WorldWideScience

Sample records for kobus vardonii livingstone

  1. Detection of Babesia spp. in free-ranging Pukus, Kobus vardonii, on a game ranch in Zambia.

    Science.gov (United States)

    Munang'andu, Hetron Mweemba; Munyeme, Musso; Nambota, Andrew Mubila; Nalubamba, King Shimumbo; Siamudaala, Victor M

    2011-12-01

    Babesia spp. were detected from 4 asymptomatic pukus captured on a game ranch in central Zambia in October 2008. Blood smears were examined in 4 species of aymptomatic free-ranging antelopes, namely the puku (Kobus vordanii), reedbuck (Redunca arundinum), bushbuck (Tragelaphus sylvaticus), and kudu (Tragelaphus strepsiceros), and showed the presence of Babesia parasites only in the puku. In the puku, the prevalence of babesiosis was estimated at 33.3% (n = 12), while the overall prevalence in all examined animals was 8.5% (n = 47). The parasites showed morphological characteristics of paired ring-like stages with the length varying between 1.61 µm and 3.02 µm (mean = 2.12 µm, n = 27; SD = 0.76 µm). Both the infected and non-infected pukus showed good body condition scores (BCS), while the dominant tick species detected from all animals were Rhipicephalus appendiculatus, Rhipicephalus spp., and Boophilus spp. To our knowledge this is the first report of Babesia spp. infection in pukus in Zambia. These findings suggest that wildlife could play an important role in the epidemiology of babesiosis in Zambia.

  2. Current status of Uganda Kob (Kobus Kob Thomasi Neumann) in ...

    African Journals Online (AJOL)

    Current status of Uganda Kob (Kobus Kob Thomasi Neumann) in Toro Game Reserve, Uganda. ... As part of a biological assessment of Toro Game Reserve, the status of Uganda kob Kobus kob Thomasi ... AJOL African Journals Online.

  3. populations de Cobe defassa (kobus ellypsiprimnus defassa ...

    African Journals Online (AJOL)

    PR BOKO

    defassa (kobus ellypsiprimnus defassa, Ruppell) population in Pendjari's biosphere park in. Benin. Among the demographic factors that characterize a given population figure priority knowledge of its workforce over time and its distribution in space. This study is conducted in order to assess the relevance of two methods of ...

  4. David Livingstone's uvulectomy.

    Science.gov (United States)

    Larner, A J

    2006-05-01

    In April 1852 in Cape Town, South Africa, Dr David Livingstone, then 39 years of age and yet to commence the explorations of Africa which would bring him to public attention, underwent the surgical procedure of uvulectomy. This article reviews the history of Livingstone's uvulectomy and its indications and outcome, as documented by his own writings. The practice of uvulectomy in indigenous African societies and some contemporary ideas about uvulectomy are also considered in order to try to ascertain why Livingstone elected to undergo this procedure.

  5. ARC Code TI: Livingstone2

    Data.gov (United States)

    National Aeronautics and Space Administration — Livingstone2 is a reusable artificial intelligence (AI) software system designed to assist spacecraft, life support systems, chemical plants or other complex systems...

  6. The Livingstone Model of a Main Propulsion System

    Science.gov (United States)

    Bajwa, Anupa; Sweet, Adam; Korsmeyer, David (Technical Monitor)

    2003-01-01

    Livingstone is a discrete, propositional logic-based inference engine that has been used for diagnosis of physical systems. We present a component-based model of a Main Propulsion System (MPS) and say how it is used with Livingstone (L2) in order to implement a diagnostic system for integrated vehicle health management (IVHM) for the Propulsion IVHM Technology Experiment (PITEX). We start by discussing the process of conceptualizing such a model. We describe graphical tools that facilitated the generation of the model. The model is composed of components (which map onto physical components), connections between components and constraints. A component is specified by variables, with a set of discrete, qualitative values for each variable in its local nominal and failure modes. For each mode, the model specifies the component's behavior and transitions. We describe the MPS components' nominal and fault modes and associated Livingstone variables and data structures. Given this model, and observed external commands and observations from the system, Livingstone tracks the state of the MPS over discrete time-steps by choosing trajectories that are consistent with observations. We briefly discuss how the compiled model fits into the overall PITEX architecture. Finally we summarize our modeling experience, discuss advantages and disadvantages of our approach, and suggest enhancements to the modeling process.

  7. A Cellular Universe: Douglas Livingstone's Collected Poems, A ...

    African Journals Online (AJOL)

    The publication of Douglas Livingstone's collected poems enables readers to see that his skill and control of his craft grew in strength and scope over the nearly forty years of his publishing career. Enriched by the inclusion of many hitherto unpublished poems, A Ruthless Fidelity reveals equally that certain features of ...

  8. Super Refractory Status Epilepticus: A Case Report from Livingstone ...

    African Journals Online (AJOL)

    Case History: A 22 years old male nursing student with first episode of generalized tonic clonic seizures brought into the medical emergency of Livingstone Central Hospital. He was treated with 60mg of diazepam but fits continued and patient was transferred to ICU, where he was treated with phenobarbitone infusion with ...

  9. Radioactive concentrations of the Livingston Island soils (Antarctica). Dosimetry considerations

    Energy Technology Data Exchange (ETDEWEB)

    Baeza, A; Rio, M del; Paniagua, J M [Facultad de Veterinaria, Ctra. de Trujillo, Caceres (Spain); Navarro, E; Rodriguez, M J; Sanchez, F [Centro Mixto Univ. de Valencia (Spain). Inst. de Fisica Corpuscular

    1994-06-01

    The radioactive concentrations of natural and man-made ([sup 90]Sr and [sup 137]Cs) emitters were studied in soil samples collected from an area of 2.3 km[sup 2] around the Spanish Antarctic Base on Livingston Island in the South Shetlands. The levels of radiation detected, for natural radioisotopes, as well as consequently the measured levels of effective dose equivalent rate, are of the order of half the values commonly assigned as world averages for these magnitudes. (Author).

  10. 78 FR 27856 - Golden Nematode; Removal of Regulated Areas in Livingston and Steuben Counties, NY

    Science.gov (United States)

    2013-05-13

    .... APHIS-2012-0079] Golden Nematode; Removal of Regulated Areas in Livingston and Steuben Counties, NY... nematode regulations by removing areas in Livingston and Steuben Counties in New York from the list of... nematode, and we determined that regulation of these areas was no longer necessary. As a result of that...

  11. 78 FR 1713 - Golden Nematode; Removal of Regulated Areas in Livingston and Steuben Counties, NY

    Science.gov (United States)

    2013-01-09

    ...-0079] Golden Nematode; Removal of Regulated Areas in Livingston and Steuben Counties, NY AGENCY: Animal... are amending the golden nematode regulations by removing areas in Livingston and Steuben Counties in... areas in these two counties are free of golden nematode, and we have determined that regulation of these...

  12. BILIRUBIN CONCENTRATIONS IN CLINICALLY HEALTHY AND DISEASED CAPTIVE WATERBUCK (KOBUS ELLIPSIPRYMNUS) AT THE SAN DIEGO ZOO SAFARI PARK.

    Science.gov (United States)

    Sadler, Ryan A; Lamberski, Nadine; Christopher, Mary M

    2016-06-01

    Captive waterbuck ( Kobus ellipsiprymnus ) that appear clinically healthy have been noted to have high serum bilirubin concentrations compared with other ruminants; however, questions remain about the physiologic factors affecting bilirubin concentration and its potential association with underlying disease and icteric serum or mucous membranes. Serum bilirubin concentrations of healthy and diseased waterbuck housed at the San Diego Zoo Safari Park from 1989 to 2012 were retrospectively analyzed to determine any link between icteric serum, total bilirubin concentration (tBili), and disease entities in this species. Total bilirubin and direct (dBili) bilirubin concentrations and the prevalence of icteric serum were compared by subspecies, age group, and health status; associations with complete blood count and biochemical results and clinical diagnosis were assessed. No significant differences were found in tBili or dBili between Ellipsen (n = 32) and Defassa (n = 29) subspecies or in juveniles (n = 22) versus adults (n = 39). Clinically healthy waterbuck (n = 40) had significantly higher tBili (mean ± 2SD, 7.9 ± 1.2 mg/dl; P bilirubin (2.2-6.2 mg/dl). These results suggest healthy waterbuck have relatively high tBili and dBili compared with related species. Icteric serum may be seen in up to 15% of healthy animals in the absence of icteric tissues.

  13. Monitoring the endangered population of the antelope Kobus leche smithemani (Artiodactyla: Bovidae, in the Bangweulu ecosystem, Zambia

    Directory of Open Access Journals (Sweden)

    Victor M. Siamudaala

    2012-12-01

    Full Text Available Black lechwe (Kobus leche smithemani is a semi-aquatic medium sized antelope currently enlisted on the IUCN red list of endangered species and is only endemic to the Bangweulu basin of Zambia. Its population has significantly decreased due to floods that took place during the period 1930-1940 from over 250 000-15 000 leading the Zambian government to gazette all habitats of Black lechwe into state protected areas, and to establish urgent management strategies needed to save the remaining population from extinction. Using retrospective data, our findings show that the population has increased from 15 000 animals in 1954 to 55 632 in 2009. The current population is estimated at 34.77% (55 632/160 000 of the carrying capacity of the Bangweulu basin. Although the Black lechwe is one of the 42 species offered for consumptive utilization by the Zambia Wildlife Authority (ZAWA, only 0.12% and 0.08% of the current stock was offered for safari and resident hunting annually for the period 2005-2009, respectively. Annual quota utilization were estimated at 67% (n=37 and 81% (n=37 for safari and resident hunting, respectively. Hence, overall income obtained from utilization of Black lechwe is very low accounting for only 2.1% of the total revenue earned from wildlife utilization. Although the current population trend is showing a unit increase of 639 animals per year, it is still far below levels ideal for the lucrative utilization. In this study, we demonstrate that adverse ecological changes on wildlife species, can lead to their vulnerability and danger of extinction, and that their recovery to full carrying capacity may demand a considerable amount of time

  14. Evaluation of a butorphanol, detomidine, and midazolam combination for immobilization of captive Nile lechwe antelopes (Kobus magaceros).

    Science.gov (United States)

    Laricchiuta, Pietro; De Monte, Valentina; Campolo, Marco; Grano, Fabio; Iarussi, Fabrizio; Crovace, Antonio; Staffieri, Francesco

    2012-07-01

    Field immobilization of captive antelope may be required for medical examination, blood sample collection, and animal identification. The aim of this study was to evaluate the effects of a combination of butorphanol, detomidine, and midazolam (BDM) and its partial reversibility in Nile lechwe antelope (Kobus megaceros). Nine captive lechwes, weighing 28-64 kg, were immobilized, in February 2011, with butorphanol 0.20 ± 0.05 (mean ± SD) mg/kg, detomidine 0.20 ± 0.05 mg/kg, and midazolam 0.31 ± 0.08 mg/kg administered intramuscularly (IM) with a blowpipe. Physiologic parameters and depth of anesthesia were recorded when the animals became recumbent at 19.55 ± 8.36 min after darting (T0) and after 10 (T10), 20 (T20), and 30 (T30) min. An arterial blood sample was collected at T20. At the end of the procedures, immobilization was partially reversed with atipamezole 0.25 mg/kg IM. Quality of induction, immobilization, and recovery was scored. The BDM combination induced immobilization and lateral recumbency in 13.44 ± 5.61 min. Median induction score (scored 1 [excellent] to 4 [poor]) was 1 (range 1-2). Heart rate varied 40-104 beats/min, respiratory rate 16-108 breaths/min, and rectal temperature 36.5-40.3 C. Hyperthermia was observed and rapidly treated in three animals that demonstrated insufficient immobilization after darting. Arterial blood gas analyses revealed a mean pH of 7.43 ± 0.07, partial arterial pressure of CO(2) of 44.1 ± 6.0 mmHg, partial arterial pressure of O(2) of 74.0 ± 13.5 mmHg, and an arterial O(2) saturation of 94.77 ± 3.96%. Recovery was smooth and animals were walking in 13.44 ± 7.85 min. Median recovery score (1 = excellent to 4 = poor) was 1 (range 1-2). The BDM was effective in immobilizing captive healthy lechwes with minimal cardiorespiratory changes.

  15. Monitoring the endangered population of the antelope Kobus leche smithemani (Artiodactyla: Bovidae, in the Bangweulu ecosystem, Zambia

    Directory of Open Access Journals (Sweden)

    Victor M. Siamudaala

    2012-12-01

    Full Text Available Black lechwe (Kobus leche smithemani is a semi-aquatic medium sized antelope currently enlisted on the IUCN red list of endangered species and is only endemic to the Bangweulu basin of Zambia. Its population has significantly decreased due to floods that took place during the period 1930-1940 from over 250 000-15 000 leading the Zambian government to gazette all habitats of Black lechwe into state protected areas, and to establish urgent management strategies needed to save the remaining population from extinction. Using retrospective data, our findings show that the population has increased from 15 000 animals in 1954 to 55 632 in 2009. The current population is estimated at 34.77% (55 632/160 000 of the carrying capacity of the Bangweulu basin. Although the Black lechwe is one of the 42 species offered for consumptive utilization by the Zambia Wildlife Authority (ZAWA, only 0.12% and 0.08% of the current stock was offered for safari and resident hunting annually for the period 2005-2009, respectively. Annual quota utilization were estimated at 67% (n=37 and 81% (n=37 for safari and resident hunting, respectively. Hence, overall income obtained from utilization of Black lechwe is very low accounting for only 2.1% of the total revenue earned from wildlife utilization. Although the current population trend is showing a unit increase of 639 animals per year, it is still far below levels ideal for the lucrative utilization. In this study, we demonstrate that adverse ecological changes on wildlife species, can lead to their vulnerability and danger of extinction, and that their recovery to full carrying capacity may demand a considerable amount of timeEl lechwe negro (Kobus leche smithemani es un antílope semi-acuático de tamaño medio que en la actualidad se encuentra en la lista roja de la UICN de especies en peligro de extinción y sólo es endémica de la cuenca del Bangweulu de Zambia. Su población ha disminuido considerablemente, de más de

  16. The socio-economic impact of stroke on households in Livingstone ...

    African Journals Online (AJOL)

    The World Health Organization (WHO) defines stroke as 'the neurological deficit of cerebral vascular cause that persists beyond twenty four hours or is interrupted by death within 24 hours'. In Livingstone, Zambia, more than 30% of stroke victims indicate socio-economic problems. The study aimed at assessing the ...

  17. The Socio‑economic Impact of Stroke on Households in Livingstone ...

    African Journals Online (AJOL)

    The Socio‑economic Impact of Stroke on Households in Livingstone District, Zambia: A Cross‑sectional Study. ... Annals of Medical and Health Sciences Research ... socio‑economic burden of the disease in terms of its impacts on the individual, family and community both directly and indirectly in Sub‑Sahara Africa region ...

  18. Livingston Parish Landfill Methane Recovery Project (Feasibility Study)

    Energy Technology Data Exchange (ETDEWEB)

    White, Steven

    2012-11-15

    The Woodside Landfill is owned by Livingston Parish, Louisiana and is operated under contract by Waste Management of Louisiana LLC. This public owner/private operator partnership is commonplace in the solid waste industry today. The landfill has been in operation since approximately 1988 and has a permitted capacity of approximately 41 million cubic yards. Based on an assumed in-place waste density of 0.94 ton per cubic yard, the landfill could have an expected design capacity of 39.3 million tons. The landfill does have an active landfill gas collection and control system (LFGCCS) in place because it meets the minimum thresholds for the New Source Performance Standards (NSPS). The initial LFGCS was installed prior to 2006 and subsequent phases were installed in 2007 and 2010. The Parish received a grant from the United States Department of Energy in 2009 to evaluate the potential for landfill gas recovery and utilization at the Woodside Landfill. This includes a technical and economic feasibility study of a project to install a landfill gas to energy (LFGTE) plant and to compare alternative technologies. The LFGTE plant can take the form of on-site electrical generation, a direct use/medium Btu option, or a high-Btu upgrade technology. The technical evaluation in Section 2 of this report concludes that landfill gas from the Woodside landfill is suitable for recovery and utilization. The financial evaluations in sections 3, 4, and 5 of this report provide financial estimates of the returns for various utilization technologies. The report concludes that the most economically viable project is the Electricity Generation option, subject to the Parish’s ability and willingness to allocate adequate cash for initial capital and/or to obtain debt financing. However, even this option does not present a solid return: by our estimates, there is a 19 year simple payback on the electricity generation option. All of the energy recovery options discussed in this report

  19. Effect of Livingstone Potato ( N.E.Br on Diabetes and Its Complications in Streptozotocin Induced Diabetes in Rats

    Directory of Open Access Journals (Sweden)

    Chinedum Ogbonnaya Eleazu

    2014-10-01

    Full Text Available BackgroundThe effect of livingstone potato (Plectranthus esculenthus N.E.Br on diabetes and its complications in Streptozotocin induced diabetic rats was investigated. The duration of the experiment was 4 weeks.MethodsThe blood glucose level of the rats was measured with a glucometer, the protein and glucose and specific gravity in the urine samples of the rats were measured using urine assay strips and urinometer respectively. The liver and kidney function parameters in the serum of the rats were determined using Biosystem Kits.ResultsThe diabetic rats given livingstonepotato incorporated feeds, had 129.7% decrease in their hyperglycemia with corresponding amelioration of their elevated urinary protein, sugars, specific gravity, renal growth, liver growth as well as 15.64% decrease in body weights compared with the nondiabetic rats that had 5.54% decrease in blood glucose and 20.39% increase in body weight unlike the diabetic control rats that had 18.34% decrease in blood glucose and 52.68% decrease in body weight. There were significant differences (P0.05 in the relative heart weights of all the rats in the three different groups. In terms of liver and kidney function parameters, values obtained for the diabetic rats given livingstone potato incorporated feeds were not significantly different from that of the nondiabetic rats except for total bilurubin, aspartate transaminase, and creatinine (P>0.05 while they were significantly different from the values obtained for the diabetic control rats (P<0.05. In addition, the serum amylase of the diabetic control rats were significantly higher (P<0.05 than that of the nondiabetic and diabetic rats treated with livingstone potato incorporated feeds.ConclusionResults show the antidiabetic actions of livingstone potato and its ability to ameliorate glomerular complication and liver hypertrophy in diabetics.

  20. An automatic DI-flux at the Livingston Island geomagnetic observatory, Antarctica: requirements and lessons learned

    Science.gov (United States)

    Marsal, Santiago; José Curto, Juan; Torta, Joan Miquel; Gonsette, Alexandre; Favà, Vicent; Rasson, Jean; Ibañez, Miquel; Cid, Òscar

    2017-07-01

    The DI-flux, consisting of a fluxgate magnetometer coupled with a theodolite, is used for the absolute manual measurement of the magnetic field angles in most ground-based observatories worldwide. Commercial solutions for an automated DI-flux have recently been developed by the Royal Meteorological Institute of Belgium (RMI), and are practically restricted to the AutoDIF and its variant, the GyroDIF. In this article, we analyze the pros and cons of both instruments in terms of its suitability for installation at the partially manned geomagnetic observatory of Livingston Island (LIV), Antarctica. We conclude that the GyroDIF, even if it is less accurate and more power demanding, is more suitable than the AutoDIF for harsh conditions due to the simpler infrastructure that is necessary. Power constraints in the Spanish Antarctic Station Juan Carlos I (ASJI) during the unmanned season require an energy-efficient design of the thermally regulated box housing the instrument as well as thorough power management. Our experiences can benefit the geomagnetic community, which often faces similar challenges.

  1. An automatic DI-flux at the Livingston Island geomagnetic observatory, Antarctica: requirements and lessons learned

    Directory of Open Access Journals (Sweden)

    S. Marsal

    2017-07-01

    Full Text Available The DI-flux, consisting of a fluxgate magnetometer coupled with a theodolite, is used for the absolute manual measurement of the magnetic field angles in most ground-based observatories worldwide. Commercial solutions for an automated DI-flux have recently been developed by the Royal Meteorological Institute of Belgium (RMI, and are practically restricted to the AutoDIF and its variant, the GyroDIF. In this article, we analyze the pros and cons of both instruments in terms of its suitability for installation at the partially manned geomagnetic observatory of Livingston Island (LIV, Antarctica. We conclude that the GyroDIF, even if it is less accurate and more power demanding, is more suitable than the AutoDIF for harsh conditions due to the simpler infrastructure that is necessary. Power constraints in the Spanish Antarctic Station Juan Carlos I (ASJI during the unmanned season require an energy-efficient design of the thermally regulated box housing the instrument as well as thorough power management. Our experiences can benefit the geomagnetic community, which often faces similar challenges.

  2. Patch-occupancy survey of elephant (Loxodonta africana surrounding Livingstone, Zambia

    Directory of Open Access Journals (Sweden)

    David A. Youldon

    2017-01-01

    Full Text Available Wild elephants represent the biggest human–wildlife conflict issue in Livingstone, Zambia. However, little is known about their movements. This survey investigated elephants’ habitat use outside a core protected and fenced zone that forms part of Mosi-oa-Tunya National Park, Zambia. Using ‘patch-occupancy’ methodology, indications of elephant presence (feeding behaviour, dung and tracks were surveyed. The survey aimed to assist proposed future monitoring exercises by defining the geographical extent that should be considered to improve accuracy in species abundance estimates. Results were supplemented using collected indications of elephant presence from prior monitoring exercises, and during this survey. Elephant presence was confirmed up to 8 km from the boundary of the protected core habitat, focussed in: (1 an unfenced zone of the national park, (2 along a road leading from the national park to the Dambwa Forest to the north and (3 along two rivers located to the west (Sinde River and east (Maramba River of the core area. Detection probability of elephant presence was high using these methods, and we recommend regular sampling to determine changes in habitat use by elephants, as humans continue to modify land-use patterns. Conservation implications: Identification of elephant ranging behaviour up to 8 km outside of the Mosi-oa-Tunya National Park in southern Zambia will assist in managing human– elephant conflict in the area, as well as in assessing this seasonal population’s abundance.

  3. Recent evolution of the overall radioactive levels in the ice of Livingston Island (Antarctica)

    Energy Technology Data Exchange (ETDEWEB)

    Baeza, A.; Del Rio, L.M.; Jimenez, A.; Miro, C.; Paniagua, J.M. [Universidad de Extremadura, Caceres (Spain). Departamento de Fisica; Navarro, E. [IFIC, Facutad de Fisicas, Valencia (Spain)

    1996-08-01

    A study was carried out of the physico-chemical characteristics of the different layers of ice to a depth of 8.32 m in the Hurd glacier on Livingston Island in the South Shetland archipelago (Antartica). No dependence on depth was observed for the pH, dry residue, or the concentrations of Ca{sup 2+}, Mg{sup 2+}, and K{sup +} ions. The only dependence observed was a systematic increase in density from 05 to 0.85 g cm{sup -3} due to the greater compaction of the deeper layers. The mean annual mass balance was determined by two methods; localization of the ashes emitted by a volcano on Deception Island and by means of a {sup 210}Pb dating method. The result in both cases was a value of 0.24 kg m{sup -2} kg m{sup -2} yr{sup -1}, which allowed us to date different layers of ice sampled. The mean annual {sup 210}Pb fallout was determined to be 1.9 Bq m{sup -2} yr{sup -1}. While no systematic variations in total {beta} activity were observed with depth, they were observed for total {alpha} and residual {beta} activities in the said ice layers. (Author).

  4. Recent evolution of the overall radioactive levels in the ice of Livingston Island (Antarctica)

    International Nuclear Information System (INIS)

    Baeza, A.; Del Rio, L.M.; Jimenez, A.; Miro, C.; Paniagua, J.M.

    1996-01-01

    A study was carried out of the physico-chemical characteristics of the different layers of ice to a depth of 8.32 m in the Hurd glacier on Livingston Island in the South Shetland archipelago (Antartica). No dependence on depth was observed for the pH, dry residue, or the concentrations of Ca 2+ , Mg 2+ , and K + ions. The only dependence observed was a systematic increase in density from 05 to 0.85 g cm -3 due to the greater compaction of the deeper layers. The mean annual mass balance was determined by two methods; localization of the ashes emitted by a volcano on Deception Island and by means of a 210 Pb dating method. The result in both cases was a value of 0.24 kg m -2 kg m -2 yr -1 , which allowed us to date different layers of ice sampled. The mean annual 210 Pb fallout was determined to be 1.9 Bq m -2 yr -1 . While no systematic variations in total β activity were observed with depth, they were observed for total α and residual β activities in the said ice layers. (Author)

  5. CEDEX research activities in Antarctica. Aquatic ecosystems in Byers Peninsula (Livingston Island, maritime Antarctica)

    International Nuclear Information System (INIS)

    Toro, M.; Quesada, A.; Camacho, A.; Oliva, M.; Alcami, A.; Antoniades, D.; Banon, M.; Fassnacht, S.; Fernandez-Valiente, E.; Galan, L.; Giralt, S.; Granados, I.; Justel, A.; Liu, E. J.; Lopez-Bravo, A.; Martinez-Cortizas, A.; Pla-Rabes, S.; Rastrojo, A.; Rico, E.; Rochera, C.; Van de Vijver, B.; Velazquez, D.; Villaescusa, J. A.; Vicent, W. F.

    2015-01-01

    Since 2001 CEDEX has taken part in many Antarctic joint research projects with different institutions from Spain and other countries, developing scientific activities in the International Camp of Byers Peninsular (Livingston Island, South Shetland Islands, Antarctica). This place was designed as an Antarctic Specially Protected Area (No.126) because the importance and value of its terrestrial and aquatic habitats. It is one of the largest ice-free areas of maritime Antarctica, with the highest diversity of environments and geological, hydrological and biological processes in the whole region, all of them in a pristine state. Byers Peninsula is considered the most significant limnological area in the Antarctic Peninsula region because it hosts a high number of lakes, ponds and streams, with an exceptional fauna and flora diversity, including the most singular, representative or endemic Antarctic species. Furthermore, the lakes sedimentary record is one of the widest and complete archives in Antarctic Peninsula region for the palaeocological and climatic study of the Holocene. Because Byers Peninsula is an Antarctic biodiversity hotspot, and it is located in one of the areas in the Earth where global warming is being more significant, it must be considered as a suitable international reference site for limnetic, terrestrial and coastal studies, and long term monitoring programmes. (Author)

  6. Role of Snow Deposition of Perfluoroalkylated Substances at Coastal Livingston Island (Maritime Antarctica).

    Science.gov (United States)

    Casal, Paulo; Zhang, Yifeng; Martin, Jonathan W; Pizarro, Mariana; Jiménez, Begoña; Dachs, Jordi

    2017-08-01

    Perfluoroalkyl substances (PFAS) are ubiquitous in the environment, including remote polar regions. To evaluate the role of snow deposition as an input of PFAS to Maritime Antarctica, fresh snow deposition, surface snow, streams from melted snow, coastal seawater, and plankton samples were collected over a three-month period (December 2014-February 2015) at Livingston Island. Local sources of PFASs were significant for perfluoroalkyl sulfonates (PFSAs) and C7-14 perfluoroalkyl carboxylates (PFCAs) in snow but limited to the transited areas of the research station. The concentrations of 14 ionizable PFAS (∑PFAS) in freshly deposited snow (760-3600 pg L -1 ) were 1 order of magnitude higher than those in background surface snow (82-430 pg L -1 ). ∑PFAS ranged from 94 to 420 pg L -1 in seawater and from 3.1 to 16 ng g dw -1 in plankton. Ratios of individual PFAS concentrations in freshly deposited snow relative to surface snow (C SD /C Snow ), snowmelt (C SD /C SM ), and seawater (C SD /C SW ) were close to 1 (from 0.44 to 1.4) for all perfluorooctanesulfonate (PFOS) isomers, suggesting that snowfall does not contribute significantly to PFOS in seawater. Conversely, these ratios for PFCAs ranged from 1 to 33 and were positively correlated with the number of carbons in the PFCA alkylated chain. These trends suggest that snow deposition, scavenging sea-salt aerosol bound PFAS, plays a role as a significant input of PFCAs to the Maritime Antarctica.

  7. Leifsonia psychrotolerans sp. nov., a psychrotolerant species of the family Microbacteriaceae from Livingston Island, Antarctica.

    Science.gov (United States)

    Ganzert, Lars; Bajerski, Felizitas; Mangelsdorf, Kai; Lipski, André; Wagner, Dirk

    2011-08-01

    A cold-tolerant, yellow-pigmented, Gram-positive, motile, facultatively anaerobic bacterial strain, LI1(T), was isolated from a moss-covered soil from Livingston Island, Antarctica, near the Bulgarian station St. Kliment Ohridski. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Leifsonia kafniensis KFC-22(T), Leifsonia pindariensis PON10(T) and Leifsonia antarctica SPC-20(T), with which it showed sequence similarities of 99.0, 97.9 and 97.9 %, respectively. DNA-DNA hybridization revealed a reassociation value of 2.7 % with L. kafniensis LMG 24362(T). The DNA G+C content of strain LI1(T) was 64.5 mol%. The growth temperature range was -6 to 28 °C, with optimum growth at 16 °C. Growth occurred in 0-5 % NaCl and at pH 4.5-9.5, with optimum growth in 1-2 % NaCl and at pH 5.5-6.5. The predominant fatty acids were anteiso-C(15 : 0), C(18 : 0) and iso-C(15 : 0). The polar lipids were phosphatidylglycerol and diphosphatidylglycerol. Physiological and biochemical tests clearly differentiated strain LI1(T) from L. kafniensis. Therefore, a novel cold-tolerant species within the genus Leifsonia is proposed: Leifsonia psychrotolerans sp. nov. (type strain LI1(T) = DSM 22824(T) = NCCB 100313(T)).

  8. The Socio-economic Impact of Stroke on Households in Livingstone District, Zambia: A Cross-sectional Study.

    Science.gov (United States)

    Mapulanga, M; Nzala, S; Mweemba, C

    2014-07-01

    Stroke is the leading cause of adult disability. Stroke, which affects mostly the productive age group, leaves about 65% of its victims disabled, leads to increased loss of manpower both at individual and national levels. Little is known about the socio-economic burden of the disease in terms of its impacts on the individual, family and community both directly and indirectly in Sub-Sahara Africa region and Zambia at large. The study was aimed at assessing the socio-economic impact of stroke households in Livingstone district, Zambia. A total of 50 households were randomly selected from the registers of Livingstone General Hospital. Self-administered questionnaires and focus group discussions were used to collect quantitative and qualitative data respectively. The data was analyzed using Statistical Package for Social Sciences version 16 (IBM Corporation) and content analysis. Chi-square test was used to make associations between variables. The social impacts on the victim were depression, difficult to get along with, resentfulness, apathy, needy, separation, divorce, general marital problems, neglect on the part of the victim and fear. The economic impacts were loss of employment, reduced business activity and loss of business on the part of the victim. Economic activities such as food provision, payment of school fees, accommodation were affected as a result of stroke and this led to financial insecurities in households with lost incomes in form of salaries and businesses. The activities forgone by stroke households were food provision, housing and education. The study also revealed an association between period of stroke and relationship changes (P < 0.001). Gender and family relationship changes were highly associated (P < 0.00), as more females than males experienced relationship changes. The results of the present study show that stroke has considerable socio-economic impact on households in Livingstone district, which can deter the victims' development as

  9. Targeting condom distribution at high risk places increases condom utilization-evidence from an intervention study in Livingstone, Zambia

    Directory of Open Access Journals (Sweden)

    Sandøy Ingvild

    2012-01-01

    Full Text Available Abstract Background The PLACE-method presumes that targeting HIV preventive activities at high risk places is effective in settings with major epidemics. Livingstone, Zambia, has a major HIV epidemic despite many preventive efforts in the city. A baseline survey conducted in 2005 in places where people meet new sexual partners found high partner turnover and unprotected sex to be common among guests. In addition, there were major gaps in on-site condom availability. This study aimed to assess the impact of a condom distribution and peer education intervention targeting places where people meet new sexual partners on condom use and sexual risk taking among people socializing there. Methods The 2005 baseline survey assessed the presence of HIV preventive activities and sexual risk taking in places where people meet new sexual partners in Livingstone. One township was selected for a non-randomised intervention study on condom distribution and peer education in high risk venues in 2009. The presence of HIV preventive activities in the venues during the intervention was monitored by an external person. The intervention was evaluated after one year with a follow-up survey in the intervention township and a comparison township. In addition, qualitative interviews and focus group discussions were conducted. Results Young people between 17-32 years of age were recruited as peer educators, and 40% were females. Out of 72 persons trained before the intervention, 38 quit, and another 11 had to be recruited. The percentage of venues where condoms were reported to always be available at least doubled in both townships, but was significantly higher in the intervention vs. the control venues in both surveys (84% vs. 33% in the follow-up. There was a reduction in reported sexual risk taking among guests socializing in the venues in both areas, but reporting of recent condom use increased more among people interviewed in the intervention (57% to 84% than in the

  10. Targeting condom distribution at high risk places increases condom utilization-evidence from an intervention study in Livingstone, Zambia.

    Science.gov (United States)

    Sandøy, Ingvild Fossgard; Zyaambo, Cosmas; Michelo, Charles; Fylkesnes, Knut

    2012-01-05

    The PLACE-method presumes that targeting HIV preventive activities at high risk places is effective in settings with major epidemics. Livingstone, Zambia, has a major HIV epidemic despite many preventive efforts in the city. A baseline survey conducted in 2005 in places where people meet new sexual partners found high partner turnover and unprotected sex to be common among guests. In addition, there were major gaps in on-site condom availability. This study aimed to assess the impact of a condom distribution and peer education intervention targeting places where people meet new sexual partners on condom use and sexual risk taking among people socializing there. The 2005 baseline survey assessed the presence of HIV preventive activities and sexual risk taking in places where people meet new sexual partners in Livingstone. One township was selected for a non-randomised intervention study on condom distribution and peer education in high risk venues in 2009. The presence of HIV preventive activities in the venues during the intervention was monitored by an external person. The intervention was evaluated after one year with a follow-up survey in the intervention township and a comparison township. In addition, qualitative interviews and focus group discussions were conducted. Young people between 17-32 years of age were recruited as peer educators, and 40% were females. Out of 72 persons trained before the intervention, 38 quit, and another 11 had to be recruited. The percentage of venues where condoms were reported to always be available at least doubled in both townships, but was significantly higher in the intervention vs. the control venues in both surveys (84% vs. 33% in the follow-up). There was a reduction in reported sexual risk taking among guests socializing in the venues in both areas, but reporting of recent condom use increased more among people interviewed in the intervention (57% to 84%) than in the control community (55% to 68%). It is likely that the

  11. “Symptoms, Attitudes and Treatment Choices Surrounding Menopause among the Q’eqchi Maya of Livingston, Guatemala”

    Science.gov (United States)

    Michel, Joanna L.; Veliz, Mario; Soejarto, Doel D.; Caceres, Armando; Mahady, Gail B

    2006-01-01

    The present study explored symptoms, attitudes and treatments surrounding women’s health and menopause among the Q’eqchi Maya of the eastern tropical lowlands of Guatemala. Data were obtained through participant observation, semi-structured interviews, focus groups and plant walks with 50 Q’eqchi community members from the state of Izabal, Municipality of Livingston, including 5 midwives, 5 traditional male healers and 8 postmenopausal women. Results indicate that the Q’eqchi Maya of Livingston possess their own cultural perceptions of women’s health which affect attitudes, symptoms and treatment choices during the menopausal transition. Since discussions of menstruation and menopause are considered cultural taboos among the Q’eqchi, many women mentioned experiencing excessive preoccupation when unanticipated and unfamiliar symptoms occurred. Furthermore, many women suffered from additional hardship when their spouse misinterpreted menopausal symptoms (vaginal dryness, sexual disinterest) as infidelity. Seven of the eight postmenopausal women interviewed indicated experiencing one or more symptoms during the menopausal transition, including headaches, anxiety, muscular pain, depression, and hot flashes. These results differ from the lack of symptomatology reported in previous studies in Mexico, but are in line with the result of menopausal research conducted among other Maya groups from the highlands of Guatemala. Although the Q’eqchi did not use a specific term for “hot flash”, three Q’eqchi women used the expression “baja presion” or a “lowering of blood pressure” to explain symptoms of profuse sweating followed by chills, heart palpitations, and emotional instability. The Q’eqchi Maya mentioned a number of herbal remedies to treat menopausal symptoms. Further research on these botanical treatments is needed in order to ascertain their safety and efficacy for continued use. PMID:16580764

  12. Fluid and element transfer at the slab-mantle interface: insights from the serpentinized Livingstone Fault, New Zealand

    Science.gov (United States)

    Smith, S. A. F.; Scott, J.; Tarling, M.; Tulley, C. J.; le Roux, P. J.

