; Kijel, D.; Weissman, L.; Aviv, O.; Berkovits, D.; Dudovitch, O.; Eisen, Y.; Eliyahu, I.; Haquin, G.; Hazenshprung, N.; Kreisel, A.; Mardor, I.; Shimel, G.; Shor, A.; Silverman, I.; Yungrais, Z. [Soreq NRC, Yavne 81800 (Israel); Paul, M., E-mail: paul@vms.huji.ac.il; Tessler, M. [Racah Institute of Physics, Hebrew University, Jerusalem 91904 (Israel)

2014-05-15

The free-surface Liquid-Lithium Target, recently developed at Soreq Applied Research Accelerator Facility (SARAF), was successfully used with a 1.9 MeV, 1.2 mA (2.3 kW) continuous-wave proton beam. Neutrons (∼2 × 10{sup 10} n/s having a peak energy of ∼27 keV) from the {sup 7}Li(p,n){sup 7}Be reaction were detected with a fission-chamber detector and by gold activation targets positioned in the forward direction. The setup is being used for nuclear astrophysics experiments to study neutron-induced reactions at stellar energies and to demonstrate the feasibility of accelerator-based boron neutron capture therapy.

POST-STARBURST TIDAL TAILS IN THE ARCHETYPICAL ULTRA LUMINOUS INFRARED GALAXY Arp 220

International Nuclear Information System (INIS)

Taniguchi, Y.; Matsubayashi, K.; Kajisawa, M.; Shioya, Y.; Ideue, Y.; Ohyama, Y.; Nagao, T.; Murayama, T.; Koda, J.

2012-01-01

We present our new deep optical imaging and long-slit spectroscopy for Arp 220, the archetypical ultra luminous infrared galaxy in the local universe. Our sensitive Hα imaging has newly revealed large-scale Hα absorption, i.e., post-starburst regions in this merger. One is found in the eastern superbubble and the other is in the two tidal tails that are clearly revealed in our deep optical imaging. The size of the Hα absorption region in the eastern bubble is 5 kpc × 7.5 kpc, and the observed Hα equivalent widths are ∼2 Å ± 0.2 Å. The sizes of the northern and southern Hα-absorption tidal tails are ∼5 kpc × 10 kpc and ∼6 kpc × 20 kpc, respectively. The observed Hα equivalent widths range from 4 Å to 7 Å. In order to explain the presence of the two post-starburst tails, we suggest a possible multiple-merger scenario for Arp 220 in which two post-starburst disk-like structures merged into one, causing the two tails. This favors Arp 220 as a multiple merging system composed of four or more galaxies arising from a compact group of galaxies. Taking our new results into account, we discuss a star formation history in the last 1 Gyr in Arp 220.

105-KW Sandfilter Backwash Pit sludge volume calculation

International Nuclear Information System (INIS)

Dodd, E.N. Jr.

1995-01-01

The volume of sludge contained in the 100-KW Sandfilter Backwash Pit (SFBWP) was calculated from depth measurements of the sludge, pit dimension measurements and analysis of video tape recordings taken by an underwater camera. The term sludge as used in this report is any combination of sand, sediment, or corrosion products visible in the SFBWP area. This work was performed to determine baseline volume for use in determination of quantities of uranium and plutonium deposited in the pit from sandfilter backwashes. The SFBWP has three areas where sludge is deposited: (1) the main pit floor, (2) the transfer channel floor, and (3) the surfaces and structures in the SFBWP. The depths of sludge and the uniformity of deposition varies significantly between these three areas. As a result, each of the areas was evaluated separately. The total volume of sludge determined was 3.75 M 3 (132.2 ft 3 )

9 CFR 93.220 - Inspection at port of entry.

Science.gov (United States)

2010-01-01

... CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Poultry Mexico 8 § 93.220 Inspection at port of entry. (a) All poultry offered for entry from Mexico, including such poultry intended for movement through...

System Description for the KW Basin Integrated Water Treatment System (IWTS) (70.3)

International Nuclear Information System (INIS)

DERUSSEAU, R.R.

2000-01-01

This is a description of the system that collects and processes the sludge and radioactive ions released by the spent nuclear fuel (SNF) processing operations conducted in the 105 KW Basin. The system screens, settles, filters, and conditions the basin water for reuse. Sludge and most radioactive ions are removed before the water is distributed back to the basin pool. This system is part of the Spent Nuclear Fuel Project (SNFP)

Incoherent beam combining of fiber lasers by an all-fiber 7 × 1 signal combiner at a power level of 14 kW.

Science.gov (United States)

Lei, Chengmin; Gu, Yanran; Chen, Zilun; Wang, Zengfeng; Zhou, Pu; Ma, Yanxing; Xiao, Hu; Leng, Jinyong; Wang, Xiaolin; Hou, Jing; Xu, Xiaojun; Chen, Jinbao; Liu, Zejin

2018-04-16

We demonstrate an all-fiber 7 × 1 signal combiner with an output core diameter of 50 μm for high power incoherent beam combining of seven self-made Yb-doped single-mode fiber lasers around a wavelength of 1080 nm and output power of 2 kW. 14.1 kW combined output power is achieved with a total transmission efficiency of higher than 98.5% and a beam quality of M 2 = 5.37, which is close to the theoretical results based on finite-difference beam propagation technique. To the best of our knowledge, this is the highest output power ever reported for all-fiber structure beam combining generation, which indicates the feasibility and potential of >10 kW high brightness incoherent beam combining based on an all-fiber signal combiner.

ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT, SWINE WASTE ELECTRIC POWER AND HEAT PRODUCTION--CAPSTONE 30KW MICROTURBINE SYSTEM

Science.gov (United States)

Under EPA’s Environmental Technology Verification program, which provides objective and scientific third party analysis of new technology that can benefit the environment, a combined heat and power system was evaluated based on the Capstone 30kW Microturbine developed by Cain Ind...

Laser cutting of thick steel plates with 30 kW fiber laser for nuclear decommissioning

International Nuclear Information System (INIS)

Tamura, Koji

2015-01-01

Laser cutting technologies of the thick steel plates for the nuclear decommissioning were developed with a 30 kW fiber laser. Plates of stainless steel and carbon steel more than 100 mm thick were successfully cut, indicating that this technology is promising for the application to the nuclear decommissioning. (author)

Design and experimental investigation of a second harmonic 20 kW class 28 GHz gyrotron for evaluation of new emitter technologies

Energy Technology Data Exchange (ETDEWEB)

Malygin, Anton

2016-07-01

Gyrotrons are high-power mm-wave tubes. Here, the design, construction and experimental investigation of a 20 kW, 28 GHz gyrotron (2nd harmonic) are reported. This tube was designed to evaluate new emitters for future highly efficient and reliable fusion gyrotrons and for material processing applications. Following experimental results have been achieved in CW operation: 22.5 kW output power at 23.4 kV electron beam voltage and 2.23 A beam current with the world record efficiency of 43 %.

OBSERVATIONS OF Arp 220 USING HERSCHEL-SPIRE: AN UNPRECEDENTED VIEW OF THE MOLECULAR GAS IN AN EXTREME STAR FORMATION ENVIRONMENT

Energy Technology Data Exchange (ETDEWEB)

Rangwala, Naseem; Maloney, Philip R.; Glenn, Jason; Kamenetzky, Julia [Center for Astrophysics and Space Astronomy, University of Colorado, 1255 38th street, Boulder, CO 80303 (United States); Wilson, Christine D.; Mentuch, Erin; Schirm, Maximilien R. P. [Department of Physics and Astronomy, McMaster University, Hamilton, Ontario, L8S 4M1 (Canada); Rykala, Adam [School of Physics and Astronomy, Cardiff University, Queens Buildings The Parade, Cardiff CF24 3AA (United Kingdom); Isaak, Kate [ESA Astrophysics Missions Division, ESTEC, PO Box 299, 2200 AG Noordwijk (Netherlands); Baes, Maarten [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Bendo, George J. [UK ALMA Regional Centre Node, Jordell Bank Center for Astrophysics, School of Physics and Astronomy, University of Manchester, Oxford Road, Manchester M13 9PL (United Kingdom); Boselli, Alessandro [Laboratoire d' Astrophysique de Marseille, UMR6110 CNRS, 38 rue F. Joliot-Curie, F-13388 Marseille (France); Bradford, Charles M. [JPL, Pasadena, CA 91109 (United States); Clements, D. L. [Astrophysics Group, Imperial College, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Cooray, Asantha [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Fulton, Trevor; Imhof, Peter [Blue Sky Spectroscopy Inc, Suite 9-740 4th Avenue South, Lethbridge, Alberta T1J 0N9 (Canada); Madden, Suzanne C.; Sauvage, Marc [CEA, Laboratoire AIM, Irfu/SAp, Orme des Merisiers, F-91191 Gif-sur-Yvette (France); Sacchi, Nicola [Istituto di Fisica dello Spazio Interplanetario, INAF, Via del Fosso del Cavaliere 100, I-00133 Roma (Italy); and others

2011-12-10

We present Herschel Spectral and Photometric Imaging Receiver Fourier Transform Spectrometer (Herschel SPIRE-FTS) observations of Arp 220, a nearby ultra-luminous infrared galaxy. The FTS provides continuous spectral coverage from 190 to 670 {mu}m, a wavelength region that is either very difficult to observe or completely inaccessible from the ground. The spectrum provides a good measurement of the continuum and detection of several molecular and atomic species. We detect luminous CO (J = 4-3 to 13-12) and water rotational transitions with comparable total luminosity {approx}2 Multiplication-Sign 10{sup 8} L{sub Sun }; very high-J transitions of HCN (J = 12-11 to 17-16) in absorption; strong absorption features of rare species such as OH{sup +}, H{sub 2}O{sup +}, and HF; and atomic lines of [C I] and [N II]. The modeling of the continuum shows that the dust is warm, with T = 66 K, and has an unusually large optical depth, with {tau}{sub dust} {approx} 5 at 100 {mu}m. The total far-infrared luminosity of Arp 220 is L{sub FIR} {approx} 2 Multiplication-Sign 10{sup 12} L{sub Sun }. Non-LTE modeling of the extinction corrected CO rotational transitions shows that the spectral line energy distribution of CO is fit well by two temperature components: cold molecular gas at T {approx} 50 K and warm molecular gas at T {approx} 1350{sup +280}{sub -100} K (the inferred temperatures are much lower if CO line fluxes are not corrected for dust extinction). These two components are not in pressure equilibrium. The mass of the warm gas is 10% of the cold gas, but it dominates the CO luminosity. The ratio of total CO luminosity to the total FIR luminosity is L{sub CO}/L{sub FIR} {approx} 10{sup -4} (the most luminous lines, such as J = 6-5, have L{sub CO,J=6-5}/L{sub FIR} {approx} 10{sup -5}). The temperature of the warm gas is in excellent agreement with the observations of H{sub 2} rotational lines. At 1350 K, H{sub 2} dominates the cooling ({approx}20 L{sub Sun} M{sup -1}{sub

Rehabilitation of broken-down chamber for the Gammacell-220 Irradiation Facility

International Nuclear Information System (INIS)

Emi-Reynolds, G.; Banini, G.K.; Ennison, I.

1997-01-01

The broken-down chamber of the gammacell-220 irradiation facility used for the calibration of dosimeters at the National Nuclear Research has been repaired. This repair work involved the identification of suitable components for the aluminum welding capable of ensuring double welding of the inside and outside joints of the chamber. Of paramount importance is the ability of the welded joint to physically sustain the safety column which is made of 26.9 kg of reinforce lead. The wielding was also expected to ensure that the shape of the chamber is retained after installation, apart from allowing uninhibited movement of the chamber which carries samples to be taken into the belly of the gamma cell for irradiation. The Ferrous ammonium sulfate (Fricke) solution was used as the dosimetry standard to check the gamma dose after restoration of the equipment. This report presents information on the procedure and justification for undertaking the repairs of this unit. By this successful repairs and putting into operation of the Gammacell-220, the maintenance team at the Center have demonstrated their ability to undertake similar works on the Gammacell-220 in the future even to other countries in the sub-region. (author). 2 refs., 2 figs

10 CFR 600.220 - Standards for financial management systems.

Science.gov (United States)

2010-01-01

... financial reporting requirements of the grant or subgrant. (2) Accounting records. Grantees and subgrantees... advances to the grantees. (c) An awarding agency may review the adequacy of the financial management system... 10 Energy 4 2010-01-01 2010-01-01 false Standards for financial management systems. 600.220...

The Use of a Solid State Analog Television Transmitter as a Superconducting Electron Gun Power Amplifier

Energy Technology Data Exchange (ETDEWEB)

J.G. Kulpin, K.J. Kleman, R.A. Legg

2012-07-01

A solid state analog television transmitter designed for 200 MHz operation is being commissioned as a radio frequency power amplifier on the Wisconsin superconducting electron gun cavity. The amplifier consists of three separate radio frequency power combiner cabinets and one monitor and control cabinet. The transmitter employs rugged field effect transistors built into one kilowatt drawers that are individually hot swappable at maximum continuous power output. The total combined power of the transmitter system is 33 kW at 200 MHz, output through a standard coaxial transmission line. A low level radio frequency system is employed to digitally synthesize the 200 MHz signal and precisely control amplitude and phase.

A novel DWDM method to design a 100-kW Laser

Science.gov (United States)

Basu, Santanu

2010-02-01

In this paper, I will present the design analysis of a novel concept that may be used to generate a diffraction-limited beam from an aperture so that as much as 450 kW of laser power can be efficiently deposited on a diffraction-limited spot at a range. The laser beam will be comprised of many closely spaced wavelength channels as in a DWDM. The technique relies on the ability of an angular dispersion amplifier to multiplex a large number of high power narrow frequency lasers, wavelengths of which may be as close as 0.4 nm.

Magnetic Measurement of the 10 kW, IR FEL Dipole Magnets

International Nuclear Information System (INIS)

Tommy Hiatt; Kenneth Baggett; J. Beck; George Biallas; David Douglas; Kevin Sullivan; C. Tennant

2003-01-01

Magnetic measurements have been performed on several families of dipoles for the 10 kW IR-FEL presently under construction at the Thomas Jefferson National Accelerator Facility. The requirements for these magnets include varying field strengths, large horizontal apertures and parts in 10,000 field homogeneity as well as setability of core and integrated field. Measurements were made to quantify the magnets according to these requirements and to determine the hysteresis protocol, ramp rate dependence, and field clamp settings that are used. This paper will describe the results of these measurements and the procedures used to accomplish them

Next generation diode lasers with enhanced brightness

Science.gov (United States)

Ried, S.; Rauch, S.; Irmler, L.; Rikels, J.; Killi, A.; Papastathopoulos, E.; Sarailou, E.; Zimer, H.

2018-02-01

High-power diode lasers are nowadays well established manufacturing tools in high power materials processing, mainly for tactile welding, surface treatment and cladding applications. Typical beam parameter products (BPP) of such lasers range from 30 to 50 mm·mrad at several kilowatts of output power. TRUMPF offers a product line of diode lasers to its customers ranging from 150 W up to 6 kW of output power. These diode lasers combine high reliability with small footprint and high efficiency. However, up to now these lasers are limited in brightness due to the commonly used spatial and coarse spectral beam combining techniques. Recently diode lasers with enhanced brightness have been presented by use of dense wavelength multiplexing (DWM). In this paper we report on TRUMPF's diode lasers utilizing DWM. We demonstrate a 2 kW and a 4 kW system ideally suited for fine welding and scanner welding applications. The typical laser efficiency is in the range of 50%. The system offers plug and play exchange of the fiber beam delivery cable, multiple optical outputs and integrated cooling in a very compact package. An advanced control system offers flexible integration in any customer's shop floor environment and includes industry 4.0 capabilities (e.g. condition monitoring and predictive maintenance).

Output Performance and Payback Analysis of a Residential Photovoltaic System in Colorado: Preprint

Energy Technology Data Exchange (ETDEWEB)

Johnston, S.

2012-06-01

Cost of installation and ownership of a 9.66-kilowatt (kW) residential photovoltaic system is described, and the performance of this system over the past 3 years is shown. The system is located in Colorado at 40 degrees latitude and consists of arrays on two structures. Two arrays are installed on a detached garage, and these are each composed of 18 Kyocera 130-W modules strung in series facing south at an angle of 40 degrees above horizontal. Each 18-panel array feeds into a Xantrex/Schneider Electric 2.8-kW inverter. The other two arrays are installed on the house and face south at an angle of 30 degrees. One of these arrays has twelve 205-W Kyocera panels in series, and the other is made up of twelve 210-Kyocera panels. Each of these arrays feeds into Xantrex/Schneider Electric 3.3-kW inverters. Although there are various shading issues from trees and utility poles and lines, the overall output resembles that which is expected from PVWatts, a solar estimate program. The array cost, which was offset by rebates from the utility company and federal tax credits, was $1.17 per watt. Considering measured system performance, the estimated payback time of the system is 9 years.

41 CFR 101-29.220 - Market research and analysis.

Science.gov (United States)

2010-07-01

... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Market research and... PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.220 Market research and analysis. Market research and... to determine whether they meet user needs and to identify the market practices of firms engaged in...

Mathematical investigation of the possibility of a power increase of the subcritical assembly in Dubna (SAD) up to 100 kW

International Nuclear Information System (INIS)

Petrochenkov, S.A.; Shvetsov, V.N.; Polanski, A.

2007-01-01

We present the results of Monte-Carlo modeling of the experimental accelerator-driven electronuclear system composed of the subcritical assembly and DLNP JINR Phasotron. The expected thermal power of the subcritical assembly in Dubna (SAD) is about 30 kW. The possibility of assembly power increase without changes in design and basic elements is considered. The proposed assembly upgrade gives power increase up to 100 kW. It is of importance that proposed upgrade operations can be performed both before and after the run with nominal power and partial fulfillment of a basic experimental program

THE RECEPTION OF GALATIANS 2:20 IN THE PATRISTIC PERIOD ...

African Journals Online (AJOL)

This article explores the reception of Galatians 2:20 in the Patristic period, and ... theological framework in which later generations placed the communities wherein ... quality of reality – and in Christ that is as perfect as eternal life can ever be.

A 20 kw beam-on-target test of a high-power liquid lithium target for RIA

International Nuclear Information System (INIS)

Reed, Claude B.; Nolen, Jerry A.; Specht, James R.; Novick, Vincent J.; Plotkin, Perry

2004-01-01

The high-power heavy-ion beams produced by the Rare Isotope Accelerator (RIA) driver linac have large energy deposition density in solids and in many cases no solid materials would survive the full beam power. Liquid lithium technology has been proposed to solve this problem in RIA. Specifically, a windowless target for the production of radioactive ions via fragmentation, consisting of a jet of about 3 cm thickness of flowing liquid lithium, exposed to the beamline vacuum [1,2] is being developed. To demonstrate that power densities equivalent to a 200-kW RIA uranium beam, deposited in the first 4 mm of a flowing lithium jet, can be handled by the windowless target design, a high power 1 MeV Dynamitron was leased and a test stand prepared to demonstrate the target's capability of absorbing and carrying away a 20kW heat load without disrupting either the 5 mm x 10 mm flowing lithium jet target or the beam line vacuum

7 CFR 220.14 - Claims against school food authorities.

Science.gov (United States)

2010-01-01

..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SCHOOL BREAKFAST PROGRAM § 220.14 Claims against school food authorities. (a) State agencies shall disallow any portion of a claim and recover any payment made... FNSRO, when FNSRO disallows a claim or a portion of a claim, or makes a demand for refund of an alleged...

EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2013. Scientific Opinion on Flavouring Group Evaluation 220, Revision 2 (FGE.220Rev1): α,β-Unsaturated ketones and precursors from chemical subgroup 4.4 of FGE.19: 3(2H)-Furanones

DEFF Research Database (Denmark)

Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia

The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 10 flavouring substances from subgroup 4.4 of FGE.19 in the Flavouring Group Evaluation 220 (FGE.220). FGE.220 is subdivided int...

Physics design of a 10 MeV, 6 kW travelling wave electron linac for ...

Indian Academy of Sciences (India)

2016-10-11

Oct 11, 2016 ... We present the physics design of a 10 MeV, 6 kW S-band (2856 MHz) electron linear ... linac (in contrast with standing wave linac) is that it accepts the RF power over a band of frequencies. Three- ... structures are preferred for relatively higher energy ... klystron in a TW linac, which results in cost reduction.

20 CFR 220.142 - General information about work activity.

Science.gov (United States)

2010-04-01

... gainful activity. (e) Time spent in work. While the time the claimant spends in work is important, the... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false General information about work activity. 220... of whether the claimant spends more time or less time at the job than workers who are not impaired...

Development of a Solid State RF Amplifier in the kW Regime for Application with Low Beta Superconducting RF Cavities

CERN Document Server

Piel, Christian; Borisov, A; Kolesov, Sergej; Piel, Helmut

2005-01-01

Projects based on the use of low beta superconducting cavities for ions are under operation or development at several labs worldwide. Often these cavities are individually driven by RF power sources in the kW regime. For an ongoing project a modular 2 kW, 176 MHz unconditionally stable RF amplifier for CW and pulsed operation was designed, built, and tested. Extended thermal analysis was used to develop a water cooling system in order to optimize the performance of the power transistors and other thermally loaded components. The paper will outline the design concept of the amplifier and present first results on the test of the amplifier with a superconducting cavity.

Synthetic Biology Open Language (SBOL) Version 2.2.0.

Science.gov (United States)

Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grünberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H; Myers, Chris; Sauro, Herbert; Wipat, Anil

2018-04-02

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL) Version 2.2.0

KAUST Repository

Cox, Robert Sidney

2018-04-04

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year\\'s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL Version 2.2.0

Directory of Open Access Journals (Sweden)

Cox Robert Sidney

2018-04-01

Full Text Available Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year’s JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Synthetic Biology Open Language (SBOL) Version 2.2.0

KAUST Repository

Cox, Robert Sidney; Madsen, Curtis; McLaughlin, James Alastair; Nguyen, Tramy; Roehner, Nicholas; Bartley, Bryan; Beal, Jacob; Bissell, Michael; Choi, Kiri; Clancy, Kevin; Grunberg, Raik; Macklin, Chris; Misirli, Goksel; Oberortner, Ernst; Pocock, Matthew; Samineni, Meher; Zhang, Michael; Zhang, Zhen; Zundel, Zach; Gennari, John H.; Myers, Chris; Sauro, Herbert; Wipat, Anil

2018-01-01

Synthetic biology builds upon the techniques and successes of genetics, molecular biology, and metabolic engineering by applying engineering principles to the design of biological systems. The field still faces substantial challenges, including long development times, high rates of failure, and poor reproducibility. One method to ameliorate these problems would be to improve the exchange of information about designed systems between laboratories. The synthetic biology open language (SBOL) has been developed as a standard to support the specification and exchange of biological design information in synthetic biology, filling a need not satisfied by other pre-existing standards. This document details version 2.2.0 of SBOL that builds upon version 2.1.0 published in last year's JIB special issue. In particular, SBOL 2.2.0 includes improved description and validation rules for genetic design provenance, an extension to support combinatorial genetic designs, a new class to add non-SBOL data as attachments, a new class for genetic design implementations, and a description of a methodology to describe the entire design-build-test-learn cycle within the SBOL data model.

Cladding using a 15 kW CO2 laser

International Nuclear Information System (INIS)

Vesely, E.J.; Verma, S.K.

1989-01-01

Laser alloying or cladding differs little in principle from the traditional forms of weld overlays, but lasers as a heat source offer some distinct advantages. With the selective heating attainable using high power lasers, good metallurgical bond of the clad layer, minimal dilution and typically, a very fine homogeneous microstructure can be obtained in the clad layer. This is a review of work in laser cladding using the 15 kW CO 2 laser. The authors discuss the ability of the laser clad surface to increase the high temperature oxidation resistance of a low-alloy carbon steel (4140). Examples of clads subjected to high- temperature thermal cycling of nickel-20% aluminum and TaC + 4140 clad low-alloy steel and straight high-temperature oxidation of Stellite 6-304L cladding on a 4140 substrate are given

77 FR 68768 - Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of...

Science.gov (United States)

2012-11-16

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. RM10-12-000] Electricity Market Transparency Provisions of Section 220 of the Federal Power Act; Notice of Technical Conference...., Washington, DC 20426. \\1\\ Electricity Market Transparency Provisions of Section 220 of the Federal Power Act...

Hydrogen as a clean energy option; Option Wasserstoff als sauberer Energietraeger

Energy Technology Data Exchange (ETDEWEB)

Newi, G. [Consulectra Unternehmensberatung GmbH, Hamburg (Germany)

1998-06-01

Many visionary action programmes are based on the conviction that hydrogen produced from renewable, environmentally sustainable resources is the chemical energy carrier of the future. In Hamburg there have been various pilot projects over the past ten years which deal explicitly with problems of infrastructure relating to the integration of renewable energy sources in the existing energy supply. One such example is the fuel cell block heating station in Hamburg Behrenfeld which has been supplying residential buildings for some time now. Another is a practice-oriented pilot project involving a hydrogen-fuelled PAFC with 220 kW thermal and 200 kW electrical power output. The hydrogen is supplied by a 60 m-3 LH{sub 2} tank, the first of its kind to be approved by the authorities and accepted by the public. [Deutsch] Viele visionaere Aktionsprogramme sehen aus dauerhaft umweltvertraeglichen Quellen erzeugten Wasserstoff als chemischen Energietraeger der Zukunft. In Hamburg gibt es seit rd. 10 Jahren verschiedene Pilotprojekte, die sich insbesondere mit Fragen der Infrastruktur zur Integration erneuerbarer Energiequellen in die bestehende Energieversorgung befassen. Ein Beispiel ist das in Hamburg-Behrenfeld seit einiger Zeit betriebene Brennstoffzellen-Blockheizkraftwerk zur Versorgung von Wohngebaeuden. Als praxisbezogenes Pilotprojekt wird u.a. eine H{sub 2}-versorgte PAFC mit 220 kW thermischer und 200 kW elektrischer Leistung betrieben. Die Wasserstoffversorgung aus einem oberirdischen 60 m{sup 3} LH{sub 2}-Tank wurde erstmals in dieser Anwendungsform behoerdlich genehmigt und von der Oeffentlichkeit akzeptiert. (orig./MSK)

Next generation 9xx/10xx nm high power laser diode bars for multi-kilowatt industrial applications

Science.gov (United States)

Commin, Paul; Todt, René; Krejci, Martin; Bättig, Rainer; Brunner, Reinhard; Lichtenstein, Norbert

2013-02-01

We report on the development of high power, 9xx-10xx nm laser diode bars for use in direct diode systems and for solidstate and fibre laser pumping with applications in industrial markets. For 1 cm wide bars on micro channel cooler (MCC) we have achieved a reliable output power of 250 W across the 900 nm - 1060 nm range. At this output power level we have achieved power conversion efficiencies of 65-66 % and 90 % power content slow axis beam divergence of ~6.5°. Results of a 6400 h life test show an average power degradation of 0.6 % per 1000 h at this operating power level. We will also show results of high power bars assembled on the new OCLARO conductive cooler, the BLM. This new cooler has a small footprint of 12.6 mm × 24.8 mm and is designed for lateral or vertical stacking of diodes in multi kilowatt systems but with the benefits associated with a conductive cooler. The thermal properties are shown to be the same as for a standard CS mount. 1 cm wide high fill factor bars and 0.5 cm wide low fill factor half bars assembled on the BLM operate at 63-64 % power conversion efficiency (PCE) with output powers of up to 250 W and 150 W, respectively.

Derivation of an expression for the roundoff noise determinant det (KW)^{1/2} for digital filters

DEFF Research Database (Denmark)

Jørsboe, Helge

1978-01-01

The minimal roundoff noise in fixed point digital filters is determined by a certain determinant, generally denoted by det(KW)^{1/2}. This determinant may be expressed by the poles and zeros of the filter transfer function H(z). This paper presents a simple and direct derivation of this expression...

ALMA IMAGING OF HCN, CS, AND DUST IN ARP 220 AND NGC 6240

Energy Technology Data Exchange (ETDEWEB)

Scoville, Nick; Manohar, Swarnima; Murchikova, Lena [California Institute of Technology, MC 249-17, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Sheth, Kartik [North American ALMA Science Center, National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Walter, Fabian; Zschaechner, Laura [Max-Planck-Institut fur Astronomie, Konigstuhl 17, D-69117 Heidelberg (Germany); Yun, Min [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Koda, Jin [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Sanders, David; Barnes, Joshua [Institute for Astronomy, 2680 Woodlawn Drive, University of Hawaii, Honolulu, Hawaii, HI 96822 (United States); Thompson, Todd [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Robertson, Brant; Tacconi, Linda; Narayanan, Desika [Department of Astronomy and Steward Observatory, University of Arizona, Tucson AZ 85721 (United States); Genzel, Reinhard; Davies, Richard [Max-Planck-Institut fur extraterrestrische Physik (MPE), Giessenbachstrasse, D-85748 Garching (Germany); Hernquist, Lars [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Brown, Robert [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22901 (United States); Hayward, Christopher C. [TAPIR 350-17, California Institute of Technology, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Kartaltepe, Jeyhan [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); and others

2015-02-10

We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10{sup 9} M {sub ☉}within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n{sub H{sub 2}}∼10{sup 5} cm{sup –3} at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n {sub H2} ∼ 2 × 10{sup 5} cm{sup –3}. The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese.