    2017-12-01

    At the slab-mantle interface in subduction zones, hydrous fluids released by dehydration reactions are fluxed upwards into the fore-arc mantle corner. The extent to which these fluids can move across the plate interface shear zone has significant implications for understanding the composition of the mantle wedge and the origin of episodic tremor and slow slip. The >1000 km long Livingstone Fault in New Zealand provides a superbly exposed analogue (both in terms of scale and the rock types involved) for the serpentinite shear zone likely to be present along the slab-mantle interface. The Livingstone Fault is a sheared serpentinite mélange up to several hundreds of meters wide that separates greenschist-facies quartzofeldspathic metasediments (e.g. analogue for slab sediments) from variably-serpentinized harzburgitic peridotite (e.g. analogue for mantle wedge). To track element mobility and paleo-fluid flow across the shear zone, Sr and Nd isotopes were measured in five transects across the metasediments, mélange and serpentinized peridotites. Results show that the mélange and serpentinized peridotites (originally with Sr and Nd similar to Permian MORB) were progressively overprinted with the isotopic composition of the metasediments at distances of up to c. 400 m from the mélange-metasediment contact. Mass balance calculations require that many elements were mobile across the mélange shear zone, but permeability modeling indicates that diffusive transfer of such elements is unrealistically slow. Instead, it appears that fluid and element percolation in to and across the mélange was aided by episodic over-pressuring and fracturing, as indicated by the widespread presence of tremolite-bearing breccias and veins that mutually cross-cut the serpentinite mélange fabrics. Overall, the field and isotopic results indicate that fluid and element redistribution within major serpentinite-bearing shear zones is strongly aided by fracturing and brecciation that are

  13. CEDEX research activities in Antarctica. Aquatic ecosystems in Byers Peninsula (Livingston Island, maritime Antarctica); Actividad investigadora del CEDEX en la Antartida. Ecosistemas acuaticos de la Peninsula Byers (Isla Livingston, Antartida)

    Energy Technology Data Exchange (ETDEWEB)

    Toro, M.; Quesada, A.; Camacho, A.; Oliva, M.; Alcami, A.; Antoniades, D.; Banon, M.; Fassnacht, S.; Fernandez-Valiente, E.; Galan, L.; Giralt, S.; Granados, I.; Justel, A.; Liu, E. J.; Lopez-Bravo, A.; Martinez-Cortizas, A.; Pla-Rabes, S.; Rastrojo, A.; Rico, E.; Rochera, C.; Van de Vijver, B.; Velazquez, D.; Villaescusa, J. A.; Vicent, W. F.

    2015-07-01

    Since 2001 CEDEX has taken part in many Antarctic joint research projects with different institutions from Spain and other countries, developing scientific activities in the International Camp of Byers Peninsular (Livingston Island, South Shetland Islands, Antarctica). This place was designed as an Antarctic Specially Protected Area (No.126) because the importance and value of its terrestrial and aquatic habitats. It is one of the largest ice-free areas of maritime Antarctica, with the highest diversity of environments and geological, hydrological and biological processes in the whole region, all of them in a pristine state. Byers Peninsula is considered the most significant limnological area in the Antarctic Peninsula region because it hosts a high number of lakes, ponds and streams, with an exceptional fauna and flora diversity, including the most singular, representative or endemic Antarctic species. Furthermore, the lakes sedimentary record is one of the widest and complete archives in Antarctic Peninsula region for the palaeocological and climatic study of the Holocene. Because Byers Peninsula is an Antarctic biodiversity hotspot, and it is located in one of the areas in the Earth where global warming is being more significant, it must be considered as a suitable international reference site for limnetic, terrestrial and coastal studies, and long term monitoring programmes. (Author)

  14. Ethnobotanical Study of Plants Used in the Management of HIV/AIDS-Related Diseases in Livingstone, Southern Province, Zambia

    Directory of Open Access Journals (Sweden)

    Kazhila C. Chinsembu

    2016-01-01

    Full Text Available Faced with critical shortages of staff, long queues, and stigma at public health facilities in Livingstone, Zambia, persons who suffer from HIV/AIDS-related diseases use medicinal plants to manage skin infections, diarrhoea, sexually transmitted infections, tuberculosis, cough, malaria, and oral infections. In all, 94 medicinal plant species were used to manage HIV/AIDS-related diseases. Most remedies are prepared from plants of various families such as Combretaceae, Euphorbiaceae, Fabaceae, and Lamiaceae. More than two-thirds of the plants (mostly leaves and roots are utilized to treat two or more diseases related to HIV infection. Eighteen plants, namely, Achyranthes aspera L., Lannea discolor (Sond. Engl., Hyphaene petersiana Klotzsch ex Mart., Asparagus racemosus Willd., Capparis tomentosa Lam., Cleome hirta Oliv., Garcinia livingstonei T. Anderson, Euclea divinorum Hiern, Bridelia cathartica G. Bertol., Acacia nilotica Delile, Piliostigma thonningii (Schumach. Milne-Redh., Dichrostachys cinerea (L. Wight and Arn., Abrus precatorius L., Hoslundia opposita Vahl., Clerodendrum capitatum (Willd. Schumach., Ficus sycomorus L., Ximenia americana L., and Ziziphus mucronata Willd., were used to treat four or more disease conditions. About 31% of the plants in this study were administered as monotherapies. Multiuse medicinal plants may contain broad-spectrum antimicrobial agents. However, since widely used plants easily succumb to the threats of overharvesting, they need special protocols and guidelines for their genetic conservation. There is still need to confirm the antimicrobial efficacies, pharmacological parameters, cytotoxicity, and active chemical ingredients of the discovered plants.

  15. Ethnobotanical Study of Plants Used in the Management of HIV/AIDS-Related Diseases in Livingstone, Southern Province, Zambia.

    Science.gov (United States)

    Chinsembu, Kazhila C

    2016-01-01

    Faced with critical shortages of staff, long queues, and stigma at public health facilities in Livingstone, Zambia, persons who suffer from HIV/AIDS-related diseases use medicinal plants to manage skin infections, diarrhoea, sexually transmitted infections, tuberculosis, cough, malaria, and oral infections. In all, 94 medicinal plant species were used to manage HIV/AIDS-related diseases. Most remedies are prepared from plants of various families such as Combretaceae, Euphorbiaceae, Fabaceae, and Lamiaceae. More than two-thirds of the plants (mostly leaves and roots) are utilized to treat two or more diseases related to HIV infection. Eighteen plants, namely, Achyranthes aspera L., Lannea discolor (Sond.) Engl., Hyphaene petersiana Klotzsch ex Mart., Asparagus racemosus Willd., Capparis tomentosa Lam., Cleome hirta Oliv., Garcinia livingstonei T. Anderson, Euclea divinorum Hiern, Bridelia cathartica G. Bertol., Acacia nilotica Delile, Piliostigma thonningii (Schumach.) Milne-Redh., Dichrostachys cinerea (L.) Wight and Arn., Abrus precatorius L., Hoslundia opposita Vahl., Clerodendrum capitatum (Willd.) Schumach., Ficus sycomorus L., Ximenia americana L., and Ziziphus mucronata Willd., were used to treat four or more disease conditions. About 31% of the plants in this study were administered as monotherapies. Multiuse medicinal plants may contain broad-spectrum antimicrobial agents. However, since widely used plants easily succumb to the threats of overharvesting, they need special protocols and guidelines for their genetic conservation. There is still need to confirm the antimicrobial efficacies, pharmacological parameters, cytotoxicity, and active chemical ingredients of the discovered plants.

  16. Thermal conductivity and thermal diffusivity of cores from a 26 meter deep borehole drilled in Livingston Island, Maritime Antarctic

    Science.gov (United States)

    Correia, A.; Vieira, G.; Ramos, M.

    2012-06-01

    During the month of January of 2008 a borehole (Permamodel-Gulbenkian 1 — PG1) 26 m deep was drilled on the top of Mount Reina Sofia (275 m a.s.l.) near the Spanish Antarctic Station of Livingston Island, South Shetland Islands. Cores from 1.5 m to about 26 m deep were collected for measuring several physical properties. The objective of the present work is to report the values of the thermal conductivity and the thermal diffusivity that were measured in the cores from the borehole and the heat production that was estimated for the geological formations intercepted by it. Seven cores were selected to measure the thermal conductivity and the thermal diffusivity. The measured values for the thermal conductivity vary from 2.6 W/mK to 3.3 W/mK while the measured values for the thermal diffusivity vary from 1.1 × 10- 6 m2/s to 1.6 × 10- 6 m2/s. Both thermal conductivity and thermal diffusivity, on average, show a slight increase with depth. Average heat production was also estimated for two portions of the borehole: one from 2 to 12 m and the other from 12 to 25 m. A gamma-ray spectrometer was used to estimate the concentrations of uranium, thorium, and potassium of the cores, from which the heat production per unit volume was calculated. The estimated heat production for the first half of the borehole is 2.218 μW/m3 while for the second half it is 2.173 μW/m3; these heat production values are compatible with acidic rock types. Porosity and density were also estimated for the same cores.

  17. Metasomatism, Fluid Overpressure and Brecciation at the Slab-Mantle Interface: Insights from the Livingstone Fault, New Zealand

    Science.gov (United States)

    Tarling, M.; Smith, S. A. F.; Scott, J.

    2017-12-01

    Juxtaposition of mantle peridotite and serpentinite against quartzofeldspathic and mafic schists occurs along the shallow slab-mantle interface in some subduction zones. This part of the subduction interface has been invoked as a possible source region of episodic tremor and slow slip, yet geological observations of fault zone structures and chemical reactions pertinent to this region are quite rare. The >1000 km long Livingstone Fault in New Zealand is a superbly exposed fault zone that provides a suitable analogue (both in terms of scale and the rock types involved) for the shallow slab-mantle interface. The fault is characterized by a foliated and highly sheared serpentinite mélange tens to several hundreds of meters wide that separates (partially serpentinised) peridotites from quartzofeldspathic schists. Talc- and tremolite-forming metasomatic reactions occurred along the margins of the mélange and around entrained pods due to mixing of serpentinite with silica- and calcium-rich fluids derived from the adjacent quartzofeldspathic schist. The metasomatic reactions generated significant volumes of water at the melange-schist contact that became trapped between the two relatively impermeable fault zone lithologies. On the schist side of the contact, brittle faulting was promoted by the formation of a laterally-continuous silicified zone up to tens of metres wide. On the melange side, a zone up to tens of metres wide of `crackle-breccias' containing veined stockworks of tremolite indicates periodic increases of pore pressure sufficient to cause hydraulic fracture of serpentinite. The crackle-breccias are multi-generational indicating that this process was episodic. Sr and Nd isotope data and permeability calculations suggest that the episodic brecciation process was critical to the transfer of fluids across the melange. Our observations suggest that fluid-producing metasomatic reactions along the shallow slab-mantle interface may contribute to the tremor signal

  18. Rifampicin resistance in mycobacterium tuberculosis patients using GeneXpert at Livingstone Central Hospital for the year 2015: a cross sectional explorative study.

    Science.gov (United States)

    Masenga, Sepiso K; Mubila, Harrison; Hamooya, Benson M

    2017-09-22

    Since the recent introduction of GeneXepert for the detection of Tuberculosis (TB) drug resistance mutations in both primary resistance and acquired resistance in Zambia, little has been documented in literature on the issue of rifampicin resistance especially in the face of a high National TB burden. The study aimed to determine the prevalence of rifampicin resistance in tuberculosis patients at Livingstone Central Hospital for the year 2015. This was a cross sectional study conducted at Livingstone Central Hospital where we reviewed 152 records (from January 1, 2015 to 31st December, 2015) involving patients who presented with clinically suspected TB or documented TB, whose samples were sent to the laboratory for GeneXpert Mycobacterium tuberculosis/rifampicin testing. Statistical evaluations used a one-sample test of proportion and Fisher's exact test. The age of participants ranged from 8 months to 73 years old (median = 34). Of the participants with complete data on gender, 99 (66%) and 52 (34%) were males and females respectively. The TB co-infection with HIV prevalence was 98.3% (p < 0.001). Prevalence of rifampicin resistance was 5.9% and there was no statistical significant difference between being male or female (p = 0.721). We were able to show from our study, evidence of rifampicin resistance at Livingstone Central Hospital. Hence, there was need for further in-depth research and appropriate interventions (i.e close follow-up and patient care for drug resistance positive patients).

  19. PATRONES HISTÓRICOS DE CUEREO EN LOBOS MARINOS: LA EVIDENCIA DE LOS ABRIGOS 1 Y 2 DE PLAYA YÁMANA (ISLA LIVINGSTON, ANTARTICA CHILENA)

    OpenAIRE

    CARTAJENA F, ISABEL; LABARCA E, RAFAEL

    2007-01-01

    Se presentan los resultados del análisis de huellas de corte en restos óseos de pinnipedos provenientes de dos yacimientos loberos históricos, localizados en cabo Shirreff, isla Livingston, Antartica Chilena. Se describe la ubicación, disposición y características morfológicas de las huellas, con el objeto de establecer los modos de procesamiento llevados a cabo en los yacimientos estudiados. Los resultados indican que los cortes fueron hechos con instrumentos metálicos, en su mayoría orienta...

  20. Topographic and geomorphologic controls on the distribution of vegetation formations in Elephant Point (Livingston Island, Maritime Antarctica).

    Science.gov (United States)

    Ruiz-Fernández, Jesús; Oliva, Marc; García-Hernández, Cristina

    2017-06-01

    This article focuses on the spatial distribution of vegetation formations in Elephant Point, an ice-free area of 1.16km 2 located in Livingston Island (South Shetland Islands, Antarctica). Fieldwork carried out in January 2014 consisted of floristic surveys and designation of a vegetation map. We have examined these data in a GIS environment together with topographical and geomorphological features existing in the peninsula in order to infer the factors controlling vegetation distribution. This has allowed quantifying the total area covered by the four different vegetation formations distributed across the peninsula, proliferating mainly on bedrock plateaus and Holocene raised beaches. Grass formation is essentially composed of Deschampsia antarctica, distributed almost exclusively on raised beaches, and covering 4.1% of the ice-free surface. The remaining three formations are fundamentally composed of cryptogam species. The first of which is fruticose lichen and moss formation, present on high bedrock plateaus and principally formed by lichens such as Usnea aurantiaco-atra. The next is the crustose lichen formation, spreading on bedrock plateaus near the coast populated by bird colonies. In this case, ornitocoprophilous lichens such as Caloplaca regalis, Xanthoria elegans and Haematomma erythromma are predominant. Together, both formations have colonised 5.1% of the peninsula. The last variety, moss carpet and moss cushion formation, occupies 1.4% of the deglaciated surface, spreading primarily in flooded areas, stabilised talus slopes, and bedrock plateaus as well. Therefore, the total surface colonised by vegetation is 12.2ha, which comprises 10.5% of the peninsula. Due to the retreat of the Rotch Dome glacier, 20.1ha remain ice-free since 1956 (17.3% of the deglaciated area). Ever since, even though the Antarctic Peninsula has registered one of the most significant temperature rises on Earth, vegetation has only colonised 0.04ha of this new space, which merely

  1. Effect of Storage Methods and Period on the Physiological and Nutrient Components of Livingstone Potato (Plectranthus esculentus in Abia State, Nigeria

    Directory of Open Access Journals (Sweden)

    Ezeocha Chinelo Vanessa

    2017-02-01

    Full Text Available Livingstone potato production in Nigeria is faced with the challenge of high postharvest losses. The aim of this study was to assess the effect of some storage methods on the physiological and nutritional quality of livingstone potato. Potatoes were separated and stored using eight different methods: potatoes stored in3x3x3 ft pits and covered with sand under the shade (T1, potatoes stored in3x3x3 ft pits and covered with ash under the shade (T2, potatoes stored in3x3x3 ft pits and covered with rice husk under the shade (T3, potatoes stored in3x3x3 ft pits and covered with a wood shavings under the shade (T4, potatoes spread on a bamboo platform under the shade(T5, potatoes spread on a raffia palm platform under the shade(T6, potatoes spread on concrete pavement inside the barn (T7, potatoes spread on the ground under the shade(T8, potatoes buried under the ground (T9. T8 was used as the control treatment. Temperature and relative humidity of the environment was monitored, the roots were weighed monthly to access the weight loss, sprouting and rot were observed visually and proximate composition of the stored roots were evaluated using standard methods. The lowest percentage weight loss was observed in samples stored in a pit covered with wood ash and those covered with river sand. Samples stored in pits and covered with wood shavings, wood ash and river sand had the lowest percentage of sprouting (1.63%, 3.45% and 6.06% respectively. The dry matter content increased with storage period in all the storage methods. The starch yield varied in the different storage methods with the samplescovered with river sand (13.45% and the samples buried underground in the field(10.53% giving the highest starch yield at the end of the storage period. Samples stored under rice husk had the highest ash content (4.77% while the crude fibre and crude protein contents were highest in the samples spread on raffia palm. The results showed that spreading on the floor

  2. A 14-year dataset of in situ glacier surface velocities for a tidewater and a land-terminating glacier in Livingston Island, Antarctica

    Science.gov (United States)

    Machío, Francisco; Rodríguez-Cielos, Ricardo; Navarro, Francisco; Lapazaran, Javier; Otero, Jaime

    2017-10-01

    We present a 14-year record of in situ glacier surface velocities determined by repeated global navigation satellite system (GNSS) measurements in a dense network of 52 stakes distributed across two glaciers, Johnsons (tidewater) and Hurd (land-terminating), located on Livingston Island, South Shetland Islands, Antarctica. The measurements cover the time period 2000-2013 and were collected at the beginning and end of each austral summer season. A second-degree polynomial approximation is fitted to each stake position, which allows estimating the approximate positions and associated velocities at intermediate times. This dataset is useful as input data for numerical models of glacier dynamics or for the calibration and validation of remotely sensed velocities for a region where very scarce in situ glacier surface velocity measurements have been available so far. The link to the data repository is as follows: pangaea.de/10.1594/PANGAEA.846791" target="_blank">http://doi.pangaea.de/10.1594/PANGAEA.846791.

  3. A 14-year dataset of in situ glacier surface velocities for a tidewater and a land-terminating glacier in Livingston Island, Antarctica

    Directory of Open Access Journals (Sweden)

    F. Machío

    2017-10-01

    Full Text Available We present a 14-year record of in situ glacier surface velocities determined by repeated global navigation satellite system (GNSS measurements in a dense network of 52 stakes distributed across two glaciers, Johnsons (tidewater and Hurd (land-terminating, located on Livingston Island, South Shetland Islands, Antarctica. The measurements cover the time period 2000–2013 and were collected at the beginning and end of each austral summer season. A second-degree polynomial approximation is fitted to each stake position, which allows estimating the approximate positions and associated velocities at intermediate times. This dataset is useful as input data for numerical models of glacier dynamics or for the calibration and validation of remotely sensed velocities for a region where very scarce in situ glacier surface velocity measurements have been available so far. The link to the data repository is as follows: http://doi.pangaea.de/10.1594/PANGAEA.846791.

  4. Knowledge and disease management skills of cattle owners on East Coast Fever and Foot and Mouth Disease in Kazungula and Livingstone Districts of Zambia

    Directory of Open Access Journals (Sweden)

    Chisembele, C.

    2005-01-01

    Full Text Available Effective animal disease control and prevention should be based on accurate information from the field. Part of this field information can be obtained from the cattle owners. In order to assess their disease knowledge, a survey focusing on East Coast Fever (ECF and Foot and Mouth Disease (FMD was organised among 302 cattle owners from the Kazungula and Livingstone Districts of the Southern Province of Zambia. The cattle owners' level of knowledge of ECF was low (34% with most of those able to describe the disease belonging to the endemic zone where ECF caused high death rates in cattle. A larger proportion of the cattle owners (46% were able to give an adequate description of FMD symptoms. It reached up to 61% in the FMD high-risk zone. Reporting to the animal health service providers appeared to be low. The results of the survey showed that attempts should be made to improve the cattle owners' knowledge and response to important diseases by carrying out more extension and sensitization activities. This is especially so in areas of low infection or where the disease was experienced long time ago.

  5. Glacial evolution in King George and Livingston Islands (Antarctica) since the Last Glacial Maximum based on cosmogenic nuclide dating and glacier surface reconstruction - CRONOANTAR project

    Science.gov (United States)

    Ruiz Fernández, Jesús; Oliva, Marc; Fernández Menéndez, Susana del Carmen; García Hernández, Cristina; Menéndez Duarte, Rosa Ana; Pellitero Ondicol, Ramón; Pérez Alberti, Augusto; Schimmelpfennig, Irene

    2017-04-01

    CRONOANTAR brings together researchers from Spain, Portugal, France and United Kingdom with the objective of spatially and temporally reconstruct the deglaciation process at the two largest islands in the South Shetlands Archipelago (Maritime Antarctica), since the Global Last Glacial Maximum. Glacier retreat in polar areas has major implications at a local, regional and even planetary scale. Global average sea level rise is the most obvious and socio-economically relevant, but there are others such as the arrival of new fauna to deglaciated areas, plant colonisation or permafrost formation and degradation. This project will study the ice-free areas in Byers and Hurd peninsulas (Livingston Island) and Fildes and Potter peninsulas (King George Island). Ice-cap glacier retreat chronology will be revealed by the use of cosmogenic isotopes (mainly 36Cl) on glacially originated sedimentary and erosive records. Cosmogenic dating will be complemented by other dating methods (C14 and OSL), which will permit the validation of these methods in regions with cold-based glaciers. Given the geomorphological evidences and the obtained ages, a deglaciation calendar will be proposed and we will use a GIS methodology to reconstruct the glacier extent and the ice thickness. The results emerging from this project will allow to assess whether the high glacier retreat rates observed during the last decades were registered in the past, or if they are conversely the consequence (and evidence) of the Global Change in Antarctica. Acknowledgements This work has been funded by the Spanish Ministry of Economy, Industry and Competitiveness (Reference: CTM2016-77878-P).

  6. floodzones_livingston_FEMA_1999

    Data.gov (United States)

    Louisiana Geographic Information Center — The Q3 Flood Data are derived from the Flood Insurance Rate Maps (FIRMS) published by the Federal Emergency Management Agency (FEMA). The file is georeferenced to...

  7. Penning Ulysses | Livingstone | English in Africa

    African Journals Online (AJOL)

    English in Africa. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 40, No 3 (2013) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT ...

  8. Kuidas ma olin dr Livingstone / Stuart Sweeney

    Index Scriptorium Estoniae

    Sweeney, Stuart

    2007-01-01

    Inglise ajakirjanik, Nukufilmi stuudio ja animafilmide festivali "Animated Dreams" ning Nukufilmi 50. juubeli tähistamiseks korraldatud rahvusvahelise konverentsi "Voodoo hing" külaline Eesti stuudiost ja Eesti nukufilmidest

  9. The Composition Process | Livingstone | English in Africa

    African Journals Online (AJOL)

    English in Africa. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 40, No 3 (2013) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT ...

  10. Phylogeography, hybridization and Pleistocene refugia of the kob antelope (Kobus kob)

    DEFF Research Database (Denmark)

    Lorenzen, Eline Deidre; De Neergaard, Rikke; Arctander, Peter

    2007-01-01

    that the divergent phenotype and life-history adaptations of K. k. leucotis reflect the isolation of kob populations in refugia in west and east Africa during the Pleistocene. Subsequent dispersal has led to secondary contact and hybridization in northern Uganda between lineages, which was supported by high levels...

  11. Species distribution of kobs (Kobus kob) in the Shai Hills Resource Reserve: an exploratory analysis.

    Science.gov (United States)

    Antwi, Raymond Agyepong; Owusu, Erasmus Henaku; Attuquayefio, Daniel Korley

    2018-02-01

    The well-being of a species fundamentally rests on understanding its biology, home range, and distribution. The highly seasonal distribution of kobs poses conservation and management difficulties, particularly because of the capricious nature of the ever-changing ecological and vegetation dynamics of the ecosystem. Assessing the distribution of kobs and their associated vegetation provides insight into the vulnerability and conservation status of the species. Species distribution and habitat suitability maps were developed and created respectively for the management of kobs in the Shai Hills Resource Reserve. Kob presence data collected was analyzed using the spatial analyst and Hawth's tool in the ArcGIS software where the gradients of kob distribution within the protected area landscape were plotted and mapped. Seven environmental variables including location, land cover/use, slope/elevation, nearness to dams and rivers, temperature, and rainfall were considered to have effect on kob distribution pattern and as such used in the development of species distribution and habitat suitability maps. The results indicated that kobs in the Shai Hills Resource Reserve (SHRR) assume a clumped or contagious distribution pattern where individual kobs are aggregated in patches. Rainfall, temperature, nearness to dams and rivers, slope/elevation, and land cover/use had influence in kob distribution. Of all the cataloged habitats, 86, 13, and 1% were moderately suitable, suitable, and unsuitable, respectively. Long-term survival of species depends on adequately large areas of suitable habitats and opportunities for home range activities between such areas. As such, it is recommended that suitable habitats for kobs be dedicated and designated as conservation areas, especially areas along the western boundary.

  12. Floodplain Mapping Submission for Village of Dansville, Livingston County, NY

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

  13. Comment on a Questionnaire | Livingstone | English in Africa

    African Journals Online (AJOL)

    English in Africa. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 40, No 3 (2013) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. DOWNLOAD FULL TEXT Open Access DOWNLOAD FULL TEXT ...

  14. From Livingstone to ecotourism. What's new in travel medicine?

    Science.gov (United States)

    Houston, S

    2000-01-01

    To review recent developments in the field of travel medicine and to outline the knowledge and resources family physicians need for providing health advice to travelers headed for tropical or developing countries. Personal files; references from review articles and from a recent textbook of travel medicine; current guidelines on pretravel advice; and a review of the 1996 to 1999 MEDLINE database using "travel medicine" as a term and subject heading, "trave(l)lers' diarrhea" as a text word and subject heading, "immunization + travel," and "malaria + chemo prevention" were used as information sources. Priority was given to randomized controlled trials and recommendations of expert or national bodies. Some elements of travel medicine, such as malaria chemoprophylaxis, have become more complex. Some valuable new preventive measures, such as hepatitis A vaccine, treated bed nets, and antimalarial drugs, have become available. Some health risks, such as cholera, have been overemphasized in the past, whereas others, such as tuberculosis and sexually transmitted diseases, have been underemphasized. Information sources relevant for providing travel health advice have improved and expanded. Canadian evidence-based guidelines addressing most important travel health issues are now available. Travel medicine is a rapidly evolving field. Physicians intending to provide health advice to travelers to high-risk parts of the world should be well prepared and have access to good, up-to-date information.

  15. Structure and ecology of freshwater benthic diatom communities from Byers Peninsula, Livingston Island, South Shetland Islands

    Czech Academy of Sciences Publication Activity Database

    Kopalová, Kateřina; Van de Vijver, B.

    2013-01-01

    Roč. 25, č. 2 (2013), s. 239-253 ISSN 0954-1020 Institutional support: RVO:67985939 Keywords : Bacillariophyta * lakes * Maritime Antarctic Region Subject RIV: EF - Botanics Impact factor: 1.417, year: 2013

  16. The Socio‑economic Impact of Stroke on Households in Livingstone ...

    African Journals Online (AJOL)

    Background: Stroke is the leading cause of adult disability. Stroke ... analyzed using Statistical Package for Social Sciences version 16 (IBM Corporation) and content ... impacts on the victim were depression, difficult to get along with, resentfulness, apathy, needy, ..... achievable through the media and information education.

  17. Floodplain Mapping Submission for Town of North Dansville, Livingston County, NY

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — The Floodplain Mapping/Redelineation study deliverables depict and quantify the flood risks for the study area. The primary risk classifications used are the...

  18. Livingston-Courant magnetic lens and their use in focussing a beam supplied by a Van der Graaff; Lentilles magnetiques Courant-Livingston et leur utilisation a la focalisation du faisceau donne par un Van de Graaff

    Energy Technology Data Exchange (ETDEWEB)

    Gendreau, G.

    1953-11-15

    This technical note presents the general calculation of focal distances of a system made of two crossed thick lens. It outlines that these lens can be considered as thin lens in their operation domain (focal distance comprised between an element length and the infinite), and then elaborated formula for all optical elements. These formula are then applied to lens built for the Van der Graaff. The actual length of a lens is then given with respect to its theoretical length. Obtained numerical values lead to the determination of magnetic and mechanical characteristics of a lens [French] Le calcul general des distances focales d'un systeme de deux lentilles epaisses croisees est explicite. Dans leur domaine d'utilisation (distances focales comprises entre l'infini et la longueur d'un element) on peut les considerer comme minces, tous les elements optiques sont alors formules. L'application de ces formules aux lentilles construites pour le Van de Graaff se traduit par les tableaux I et II. On donne la longueur reelle d'une lentille en fonction de sa longueur theorique. Les valeurs numeriques trouvees conduisent a la determination des caracteristiques magnetiques et mecaniques d'une lentille. (auteur)

  19. Case studies of transport for London.

    Science.gov (United States)

    2009-01-01

    This project was motivated by the election of Ken Livingston as Mayor of London in : 2000. Mayor Livingston campaigned on a platform of improving transportation service through : such innovative means as congestion pricing. Mayor Livingston relied on...

  20. L'invisibilité du cancer en Afrique [Review of: J. Livingston Improvising medicine: an African oncology ward in an emerging cancer epidemic

    NARCIS (Netherlands)

    Chabrol, F.; Nguyen, V.K.

    2013-01-01

    L’Afrique australe se remet à peine de l’épidémie de sida, grâce à une mobilisation transnationale sans précédent et à des financements massifs pour acheminer les antirétroviraux, qu’une épidémie de cancer prolifère dans le sillon du VIH. Comment rendre compte de ce drame oublié des politiques de

  1. Geomorfología de la península del Cabo Shirreff. Isla Livingston. Shetland del Sur. Antártida

    OpenAIRE

    Vilaplana, J. M.; Pallàs, R.; Calvet, J.

    1993-01-01

    The geomorphological exploration and mapping of Cape Shirreff area was carried out during the 1992/93 Spanish Antartic Expedition in Livin gston Island. In this area two main systems of lanforms were recognized. A) Marine landforms mostly constituted by three groups of raised platforms and by five levels of raised beaches. B) Glacial landforms conformed by recent moraines related to the present ice-margin and by older glacial deposits located on the different marine levels. These landforms an...

  2. Análisis del microclima de la Península Byers, isla Livingston, Antártida en el marco del proyecto LIMNOPOLAR

    OpenAIRE

    Bañón García, Manuel; Justel, Ana; Quesada, Antonio

    2006-01-01

    Ponencia presentada en: XXIX Jornadas Científicas de la AME y el VII Encuentro Hispano Luso de Meteorología celebrado en Pamplona, del 24 al 26 de abril de 2006. Este estudio es parte del proyecto REN2000-0435 ANT de la CICYT.

  3. ``Models'' CAVEAT EMPTOR!!!: ``Toy Models Too-Often Yield Toy-Results''!!!: Statistics, Polls, Politics, Economics, Elections!!!: GRAPH/Network-Physics: ``Equal-Distribution for All'' TRUMP-ED BEC ``Winner-Take-All'' ``Doctor Livingston I Presume?''

    Science.gov (United States)

    Preibus-Norquist, R. N. C.-Grover; Bush-Romney, G. W.-Willard-Mitt; Dimon, J. P.; Adelson-Koch, Sheldon-Charles-David-Sheldon; Krugman-Axelrod, Paul-David; Siegel, Edward Carl-Ludwig; D. N. C./O. F. P./''47''%/50% Collaboration; R. N. C./G. O. P./''53''%/49% Collaboration; Nyt/Wp/Cnn/Msnbc/Pbs/Npr/Ft Collaboration; Ftn/Fnc/Fox/Wsj/Fbn Collaboration; Lb/Jpmc/Bs/Boa/Ml/Wamu/S&P/Fitch/Moodys/Nmis Collaboration

    2013-03-01

    ``Models''? CAVEAT EMPTOR!!!: ``Toy Models Too-Often Yield Toy-Results''!!!: Goldenfeld[``The Role of Models in Physics'', in Lects.on Phase-Transitions & R.-G.(92)-p.32-33!!!]: statistics(Silver{[NYTimes; Bensinger, ``Math-Geerks Clearly-Defeated Pundits'', LATimes, (11/9/12)])}, polls, politics, economics, elections!!!: GRAPH/network/net/...-PHYSICS Barabasi-Albert[RMP (02)] (r,t)-space VERSUS(???) [Where's the Inverse/ Dual/Integral-Transform???] (Benjamin)Franklin(1795)-Fourier(1795; 1897;1822)-Laplace(1850)-Mellin (1902) Brillouin(1922)-...(k,)-space, {Hubbard [The World According to Wavelets,Peters (96)-p.14!!!/p.246: refs.-F2!!!]},and then (2) Albert-Barabasi[]Bose-Einstein quantum-statistics(BEQS) Bose-Einstein CONDENSATION (BEC) versus Bianconi[pvt.-comm.; arXiv:cond-mat/0204506; ...] -Barabasi [???] Fermi-Dirac

  4. Relation entre densité absolue et indice de densité dans l'inventaire ...

    African Journals Online (AJOL)

    ... between the absolute density and the density index in the count of Cobe defassa (kobus ellypsiprimnus defassa, Ruppell) population in Pendjari's biosphere park in Benin. Among the demographic factors that characterize a given population figure priority knowledge of its workforce over time and its distribution in space.

  5. Population status, distribution and habitat association of waterbuck ...

    African Journals Online (AJOL)

    As part of ecological studies of larger mammals in Chebera Churchura National Park, southwestern Ethiopia, population, distribution and habitat association of the waterbuck, Kobus ellipsiprymnus ellipsiprymnus were studied during wet and dry seasons of 2013–2014. Representative transects across the main habitat types ...

  6. South African Medical Journal - Vol 95, No 5 (2005)

    African Journals Online (AJOL)

    ... of sulfadoxine-pyrimethamine for Plasmodium falciparum malaria · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Aaron Mabuza, John Govere, Kobus laGrange, Nicros Mngomezulu, Elizabeth Allen, Alpheus Zitha, Frans Mbokazi, David Durrheim, Karen Barnes ...

  7. The Agincourt demographic and health study - site description ...

    African Journals Online (AJOL)

    The Agincourt demographic and health study - site description, baseline findings and implications. Stephen M Tollman, Kobus Herbst, Michel Garenne, John S.S. Gear, KathJeen Kahn. Abstract. No Abstract. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT.

  8. 77 FR 46771 - Notice of Permit Applications Received Under the Antarctic Conservation Act of 1978

    Science.gov (United States)

    2012-08-06

    ... handle adult penguins (Gentoo, Chinstrap and Adelie) to obtain small samples of body and tail feathers... Island; ASPA 125-King George Island; ASPA 126-Livingston Island; ASPA 128-Western shore of Admiralty Bay...; ASPA 117-Avian Island; ASPA 125-King George Island; ASPA 126-Livingston Island; ASPA 128-Western shore...

  9. D.I.M.E.F.I.L.: A Wordwide Campaign for Life

    Science.gov (United States)

    2007-05-01

    34 Anne Marie Oliver, and Paul F. Steinberg, The Road to Martyrs’ Square (New York: Oxford...Livingstone and Terrell Arnold, Fighting Back: Winning the War Against Terrorism (Lexington, DC Heath and Company 1986), 225. 117 Ibid., 226. 49...psychological Profiles Possible.” Studies in Conflict and Terrorism, 27: (February 2004): 283- 295. Livingstone, Neil and Terrell Arnold. Fighting Back

  10. The knowledge economy and lifelong learning

    DEFF Research Database (Denmark)

    Milana, Marcella

    2014-01-01

    Anmeldelse af bogen: The knowledge economy and lifelong learning. A critical reader, edited by David W. Livingstone and David Guile (Sense Publishers, Rotterdam, 2012.......Anmeldelse af bogen: The knowledge economy and lifelong learning. A critical reader, edited by David W. Livingstone and David Guile (Sense Publishers, Rotterdam, 2012....

  11. Depo Provera

    African Journals Online (AJOL)

    2008-11-13

    Nov 13, 2008 ... 6. Rang HP, Dale MM, Ritter JM, Moore PK. Pharmacology. 5th ed. Edinburgh: Churchill Livingstone;. 2003. 7. Standring S (ed). Gray's anatomy. 39th ed. Edinburgh: Churchill Livingstone; 2005. 8. Cronjé HS, Grobler CJF. Obstetrics in Southern Africa. 2nd ed. Paarl: Van Schaik Publishers; 2003. 9. Nel JT.

  12. Ecology of rodents at an old quarry in Zambia

    African Journals Online (AJOL)

    Ecology of rodents at an old quarry in Zambia. E.N. Chidumayo. Livingstone Museum, Zambia. An old quarry, 2,5 hain size near Livingstone in southern. Zambia was kill- and live-trapped between September 1974 and December 1976 to determine ecological relations among. rodent species inhabiting it. Seven species ...

  13. Marker list: QM183663 [PGDBj Registered plant list, Marker list, QTL list, Plant DB link and Genome analysis methods[Archive

    Lifescience Database Archive (English)

    Full Text Available CG GCTCCAACTTCAATGCCTGT Gold Ball Livingston x Yellow Pear|San Marzano x Gold Ball Livingston|T1693 x Yellow Pear ... chr11 fruit shape 1 10.1038/hdy.2013.45 23673388 ... QM183663 Solanum lycopersicum Solanaceae 11EP186 CAPS/dCAPS TGGAAGCTTTAAACTTGTCGTT

  14. Selected aspects of nursing care for an elderly patient with chronic obstructive pulmonary disease

    OpenAIRE

    Budnik, Marta; Galikowska, Anna; Marzec, Izabela; Balcerak, Dominika; Kobus, Edyta; Posieczek, Zuzanna

    2017-01-01

    Budnik Marta, Galikowska Anna, Marzec Izabela, Balcerak Dominika, Kobus Edyta, Posieczek Zuzanna. Selected aspects of nursing care for an elderly patient with chronic obstructive pulmonary disease. Journal of Education, Health and Sport. 2017;7(6):34-44. eISSN 2391-8306. DOI http://dx.doi.org/10.5281/zenodo.802926 http://ojs.ukw.edu.pl/index.php/johs/article/view/4501 The journal has had 7 points in Ministry of Science and Higher Education parametric evaluation...

  15. Proceedings of the 1989 Antenna Applications Symposium. Volume 2

    Science.gov (United States)

    1990-03-01

    Utilizing Closely 283 Spaced Printed Circuit Flared Slot Antenna Elements for Active Transmit and Receive Phased Array Demonstration," Mark J. Povinelli ...Notch Array, Mark J. Povinelli and John D’Angelo 19. "EHF Active Array, Joe Kobus 343 20. "Unique Joint Stars Phased-Array Antenna," H. Shnitkin 360 iv...Anten..as Propagat., vol. AP-33, pp. 1392-1400, Dec. 1985. [4] M. J. Povinelli and J. A. Johnson, "Design and performance of wideband, dual polarized

  16. On-call x-rays made easy AN Au-Yong On-call x-rays made easy , Amy Au-Yong and Nigel Broderick Churchill Livingstone Elsevier £21.99 304pp 9780702034459 0702034452 [Formula: see text].

    Science.gov (United States)

    2011-02-10

    DesigneD for clinicians involved in the management of acutely ill patients, this book enables them to recognise quickly the appearance of life-threatening conditions. It also concentrates on the interpretation of plain chest and abdominal images.

  17. Automated Diagnosis and Control of Complex Systems

    Science.gov (United States)

    Kurien, James; Plaunt, Christian; Cannon, Howard; Shirley, Mark; Taylor, Will; Nayak, P.; Hudson, Benoit; Bachmann, Andrew; Brownston, Lee; Hayden, Sandra; hide

    2007-01-01

    Livingstone2 is a reusable, artificial intelligence (AI) software system designed to assist spacecraft, life support systems, chemical plants, or other complex systems by operating with minimal human supervision, even in the face of hardware failures or unexpected events. The software diagnoses the current state of the spacecraft or other system, and recommends commands or repair actions that will allow the system to continue operation. Livingstone2 is an enhancement of the Livingstone diagnosis system that was flight-tested onboard the Deep Space One spacecraft in 1999. This version tracks multiple diagnostic hypotheses, rather than just a single hypothesis as in the previous version. It is also able to revise diagnostic decisions made in the past when additional observations become available. In such cases, Livingstone might arrive at an incorrect hypothesis. Re-architecting and re-implementing the system in C++ has increased performance. Usability has been improved by creating a set of development tools that is closely integrated with the Livingstone2 engine. In addition to the core diagnosis engine, Livingstone2 includes a compiler that translates diagnostic models written in a Java-like language into Livingstone2's language, and a broad set of graphical tools for model development.

  18. Biomass-based gasifiers for internal combustion (IC) engines—A ...

    Indian Academy of Sciences (India)

    biomass is converted into a combustible producer gas. ..... with gasification efficiency, increased with the increase in gas flow rate. .... Livingston W R 2007 Report on Biomass ash characteristics and behaviour in combustion, gasification.

  19. Who is at Risk for Down Syndrome?

    Science.gov (United States)

    ... NICHD Research Information Find a Study More Information Preeclampsia and Eclampsia About NICHD Research Information Find a ... 2006. Birth Defects Research. Part A, Clinical and Molecular Teratology , 88, 1008–1016. Livingston, G. & Cohn, D. ( ...

  20. Various scoring systems for predicting mortality in Intensive Care Unit

    African Journals Online (AJOL)

    2015-12-07

    Dec 7, 2015 ... Mortality rate was higher in patients admitted from wards other than surgery ... evaluate the predictability of various severity of illness scores, and ..... Livingston BM, MacKirdy FN, Howie JC, Jones R, Norrie JD. Assessment of.

  1. To Your Health: NLM update transcript - Countering obesity

    Science.gov (United States)

    ... The perspective's author explains the steady increase in obesity among Americans initially began in 1980. Edward Livingston M. ... pages devoted to: weight control ; body weight ; and obesity in children . Before I go, this reminder... MedlinePlus.gov is ...

  2. Uterine sarcoma

    Science.gov (United States)

    ... Livingstone; 2014:chap 88. Crum CP, Laury AR, Hirsch MS, Quick CM, Peters WA. Undifferentiated uterine sarcoma. ... Crum CP, Quick CM, Laury AR, Peters WA, Hirsch MS, eds. Gynecologic and Obstetric Pathology . Philadelphia, PA: ...

  3. Working with numbers and statistics a handbook for journalists

    CERN Document Server

    Livingston, Charles

    2005-01-01

    Working With Numbers and Statistics: A Handbook for Journalists will bolster math skills and improve math confidence for journalists at all skill levels. Authors Charles Livingston and Paul Voakes developed this resource book to improve journalist

  4. Backup_of_23. THE SOCIO-ECONOMIC IMPACT OF STROKE ON

    African Journals Online (AJOL)

    Esem

    problems. The study aimed at assessing the socio- economic impact of stroke in households in Livingstone district. A total ... economic challenges after stroke with a few of them were ..... 20 Trainer T, The transition; Getting to a sustainable and.

  5. 7. The Socio-Economic Impact of Stroke on

    African Journals Online (AJOL)

    Esem

    2University of Zambia, School of Medicine, Department of Community Medicine, Lusaka. *Corresponding ... Key words: Stroke, household, socio-economic, impact,. Livingstone ..... breakdowns resulting in delinquency, reduced. 21 family ties ...

  6. How Rational Are Inflation Expectations? A Vector Autoregression Decomposition of Inflation Forecasts and Their Errors

    National Research Council Canada - National Science Library

    Ladvogt, Timothy

    2002-01-01

    ... inflation forecast data from the Livingston Survey and the ASA/NBER Survey of Professional Forecasters over the past 30 years to determine what publicly available macroeconomic information, if any, explains...

  7. Manhattanile autoga minek läheb maksu alla / Neeme Raud

    Index Scriptorium Estoniae

    Raud, Neeme, 1969-

    2007-01-01

    New Yorgis toimunud maailma suurlinnajuhtide kliimafoorumil propageeris Londoni linnapea Ken Livingston linnasüdametesse sissesõidutasu kehtestamist, New Yorgi meer Michael Bloomberg plaanib kehtestada Manhattanile sissesõidu eest kaheksadollarilise tasu. Lisa: Suurlinnad autosid piiramas

  8. 78 FR 14149 - Louisiana Disaster #LA-00050

    Science.gov (United States)

    2013-03-04

    ..., Franklin, Jefferson, Livingston, Madison, Saint Landry, Vermilion. The Interest Rates are: Percent For... economic injury is 13503B. (Catalog of Federal Domestic Assistance Numbers 59002 and 59008) James E. Rivera...

  9. Books/Boeke

    African Journals Online (AJOL)

    This book describes ocular diseases with a brief surrunary and then gives the .... Furthermore, the review of adjuvant treatment of breast cancer could have ... New York: Churchill Livingstone. 1989. .... unlikely to reach their target audience.

  10. 2010 ARRA Lidar: 4 Southeast Counties (MI)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — TASK NAME: Southeast Michigan LiDAR LiDAR Data Acquisition and Processing Production Task- Monroe, St. Clair, Macomb, and Livingston Counties SEMCOG CONTRACT:...

  11. Preventing Hypothermia in Preterm Infants: A Program of Research

    African Journals Online (AJOL)

    This paper describes a program of research to examine thermoregulation in premature .... designed to minimize heat loss and aim for thermal ..... (4th ed.). London: Churchill Livingstone. Sedin, G. (1995). Neonatal heat transfer, routes of heat.

  12. 76 FR 19147 - Proposal Review Panel for Physics; Notice of Meeting

    Science.gov (United States)

    2011-04-06

    ... NATIONAL SCIENCE FOUNDATION Proposal Review Panel for Physics; Notice of Meeting In accordance... announces the following meeting. Name: LIGO Laboratory Annual Review at Livingston Observatory for Physics...: Partially Closed. Contact Person: Thomas Carruthers, Program Director, Division of Physics, National Science...

  13. Founders at work stories of startups'' early days

    CERN Document Server

    Livingston, Jessica

    2008-01-01

    Livingston presents a collection of interviews with founders of famous technology companies about what happens in the very earliest days. Includes interviews with Steve Wozniak (Apple), Max Levchin (PayPal), and others.

  14. 7 CFR Exhibit D to Subpart E of... - Goals and Timetables for Minorities and Women

    Science.gov (United States)

    2010-01-01

    ... Columbia; the Virginia cities of Alexandria, Fairfax, and Falls Church; the Virginia counties of Arlington..., Tazewell, Woodford, Knox, Stark, Marshall, Hancock, Mason, McLean, McDonough, Henderson, Warren, Livingston...

  15. Who believes in the Taylor Principle?

    DEFF Research Database (Denmark)

    Stadtmann, Georg; Pierdzioch; Rülke

    2012-01-01

    The Livingston survey data are used to investigate whether economists’ forecasts are consistent with the Taylor principle. Consistency with the Taylor principle is strong for academics and Federal Reserve economists, and less strong for private-sector economists.......The Livingston survey data are used to investigate whether economists’ forecasts are consistent with the Taylor principle. Consistency with the Taylor principle is strong for academics and Federal Reserve economists, and less strong for private-sector economists....

  16. Estimation in Latent Trait Models.

    Science.gov (United States)

    1981-05-01

    by k (V+l)t 21 jg=6 k (V+l) t22 j 2 _ B1 2 • 13 where 2 + (V) (\\+1) jl E( j ) (3.12) and j2 +) ( +i)) j2~l = E(B !iY,t ,v ) (3.13) 2 (V+l)2 (V M Step...Charles Myers Library Livingstone House 1 ERIC Facility-Acquisitions Livingstone Road 4833 Rugby Avenue Stratford Bethesda, MD 20014 London E15 2LJ

  17. LYAPUNOV-Based Sensor Failure Detection and Recovery for the Reverse Water Gas Shift Process

    Science.gov (United States)

    Haralambous, Michael G.

    2002-01-01

    Livingstone, a model-based AI software system, is planned for use in the autonomous fault diagnosis, reconfiguration, and control of the oxygen-producing reverse water gas shift (RWGS) process test-bed located in the Applied Chemistry Laboratory at KSC. In this report the RWGS process is first briefly described and an overview of Livingstone is given. Next, a Lyapunov-based approach for detecting and recovering from sensor failures, differing significantly from that used by Livingstone, is presented. In this new method, models used are in t e m of the defining differential equations of system components, thus differing from the qualitative, static models used by Livingstone. An easily computed scalar inequality constraint, expressed in terms of sensed system variables, is used to determine the existence of sensor failures. In the event of sensor failure, an observer/estimator is used for determining which sensors have failed. The theory underlying the new approach is developed. Finally, a recommendation is made to use the Lyapunov-based approach to complement the capability of Livingstone and to use this combination in the RWGS process.

  18. What can we expect from future accelerators

    International Nuclear Information System (INIS)

    Panofsky, W.K.H.

    1984-06-01

    This talk covers a general but highly subjective overview of the expectation for new accelerator development. An updated version of the Livingston chart demonstrates the exponential growth in time of the equivalent laboratory energy of accelerators. A similar Livingston chart pertaining only to electron-positron colliders shows an exponential growth but in the past only one technology - electron-positron storage rings - have been responsible for this development. The question addressed is whether the type of exponential growth reflected by these two charts can be sustained in the future

  19. Haemophilia A patients are not at increased risk of hepatitis A virus ...

    African Journals Online (AJOL)

    Azza A.G. Tantawy

    2012-02-21

    Feb 21, 2012 ... assessed 2 months after the second vaccine dose by anti-HAV IgG. Results: Seroprevalence ... vealed that proper factor replacement in haemophilia patients in Egypt is ..... hemophilia by factor VIII concentrates treated with organic solvent and ... 9th ed. United Kingdom; London: Churchill Livingstone 2001.

  20. The Art of Thinking: Using Collage to Stimulate Scholarly Work

    Science.gov (United States)

    Simmons, Nicola; Daley, Shauna

    2013-01-01

    Integrating the arts into higher education pedagogy provides an opportunity for cultivating rich ideas and high-level thinking, capitalizing on the creativity that every person already possesses and uses (Livingston, 2010). As Newton and Plummer (2009) note "the use of the creative arts as pedagogical strategy enables individuals to better…

  1. Developing a classification of motivations for consumers’ online brand-related activities

    NARCIS (Netherlands)

    Muntinga, D.G.; Moorman, M.; Smit, E.G.

    2010-01-01

    With the advance of new and highly interactive media technologies, internet users have become active seekers and producers of content (Livingstone, 2004). Social media provide internet users with unparalleled opportunities and completely different ways to interact. Myriad so-called social media

  2. A new species of Chameleon (Sauria: Chamaeleonidae: Kinyongia highlights the biological affinities between the Southern Highlands and Eastern Arc Mountains of Tanzania

    Directory of Open Access Journals (Sweden)

    Michele Menegon

    2015-12-01

    Full Text Available A new species of chameleon is described from the Livingstone and Udzungwa Mountains of Tanzania. The new species is morphologically most similar to Kinyongia vanheygeni. Furthermore, a single, short rostral appendage shows the species similarity to other Eastern Arc endemic Kinyongia species (e.g. K. uthmoelleri, K. oxyrhina, K. magomberae and K. tenuis. Females of all these species lack any rostral ornamentation and are all very similar morphologically. Males of the new species, on which the morphological diagnosis is based, can be distinguished from other Kinyongia by a shorter rostral appendage that bifurcates at the tip. They are easily distinguished from K. vanheygeni, otherwise the most similar species, by differences in head scalation and the length and shape of the rostral appendage. The new species is associated with montane rainforest and is known from only four forest fragments of which two are in the Udzungwa and two in the Livingstone Mountains. Phylogenetically, the new species is sister to K. tenuis and K. magomberae, which together, form a clade that also contains K. oxyrhina. The disjunct distribution of the new species, in the Livingstone and Udzungwa mountains, stretches across the ‘Makambako Gap’ which is a putative biogeographical barrier separating the distinct faunas of the Southern highlands and Eastern Arc Mountains. Evidence from this species however, points to potentially closer biological affinities between the Livingstone and Udzungwa mountains.

  3. A Microbial Survey of the Gastrointestinal Flora of Pigs in Dschang ...

    African Journals Online (AJOL)

    The 243 pigs examined for microbial infection harboured one ... animals cau be infected by these organisms if faeces are dumped or washed into ..... to E. co/z'. Hurnans can also come down with diseases like candidiasis and ... I. 13s' ed. English Language Book. Society (ELBS). Longman Group Ltd. Churchill, Livingstone,.

  4. 76 FR 50913 - Changes in Flood Elevation Determinations

    Science.gov (United States)

    2011-08-17

    ... respective addresses are listed in the table below. FOR FURTHER INFORMATION CONTACT: Luis Rodriguez, Chief..., Huntsville, AL 35801. Madison City of Madison (10- June 30, 2011; July The Honorable Paul November 4, 2011... Paul September 12, 2011 450170 of Richland County 2011; The Columbia Livingston, Chairman, (11-04-1879P...

  5. Author Details

    African Journals Online (AJOL)

    Brown, Duncan. Vol 16, No 2 (2002): Continental Africans & the Question of Identity - Articles Environment and Identity: Douglas Livingstone's A Littoral Zone Details. ISSN: 0256-004. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's ...

  6. Student Teaching--An Experience of Change and Growth.

    Science.gov (United States)

    Nicholsen, Jean

    1980-01-01

    Jonathan Livingston Seagull represents the concepts of change and growth in the elementary student teaching program at Indiana University-Purdue University. Student feedback indicates acceptance of the symbolism as it is used in materials and activities to reinforce the motto, "We can be free! We can learn to fly!" (CM)

  7. 76 FR 52354 - Notice of Permit Application Received Under the Antarctic Conservation Act of 1978

    Science.gov (United States)

    2011-08-22

    ... can be broken and release plastic into the ocean. (2) Fishing nets: (a) Plankton nets come in a... in ASPA 149-Cape Shirreff, Livingston Island by the Antarctic Marine Living Resources (AMLR) Program... release of a designated pollutant in Antarctica, and for the release of waste in Antarctica. NSF has...

  8. On Humans as Animals: Sparring with the beast in Douglas ...

    African Journals Online (AJOL)

    This paper draws on Charles Darwin's argument in The Descent of Man that humans are animals, and then offers a close reading of Douglas Livingstone's poem “Traffic interlude: Descent from the Tower”. It argues that the poem uses the genre of fable to tell the story of man's internal tussle between intellect and instinct, ...

  9. Exporting the Colombian Model Comparing Law Enfocement Stratregies Towards Security and Stability Operations in Colombia and Mexico

    Science.gov (United States)

    2014-06-01

    Belen Boville provides a 7 Nathan Leites and Charles Wolf, Rebellion and Authority: An Analytic Essay ...Narcocorridos are so influential that the Mexican government has banned such music on public radio.189 Despite the government’s efforts, the lyrics ...and Wolf Jr., Charles. Rebellion and Authority: An Analytic Essay on Insurgent Conflicts. Chicago: Markham Publishing Company, 1970. Livingstone

  10. 76 FR 13642 - Town Hall Discussion With the Director of the Center for Devices and Radiological Health and...

    Science.gov (United States)

    2011-03-14

    ... Senior Center Management.'' The purpose of this public meeting in the Orlando, FL, area is to engage in a.... Location: The public meeting will be held at the Sheraton Orlando Downtown Hotel, 400 West Livingston St... Senior Center Management AGENCY: Food and Drug Administration, HHS. ACTION: Notice of public meeting...

  11. 78 FR 25481 - Investigations Regarding Eligibility To Apply for Worker Adjustment Assistance

    Science.gov (United States)

    2013-05-01

    ... Industries, Inc. Newton, NC 03/26/13 03/25/13 (Company). 82595 AIG Global Services, Inc. Livingston, NJ.../13 03/25/13 One-Stop). 82601 Kindel Furniture (State/One- Grand Rapids, MI....... 03/26/13 03/25/13...

  12. 29 CFR 1410.3 - Individual access requests.

    Science.gov (United States)

    2010-07-01

    ..., North Dakota, South Dakota, Michigan, and Ohio (except counties listed under the Southern Region). 3..., Floyd, Harrison, Crawford, Perry, Spencer, DuBois, Pike, Gibson, Posey, Vanderburgh, and Warrick); Ohio..., Caldwell, Livingston, Linn, Macon, Shelby, Randolph, Chariton, Carrol, Ray, Clay, Platte, Jackson...

  13. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 224 ... Vol 41, No 1 (2014), Achieved Professionalism: The Columbia Guide to South African Literature in English and The Cambridge History of South African Literature*, Abstract. L Bethlehem. Vol 40, No 3 (2013), Address to the Berg Writers' Seminar, Abstract. D Livingstone. Vol 40, No 3 (2013), Address to the ...

  14. The History of Artificial Intelligence at Rutgers

    OpenAIRE

    Amarel, Saul

    1985-01-01

    The founding of a new college at Rutgers in 1969 became the occasion for building a strong computer science presence in the University. Livingston College thus provided the home for the newly organized Department of Computer Science (DCS) and for the beginning of computer science research at Rutgers.

  15. ORIGINAL ARTICLE Prenatal diagnosis of aneuploidy among a ...

    African Journals Online (AJOL)

    salah

    terphase cells. Patients and Methods: Prenatal diagnosis was performed on 40 high risk ... Prenatal diagnosis of aneuploidy among a sample of Egyptian high risk pregnancies ..... of medical genetics. 9th ed.: Churchill. Livingstone; 1995. p. 23-45. Edwards and Beard: FISH studies of. 2. pre-implantation embryos and PGD.

  16. Danish and British Architects at Work: A Micro-Study of Architectural Encounters after the Second World War

    Science.gov (United States)

    de Coninck-Smith, Ning

    2010-01-01

    Invoking a statement by the cultural geographer David Livingstone--that location is essential to knowing--this paper focuses on Danish school architecture during the 1950s and 1960s and the interplay between local geography and developments and discussions on the national and international scene. Through exhibitions and study tours and…

  17. Function of ZFAND3 in the DNA Damage Response

    Science.gov (United States)

    2013-06-01

    Cantor SB, Naka- tani Y, Livingston DM. 2006. Multifactorial contribu- tions to an acute DNA damage response by BRCA1/ BARD1-containing complexes. Genes...Cutaneous T Cell Lymphoma. PLoS ONE 8(7): e68915. doi:10.1371/journal.pone.0068915 Editor: Sue Cotterill, St. Georges University of London, United

  18. Pathogenetic Influences of Human Herpesvirus 8 (HHV-8) in Prostate Cancer Progression

    Science.gov (United States)

    2012-05-25

    Science 1974;186:1213-1215. 11. Wilson JD, Griffin JE, Leshin M, George FW. Role of gonadal hormones in development of the sexual phenotypes. Hum Genet... Cantor A, Muro-Cacho C, Livingston S, Karras J, Pow-Sang J, Jove R. Constitutive activation of Stat3 in human prostate tumors and cell lines: direct

  19. All-sky search for long-duration gravitational wave transients with initial LIGO

    NARCIS (Netherlands)

    Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acernese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwal, N.T.; Aguiar, O. D.; Ain, A.; Ajith, P.; Allen, B.; Allocca, A.; Amariutei, D. V.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Barker, R.D.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Behnke, B.; Bejger, M.; Belczynski, C.; Bell, A. S.; Bell, J.; Berger, B. K.; Bergman, J.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitossi, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, C. D.; Blair, R. M.; Bloemen, A.L.S.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bojtos, P.; Bond, T.C; Bondu, F.; Bonnand, R.; Bork, R.; Boschi, V.; Bose, S.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, D.; Brown, N. M.; Buchanan, C. C.; Buikema, A.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Cahillane, C.; Calderon Bustillo, J.; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Qian; Chua, S. E.; Chung, E.S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, A.C.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, A.L.; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dattilo, V.; Dave, I.; Daveloza, H. P.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Debra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.A.; DeRosa, R. T.; Rosa, R.; DeSalvo, R.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M.G.; Di Lieto, A.; Di Palma, I.; Di Virgilio, A.; Dojcinoski, G.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Eggenstein, H. -B.; Ehrens, P.; Eichholz, J. M.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, T. M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, V.; Fair, H.; Fairhurst, S.; Fan, X.M.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fisher, R. P.; Flaminio, R.; Fletcher, M; Fournier, J. -D.; Franco, S; Frasca, S.; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garufi, F.; Gatto, A.; Gaur, G.; Gehrels, N.; Gemme, G.; Gendre, B.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, A.; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gill, K.P.; Glaefke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.M.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunwald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Buffoni-Hall, R.; Hall, E. D.; Hammond, G.L.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hannam, M. D.; Hanson, P.J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Hennig, J.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Hofman, D.; Hollitt, S. E.; Holt, K.; Holz, D. E.; Hopkins, P.; Hosken, D. J.; Hough, J.; Houston, E. A.; Howell, J.; Hu, Y. M.; Huang, S.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Idrisy, A.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Islas, G.; Isogai, T.; Iyer, B. R.; Izumi, K.; Jacqmin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.; Jones, R.; Jonker, R. J. G.; Ju, L.; Haris, K.; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.H.; Kanner, J. B.; Karki, S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kawazoe, F.; Kefelian, F.; Kehl, M. S.; Keitel, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalaidovski, A.; Khalili, F. Y.; Khan., S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, C.; Kim, J.; Kim, K.; Kim, Namjun; Kim, Namjun; Kim, Y.M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Kokeyama, K.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringel, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Lazzarini, A.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C.H.; Lee, K.H.; Lee, M.H.; Lee, K.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Levine, B. M.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Logue, J.; Lombardi, A. L.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Lueck, H.; Lundgren, A. P.; Luo, J.; Lynch, R.; Ma, Y.; MacDonald, T.T.; Machenschalk, B.; MacInnis, M.; Macleod, D. M.; Magana-Sandoval, F.; Magee, R. M.; Mageswaran, M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandel, I.; Mandic, V.; Mangano, V.; Mansell, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martin, R.M.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Matichard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mendell, G.; Mendoza-Gandara, D.; Mercer, R. A.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Meyers, P. M.; Mezzani, F.; Miao, H.; Michel, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, J.C.; Moraru, D.; Gutierrez Moreno, M.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecchia, I.; Naticchioni, L.; Nayak, R. K.; Necula, V.; Nedkova, K.; Nelemans, G.; Gutierrez-Neri, M.; Neunzert, A.; Newton-Howes, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J.; Oh, S. H.; Ohme, F.; Oliver, M. B.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ott, C. D.; Ottaway, D. J.; Ottens, R. S.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Pereira, R.R.; Perreca, A.; Phelps, M.; Piccinni, O. J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, M.; Pitkin, M.; Poggiani, R.; Post, A.; Powell, J.; Prasad, J.; Predoi, V.; Premachandra, S. S.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prodi, G. A.; Prokhorov, L. G.; Punturo, M.; Puppo, P.; Puerrer, M.; Qi, H.; Qin, J.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Ricci, F.; Riles, K.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Ruediger, A.; Ruggi, P.; Ryan, K.A.; Sachdev, P.S.; Sadecki, T.; Sadeghian, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, O.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabel, R.B.; Schofield, R. M. S.; Schoenbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, M.S.; Sellers, D.; Sentenac, D.; Sequino, V.; Sergeev, A.; Serna, G.; Setyawati, Y.; Sevigny, A.; Shaddock, D. A.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shao, Z.M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Siellez, K.; Siemens, X.; Sigg, D.; Silva, António Dias da; Simakov, D.; Singer, A; Singer, L. P.; Singh, A.; Singh, R.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazu, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, J.R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sun, L.; Sutton, P. J.; Swinkels, B. L.; Szczepanczyk, M. J.; Tacca, M.D.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tomlinson, C.; Tonelli, M.; Torres, C. V.; Torrie, C. I.; Toeyrae, D.; Travasso, F.; Traylor, G.; Trifiro, D.; Tringali, M. C.; Trozzo, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Vajente, G.; Valdes, G.; van Bakel, N.; Van Beuzekom, Martin; van den Brand, J. F. J.; Van Den Broeck, C.F.F.; van der Schaaf, L.; van der Sluys, M. V.; van Heijningen, J. V.; van Veggel, A. A.; Vardaro, M.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Wang, G.; Wang, H.; Wang, M.; Wang, X.; Wang, Y.; Ward, R. L.; Warner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.M.; Wessels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; White, D. J.; Whiting, B. F.; Williams, D.R.; Williamson, R.; Willis, J. L.; Willke, B.; Wimmer, M. H.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Wright, J.L.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. -P.; Zevin, M.; Zhang, F.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, X. J.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.

    2016-01-01

    We present the results of a search for long-duration gravitational wave transients in two sets of data collected by the LIGO Hanford and LIGO Livingston detectors between November 5, 2005 and September 30, 2007, and July 7, 2009 and October 20, 2010, with a total observational time of 283.0 days and

  20. “and africa will be saved!”? nadenke oor die kerk, die sending en die ...

    African Journals Online (AJOL)

    Livingstone (1813-1873) with his emphasis on “Christianity, civilisation, commerce” had high expectations that Western influence would lead to total new conditions in. Africa and the end of slave trade. Ludwig Krapf (1810-1881) was very sceptical con- cerning Western influence and of opinion that it would only lead to ...

  1. Psychometric Properties of the Folstein Mini-Mental State Examination

    Science.gov (United States)

    Lopez, Michael N.; Charter, Richard A.; Mostafavi, Beeta; Nibut, Lorraine P.; Smith, Whitney E.

    2005-01-01

    Criterion-referenced (Livingston) and norm-referenced (Gilmer-Feldt) techniques were used to measure the internal consistency reliability of Folsteins Mini-Mental State Examination (MMSE) on a large sample (N = 418) of elderly medical patients. Two administration and scoring variants of the MMSE Attention and Calculation section (Serial 7s only…

  2. Hazardous Waste Cleanup: American Motive Power Incorporated in Dansville, New York

    Science.gov (United States)

    The American Motive Power, Inc. is located at 9431 Foster Wheeler Road, Town of North Dansville in Livingston County in New York. The facility was a metal fabrication plant where a variety of industrial processes occurred over the years from 1927 through 2

  3. Restoring Law and Order: The Kentucky State Guard in the Black Patch War of 1907-1909

    Science.gov (United States)

    2011-05-19

    Fulton, Galloway , Graves, Hickman, Hopkins, Livingston, Logan, Lyon, Marshall, McCracken, Simpson, Todd, and Trigg. The region’s name refers to the...Infernal Machine Addressed to Sanford Hall Found in Paducah Post Office,” September 28, 1908, Will Scott , “Herbert Hall Murdered: His Fate Told By

  4. Application of molecular methods for identification of strains classified as Salmonella enterica serovar 6, 7/-/- by conventional serotyping

    DEFF Research Database (Denmark)

    Chadfield, M. S.; Christensen, J. P.; Madsen, Mogens

    2002-01-01

    analysis for the phase 2 gene fljB demonstrated variants of Salmonella Infantis (6, 7: r: z(49)) expressing the R-phase antigen (Rz(49)) and possessing the gene for normal phase 2 antigen H: 1, 5. One of the two undefined strains demonstrated genotypic identity with a Salmonella Livingstone reference...

  5. The Structure of Analogical Models in Science.

    Science.gov (United States)

    1980-07-01

    mapping M of the nodes b1 , b2 ,...,bn of system B into the (different) nodes t1, t2,...,tm of system T. (2) The mapping is such that substantial parts... Rugby Avenue Livingstone Road Bethesda, MD 20014 Stratford London E15 2LJ 1 Dr. A. J. Eschenbrenner ENGLAND Dept. E422, Bldg. 81 McDonnell Douglas

  6. Boeke/Books

    African Journals Online (AJOL)

    Edinburgh: Churchill Livingstone. 1990. The list of ... airways disease, large bowel problems, pain control and terminal care. ... usefulness and shortcomings of the various techniques and tools to ... Manual of Epidemiology for District Health Management. .... growth, factors associated with growth retardation, assessment of.

  7. Author Details

    African Journals Online (AJOL)

    Kapembwa, KC. Vol 44, No 2 (2017) - Articles Super Refractory Status Epilepticus: A Case Report from Livingstone Central Hospital, Zambia Abstract PDF. ISSN: 0047-651X. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms ...

  8. Structural, Geochemical, and Isotopic Studies on Magmatic Dyke Swarms of the South Shetland Islands Volcanic Arc, West Antarctica - Revealing the Geodynamic History

    Science.gov (United States)

    Kraus, S.; Miller, H.

    2003-12-01

    Between 2000 and 2002 areas of up to 100,000 m2 have been mapped at several locations of the South Shetland Islands, mainly on King George and Livingston Islands. A structural analysis of the dykes and the host rocks was undertaken, and about 250 dykes were sampled for geochemical studies. On Livingston Island six different strike directions were identified, yielding a reliable relative time sequence as deduced from field-relationships. Geochemically, these dykes can be separated into five different groups, correlating with the different strike directions, one of those groups comprising two directions. Analysis of the structural data shows, that at least on Livingston Island only minor changes of the tensional situation occurred. Geochemical data reveal that all dykes of the South Shetland Islands belong to a calc-alkaline, arc-related suite, ranging from primitive basalts to highly differentiated rhyolites. Interpretation of Sr isotopic data of the dykes proves difficult, as there are indications for sea-water induced Sr-alteration. Nd isotopic analysis yield better results, revealing a three-stage development from the oldest dykes (ɛ Nd -0.2 to 0.6) on Livingston Island towards a second, younger group (ɛ Nd 2.8 to 4.2, also Livingston), terminating with a third one (ɛ Nd 5.2 to 7.6), which includes the youngest dykes on Livingston and all dykes on King George and also Penguin Island. Either two mantle sources were involved, or the amount of crustal contamination changed considerately with time. It may have been high during initial arc volcanism, because of a still unstretched crust, then decreasing continually with progressing volcanism. In any case, the pattern reflects a chronological sequence corresponding with other authors' hypothesis of a migrating arc volcanism from SW to NE, i.e. from Livingston (older dykes) towards King George Island (younger dykes). Pb isotopic data, plottet together with MORB- and sediment-samples dredged from the Drake Passage

  9. Potential of Biosynthesized Silver Nanoparticles as Nanocatalyst for Enhanced Degradation of Cellulose by Cellulase

    Directory of Open Access Journals (Sweden)

    Bipinchandra K. Salunke

    2015-01-01

    Full Text Available Silver nanoparticles (AgNPs as a result of their excellent optical and electronic properties are promising catalytic materials for various applications. In this study, we demonstrate a novel approach for enhanced degradation of cellulose using biosynthesized AgNPs in an enzyme catalyzed reaction of cellulose hydrolysis by cellulase. AgNPs were synthesized through reduction of silver nitrate by extracts of five medicinal plants (Mentha arvensis var. piperascens, Buddleja officinalis Maximowicz, Epimedium koreanum Nakai, Artemisia messer-schmidtiana Besser, and Magnolia kobus. An increase of around twofold in reducing sugar formation confirmed the catalytic activity of AgNPs as nanocatalyst. The present study suggests that immobilization of the enzyme onto the surface of the AgNPs can be useful strategy for enhanced degradation of cellulose, which can be utilized for diverse industrial applications.