ALMA IMAGING OF HCN, CS, AND DUST IN ARP 220 AND NGC 6240

International Nuclear Information System (INIS)

Scoville, Nick; Manohar, Swarnima; Murchikova, Lena; Sheth, Kartik; Walter, Fabian; Zschaechner, Laura; Yun, Min; Koda, Jin; Sanders, David; Barnes, Joshua; Thompson, Todd; Robertson, Brant; Tacconi, Linda; Narayanan, Desika; Genzel, Reinhard; Davies, Richard; Hernquist, Lars; Brown, Robert; Hayward, Christopher C.; Kartaltepe, Jeyhan

2015-01-01

We report ALMA Band 7 (350 GHz) imaging at 0.''4-0.''6 resolution and Band 9 (696 GHz) at ∼0.''25 resolution of the luminous IR galaxies Arp 220 and NGC 6240. The long wavelength dust continuum is used to estimate interstellar medium masses for Arp 220 east and west and NGC 6240 of 1.9, 4.2, and 1.6 × 10 9 M ☉ within radii of 69, 65, and 190 pc. The HCN emission was modeled to derive the emissivity distribution as a function of radius and the kinematics of each nuclear disk, yielding dynamical masses consistent with the masses and sizes derived from the dust emission. In Arp 220, the major dust and gas concentrations are at radii less than 50 pc in both counter-rotating nuclear disks. The thickness of the disks in Arp 220 estimated from the velocity dispersion and rotation velocities are 10-20 pc and the mean gas densities are n H 2 ∼10 5  cm –3 at R <50 pc. We develop an analytic treatment for the molecular excitation (including photon trapping), yielding volume densities for both the HCN and CS emission with n H2 ∼ 2 × 10 5  cm –3 . The agreement of the mean density from the total mass and size with that required for excitation suggests that the volume is essentially filled with dense gas, i.e., it is not cloudy or like swiss cheese

Research on Power Factor Correction Boost Inductor Design Optimization – Efficiency vs. Power Density

DEFF Research Database (Denmark)

Li, Qingnan; Andersen, Michael A. E.; Thomsen, Ole Cornelius

2011-01-01

Nowadays, efficiency and power density are the most important issues for Power Factor Correction (PFC) converters development. However, it is a challenge to reach both high efficiency and power density in a system at the same time. In this paper, taking a Bridgeless PFC (BPFC) as an example......, a useful compromise between efficiency and power density of the Boost inductors on 3.2kW is achieved using an optimized design procedure. The experimental verifications based on the optimized inductor are carried out from 300W to 3.2kW at 220Vac input....

S-band low noise amplifier and 40 kW high power amplifier subsystems of Japanese Deep Space Earth Station

Science.gov (United States)

Honma, K.; Handa, K.; Akinaga, W.; Doi, M.; Matsuzaki, O.

This paper describes the design and the performance of the S-band low noise amplifier and the S-band high power amplifier that have been developed for the Usuda Deep Space Station of the Institute of Space and Astronautical Science (ISAS), Japan. The S-band low noise amplifier consists of a helium gas-cooled parametric amplifier followed by three-stage FET amplifiers and has a noise temperature of 8 K. The high power amplifier is composed of two 28 kW klystrons, capable of transmitting 40 kW continuously when two klystrons are combined. Both subsystems are operating quite satisfactorily in the tracking of Sakigake and Suisei, the Japanese interplanetary probes for Halley's comet exploration, launched by ISAS in 1985.

A 100-kW three-phase ac plasma furnace for spheroidization of aluminum silicate particles

International Nuclear Information System (INIS)

Gold, D.; Bonet, C.; Chauvin, G.; Geinaert, G.; Mathieu, A.C.; Millet, J.

1981-01-01

A 100-kW three-phase ac plasma furnace with sheathed copper electrodes (sheathing gas: air) is presented. It is used for spheroidizing ''chamotte'' (refractory-fired clay) particles having a smooth, pore-free surface. A simple, one-dimensional numerical model for the heat transfer to the particles explains the maximum processing rate and the detrimental influence of an inhomogeneous particle size distribution

Modeling and Implementation of a 1 kW, Air Cooled HTPEM Fuel Cell in a Hybrid Electrical Vehicle

DEFF Research Database (Denmark)

Andreasen, Søren Juhl; Ashworth, Leanne; Remón, Ian Natanael

2008-01-01

This work is a preliminary study of using the PBI-based, HTPEM fuel cell technology in automotive applications. This issue was investigated through computational modeling and an experimental investigation. A hybrid fuel cell system, consisting of a 1 kW stack and lead acid batteries, was implemen......This work is a preliminary study of using the PBI-based, HTPEM fuel cell technology in automotive applications. This issue was investigated through computational modeling and an experimental investigation. A hybrid fuel cell system, consisting of a 1 kW stack and lead acid batteries......, was implemented in a small electrical vehicle. A dynamic model was developed using Matlab-Simulink to describe the system characteristics, select operating conditions and to size system components. Preheating of the fuel cell stack with electrical resistors was investigated and found to be an unrealistic approach...

Industrial Applications of High Average Power FELS

CERN Document Server

Shinn, Michelle D

2005-01-01

The use of lasers for material processing continues to expand, and the annual sales of such lasers exceeds $1 B (US). Large scale (many m2) processing of materials require the economical production of laser powers of the tens of kilowatts, and therefore are not yet commercial processes, although they have been demonstrated. The development of FELs based on superconducting RF (SRF) linac technology provides a scaleable path to laser outputs above 50 kW in the IR, rendering these applications economically viable, since the cost/photon drops as the output power increases. This approach also enables high average power ~ 1 kW output in the UV spectrum. Such FELs will provide quasi-cw (PRFs in the tens of MHz), of ultrafast (pulsewidth ~ 1 ps) output with very high beam quality. This talk will provide an overview of applications tests by our facility's users such as pulsed laser deposition, laser ablation, and laser surface modification, as well as present plans that will be tested with our upgraded FELs. These upg...

Development of a measurement and control system for a 10 kW@20 K refrigerator based on Siemens PLC S7-300

Science.gov (United States)

Li, J.; Liu, L. Q.; Liu, T.; Xu, X. D.; Dong, B.; Lu, W. H.; Pan, W.; Wu, J. H.; Xiong, L. Y.

2017-02-01

A 10 kW@20 K refrigerator has been established by the Technical Institute of Physics and Chemistry, Chinese Academy of Sciences. A measurement and control system based on Siemens PLC S7-300 for this 10 kW@20 K refrigerator is developed. According to the detailed measurement requirements, proper sensors and transmitters are adopted. Siemens S7-300 PLC CPU315-2 PN/DP operates as a master station. Two sets of ET200M DP remote expand I/O, one power meter, two compressors and one vacuum gauge operate as slave stations. Profibus-DP field communication and Modbus communication are used between the master station and the slave stations in this control system. The upper computer HMI (Human Machine Interface) is compiled using Siemens configuration software WinCC V7.0. The upper computer communicates with PLC by means of industrial Ethernet. After commissioning, this refrigerator has been operating with a 10 kW of cooling power at 20 K for more than 72 hours.

Homecell: design and development of a 2 kW fuel cell based electric energy generating system, for the domestic market

Energy Technology Data Exchange (ETDEWEB)

Bordallo, C.R.; Moreno, E.; Brey, J.J.; Garcia, C.; Castro, A.; Sarmiento, B. [Hynergreen Technologies, S.A., Seville (Spain)

2004-07-01

'Full text:' Even though fuel cell technology has been known in industry for decades now, it has come to the fore in recent years hand in hand with renewable energy sources and the hydrogen vector, as a clean, reliable and efficient electric energy source. Within the stationary applications of fuel cells, the production of high output electric energy has always stood out and this could range from several hundreds of watts to megawatts to supply large plants. The objective of this project is to develop, construct and experimentally validate an electric energy generating system for domestic applications of up to 2 kW. This is due to the fact that multiple domestic applications currently exist for which an electric output of 2 kW is sufficient. On the other hand, an electricity supply might not exist, or might be deficient; and this system will enable electricity supply even under these circumstances. Moreover, the existing system is very versatile and could be complemented with other hydrogen production ones (using photovoltaic energy for example), or else two systems could be used in parallel if outputs up to 4 kW were required, and other applications in other markets, such as telecommunications or tele-metering systems, could be undertaken. (author)

A diode-pumped continuous-wave Nd:YAG laser with an average output power of 1 kW

International Nuclear Information System (INIS)

Lee, Sung Man; Cha, Byung Heon; Kim, Cheol Jung

2004-01-01

A diode-pumped Nd:YAG laser with an average output power of 1 kW is developed for industrial applications, such as metal cutting, precision welding, etc. To develop such a diode-pumped high power solid-state laser, a series of laser modules have been used in general with and without thermal birefringence compensation. For example, Akiyama et al. used three laser modules to obtain a output power of 5.4 kW CW.1 In the side-pumped Nd:YAG laser, which is a commonly used pump scheme to obtain high output power, the crystal rod has a short thermal focal length at a high input pump power, and the short thermal focal length in turn leads to beam distortion within a laser resonator. Therefore, to achieve a high output power with good stability, isotropic beam profile, and high optical efficiency, the detailed analysis of the resonator stability condition depending on both mirror distances and a crystal separation is essential

20 CFR 220.178 - Determining medical improvement and its relationship to the annuitant's ability to do work.

Science.gov (United States)

2010-04-01

... relationship to the annuitant's ability to do work. 220.178 Section 220.178 Employees' Benefits RAILROAD... improvement and its relationship to the annuitant's ability to do work. (a) General. Paragraphs (a), (b), and... ability to work and medical improvement that is related to the ability to work. How the Board will arrive...

Energy and exergy evaluation of a 220MW thermal power plant ...

African Journals Online (AJOL)

Energy and exergy evaluation of a 220MW thermal power plant. ... Nigerian Journal of Technology ... At the variation of environmental or dead state temperature, ther e were no appreciable changes in the values of exergy efficiency of the ...

Effects of ultrasonic and thermo-chemical pre-treatments on methane production from fat, oil and grease (FOG) and synthetic kitchen waste (KW) in anaerobic co-digestion.

Science.gov (United States)

Li, Chenxi; Champagne, Pascale; Anderson, Bruce C

2013-02-01

The effects of ultrasonic and thermo-chemical pre-treatments on the methane production potential of anaerobic co-digestion with synthetic kitchen waste (KW) or fat, oil and grease (FOG) were investigated. Non-linear regressions were fitted to accurately assess and compare the methane production from co-digestion under the various pre-treatment conditions and to achieve representative simulations and predictions. Ultrasonic pre-treatment was not found to improve methane production effectively from either FOG co-digestion or KW co-digestions. Thermo-chemical pre-treatment could increase methane production yields from both FOG and KW co-digestions. COD solubilization was found to effectively represent the effects of pre-treatment. A comprehensive evaluation indicated that the thermo-chemical pre-treatments of pH=10, 55°C and pH=8, 55°C provided the best conditions to increase methane production from FOG and KW co-digestions, respectively. The most effective enhancement of biogas production (288±0.85mLCH(4)/g TVS) was achieved from thermo-chemically pre-treated FOG co-digestion, which was 9.9±1.5% higher than FOG co-digestion without thermo-chemical pre-treatment. Copyright © 2012 Elsevier Ltd. All rights reserved.

Test results of a 5 kW fully superconducting homopolar motor

Energy Technology Data Exchange (ETDEWEB)

Lee, J. K. [Woosuk University, Wanju (Korea, Republic of); Park, S. H.; Kim, Y.; Lee, S.; Joo, H. G.; Kim, W. S.; Choi, K. [Korea Polytechnic University,Siheong (Korea, Republic of); Hahm, S. Y. [Electrical Engineering and Science Research Institute,Seoul (Korea, Republic of)

2013-05-15

The superconducting Homopolar motor is manufactured and tested. Homopolar motor system is simple and solid as the field coil of the motor is fixed near the stator coil without rotating system. In this paper, a 5 kW fully superconducting homopolar motor which has high temperature superconducting armature and field coils is manufactured and tested in liquid nitrogen. The critical current test results of the used 2G superconducting wire, pancake coil for rotor winding and race-track coils for armature winding are reported. Also, the test result of rotating and operating performance is presented. The operating frequency is to be 5 Hz for low-speed rotating. The developed fully superconducting Homopolar motor is the world's first.

Test results of a 5 kW fully superconducting homopolar motor

International Nuclear Information System (INIS)

Lee, J. K.; Park, S. H.; Kim, Y.; Lee, S.; Joo, H. G.; Kim, W. S.; Choi, K.; Hahm, S. Y.

2013-01-01

The superconducting Homopolar motor is manufactured and tested. Homopolar motor system is simple and solid as the field coil of the motor is fixed near the stator coil without rotating system. In this paper, a 5 kW fully superconducting homopolar motor which has high temperature superconducting armature and field coils is manufactured and tested in liquid nitrogen. The critical current test results of the used 2G superconducting wire, pancake coil for rotor winding and race-track coils for armature winding are reported. Also, the test result of rotating and operating performance is presented. The operating frequency is to be 5 Hz for low-speed rotating. The developed fully superconducting Homopolar motor is the world's first.

Stand-alone version of the 11kW Gaia wind turbine

Energy Technology Data Exchange (ETDEWEB)

Bindner, H.; Rosas, P.A.C.; Teodorescu, R.; Blaabjerg, F.