  10. Alkaloids as taxonomic markers in some species of Magnolia L. and Liriodendron L.

    Directory of Open Access Journals (Sweden)

    Mirosław Furmanowa

    2014-01-01

    Full Text Available Some Magnoliaceae cultivated in Poland were investigated: Liriodendron tulipifera L. and 6 species of magnolia: Magnolia acuminata L., M. denudata Desr., M. kobus DC., M. obovata Thunb., M. salicifolia Maxim. and M. tripetala L. For alkaloid detection in the leaves thin-,layer chromatography was used. In Liriodendron tulipifera L. and in all the Magnolia species liriodenine which exhibits cytostatic activity was detected. The extract of Liriodendron tulipifera L. leaves showed, beside liriodenine other spots on the chromatogram than did the magnolias. Alkaloids can be utilized in the chemotaxonomy of Magnoliaceae as a diagnostic trait. The results of the investigations indicate a certain distinctiveness of M. acuminata L., in agreement with those obtained by way of numerical taxonomy. Most similar as regards alkaloid content in leaves are M. obovata Thunb. and M. tripetala L.

  11. Zygomycetes from herbivore dung in the ecological reserve of Dois Irmãos, Northeast Brazil

    Directory of Open Access Journals (Sweden)

    André Luiz Cabral Monteiro de Azevedo Santiago

    2011-03-01

    Full Text Available Thirty-eight taxa of Zygomycetes distributed in 15 genera were recorded from tapir (Tapirus terrestris, camel (Camelus bactrianus, horse (Equus caballus, deer (Cervus elaphus, agouti (Dasyprocta aguti, donkey (Equus asinus, llama (Llama glama and waterbuck (Kobus ellipsiprymnus dung collected at the Reserva Ecológica de Dois Irmãos located in Recife, State of Pernambuco, Northeast Brazil. The samples were collected on a monthly basis from June 2005 to May 2006, taken to the laboratory and incubated in moist chambers. Higher number of taxa was observed in the excrements of tapir, followed by deer and donkey. The highest number of species was detected for Mucor, followed by Pilobolus. Statistical analyses showed significant differences in richness of Zygomycetes taxa between the herbivore dung types. Differences of species composition, however, were weak. Seasonality influenced the Zygomycetes species composition but not its richness. Variations in taxa composition between ruminants and non-ruminants dung were non significant.

  12. Zygomycetes From Herbivore Dung in the Ecological Reserve of Dois IrmÃOs, Northeast Brazil

    Science.gov (United States)

    de Azevedo Santiago, André Luiz Cabral Monteiro; Botelho Trufem, Sandra Farto; Malosso, Elaine; dos Santos, Paulo Jorge Parreira; de Queiroz Cavalcanti, Maria Auxiliadora

    2011-01-01

    Thirty-eight taxa of Zygomycetes distributed in 15 genera were recorded from tapir (Tapirus terrestris), camel (Camelus bactrianus), horse (Equus caballus), deer (Cervus elaphus), agouti (Dasyprocta aguti), donkey (Equus asinus), llama (Llama glama) and waterbuck (Kobus ellipsiprymnus) dung collected at the Reserva Ecológica de Dois Irmãos located in Recife, State of Pernambuco, Northeast Brazil. The samples were collected on a monthly basis from June 2005 to May 2006, taken to the laboratory and incubated in moist chambers. Higher number of taxa was observed in the excrements of tapir, followed by deer and donkey. The highest number of species was detected for Mucor, followed by Pilobolus. Statistical analyses showed significant differences in richness of Zygomycetes taxa between the herbivore dung types. Differences of species composition, however, were weak. Seasonality influenced the Zygomycetes species composition but not its richness. Variations in taxa composition between ruminants and non-ruminants dung were non significant. PMID:24031609

  13. The role of African buffalos (Syncerus caffer) in the maintenance of foot-and-mouth disease in Uganda

    DEFF Research Database (Denmark)

    Ayebazibwe, C.; Mwiine, F. N.; Tjørnehøj, Kirsten

    2010-01-01

    (Alcelaphus buselaphus) and 5 waterbucks (Kobus ellipsiprymnus) from four major National Parks in Uganda between 2005 and 2008. Serum samples were screened to detect antibodies against foot-and-mouth disease virus (FMDV) non-structural proteins (NSP) using the Ceditest FMDV NS ELISA. Solid Phase Blocking......Background To study the role of African buffalos (Syncerus caffer) in the maintenance of foot-and-mouth disease in Uganda, serum samples were collected from 207 African buffalos, 21 impalas (Aepyceros melampus), 1 giraffe (Giraffa camelopardalis), 1 common eland (Taurotragus oryx), 7 hartebeests...... ELISAs (SPBE) were used to determine the serotype-specificity of antibodies against the seven serotypes of FMDV among the positive samples. Virus isolation and sequencing were undertaken to identify circulating viruses and determine relatedness between them. Results Among the buffalo samples tested, 85...

  14. The role of African buffalos (Syncerus caffer) in the maintenance of foot-and-mouth disease in Uganda

    DEFF Research Database (Denmark)

    Ayebazibwe, C.; Mwiine, F. N.; Tjørnehøj, Kirsten

    2010-01-01

    (Alcelaphus buselaphus) and 5 waterbucks (Kobus ellipsiprymnus) from four major National Parks in Uganda between 2005 and 2008. Serum samples were screened to detect antibodies against foot-and-mouth disease virus (FMDV) non-structural proteins (NSP) using the Ceditest FMDV NS ELISA. Solid Phase Blocking...... ELISAs (SPBE) were used to determine the serotype-specificity of antibodies against the seven serotypes of FMDV among the positive samples. Virus isolation and sequencing were undertaken to identify circulating viruses and determine relatedness between them. Results Among the buffalo samples tested, 85......% (95% CI = 80-90%) were positive for antibodies against FMDV non-structural proteins while one hartebeest sample out of seven (14.3%; 95% CI = -11.6-40.2%) was the only positive from 35 other wildlife samples from a variety of different species. In the buffalo, high serotype-specific antibody titres...

  15. Utilization of γ-irradiation technique on plant mutation breeding and plant growth regulation in Tokyo Metropolitan Isotope Research Center

    International Nuclear Information System (INIS)

    Suda, Hirokatsu

    1997-01-01

    During about 30-years, we have developed γ-irradiation technique and breeding back pruning method for the study of mutation breeding of ornamental plants. As a result, we have made a wide variety of new mutant lines in chrysanthemum, narcissus, begonia rex, begonia iron cross, winter daphne, zelkova, sweet-scented oleander, abelia, kobus, and have obtained 7 plant patents. By the use of γ-irradiation to plant mutation breeding, we often observed that plants irradiated by low dose of γ-rays showed superior or inferior growth than the of non-irradiated plants. Now, we established the irradiation conditions of γ-rays for mutation breeding and growth of regulation in narcissus, tulip, Enkianthus perulatus Schneid., komatsuna, moyashi, african violet. In most cases, irradiation dose rate is suggested to be a more important factor to induce plant growth regulators than irradiation dose. (author)

  16. Lost opportunities in HIV prevention: programmes miss places where exposures are highest

    Science.gov (United States)

    Sandøy, Ingvild F; Siziya, Seter; Fylkesnes, Knut

    2008-01-01

    Background Efforts at HIV prevention that focus on high risk places might be more effective and less stigmatizing than those targeting high risk groups. The objective of the present study was to assess risk behaviour patterns, signs of current preventive interventions and apparent gaps in places where the risk of HIV transmission is high and in communities with high HIV prevalence. Methods The PLACE method was used to collect data. Inhabitants of selected communities in Lusaka and Livingstone were interviewed about where people met new sexual partners. Signs of HIV preventive activities in these places were recorded. At selected venues, people were interviewed about their sexual behaviour. Peer educators and staff of NGOs were also interviewed. Results The places identified were mostly bars, restaurants or sherbeens, and fewer than 20% reported any HIV preventive activity such as meetings, pamphlets or posters. In 43% of places in Livingstone and 26% in Lusaka, condoms were never available. There were few active peer educators. Among the 432 persons in Lusaka and 676 in Livingstone who were invited for interview about sexual behaviour, consistent condom use was relatively high in Lusaka (77%) but low in Livingstone (44% of men and 34% of women). Having no condom available was the most common reason for not using one. Condom use in Livingstone was higher among individuals socializing in places where condoms always were available. Conclusion In the places studied we found a high prevalence of behaviours with a high potential for HIV transmission but few signs of HIV preventive interventions. Covering the gaps in prevention in these high exposure places should be given the highest priority. PMID:18218124

  17. Taenia spp. infections in wildlife in the Bangweulu and Kafue flood plains ecosystems of Zambia.

    Science.gov (United States)

    Muma, J B; Gabriël, S; Munyeme, M; Munang'andu, H M; Victor, B; Dorny, P; Nalubamba, K S; Siamudaala, V; Mwape, K E

    2014-09-15

    Taenia spp. have an indirect life cycle, cycling between a definitive and an intermediate host with zoonotic species causing public health problems in many developing countries. During the course of 2 separate surveys in Zambia (2004 and 2009), the presence of Taenia larval stages (cysticerci) was examined in Kafue lechwe (Kobus leche kafuensis), Black lechwe (Kobus leche smithermani) and other wildlife species from the Kafue and Bangweulu flood plains. Examinations involved post-mortem inspection and serum specific antigen detection. The recovered cysts from seven carcasses were characterised using PCR and DNA sequence analysis. The overall proportion of infection in wildlife on post-mortem examination was 19.0% (95% CI: 9.1-29.0%). The proportion of infected wildlife based on post-mortem examinations in the Kafue flood plains was estimated at 28.6% (95% CI: 13.3-43.9%), while the seroprevalence was estimated at 25.0% (95% CI: 2.9-47.1%). The seroprevalence for cattle in the Kafue flood plains was estimated at 61.5% (95% CI: 42.0-81.0%) while that of Kafue lechwe in the same ecosystem was estimated at 66.6% (95% CI: 45.6-85.7%). Infection rates were higher in Kafue lechwe than in Black lechwe suggesting differences in the exposure patterns. The sequencing results indicated that none of the recovered cysts were either Taenia solium or Taenia saginata. We therefore conclude they most likely belong to a less studied (wildlife) Taenia species that requires further characterisation. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Turner's prize[London transport policy

    Energy Technology Data Exchange (ETDEWEB)

    Sherrington, M.

    2000-10-26

    The article describes Ken Livingstone's plans for solving London's traffic problems: Derek Turner will be 'in charge of the capital's streets' but Livingstone will chair the board meetings. The radical new scheme will apply to both the Greater London Authority, its transport branch Transport for London (TfL) and 33 London Boroughs. Within TfL there is a core division called 'street management services' which has five area teams for day-to-day street management including road maintenance and street lighting. Other departments are communications, support services, traffic technology services, service development and performance, a London bus department and a department concentrating on congestion charging. There are plans to support pedestrians and cyclists but 'bus travel is really what it is all about'.

  19. Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer

    Science.gov (United States)

    2000-10-01

    Although it is interesting that the nature of this correlation chemistry are necessary to confirm this observation, the is different between the in...Bastholm L, Elling F, chemistry protocol, which may effect staining with some Georgiev G, Lukanidin E: Effect of mtsl ($100A4) expression on the...Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW: J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct

  20. Resources for Precision Analysis of Human Breast Cancer

    Science.gov (United States)

    2000-08-01

    correlation chemistry are necessary to confirm this observation, the, is different between the in vitro and in vivo situations, pattern of expression is...Feunteun 44. Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann C1 J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct...with progression-free survival, in prostate cancer [20]. expression but strong staining by immunohisto-S • chemistry were positive by western blot

  1. Cognitive and Neural Sciences Division 1991 Programs

    Science.gov (United States)

    1991-08-01

    interventions , for performance aiding, for certification and for performance evaluation. As the Navy modernizes those systems to take advantage of potential...2223-2237. Livingstone, M., Drislane, F. and Galaburda, A. (1991, in press) Physiological evidence for a magnocellular defect in dyslexia . Science. 201...develop training interventions to counter the effects of stress on performance. Progress: This grant is new in FY91. Outside Funding: Funds for this

  2. Genotoxic potency of mercuric chloride in gill cells of marine gastropod Planaxis sulcatus using comet assay

    Digital Repository Service at National Institute of Oceanography (India)

    Bhagat, J.; Ingole, B.S.

    in Thane Creek area Mumbai. Chemosphere 69 (6):972-978 Mitchelmore CL, Birmelin C, Chipman JK, Livingstone DR (1998) Evidence for cytochrome P-450 catalysis and free radical involvement in the production of DNA strand breaks by benzo[ a... mechanisms through which mercury can cause DNA damage. One of them are production of reactive oxygen species such as superoxide anion radical (O2 –), hydrogen peroxide (H2O2), and hydroxyl radicals (OH●) (Tsuzuki et al., 1994). The antioxidant mechanism...

  3. XML-Based SHINE Knowledge Base Interchange Language

    Science.gov (United States)

    James, Mark; Mackey, Ryan; Tikidjian, Raffi

    2008-01-01

    The SHINE Knowledge Base Interchange Language software has been designed to more efficiently send new knowledge bases to spacecraft that have been embedded with the Spacecraft Health Inference Engine (SHINE) tool. The intention of the behavioral model is to capture most of the information generally associated with a spacecraft functional model, while specifically addressing the needs of execution within SHINE and Livingstone. As such, it has some constructs that are based on one or the other.

  4. haematological values of appararently healthy sheep and goats

    African Journals Online (AJOL)

    Dr Olaleye

    Uquhart, G.M., Armour, J., Duncan, J.L., Dunn, A.M. and Jenning, F.W. (1992). Veterinary Parasitology,. Chuchill Livingstone Inc. New York, U.S.A. pp 4-244. Wilkins, J.H. and Hodges, R.E.D.H. (1962):. Observations on normal goats blood. Royal Army Vet. Corp. J. 33:7. Received: July 1998. Revised version accepted: June ...

  5. Marine debris: global and regional impacts

    OpenAIRE

    Torres N,Daniel; Berguño B,Jorge

    2011-01-01

    A synthesis on the Marine Debris problem is given upon de basis of the general knowledge on the matter as well as that obtained at Cape Shirreff, Livingston Island, South Shetland, Antarctica. It is suggested to improve the database on marine debris through permanent scientific research as well as with monitoring activities. It is necessary to coordinate key groups to apply strategies to identify types, sources, amount, interactions and socio-economic aspects of this global and regional probl...

  6. Terrebonne Parish-Wide Forced Drainage System, Terrebonne Parish, Louisiana.

    Science.gov (United States)

    1983-08-01

    the tide is subject to the effects of changing weather conditions (meteorological tides) ( Wax , Borengasser, R.A. Muller 1978). Livingston and Locks...P., M. Borengasser, G. Drew, R. Miller, B.L. Smith, Jr. and C. Wax . 1976. Barataria basin: hydrologic and climatologic processes. Louisiana State...1977. Contributions to the flora of Louisiana. II. Distribution and Identification of the Orchidaceae . Castena 42: 293-304. Pritchard, W., F.P

  7. Pursuit of X-ray Vision for Augmented Reality

    Science.gov (United States)

    2012-01-01

    applications. Virtual Reality 15(2–3), 175–184 (2011) 29. Livingston, M.A., Swan II, J.E., Gabbard , J.L., Höllerer, T.H., Hix, D., Julier, S.J., Baillot, Y...Brown, D., Baillot, Y., Gabbard , J.L., Hix, D.: A perceptual matching technique for depth judgments in optical, see-through augmented reality. In: IEEE

  8. Backstreet abortion: Women’s experiences

    OpenAIRE

    F. Makorah; K. Wood; R. Jewkes

    1997-01-01

    This was a descriptive study aimed at exploring the personal experiences of women who induce abortion and the circumstances surrounding induced abortion. The study was conducted in six public hospitals in four different provinces: Baragwanath (Gauteng), Groote Schuur and Tygerberg (Western Cape), King Edward and R.K. Khan (Kwa-Zulu/Natal) and Livingstone (Eastern Cape). In-depth interviews were conducted with 25 African, Indian and Coloured women admitted to the hospitals following backstreet...

  9. Challenging orthodoxies in digital literacy: young people’s practices online

    OpenAIRE

    Davies, Huw C.

    2015-01-01

    We are told the Web is different from previous mass communication technologies because its technical affordances have created an informational “Wild West” (Reevell (2007)). We are also told, that by overestimating their ‘savvy’, we have abandoned many young people to the risks of this frontier beyond regulation (Hargittai, 2010) (boyd, 2014) (Livingstone, 2007). Young people are therefore said to be vulnerable to untruths circulating on the Web such as health misinformation (Levin-Zamir, Lemi...

  10. Cisco (Coregonus artedii) mortalities in a southern Michigan lake, July 1968

    Science.gov (United States)

    Colby, Peter J.; Brooke, Larry T.

    1969-01-01

    Cisco die-offs are common in the summer in certain lakes of northern Indiana and southern Michigan, along the southern boundary of the national distribution of coregonine fishes. Although numerous cisco die-offs have been reported, few, if any, have been accompanied by environmental information at the time of the die-off. On 31 July and 1 August 1968, we investigated a cisco die-off on Halfmoon Lake, on the border of Washtenaw and Livingston Counties, Michigan.

  11. 75 FR 43556 - TA-W-73,381, MT Rail Link, Inc., Missoula, MT; TA-W-73,381A, Billings, MT; TA-W-73,381B, Laurel...

    Science.gov (United States)

    2010-07-26

    ... DEPARTMENT OF LABOR Employment and Training Administration TA-W-73,381, MT Rail Link, Inc., Missoula, MT; TA-W-73,381A, Billings, MT; TA-W-73,381B, Laurel, MT; TA-W-73,381C, Livingston, MT; TA-W-73... Helena, Montana. The amended notice applicable to TA-W-73,381 is hereby issued as follows: All workers of...

  12. Early Training Estimation System

    Science.gov (United States)

    1980-08-01

    first year efforts in CTES development were Cecil Wakelin, Gavin Livingstone, Ray Walsh« Peter Weddle, David Herlihy, Laurel Brown, Drs. Paul Ronco...and Society, 1980, pp. 1067-1974. David , J., Price, J. Successful communication in full scale engineering development statements of work. Air Force...1980, U.S. Army Engineering Laboratory. Shrier , S. Algorithms for system design. Proceedings of the International Conference on Cybernetics and

  13. Bilingualism and cognitive decline : a story of pride and prejudice

    OpenAIRE

    Woumans, Evy; Versijpt, Jan; Sieben, Anne; Santens, Patrick; Duyck, Wouter

    2017-01-01

    In a recent review, Mukadam, Sommerlad, and Livingston (2017) argue that bilingualism offers no protection against cognitive decline. The authors examined the results of 13 studies (five prospective, eight retrospective) in which monolinguals and bilinguals were compared for cognitive decline and onset of dementia symptoms. Analysis of four of the five prospective studies resulted in the conclusion that there was no difference between monolinguals and bilinguals, whereas seven of the eight re...

  14. China and Latin America: The Other Option

    Science.gov (United States)

    2017-06-09

    Guatemala, the U.S. planned and ousted Jacobo Arbenz by a coup because his tax policy adversely affected the Unit Fruit Company (Livingstone 2009, 26...China’s focus sectors: energy and mining (Diaz 2009). China is reliant on imports for over half of its oil consumption and the Chinese look towards the...137). Therefore, the researcher chose to focus the scope of analysis in chapter 4 on the countries of Brazil and Peru. The selection of Brazil was

  15. Quantifying downstream impacts of impoundment on flow regime and channel planform, lower Trinity River, Texas

    Science.gov (United States)

    Wellmeyer, Jessica L.; Slattery, Michael C.; Phillips, Jonathan D.

    2005-07-01

    As human population worldwide has grown, so has interest in harnessing and manipulating the flow of water for the benefit of humans. The Trinity River of eastern Texas is one such watershed greatly impacted by engineering and urbanization. Draining the Dallas-Fort Worth metroplex, just under 30 reservoirs are in operation in the basin, regulating flow while containing public supplies, supporting recreation, and providing flood control. Lake Livingston is the lowest, as well as largest, reservoir in the basin, a mere 95 km above the Trinity's outlet near Galveston Bay. This study seeks to describe and quantify channel activity and flow regime, identifying effects of the 1968 closure of Livingston dam. Using historic daily and peak discharge data from USGS gauging stations, flow duration curves are constructed, identifying pre- and post-dam flow conditions. A digital historic photo archive was also constructed using six sets of aerial photographs spanning from 1938 to 1995, and three measures of channel activity applied using a GIS. Results show no changes in high flow conditions following impoundment, while low flows are elevated. However, the entire post-dam period is characterized by significantly higher rainfall, which may be obscuring the full impact of flow regulation. Channel activity rates do not indicate a more stabilized planform following dam closure; rather they suggest that the Trinity River is adjusting itself to the stress of Livingston dam in a slow, gradual process that may not be apparent in a modern time scale.

  16. Parasites gastro-intestinaux d'antilopes et de buffles (Syncerus caffer brachyceros du ranch de gibier de Nazinga au Burkina Faso

    Directory of Open Access Journals (Sweden)

    Belem AMG.

    2009-01-01

    Full Text Available Gastro-intestinal parasites of antelopes and buffalos (Syncerus caffer brachyceros from the Nazinga game ranch in Burkina Faso. Parasitological survey done on the digestive tracts of antelopes [roans (Hippotragus equinus koba, hartebeests (Alcelaphus buselaphus major, defassa waterbucks (Kobus ellipsiprymnus defassa, oribis (Ourebia ourebi quadriscopa] and buffalos (Syncerus caffer brachyceros from the Nazinga game ranch in Burkina Faso allowed the identification of gastrointestinal parasites and the estimation of their prevalence and load. Nine different nematode species and three cestode species were found. Females and larvae of Cooperia were not identified up to the species level and were recognized as Cooperia spp. The nematode species found were: Haemonchus contortus, Trichostrongylus axei, Cooperia curticei, Cooperia spatulata, Skrjabinema sp., Trichostrongylus colubriformis, Trichuris ovis, Bunostomum phlebotomum, and Oesophagostomum sp. Cestodes’ species were: Moniezia expansa, Avitellina centripunctata, and Stilesia globipunctata. It was also noted without a thorough investigation the presence of Setaria labiato-papillosa in the abdominal cavity and paramphistomes in the rumen. In spite of the presence of parasites on the antelopes and buffalos, their killing out percentages (47.5 to 54.7% indicated a good physical status.

  17. Parasites of South African wildlife. XIX. The prevalence of helminths in some common antelopes, warthogs and a bushpig in the Limpopo province, South Africa.

    Science.gov (United States)

    Van Wyk, Ilana C; Boomker, Joop

    2011-11-10

    Little work has been conducted on the helminth parasites of artiodactylids in the northern and western parts of the Limpopo province, which is considerably drier than the rest of the province. The aim of this study was to determine the kinds and numbers of helminth that occur in different wildlife hosts in the area as well as whether any zoonotic helminths were present. Ten impalas (Aepyceros melampus), eight kudus (Tragelaphus strepsiceros), four blue wildebeest (Connochaetes taurinus), two black wildebeest (Connochaetes gnou), three gemsbok (Oryx gazella), one nyala (Tragelaphus angasii), one bushbuck (Tragelaphus scriptus), one waterbuck (Kobus ellipsiprymnus), six warthogs (Phacochoerus aethiopicus) and a single bushpig (Potamochoerus porcus) were sampled from various localities in the semi-arid northern and western areas of the Limpopo province. New host-parasite associations included Trichostrongylus deflexus from blue wildebeest, Agriostomum gorgonis from black wildebeest, Stilesia globipunctata from the waterbuck and Fasciola hepatica in a kudu. The mean helminth burden, including extra-gastrointestinal helminths, was 592 in impalas, 407 in kudus and blue wildebeest, 588 in black wildebeest, 184 in gemsbok, and 2150 in the waterbuck. Excluding Probstmayria vivipara, the mean helminth burden in warthogs was 2228 and the total nematode burden in the bushpig was 80. The total burdens and species richness of the helminths in this study were consistently low when compared with similar studies on the same species in areas with higher rainfall. This has practical implications when animals are translocated to areas with higher rainfall and higher prevalence of helminths.

  18. Plant resources in seven Jeonju City reservoirs: Osongjae, Gisijae, Sunggokjae, Gujujae, Seounjae, Hwanghakjae and Hacksojae

    Directory of Open Access Journals (Sweden)

    Dong-Ok Lim

    2014-09-01

    Full Text Available The vascular plants of the seven reservoirs of Jeonju City were identified as consisting of 309 taxa; 87 families, 231 genera, 270 species, 35 varieties, and four forms. Eight taxa of endemic Korean plants were identified, including Taxus cuspidata var. caepitosa and Aster koraiensis. Ten taxa of rare and endangered species were identified, including T. cuspidata and Penthorum chinense. A total of 26 taxa of floristic special plants were recorded: class V species (5 taxa included Magnolia kobus and Prunus yedoensis; class IV species (3 taxa included Prunus davidiana and Campanula takesimana; class III species (5 taxa included Acer palmatum and Alisma orientale. The hydrophytes of the seven reservoirs of Jeonju City were investigated and, of a total of 56 taxa, 46 taxa of emerged plants, two taxa of submerged plants, five taxa of floating-leaved plants, and three taxa of floating plants were identified. Thirty-two taxa of naturalized plants were identified. Among these, Sicyos angulatus, Lactuca scariola, Paspalum distichum var. indutum and P. distichum were identified, which are all wild plants that may disturb the ecosystem. The study suggests that these areas require management for the physical removal of these wild plants.

  19. The stopping power and energy straggling of the energetic C and O ions in polyimide

    Energy Technology Data Exchange (ETDEWEB)

    Mikšová, R., E-mail: miksova@ujf.cas.cz [Nuclear Physics Institute of the Academy of Science of the Czech Republic v.v.i, 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Macková, A. [Nuclear Physics Institute of the Academy of Science of the Czech Republic v.v.i, 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Slepička, P. [Department of Solid State Engineering, Institute of Chemical Technology, 166 28 Prague (Czech Republic)

    2016-03-15

    The stopping power and energy straggling of {sup 12}C{sup n+} and {sup 16}O{sup n+} heavy ions in the energy range 5.3–8.0 MeV in 8 μm thick polyimide (PI) foil were measured by means of an indirect transmission method using a half-covered a PIPS detector. Ions scattered from thin gold layer, under the scattering angle 150° were detected and the spectrum of ions penetrating the PI foil and without foil was recorded. The values of the experimentally determined stopping powers were compared to the calculated data by SRIM-2013 and MSTAR codes. Measured data were in good agreement with data calculated by SRIM-2013, especially for C ions was observed better agreement than for O ions. The energy straggling was determined and compared to those calculated by using Bohr’s, Bethe–Livingston and Yang models. The measured energy straggling values in the PI foil was corrected for foil roughness and thickness inhomogeneity determined from AFM. Bethe–Livingston predicting formula has been modified to make it appropriate for thicker targets. The energy straggling determined in our experiment was obtained higher than Bohr’s predicted value; the predictions by Yang are in good agreement with our experiment. Bethe–Livingston formulation of the energy straggling shows better agreement with the experimental data after the modified formula implementation which assumes that the thick target was consisted to be composed of n-number of thin layers. Influence of the charge-exchange phenomena to the energy straggling of C and O ions in PI was discussed.

  20. Effect of egg washing and correlation between cuticle and egg penetration by various Salmonella strains.

    Science.gov (United States)

    Gole, Vaibhav C; Roberts, Juliet R; Sexton, Margaret; May, Damian; Kiermeier, Andreas; Chousalkar, Kapil K

    2014-07-16

    In Australia, Europe and the United States, eggs and egg products are frequently associated with Salmonella food poisoning outbreaks. Many of the egg-associated Salmonella outbreaks have been due to the products such as mayonnaise, ice-cream and cold desserts which are eaten without cooking following the addition of raw egg. The ability of four Salmonella isolates (one each of S. Singapore, S. Adelaide, S. Worthington and S. Livingstone) to penetrate washed and unwashed eggs using whole egg and agar egg penetration methods was investigated in the current study. The results of the agar penetration experiment indicated that all the isolates used in the present study have the capacity to penetrate the eggshell. Eggshell penetration by the S. Worthington isolate was higher but not significant (p=0.06) in washed eggs compared to unwashed eggs. However, for all other isolates (S. Singapore, S. Adelaide and S. Livingstone), there was no significant difference in penetration of washed and unwashed eggs. Statistical analysis indicated that cuticle score was a significant linear predictor of Salmonella eggshell penetration. Whole egg penetration results showed that all of the Salmonella isolates used in the present study were capable of surviving on the eggshell surface after 21days of incubation (at 20°C) following a high dose of inoculation (10(5)CFU/mL). The combined data of all isolates demonstrated that, the survival rate of Salmonella on eggshells (inoculated with 10(5)CFU/mL) was significantly higher (p=0.002) at 20°C as compared to 37°C. S. Singapore, S. Worthington, and S. Livingstone were not detected in egg internal contents whereas S. Adelaide was detected in one egg's internal contents. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.

  1. Evaluation of antimicrobial resistance among Salmonella and Shigella isolates in the University Hospital "St. George," Plovdiv, Bulgaria.

    Science.gov (United States)

    Petrov, Michael M; Petrova, Atanaska; Stanimirova, Irina; Mircheva-Topalova, Marina; Koycheva, Lalka; Velcheva, Rayna; Stoycheva-Vartigova, Mariana; Raycheva, Ralitsa; Asseva, Galina; Petrov, Petar; Kardjeva, Velichka; Murdjeva, Marianna

    2017-03-01

    The aim of this work is to study the epidemiology and antimicrobial resistance to the most commonly used antibiotics for the treatment of acute gastroenteritis caused by Salmonella and Shigella at the largest Bulgarian hospital-University Hospital "St. George," Plovdiv-for the period 2009-2013. Two hundred ninety strains were in vitro tested for resistance to 15 antimicrobial agents. The presence of extended-spectrum beta-lactamases (ESBLs) was demonstrated by a variety of specialized tests. For comparison, a collection of 28 strains submitted by the National Reference Laboratory (NRL) "Enteric Infections" at the National Center of Infectious and Parasitic Diseases (NCIPD), Sofia, was also tested for the production of ESBLs. In isolates, phenotypically demonstrated as ESBL producers, polymerase chain reaction (PCR) detection of the genes bla-CTX-M, bla-SHV, and bla-TEM was performed. Among the 290 tested isolates, only two- Salmonella serotype Livingstone and Shigella flexneri-were phenotypically proven to be ESBL producers. Only 4 strains from the collection of 28, submitted from the NRL "Intestinal Infections" in NCIPD, Sofia, were phenotypically confirmed as ESBL producers. The presence of the bla-CTX-M gene was detected in all of the tested strains (4 from NRL, NCIPD, Sofia, and 2 from the University Hospital St. George, Plovdiv), the bla-SHV gene only in strain S. Livingstone from Plovdiv, and the bla-TEM gene in two from Sofia and one (again S. Livingstone) from Plovdiv. In conclusion, Salmonella and Shigella isolates from patients hospitalized at the University Hospital St. George, Plovdiv, with acute gastroenteritis demonstrate good susceptibility to the most commonly used antibiotic agents, including azithromycin.

  2. Environmental radionuclides tracers and timers of terrestrial processes

    CERN Document Server

    Froehlich, Klaus

    2009-01-01

    The book presents a state-of-the-art summary of knowledge on the use of radionuclides to study processes and systems in the continental part of the Earth's environment. It is conceived as a companion to the two volumes of this series, which deal with isotopes as tracers in the marine environment (Livingston, Marine Radioactivity) and with the radioecology of natural and man-made terrestrial systems (Shaw, Radioactivity in Terrestrial Ecosystems). Although the book focuses on natural and anthropogenic radionuclides (radioactive isotopes), it also refers to stable environmental isotopes, which i

  3. A data analysis technique for the LIGO-ALLEGRO stochastic background search

    International Nuclear Information System (INIS)

    Whelan, John T; Bose, Sukanta; Hanson, Jonathan; Heng, Ik Siong; Johnson, Warren W; McHugh, Martin P; Zhang, Peter

    2005-01-01

    We describe the cross-correlation measurements being carried out on data from the LIGO Livingston Observatory and the ALLEGRO resonant bar detector. The LIGO data are sampled at 16 384 Hz while the ALLEGRO data are base-banded, i.e., heterodyned at 899 Hz and then sampled at 250 Hz. We handle these different sampling parameters by working in the Fourier domain, and demonstrate the approximate equivalence of this measurement to a hypothetical time-domain method in which both data streams are upsampled

  4. Stochastic background search correlating ALLEGRO with LIGO engineering data

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, John T [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Daw, Edward [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Heng, Ik Siong [Max-Planck-Institut fuer Gravitationsphysik, Albert-Einstein-Institut, Aussenstelle Hannover, D-30167 Hannover (Germany); McHugh, Martin P [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Lazzarini, Albert [LIGO Laboratory, California Institute of Technology, Pasadena, CA 91125 (United States)

    2003-09-07

    We describe the role of correlation measurements between the LIGO interferometer in Livingston, LA, and the ALLEGRO resonant bar detector in Baton Rouge, LA, in searches for a stochastic background of gravitational waves. Such measurements provide a valuable complement to correlations between interferometers at the two LIGO sites, since they are sensitive in a different, higher, frequency band. Additionally, the variable orientation of the ALLEGRO detector provides a means to distinguish gravitational wave correlations from correlated environmental noise. We describe the analysis underway to set a limit on the strength of a stochastic background at frequencies near 900 Hz using ALLEGRO data and data from LIGO's E7 Engineering Run.

  5. A data analysis technique for the LIGO-ALLEGRO stochastic background search

    Energy Technology Data Exchange (ETDEWEB)

    Whelan, John T [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Bose, Sukanta [Washington State University, Pullman, Washington 99164 (United States); Hanson, Jonathan [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Heng, Ik Siong [Department of Physics and Astronomy, University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Johnson, Warren W [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States); McHugh, Martin P [Department of Physics, Loyola University, New Orleans, Louisiana 70118 (United States); Zhang, Peter [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, Louisiana 70803 (United States)

    2005-09-21

    We describe the cross-correlation measurements being carried out on data from the LIGO Livingston Observatory and the ALLEGRO resonant bar detector. The LIGO data are sampled at 16 384 Hz while the ALLEGRO data are base-banded, i.e., heterodyned at 899 Hz and then sampled at 250 Hz. We handle these different sampling parameters by working in the Fourier domain, and demonstrate the approximate equivalence of this measurement to a hypothetical time-domain method in which both data streams are upsampled.

  6. Stochastic background search correlating ALLEGRO with LIGO engineering data

    International Nuclear Information System (INIS)

    Whelan, John T; Daw, Edward; Heng, Ik Siong; McHugh, Martin P; Lazzarini, Albert

    2003-01-01

    We describe the role of correlation measurements between the LIGO interferometer in Livingston, LA, and the ALLEGRO resonant bar detector in Baton Rouge, LA, in searches for a stochastic background of gravitational waves. Such measurements provide a valuable complement to correlations between interferometers at the two LIGO sites, since they are sensitive in a different, higher, frequency band. Additionally, the variable orientation of the ALLEGRO detector provides a means to distinguish gravitational wave correlations from correlated environmental noise. We describe the analysis underway to set a limit on the strength of a stochastic background at frequencies near 900 Hz using ALLEGRO data and data from LIGO's E7 Engineering Run

  7. A Prospective Investigation of Injury Incidence and Risk Factors Among Army Recruits in Combat Engineer Training

    Science.gov (United States)

    2013-03-05

    Sports 1997, 7:304–311. 23. Knapik JJ, Spiess A, Swedler D, Grier T, Darakjy S, Amoroso P, Jones BH: Injury risk factors in parachuting and...reducing parachute-related ankle injuries. Med Sci Sports Exerc 2004, 36:S312. 26. Knapik JJ, Grier T, Spiess A, Swedler DI, Hauret KG, Graham B, Yoder...Knapik JJ, Spiess A, Darakjy S, Grier T, Manning F, Livingstone E, Swedler D, Amoroso P, Jones BH: Risk factors for parachute injuries and comments about

  8. Healing bodies or saving souls? Reverend Dr Peter Parker (1804-1888) as medical missionary.

    Science.gov (United States)

    Fu, Louis

    2016-05-01

    The important role played by medical services in the preaching of the Gospel in China was undeniable. Anglo-American missionaries entered Canton in the early 18th century and introduced modern Western medicine to China. Reverend Dr Peter Parker, founder of medical missionaries to China, was more than that, far more advanced than his predecessors including Drs Pearson, Livingstone and Colledge. He was an enthusiastic missionary of exceptional ability and vigour as witnessed his labours at the Canton Ophthalmic Hospital. His 20 years in the medical field unexpectedly paved the way for his future career as a diplomat in the American Legation. © © IMechE 2014.

  9. Theory of relations

    CERN Document Server

    Fraïssé, R

    2011-01-01

    The first part of this book concerns the present state of the theory of chains (= total or linear orderings), in connection with some refinements of Ramsey's theorem, due to Galvin and Nash-Williams. This leads to the fundamental Laver's embeddability theorem for scattered chains, using Nash-Williams' better quasi-orderings, barriers and forerunning.The second part (chapters 9 to 12) extends to general relations the main notions and results from order-type theory. An important connection appears with permutation theory (Cameron, Pouzet, Livingstone and Wagner) and with logics (existence criter

  10. Measurement of the orbital angular momentum density of light by modal decomposition

    CSIR Research Space (South Africa)

    Schulze, C

    2013-07-01

    Full Text Available indices for light fields possessing orbital angular momentum Appl. Phys. Lett. 100 231115 [17] Hickmann J M, Fonseca E J S, Soares W C and Cha´vez-Cerda S 2010 Unveiling a truncated optical lattice associated with a triangular aperture using light’s... fields J. Opt. Soc. Am. A 24 3500–7 [39] Lee W-H 1979 Binary computer-generated holograms Appl. Opt. 18 3661–9 [40] Born M and Wolf E 1991 Principles of Optics (Cambridge: Cambridge University Press) [41] Berry H G, Gabrielse G and Livingston A E 1977...

  11. Genotoxicity of cadmium chloride in the marine gastropod Nerita chamaeleon using comet assay and alkaline unwinding assay

    Digital Repository Service at National Institute of Oceanography (India)

    Sarkar, A.; Bhagat, J.; Ingole, B.S.; Rao, P.V.S.S.D.P.; Markad, V.L.

    cell lines. Toxicology 126:103–114. Mitchelmore CL, Birmelin C, Chipman JK, Livingstone DR. 1998. Evidence for cytochrome P-450 catalysis and free radical involvement in the production of DNA strand breaks by benzo[a]pyrene and nitroaromatics... Lymnaea luteola L. Aquat Toxicol 124:83-90. Anderson D, Yu TW, Phillips BJ, Schmezer P. 1994. The effect of various antioxidants and other modifying agents on oxygen-radical-generated DNA damage in human lymphocytes in the Comet assay. Mutat Res...

  12. Remarkable rates of lightning strike mortality in Malawi.

    Science.gov (United States)

    Mulder, Monique Borgerhoff; Msalu, Lameck; Caro, Tim; Salerno, Jonathan

    2012-01-01

    Livingstone's second mission site on the shore of Lake Malawi suffers very high rates of consequential lightning strikes. Comprehensive interviewing of victims and their relatives in seven Traditional Authorities in Nkhata Bay District, Malawi revealed that the annual rate of consequential strikes was 419/million, more than six times higher than that in other developing countries; the rate of deaths from lightning was 84/million/year, 5.4 times greater than the highest ever recorded. These remarkable figures reveal that lightning constitutes a significant stochastic source of mortality with potential life history consequences, but it should not deflect attention away from the more prominent causes of mortality in this rural area.

  13. Field trip report: Observations made at Yucca Mountain, Nye County, Nevada. Special report No. 2

    International Nuclear Information System (INIS)

    Hill, C.A.

    1993-03-01

    A field trip was made to the Yucca Mountain area on December 5-9, 1992 by Jerry Frazier, Don Livingston, Christine Schluter, Russell Harmon, and Carol Hill. Forty-three separate stops were made and 275 lbs. of rocks were collected during the five days of the field trip. Key localities visited were the Bare Mountains, Yucca Mountain, Calico Hills, Busted Butte, Harper Valley, Red Cliff Gulch, Wahmonie Hills, Crater Flat, and Lathrop Wells Cone. This report only describes field observations made by Carol Hill. Drawings are used rather than photographs because cameras were not permitted on the Nevada Test Site during this trip

  14. Investigations of hydro-tectonic hazards at the proposed Yucca Mountain high-level nuclear waste repository. Annual report - Nevada

    International Nuclear Information System (INIS)

    Livingston, D.E.

    1994-01-01

    This document includes several reports describing scientific studies of the origin of near surface calcite/silica deposits at Yucca Mountain, Nevada. The origin of these deposits is controversial and the authors have extended and strengthened the basis of their arguments for epigenetic, metasomatic alteration of the tuffs at Yucca Mountain. This report includes stratigraphic, mineralogical, and geochronological information along with geochemical data to support the conclusions described by Livingston and Szymanski. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database

  15. A fragilidade das Instituições Sociais e o rompimento da Ética no filme Agnes de Deus.

    OpenAIRE

    Marco Antonio Palermo Moretto

    2015-01-01

    Research about the fragilities of the social institutions in the movie Agnes of God and the ethic and moral. There are a mistery in the story:a murder of the baby inside the convent.  The young nun, Agnes killed her baby and a psichiatrist. Dra. Martha Livingstone  begans a investigation since the childhood of Agnes until the crime. The presence of the Superior Mother, Mirian Ruth is important to the story. She is an administrator and protect Agnes in many situations. Such social institutions...

  16. On constraining the speed of gravitational waves following GW150914

    CERN Document Server

    Blas, Diego; Sawicki, Ignacy; Sibiryakov, Sergey

    2016-07-31

    We point out that the observed time delay between the detection of the signal at the Hanford and Livingston LIGO sites from the gravitational wave event GW150914 places an upper bound on the speed of propagation of gravitational waves, $c_{gw}\\lesssim 1.7$ in the units of speed of light. Combined with the lower bound from the absence of gravitational Cherenkov losses by cosmic rays that rules out most of subluminal velocities, this gives a model-independent double-sided constraint $1\\lesssim c_{gw}\\lesssim 1.7$. We compare this result to model-specific constraints from pulsar timing and cosmology.

  17. Ikke bare porno på mobilen

    DEFF Research Database (Denmark)

    Andersen, Tem Frank

    2013-01-01

    Den britiske børne- og ungdomsforsker professor Sonia Livingstone ved London School of Economics viser gennem en række interviews, at billeder af eksplicitte sexhandlinger er en velkendt del af den ungdommelige cirkulation af ’hverdagspornografisk’ materiale (Ringrose et al. 2012). ’Sexting’ er a...... altså ikke bare porno på en mobilplatform. Det er handlinger og værgestrategier, som unge piger er nødt til at forholde sig til i hverdagen, mens drengene umiddelbart ser ud til at slippe relativt let udenom den chikane, der kan ligge i ’sexting’....

  18. Backstreet abortion: Women’s experiences

    Directory of Open Access Journals (Sweden)

    F. Makorah

    1997-05-01

    Full Text Available This was a descriptive study aimed at exploring the personal experiences of women who induce abortion and the circumstances surrounding induced abortion. The study was conducted in six public hospitals in four different provinces: Baragwanath (Gauteng, Groote Schuur and Tygerberg (Western Cape, King Edward and R.K. Khan (Kwa-Zulu/Natal and Livingstone (Eastern Cape. In-depth interviews were conducted with 25 African, Indian and Coloured women admitted to the hospitals following backstreet abortions. The study gave women the opportunity to "speak for themselves" about "why" and "how" and the context in which the unscfe induced abortions occurred

  19. The Gull Sees Farthest Who Flies Highest

    Science.gov (United States)

    Pirri, Anthony N.

    2005-04-01

    The proverb from Richard Bach's book Jonathan Livingston Seagull expresses the theme that he in life who thinks and acts ahead of the flock lives live to the fullest and enjoys the freedom that is the very nature of being. This keynote address will give examples of three noted professionals who were not content to make small improvements in technology but strove to make giant leaps. Their work became the driving force for those of us who became their followers in seeking fulfillment from our professional lives.

  20. Isolation of Campylobacter spp. from Three Species of Antarctic Penguins in Different Geographic Locations.

    Science.gov (United States)

    García-Peña, F J; Llorente, M T; Serrano, T; Ruano, M J; Belliure, J; Benzal, J; Herrera-León, S; Vidal, V; D'Amico, V; Pérez-Boto, D; Barbosa, A

    2017-03-01

    The presence of Campylobacter species was studied in three Antarctic penguin species, Adélie (Pygoscelis adeliae), chinstrap (Pygoscelis antarctica) and gentoo (Pygoscelis papua). A total of 390 penguins were captured in 12 different rookeries along the Antarctic Peninsula with differences in the amount of human visitation: six colonies were highly visited [Stranger Point, King George Island (P. papua and P. adeliae); Hannah Point, Livingston Island (P. papua and P. antarctica); Deception Island (P. antarctica); and Paradise Bay, Antarctic Peninsula (P. papua)], and six colonies were rarely visited [Devil's Point, Byers Peninsula, Livingston Island (P. papua); Cierva Cove, Antarctic Peninsula (P. papua); Rongé Island (P. papua and P. antarctica); Yalour Island (P. adeliae); and Avian Island (P. adeliae)]. A total of 23 strains were isolated from penguins from nine different rookeries. Campylobacter lari subsp. lari was isolated from eight samples (seven from P. papua and one from P. adeliae); C. lari subsp. concheus from 13 (ten from P. adeliae and three from P. antarctica) and C. volucris from two samples (both from P. papua). We did not find any significant differences in the prevalence of Campylobacter spp. between the populations in highly and rarely visited areas. This is the first report of C. lari subsp. concheus and C. volucris isolation from penguins in the Antarctic region.

  1. A search for the volcanomagnetic signal at Deception volcano (South Shetland I., Antarctica

    Directory of Open Access Journals (Sweden)

    J. M. Ibáñez

    1997-06-01

    Full Text Available After the increase in seismic activity detected during the 1991-1992 summer survey at Deception Island, the continuous measurement of total magnetic intensity was included among the different techniques used to monitor this active volcano. The Polish geomagnetic observatory Arctowski, located on King George Island, served as a reference station, and changes in the differences between the daily mean values at both stations were interpreted as indicators of volcanomagnetic effects at Deception. A magnetic station in continuous recording mode was also installed during the 1993-1994 and 1994-1995 surveys. During the latter, a second magnetometer was deployed on Deception Island, and a third one in the vicinity of the Spanish Antarctic Station on Livingston Island (at a distance of 35 km and was used as a reference station. The results from the first survey suggest that a small magma injection, responsible for the seismic re-activation, could produce a volcanomagnetic effect, detected as a slight change in the difference between Deception and Arctowski. On the other hand, a long term variation starting at that moment seems to indicate a thermomagnetic effect. However the short register period of only two stations do not allow the sources to be modelled. The future deployment of a magnetic array during the austral summer surveys, throughout the volcano, and of a permanent geomagnetic observatory at Livingston I. is aimed at further observations of magnetic transients of volcanic origin at Deception Island.

  2. Seroprevalences of antibodies to Neospora caninum and Toxoplasma gondii in zoo animals.

    Science.gov (United States)

    Sedlák, K; Bártová, E

    2006-03-31

    Neospora caninum is an apicomplexan parasite that causes neuromuscular disease in dogs and abortions in cattle. Little is known about the prevalence of antibodies to this parasite in zoo animals. Sera from 556 animals, from 13 Czech and Slovak zoos were tested for antibodies to N. caninum and Toxoplasma gondii by indirect fluorescent antibody test. Antibodies to N. caninum were found in 31 of 556 zoo animals (5.6%), representing 18 of 114 species tested: Eurasian wolf (Canis lupus lupus), Maned wolf (Chrysocyon brachyurus), fennec (Vulpes zerda), cheetah (Acinonyx jubatus), jaguarundi (Herpailurus yaguarondi), Eurasian lynx (Lynx lynx), Indian lion (Panthera leo goojratensis), fisher (Martes pennanti), blackbuck (Antilope cervicapra), European bison (Bison bonasus), lechwe (Kobus leche), African buffalo (Syncerus caffer caffer), eland (Taurotragus oryx), sitatunga (Tragelaphus spekei gratus), Thorold's deer (Cervus albirostris), Eastern elk (C. elaphus canadensis), Vietnam sika deer (C. nippon pseudaxis) and Père David's deer (Elaphurus davidianus). Titres ranged from 1:40 to 1:2560. The highest prevalence 50% was found in family mustelidae of the order carnivora. Antibodies to T. gondii were detected in 193 of 556 zoo animals (34.7%) representing 72 of 114 species tested, with titres ranging from 1:40 to 1:40960. The highest prevalence 100% was found in families: hyaenidae, mustelidae, ursidae and viveridae of the order carnivora. The results of this study indicate that zoo animals have more exposure to T. gondii than to N. caninum. It is the first report of seroprevalence of antibodies to N. caninum in European zoo animals.

  3. Protecting cows in small holder farms in East Africa from tsetse flies by mimicking the odor profile of a non-host bovid.

    Directory of Open Access Journals (Sweden)

    Rajinder K Saini

    2017-10-01

    Full Text Available For the first time, differential attraction of pathogen vectors to vertebrate animals is investigated for novel repellents which when applied to preferred host animals turn them into non-hosts thereby providing a new paradigm for innovative vector control. For effectively controlling tsetse flies (Glossina spp., vectors of African trypanosomosis, causing nagana, repellents more powerful than plant derived, from a non-host animal the waterbuck, Kobus ellipsiprymnus defassa, have recently been identified. Here we investigate these repellents in the field to protect cattle from nagana by making cattle as unattractive as the buck.To dispense the waterbuck repellents comprising guaiacol, geranylacetone, pentanoic acid and δ-octalactone, (patent application we developed an innovative collar-mounted release system for individual cattle. We tested protecting cattle, under natural tsetse challenge, from tsetse transmitted nagana in a large field trial comprising 1,100 cattle with repellent collars in Kenya for 24 months. The collars provided substantial protection to livestock from trypanosome infection by reducing disease levels >80%. Protected cattle were healthier, showed significantly reduced disease levels, higher packed cell volume and significantly increased weight. Collars >60% reduced trypanocide use, 72.7% increase in ownership of oxen per household and enhanced traction power (protected animals ploughed 66% more land than unprotected. Land under cultivation increased by 73.4%. Increase in traction power of protected animals reduced by 69.1% acres tilled by hand per household per ploughing season. Improved food security and household income from very high acceptance of collars (99% motivated the farmers to form a registered community based organization promoting collars for integrated tsetse control and their commercialization.Clear demonstration that repellents from un-preferred hosts prevent contact between host and vector, thereby

  4. Investigations of natural groundwater hazards at the proposed Yucca Mountain high level nuclear waste repository. Part A: Geology at Yucca Mountain. Part B: Modeling of hydro-tectonic phenomena relevant to Yucca Mountain. Annual report - Nevada

    International Nuclear Information System (INIS)

    Szymanski, J.S.; Schluter, C.M.; Livingston, D.E.

    1993-05-01

    This document is an annual report describing investigations of natural groundwater hazards at the proposed Yucca Mountain, Nevada High-Level Nuclear Waste Repository.This document describes research studies of the origin of near surface calcite/silica deposits at Yucca Mountain. The origin of these deposits is controversial and the authors have extended and strengthened the basis of their arguments for epigenetic, metasomatic alteration of the tuffs at Yucca Mountain. This report includes stratigraphic, mineralogical, and geochronological information along with geochemical data to support the conclusions described by Livingston and Szymanski, and others. As part of their first annual report, they take this opportunity to clarify the technical basis of their concerns and summarize the critical geological field evidence and related information. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database

  5. New technologies for a future superconducting proton collider

    International Nuclear Information System (INIS)

    Malamud, E.; Foster, G.W.

    1996-06-01

    New more economic approaches are required to continue the dramatic exponential rise in particle accelerator energies as represented by the well-known Livingston plot. The old idea of low-cost, low-field iron dominated magnets in a small diameter pipe may become feasible in the next decade with dramatic recent advances in technology: (1) high T c superconductors operating at liquid N 2 or H 2 temperatures, (2) advanced tunneling technologies for small diameter, non human accessible tunnels, (3) accurate remote guidance systems for boring machine steering, (4) industrial applications of remote manipulation and robotics, and (5) digitally multiplexed electronics to minimize cables There is an opportunity for mutually beneficial partnerships between the High Energy Physics community and the commercial sector to develop the necessary technology. This will gain public support, a necessary part of the challenge of building a new, very high energy collider

  6. Everyday Struggels with Technology

    DEFF Research Database (Denmark)

    Mahnke, Martina; Schwartz, Sander Andreas

    2017-01-01

    Technology has not only become an integral part of people’s lives but also of people’s everyday struggles. Struggles with technology are complex in nature; we tend to not only struggle with their basic functions but also with how they make us feel. During the course of our life we tend to master...... and struggle with technology in different ways. This struggle has been studied in relation to media literacy (Livingstone, 2004), to domestication theory (Silverstone et al. 1992), or in everyday life (Bakardjieva, 2005). This work enhances these lines of studies by exploring everyday struggles with technology...... from a life stage (Erikson, 1959) point of view. In particular, we explore what are common struggles people have with technology and what are distinct struggles in relation to life stages. In conclusion, we will present our findings by outlining what we call ‘technological biographies’. Those...

  7. On the time lags of the LIGO signals

    International Nuclear Information System (INIS)

    Creswell, James; Von Hausegger, Sebastian; Liu, Hao; Naselsky, Pavel; Jackson, Andrew D.

    2017-01-01

    To date, the LIGO collaboration has detected three gravitational wave (GW) events appearing in both its Hanford and Livingston detectors. In this article we reexamine the LIGO data with regard to correlations between the two detectors. With special focus on GW150914, we report correlations in the detector noise which, at the time of the event, happen to be maximized for the same time lag as that found for the event itself. Specifically, we analyze correlations in the calibration lines in the vicinity of 35 Hz as well as the residual noise in the data after subtraction of the best-fit theoretical templates. The residual noise for the other two events, GW151226 and GW170104, exhibits similar behavior. A clear distinction between signal and noise therefore remains to be established in order to determine the contribution of gravitational waves to the detected signals.

  8. Analysis of Windscale and Bikini atoll sediments for Am-242m

    International Nuclear Information System (INIS)

    Beasley, T.M.

    1976-01-01

    Bowen and Livingston have recently reported the existence of 242 Am in both 1962 nuclear test debris and in a marine algae sample (kelp) contaminated by nuclear fuel reprocessing wastes. The presence of 242m Am (T 1/2 = 152y) was deduced by measuring its daughter product, 242C m. In the case of the fallout debris, the long decay time (25 years) between collection and analysis was argued to preclude the possibility of unsupported 242 Cm being present in the sample. The non-adherence to simple radiometric decay of the 242 Cm measured in two aliquots of the algae sample suggested that a small percentage of the isotope (≈ 3%) was in fact supported by its longer lived parent

  9. LA MOVILIZACIÓN DE LOS GARÍFUNAS PARA PRESERVAR SUS TIERRAS «ANCESTRALES» EN GUATEMALA

    OpenAIRE

    Nicolás Rey

    2009-01-01

    Livingston, en el noreste de Guatemala, es la «ciudad negra» de ese país que cuenta con una población de mayoría maya. Los derechos de los garífunas, mayas y xincas —recuperación de tierras ancestrales, valorización de su identidad y desarrollo socioeconómico— fueron inscritos en los Acuerdos de Paz, 1995-1996. Este artículo, resultado de una amplia investigación, presenta la increíble trayectoria de los garífunas: - un pueblo «en resistencia» nacido en las Antillas Menores, del encuentr...

  10. Basic Data Report for Drillhole SNL-3 (C-2949)

    Energy Technology Data Exchange (ETDEWEB)

    Dennis W. Powers; Washington Regulatory and Environmental Services

    2005-01-20

    SNL-3 (permitted by the New Mexico State Engineer as C-2949) was drilled to provide geological data and hydrological testing of the Culebra Dolomite Member of the Permian Rustler Formation within a dissolution reentrant north of the WIPP site and well east of Livingston Ridge. SNL-3 is located in the southeast quarter of section 34, T21S, R31E, in eastern Eddy County, New Mexico. SNL-3 was drilled to a total depth of 970 ft below ground level (bgl). Below surface dune sand, SNL-3 encountered, in order, the Mescalero caliche, Gatuna, Dewey Lake, Rustler, and upper Salado Formations. Two intervals were cored: (1) from the lower Forty-niner Member through the Magenta Dolomite and into the upper Tamarisk Member; and (2) from the lower Tamarisk Member through the Culebra Dolomite and Los Meda?os Members and into the uppermost Salado.

  11. The Protestant medical missions to China: the introduction of Western medicine with vaccination.

    Science.gov (United States)

    Fu, Louis

    2013-05-01

    Modern medicine in China began with the arrival of Anglo-American Protestant missionaries in the early 19th century. Conditions were vastly different from the times of the Jesuits in Peking during the 17th and 18th centuries, when the priests enjoyed the endorsement of the Court and high officials. Faced with hostile and xenophobic officialdom and populace, surgeons of the British East India Company in collaboration with missionaries took the initiative. In 1805 Dr Alexander Pearson (1780-1874) introduced smallpox vaccination in Macao and Canton. Reverend Dr Robert Morrison (1782-1834) of the London Missionary Society with another East India Company Surgeon, Dr John Livingstone (1829) opened a dispensary for the poor in Macao in 1820. These pioneers paved the way for later Anglo-American medical missionaries who revolutionized medical practice in China.

  12. The effect of a thin silver layer on the critical current of epitaxial YBCO films

    International Nuclear Information System (INIS)

    Polturak, E.; Koren, G.; Cohen, D.; Cohen, D.; Snapiro, I.

    1992-01-01

    We compare measurements of the critical current density of an epitaxial YBCO film with that of an identical film overlaid by a thin silver layer. We find that the presence of the silver lowers Tc of the film by about 1.5 K, which is two orders of magnitude larger than predicted by the theory of the proximity effect for our experimental conditions. In addition, J c of the Ag/YBCO film near Tc is also significantly lower than that of the bare YBCO film. We propose two alternate interpretations of this effect, one in terms of destabilization of the flux distribution in the film and the other making use of the effect of the silver on the Bean-Livingston surface barrier for the initial penetration of flux. The latter seems the more plausible explanation of our results. (orig.)

  13. Congratulations on the direct detection of gravitational waves

    CERN Multimedia

    2016-01-01

    This week saw the announcement of an extraordinary physics result: the first direct detection of gravitational waves by the LIGO Scientific Collaboration, which includes the GEO team, and the Virgo Collaboration, using the twin Laser Interferometer Gravitational-wave Observatory (LIGO) detectors located in Livingston, Louisiana, and Hanford, Washington, USA.   Albert Einstein predicted gravitational waves in a paper published 100 years ago in 1916. They are a natural consequence of the theory of general relativity, which describes the workings of gravity and was published a few months earlier. Until now, they have remained elusive. Gravitational waves are tiny ripples in space-time produced by violent gravitational phenomena. Because the fractional change in the space-time geometry can be at the level of 10-21 or smaller, extremely sophisticated, high-sensitivity instruments are needed to detect them. Recently, the Advanced LIGO detector increased its sensitivity by alm...

  14. A versatile analog device for identifying charged particles by their energies and ionizing powers

    International Nuclear Information System (INIS)

    Harmanci, Ali Emre

    1971-06-01

    The various methods of identification previously used are discussed; particular attention is given to an ΔE-E telescope. The usual approximations of the equation of Beth-Livingstone are examined and a more universal formula is given. It is shown that when this formula is applied to the case of light particles (p, d, t, H e 3 , α) identification over a wide energy range is possible. The equipment operates logarithmically using analog operators. The identifier possesses certain number of special features, especially concerning the logarithmic converters and the base line restorers. High accuracy, speed, and a good performance at high counting rates have been achieved. Experimental results confirm the performance of the equipment and the validity of the formulas used. A large number of particles corresponding to Z = 8, were identified. (author) [fr

  15. Effect of twinning plane on superconductor magnetic properties

    International Nuclear Information System (INIS)

    Buzdin, A.I.; Kuptsov, D.A.

    1989-01-01

    Effect of twinning planes on pinning of the Abrikosov vortices in superconductors of the second order with the Ginsburg-Landau parameter, κ >> 1, is considered. The modified Ginsburg-Landau functional, where the effect of superconducting properties improvement near the twinning plane is taken into account by adding the additional δ-function component, is used to descibe superconductivity of twinning plane. Force of interaction of a vortex filament and the twinning plane is calculated. It is shown that in case of the twinning plane opaque to electrons, additional attractive force, being analogous to that occurring in the problem on the surface Been-Livingston barrier, affects the vortex filament. The results can explain anisotropy of vortex pinning observed in the periodic twinning structure in high-temperature superconductors

  16. Precise measurements of energy loss straggling for swift heavy ions in polymers

    Science.gov (United States)

    Rani, Bindu; Neetu; Sharma, Kalpana; Diwan, P. K.; Kumar, Shyam

    2016-11-01

    The energy loss straggling measurements for heavy ions with Z = 3-22 (∼0.2-2.5 MeV/u) in PEN (C7H5O2) and PET (C10H8O4) polymers have been carried out utilizing the swift heavy ion beam facility from 15UD Pelletron accelerator at Inter University Accelerator Centre (IUAC), New Delhi, India. The recorded spectra are analyzed in such a way that the Straggling associated with energy loss process could be measured in a systematic manner at any selected value of energy, in terms of per unit thickness of the absorber, at any desired energy intervals. The measured values have been compared with the calculated values obtained from the most commonly used Bethe-Livingston formulations applicable for collisional straggling. The results are tried to be understood in terms of the effective charge on the impinging ion within the absorber. Some interesting trends are observed.

  17. Advanced LIGO status

    International Nuclear Information System (INIS)

    Dwyer, S

    2015-01-01

    Advanced LIGO is currently in the final stages of installation and early commissioning. In the design of Advanced LIGO a key goal was the ability to detect gravitational waves from compact object binary inspirals, as these are thought to be the most likely candidates for early detections with ground based interferometers. Special emphasis has been placed on improving the low frequency sensitivity relative to the first generations of LIGO, in addition to improving the high frequency sensitivity by increasing the laser power. The interferometer in Livingston Louisiana has been locked (continuously held within the linear operating range) and noise investigations have begun, and the major installation activities for the interferometer at Hanford, Washington are completed. (paper)

  18. The occurrence of pycnogonids associated with the volcanic structures of Bransfield Strait central basin (Antarctica

    Directory of Open Access Journals (Sweden)

    Tomás Munilla

    2007-12-01

    Full Text Available Fifty-four specimens of pycnogonids belonging to twenty-two species, eight genera and six families were collected with a rocky dredge during the cruise Gebrap-96 in the central basin of Bransfield Strait, from depths between 647 and 1592 m. The richest station in terms of abundance and biomass was DR6 (south of Livingston Island, which was also the shallowest one; at this relatively shallow depth food is more available than in deeper waters. The families Nymphonidae and Colossendeidae had the same number of specimens (21 specimens; 39% abundance each. The most abundant species were Nymphon villosum and N. proximum. Pallenopsis buphthalmus was collected for only the third time. The collections increased the geographical distribution of three species and the depth range of six species. The volcanic structures sampled were inactive during 1996, since none of the specimens showed signs of hydrothermal phenomena. This collection was typically representative of the west Antarctic benthic zone.

  19. Conducting evaluation research with children exposed to violence: How technological innovations in methodologies and data collection may enhance the process.

    Science.gov (United States)

    Wall, Michael A; Jenney, Angelique; Walsh, Margaret

    2018-01-20

    Research and program evaluation processes that engage children and youth are becoming much more common due to influences from children's rights and the acknowledgement that children have the capacity to contribute to research, both as participants and co-researchers (Roberts, 2017). Recent technological advances in the form of tablet and internet-based applications have provided researchers with additional methodological tools to better capture the voices and experiences of children and their caregivers (Livingstone & Blum-Ross, 2017). However, little has been written on the ways in which these new technological advances can improve research experiences for children who have been exposed to intimate partner and family violence, as well as other forms of traumatic experiences. This paper provides a review of current literature and a case study example of how one children's mental health agency has implemented tablet-based data collection procedures. Copyright © 2018. Published by Elsevier Ltd.

  20. LIGO: The strong belief

    CERN Multimedia

    Antonella Del Rosso

    2016-01-01

    Twenty years of designing, building and testing a number of innovative technologies, with the strong belief that the endeavour would lead to a historic breakthrough. The Bulletin publishes an abstract of the Courier’s interview with Barry Barish, one of the founding fathers of LIGO.   The plots show the signals of gravitational waves detected by the twin LIGO observatories at Livingston, Louisiana, and Hanford, Washington. (Image: Caltech/MIT/LIGO Lab) On 11 February, the Laser Interferometer Gravitational-Wave Observatory (LIGO) and Virgo collaborations published a historic paper in which they showed a gravitational signal emitted by the merger of two black holes. These results come after 20 years of hard work by a large collaboration of scientists operating the two LIGO observatories in the US. Barry Barish, Linde Professor of Physics, Emeritus at the California Institute of Technology and former Director of the Global Design Effort for the Internat...

  1. On the time lags of the LIGO signals

    Energy Technology Data Exchange (ETDEWEB)

    Creswell, James; Von Hausegger, Sebastian; Liu, Hao; Naselsky, Pavel [The Niels Bohr Institute and Discovery Center, Blegdamsvej 17, DK-2100 Copenhagen (Denmark); Jackson, Andrew D., E-mail: dgz764@alumni.ku.dk, E-mail: s.vonhausegger@nbi.dk, E-mail: jackson@nbi.dk, E-mail: liuhao@nbi.dk, E-mail: naselsky@nbi.dk [Niels Bohr International Academy, Blegdamsvej 17, DK-2100 Copenhagen (Denmark)

    2017-08-01

    To date, the LIGO collaboration has detected three gravitational wave (GW) events appearing in both its Hanford and Livingston detectors. In this article we reexamine the LIGO data with regard to correlations between the two detectors. With special focus on GW150914, we report correlations in the detector noise which, at the time of the event, happen to be maximized for the same time lag as that found for the event itself. Specifically, we analyze correlations in the calibration lines in the vicinity of 35 Hz as well as the residual noise in the data after subtraction of the best-fit theoretical templates. The residual noise for the other two events, GW151226 and GW170104, exhibits similar behavior. A clear distinction between signal and noise therefore remains to be established in order to determine the contribution of gravitational waves to the detected signals.

  2. A fragilidade das Instituições Sociais e o rompimento da Ética no filme Agnes de Deus.

    Directory of Open Access Journals (Sweden)

    Marco Antonio Palermo Moretto

    2015-04-01

    Full Text Available Research about the fragilities of the social institutions in the movie Agnes of God and the ethic and moral. There are a mistery in the story:a murder of the baby inside the convent.  The young nun, Agnes killed her baby and a psichiatrist. Dra. Martha Livingstone  begans a investigation since the childhood of Agnes until the crime. The presence of the Superior Mother, Mirian Ruth is important to the story. She is an administrator and protect Agnes in many situations. Such social institutions are showed as Family, Religion and the Justice. Methods are explained: questions and the hipnosis. Agnes has mistics experiences and reveal the conflict between cience and religion.

  3. Children as digital rights agents

    DEFF Research Database (Denmark)

    Stald, Gitte Bang

    2016-01-01

    This paper looks at children’s involvement and contribution to internet safety policy. In many respects, the research perspective on children and young people has also seen a shift towards the child as agent, as citizen (Livingstone 2002, 2009; Dahlgren 2007). With increasing attention given...... to children’s communication rights there is an acknowledgement that children’s voices should be heard in all matters that affect them (Hamelink 2008). We still, however, primarily discuss how adults could and should take responsibility in guarding children and young people from risk and harm, and what...... the role of the “adult world” is. We need to focus more on the active role that children and adolescents play, according to age, skills and various capacities, in identifying, reflecting upon and acting according to opportunities and challenges in relation to digital media and digital rights (Hartman et al...

  4. The origin and history of alteration and carbonatization of the Yucca Mountain ignimbrites. Volume I

    International Nuclear Information System (INIS)

    Szymanski, J.S.

    1992-04-01

    This document contains Volume I of the report entitled The Origin and History of Alteration and Carbonatization of the Yucca Mountain Ignimbrites by Jerry S. Szymanski and a related correspondence with comments by Donald E. Livingston. In the Great Basin, the flow of terrestrial heat through the crust is affected in part by the flow of fluids. At Yucca Mountain, the role of fluids in crustal heat transport is manifested at the surface by youthful calcretes, sinters, bedrock veins, hydrothermal eruption breccias and hydrothermal alteration. This report discusses evidence for recent metasomatism high in the stratigraphic section at Yucca Mountain. Over the last several hundred years, episodes of calcite emplacement contemporaneous with local mafic volcanism have occurred at intervals that are not long in comparison with the isolation time required for a High-Level Radioactive Waste repository

  5. An Information Retrieval and Recommendation System for Astronomical Observatories

    Science.gov (United States)

    Mukund, Nikhil; Thakur, Saurabh; Abraham, Sheelu; Aniyan, A. K.; Mitra, Sanjit; Sajeeth Philip, Ninan; Vaghmare, Kaustubh; Acharjya, D. P.

    2018-03-01

    We present a machine-learning-based information retrieval system for astronomical observatories that tries to address user-defined queries related to an instrument. In the modern instrumentation scenario where heterogeneous systems and talents are simultaneously at work, the ability to supply people with the right information helps speed up the tasks for detector operation, maintenance, and upgradation. The proposed method analyzes existing documented efforts at the site to intelligently group related information to a query and to present it online to the user. The user in response can probe the suggested content and explore previously developed solutions or probable ways to address the present situation optimally. We demonstrate natural language-processing-backed knowledge rediscovery by making use of the open source logbook data from the Laser Interferometric Gravitational Observatory (LIGO). We implement and test a web application that incorporates the above idea for LIGO Livingston, LIGO Hanford, and Virgo observatories.

  6. Basic Data Report for Drillhole SNL-3 (C-2949) (Waste Isolation Pilot Plant)

    International Nuclear Information System (INIS)

    Powers, Dennis W.