2004-09-15

This report describes the development of a stand-alone version of the 11kW Gaia wind turbine. Various possible configurations are investigated and a configuration using a back-to-back converter is chosen. A model is developed for controller design of the fast controllers of the unit. Controllers are designed and a prototype is built for testing. The report documents the performance of the prototype through measurements done on the full scale prototype installed in a test facility where it has been tested both as a standalone unit and in parallel with a diesel genset. For system wide power quality assessment and controller design a dynamic performance assessment model has been developed. (au)

NREL-Prime Next-Generation Drivetrain Dynamometer Test Report

Energy Technology Data Exchange (ETDEWEB)

Keller, Jonathan [National Renewable Energy Lab. (NREL), Golden, CO (United States); Erdman, Bill [Cinch, Inc., Moraga, CA (United States); Blodgett, Douglas [DNV KEMA Renewables, Burlington, VT (United States); Halse, Christopher [Romax Technology, Boulder, CO (United States)

2016-08-01

Advances in wind turbine drivetrain technologies are necessary to improve reliability and reduce the cost of energy for land-based and offshore wind turbines. The NREL-Prime Next-Generation Drivetrain team developed a geared, medium-speed drivetrain that is lighter, more reliable and more efficient than existing designs. One of the objectives of Phase II of the project was to complete the detailed design, fabrication, and dynamometer testing of a 750 kilowatt (kW) drivetrain that includes the key gearbox innovations designed by Romax Technology and power converter innovations designed by DNV Kema Renewables. The purpose of this document is to summarize these tests completed in NREL's National Wind Technology Center 2.5 megawatt (MW) dynamometer.

Flying without fuel. Minimalism in aircraft construction; Fliegen ohne Sprit. Minimalisten im Flugzeugbau

Energy Technology Data Exchange (ETDEWEB)

Knapp, W.

1997-05-01

The article describes the solar aircraft `Icare`` which was constucted in a joint project by engineers and scientists of Stuttgart university. The aircraft requires slightly more than one kW for staying up. The theoretical fundamentals are presented in the dissertation of Peer Frank, ``Aircraft design for minimum fuel consumption` (Institute of Aircraft Engineering, Stuttgart, 1992). (orig.) [Deutsch] Allein mit Sonnenkraft kann das Flugzeug `Icare` fliegen. Es entstand in Gemeinschaftsarbeit von Ingenieuren und Wissenschaftlern der Stuttgarter Universitaet. Das Solarflugzeug Icare benoetigt etwas ueber ein Kilowatt, um oben zu bleiben. In seiner Doktorarbeit `Die Auslegung von Flugzeugen mit geringstem Antriebsleistungsbedarf` (Institut fuer Flugzeugbau, Stuttgart, 1992) hat der Duesseldorfer Peer Frank die theoretischen Grundlagen dazu behandelt. (orig.)

42 CFR 413.220 - Methodology for calculating the per-treatment base rate under the ESRD prospective payment system...

Science.gov (United States)

2010-10-01

... rate under the ESRD prospective payment system effective January 1, 2011. 413.220 Section 413.220...-treatment base rate under the ESRD prospective payment system effective January 1, 2011. (a) Data sources. The methodology for determining the per treatment base rate under the ESRD prospective payment system...

A Double-blind Trial of Lactobacillus paracasei Strain KW3110 Administration for Immunomodulation in Patients with Pollen Allergy

Directory of Open Access Journals (Sweden)

Daisuke Fujiwara

2005-01-01

Conclusions: Our results suggest that ingestion of the L. paracasei strain KW3110 is associated with both repression of Th2 cell generation and eosinophil activation. Our data point to the possibility that specific lactic acid bacteria may be useful for allergy therapy.

High-voltage horizontal shaft squirrel cage type induction motor TOSMIGHTY{sub TM}-T98 series; Yokojiku koatsu kagogata yudo dendoki TOSMIGHTY{sub TM}-T98 series

Energy Technology Data Exchange (ETDEWEB)

NONE

1999-03-01

T98 series developed as succeeding series of T90 for as short as 2 years expanded a standardization range from 450- 630 to 450-900 in frame number, and covered a power range up to 15,000kW in 4-pole motor base. The concept of T98 series is as follows: (1) ON TIME (rapid correspondence to requests, delivery time shortest in the world), (2) ON SPEC (security for customer`s demand quality, satisfaction of various international standards), and (3) ON PRICE (compactness, space saving and reasonable price by development of elementary technologies through joint research with the research division). This series is placed as strategic series for sales promotion through the existing electronic catalog (CD-ROM) and acquisition of further BASEEFA certifications. (translated by NEDO)

High-voltage horizontal shaft squirrel cage type induction motor TOSMIGHTY[sub TM]-T98 series. Yokojiku koatsu kagogata yudo dendoki TOSMIGHTY[sub TM]-T98 series

Energy Technology Data Exchange (ETDEWEB)

1999-03-01

T98 series developed as succeeding series of T90 for as short as 2 years expanded a standardization range from 450- 630 to 450-900 in frame number, and covered a power range up to 15,000kW in 4-pole motor base. The concept of T98 series is as follows: (1) ON TIME (rapid correspondence to requests, delivery time shortest in the world), (2) ON SPEC (security for customer's demand quality, satisfaction of various international standards), and (3) ON PRICE (compactness, space saving and reasonable price by development of elementary technologies through joint research with the research division). This series is placed as strategic series for sales promotion through the existing electronic catalog (CD-ROM) and acquisition of further BASEEFA certifications. (translated by NEDO)

The cryogenic system for the superconducting solenoid magnet of the CMS experiment

CERN Document Server

Delikaris, D; Passardi, Giorgio; Lottin, J C; Lottin, J P; Lyraud, C

1998-01-01

The design concept of the CMS experiment, foreseen for the Large Hadron Collider (LHC) project at CERN, is based on a superconducting solenoid magnet. The large coil will be made of a four layers winding generating the 4 T uniform magnetic induction required by the detector. The length of the solenoid is 13 m with an inner diameter of 5.9 m. The mass kept at liquid helium temperature totals 220 t and the electromagnetic stored energy is 2.7 GJ. The windings are indirectly cooled with a liquid helium flow driven by a thermosyphon effect. The external cryogenic system consists of a 1.5 kW at 4.5 K (entropy equivalent) cryoplant including an additional liquid nitrogen precooling unit and a 5000 litre liquid helium buffer. The whole magnet and cryogenic system will be tested at the surface by 2003 before final installation in the underground area of LHC.

Simultaneous quantification of MTC-220 and its metabolites in beagle dog plasma by liquid chromatography-tandem mass spectrometry.

Science.gov (United States)

Liu, Xin; Zhao, Manman; Mi, Jiaqi; Liu, Zhihao; Hu, Jinping; Sheng, Li; Wang, Baolian; Li, Dan; Yang, Shuang; Li, Yan

2014-10-01

A sensitive LC-ESI-MS/MS method for simultaneous determination of MTC-220 and its metabolites (paclitaxel and MDA-linker) in dog plasma has been developed and validated. After addition of docetaxel (internal standard), plasma samples containing MTC-220, paclitaxel and MDA-linker were prepared based on a simple protein precipitation by adding two volumes of acetonitrile. The separation was performed on a ZorbaxSB-C18 column (3.5μm, 2.1mm×100mm) at a flow rate of 0.2ml/min, using acetonitrile/water containing 0.1% formic acid (v/v) as mobile phase. The detection was performed on a triple quadrupole tandem mass spectrometer equipped with electrospray ionization (ESI) by selected reaction monitoring (SRM). The MS/MS ion transit ions monitored were 1444.4→623.8 for MTC-220, 876.4→307.9 for paclitaxel, 631.2→531.2 for MDA-linker and 830.2→549.1 for the internal standard. Linear detection responses were obtained for MTC-220, paclitaxel and MDA-linker ranging from 10 to 5000, 5 to 2500 and 5 to 500ng/ml, respectively. The lower limits of quantitation (LLOQs) for MTC-220, paclitaxel and MDA-linker were 10, 5 and 5ng/ml, respectively. The intra-day and inter-day precisions (RSD, %) of the three analytes do not exceed 10.9% except for LLOQs (≤17.50), and the accuracy (RE, %) were within ±17.5% for LLOQs and ±12.6% for the others. The average recoveries of three compounds were greater than 85.0%. The analytes were proved to be stable during all sample storage, preparation and analytic procedures. The validated method was successfully applied to pharmacokinetic studies of MTC-220 and its metabolites in beagle dogs after intravenous infusion of MTC-220 at 2.5mg/kg. Copyright © 2014 Elsevier B.V. All rights reserved.

40 CFR 280.220 - Ownership of an underground storage tank or underground storage tank system or facility or...

Science.gov (United States)

2010-07-01

... tank or underground storage tank system or facility or property on which an underground storage tank or underground storage tank system is located. 280.220 Section 280.220 Protection of Environment ENVIRONMENTAL... underground storage tank or underground storage tank system or facility or property on which an underground...

Supplementary shutdown system of 220 MWe standard PHWR in India

International Nuclear Information System (INIS)

Muktibodh, U.C.

1997-01-01

The design objective of the shutdown system is to make the reactor subcritical and hold it in that state for an extended period of time. This objective must be realised under all anticipated operational occurrences and postulated abnormal conditions even during most reactive state of the core. PHWR design criteria for shutdown stipulates requirement of two independent diverse and fast acting shutdown systems, either of which acting alone should meet the above objectives. This requirement would normally call for a large number of reactivity mechanism penetrations into the calandria. From the point of view of space availability at the reactivity mechanism area on top of calandria, for the relatively small core of 220 MWe PHWRs, and ease of maintenance realisation of the total worth by either of the shutdown systems acting alone was difficult. To overcome this engineering constraint and at the same time to satisfy the design criteria, a unique approach to meet the reactivity demands for shutdown was adopted. The reactivity requirements of the shutdown consists of fast and slow reactivity changes. For the shutdown system of 220 MWe PHWRs, the approach of realizing fast reactivity changes with dual redundant, diverse, fast acting shutdown systems aided by a slow acting shutdown system to counter delayed reactivity changes was conceived. The supplementary slow acting shutdown system is called upon to act after actuation of either of the two redundant fast acting systems and is referred to as Liquid Poison Injection System (LPIS). The system adds bulk amount of neutron poison (boric acid), equivalent to 45 mk, directly into the moderator through two nozzles in calandria using pneumatic pressure. This paper describes the design of LPIS as envisaged for the standardised 220 MWe PHWRs. (author)

30 CFR 220.014 - Allocation of joint costs and credits.

Science.gov (United States)

2010-07-01

... allocation principles apply in allocating joint costs: (1) G & G. G & G shall be allocated on a line mile per... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Allocation of joint costs and credits. 220.014... MANAGEMENT ACCOUNTING PROCEDURES FOR DETERMINING NET PROFIT SHARE PAYMENT FOR OUTER CONTINENTAL SHELF OIL AND...

Measurement of 222Rn and 220Rn exhalation rate from soil samples of Kumaun Hills, India

Science.gov (United States)

Semwal, Poonam; Singh, Kuldeep; Agarwal, T. K.; Joshi, Manish; Pant, Preeti; Kandari, Tushar; Ramola, R. C.

2018-03-01

The source terms, i.e., exhalation and emanation from soil and building materials are the primary contributors to the radon (222Rn)/thoron (220Rn) concentration levels in the dwellings, while the ecological constraints like ventilation rate, temperature, pressure, humidity, etc., are the influencing factors. The present study is focused on Almora District of Kumaun, located in Himalayan belt of Uttarakhand, India. For the measurement of 222Rn and 220Rn exhalation rates, 24 soil samples were collected from different locations. Gamma radiation level was measured at each of these locations. Chamber technique associated with Smart Rn Duo portable monitor was employed for the estimation of 222Rn and 220Rn exhalation rates. Radionuclides (226Ra, 232Th and 40K) concentrations were also measured in soil samples using NaI(Tl) scintillation based gamma ray spectrometry. The mass exhalation rate for 222Rn was varying between 16 and 54 mBq/kg/h, while the 220Rn surface exhalation rate was in the range of 0.65-6.43 Bq/m2/s. Measured gamma dose rate for the same region varied from 0.10 to 0.31 µSv/h. Inter-correlation of exhalation rates and intra-correlation with background gamma levels were studied.

Chandra Observations of Extended X-Ray Emission in ARP 220

Science.gov (United States)

McDowell, J. C.; Clements, D. L.; Lamb, S. A.; Shaked, S.; Hearn, N. C.; Colina, L.; Mundell, C.; Borne, K.; Baker, A. C.; Arribas, S.

2003-01-01

We resolve the extended X-ray emission from the prototypical ultraluminous infrared galaxy Arp 220. Extended, faint, edge-brightened, soft X-ray lobes outside the optical galaxy are observed to a distance of 1CL 15 kpc on each side of the nuclear region. Bright plumes inside the optical isophotes coincide with the optical line emission and extend 1 1 kpc from end to end across the nucleus. The data for the plumes cannot be fitted by a single-temperature plasma and display a range of temperatures from 0.2 to 1 keV. The plumes emerge from bright, diffuse circumnuclear emission in the inner 3 kpc centered on the Ha peak, which is displaced from the radio nuclei. There is a close morphological correspondence between the Ha and soft X-ray emission on all spatial scales. We interpret the plumes as a starburst-driven superwind and discuss two interpretations of the emission from the lobes in the context of simulations of the merger dynamics of Arp 220.

A 30 KW RF power amplifier for the RFQ accelerator (Paper No. CP 27)

International Nuclear Information System (INIS)

Luktuke, R.D.; Garud, A.N.; Murthy, P.N.K.; Sethi, R.C.

1990-01-01

A radio frequency quadrupole (RFQ) accelerator, to accelerate deuterons to an energy of 150 keV with beam current of 20 mA, has been designed and is under construction. This accelerator needs approximately 30 kW of RF power to generate the desired voltage of 55 kV on the electrodes, at a frequency of 45 MHz. The power amplifier is designed with four stages of RF amplification using vacuum tubes. The first two stages are built with the tubes 6146 and BEL 250 CX, to deliver about 100 watts power to the grid circuit of the pre driver. The pre driver (EIMAC 5 CX 1500 A) and the driver (BEL 4000 CX) give an output power of about 5kW, at the grid of the high power amplifier. All the four tubes operate in class A/AB mode. The high power amplifier has been designed and is being built around the BEL power tetrode tube CQK-50-2. The output from the high power amplifier is fed to the RFQ, via a matching network to tranform the plate impedance to 50 ohm loop impedeance at the RFQ. The paper presents the design aspects of the high power amplifier, matching network and the results obtained for the earlier stages. (author). 3 refs., 3 tabs., 2 figs

46 CFR 199.220 - Survival craft and rescue boat embarkation arrangements.

Science.gov (United States)

2010-10-01

... 46 Shipping 7 2010-10-01 2010-10-01 false Survival craft and rescue boat embarkation arrangements... APPLIANCES AND ARRANGEMENTS LIFESAVING SYSTEMS FOR CERTAIN INSPECTED VESSELS Additional Requirements for Passenger Vessels § 199.220 Survival craft and rescue boat embarkation arrangements. (a) Survival craft...

36 CFR 220.5 - Environmental impact statement and record of decision.

Science.gov (United States)

2010-07-01

... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Environmental impact..., DEPARTMENT OF AGRICULTURE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) COMPLIANCE § 220.5 Environmental impact statement and record of decision. (a) Classes of actions normally requiring environmental impact statements...

Effects of air conditioning, dehumidification and natural ventilation on indoor concentrations of 222Rn and 220Rn

International Nuclear Information System (INIS)

Lee, Thomas K.C.; Yu, K.N.

2000-01-01

A bedroom was selected for detailed measurements on 220 Rn and 222 Rn concentrations and environmental parameters including CO 2 concentration, temperature and relative humidity. To simulate different sealing conditions, five conditions were artificially created in the sampling period of 25 consecutive days. It was concluded that natural ventilation is the most efficient way to lower the 222 Rn levels, while air conditioning is the next. Dehumidification provides only a marginal reduction of 222 Rn levels. The 220 Rn concentrations are not affected by natural ventilation, air conditioner or dehumidification, and were all around 10 Bq m -3 . There are no significant correlations between the 220 Rn and 222 Rn concentrations and environmental conditions such as CO 2 concentrations, temperature, relative humidity and pressure

Conceptual design of a fixed-pitch wind turbine generator system rated at 400 kilowatts

Science.gov (United States)

Pintz, A.; Kasuba, R.; Spring, J.

1984-01-01

The design and cost aspects of a fixed pitch, 400 kW Wind Turbine Generator (WTG) concept are presented. Improvements in reliability and cost reductions were achieved with fixed pitch operation and by incorporating recent advances in WTG technology. The specifications for this WTG concept were as follows: (1) A fixed pitch, continuous wooden rotor was to be provided by the Gougeon Bros. Co. (2) An 8 leg hyperboloid tower that showed promise as a low cost structure was to be used. (3) Only commercially available components and parts that could be easily fabricated were to be considered. (4) Design features deemed desirable based on recent NASA research efforts were to be incorporated. Detailed costs and weight estimates were prepared for the second machine and a wind farm of 12 WTG's. The calculated cost of energy for the fixed pitch, twelve unit windfarm is 11.5 cents/kW hr not including the cost of land and access roads. The study shows feasibility of fixed pitch, intermediate power WTG operation.

3.05 kW monolithic fiber laser oscillator with simultaneous optimizations of stimulated Raman scattering and transverse mode instability

Science.gov (United States)

Yang, Baolai; Zhang, Hanwei; Shi, Chen; Tao, Rumao; Su, Rongtao; Ma, Pengfei; Wang, Xiaolin; Zhou, Pu; Xu, Xiaojun; Lu, Qisheng

2018-01-01

We report a high power monolithic ytterbium-doped fiber laser oscillator with an output power of 3.05 kW, which is achieved by simultaneous optimizations of the stimulated Raman scattering (SRS) and transverse mode instability (TMI). The optimizations of the SRS are designed and utilized in the construction of the fiber laser oscillator, while the TMI threshold is optimized with the study of the dependence of TMI threshold on the pump distribution. In the fiber laser oscillator, the TMI threshold is enhanced by ˜30% when the counter-pump scheme is employed instead of the co-pump scheme. By applying bidirectional-pump scheme and appropriately distributing the pump power, the TMI threshold is further enhanced and the monolithic fiber laser oscillator achieves an output power of 3.05 kW with near diffraction limited beam quality.

Controlled Velocity Testing of an 8-kW Wind Turbine

Energy Technology Data Exchange (ETDEWEB)

Larwood, S.; Sencenbaugh, J.; Acker, B.

2001-07-31

This paper describes a case study of the controlled-velocity test of an 8-kW wind turbine. The turbine was developed in response to the U.S. Department of Energy's small wind turbine program. As background, the prototype development is discussed. The turbine mechanical and electrical components are described. The turbine was tested on a flatbed truck and driven down an airfield runway at constant relative wind speed. Horizontal furling was used to control over-speed. Various parameters were changed to determine their effects on furling. The testing showed that the machine had insufficient rotor offset for adequate furling. Also, a rotor resonance problem was discovered and remedied. Problems associated with taking the measurements made it difficult to determine if the truck test was a suitable method for code validation. However, qualitative observations gleaned from the testing justified the effort.

Intracranial inertial cavitation threshold and thermal ablation lesion creation using MRI-guided 220-kHz focused ultrasound surgery: preclinical investigation.

Science.gov (United States)

Xu, Zhiyuan; Carlson, Carissa; Snell, John; Eames, Matt; Hananel, Arik; Lopes, M Beatriz; Raghavan, Prashant; Lee, Cheng-Chia; Yen, Chun-Po; Schlesinger, David; Kassell, Neal F; Aubry, Jean-Francois; Sheehan, Jason

2015-01-01

In biological tissues, it is known that the creation of gas bubbles (cavitation) during ultrasound exposure is more likely to occur at lower rather than higher frequencies. Upon collapsing, such bubbles can induce hemorrhage. Thus, acoustic inertial cavitation secondary to a 220-kHz MRI-guided focused ultrasound (MRgFUS) surgery is a serious safety issue, and animal studies are mandatory for laying the groundwork for the use of low-frequency systems in future clinical trials. The authors investigate here the in vivo potential thresholds of MRgFUS-induced inertial cavitation and MRgFUS-induced thermal coagulation using MRI, acoustic spectroscopy, and histology. Ten female piglets that had undergone a craniectomy were sonicated using a 220-kHz transcranial MRgFUS system over an acoustic energy range of 5600-14,000 J. For each piglet, a long-duration sonication (40-second duration) was performed on the right thalamus, and a short sonication (20-second duration) was performed on the left thalamus. An acoustic power range of 140-300 W was used for long-duration sonications and 300-700 W for short-duration sonications. Signals collected by 2 passive cavitation detectors were stored in memory during each sonication, and any subsequent cavitation activity was integrated within the bandwidth of the detectors. Real-time 2D MR thermometry was performed during the sonications. T1-weighted, T2-weighted, gradient-recalled echo, and diffusion-weighted imaging MRI was performed after treatment to assess the lesions. The piglets were killed immediately after the last series of posttreatment MR images were obtained. Their brains were harvested, and histological examinations were then performed to further evaluate the lesions. Two types of lesions were induced: thermal ablation lesions, as evidenced by an acute ischemic infarction on MRI and histology, and hemorrhagic lesions, associated with inertial cavitation. Passive cavitation signals exhibited 3 main patterns identified as

Estimating the cost of saving electricity through U.S. utility customer-funded energy efficiency programs

International Nuclear Information System (INIS)

Hoffman, Ian M.; Goldman, Charles A.; Rybka, Gregory; Leventis, Greg; Schwartz, Lisa; Sanstad, Alan H.; Schiller, Steven

2017-01-01

The program administrator and total cost of saved energy allow comparison of the cost of efficiency across utilities, states, and program types, and can identify potential performance improvements. Comparing program administrator cost with the total cost of saved energy can indicate the degree to which programs leverage investment by participants. Based on reported total costs and savings information for U.S. utility efficiency programs from 2009 to 2013, we estimate the savings-weighted average total cost of saved electricity across 20 states at $0.046 per kilowatt-hour (kW h), comparing favorably with energy supply costs and retail rates. Programs targeted on the residential market averaged $0.030 per kW h compared to $0.053 per kW h for non-residential programs. Lighting programs, with an average total cost of $0.018 per kW h, drove lower savings costs in the residential market. We provide estimates for the most common program types and find that program administrators and participants on average are splitting the costs of efficiency in half. More consistent, standardized and complete reporting on efficiency programs is needed. Differing definitions and quantification of costs, savings and savings lifetimes pose challenges for comparing program results. Reducing these uncertainties could increase confidence in efficiency as a resource among planners and policymakers. - Highlights: • The cost of saved energy allows comparisons among energy resource investments. • Findings from the most expansive collection yet of total energy efficiency program costs. • The weighted average total cost of saved electricity was $0.046 for 20 states in 2009–2013. • Averages in the residential and non-residential sectors were $0.030 and $0.053 per kW h, respectively. • Results strongly indicate need for more consistent, reliable and complete reporting on efficiency programs.

Development program for a 200-kW, cw gyrotron. Quarterly report No. 9, July-September 1981

International Nuclear Information System (INIS)

Tancredi, J.J.; Caplan, M.; Matranga, V.A.; Sandoval, J.J.

1981-01-01

The objective of this program is the design and development of a millimeter-wave device to produce 200 kW of continuous-wave power at 60 GHz. The device, which will be a gyrotron oscillator, will be compatible with power delivery to an electron-cyclotron plasma. Smooth control of rf power output over a 17 dB range is required, and the device should be capable of operation into a severe time-varying rf load mismatch. The superconducting solenoid which had been sent back to the manufacturer because of an open coil, was repaired and returned to Hughes. The gyrotron S/N 1 was successfully operated at a frequency of 59.7 GHz with a power level of 160 kW peak. Diagnostic x-ray measurements of the collector area revealed a reasonable beam power density of 600 W/cm 2 , under worst case conditions of no rf output, and with no auxilary means of spreading the beam. The latter portion of this report period was spent characterizing S/N 1's rf and dc performance and evaluating an anomolous oscillation emitted from the electron gun

rsfMRI effects of KB220Z™ on Neural Pathways in Reward Circuitry of Abstinent Genotyped Heroin Addicts

Science.gov (United States)

Blum, Kenneth; Liu, Yijun; Wang, Wei; Wang, Yarong; Zhang, Yi; Oscar-Berman, Marlene; Smolen, Andrew; Febo, Marcelo; Han, David; Simpatico, Thomas; Cronjé, Frans J; Demetrovics, Zsolt; Gold, Mark S.

2016-01-01

Recently Willuhn et al. reported that cocaine use and even non-substance related addictive behavior, increases, as dopaminergic function is reduced. Chronic cocaine exposure has been associated with decreases in D2/D3 receptors, also associated with lower activation to cues in occipital cortex and cerebellum in a recent PET study from Volkow’s group. Therefore, treatment strategies, like dopamine agonist therapy, that might conserve dopamine function may be an interesting approach to relapse prevention in psychoactive drug and behavioral addictions. To this aim, we evaluated the effect of KB220Z™ on reward circuitry of ten heroin addicts undergoing protracted abstinence, an average 16.9 months. In a randomized placebo-controlled crossover study of KB220Z™ five subjects completed a triple blinded–experiment in which the subject, the person administering the treatment and the person evaluating the response to treatment were blinded as to which treatment any particular subject was receiving. In addition, nine subjects total were genotyped utilizing the GARSRX™ test. We preliminarily report that KB220Z ™ induced an increase in BOLD activation in caudate-accumbens-dopaminergic pathways compared to placebo following one-hour acute administration. Furthermore, KB220Z™ also reduced resting state activity in the putamen of abstinent heroin addicts. In the second phase of this pilot study of all ten abstinent heroin-dependent subjects, three brain regions of interest (ROIs) we observed to be significantly activated from resting state by KB220Z compared to placebo (P addiction by direct or indirect dopaminergic interaction. Due to small sample size, we caution definitive interpretation of these preliminary results and confirmation with additional research and ongoing rodent and human studies of KB220Z, is required. PMID:25526228

A preliminary investigation of 222Rn and 220Rn levels in non-uranium mines in China

International Nuclear Information System (INIS)

Shang Bing; Cui Hongxing; Wu Yunyun; Zhang Qingzhao; Su Xu

2008-01-01

Objective: To measure levels of 222 Rn and 220 Rn in typical non-uranium mines, China, and to estimate dose from the occupational radon exposure in the miners. Methods: Using typical sampling scheme, 44 mines were selected in 12 provinces, which can be classified into 4 categories and 17 types of mines. The radon-thoron discriminative detectors were used to measure 222 Rn and 220 Rn concentrations in mines. Result: The concentration of 222 Rn or 220 Rn was log-normally distributed. The arithmetic mean (AM) concentration and geometric mean (GM) concentration of 222 Rn and 220 Rn in 25 metal mines (n=147) were estimated to be (1211 ±2359) Bq/m 3 (AM) and (311 ± 5.5) Bq/m 3 (GM), and (269 ±700) Bq/m 3 (AM) and (71 ± 4.4)Bq/m 3 (GM), respectively. The mean concentrations of 222 Rn and 220 Rn in 18 non-metal mines (n=118) were (98 ± 207) Bq/m 3 (AM) and(55 ± 2.5) Bq/m 3 (GM), and (60 ± 76) Bq/m 3 (AM) and (38 ± 2.4) Bq/m 3 (GM) respectively. In total, we measured 222 Rn concentration in 44 underground mines, 6 of them, accounted for 15%, with the mean radon concentration exceeding 1000 Bqm -3 (limit of workplace in China). Approximately 7% of radon concentration in mines measured were higher than 3700 Bq/m 3 (current limit in uranium mine in China), some points even exceeded 10 000 Bq/m 3 . Based on this typical measurements, the equilibrium factor for 222 Rn was estimated to be 0.33 ± 0.15 in underground mines and 0.47 ±0.18 in nearby houses. Equilibrium factor for 220 Rn ranged from 0.001 to 0.032. Using the data obtained in this typical survey, the average annual effective dose of underground miners exposed to radon and thoron was estimated to be 8.15 mSv/a. Conclusions: High levels of 222 Rn exists in metal mines, such as copper, tin, lead and zinc, gold, and aluminum mines among others. More study and administrative measures are needed to address the radiation protection of workers occupationally exposed to high radon in mines. (authors)

Development of high average power industrial Nd:YAG laser with peak power of 10 kW class

International Nuclear Information System (INIS)

Kim, Cheol Jung; Kim, Jeong Mook; Jung, Chin Mann; Kim, Soo Sung; Kim, Kwang Suk; Kim, Min Suk; Cho, Jae Wan; Kim, Duk Hyun

1992-03-01

We developed and commercialized an industrial pulsed Nd:YAG laser with peak power of 10 kW class for fine cutting and drilling applications. Several commercial models have been investigated in design and performance. We improved its quality to the level of commercial Nd:YAG laser by an endurance test for each parts of laser system. The maximum peak power and average power of our laser were 10 kW and 250 W, respectively. Moreover, the laser pulse width could be controlled from 0.5 msec to 20 msec continuously. Many optical parts were localized and lowered much in cost. Only few parts were imported and almost 90% in cost were localized. Also, to accellerate the commercialization by the joint company, the training and transfer of technology were pursued in the joint participation in design and assembly by company researchers from the early stage. Three Nd:YAG lasers have been assembled and will be tested in industrial manufacturing process to prove the capability of developed Nd:YAG laser with potential users. (Author)

10 CFR Appendix A1 to Subpart B of... - Uniform Test Method for Measuring the Energy Consumption of Electric Refrigerators and Electric...