    2005-01-01

    SNL-3 (permitted by the New Mexico State Engineer as C-2949) was drilled to provide geological data and hydrological testing of the Culebra Dolomite Member of the Permian Rustler Formation within a dissolution reentrant north of the WIPP site and well east of Livingston Ridge. SNL-3 is located in the southeast quarter of section 34, T21S, R31E, in eastern Eddy County, New Mexico. SNL-3 was drilled to a total depth of 970 ft below ground level (bgl). Below surface dune sand, SNL-3 encountered, in order, the Mescalero caliche, Gatuna, Dewey Lake, Rustler, and upper Salado Formations. Two intervals were cored: (1) from the lower Forty-niner Member through the Magenta Dolomite and into the upper Tamarisk Member; and (2) from the lower Tamarisk Member through the Culebra Dolomite and Los Medanos Members and into the uppermost Salado.

  7. South Louisiana Enhanced Oil Recovery/Sequestration R&D Project Small Scale Field Tests of Geologic Reservoir Classes for Geologic Storage

    Energy Technology Data Exchange (ETDEWEB)

    Hite, Roger [Blackhorse Energy LLC, Houston, TX (United States)

    2016-10-01

    The project site is located in Livingston Parish, Louisiana, approximately 26 miles due east of Baton Rouge. This project proposed to evaluate an early Eocene-aged Wilcox oil reservoir for permanent storage of CO2. Blackhorse Energy, LLC planned to conduct a parallel CO2 oil recovery project in the First Wilcox Sand. The primary focus of this project was to examine and prove the suitability of South Louisiana geologic formations for large-scale geologic sequestration of CO2 in association with enhanced oil recovery applications. This was to be accomplished through the focused demonstration of small-scale, permanent storage of CO2 in the First Wilcox Sand. The project was terminated at the request of Blackhorse Energy LLC on October 22, 2014.

  8. Transport properties of high-temperature superconductors: Surface vs bulk effect

    International Nuclear Information System (INIS)

    Burlachkov, L.; Koshelev, A.E.; Vinokur, V.M.

    1996-01-01

    We investigate surface-related transport properties of high-temperature superconductors. We find the mean vortex velocity under applied transport current determined by the activation energies for vortex penetration and exit through the Bean-Livingston barrier. We determine the current distribution between the surfaces of superconductor and the field and current dependencies of the transport activation energies. For a three-dimensional superconductor the transport activation energy, U s 3D , is found to decrease with the external field, H, and transport current, J, as U s 3D ∝H -1/2 and U s 3D ∝J -1/2 , respectively. In the quasi-two-dimensional compounds, U s 2D decays logarithmically with field and current. The interplay between the surface and the bulk contributions to the transport properties, such as current-voltage characteristics, is discussed. copyright 1996 The American Physical Society

  9. Ubiquitous media in everyday practices of grief and commemoration on children’s graves and online memorial sites

    DEFF Research Database (Denmark)

    Sandvik, Kjetil; Christensen, Dorthe Refslund

    is not allocated to a specific period of time (a time of mourning) but that grieving and the social technologies like media, materiality and ritualization related to it are embedded in everyday life practices and have to be conceived of as processes rather than events that (suddenly) occur and then are over......’s graves in urban cemeteries. It is, however, also similarly apparent in the formation of network and peer-to-peer associations and, not the least, in the establishment of online networks and sites of grief and commemoration on social media. Facebook, Twitter and YouTube are media alive with discussions...... as such (Featherstone 1992, Elias 1998) and in relation to death practices (Gibson 2008). In recent years, media research has contributed to the field of death studies. Mediatization studies have focused on how various societal practices are influenced by media logics (Livingstone 2009, Lundby 2009) including religious...

  10. Report on field research of the Spanish Antarctic Campaign 2014/15: a cooperative international research project with the 56th Japanese Antarctic Research Expedition

    Directory of Open Access Journals (Sweden)

    Sakae Kudoh

    2015-07-01

    Full Text Available A study on the limnological and ecological characteristics of maritime Antarctic lakes on Byers Peninsula, Livingstone Island, South Shetland Islands, West Antarctica, was conducted by the Spanish Antarctic Research Campaign during the 2014/15 season, in cooperation with the research program of the 56th Japanese Antarctic Research Expedition. Limnological surveys of three hillside lakes and three lagoons near beaches were conducted under conditions of heavy snow cover. Soils and biological samples in the catchment areas of the lakes and lagoons were also collected and analyzed. The hillside lakes were covered by thick ice and snow, which maintained winter water conditions in the lakes, such as irreversible stratification, oxygen depletion of bottom water, very weak underwater light conditions, etc., even in mid-January, although swimming zooplankton were abundant. Water samples were also collected in coastal lagoons and streams, an environment in which birds and marine mammals transport materials through the aquatic system.

  11. Gamma-ray-burst beaming and gravitational-wave observations.

    Science.gov (United States)

    Chen, Hsin-Yu; Holz, Daniel E

    2013-11-01

    Using the observed rate of short-duration gamma-ray bursts (GRBs) it is possible to make predictions for the detectable rate of compact binary coalescences in gravitational-wave detectors. We show that the nondetection of mergers in the existing LIGO/Virgo data constrains the beaming angles and progenitor masses of gamma-ray bursts, although these limits are fully consistent with existing expectations. We make predictions for the rate of events in future networks of gravitational-wave observatories, finding that the first detection of a neutron-star-neutron-star binary coalescence associated with the progenitors of short GRBs is likely to happen within the first 16 months of observation, even in the case of only two observatories (e.g., LIGO-Hanford and LIGO-Livingston) operating at intermediate sensitivities (e.g., advanced LIGO design sensitivity, but without signal recycling mirrors), and assuming a conservative distribution of beaming angles (e.g., all GRBs beamed within θ(j) = 30°). Less conservative assumptions reduce the waiting time until first detection to a period of weeks to months, with an event detection rate of >/~10/yr. Alternatively, the compact binary coalescence model of short GRBs can be ruled out if a binary is not seen within the first two years of operation of a LIGO-Hanford, LIGO-Livingston, and Virgo network at advanced design sensitivity. We also demonstrate that the gravitational wave detection rate of GRB triggered sources (i.e., those seen first in gamma rays) is lower than the rate of untriggered events (i.e., those seen only in gravitational waves) if θ(j)≲30°, independent of the noise curve, network configuration, and observed GRB rate. The first detection in gravitational waves of a binary GRB progenitor is therefore unlikely to be associated with the observation of a GRB.

  12. Vitamin D status among indigenous Mayan (Kekchi) and Afro-Caribe (Garifuna) adolescents from Guatemala: a comparative description between two ethnic groups residing on the Rio Dulce at the Caribbean coast in Izabal Province, Guatemala.

    Science.gov (United States)

    Naqvi, Ali; Solomons, Noel W; Campos, Raquel; Soto-Méndez, María José; Caplan, Emily; Armas, Laura; Bermudez, Odilia I

    2017-07-01

    To assess vitamin D status and the influence of risk factors such as skin pigmentation and time spent outdoors on hypovitaminosis D among Guatemalan Kekchi and Garifuna adolescents. Cross-sectional study, with convenient sampling design. Blood samples, anthropometric and behavioural data were all collected during the dry season. Serum 25-hydroxyvitamin D (25(OH)D) concentrations were measured by RIA. Communities of Rio Dulce and Livingston, Izabal Province, Caribbean coast of Guatemala, with latitude and longitude of 15°49'N and 88°45'W for Livingston and 15°46'N and 88°49'W for Rio Dulce, respectively. Eighty-six adolescents, divided evenly by sex and ethnicity, with mean age of 14 years. Mean (sd) 25(OH)D value was 27·8 (7·2) ng/ml for the total group, with 25·8 (5·9) and 29·8 (7·9) ng/ml, respectively, in Kekchis and Garifunas (P=0·01). Use of vitamin D supplementation, clothing practices and sun protection were not statistically different between groups. Skin area exposed on the day of data collection ranged from 20·0 % minimum to 49·4 % maximum, with mean (sd) exposure of 32·0 (8.5) %. With univariate regression analysis, age (P=0·034), sex (P=0·044), ethnicity (P=0·010), time spent outdoors (P=0·006) and percentage skin area exposed (P=0·001) were predictive. However, multivariate analysis indicated that only sex (P=0·034) and percentage skin area exposed (P=0·044) remained as predictors of 25(OH)D. Despite residing in an optimal geographic location for sunlight exposure, nearly 65 % of study adolescents were either insufficient or deficient in vitamin D. Correction and long-term prevention of this nutritional problem may be instrumental in avoiding adverse effects in adulthood attributed to low 25(OH)D during adolescence.

  13. Hair penalties: The negative influence of Afrocentric hair on ratings of Black women's dominance and professionalism.

    Directory of Open Access Journals (Sweden)

    Tina R. Opie

    2015-08-01

    Full Text Available Purpose: Women are penalized if they do not behave in a stereotype-congruent manner (Eagly & Carli, 2007; Heilman, 1983; 2001. For example, because women are not expected to be agentic they incur an agency penalty for expressing anger, dominance or assertiveness (Brescoll & Uhlmann, 2008; Eagly & Karau, 2002; Livingston, Rosette, & Washington, 2012; Rudman, 1998; Rudman & Fairchild, 2004; Rudman & Glick, 1999, 2001. Yet, all women are not equally penalized (Livingston, Rosette, & Washington, 2012. We make a novel contribution by examining how both White and Black evaluators respond to Black women’s dominance, in this case, whether Black women choose to wear Afrocentric or Eurocentric hairstyles. Design/methodology/approach: We conducted three experimental studies to examine the influence of target hairstyle and participant race on ratings of the target’s professionalism (Studies 1, 2 and 3 and dominance (Study 2. Study 1 was an online experimental study with 200 participants (112 females, 87 males, 1 missing gender; 160 Whites, 19 Blacks, 11 Latinos, 7 Asian Americans and 3 who identify as other; Mage= 35.5, SD = 11.4. Study 2 was an online experimental study with 510 participants (276 women, 234 males; 256 Blacks, 254 Whites; Mage = 41.25 years, SD = 12.21. Study 3 was an online experimental study with 291 participants (141 Blacks, 150 Whites, Mage= 47.5 years, SD = 11.66. Findings: Black, as compared to White, evaluators gave higher agency penalties to Black employment candidates when they donned Afrocentric versus Eurocentric hair, rating them as more dominant and less professional. Implications: The present research illustrates the significance of considering both target and evaluator race when examining the influence of agency, and specifically dominance, on ratings of professionalism.

  14. Modern technology to support carers of care recipients with dementia or functional mental illness: promising progress, but a long road ahead.

    Science.gov (United States)

    Lautenschlager, Nicola T; Diehl-Schmid, Janine; Loi, Samantha M; Mayer, Johannes; Tensil, Maria; Kurz, Alexander F

    2017-12-01

    There is no doubt that family carers who look after a family member with dementia or with a functional mental illness fulfill an important role, not only for their loved one, but also for the health and aged care systems of the countries they live in. Due to increasing life expectancy, but also improved healthcare the number of family carers supporting older care recipients with functional mental illness or dementia is on the rise. While the carer role often can offer rewarding experiences caregivers are at increased risk of stress, depression, sleep problems, and often experience poor health outcomes with increased morbidity and mortality (Oyebode, 2003). Next to the stressors directly associated with the carer role, they often do not have the time to engage in healthy behavior to protect their physical, mental, and cognitive health (Loi et al., 2014). There is a wealth of literature providing evidence about effective strategies to support carers and the recent Lancet Commission on Dementia prevention, intervention, and care highlighted the importance of exploring how the use of technological innovations could support carers better (Livingston et al., 2017). The use of modern technology in this context can mean a variety of approaches, such as internet-based programs to provide education and skill-building, virtual support to assist with monitoring and managing challenging behavior, online support groups, and the use of assistive or therapeutic technology to improve safety, enable positive activities, and support communication between carer and care recipient, to name just a few (D'Onofrio et al., 2017; Ienca et al., 2017; Livingston et al., 2017). More specifically, telehealth approaches via videoconferences have the potential to better support carers who live in rural or remote regions (O'Connell et al., 2014) or who cannot attend face-to-face support programs for other reasons such as inability to leave the care recipient alone at home, being a multiple carer

  15. Fundamentals - longitudinal motion

    International Nuclear Information System (INIS)

    Weng, W.T.

    1989-01-01

    There are many ways to accelerate charged particles to high energy for physics research. Each has served its purpose but eventually has encountered fundamental limitations of one kind or another. Looking at the famous Livingston curve, the initial birth and final level-off of all types of accelerators is seen. In fact, in the mid-80s we personally witnessed the creation of a new type of collider - the Stanford Linear Collider. Also witnessed, was the resurgence of study into novel methods of acceleration. This paper will cover acceleration and longitudinal motion in a synchrotron. A synchrotron is a circular accelerator with the following three characteristics: (1) Magnetic guiding (dipole) and confinement (quadrupole) components are placed in a small neighborhood around the equilibrium orbit. (2) Particles are kept in resonance with the radio-frequency electric field indefinitely to achieve acceleration to higher energies. (3) Magnetic fields are varied adiabatically with the energy of the particle. D. Edwards described the transverse oscillations of particles in a synchrotron. Here the author talks about the longitudinal oscillations of particles. The phase stability principle was invented by V. Veksler and E. McMillan independently in 1945. The phase stability and strong focusing principle, invented by Courant and Livingston in 1952, enabled the steady energy gain of accelerators and storage rings witnessed during the past 30 years. This paper is a unified overview of the related rf subjects in an accelerator and a close coupling between accelerator physics and engineering practices, which is essential for the major progress in areas such as high intensity synchrotrons, a multistage accelerator complex, and anti-proton production and cooling, made possible in the past 20 years

  16. A review of bear farming and bear trade in Lao People's Democratic Republic

    Directory of Open Access Journals (Sweden)

    E. Livingstone

    2018-01-01

    Full Text Available This study reviews the bear farming industry in Lao PDR with the objective of documenting the current number of commercial bear facilities (i.e. captive bear facilities judged to be trading in bear bile and/or bears and bear parts and the number of bears contained within these facilities, noting changes since it was last examined between 2000 and 2012 by Livingstone and Shepherd (2014. We surveyed all known commercial bear facilities and searched for previously unrecorded facilities. We compared our records with Livingstone and Shepherd (2014 and corrected some duplicate records from their study. In 2017, we recorded seven commercial facilities; four dedicated bear farms, and three tiger farms that were reportedly also keeping bears. We found that between 2012 and 2017 the recorded number of dedicated bear farms reduced by two, and the recorded number of tiger farms also keeping bears increased by one. Within the same period, the total number of captive bears among all facilities in Lao PDR hardly changed (+one, but the number of bears within each facility did. The northern facilities, owned by ethnic Chinese, have expanded since 2012, and central and southern facilities have downsized or closed. While bear farming appears to be downsizing in Lao PDR overall, efforts to phase it out are undermined by the expansion of foreign owned facilities in the north, within Special and Specific Economic Zones that largely cater to a Chinese market, and where the Lao government's efforts to enforce laws and protect wildlife appear to be lacking. Closing the facilities in the north will require political will and decisive law enforcement. Keywords: Bear farms, Bear bile, Gall bladder, Urso-deoxycholic acid, Bear bile extraction facilities, Lao PDR, Ursus thibetanus

  17. Byers Peninsula: A reference site for coastal, terrestrial and limnetic ecosystem studies in maritime Antarctica

    Science.gov (United States)

    Quesada, A.; Camacho, A.; Rochera, C.; Velázquez, D.

    2009-11-01

    This article describes the development of an international and multidisciplinary project funded by the Spanish Polar Programme on Byers Peninsula (Livingston Island, South Shetlands). The project adopted Byers Peninsula as an international reference site for coastal and terrestrial (including inland waters) research within the framework of the International Polar Year initiative. Over 30 scientists from 12 countries and 26 institutions participated in the field work, and many others participated in the processing of the samples. The main themes investigated were: Holocene changes in climate, using both lacustrine sediment cores and palaeo-nests of penguins; limnology of the lakes, ponds, rivers and wetlands; microbiology of microbial mats, ecology of microbial food webs and viral effects on aquatic ecosystems; ornithology, with investigations on a Gentoo penguin rookery ( Pygoscelis papua) as well as the flying ornithofauna; biocomplexity and life cycles of species from different taxonomic groups; analysis of a complete watershed unit from a landscape perspective; and human impacts, specifically the effect of trampling on soil characteristics and biota. Byers Peninsula offers many features as an international reference site given it is one of the largest ice-free areas in the Antarctic Peninsula region, it has a variety of different landscape units, and it hosts diverse aquatic ecosystems. Moreover, the Byers Peninsula is a hotspot for Antarctic biodiversity, and because of its high level of environmental protection, it has been very little affected by human activities. Finally, the proximity to the Spanish polar installations on Livingston Island and the experience derived from previous expeditions to the site make it logistically feasible as a site for ongoing monitoring and research.

  18. Characterisation of the wildlife reservoir community for human and animal trypanosomiasis in the Luangwa Valley, Zambia.

    Directory of Open Access Journals (Sweden)

    Neil E Anderson

    2011-06-01

    Full Text Available Animal and human trypanosomiasis are constraints to both animal and human health in Sub-Saharan Africa, but there is little recent evidence as to how these parasites circulate in wild hosts in natural ecosystems. The Luangwa Valley in Zambia supports high densities of tsetse flies (Glossina species and is recognised as an historical sleeping sickness focus. The objective of this study was to characterise the nature of the reservoir community for trypanosomiasis in the absence of influence from domesticated hosts.A cross-sectional survey of trypanosome prevalence in wildlife hosts was conducted in the Luangwa Valley from 2005 to 2007. Samples were collected from 418 animals and were examined for the presence of Trypanosoma brucei s.l., T. b. rhodesiense, Trypanosoma congolense and Trypanosoma vivax using molecular diagnostic techniques. The overall prevalence of infection in all species was 13.9% (95% confidence interval [CI]: 10.71-17.57%. Infection was significantly more likely to be detected in waterbuck (Kobus ellipsiprymnus (Odds ratio [OR]=10.5, 95% CI: 2.36-46.71, lion (Panthera leo (OR=5.3, 95% CI: 1.40-19.69, greater kudu (Tragelaphus strepsiceros (OR=4.7, 95% CI: 1.41-15.41 and bushbuck (Tragelaphus scriptus (OR=4.5, 95% CI: 1.51-13.56. Bushbucks are important hosts for T. brucei s.l. while the Bovidae appear the most important for T. congolense. The epidemiology of T. vivax was less clear, but parasites were detected most frequently in waterbuck. Human infective T. b. rhodesiense were identified for the first time in African buffalo (Syncerus caffer and T. brucei s.l. in leopard (Panthera pardus. Variation in infection rates was demonstrated at species level rather than at family or sub-family level. A number of significant risk factors interact to influence infection rates in wildlife including taxonomy, habitat and blood meal preference.Trypanosoma parasites circulate within a wide and diverse host community in this bio

  19. 'Life?': modernism and liminality in Douglas Livingstone’s A littoral zone

    Directory of Open Access Journals (Sweden)

    E. Terblanche

    2006-07-01

    Full Text Available In an attempt to find his place within nature in South Africa and in a global modern context, Douglas Livingstone returns strongly to modernist poetry in his 1991 volume A littoral zone. In contrast to his predecessors like Wallace Stevens in “The glass of water” and T.S. Eliot in The waste land, this volume at critical moments gets stuck in a liminal stage. Images and poems, and eventually the volume as a whole, despite the highlights they present, say that it no longer seems so possible to end up also within the postliminal stage, so as to complete a rite of passage. Yet modernist poems such as Stevens’s “The glass of water” have the ability to end up in postliminal affirmation through and beyond the liminal stage of the overall process. Here light becomes a thirsty lion that comes down to drink from the glass, with a resultant transcendence of the dualistic between-ness that characterises the liminal stage in the modernist poetic mode, while this further results in the incorporation of a deeper and refreshing, dynamic unity. Even more remarkable is that this poetic rite is not of a closing nature, but open, especially in the sense that it affirms all that is possible and greater than the individual ego or subject, this, while getting stuck within a liminal stage just short of the postliminal stage can be in the nature of closure, as Livingstone shows, for example, when he says in “Low tide at Station 20” that humanity is trapped in its inability to see the original power of unity with and within nature in order to live within it; and while humanity remains an ugly outgrowth on the gigantic spine of evolution. In provisional conclusion this article finds that it will be better to view Victor Turner’s 1979 celebration of what he terms the “liminoid” in the place of a “true liminality” critically. Although it is impossible to return to a collective catharsis in watching a play, one cannot feel too comfortable about

  20. Viewpoint (Gustav-Adolf Voss)

    International Nuclear Information System (INIS)

    Anon.

    1995-01-01

    Retiring after a distinguished f i career, including 14 years at the Cambridge (Massachusetts) Electron Accelerator and 22 years as Head of the Accelerator Department at the DESY Laboratory in Hamburg (March/April, page 6), Gustav-Adolf Voss was invited to give a 'Personal Perspective of High Energy Accelerators' at the Particle Accelerator Conference in Dallas, Texas, in May, of which we publish an abbreviated version. At the beginning of this year I retired as Head of the Accelerator Department at the Deutsches Elektronen Synchrotron, DESY, in Hamburg, a position I had held for 22 years. An invitation to talk gives me a chance to thank my teachers, colleagues and friends from the 37 years I have been working in the accelerator field. My first teachers were Stanley M. Livingston, Ken Robinson and Tom L. Collins. It is widely known that Livingston built the first working cyclotron as his PhD thesis under Ernest Lawrence. It is also known that Lawrence was inspired with the cyclotron idea by reading Rolf Wideroe's pioneer linear accelerator paper in 1927. Rolf Wideroe, although 93 now, is still full of ideas, which he sometimes tries out on me. Accelerator science does not have a long history. Ken Robinson was the legendary genius who developed most of the theory of electron synchrotrons and storage rings single-handed and in whose unpublished papers, found after his death, the basics of the free electron laser had been developed, a full 10 years ahead of time. Tom Collins was Assistant Director at the Cambridge Electron Accelerator (CEA), my first real workplace. He developed the 'Collins Straight Section' and furthered my technical education. Among my CEA colleagues and friends were also Karl Strauch, John Rees, Ewan Paterson, Herman Winick and Albert Hofmann. When I started in the accelerator field, life was different. The first atomic bomb had been exploded not much more than a decade earlier and the prestige of the nuclear physicist was

  1. Magnetic flux dynamics in superconducting materials

    International Nuclear Information System (INIS)

    Hernandez Nieves, Alexander

    2004-01-01

    The magnetization curves, the Bean-Livingston barrier in type I and type II superconductors, the ac magnetic response, the effects of thermal fluctuations on the magnetic behavior and the different dissipation mechanism at microwave frequencies are investigated in mesoscopic superconductors.For small mesoscopic samples we study the peaks and discontinuous jumps found in the magnetization as a function of magnetic field.To interpret these jumps we consider that vortices located inside the sample induce a reinforcement of the Bean- Livingston surface barrier at fields greater than the first penetration field Hp1.This leads to multiple penetration fields Hpi Hp1;Hp2;Hp3;... for vortex entrance in mesoscopic samples.For low-T c mesoscopic superconductors we found that the meta-stable states due to the surface barrier have a large half-life time, which leads to the hysteresis in the magnetization curves as observed experimentally.A very different behavior appears for high-T c mesoscopic superconductors where thermally activated vortex entrance/exit through surface barriers is frequent.This leads to a reduction of the magnetization and a non-integer average number of flux quanta penetrating the superconductor.At microwave frequencies we found that each vortex penetration event produces a significant suppression of the ac losses since the imaginary part of the ac susceptibility X ( H d c) as a function of the magnetic field (Hdc) increases before the penetration of vortices and then it decreases abruptly after vortices have entered into the sample.We show that nascent vortices (vortices that are partly inside the sample and nucleated at the surface) play an important role in the dynamic behavior of mesoscopic samples. In type I macroscopic superconductors with first-principles simulations of the TDGL equations we have been able to reproduce several features of the intermediate state observed in experiments.Particularly, droplet and striped patterns are obtained depending

  2. Multiple Nonconformities in Ice-Walled Lake Successions Indicate Periods with Cold Summers (24.4 - 22.5 ka, 21.1 - 19.2 ka, 18.5 - 18.1 ka) during the Last Deglaciation in Northeastern Illinois, USA

    Science.gov (United States)

    Curry, B. B.

    2014-12-01

    Unprecedented age control on many last glacial stratigraphic units and morainal ice-margin positions are interpreted from AMS radiocarbon ages of tundra plant macrofossils archived in low-relief ice-walled lake plain (IWLP) deposits the Lake Michigan Lobe (south-central Laurentide Ice Sheet). IWLPs are periglacial features that formed on morainal dead-ice permafrost. Lacustrine sediment, and the fossils contained therein, had physical and temporal proximity to the glacier which formed the underlying moraine. In modern ice-walled lakes, as the lake's ice cover begins to melt, moats form which allows access of sloughing tundra-mantled active layer sediment (soil) into the lakes. Multiple AMS ages from two sites with proglacial sediment buried by glacial max LIS diamicton, and IWLPs reveal evidence of episodic plant growth and sedimentation including ca. 24.0 to 24.4 ka (post Shelby Phase), 22.5 to 21.1 ka (post Livingston Phase), 18.1 to 17.4 ka (post Woodstock Phase). Although presently based on negative evidence, the associated nonconformities (listed in title) indicate periods when cold conditions did not promote development of the estival moat. Although the evidence does not preclude tundra growth during the cold summers, there was little landscape modification due to limited thawing of the active layer. At approximately the onset of the 19.2-18.5 "warm" period, at least two large deglacial discharge events flooded the Fox and Kankakee tributary valleys of the Illinois River. The latter, known as the Kankakee Torrent, occurred at 19.05 - 18.85 ka (σ1 range) at the Oswego channel complex. The temporal coincidence of the torrents and sedimentation in ice-walled lakes suggests that the post-Livingston Phase nonconformity (21.1 - 19.2 ka) was a period of lessened meltwater discharge through subglacial conduits (tunnel valleys) as the frozen toe promoted formation of subglacial lakes, buildup of pore-water pressures, and the release of subglacial water as "torrents

  3. LA MOVILIZACIÓN DE LOS GARÍFUNAS PARA PRESERVAR SUS TIERRAS «ANCESTRALES» EN GUATEMALA

    Directory of Open Access Journals (Sweden)

    Nicolás Rey

    2009-12-01

    Full Text Available Livingston, en el noreste de Guatemala, es la «ciudad negra» de ese país que cuenta con una población de mayoría maya. Los derechos de los garífunas, mayas y xincas —recuperación de tierras ancestrales, valorización de su identidad y desarrollo socioeconómico— fueron inscritos en los Acuerdos de Paz, 1995-1996. Este artículo, resultado de una amplia investigación, presenta la increíble trayectoria de los garífunas: - un pueblo «en resistencia» nacido en las Antillas Menores, del encuentro entre indígenas caribes y negros cimarrones durante la colonización y la esclavitud; luego deportado a América Central, - que está reconquistando «espacios» como la tierra, lo político... gracias a una dinámica social compleja que une los vivos a los muertos —culto a los ancestros—, en alianza a veces con otros grupos mayas y ladinos.   ABSTRACT Livingston, in the northeast of Guatemala, is a «black city» in a country with a predominantly Maya population. The rights of the Garinagu, Maya and Xinca—the recovery of their ancestral lands, the value placed on their identity, and socio-economic development—were enshrined in the peace agreements (1995-1996. This article, resulting from an extensive research project, describes the incredible story of the Garinagu: - a people in «resistance» born in the Lesser Antilles from the encounter between Carib Indians and black runaway slaves, during colonization and slavery, later deported to Central America - who are reconquering «spaces» such as land and politics, thanks to a complex social dynamic that links those who are alive to the dead —ancestor worship—, occasionally in conjunction with other groups —Maya, Ladinos—.

  4. Institutionalizing provider-initiated HIV testing and counselling for children: an observational case study from Zambia.

    Science.gov (United States)

    Mutanga, Jane N; Raymond, Juliette; Towle, Megan S; Mutembo, Simon; Fubisha, Robert Captain; Lule, Frank; Muhe, Lulu

    2012-01-01

    Provider-initiated testing and counselling (PITC) is a priority strategy for increasing access for HIV-exposed children to prevention measures, and infected children to treatment and care interventions. This article examines efforts to scale-up paediatric PITC at a second-level hospital located in Zambia's Southern Province, and serving a catchment area of 1.2 million people. Our retrospective case study examined best practices and enabling factors for rapid institutionalization of PITC in Livingstone General Hospital. Methods included clinical observations, key informant interviews with programme management, and a desk review of hospital management information systems (HMIS) uptake data following the introduction of PITC. After PITC roll-out, the hospital experienced considerably higher testing uptake. In a 36-month period following PITC institutionalization, of total inpatient children eligible for PITC (n = 5074), 98.5% of children were counselled, and 98.2% were tested. Of children tested (n = 4983), 15.5% were determined HIV-infected; 77.6% of these results were determined by DNA polymerase chain reaction (PCR) testing in children under the age of 18 months. Of children identified as HIV-infected in the hospital's inpatient and outpatient departments (n = 1342), 99.3% were enrolled in HIV care, including initiation on co-trimoxazole prophylaxis. A number of good operational practices and enabling factors in the Livingstone General Hospital experience can inform rapid PITC institutionalization for inpatient and outpatient children. These include the placement of full-time nurse counsellors at key areas of paediatric intake, who interface with patients immediately and conduct testing and counselling. They are reinforced through task-shifting to peer counsellors in the wards. Nurse counsellor capacity to draw specimen for DNA PCR for children under 18 months has significantly enhanced early infant diagnosis. The hospital's bolstered antiretroviral

  5. Institutionalizing provider-initiated HIV testing and counselling for children: an observational case study from Zambia.

    Directory of Open Access Journals (Sweden)

    Jane N Mutanga

    Full Text Available BACKGROUND: Provider-initiated testing and counselling (PITC is a priority strategy for increasing access for HIV-exposed children to prevention measures, and infected children to treatment and care interventions. This article examines efforts to scale-up paediatric PITC at a second-level hospital located in Zambia's Southern Province, and serving a catchment area of 1.2 million people. METHODS AND PRINCIPAL FINDINGS: Our retrospective case study examined best practices and enabling factors for rapid institutionalization of PITC in Livingstone General Hospital. Methods included clinical observations, key informant interviews with programme management, and a desk review of hospital management information systems (HMIS uptake data following the introduction of PITC. After PITC roll-out, the hospital experienced considerably higher testing uptake. In a 36-month period following PITC institutionalization, of total inpatient children eligible for PITC (n = 5074, 98.5% of children were counselled, and 98.2% were tested. Of children tested (n = 4983, 15.5% were determined HIV-infected; 77.6% of these results were determined by DNA polymerase chain reaction (PCR testing in children under the age of 18 months. Of children identified as HIV-infected in the hospital's inpatient and outpatient departments (n = 1342, 99.3% were enrolled in HIV care, including initiation on co-trimoxazole prophylaxis. A number of good operational practices and enabling factors in the Livingstone General Hospital experience can inform rapid PITC institutionalization for inpatient and outpatient children. These include the placement of full-time nurse counsellors at key areas of paediatric intake, who interface with patients immediately and conduct testing and counselling. They are reinforced through task-shifting to peer counsellors in the wards. Nurse counsellor capacity to draw specimen for DNA PCR for children under 18 months has significantly enhanced early

  6. Precise measurements of energy loss straggling for swift heavy ions in polymers

    Energy Technology Data Exchange (ETDEWEB)

    Rani, Bindu [Department of Physics, Kurukshetra University, Kurukshetra 136 119 (India); Neetu [Department of Physics, S.D College, Panipat 132103 (India); Sharma, Kalpana [Department of Physics, CMR Institute of Technology, Bangalore 560037 (India); Diwan, P.K. [Department of Applied Sciences, UIET, Kurukshetra University, Kurukshetra 136 119 (India); Kumar, Shyam, E-mail: profshyam@gmail.com [Department of Physics, Kurukshetra University, Kurukshetra 136 119 (India)

    2016-11-15

    The energy loss straggling measurements for heavy ions with Z = 3–22 (∼0.2–2.5 MeV/u) in PEN (C{sub 7}H{sub 5}O{sub 2}) and PET (C{sub 10}H{sub 8}O{sub 4}) polymers have been carried out utilizing the swift heavy ion beam facility from 15UD Pelletron accelerator at Inter University Accelerator Centre (IUAC), New Delhi, India. The recorded spectra are analyzed in such a way that the Straggling associated with energy loss process could be measured in a systematic manner at any selected value of energy, in terms of per unit thickness of the absorber, at any desired energy intervals. The measured values have been compared with the calculated values obtained from the most commonly used Bethe-Livingston formulations applicable for collisional straggling. The results are tried to be understood in terms of the effective charge on the impinging ion within the absorber. Some interesting trends are observed.

  7. Salmonella and raw shell eggs: results of a cross-sectional study of contamination rates and egg safety practices in the United Kingdom catering sector in 2003.

    Science.gov (United States)

    Elson, R; Little, C L; Mitchell, R T

    2005-02-01

    This study was prompted by epidemiological investigations of the unusual number of Salmonella Enteritidis outbreaks associated with the use of eggs in catering premises in England and Wales during 2002. The aims of the study, performed between April and May 2003, were to establish the rate of Salmonella contamination in raw shell eggs from catering premises, investigate any correlation between the origin and type of eggs and the presence of particular serotypes or phage types (PTs) of Salmonella, and examine the use of raw shell eggs in catering premises in the United Kingdom. A total of 34,116 eggs (5,686 pooled samples of six eggs) were collected from 2,104 catering premises, most of which were eggs produced in the United Kingdom (88%). Salmonella was isolated from 17 pools (0.3%) of eggs. Of these, 15 were Salmonella Enteritidis, which were further characterized to PTs as follows: PT6 (0.1%), PT4 (0.07%), PT12 (0.04%), PT1 (0.04%), and PT14b (0.02%). Salmonella Livingstone and Salmonella Typhimurium definitive type 7 resistant to ampicillin, streptomycin, sulfonamides, and tetracycline were also isolated. The Salmonella contamination rate of eggs produced in the United Kingdom appears to have decreased significantly since 1995 and 1996. This trend is reflected in the decrease of Salmonella Enteritidis and, in particular, Salmonella Enteritidis PT4. The impact of the United Kingdom Food Standards Agency's advice on the use of eggs, issued in January 2003, is discussed.

  8. The stopping powers and energy straggling of heavy ions in polymer foils

    Energy Technology Data Exchange (ETDEWEB)

    Mikšová, R., E-mail: miksova@ujf.cas.cz [Nuclear Physics Institute of the Academy of Sciences of the Czech Republic, v.v.i., 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Macková, A.; Malinský, P. [Nuclear Physics Institute of the Academy of Sciences of the Czech Republic, v.v.i., 250 68 Rez (Czech Republic); Department of Physics, Faculty of Science, J.E. Purkinje University, Ceske Mladeze 8, 400 96 Usti nad Labem (Czech Republic); Hnatowicz, V. [Nuclear Physics Institute of the Academy of Sciences of the Czech Republic, v.v.i., 250 68 Rez (Czech Republic); Slepička, P. [Department of Solid State Engineering, Institute of Chemical Technology, 166 28 Prague (Czech Republic)

    2014-07-15

    The stopping power and energy straggling of {sup 7}Li, {sup 12}C and {sup 16}O ions in thin poly(etheretherketone) (PEEK), polyethylene terephthalate (PET) and polycarbonate (PC) foils were measured in the incident beam energy range of 9.4–11.8 MeV using an indirect transmission method. Ions scattered from a thin gold target at an angle of 150° were registered by a partially depleted PIPS detector, partly shielded with a polymer foil placed in front of the detector. Therefore, the signals from both direct and slowed down ions were visible in the same energy spectrum, which was evaluated by the ITAP code, developed at our laboratory. The ITAP code was employed to perform a Gaussian-fitting procedure to provide a complete analysis of each measured spectrum. The measured stopping powers were compared with the predictions obtained from the SRIM-2008 and MSTAR codes and with previous experimental data. The energy straggling data were compared with those calculated by using Bohr’s, Lindhard–Scharff and Bethe–Livingston theories.