Science.gov (United States)

2010-01-01

... equivalent to: ET=(1440 × EP1/T1) + (EP2F − (EPF × T2/T1)) × 12/CTF + (EP2R − (EPR × T3/T1)) × 12/CTR Where 1440, EP1, T1, EP2, 12, and CT are defined in 5.2.1.2 EPF = energy expended in kilowatt-hours during...

Kidins220/ARMS depletion is associated with the neural-to Schwann-like transition in a human neuroblastoma cell line model.

Science.gov (United States)

Rogers, Danny A; Schor, Nina F

2013-03-10

Peripheral neuroblastic tumors exist as a heterogeneous mixture of neuroblastic (N-type) cells and Schwannian stromal (S-type) cells. These stromal cells not only represent a differentiated and less aggressive fraction of the tumor, but also have properties that can influence the further differentiation of nearby malignant cells. In vitro neuroblastoma cultures exhibit similar heterogeneity with N-type and S-type cells representing the neuroblastic and stromal portions of the tumor, respectively, in behavior, morphology, and molecular expression patterns. In this study, we deplete kinase D-interacting substrate of 220kD (Kidins220) with an shRNA construct and thereby cause morphologic transition of the human SH-SY5Y neuroblastoma cell line from N-type to S-type. The resulting cells have similar morphology and expression profile to SH-EP1 cells, a native S-type cell line from the same parent cell line, and to SH-SY5Y cells treated with BrdU, a treatment that induces S-type morphology. Specifically, both Kidins220-deficient SH-SY5Y cells and native SH-EP1 cells demonstrate down-regulation of the genes DCX and STMN2, markers for the neuronal lineage. We further show that Kidins220, DCX and STMN2 are co-down-regulated in cells of S-type morphology generated by methods other than Kidins220 depletion. Finally, we report that the association of low Kidins220 expression with S-type morphology and low DCX and STMN2 expression is demonstrated in spontaneously occurring human peripheral neuroblastic tumors. We propose that Kidins220 is critical in N- to S-type transition of neural crest tumor cells. Copyright © 2013 Elsevier Inc. All rights reserved.

30 CFR 220.020 - Calculation of the allowance for capital recovery.

Science.gov (United States)

2010-07-01

... recovery factor. The negative product of this calculation shall be debited to the NPSL capital account as... the capital recovery factor, and shall be debited to the NPSL capital account as specified in § 220... credits related to any time period after the end of the capital recovery period. ...

Design of current source DC/DC converter and inverter for 2kW fuel cell application

DEFF Research Database (Denmark)

Andreiciks, A.; Steiks, I.; Krievs, O.

2013-01-01

In order to use hydrogen fuel cell in domestic applications either as main power supply or backup power source, the low DC output voltage of the fuel cell has to be matched to the voltage level and frequency of the utility grid AC voltage. The interfacing power converter systems usually consist...... system is designed for interfacing a 2kW proton exchange membrane (PEM) fuel cell....

Monitoring and economics of a 60 kW wind turbine generator on a pig farm in Scotland

International Nuclear Information System (INIS)

Saluja, G.S.

1990-01-01

Low cost monitoring of a 60 kW wind turbine generator connected to an intensive pig farm in the Grampian area of Scotland is described. A method of calculating the economic implications of installing a small grid-connected wind turbine generator at a farm is based on monitored data, electricity bills and energy production is proposed. (author)

Two-dimensional 220 MHz Fourier transform EPR imaging

International Nuclear Information System (INIS)

Placidi, Giuseppe; Brivati, John A.; Alecci, Marcello; Testa, Luca; Sotgiu, Antonello

1998-01-01

In the last decade radiofrequency continuous-wave EPR spectrometers have been developed to detect and localize free radicals in vivo. Only recently, pulsed radiofrequency EPR spectrometers have been described for imaging applications with small samples. In the present work, we show the first two-dimensional image obtained at 220 MHz on a large phantom (40 ml) that simulates typical conditions of in vivo EPR imaging. This pulsed EPR apparatus has the potential to make the time required for three-dimensional imaging compatible with the biological half-life of normally used paramagnetic probes. (author)

Power train analysis for the DOE/NASA 100-kW wind turbine generator

Science.gov (United States)

Seidel, R. C.; Gold, H.; Wenzel, L. M.

1978-01-01

Progress in explaining variations of power experienced in the on-line operation of a 100 kW experimental wind turbine-generator is reported. Data are presented that show the oscillations tend to be characteristic of a wind-driven synchronous generator because of low torsional damping in the power train, resonances of its large structure, and excitation by unsteady and nonuniform wind flow. The report includes dynamic analysis of the drive-train torsion, the generator, passive driveline damping, and active pitch control as well as correlation with experimental recordings. The analysis assumes one machine on an infinite bus with constant generator-field excitation.

Instalación solar fotovoltaica -20 Kw para conexión a red

OpenAIRE

Sacristán Benito, Silvia

2014-01-01

Este TFG trata sobre el diseño de una instalación de generación eléctrica de una potencia nominal de 20 kW mediante paneles fotovoltaicos. Estos paneles se situarán sobre la cubierta de una nave industrial en la localidad de Soria. Toda la energía producida será vertida a la red eléctrica de baja tensión, abasteciendo al entorno cercano. Se describe, el funcionamiento de una instalación de este tipo, en la cual el componente más destacado es el panel fotovoltaico, que genera...

20 CFR 627.220 - Coordination with programs under title IV of the Higher Education Act including the Pell grant...

Science.gov (United States)

2010-04-01

... the Higher Education Act including the Pell grant program. 627.220 Section 627.220 Employees' Benefits... of the Higher Education Act including the Pell grant program. (a) Coordination. Financial assistance programs under title IV of the Higher Education Act of 1965, as amended (HEA) (the Pell Grant program, the...

Design of the 50 kW neutron converter for SPIRAL2 facility

Energy Technology Data Exchange (ETDEWEB)

Avilov, M.S. [Budker Institute of Nuclear Physics, 630090 Novosibirsk, SB RAS (Russian Federation); Tecchio, L.B., E-mail: tecchio@lnl.infn.i [Laboratori Nazionali di Legnaro, 35020 Legnaro (Italy); Titov, A.T. [Boreskov Institute of Catalysis, 630090 Novosibirsk, SB RAS (Russian Federation); Tsybulya, V.S. [Trofimuk Institute of Geology, 630090 Novosibirsk, SB RAS (Russian Federation); Zhmurikov, E.I. [Budker Institute of Nuclear Physics, 630090 Novosibirsk, SB RAS (Russian Federation)

2010-06-21

SPIRAL2 is a facility for the study of fundamental nuclear physics and multidisciplinary research. SPIRAL2 represents a major advance for research on exotic nuclei. The radioactive ion beam (RIB) production system is comprised of a neutron converter, a target and an ion source. This paper is dedicated to the designing of the 50 kW neutron converter for the SPIRAL2 facility. Among the different variants of the neutron converter, the one based on a rotating solid disk seems quite attractive due to its safety, ease in production and relatively low cost. Dense graphite used as the converter's material allows the production of high-intensity neutron flux and, at the same time, the heat removal from the converter by means of radiation cooling. Thermo-mechanical simulations performed in order to determine the basic geometry and physical characteristics of the neutron production target for SPIRAL2 facility, to define the appropriate beam power distribution, and to predict the target behaviour under the deuteron beam of nominal parameters (40 MeV, 1.2 mA, 50 kW) are presented. To study the main physical and mechanical properties and serviceability under operating conditions, several kinds of graphite have been analyzed and tested. The paper reports the results of such measurements. Radiation damage is the most important issue for the application of graphite as neutron converter. It is well known that the thermal conductivity of the neutron-irradiated graphite is reduced by a factor of 10 from the initial value after irradiation. Difference in volume expansions between the matrix and the fiber results in serious damage of neutron-irradiated C/C composites. Calculations showed that at high temperature the effect of neutron radiation is not so critical and that the change in thermal conductivity does not prevent the use of graphite as neutron converter.

Design of the 50 kW neutron converter for SPIRAL2 facility

International Nuclear Information System (INIS)

Avilov, M.S.; Tecchio, L.B.; Titov, A.T.; Tsybulya, V.S.; Zhmurikov, E.I.

2010-01-01

SPIRAL2 is a facility for the study of fundamental nuclear physics and multidisciplinary research. SPIRAL2 represents a major advance for research on exotic nuclei. The radioactive ion beam (RIB) production system is comprised of a neutron converter, a target and an ion source. This paper is dedicated to the designing of the 50 kW neutron converter for the SPIRAL2 facility. Among the different variants of the neutron converter, the one based on a rotating solid disk seems quite attractive due to its safety, ease in production and relatively low cost. Dense graphite used as the converter's material allows the production of high-intensity neutron flux and, at the same time, the heat removal from the converter by means of radiation cooling. Thermo-mechanical simulations performed in order to determine the basic geometry and physical characteristics of the neutron production target for SPIRAL2 facility, to define the appropriate beam power distribution, and to predict the target behaviour under the deuteron beam of nominal parameters (40 MeV, 1.2 mA, 50 kW) are presented. To study the main physical and mechanical properties and serviceability under operating conditions, several kinds of graphite have been analyzed and tested. The paper reports the results of such measurements. Radiation damage is the most important issue for the application of graphite as neutron converter. It is well known that the thermal conductivity of the neutron-irradiated graphite is reduced by a factor of 10 from the initial value after irradiation. Difference in volume expansions between the matrix and the fiber results in serious damage of neutron-irradiated C/C composites. Calculations showed that at high temperature the effect of neutron radiation is not so critical and that the change in thermal conductivity does not prevent the use of graphite as neutron converter.

Controller for the Machine-Side Power Converter of a 2kW Switched Reluctance Motor; Controlador del Convertidor Electronico de Potencia Lado Maquina de un Motor de Reluctancia Variable de 2kW

Energy Technology Data Exchange (ETDEWEB)

Vazquez, C.

2006-07-01

The ACE2 project deals with the development of a kynetic energy storage (KES) system for power peak shaving in high speed railway substations. This KES system consists in a double power converter which drives a switched reluctance machine (SRM) along with a flywheel operating in a wide speed range. This document presents from a technical point of view the features of the controller for the machine-side power converter of a 2kW SRM prototype. Hardware and software issues are treated in detail. (Author)

Controller for the Machine-Side Power Converter of a 2kW Switched Reluctance Motor; Controlador del Convertidor Electronico de Potencia Lado Red de un Motor de Reluctancia Variable de 2kW

Energy Technology Data Exchange (ETDEWEB)

Vazquez, C.

2006-12-19

The ACE2 project deals with the development of a kynetic energy storage (KES) system for power peak shaving in high speed railway substations. This KES system consists in a double power converter which drives a switched reluctance machine (SRM) along with a flywheel operating in a wide speed range. This document presents from a technical point of view the features of the controller for the machine-side power converter of a 2kW SRM prototype. Hardware and software issues are treated in detail. (Author)

20 CFR 220.27 - What is needed to show an impairment.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false What is needed to show an impairment. 220.27... is needed to show an impairment. A physical or mental impairment must result from anatomical... diagnostic techniques. A physical or mental impairment must be established by medical evidence consisting of...

Laser cutting of steel plates up to 100 mm in thickness with a 6-kW fiber laser for application to dismantling of nuclear facilities

Science.gov (United States)

Shin, Jae Sung; Oh, Seong Yong; Park, Hyunmin; Chung, Chin-Man; Seon, Sangwoo; Kim, Taek-Soo; Lee, Lim; Lee, Jonghwan

2018-01-01

A cutting study with a high-power ytterbium-doped fiber laser was conducted for the dismantling of nuclear facilities. Stainless steel and carbon steel plates of various thicknesses were cut at a laser power of 6-kW. Despite the use of a low output of 6-kW, the cutting was successful for both stainless steel and carbon steel plates of up to 100 mm in thickness. In addition, the maximum cutting speeds against the thicknesses were obtained to evaluate the cutting performance. As representative results, the maximum cutting speeds for a 60-mm thickness were 72 mm/min for the stainless steel plates and 35 mm/min for the carbon steel plates, and those for a 100-mm thickness were 7 mm/min for stainless steel and 5 mm/min for carbon steel plates. These results show an efficient cutting capability of about 16.7 mm by kW, whereas other groups have shown cutting capabilities of ∼10 mm by kW. Moreover, the maximum cutting speeds were faster for the same thicknesses than those from other groups. In addition, the kerf widths of 60-mm and 100-mm thick steels were also obtained as another important parameter determining the amount of secondary waste. The front kerf widths were ∼1.0 mm and the rear kerf widths were larger than the front kerf widths but as small as a few millimeters.

Gas and liquid sampling for closed canisters in KW Basin - Work Plan

International Nuclear Information System (INIS)

Pitkoff, C.C.

1995-01-01

Work Plan for the design and fabrication of gas/liquid sampler for closed canister sampling in KW Basin. This document defines the tasks associated with the design, fabrication, assembly, and acceptance testing equipment necessary for gas and liquid sampling of the Mark I and Mark II canisters in the K-West basin. The sampling of the gas space and the remaining liquid inside the closed canisters will be used to help understand any changes to the fuel elements and the canisters. Specifically, this work plan will define the scope of work and required task structure, list the technical requirements, describe design configuration control and verification methodologies, detail quality assurance requirements, and present a baseline estimate and schedule

Thermodynamic design of 10 kW Brayton cryocooler for HTS cable

Science.gov (United States)

Chang, Ho-Myung; Park, C. W.; Yang, H. S.; Sohn, Song Ho; Lim, Ji Hyun; Oh, S. R.; Hwang, Si Dole

2012-06-01

Thermodynamic design of Brayton cryocooler is presented as part of an ongoing governmental project in Korea, aiming at 1 km HTS power cable in the transmission grid. The refrigeration requirement is 10 kW for continuously sub-cooling liquid nitrogen from 72 K to 65 K. An ideal Brayton cycle for this application is first investigated to examine the fundamental features. Then a practical cycle for a Brayton cryocooler is designed, taking into account the performance of compressor, expander, and heat exchangers. Commercial software (Aspen HYSYS) is used for simulating the refrigeration cycle with real fluid properties of refrigerant. Helium is selected as a refrigerant, as it is superior to neon in thermodynamic efficiency. The operating pressure and flow rate of refrigerant are decided with a constraint to avoid the freezing of liquid nitrogen

46 CFR 130.220 - Design of equipment for cooking and heating.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Design of equipment for cooking and heating. 130.220... Design of equipment for cooking and heating. (a) Doors on each cooking appliance must be provided with heavy-duty hinges and locking-devices to prevent accidental opening in heavy weather. (b) Each cooking...

30 CFR 220.015 - Pricing of materiel purchases, transfers, and dispositions.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Pricing of materiel purchases, transfers, and... CONTINENTAL SHELF OIL AND GAS LEASES § 220.015 Pricing of materiel purchases, transfers, and dispositions. (a... shall be priced under the provisions for tubular goods pricing in paragraph (a)(2)(i)(A) of this section...

3C 220.3: A Radio Galaxy Lensing a Submillimeter Galaxy

NARCIS (Netherlands)

Haas, Martin; Leipski, Christian; Barthel, Peter; Wilkes, Belinda J.; Vegetti, Simona; Bussmann, R. Shane; Willner, S. P.; Westhues, Christian; Ashby, Matthew L. N.; Chini, Rolf; Clements, David L.; Fassnacht, Christopher D.; Horesh, Assaf; Klaas, Ulrich; Koopmans, Léon V. E.; Kuraszkiewicz, Joanna; Lagattuta, David J.; Meisenheimer, Klaus; Stern, Daniel; Wylezalek, Dominika

2014-01-01

Herschel Space Observatory photometry and extensive multiwavelength follow-up have revealed that the powerful radio galaxy (PRG) 3C 220.3 at z = 0.685 acts as a gravitational lens for a background submillimeter galaxy (SMG) at z = 2.221. At an observed wavelength of 1 mm, the SMG is lensed into

Attached, unattached fraction of progeny concentrations and equilibrium factor for dose assessments from {sup 222}Rn and {sup 220}Rn

Energy Technology Data Exchange (ETDEWEB)

Singh, Parminder; Saini, Komal; Bajwa, Bikramjit Singh [Guru Nanak Dev University, Department of Physics, Amritsar, Punjab (India); Mishra, Rosaline; Sahoo, Bijay Kumar [Bhabha Atomic Research Centre, Radiological Physics and Advisory Division, Mumbai (India)

2016-08-15

In this study, measurements of indoor radon ({sup 222}Rn), thoron ({sup 220}Rn) and their equilibrium equivalent concentration (EEC) were carried out in 96 dwellings from 22 different villages situated in Hamirpur district, Himachal Pradesh, India, by using LR-115 type II-based pinhole twin cup dosimeters and deposition-based progeny sensors (DRPS/DTPS). The annual average indoor {sup 222}Rn and {sup 220}Rn concentrations observed in these dwellings were 63.82 and 89.59 Bq/m{sup 3}, respectively, while the average EEC (attached + unattached) for {sup 222}Rn and {sup 220}Rn was 29.28 and 2.74 Bq/m{sup 3}. For {sup 222}Rn (f{sub Rn}) and {sup 220}Rn (f{sub Tn}), the average values of unattached fraction were 0.11 and 0.09, respectively. The equilibrium factors for radon (F{sub Rn}) and thoron (F{sub Tn}) varied from 0.12 to 0.77 with an average of 0.50, and from 0.01 to 0.34 with an average of 0.05, respectively. The annual inhalation dose due to mouth and nasal breathing was calculated using dose conversion factors and unattached fractions. The indoor annual effective doses for {sup 222}Rn (AEDR) and {sup 220}Rn (AEDT) were found to be 1.92 and 0.83 mSv a{sup -1}, respectively. The values of {sup 222}Rn/{sup 220}Rn concentrations and annual effective doses obtained in the present study are within the safe limits as recommended by the International Commission on Radiological Protection for indoor dwelling exposure conditions. (orig.)

Designing and overproducing a tandem epitope of gp350/220 that shows a potential to become an EBV vaccine

Directory of Open Access Journals (Sweden)

Widodo

2018-03-01

Full Text Available Background: Epstein-Barr virus (EBV can cause cancer in people from around the world. There is no EBV vaccine available for use on a global scale. However, emerging evidence suggests that the epitope on the gp350/220 capsid protein may be developed into an EBV vaccine. Nevertheless, the production of small, single epitope is challenging of stability issues and possible alteration of peptide structure. In this study, a tandem epitope was developed consisting of three single epitopes, aimed to improve stability, antigenicity and preserve epitope structure. Materials and methods: A tandem epitope was designed using bioinformatics based on the epitope structure of the gp350/220 protein. The tandem epitope structure was analyzed using a protein folding method with Abalone software, which was further refined via YASARA force field and molecular repairing using a FoldX method. Immunogenicity was examined with Epitopia software, whereas allergen properties were tested using AlgPred. The pattern of the tandem epitope binding with anti-gp350/220 antibodies was performed using Z-dock and snugDock. The tandem epitope was then overproduced in E. coli strain BL21 as a host cell. Result: Our model demonstrated a successfully designed and overproduced tandem epitope. The tandem epitope demonstrated a similar structure compared with the epitope of whole protein gp350/220. Our epitope also demonstrated non-allergen and antigenicity properties, and possessed antibody binding patterns consistent with whole protein gp350/220. Conclusion and recommendation: These data suggest a novel tandem epitope composed of three similar epitopes demonstrates antigenicity, structure, and binding properties consistent with whole protein gp350/220. We also demonstrate successful production of the tandem epitope using E. coli strain BL21 as a host. Future in vivo experimental animal research is necessary to test the ability of this tandem epitope to stimulate antibody production

Distinction of [220] and [204] textures of Cu(In,Ga)Se{sub 2} film and their growth behaviors depending on substrate nature and Na incorporation

Energy Technology Data Exchange (ETDEWEB)

Cho, Dae-Hyung, E-mail: dhcho@etri.re.kr [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Kim, Jeha [Department of Solar & Energy Engineering, Cheongju University, 298 Daeseongro, Sangdang-gu, Cheongju, Chungbuk 360-764 (Korea, Republic of); Chung, Yong-Duck [IT Components and Materials Industry Technology Research Department, Electronics and Telecommunications Research Institute (ETRI), 218 Gajeongno, Yuseong-gu, Daejeon 305-700 (Korea, Republic of); Korea University of Science and Technology (UST), 217 Gajeongno, Yuseong-gu, Daejeon 305-350 (Korea, Republic of)

2015-08-31

For better understanding of the structural property of polycrystalline tetragonal Cu(In,Ga)Se{sub 2} (CIGS) thin films grown on soda-lime glass, it is necessary to characterize the [220]- and [204]-oriented textures clearly that are related to the different physical properties. However, the distinction between the [220]- and [204]-oriented textures is very difficult because of their nearly identical plane spacings and atomic arrangements. Using X-ray diffraction techniques of high resolution θ–2θ scanning and reciprocal space mapping, we distinguished the [220]- and [204]-oriented textures of CIGS films and observed that the behaviors of [220] and [204] textures independently depended on both substrate nature and Na presence. We report the Na- and substrate-related dependence of the physical properties of the CIGS film was attributed to the independent growth behaviors of the [220] and [204] textures in the CIGS. - Highlights: • We investigated [220]- and [204]-oriented textures of Cu(In,Ga)Se{sub 2} (CIGS) films. • X-ray diffraction methods distinguished two textures. • The growth behaviors were influenced by underlying substrate and Na. • The [220] and [204] textures in CIGS should be differentially observed.

42 CFR 484.220 - Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and...

Science.gov (United States)

2010-10-01

... address changes to the case-mix that are a result of changes in the coding or classification of different...-day episode payment rate for case-mix and area wage levels. 484.220 Section 484.220 Public Health... Calculation of the adjusted national prospective 60-day episode payment rate for case-mix and area wage levels...

20 CFR 220.57 - Types of purchased examinations and selection of sources.

Science.gov (United States)

2010-04-01

... RAILROAD RETIREMENT ACT DETERMINING DISABILITY Consultative Examinations § 220.57 Types of purchased examinations and selection of sources. (a) Additional evidence needed for disability determination. The types... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Types of purchased examinations and selection...

Diverse IgG serum response to novel glycopeptide epitopes detected within immunodominant stretches of Epstein-Barr virus glycoprotein 350/220

DEFF Research Database (Denmark)

D'Arrigo, Isotta; Cló, Emiliano; Bergström, Tomas

2013-01-01

/220 and demonstrate a remarkable variability between individual samples with respect to their reactivity patterns to peptides and glycopeptides. The study provides additional insights into the complex B-cell response towards the EBV gp350/220 envelope protein, which may have implications for diagnostic and vaccine...

30 CFR 250.220 - If I propose activities in the Alaska OCS Region, what planning information must accompany the EP?

Science.gov (United States)

2010-07-01

... Region, what planning information must accompany the EP? 250.220 Section 250.220 Mineral Resources... activities in the Alaska OCS Region, what planning information must accompany the EP? If you propose exploration activities in the Alaska OCS Region, the following planning information must accompany your EP: (a...

An SCR inverter with an integral battery charger for electric vehicles

Science.gov (United States)

Thimmeach, D.

1983-01-01

The feasibility of incorporating an onboard battery charger into the inverter previously developed under a NASA contract is successfully demonstrated. The rated output power of the resulting isolated battery charger is 3.6 kW at 220 Vac with an 86 percent efficiency and a 95 percent power factor. Also achieved are improved inverter efficiency (from 90 to 93 percent at 15 kW motor shaft power), inverter peak power capability (from 26 to 34 kW), and reduced weight and volume of the combined inverter/charger package (47 kg, 49 x 44 x 24 cm). Some major conclusions are that using the inverter commutation circuitry to perform the battery charging function is advantageous, and that the input-commutated thyristor inverter has the potential to be an excellent inverter and battery charger for use in electric vehicle applications.

Assessment of 25 kW free-piston Stirling technology alternatives for solar applications

Science.gov (United States)

Erbeznik, Raymond M.; White, Maurice A.; Penswick, L. B.; Neely, Ronald E.; Ritter, Darren C.; Wallace, David A.

1992-01-01

The final design, construction, and testing of a 25-kW free-piston advanced Stirling conversion system (ASCS) are examined. The final design of the free-piston hydraulic ASCS consists of five subsystems: heat transport subsystem (solar receiver and pool boiler), free-piston hydraulic Stirling engine, hydraulic subsystem, cooling subsystem, and electrical and control subsystem. Advantages and disadvantages are identified for each technology alternative. Technology alternatives considered are gas bearings vs flexure bearings, stationary magnet linear alternator vs moving magnetic linear alternator, and seven different control options. Component designs are generated using available in-house procedures to meet the requirements of the free-piston Stirling convertor configurations.

Performance and Potential Study of 10kW Wind Turbine Generator for 6 Cities in Malaysia

OpenAIRE

Mustaqimah Mustaqimah

2013-01-01

ABSTRACT. This study presents an analysis of the optimization by using HOMER software and financial viability of 10 kW wind turbine generator (WTG) through grid connected system for six different locations in Malaysia (Mersing, Kuching, K.Trengganu, Kudat, Melaka and Labuan). Assessment criteria comprised Total Net Present Cost (TNPC), and Cost of Energy ( COE ). The HOMER ( National Renewable Energy laboratory, US) was utilized as the assessment tool with modeling performed with hourly load ...

Development program for a 200 kW, CW gyrotron. Quarterly report No. 4, April-June 1980

International Nuclear Information System (INIS)

Tancredi, J.J.; Caplan, M.; Sandoval, J.J.; Weiss, W.

1980-01-01

The objective of this program is the design and development of a millimeter-wave device to produce 200 kW of continuous-wave power at 60 GHz. The device, which will be a gyrotron oscillator, will be compatible with power delivery to an electron-cyclotron plasma. Smooth control of rf power output over a 17 db range is required, and the device should be capable of operation into a severe time-varyinng rf load mismatch

Adaptive Environmentally Contained Power and Cooling IT Infrastructure for the Data Center

Energy Technology Data Exchange (ETDEWEB)

Mann, Ron; Chavez, Miguel, E.

2012-06-27

The objectives of this program were to research and develop a fully enclosed Information Technology (IT) rack system for 100 kilowatts (KW) of IT load that provides its own internal power and cooling with High Voltage Alternating Current (HVAC defined as 480 volt) and chilled water as the primary inputs into the system and accepts alternative energy power sources such as wind and solar. For maximum efficiency, internal power to the IT equipment uses distributed High Voltage Direct Current power (HVDC defined as 360-380 volt) from the power source to the IT loads. The management scheme aggressively controls energy use to insure the best utilization of available power and cooling resources. The solution incorporates internal active management controls that not only optimizes the system environment for the given dynamic IT loads and changing system conditions, but also interfaces with data center Building Management Systems (BMS) to provide a complete end-to-end view of power and cooling chain. This technology achieves the goal of a Power Usage Effectiveness (PUE) of 1.25, resulting in a 38% reduction in the total amount of energy needed to support a 100KW IT load compared to current data center designs.

Colorado State University: A Midscale Market Solar Customer Case Study

Energy Technology Data Exchange (ETDEWEB)

Holm, Alison [National Renewable Energy Lab. (NREL), Golden, CO (United States); Chernyakhovskiy, Ilya [National Renewable Energy Lab. (NREL), Golden, CO (United States)

2016-12-01

Despite substantial increases in solar photovoltaic (PV) deployment between 2005 and 2015, a large untapped market for solar PV deployment still exists in midscale market investments by universities. Recent estimates show that if all universities in the United States installed enough solar PV to meet 25% of their annual electricity consumption, this would cumulatively result in just over 16 gigawatts (GW) of additional installed PV capacity. Within this context, midscale market projects - loosely defined as solar PV installations ranging from 100 kilowatts (kW) to 2 megawatts (MW), but more broadly representing installations not captured in the residential or utility-scale sectors - could be an attractive option for universities. This case study focuses on one university solar customer, Colorado State University (CSU), to provide a detailed example of the challenges, solutions, and opportunities associated with university solar power procurement. Between 2009 and 2015, a combined 6,754 kW of both ground-mounted and rooftop solar PV was installed across multiple CSU campuses in Fort Collins, Colorado. This case study highlights CSU's decision-making process, campus engagement strategies, and relationships with state, local, and utility partners, which have culminated in significant on-campus PV deployment.