  9. A comparison of methods for gravitational wave burst searches from LIGO and Virgo

    International Nuclear Information System (INIS)

    Beauville, F; Buskulic, D; Grosjean, D; Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P; Blackburn, L; Katsavounidis, E; Bosi, L; Brocco, L; Brown, D A; Chatterji, S; Christensen, N; Knight, M; Fairhurst, S; Guidi, G; Heng, S; Hewitson, M; Klimenko, S

    2008-01-01

    The search procedure for burst gravitational waves has been studied using 24 h of simulated data in a network of three interferometers (Hanford 4 km, Livingston 4 km and Virgo 3 km are the example interferometers). Several methods to detect burst events developed in the LIGO Scientific Collaboration (LSC) and Virgo Collaboration have been studied and compared. We have performed coincidence analysis of the triggers obtained in the different interferometers with and without simulated signals added to the data. The benefits of having multiple interferometers of similar sensitivity are demonstrated by comparing the detection performance of the joint coincidence analysis with LSC and Virgo only burst searches. Adding Virgo to the LIGO detector network can increase by 50% the detection efficiency for this search. Another advantage of a joint LIGO-Virgo network is the ability to reconstruct the source sky position. The reconstruction accuracy depends on the timing measurement accuracy of the events in each interferometer, and is displayed in this paper with a fixed source position example

  10. Development and testing of a high temperature (673-1273K), high pressure regenerative desulphurization process for IGCC concepts

    Energy Technology Data Exchange (ETDEWEB)

    Janssen, F.J.J.G.; Meijer, R. (KEMA Fossil Power Plants, Arnhem (Netherlands))

    1994-01-01

    In the period 1990-1993 a European Community (EC) subsidized international project on the subject of high-temperature and high-pressure desulfurization of coal gas has been carried out within the framework of the JOULE 1 program. This report is a summary of the final report, in which an overview is given of the developed and tested absorbents and the results of a feasibility study for a 100 MWe Integrated Coal Gasification Combined Cycle (ICGCC) in combination with a high-temperature desulfurization process. The Utrecht University in Utrecht, Netherlands, developed absorbents in cooperation with The Dutch Centre for Gas Technology GASTEC in Apeldoorn, Netherlands. The absorbents are tested by KEMA and the Netherlands Energy Research Foundation in Petten, Netherlands. Foster Wheeler in Livingston, New Jersey, USA, executed the feasibility study. The combination of iron oxide/molybdenum oxide on aluminium phosphate appears to be the most promising absorbent. The preparation method has been patented. From the feasibility study it appeared that by means of a high-temperature desulfurization process the investment and operational costs can be reduced considerably. Further development of the absorbent and the accompanying reactor concept already has started in a new EC project within the framework of the JOULE 1 program

  11. Organizing for a Peaceful Crowd: An Example of a Football Match

    Directory of Open Access Journals (Sweden)

    Ingrid Hylander

    2010-03-01

    Full Text Available Crowd violence has interested researchers in social psychology for many years and is an important issue for sports psychology (STOTT, ADANG, LIVINGSTONE & SCHREIBER, 2007; STOTT, HUTCHINSON & DRURY, 2001; RUSSELL, 2004; MUSTONEN, ARMS & RUSSELL, 1996. Riots in crowds have been explained from different theoretical perspectives (HYLANDER, 2008, such as individual differences, de-individuation (PRENTICE-DUNN & ROGERS, 1989, group interaction (DRURY & REICHER, 2000, history (GUTTMAN, 1986, 1998 and cultural perspectives (CRABBE, 2003. In this study, a social psychology model focusing on group interaction, the Aggravation and Mitigation (AM model (GUVÅ & HYLANDER, 2008; GRANSTRÖM, 2008; GRANSTRÖM & ROSANDER, 2008, is used as a means of analysis. This article applies the AM model to a sporting event to identify if and how peacemaking processes can be detected. Furthermore, the intention is to discern and illuminate organizational strategies that maybe linked to peacemaking processes. The main results indicate that when arrangements are based on (a "festival-making," (b arrangements for basic needs and recognizable order and (c the creation of a superordinate identity, then the outcome of mass events may turn out peaceful, which is also in line with the AM model. URN: urn:nbn:de:0114-fqs100283

  12. Circular polarization of gravitational waves from non-rotating supernova cores: a new probe into the pre-explosion hydrodynamics

    Science.gov (United States)

    Hayama, Kazuhiro; Kuroda, Takami; Kotake, Kei; Takiwaki, Tomoya

    2018-06-01

    We present an analysis of the circular polarization of gravitational waves (GWs) using results from three-dimensional (3D), general relativistic (GR) core-collapse simulations of a non-rotating 15 M⊙ star. For the signal detection, we perform a coherent network analysis taking into account the four interferometers of LIGO Hanford, LIGO Livingston, VIRGO, and KAGRA. We focus on the Stokes V parameter, which directly characterizes the asymmetry of the GW circular polarization. We find that the amplitude of the GW polarization becomes bigger for our 3D-GR model that exhibits strong activity of the standing accretion shock instability (SASI). Our results suggest that the SASI-induced accretion flows to the proto-neutron star (PNS) lead to a characteristic, low-frequency modulation (100-200 Hz) in both the waveform and the GW circular polarization. By estimating the signal-to-noise ratio of the GW polarization, we demonstrate that the detection horizon of the circular polarization extends by more than a factor of several times farther comparing to that of the GW amplitude. Our results suggest that the GW circular polarization, if detected, could provide a new probe into the pre-explosion hydrodynamics such as the SASI activity and the g-mode oscillation of the PNS.

  13. Low-cost hadron colliders at Fermilab: A discussion paper

    International Nuclear Information System (INIS)

    Foster, G.W.; Malamud, E.

    1996-01-01

    New more economic approaches are required to continue the dramatic exponential rise in collider energies as represented by the well known Livingston plot. The old idea of low cost, low field iron dominated magnets in a small diameter pipe may become feasible in the next decade with dramatic recent advances in technology: (1) advanced tunneling technologies for small diameter, non human accessible tunnels, (2) accurate remote guidance systems for tunnel survey and boring machine steering, (3) high T c superconductors operating at liquid N 2 or liquid H 2 temperatures, (4) industrial applications of remote manipulation and robotics, (5) digitally multiplexed electronics to minimize cables, (6) achievement of high luminosities in p-p and p-anti P colliders. The goal of this paper is to stimulate continuing discussions on approaches to this new collider and to identify critical areas needing calculations, construction of models, proof of principle experiments, and full scale prototypes in order to determine feasibility and arrive at cost estimates

  14. A mechanism for solar ultraviolet flux variability

    International Nuclear Information System (INIS)

    Schatten, K.H.; Heath, D.F.

    1981-01-01

    Solar UV emission observed by a filter photometer on Nimbus IV from 1969 to 1973 is examined in an attempt to understand the short term (27 day) and secular variability. Two models are discussed to explain the variations - a calcium plage model and a chromospheric network (faculae and spicule) structure model. Both relate to the remnant magnetic fields of active regions. An association between UV brightenings and the large scale magnetic field has been found consistent with the network model. An increase in UV emittance can be achieved by raising the effective chromospheric temperature closer to a photospheric level. If the Sun's luminosity is constant on these time intervals the enhanced UV radiation could be partially offset by an overall decrease in photospheric temperature as measured by Livingston in visible photospheric profiles. Total solar luminosity may then show less variability, however, the UV to visible luminosity variation may have significant planetary influences. Lockwood and Thompson (1979) report a relation between solar activity and planetary albedos, and Schatten (1979) discussed a long-suspected relationship between solar activity and the Great Red Spot appearance. (orig.)

  15. An association of genotypes and antimicrobial resistance patterns among Salmonella isolates from pigs and humans in Taiwan.

    Directory of Open Access Journals (Sweden)

    Hung-Chih Kuo

    Full Text Available We collected 110 Salmonella enterica isolates from sick pigs and determined their serotypes, genotypes using pulsed-field gel electrophoresis (PFGE, and antimicrobial susceptibility to 12 antimicrobials and compared the data with a collection of 18,280 isolates obtained from humans. The pig isolates fell into 12 common serovars for human salmonellosis in Taiwan; S. Typhimurium, S. Choleraesuis, S. Derby, S. Livingstone, and S. Schwarzengrund were the 5 most common serovars and accounted for a total of 84% of the collection. Of the 110 isolates, 106 (96% were multidrug resistant (MDR and 48 (44% had PFGE patterns found in human isolates. S. Typhimurium, S. Choleraesuis, and S. Schwarzengrund were among the most highly resistant serovars. The majority of the 3 serovars were resistant to 8-11 of the tested antimicrobials. The isolates from pigs and humans sharing a common PFGE pattern displayed identical or very similar resistance patterns and Salmonella strains that caused severe infection in pigs were also capable of causing infections in humans. The results indicate that pigs are one of the major reservoirs to human salmonellosis in Taiwan. Almost all of the pig isolates were MDR, which highlights the necessity of strictly regulating the use of antimicrobials in the agriculture sector in Taiwan.

  16. Basic Data Report for Drillhole SNL-9 (C-2950)

    International Nuclear Information System (INIS)

    Powers, Dennis W.

    2005-01-01

    SNL-9 (permitted by the State Engineer as C-2950) was drilled to provide geological data and hydrological testing of the Culebra Dolomite Member of the Permian Rustler Formation within a proposed re-entrant of the margin of halite dissolved from the upper part of the Salado near Livingston Ridge. SNL-9 is located in the southeast quarter of section 23, T22S, R30E, in eastern Eddy County, New Mexico. SNL-9 was drilled to a total depth of 845 ft below the ground surface. Below surface dune sand and the Berino soil, SNL-9 encountered, in order, the Mescalero caliche, Gatuna, Dewey Lake, Rustler, and uppermost Salado Formations. Two intervals were cored: (1) from the lower Forty-niner Member through the Magenta Dolomite and into the upper Tamarisk Member; and (2) from the lower Tamarisk Member through the Culebra Dolomite and Los Medanos Members and into the uppermost Salado Formation. Geophysical logs were acquired from the open hole to total depth, and the drillhole was successfully completed with a screened interval open across the Culebra.

  17. Spatial characterization of the edge barrier in wide superconducting films

    Science.gov (United States)

    Sivakov, A. G.; Turutanov, O. G.; Kolinko, A. E.; Pokhila, A. S.

    2018-03-01

    The current-induced destruction of superconductivity is discussed in wide superconducting thin films, whose width is greater than the magnetic field penetration depth, in weak magnetic fields. Particular attention is paid to the role of the boundary potential barrier (the Bin-Livingston barrier) in critical state formation and detection of the edge responsible for this critical state with different mutual orientations of external perpendicular magnetic field and transport current. Critical and resistive states of the film were visualized using the space-resolving low-temperature laser scanning microscopy (LTLSM) method, which enables detection of critical current-determining areas on the film edges. Based on these observations, a simple technique was developed for investigation of the critical state separately at each film edge, and for the estimation of residual magnetic fields in cryostats. The proposed method only requires recording of the current-voltage characteristics of the film in a weak magnetic field, thus circumventing the need for complex LTLSM techniques. Information thus obtained is particularly important for interpretation of studies of superconducting film single-photon light emission detectors.

  18. Basic Data Report for Drillhole SNL-9 (C-2950)

    Energy Technology Data Exchange (ETDEWEB)

    Dennis W. Powers; Washington Regulatory and Environmental Services

    2005-01-19

    SNL-9 (permitted by the State Engineer as C-2950) was drilled to provide geological data and hydrological testing of the Culebra Dolomite Member of the Permian Rustler Formation within a proposed re-entrant of the margin of halite dissolved from the upper part of the Salado near Livingston Ridge. SNL-9 is located in the southeast quarter of section 23, T22S, R30E, in eastern Eddy County, New Mexico. SNL-9 was drilled to a total depth of 845 ft below the ground surface. Below surface dune sand and the Berino soil, SNL-9 encountered, in order, the Mescalero caliche, Gatuna, Dewey Lake, Rustler, and uppermost Salado Formations. Two intervals were cored: 1) from the lower Forty-niner Member through the Magenta Dolomite and into the upper Tamarisk Member; and 2) from the lower Tamarisk Member through the Culebra Dolomite and Los Meda?os Members and into the uppermost Salado Formation. Geophysical logs were acquired from the open hole to total depth, and the drillhole was successfully completed with a screened interval open across the Culebra.

  19. "What exactly is a paedophile?" Children talking about Internet risk

    Directory of Open Access Journals (Sweden)

    Andrew Burn

    2017-09-01

    Full Text Available Reports tell us that the internet is opening new dangers to children, including online grooming, exposure to pornography and financial scams (Carr 2004; Gardner 2003; UK Home Office 2001; O'Connell 2003. The result has been various initiatives which attempt to teach children safe surfing habits. The UK Home Office "ThinkUKnow" campaign featured advertisements on the radio, internet and cinemas, targeting teens and preteens with the message that the person they are chatting to "may not be who you think they are". There are indications that such campaigns have had an impact on children's awareness of "stranger danger" on the internet (Livingstone/Bober 2003. However, many organisations are still struggling with the question of how best to prevent internet-related harm to children. Children are exposed not only to advertising campaigns about stranger danger but also sensationalist stories about, for example, what happens to girls who enter chat rooms. When a teenage girl goes missing, police investigations routinely include looking at the girls' online activities, and tabloid media frequently make the connection between missing school girls and chat room activities. These connections are firmly embedded in the minds of the children we interviewed for the study we will be discussing. Alongside the very rational and prohibitive discourse coming from campaigns which warn children against any chat with strangers, sit the folkloric stories about girls meeting up and getting killed by paedophiles. The challenge to educators is to find an approach which will engage with both sets of discourses.

  20. Biomass production by Antarctic yeast strains: an investigation on the lipid composition

    International Nuclear Information System (INIS)

    Zlatanov, M.; Antova, G.; Angelova-Romova, M.; Pavlova, K.; Georgieva, K.; Rousenova-Videva, S.

    2010-01-01

    Psychrophilic yeast strains Rhodotorula glutinis AL_1_0_7, Sporobolomyces roseus AL_1_0_8, Cryptococcus albidus AL_5_5, Cryptococcus laurentii AL_5_6 and Cryptococcus laurentii AL_5_8 isolated from soil sample taken from the region of the Bulgarien base on Livingston Island, Antarctica, were studied. The biomass production was followed after cultivation of the yeasts in a medium with pH 5.3 at 15°C for 120 h. The biomass concentration by psychrophilic yeast strains was: R. glutinis AL_1_0_7-6.05 g/l, S. roseus AL108-5.78 g/l, Cr. albidus AL_5_5, Cr. laurentii AL_5_6 and Cr. laurentii AL_5_8-6.52 g/l, 6.84 g/l and 6.24 g/l, respectively. The extracted and separated lipids from the samples were supplied to analysis and the compositions of fatty acids, phospholipids, sterols as well as tocopherols were determined. Unsaturated fatty acids, mainly oleic (58.6-63.5%) and of saturated palmitic (18.2-24.5%), predominated in triacylglycerols. Sterols (0.1-0.3%) were valued in the dry yeast biomass. The content of phospholipids, mainly phosphatidylcholine, phosphatidylinositole and phosphatidylethanolamine was found to be in the range of 0.2-1.6%. The quantity of tocopherols was 0-26.3 mg/kg. All of tocopherol classes were established.

  1. Tracking down the origins of Advanced LIGO noise: 2 examples

    Science.gov (United States)

    Berger, Beverly K.; LIGO Scientific Collaboration Collaboration

    2016-03-01

    For Advanced LIGO to reach design sensitivity various sources of instrumental and environmental noise must be identified and ameliorated. We discuss 2 efforts to search for the origin of noise bursts (glitches) at LIGO Hanford. Advanced LIGO monitors thousands of channels in addition to the gravitational wave channel. These can be studied to find correlations between the gravitational wave channel and other sensor signals. The first type of glitch had a frequency of 50 Hz and a rate of 1 per minute. It was found that the glitches were correlated with ground motion in the end station of the X-arm where the offending air compressor was tracked down and turned off. The second example manifests itself as a sudden, but brief, drop in the range occurring, typically, several times per day at LIGO Hanford and less frequently at LIGO Livingston. These range-drop glitches appear in the gravitational-wave channel. Although correlations with these glitches can be seen in many channels, it cannot be easily determined whether these channels are responding as an effect of this type of very strong glitch or whether they might be related to their cause or causes. To date, the cause of the range-drop glitches is not known.

  2. On the use of Internet in promoting social virtues. Case study: Civic Parliament

    Directory of Open Access Journals (Sweden)

    Concepción NAVAL

    2015-06-01

    Full Text Available Citizen participation is essential for democracies to be viable, sustainable and healthy. But it is necessary to establish the appropriate channels for exercising it; and we can not fail to consider the fact that people live in an increasingly interconnected society, where the mass media are a key social resource and can play an important role in fostering critical thinking and active citizenship (Livingstone, 2004; Buckingham, 2007. We understand that to achieve this, from the field of civic education, digital spaces should be considered as privileged spaces for participation. In this paper we show the initiatives undertaken by the «Civic Parliament» project to provide online teaching materials to the teachers so they can raise in their students certain social virtues. The challenges in this order are diverse, we could highlight two: to promote participatory awareness in students, and to combine the technical, pedagogical and ethical-civic aspects of media use (Gonzálvez, 2012. 

  3. Foot and mouth disease in Zambia: Spatial and temporal distributions of outbreaks, assessment of clusters and implications for control

    Directory of Open Access Journals (Sweden)

    Yona Sinkala

    2014-04-01

    Full Text Available Zambia has been experiencing low livestock productivity as well as trade restrictions owing to the occurrence of foot and mouth disease (FMD, but little is known about the epidemiology of the disease in these endemic settings. The fundamental questions relate to the spatio-temporal distribution of FMD cases and what determines their occurrence. A retrospective review of FMD cases in Zambia from 1981 to 2012 was conducted using geographical information systems and the SaTScan software package. Information was collected from peer-reviewed journal articles, conference proceedings, laboratory reports, unpublished scientific reports and grey literature. A space–time permutation probability model using a varying time window of one year was used to scan for areas with high infection rates. The spatial scan statistic detected a significant purely spatial cluster around the Mbala–Isoka area between 2009 and 2012, with secondary clusters in Sesheke–Kazungula in 2007 and 2008, the Kafue flats in 2004 and 2005 and Livingstone in 2012. This study provides evidence of the existence of statistically significant FMD clusters and an increase in occurrence in Zambia between 2004 and 2012. The identified clusters agree with areas known to be at high risk of FMD. The FMD virus transmission dynamics and the heterogeneous variability in risk within these locations may need further investigation.

  4. A comparison of methods for gravitational wave burst searches from LIGO and Virgo

    Energy Technology Data Exchange (ETDEWEB)

    Beauville, F; Buskulic, D; Grosjean, D [Laboratoire d' Annecy-le-Vieux de Physique des Particules, Chemin de Bellevue, BP 110, 74941 Annecy-le-Vieux Cedex (France); Bizouard, M-A; Cavalier, F; Clapson, A-C; Hello, P [Laboratoire de l' Accelerateur Lineaire, IN2P3/CNRS-Universite de Paris XI, BP 34, 91898 Orsay Cedex (France); Blackburn, L; Katsavounidis, E [LIGO-Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Bosi, L [INFN Sezione di Perugia and/or Universita di Perugia, Via A Pascoli, I-06123 Perugia (Italy); Brocco, L [INFN Sezione di Roma and/or Universita ' La Sapienza' , P le A Moro 2, I-00185 Roma (Italy); Brown, D A; Chatterji, S [LIGO-California Institute of Technology, Pasadena, CA 91125 (United States); Christensen, N; Knight, M [Carleton College, Northfield, MN 55057 (United States); Fairhurst, S [University of Wisconsin-Milwaukee, Milwaukee, WI 53201 (United States); Guidi, G [INFN Sezione Firenze/Urbino Via G Sansone 1, I-50019 Sesto Fiorentino (Italy); and/or Universita di Firenze, Largo E Fermi 2, I-50125 Firenze and/or Universita di Urbino, Via S Chiara 27, I-61029 Urbino (Italy); Heng, S; Hewitson, M [University of Glasgow, Glasgow, G12 8QQ (United Kingdom); Klimenko, S [University of Florida-Gainesville, FL 32611 (United States)] (and others)

    2008-02-21

    The search procedure for burst gravitational waves has been studied using 24 h of simulated data in a network of three interferometers (Hanford 4 km, Livingston 4 km and Virgo 3 km are the example interferometers). Several methods to detect burst events developed in the LIGO Scientific Collaboration (LSC) and Virgo Collaboration have been studied and compared. We have performed coincidence analysis of the triggers obtained in the different interferometers with and without simulated signals added to the data. The benefits of having multiple interferometers of similar sensitivity are demonstrated by comparing the detection performance of the joint coincidence analysis with LSC and Virgo only burst searches. Adding Virgo to the LIGO detector network can increase by 50% the detection efficiency for this search. Another advantage of a joint LIGO-Virgo network is the ability to reconstruct the source sky position. The reconstruction accuracy depends on the timing measurement accuracy of the events in each interferometer, and is displayed in this paper with a fixed source position example.

  5. Coincident Down-chirps in GW150914 Betray the Absence of Event Horizons

    Directory of Open Access Journals (Sweden)

    Spivey R. J.

    2016-07-01

    Full Text Available A century has elapsed since gravitational waves were predicted. Their recent detection by the LIGO-Virgo collaboration represents another feather in Einstein’s cap and at- tests to the technological ingenuity of experimentalists. However, the news has been portrayed as affirmation of the existence of black holes, objects whose defining charac- teristics are event horizons. Whilst a gravitational wave chirp is indicative of coalescing bodies and the inferred masses, 29 ± 4 M ⊙ and 36 ± 5 M ⊙ , rule out neutron stars, a promi- nent yet overlooked feature in the Hanford and Livingston spectrograms points to a curious mass ejection during the merger process. The spectral bifurcations, beyond which down-chirps are clearly discernible, suggest that a considerable quantity of mat- ter spiralled away from the binary system at the height of the merger. Since accretion disks cannot survive until the latter stages of coalescence , a black hole model seems un- tenable, and Einstein’s expectation that black holes can neither form nor ingest matter in a universe of finite age would appear to be upheld. By virtue of general relativity’s logi- cal consistency and the fact that gravity propagates at light speed, gravitational collapse must terminate with the formation of pathology-free temporally suspended objects.

  6. Energy loss straggling in Aluminium foils for Li and C ions in fractional energy loss limits (ΔE/E) ∼10-60%

    Science.gov (United States)

    Diwan, P. K.; Kumar, Sunil; Kumar, Shyam; Sharma, V.; Khan, S. A.; Avasthi, D. K.

    2016-02-01

    The energy loss straggling of Li and C ions in Al foils of various thicknesses has been measured, within the fractional energy loss limit (∆E/E) ∼ 10-60%. These measurements have been performed using the 15UD Pelletron accelerator facility available at Inter University Accelerator Centre (IUAC), New Delhi, India. The measured straggling values have been compared with the corresponding predicted values adopting popularly used collisional straggling formulations viz Bohr, Lindhard and Scharff, Bethe-Livingston, Titeica. In addition, the experimental data has been compared to the Yang et al. empirical formula and Close Form Model, recently proposed by Montanari et al. The straggling values derived by Titeica theory were found to be in better agreement with the measured values as compared to other straggling formulations. The charge-exchange straggling component has been estimated from the measured data based on Titeica's theory. Finally, a function of the ion effective charge and the energy loss fraction within the target has been fitted to the latter straggling component.

  7. Bilingualism and Cognitive Decline: A Story of Pride and Prejudice.

    Science.gov (United States)

    Woumans, Evy; Versijpt, Jan; Sieben, Anne; Santens, Patrick; Duyck, Wouter

    2017-01-01

    In a recent review, Mukadam, Sommerlad, and Livingston (2017) argue that bilingualism offers no protection against cognitive decline. The authors examined the results of 13 studies (five prospective, eight retrospective) in which monolinguals and bilinguals were compared for cognitive decline and onset of dementia symptoms. Analysis of four of the five prospective studies resulted in the conclusion that there was no difference between monolinguals and bilinguals, whereas seven of the eight retrospective studies actually showed bilingualism to result in a four-to-five year delay of symptom onset. The authors decided to ignore the results from the retrospective studies in favor of those from the prospective studies, reasoning that the former may be confounded by participants' cultural background and education levels. In this commentary, we argue that most of these studies actually controlled for these two variables and still found a positive effect of bilingualism. Furthermore, we argue that the meta-analysis of the prospective studies is not complete, lacking the results of two crucial reports. We conclude that the literature offers substantial evidence for a bilingual effect on the development of cognitive decline and dementia.

  8. Circular polarization of gravitational waves from non-rotating supernova cores: a new probe into the pre-explosion hydrodynamics

    Science.gov (United States)

    Hayama, Kazuhiro; Kuroda, Takami; Kotake, Kei; Takiwaki, Tomoya

    2018-04-01

    We present an analysis of the circular polarization of gravitational-waves (GWs) using results from three-dimensional (3D), general relativistic (GR) core-collapse simulations of a non-rotating 15M⊙ star. For the signal detection, we perform a coherent network analysis taking into account the four interferometers of LIGO Hanford, LIGO Livingston, VIRGO, and KAGRA. We focus on the Stokes V parameter, which directly characterizes the asymmetry of the GW circular polarization. We find that the amplitude of the GW polarization becomes bigger for our 3D-GR model that exhibits strong activity of the standing accretion shock instability (SASI). Our results suggest that the SASI-induced accretion flows to the proto-neutron star (PNS) lead to a characteristic, low-frequency modulation (100 ˜ 200 Hz) in both the waveform and the GW circular polarization. By estimating the signal-to-noise ratio of the GW polarization, we demonstrate that the detection horizon of the circular polarization extends by more than a factor of several times farther comparing to that of the GW amplitude. Our results suggest that the GW circular polarization, if detected, could provide a new probe into the pre-explosion hydrodynamics such as the SASI activity and the g-mode oscillation of the PNS.

  9. Research issues: the food environment and obesity.

    Science.gov (United States)

    Mattes, Richard; Foster, Gary D

    2014-12-01

    "Research Issues: The Food Environment and Obesity" is an article series commissioned by the American Society for Nutrition and The Obesity Society in an attempt to consider the state of understanding on this topic and identify key knowledge gaps. Roberts and Karl focus on the role of energy density in the regulation of energy intake and body weight and offer recommendations for prioritizing research. Finkelstein et al examine food and beverage purchases as a function of price changes and conclude that targeted food taxes and subsidies alone are unlikely to substantially affect obesity. Pereira points out the difficulty in establishing the strength of the association between intake of sugar-sweetened beverages and weight gain and obesity. Johnson and Wardle review the effects of palatability and variety on eating behavior and weight. Livingstone and Pourshahidi examine the impact of portion size manipulations on energy intake and weight management and find that consumers generally tend to eat proportionally more as portion size increases. Kant focuses on the efficacy and effectiveness of eating frequency manipulation for body weight management and finds that such manipulation has consistently yielded null results. Finally, Gordon-Larsen identifies several limitations of the existing literature regarding neighborhood access to healthy foods. © 2014 American Society for Nutrition.

  10. Aeromagnetic and aerial photographic survey in the South Shetland Islands,Antarctica, conducted by a small unmanned aerial vehicle (Ant-Plane

    Directory of Open Access Journals (Sweden)

    Minoru Funaki

    2013-07-01

    Full Text Available Two small unmanned aerial vehicles, Ant-Plane 6 and Ant-Plane 3, were assembled using parts and technologies developed for model airplanes. The aerial vehicles were scheduled to conduct aero magnetic and photographic surveys of the Brans?eld Basin, from a takeoff runway at Marsh Air?eld on the South Shetland Islands, Antarctica, during January 2011. However, the scheduled surveys were not conducted on account of poor weather. Research was later conducted on a glacier, using a takeoff runway at St. Kliment Ohridski Base, Livingston Island, during December 2011. A ?ight from St. Kliment Ohridski Base to Deception Island yielded satisfactory results; the total distance of 302.4 km was traversed in 3 h 7 min (3:07. On this ?ight, aeromagnetic and aerial photographic data were obtained from an altitude of 780 m for a 9×18 km area on the northern half of Deception Island. Aerial photographs of Deception Island and South Bay showed the distributions of glaciers and their crevasses. The Ant-Plane ?ew over the Antarctic horizon and surveyed above Deception Island. That was the successful venture of this kind, demonstrating that airborne surveys by Ant-Planes are useful for Antarctic research investigations. Airborne surveys provide a safe and economical approach to data acquisition as compared with manned aerial operations.

  11. VizieR Online Data Catalog: Gravitational waves from known pulsars (Aasi+, 2014)

    Science.gov (United States)