Vibration monitoring and fault diagnostics of a 45 kW motor

International Nuclear Information System (INIS)

Hafeez, T.; Ahmed, A.; Chohan, G.Y.

2003-01-01

Overheating, high noise and vibrations were observed in a 45 kW induction motor of a chilled water pump in an air conditioning plant. The vibration amplitudes along with phase angles were obtained with the help of a data collector. The vibration spectra obtained was further analyzed to diagnose the problem. The user had reported high vibrations in motor since the day of its installation. The frequency peaks and phase data has revealed the possibility of structural resonance, and misalignment in rotor bearing assembly. The problem of eccentric housing bore on non-drive end NDE that resulted in the misalignment of motor shaft in housing assembly. The spectra and phase data is presented and discussed to diagnose the motor problems. The re-monitoring of motor after rectification of manufacturing fault has confirmed the right diagnoses. (author)

Combined Heat and Power Systems Technology Development and Demonstration 370 kW High Efficiency Microturbine

Energy Technology Data Exchange (ETDEWEB)

none,

2015-10-14

The C370 Program was awarded in October 2010 with the ambitious goal of designing and testing the most electrically efficient recuperated microturbine engine at a rated power of less than 500 kW. The aggressive targets for electrical efficiency, emission regulatory compliance, and the estimated price point make the system state-of-the-art for microturbine engine systems. These goals will be met by designing a two stage microturbine engine identified as the low pressure spool and high pressure spool that are based on derivative hardware of Capstone’s current commercially available engines. The development and testing of the engine occurred in two phases. Phase I focused on developing a higher power and more efficient engine, that would become the low pressure spool which is based on Capstone’s C200 (200kW) engine architecture. Phase II integrated the low pressure spool created in Phase I with the high pressure spool, which is based on Capstone’s C65 (65 kW) commercially available engine. Integration of the engines, based on preliminary research, would allow the dual spool engine to provide electrical power in excess of 370 kW, with electrical efficiency approaching 42%. If both of these targets were met coupled with the overall CHP target of 85% total combined heating and electrical efficiency California Air Resources Board (CARB) level emissions, and a price target of $600 per kW, the system would represent a step change in the currently available commercial generation technology. Phase I of the C370 program required the development of the C370 low pressure spool. The goal was to increase the C200 engine power by a minimum of 25% — 250 kW — and efficiency from 32% to 37%. These increases in the C200 engine output were imperative to meet the power requirements of the engine when both spools were integrated. An additional benefit of designing and testing the C370 low pressure spool was the possibility of developing a stand-alone product for possible

Design of the 3.7 GHz, 500 kW CW circulator for the LHCD system of the SST-1 tokamak

Energy Technology Data Exchange (ETDEWEB)

Dixit, Harish V., E-mail: hvdixit48@yahoo.com [Veermata Jijabai Technological Institute, Mumbai, Maharashtra 400019 (India); Jadhav, Aviraj R. [Veermata Jijabai Technological Institute, Mumbai, Maharashtra 400019 (India); Jain, Yogesh M. [Institute for Plasma Research, Gandhinagar, Gujarat 382428 (India); Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094 (India); Cheeran, Alice N. [Veermata Jijabai Technological Institute, Mumbai, Maharashtra 400019 (India); Gupta, Vikas [Vidyavardhini' s College of Engineering and Technology, Vasai, Maharashtra 401202 (India); Sharma, P.K. [Institute for Plasma Research, Gandhinagar, Gujarat 382428 (India); Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400094 (India)

2017-06-15

Highlights: • Design of a 500 kW CW circulator for LHCD system at 3.7 GHz. • Mechanism for thermal management of ferrite tile. • Scheme for uniform magnetisation of the ferrite tiles. • Design of high CW power CW quadrature and 180 ° hybrid coupler. - Abstract: Circulators are used in high power microwave systems to protect the vacuum source against reflection. The Lower Hybrid Current Drive (LHCD) system of SST-1 tokamak commissioned at IPR, Gandhinagar in India comprises of four high power circulators to protect klystrons (supplying 500 kW CW each at 3.7 GHz) which power the system. This paper presents the design of a Differential Phase Shift Circulator (DPSC) capable of handling 500 kW CW power at 3.7 GHz so that four circulators can be used to protect the four available klystrons. As the DPSC is composed by three main components, viz., magic tee, ferrite phase shifter and 3 dB hybrid coupler, the designing of each of the proposed components is described. The design of these components is carried out factoring various multiphysics aspects of RF, heating due to high CW power and magnetic field requirement of the ferrite phase shifter. The primary objective of this paper is to present the complete RF, magnetic and thermal design of a high CW power circulator. All the simulations have been carried out in COMSOL Multiphysics. The designed circulator exhibits an insertion loss of 0.13 dB with a worst case VSWR of 1.08:1. The total length of the circulator is 3 m.

Metal membrane-type 25-kW methanol fuel processor for fuel-cell hybrid vehicle

Science.gov (United States)

Han, Jaesung; Lee, Seok-Min; Chang, Hyuksang

A 25-kW on-board methanol fuel processor has been developed. It consists of a methanol steam reformer, which converts methanol to hydrogen-rich gas mixture, and two metal membrane modules, which clean-up the gas mixture to high-purity hydrogen. It produces hydrogen at rates up to 25 N m 3/h and the purity of the product hydrogen is over 99.9995% with a CO content of less than 1 ppm. In this fuel processor, the operating condition of the reformer and the metal membrane modules is nearly the same, so that operation is simple and the overall system construction is compact by eliminating the extensive temperature control of the intermediate gas streams. The recovery of hydrogen in the metal membrane units is maintained at 70-75% by the control of the pressure in the system, and the remaining 25-30% hydrogen is recycled to a catalytic combustion zone to supply heat for the methanol steam-reforming reaction. The thermal efficiency of the fuel processor is about 75% and the inlet air pressure is as low as 4 psi. The fuel processor is currently being integrated with 25-kW polymer electrolyte membrane fuel-cell (PEMFC) stack developed by the Hyundai Motor Company. The stack exhibits the same performance as those with pure hydrogen, which proves that the maximum power output as well as the minimum stack degradation is possible with this fuel processor. This fuel-cell 'engine' is to be installed in a hybrid passenger vehicle for road testing.

Cool computers in a bunker. 10 000 kW of cold demand for 160 000 internet computers; Coole Rechner im Bunker. 10 000 kW Kaeltebedarf fuer 160 000 Internetrechner

Energy Technology Data Exchange (ETDEWEB)

Klein, S. [Combitherm GmbH, Stuttgart-Fellbach (Germany)

2007-06-15

In 2005, Combitherm GmbH of Stuttgart-Fellbach, a producer of refrigerators and heat pumps specializing in customized solutions, was given an unusual order as 1 and 1 Internet AG, one of the world's biggest internet providers, was looking for a cooling concept for their new central computer system near Baden-Baden, which was to become a central node in international data transmission. Combitherm already had experience with cold water units and free cooling elements in the 5000 kW range for a big computer center. The tasks were defined in close cooperation with the customer and with a Karlsruhe bureau of engineering consultants, and a refrigerating concept was developed. (orig.)

29 CFR 1472.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness...

Science.gov (United States)

2010-07-01

... 29 Labor 4 2010-07-01 2010-07-01 false By when must I publish my drug-free workplace statement and establish my drug-free awareness program? 1472.220 Section 1472.220 Labor Regulations Relating to Labor (Continued) FEDERAL MEDIATION AND CONCILIATION SERVICE GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements...

Performance of calcium manganate as oxygen carrier in chemical looping combustion of biochar in a 10 kW pilot

International Nuclear Information System (INIS)

Schmitz, Matthias; Linderholm, Carl Johan

2016-01-01

Highlights: • A manganese-based perovskite material was used as oxygen carrier in chemical looping combustion. • The oxygen carrier’s performance was superior to materials previously tested in this reactor throughout the testing period. • Under stable conditions, oxygen demand was as low as 2.1% with a carbon capture efficiency of up to 98%. • No signs of agglomeration were detected. • Gaseous oxygen was released at all relevant fuel reactor temperatures. - Abstract: Chemical looping combustion (CLC) and chemical looping with oxygen uncoupling (CLOU) are carbon capture technologies which achieve gas separation by means of cycling oxidation and reduction of a solid oxygen carrier. In this study, the performance and CLOU properties of an oxygen carrier with perovskite structure, CaMn_0_._9Mg_0_._1O_3_−_δ_, were investigated in a 10 kW pilot. The fuel consisted of biochar with very low sulphur content. Around 37 h of operation with fuel were carried out in the 10 kW chemical looping combustor. Previous operational experience in this unit has been achieved using different natural minerals as oxygen carrier – mainly ilmenite and manganese ore. Parametric studies performed in this work included variation of fuel flow, solids circulation rate, temperature and fluidization gas in the fuel reactor. The oxygen carrier was exposed to a total 73 h of hot fluidization (T > 600 °C). No hard particle agglomerations were formed during the experiments. An oxygen demand as low as 2.1% could be reached under stable operating conditions, with a carbon capture efficiency of up to 98%. CLOU properties were observed at all fuel reactor temperatures, ensuring stable operation even without steam as gasification agent present in the fuel reactor. The results suggest that CaMn_0_._9Mg_0_._1O_3_−_δ is suitable for the use as oxygen carrier in chemical looping combustion of solid biochar and offers higher gas conversion than previously tested materials without CLOU

Measurement of charged particle yields from PMMA irradiated by a 220 MeV/u12Cbeam

CERN Document Server

Piersanti, L; Bini, FU. Rome La Sapienza (main); Collamati, F; De Lucia, E; Durante, M; Faccini, R; Ferroni, F; Fiore, S; Iarocci, E; La Tessa, C; Marafini, M; Mattei, I; Patera, V; Ortega, P G; Sarti, A; Schuy, C; Sciubba, A; Vanstalle, M; Voena, C

2014-01-01

The radiation used in hadrontherapy treatments interacts with the patient body producing secondary particles, either neutral or charged, that can be used for dose and Bragg peak monitoring and to provide a fast feedback on the treatment plans. Recent results obtained from the authors on simplified setups (mono-energetic primary beams interacting with homogeneous tissue like target) have already indicated the correlation that exists between the flux of these secondaries coming from the target (e.g. protons and photons) and the position of the primary beam Bragg peak. In this paper, the measurements of charged particle fluxes produced by the interaction of a 220 MeV/u carbon ion beam at GSI, Darmstadt, with a polymethyl methacrylate target are reported. The emission region of protons (p), deuterons (d) and tritons (t) has been characterized using a drift chamber while the particle time-of-flight, used to compute the kinetic energy spectra, was measured with a LYSO scintillator.The energy released in the LYSO cr...

B220 analysis with the local lymph node assay: proposal for a more flexible prediction model.

Science.gov (United States)

Betts, Catherine J; Dearman, Rebecca J; Kimber, Ian; Ryan, Cindy A; Gerberick, G Frank; Lalko, Jon; Api, Anne Marie

2007-01-01

The mouse local lymph node assay (LLNA) has been developed and validated for the identification of chemicals that have the potential to induce skin sensitisation. In common with other predictive test methods the accuracy of the LLNA is not absolute and experience has revealed that a few chemicals, including for instance a minority of skin irritants, may elicit false-positive reactions in the assay. To improve further the performance of the LLNA, and to eliminate or reduce false-positives, there has been interest in an adjunct method in which the ability of chemicals to cause increases in the frequency of B220(+) lymphocytes in skin-draining lymph nodes is measured. Previous studies suggest that the use of B220 analyses aligned with the standard LLNA may serve to distinguish further between contact allergens and skin irritants. In the original predictive model, chemicals were regarded as being skin sensitisers if they were able to induce a 1.25-fold or greater increase in the percentage of B220(+) cells within lymph nodes compared with concurrent vehicle controls. Although this first prediction model has proven useful, in the light of more recent experience, and specifically as a consequence of some variability observed in the frequency of B220(+) lymphocytes in nodes taken from vehicle control-treated animals, it is timely now to reconsider and refine the model. As a result a new prediction model is proposed in which reliance on the use of absolute thresholds is reduced, and in which small changes in control values can be better accommodated. (c) 2007 John Wiley & Sons, Ltd.

Cleanup Verification Package for the 100-K-55:1 and 100-K-56:1 Pipelines and the 116-KW-4 and 116-KE-5 Heat Recovery Stations

International Nuclear Information System (INIS)

Capron, J.M.

2005-01-01

This cleanup verification package documents completion of remedial action for the 100-K-55:1 and 100-K-56:1 reactor cooling effluent underground pipelines and for the 116-KW-4 and 116-KE-5 heat recovery stations. The 100-K-55 and 100-K-56 sites consisted of those process effluent pipelines that serviced the 105-KW and 105-KE Reactors. This cleanup verification package documents completion of remedial action for the 100-K-55: 1 and 100-K-56: 1 reactor cooling effluent underground pipelines, referred to herein as the 100-K-55:1 and 100-K-56:l sites, as well as for the 116-KW-4 and 116-KE-5 heat recovery stations, referred to herein as the 116-KW-4 and 116-KE-5 sites. The 116-KW-4 and 116-KE-5 heat recovery stations were co-located and remediated with the 100-K-55:1 and 100-K-56:1 pipelines, respectively. These sites are located in the 100-KR-2 Operable Unit in the 100-K Area of the Hanford Site in southeastern Washington State. The 100-K-55 and 100-K-56 sites consisted of those process effluent pipelines that serviced the 105-KW and 105-KE Reactors, respectively. Both of these sites have been administratively divided into subunits based on the current extent of remediation. Portions of the pipelines remaining within the reactor security fencing and in proximity to active utility features have been delineated as the 100-K-55:2 and 100-K-56:2 pipelines, with the portions of the pipelines excluded from these boundaries identified as the 100-K-55:1 and 100-K-56:1 pipelines. This cleanup verification package addresses only the 100-K-55:1 and 100-K-56:I subunits; the 100-K-55:2 and 100-K-56:2 subunits will be addressed within a separate cleanup verification package. Site excavation and waste disposal are complete, and the exposed surfaces have been sampled and analyzed to verify attainment of the remedial action goals. Results of the sampling, laboratory analyses, and data evaluations for the 100-K-55:1, 100-K-56:1, 116-KW-4, and 116-KE-5 sites indicate that all remedial