    Aasi, J.; Abadie, J.; Abbott, B. P.; Abbott, R.; Abbott, T.; Abernathy, M. R.; Accadia, T.; Acernese, F.; Adams, C.; Adams, T.; Adhikari, R. X.; Affeldt, C.; Agathos, M.; Aggarwal, N.; Aguiar, O. D.; Ajith, P.; Allen, B.; Allocca, A.; Ceron, E. A.; Amariutei, D.; Anderson, R. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C.; Areeda, J.; Ast, S.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Austin, L.; Aylott, B. E.; Babak, S.; Baker, P. T.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barker, D.; Barnum, S. H.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barton, M. A.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J.; Bauchrowitz, J.; Bauer, Th. S.; Bebronne, M.; Behnke, B.; Bejger, M.; Beker, M. G.; Bell, A. S.; Bell, C.; Belopolski, I.; Bergmann, G.; Berliner, J. M.; Bersanetti, D.; Bertolini, A.; Bessis, D.; Betzwieser, J.; Beyersdorf, P. T.; Bhadbhade, T.; Bilenko, I. A.; Billingsley, G.; Birch, J.; Bitossi, M.; Bizouard, M. A.; Black, E.; Blackburn, J. K.; Blackburn, L.; Blair, D.; Blom, M.; Bock, O.; Bodiya, T. P.; Boer, M.; Bogan, C.; Bo, Nd C.; Bondu, F.; Bonelli, L.; Bonnand, R.; Bork, R.; Born, M.; Boschi, V.; Bose, S.; Bosi, L.; Bowers, J.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brannen, C. A.; Brau, J. E.; Breyer, J.; Briant, T.; Bridges, D. O.; Brillet, A.; Brinkmann, M.; Brisson, V.; Britzger, M.; Brooks, A. F.; Brown, D. A.; Brown, D. D.; Bruckner, F.; Bulik, T.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cadonati, L.; Cagnoli, G.; Calderon Bustillo, J.; Calloni, E.; Camp, J. B.; Campsie, P.; Cannon, K. C.; Canuel, B.; Cao, J.; Capano, C. D.; Carbognani, F.; Carbone, L.; Caride, S.; Castiglia, A.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C.; Cesarini, E.; Chakraborty, R.; Chalermsongsak, T.; Chao, S.; Charlton, P.; Chassande-Mottin, E.; Chen, X.; Chen, Y.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Chow, J.; Christensen, N.; Chu, Q.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, D. E.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P.-F.; Colla, A.; Colombini, M.; Constancio, M. Jr; Conte, A.; Conte, R.; Cook, D.; Corbitt, T. R.; Cordier, M.; Cornish, N.; Corsi, A.; Costa, C. A.; Coughlin, M. W.; Coulon, J.-P.; Countryman, S.; Couvares, P.; Coward, D. M.; Cowart, M.; Coyne, D. C.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Crowder, S. G.; Cumming, A.; Cunningham, L.; Cuoco, E.; Dahl, K.; Dal Canton, T.; Damjanic, M.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Dattilo, V.; Daudert, B.; Daveloza, H.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; Dayanga, T.; De Rosa, R.; Debreczeni, G.; Degallaix, J.; Del Pozzo, W.; Deleeuw, E.; Deleglise, S.; Denker, T.; Dent, T.; Dereli, H.; Dergachev, V.; Derosa, R.; Desalvo, R.; Dhurandhar, S.; di Fiore, L.; di Lieto, A.; di Palma, I.; di, Virgilio A.; Diaz, M.; Dietz, A.; Dmitry, K.; Donovan, F.; Dooley, K. L.; Doravari, S.; Drago, M.; Drever, R. W. P.; Driggers, J. C.; Du, Z.; Dumas, J.-C.; Dwyer, S.; Eberle, T.; Edwards, M.; Effler, A.; Ehrens, P.; Eichholz, J.; Eikenberry, S. S.; Endroczi, G.; Essick, R.; Etzel, T.; Evans, K.; Evans, M.; Evans, T.; Factourovich, M.; Fafone, V.; Fairhurst, S.; Fang, Q.; Farinon, S.; Farr, B.; Farr, W.; Favata, M.; Fazi, D.; Fehrmann, H.; Feldbaum, D.; Ferrante, I.; Ferrini, F.; Fidecaro, F.; Finn, L. S.; Fiori, I.; Fisher, R.; Flaminio, R.; Foley, E.; Foley, S.; Forsi, E.; Fotopoulos, N.; Fournier, J.-D.; Franco, S.; Frasca, S.; Frasconi, F.; Frede, M.; Frei, M.; Frei, Z.; Freise, A.; Frey, R.; Fricke, T. T.; Fritschel, P.; Frolov, V. V.; Fujimoto, M.-K.; Fulda, P.; Fyffe, M.; Gair, J.; Gammaitoni, L.; Garcia, J.; Garufi, F.; Gehrels, N.; Gemme, G.; Genin, E.; Gennai, A.; Gergely, L.; Ghosh, S.; Giaime, J. A.; Giampanis, S.; Giardina, K. D.; Giazotto, A.; Gil-Casanova, S.; Gill, C.; Gleason, J.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, G.; Gordon, N.; Gorodetsky, M. L.; Gossan, S.; Gossler, S.; Gouaty, R.; Graef, C.; Graff, P. B.; Granata, M.; Grant, A.; Gras, S.; Gray, C.; Greenhalgh, R. J. S.; Gretarsson, A. M.; Griffo, C.; Groot, P.; Grote, H.; Grover, K.; Grunewald, S.; Guidi, G. M.; Guido, C.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, B.; Hall, E.; Hammer, D.; Hammond, G.; Hanke, M.; Hanks, J.; Hanna, C.; Hanson, J.; Harms, J.; Harry, G. M.; Harry, I. W.; Harstad, E. D.; Hartman, M. T.; Haughian, K.; Hayama, K.; Heefner, J.; Heidmann, A.; Heintze, M.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, I. S.; Heptonstall, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hodge, K. A.; Holt, K.; Holtrop, M.; Hong, T.; Hooper, S.; Horrom, T.; Hosken, D. J.; Hough, J.; Howell, E. J.; Hu, Y.; Hua, Z.; Huang, V.; Huerta, E. A.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh, M.; Huynh-Dinh, T.; Iafrate, J.; Ingram, D. R.; Inta, R.; Isogai, T.; Ivanov, A.; Iyer, B. R.; Izumi, K.; Jacobson, M.; James, E.; Jang, H.; Jang, Y. J.; Jaranowski, P.; Jimenez-Forteza, F.; Johnson, W. W.; Jones, D.; Jones, D. I.; Jones, R.; Jonker, R. J. G.; Ju, L.; K, H.; Kalmus, P.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kasprzack, M.; Kasturi, R.; Katsavounidis, E.; Katzman, W.; Kaufer, H.; Kaufman, K.; Kawabe, K.; Kawamura, S.; Kawazoe, F.; Kefelian, F.; Keitel, D.; Kelley, D. B.; Kells, W.; Keppel, D. G.; Khalaidovski, A.; Khalili, F. Y.; Khazanov, E. A.; Kim, B. K.; Kim, C.; Kim, K.; Kim, N.; Kim, W.; Kim, Y.-M.; King, E. J.; King, P. J.; Kinzel, D. L.; Kissel, J. S.; Klimen, Ko S.; Kline, J.; Koehlenbeck, S.; Kokeyama, K.; Kondrashov, V.; Koranda, S.; Korth, W. Z.; Kowalska, I.; Kozak, D.; Kremin, A.; Kringel, V.; Krishnan, B.; Krolak, A.; Kucharczyk, C.; Kudla, S.; Kuehn, G.; Kumar, A.; Kumar, P.; Kumar, R.; Kurdyumov, R.; Kwee, P.; Landry, M.; Lantz, B.; Larson, S.; Lasky, P. D.; Lawrie, C.; Lazzarini, A.; Le Roux, A.; Leaci, P.; Lebigot, E. O.; Lee, C.-H.; Lee, H. K.; Lee, H. M.; Lee, J.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levine, B.; Lewis, J. B.; Lhuillier, V.; Li, T. G. F.; Lin, A. C.; Littenberg, T. B.; Litvine, V.; Liu, F.; Liu, H.; Liu, Y.; Liu, Z.; Lloyd, D.; Lockerbie, N. A.; Lockett, V.; Lodhia, D.; Loew, K.; Logue, J.; Lombardi, A. L.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J.; Luan, J.; Lubinski, M. J.; Luck, H.; Lundgren, A. P.; MacArthur, J.; MacDonald, E.; Machenschalk, B.; Macinnis, M.; MacLeod, D. M.; Magana-Sandoval, F.; Mageswaran, M.; Mailand, K.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Manca, G. M.; Mandel, I.; Mandic, V.; Mangano, V.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A.; Maros, E.; Marque, J.; Martelli, F.; Martin, I. W.; Martin, R. M.; Martinelli, L.; Martynov, D.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Matichard, F.; Matone, L.; Matzner, R. A.; Mavalvala, N.; May, G.; Mazumder, N.; Mazzolo, G.; McCarthy, R.; McClelland, D. E.; McGuire, S. C.; McIntyre, G.; McIver, J.; Meacher, D.; Meadors, G. D.; Mehmet, M.; Meidam, J.; Meier, T.; Melatos, A.; Mendell, G.; Mercer, R. A.; Meshkov, S.; Messenger, C.; Meyer, M. S.; Miao, H.; Michel, C.; Mikhailov, E. E.; Milano, L.; Miller, J.; Minenkov, Y.; Mingarelli, C. M. F.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moe, B.; Mohan, M.; Mohapatra, S. R. P.; Mokler, F.; Moraru, D.; Moreno, G.; Morgado, N.; Mori, T.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, C. L.; Mueller, G.; Mukherjee, S.; Mullavey, A.; Munch, J.; Murphy, D.; Murray, P. G.; Mytidis, A.; Nagy, M. F.; Nanda, Kumar D.; Nardecchia, I.; Nash, T.; Naticchioni, L.; Nayak, R.; Necula, V.; Nelemans, G.; Neri, I.; Neri, M.; Newton, G.; Nguyen, T.; Nishida, E.; Nishizawa, A.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E.; Nuttall, L. K.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Oh, S. H.; Ohme, F.; Oppermann, P.; O'Reilly, B.; Ortega Larcher, W.; O'Shaughnessy, R.; Osthelder, C.; Ottaway, D. J.; Ottens, R. S.; Ou, J.; Overmier, H.; Owen, B. J.; Padilla, C.; Pai, A.; Palomba, C.; Pan, Y.; Pankow, C.; Paoletti, F.; Paoletti, R.; Papa, M. A.; Paris, H.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Pedraza, M.; Peiris, P.; Penn, S.; Perreca, A.; Phelps, M.; Pichot, M.; Pickenpack, M.; Piergiovanni, F.; Pierro, V.; Pinard, L.; Pindor, B.; Pinto, I. M.; Pitkin, M.; Poeld, J.; Poggiani, R.; Poole, V.; Poux, C.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L.; Puncken, O.; Punturo, M.; Puppo, P.; Quetschke, V.; Quintero, E.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Racz, I.; Radkins, H.; Raffai, P.; Raja, S.; Rajalakshmi, G.; Rakhmanov, M.; Ramet, C.; Rapagnani, P.; Raymond, V.; Re, V.; Reed, C. M.; Reed, T.; Regimbau, T.; Reid, S.; Reitze, D. H.; Ricci, F.; Riesen, R.; Riles, K.; Robertson, N. A.; Robinet, F.; Rocchi, A.; Roddy, S.; Rodriguez, C.; Rodruck, M.; Roever, C.; Rolland, L.; Rollins, J. G.; Romano, J. D.; Romano, R.; Romanov, G.; Romie, J. H.; Rosinska, D.; Rowan, S.; Rudiger, A.; Ruggi, P.; Ryan, K.; Salemi, F.; Sammut, L.; Sandberg, V.; Sanders, J.; Sannibale, V.; Santiago-Prieto, I.; Saracco, E.; Sassolas, B.; Sathyaprakash, B. S.; Saulson, P. R.; Savage, R.; Schilling, R.; Schnabel, R.; Schofield, R. M. S.; Schreiber, E.; Schuette, D.; Schulz, B.; Schutz, B. F.; Schwinberg, P.; Scott, J.; Scott, S. M.; Seifert, F.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sergeev, A.; Shaddock, D.; Shah, S.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sidery, T. L.; Siellez, K.; Siemens, X.; Sigg, D.; Simakov, D.; Singer, A.; Singer, L.; Sintes, A. M.; Skelton, G. R.; Slagmolen, B. J. J.; Slutsky, J.; Smith, J. R.; Smith, M. R.; Smith, R. J. E.; Smith-Lefebvre, N. D.; Soden, K.; Son, E. J.; Sorazu, B.; Souradeep, T.; Sperandio, L.; Staley, A.; Steinert, E.; Steinlechner, J.; Steinlechner, S.; Steplewski, S.; Stevens, D.; Stochino, A.; Stone, R.; Strain, K. A.; Straniero, N.; Strigin, S.; Stroeer, A. S.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Susmithan, S.; Sutton, P. J.; Swinkels, B.; Szeifert, G.; Tacca, M.; Talukder, D.; Tang, L.; Tanner, D. B.; Tarabrin, S. P.; Taylor, R.; Ter Braack, A. P. M.; Thirugnanasambandam, M. P.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thorne, K. S.; Thrane, E.; Tiwari, V.; Tokmakov, K. V.; Tomlinson, C.; Toncelli, A.; Tonelli, M.; Torre, O.; Torres, C. V.; Torrie, C. I.; Travasso, F.; Traylor, G.; Tse, M.; Ugolini, D.; Unnikrishnan, C. S.; Vahlbruch, H.; Vajente, G.; Vallisneri, M.; van den Brand, J. F. J.; van den Broeck, C.; van der Putten, S.; van der Sluys, M. V.; van Heijningen, J.; van Veggel, A. A.; Vass, S.; Vasuth, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P. J.; Venkateswara, K.; Verkindt, D.; Verma, S.; Vetrano, F.; Vicere, A.; Vincent-Finley, R.; Vinet, J.-Y.; Vitale, S.; Vlcek, B.; Vo, T.; Vocca, H.; Vorvick, C.; Vousden, W. D.; Vrinceanu, D.; Vyachanin, S. P.; Wade, A.; Wade, L.; Wade, M.; Waldman, S. J.; Walker, M.; Wallace, L.; Wan, Y.; Wang, J.; Wang, M.; Wang, X.; Wanner, A.; Ward, R. L.; Was, M.; Weaver, B.; Wei, L.-W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Welborn, T.; Wen, L.; Wessels, P.; West, M.; Westphal, T.; Wette, K.; Whelan, J. T.; Whitcomb, S. E.; White, D. J.; Whiting, B. F.; Wibowo, S.; Wiesner, K.; Wilkinson, C.; Williams, L.; Williams, R.; Williams, T.; Willis, J. L.; Willke, B.; Wimmer, M.; Winkelmann, L.; Winkler, W.; Wipf, C. C.; Wittel, H.; Woan, G.; Worden, J.; Yablon, J.; Yakushin, I.; Yamamoto, H.; Yancey, C. C.; Yang, H.; Yeaton-Massey, D.; Yoshida, S.; Yum, H.; Yvert, M.; Zadrozny, A.; Zanolin, M.; Zendri, J.-P.; Zhang, F.; Zhang, L.; Zhao, C.; Zhu, H.; Zhu, X. J.; Zotov, N.; Zucker, M. E.; Zweizig, J.; Buchner, S.; Cognard, I.; Corongiu, A.; D'Amico, N.; Espinoza, C. M.; Freire, P. C. C.; Gotthelf, E. V.; Guillemot, L.; Hessels, J. W. T.; Hobbs, G. B.; Kramer, M.; Lyne, A. G.; Marshall, F. E.; Possenti, A.; Ransom, S. M.; Ray, P. S.; Roy, J.; Stappers, B. W.; VIRGO Collaboration

    2017-06-01

    In this paper we have used calibrated data from the Virgo second (Aasi et al. 2012CQGra..29o5002A) and fourth science runs (VSR2 and VSR4) and the LIGO sixth science run (S6). Virgo's third science run (VSR3) was relatively insensitive in comparison with VSR4 and has not been included in this analysis. This was partially because Virgo introduced monolithic mirror suspensions prior to VSR4 which improved sensitivity in the low-frequency range. During S6, the two LIGO 4 km detectors at Hanford, Washington (LHO/H1), and Livingston, Louisiana (LLO/L1), were running in an enhanced configuration (Adhikari et al. 2006, Enhanced LIGO, Tech. Rep. LIGO-T060156-v01, California Institute of Technology, Massachusetts Institute of Technology, https://dcc.ligo.org/LIGO-T060156-v1/public) over that from the previous S5 run (Abbott et al. 2009RPPh...72g6901A). (1 data file).

  12. The stopping powers and energy straggling of heavy ions in polymer foils

    International Nuclear Information System (INIS)

    Mikšová, R.; Macková, A.; Malinský, P.; Hnatowicz, V.; Slepička, P.

    2014-01-01

    The stopping power and energy straggling of 7 Li, 12 C and 16 O ions in thin poly(etheretherketone) (PEEK), polyethylene terephthalate (PET) and polycarbonate (PC) foils were measured in the incident beam energy range of 9.4–11.8 MeV using an indirect transmission method. Ions scattered from a thin gold target at an angle of 150° were registered by a partially depleted PIPS detector, partly shielded with a polymer foil placed in front of the detector. Therefore, the signals from both direct and slowed down ions were visible in the same energy spectrum, which was evaluated by the ITAP code, developed at our laboratory. The ITAP code was employed to perform a Gaussian-fitting procedure to provide a complete analysis of each measured spectrum. The measured stopping powers were compared with the predictions obtained from the SRIM-2008 and MSTAR codes and with previous experimental data. The energy straggling data were compared with those calculated by using Bohr’s, Lindhard–Scharff and Bethe–Livingston theories

  13. Application of asymptotic expansions for maximum likelihood estimators' errors to gravitational waves from inspiraling binary systems: The network case

    International Nuclear Information System (INIS)

    Vitale, Salvatore; Zanolin, Michele

    2011-01-01

    This paper describes the most accurate analytical frequentist assessment to date of the uncertainties in the estimation of physical parameters from gravitational waves generated by nonspinning binary systems and Earth-based networks of laser interferometers. The paper quantifies how the accuracy in estimating the intrinsic parameters mostly depends on the network signal to noise ratio (SNR), but the resolution in the direction of arrival also strongly depends on the network geometry. We compare results for six different existing and possible global networks and two different choices of the parameter space. We show how the fraction of the sky where the one sigma angular resolution is below 2 square degrees increases about 3 times when transitioning from the Hanford (USA), Livingston (USA) and Cascina (Italy) network to a network made of five interferometers (while keeping the network SNR fixed). The technique adopted here is an asymptotic expansion of the uncertainties in inverse powers of the SNR where the first order is the inverse Fisher information matrix. We show that the commonly employed approach of using a simplified parameter spaces and only the Fisher information matrix can largely underestimate the uncertainties (the combined effect would lead to a factor 7 for the one sigma sky uncertainty in square degrees at a network SNR of 15).

  14. Barriers and Facilitators to HIV Testing Among Zambian Female Sex Workers in Three Transit Hubs.

    Science.gov (United States)

    Chanda, Michael M; Perez-Brumer, Amaya G; Ortblad, Katrina F; Mwale, Magdalene; Chongo, Steven; Kamungoma, Nyambe; Kanchele, Catherine; Fullem, Andrew; Barresi, Leah; Bärnighausen, Till; Oldenburg, Catherine E

    2017-07-01

    Zambia has a generalized HIV epidemic, and HIV is concentrated along transit routes. Female sex workers (FSWs) are disproportionately affected by the epidemic. HIV testing is the crucial first step for engagement in HIV care and HIV prevention activities. However, to date little work has been done with FSWs in Zambia, and little is known about barriers and facilitators to HIV testing in this population. FSW peer educators were recruited through existing sex worker organizations for participation in a trial related to HIV testing among FSWs. We conducted five focus groups with FSW peer educators (N = 40) in three transit towns in Zambia (Livingstone, Chirundu, and Kapiri Mposhi) to elicit community norms related to HIV testing. Emerging themes demonstrated barriers and facilitators to HIV testing occurring at multiple levels, including individual, social network, and structural. Stigma and discrimination, including healthcare provider stigma, were a particularly salient barrier. Improving knowledge, social support, and acknowledgment of FSWs and women's role in society emerged as facilitators to testing. Interventions to improve HIV testing among FSWs in Zambia will need to address barriers and facilitators at multiple levels to be maximally effective.

  15. An association of genotypes and antimicrobial resistance patterns among Salmonella isolates from pigs and humans in Taiwan.

    Science.gov (United States)

    Kuo, Hung-Chih; Lauderdale, Tsai-Ling; Lo, Dan-Yuan; Chen, Chiou-Lin; Chen, Pei-Chen; Liang, Shiu-Yun; Kuo, Jung-Che; Liao, Ying-Shu; Liao, Chun-Hsing; Tsao, Chi-Sen; Chiou, Chien-Shun

    2014-01-01

    We collected 110 Salmonella enterica isolates from sick pigs and determined their serotypes, genotypes using pulsed-field gel electrophoresis (PFGE), and antimicrobial susceptibility to 12 antimicrobials and compared the data with a collection of 18,280 isolates obtained from humans. The pig isolates fell into 12 common serovars for human salmonellosis in Taiwan; S. Typhimurium, S. Choleraesuis, S. Derby, S. Livingstone, and S. Schwarzengrund were the 5 most common serovars and accounted for a total of 84% of the collection. Of the 110 isolates, 106 (96%) were multidrug resistant (MDR) and 48 (44%) had PFGE patterns found in human isolates. S. Typhimurium, S. Choleraesuis, and S. Schwarzengrund were among the most highly resistant serovars. The majority of the 3 serovars were resistant to 8-11 of the tested antimicrobials. The isolates from pigs and humans sharing a common PFGE pattern displayed identical or very similar resistance patterns and Salmonella strains that caused severe infection in pigs were also capable of causing infections in humans. The results indicate that pigs are one of the major reservoirs to human salmonellosis in Taiwan. Almost all of the pig isolates were MDR, which highlights the necessity of strictly regulating the use of antimicrobials in the agriculture sector in Taiwan.

  16. Limiting technologies for particle beams and high energy physics

    International Nuclear Information System (INIS)

    Panofsky, W.K.H.

    1985-07-01

    Since 1930 the energy of accelerators had grown by an order of magnitude roughly every 7 years. Like all exponential growths, be they human population, the size of computers, or anything else, this eventually will have to come to an end. When will this happen to the growth of the energy of particle accelerators and colliders. Fortunately, as the energy of accelerators has grown the cost per unit energy has decreased almost as fast as has the increase in energy. The result is that while the energy has increased so dramatically the cost per new installation has increased only by roughly an order of magnitude since the 1930's (corrected for inflation), while the number of accelerators operating at the frontier of the field has shrunk. As is shown in the by now familiar Livingston chart this dramatic decrease in cost has been achieved largely by a succession of new technologies, in addition to the more moderate gains in efficiency due to improved design, economies of scale, etc. We are therefore facing two questions: (1) Is there good reason scientifically to maintain the exponential growth, and (2) Are there new technologies in sight which promise continued decreases in unit costs. The answer to the first question is definitely yes; the answer to the second question is maybe

  17. OU3 sediment dating and sedimentation rates

    International Nuclear Information System (INIS)

    Blair, R.B.; Wolaver, H.A.; Burger, V.M.

    1994-01-01

    Environmental Technologies at Rocky Flats Environmental Technology Site (RFS) investigated the sediment history of Standley Lake, Great Western Reservoir, and Mower Reservoir using 137 Cs and 239,240 Pu global fall-out as dating indicators. These Colorado Front Range reservoirs have been the subject of study by various city, state and national agencies due to suspected Department of Energy Rocky Flats Plant impacts. We performed sediment dating as part of the RCRA Facility Investigation/Remedial Investigation Report for Operable Unit 3. A sediment chronology profile assists scientist in determining the year of sedimentation for a particular peak concentration of contaminants. Radioisotope sediment dating for the three reservoirs indicated sedimentation rates of 0.7 to 0.8 in./yr. for Standley Lake (SL), 0.9 in./yr. for Great Western Reservoir (GWR), and 0.3 in./yr. in Mower Reservoir (MR). RFS sediment dating for Operable Unit 3 compared favorably with the Hardy, Livingston, Burke, and Volchok Standley Lake study. This report describes the cesium/plutonium sediment dating method, estimates sedimentation rates for Operable Unit 3 reservoirs, and compares these results to previous investigations

  18. THE STORY BEHIND THE STATISTICS: ON THE DIGITAL COMPETENCES OF ROMANIAN YOUTH

    Directory of Open Access Journals (Sweden)

    GYÖNGYVÉR TŐKÉS

    2016-01-01

    Full Text Available After a critical review of the „digital competences” concept (Lankshear, Knobel, 2008, and the argumentation of the importance of studying them in the context of the second level digital divide (Hargittai, 2001, in our study we aimed to analyze the digital competences of Romanian children and adolescents (9–16 as they emerged from the qualitative data of the EU Kids Online project (Smahel, Wright, 2014. Following the theoretical framework of the EU Kids Online project, we assessed the digital competences of Romanian Youth at three levels: as 1. the range of online activities, 2. the attitudes towards the internet and 3. the self-efficacy perception (Sonck et al., 2012. The results of our study confirm in broad lines the statistical evidences of the EU Kids Online survey (Sonck et al., 2011, also offering a contextual and in depth understanding of the phenomenon by showing that the passage from the repetitive and passive consumption of the internet to the more creative activities – which top the „ladder of opportunities” (Livingstone, Haddon, 2009 – requires parental and/or school active mediation (Velicu, Barbovschi, further-coming. It is obvious, that in default of useful advisement, Romanian youth generally acquires their digital competences on their own, by trial and error processes

  19. Magmatic dyke swarms of the south shetland islands volcanic arc, west-antarctica - tracers of geodynamic history

    Science.gov (United States)

    Kraus, St.; Miller, H.

    2003-04-01

    Magmatic dykes are essential components of volcanic arcs, following joint systems and fracture zones. This work aims to reconstruct the deformational and intrusive history of the northern part of the Antarctic Peninsula by combining structural information with the geochemistry, isotopy and age of the dykes. On the South Shetland Islands volcanic activity began about 130 Ma ago. From Mid to Late Eocene (49-34 Ma) the northern Antarctic Peninsula and southern South America underwent extensional tectonics, which led to sea-floor spreading in the Drake Passage 28 Ma ago. Subsequent slab-rollback caused arc-extension and the opening of the Bransfield Rift as a backarc-basin between 4 and 1.3 Ma ago. Very slow subduction (1mm/a) at the South Shetland trench continues until the present day. Several changes of subduction direction caused crucial variations regarding the tectonic regime in the overlying South Shetland block, being the reason for the shifting strike of the dykes. Several dyke systems were mapped in areas of up to 100000m2, with the outcrop situation being good enough to observe plenty of relative age relationships. ICP-MS geochemical analysis on 132 dykes shows, as expected, that the majority of them correspond to a typical subduction-related calcalcalic suite, ranging from basalts to rhyolites. Nevertheless, some dykes show shoshonitic characteristics and are maybe related to an early stage extensional crustal regime. This is supported by the relative ages observed in the field, indicating, that these dykes belong to the oldest ones outcropping in the investigated area. In one case, the geochemical behaviour of the dyke corresponds clearly to adacitic conditions, being a hint on partially molten subducted oceanic crust. In several areas (e.g. Potter Peninsula, King George Island, and Hurd Peninsula, Livingston Island) a strong correlation between chemism and strike of the dykes - and therefore the tectonic regime at the time of intrusion - is observed. Ce

  20. Número mais provável de Salmonella isoladas de carcaças de frango resfriadas Most probable number of Salmonella isolated from refrigerated broiler carcasses

    Directory of Open Access Journals (Sweden)

    Anderlise Borsoi

    2010-11-01

    Full Text Available A Salmonella permanece um importante problema na avicultura e, considerando os patógenos transmitidos por alimentos, aparece como um dos agentes principais em surtos de toxinfecções alimentares. Para auxiliar na avaliação de riscos em adquirir infecção alimentar via carne de frangos que sofreram cocção inadequada, ou através de contaminação cruzada a partir desses animais, torna-se importante determinar a extensão de contaminação por patógenos em carne crua. No presente trabalho, foram analisadas 180 carcaças de frangos resfriadas, adquiridas em varejos, para pesquisa de Salmonella com determinação do número de células da bactéria. Foi utilizado o método do número mais provável (NMP nos ágares para isolamento verde brilhante com novobiocina (BGN e xilose-lisina tergitol 4 (XLT4. Os resultados mostraram 12,2% de ocorrência de Salmonella nas carcaças de frangos resfriadas e a média de NMP de Salmonella por mL, na leitura pelo ágar XLT4 foi de 2,7 células e no ágar BGN foi de 1,3 células. Os sorovares de Salmonella isolados das carcaças de frangos no estudo foram S. Enteritidis, S. Agona, S.Rissen, S. Heidelberg e S. Livingstone. A análise dos resultados demonstrou existir um número variável de células de Salmonella contaminando as carcaças de frango resfriadas que estão à venda ao consumidor.Salmonella in poultry remains an important worldwide problem, and among foodborne pathogens, the Salmonella appears as one of the most important outbreaks agents. To assess the risks of acquiring infection via undercooked poultry or cross contamination from chickens, it is important to determine the extent of the contamination on raw poultry with this pathogen. In this study, 180 refrigerated broiler carcasses, obtained from local stores, were assessed to recover Salmonella by the most probable number (MPN method to quantify bacterias cells onto brilliant green agar with novobiocin (BGN and xylose lysin tergitol 4 agar

  1. Detection of “Salmonella” spp. in broiler buildings and stuff of slaughterhouse in the central region of Mato Grosso do Sul Ocorrência de "Salmonella" spp. em aviários e abatedouro de frangos de corte na região central de Mato Grosso do Sul

    Directory of Open Access Journals (Sweden)

    Vitor Barbosa Fascina

    2011-03-01

    Full Text Available The aim of this study was to search Salmonella spp. occurrence in broiler poultry shed and poultry products from slaughterhouse in central county of Mato Grosso do Sul. Were analyzed 134 drag swabs in broiler poultry farms located in five counties 123 samples of chickens carcasses, viscera and chilled water from the slaughterhouse. The results showed that 11.28% of 257 samples tested positive for Salmonella, and 1.95% from the field and 9.33% from the slaughterhouse. The serovars found were Salmonella Enteritidis (1.16%, S. Typhimurium (1.94%, S. Senftenberg (0.77%, S. Schwarzengrund (4.28%, S. Livingstone (0.38%, S. Corvallis (1.55% and Salmonella enterica subspecies enterica (O: 4.5:-:1.2 with 1.16%. The use of two enrichment broths and two or more plating means increases the chances of Salmonella spp. Isolation. The serovars Enteritidis and Typhimurium, important in the poultry industry, were found in field and slaughterhouse. It can be concluded that there is an occurrence of different serovars of Salmonella spp. In poultry slaughterhouse and in Mato Grosso do Sul central county. Serovar Schwarzengrum shows the highest percentage of occurrence in the slaughterhouse, suggesting that further studies are conducted to determine the importance of presence compared to other serovars. Control programs and risk analysis are essential for maintaining the health of poultry and reduce potential health risks to the consumer.Objetivou-se com este estudo pesquisar a ocorrência de Salmonella spp. em aviários de frangos de corte e em produtos de abatedouro avícola na região central de Mato Grosso do Sul. Foram analisados 134 suabes de arraste em aviários de frangos de corte localizados em cinco municípios e 123 amostras de carcaças de frango, vísceras e água do chiller provenientes do abatedouro. Os resultados demonstraram que 11,28% das 257 amostras apresentaram resultados positivos para Salmonella, dos quais 1,95% provenientes do campo e 9,33% do

  2. The Art of Thinking: Using Collage to Stimulate Scholarly Work

    Directory of Open Access Journals (Sweden)

    Nicola Simmons

    2013-07-01

    Full Text Available Integrating the arts into higher education pedagogy provides an opportunity for cultivating rich ideas and high-level thinking, capitalizing on the creativity that every person already possesses and uses (Livingston, 2010. As Newton and Plummer (2009 note “the use of the creative arts as pedagogical strategy enables individuals to better understand themselves, [and] to stimulate thinking” (p. 75.We extend that premise to examine the impact of an arts activity on scholarly thinking. Our exploratory study examines academics’ (graduate students and educators identity and role constructs (Kelly, 1955 to understand to what extent engaging in arts-based activities supports meaning-making and conceptualizing research questions. We asked participants to reflect on collages they created, how the collage process supported their research conceptualization, challenges they encountered, and their overall reflections on the process as an adjunct to written scholarly work. We show that the process of creating collages supported participants in making their tacit knowledge explicit, in reflecting at meta-cognitive levels, and in transforming their thinking, often in ways they anticipated would affect their future practice.L’intégration des arts dans la pédagogie de l’enseignement supérieur offre l’occasion de cultiver de riches idées et rend possible une réflexion d’ordre supérieur qui permet de capitaliser sur la créativité que chaque personne possède déjà et utilise (Livingston, 2010. Comme le font remarquer Newton et Plummer (2009, « l’usage des arts créatifs en tant que stratégies pédagogiques permet aux gens de mieux se comprendre et de stimuler la réflexion. » (p. 75Nous élargissons cette prémisse pour examiner l’impact d’une activité artistique sur la pensée savante. Notre étude exploratoire examine l’identité d’universitaires (étudiants de cycles supérieurs et éducateurs et les constructions de r

  3. LIGO Finds Lightest Black-Hole Binary

    Science.gov (United States)

    Kohler, Susanna

    2017-11-01

    Wednesdayevening the Laser Interferometer Gravitational-wave Observatory (LIGO) collaboration quietly mentioned that theyd found gravitational waves from yet another black-hole binary back in June. This casual announcement reveals what is so far the lightest pair of black holes weve watched merge opening the door for comparisons to the black holes weve detected by electromagnetic means.A Routine DetectionThe chirp signal of GW170608 detected by LIGO Hanford and LIGO Livingston. [LIGO collaboration 2017]After the fanfare of the previous four black-hole-binary merger announcements over the past year and a half as well as the announcement of the one neutron-star binary merger in August GW170608 marks our entry into the era in which gravitational-wave detections are officially routine.GW170608, a gravitational-wave signal from the merger of two black holes roughly a billion light-years away, was detected in June of this year. This detection occurred after wed already found gravitational waves from several black-hole binaries with the two LIGO detectors in the U.S., but before the Virgo interferometer came online in Europe and increased the joint ability of the detectors to localize sources.Mass estimates for the two components of GW170608 using different models. [LIGO collaboration 2017]Overall, GW170608 is fairly unremarkable: it was detected by both LIGO Hanford and LIGO Livingston some 7 ms apart, and the signal looks not unlike those of the previous LIGO detections. But because were still in the early days of gravitational-wave astronomy, every discovery is still remarkable in some way! GW170608 stands out as being the lightest pair of black holes weve yet to see merge, with component masses before the merger estimated at 12 and 7 times the mass of the Sun.Why Size MattersWith the exception of GW151226, the gravitational-wave signal discovered on Boxing Day last year, all of the black holes that have been discovered by LIGO/Virgo have been quite large: the masses

  4. Optimal networks of future gravitational-wave telescopes

    Science.gov (United States)

    Raffai, Péter; Gondán, László; Heng, Ik Siong; Kelecsényi, Nándor; Logue, Josh; Márka, Zsuzsa; Márka, Szabolcs

    2013-08-01

    We aim to find the optimal site locations for a hypothetical network of 1-3 triangular gravitational-wave telescopes. We define the following N-telescope figures of merit (FoMs) and construct three corresponding metrics: (a) capability of reconstructing the signal polarization; (b) accuracy in source localization; and (c) accuracy in reconstructing the parameters of a standard binary source. We also define a combined metric that takes into account the three FoMs with practically equal weight. After constructing a geomap of possible telescope sites, we give the optimal 2-telescope networks for the four FoMs separately in example cases where the location of the first telescope has been predetermined. We found that based on the combined metric, placing the first telescope to Australia provides the most options for optimal site selection when extending the network with a second instrument. We suggest geographical regions where a potential second and third telescope could be placed to get optimal network performance in terms of our FoMs. Additionally, we use a similar approach to find the optimal location and orientation for the proposed LIGO-India detector within a five-detector network with Advanced LIGO (Hanford), Advanced LIGO (Livingston), Advanced Virgo, and KAGRA. We found that the FoMs do not change greatly in sites within India, though the network can suffer a significant loss in reconstructing signal polarizations if the orientation angle of an L-shaped LIGO-India is not set to the optimal value of ˜58.2°( + k × 90°) (measured counterclockwise from East to the bisector of the arms).

  5. Facilitating Follow-up of LIGO–Virgo Events Using Rapid Sky Localization

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hsin-Yu [Department of Astronomy and Astrophysics and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States); Holz, Daniel E. [Enrico Fermi Institute, Department of Physics, Department of Astronomy and Astrophysics, and Kavli Institute for Cosmological Physics, University of Chicago, Chicago, IL 60637 (United States)

    2017-05-10

    We discuss an algorithm for accurate and very low-latency (<1 s) localization of gravitational-wave (GW) sources using only the relative times of arrival, relative phases, and relative signal-to-noise ratios for pairs of detectors. The algorithm is independent of distances and masses to leading order, and can be generalized to all discrete (as opposed to stochastic and continuous) sources detected by ground-based detector networks. Our approach is similar to that of BAYESTAR with a few modifications, which result in increased computational efficiency. For the LIGO two-detector configuration (Hanford+Livingston) operating in O1 we find a median 50% (90%) localization of 143 deg{sup 2} (558 deg{sup 2}) for binary neutron stars. We use our algorithm to explore the improvement in localization resulting from loud events, finding that the loudest out of the first 4 (or 10) events reduces the median sky-localization area by a factor of 1.9 (3.0) for the case of two GW detectors, and 2.2 (4.0) for three detectors. We also consider the case of multi-messenger joint detections in both the gravitational and the electromagnetic radiation, and show that joint localization can offer significant improvements (e.g., in the case of LIGO and Fermi /GBM joint detections). We show that a prior on the binary inclination, potentially arising from GRB observations, has a negligible effect on GW localization. Our algorithm is simple, fast, and accurate, and may be of particular utility in the development of multi-messenger astronomy.

  6. Las audiencias activas en la regulación de los medios: la dialéctica consumidor-ciudadano en España y México

    Directory of Open Access Journals (Sweden)

    Carmen Fuente Cobo

    2014-07-01

    Full Text Available Dos han sido los prismas bajo los que se ha concebido tradicionalmente a la audiencia: como ciudadanos, que ante los mensajes de los medios ejercen sus derechos comunicativos y participan en la construcción de una opinión pública libre; o como consumidores o usuarios, que actúan dentro de un mercado de productos audiovisuales. Mientras que la primera perspectiva atiende a la comunicación audiovisual valorando su interés público y su influencia en la construcción de un espacio público de debate y discusión, la segunda atiende a la dimensión más privada e individual de la comunicación audiovisual. En el presente trabajo se abordan las principales posiciones doctrinales sobre dicha dicotomía consumidor-ciudadano, analizando para ello la obra de los autores que más atención han dedicado a estas cuestiones en el ámbito europeo, y en especial los trabajos de Peter Dahlgren sobre las relaciones entre medios y democracia, los de Richard Collins sobre política audiovisual, y los vinculados a Sonia Livingstone sobre esfera pública, participación de las audiencias y gobernanza de los medios. Realizada esta aproximación teórica, se analiza la presencia de dichas concepciones de la audiencia en dos ordenamientos jurídicos audiovisuales que están experimentando modificaciones sustanciales: el español y el mexicano. Como conclusión, se constata que las distintas concepciones de la audiencia están en profunda relación con la forma de concebir el control de los medios y la rendición de cuentas de sus operadores frente al público.

  7. Magnetron sputtering of Fe-oxides on the top of HTS YBCO films

    International Nuclear Information System (INIS)

    Nurgaliev, T.; Blagoev, B.; Buchkov, K.; Mateev, E.; Gajda, G.; Nedkov, I.; Kovacheva, D.; Slavov, L.; Starbova, I.; Starbov, N.; Nankovski, M.

    2017-01-01

    The possibilities for preparation of bilayers containing magnetic Fe-oxide (Fe-O) and high temperature superconducting (HTS) YBa 2 Cu 3 O 7−x (YBCO) thin films were investigated. For this purpose, Fe-O films were deposited using reactive magnetron sputtering at comparatively low temperatures T≤250 °C onto dielectric (for example, LaAlO 3 (LAO)) substrates, covered with a HTS YBCO film. The sputtering of the Fe-O layer at such conditions did not lead to a crucial damage of the critical temperature T C of the YBCO film, but could affect the width of the superconducting transition. A decrease of the critical temperature of the (Fe-O)/YBCO/LAO bilayer kept at ambient conditions was observed, possibly due to the negative effects of the water vapour on the sample characteristics. The double peak structure of the imaginary component of the response signal to the AC harmonic magnetic field, observed in such a (Fe-O)/YBCO/LAO sample, was ascribed from two possible views: as a consequence of morphology determined inter- and intra-granular contributions and/or as transitions from dominant irreversible processes as Bean-Livingston barrier to vortex state chains formation. - Highlights: • Iron-oxide (Fe-O) film sputtered on the top of superconducting HTS YBCO film at not very high temperatures. • No crucially damaged superconducting properties of YBCO film during Fe-O sputtering process. • A negative effect of the ambient conditions on the critical temperature of the obtained samples. • A double peak structure of the response signal to the AC harmonic magnetic field in a (Fe-O)/YBCO/LAO is observed.

  8. Multiscale sampling model for motion integration.

    Science.gov (United States)

    Sherbakov, Lena; Yazdanbakhsh, Arash

    2013-09-30

    Biologically plausible strategies for visual scene integration across spatial and temporal domains continues to be a challenging topic. The fundamental question we address is whether classical problems in motion integration, such as the aperture problem, can be solved in a model that samples the visual scene at multiple spatial and temporal scales in parallel. We hypothesize that fast interareal connections that allow feedback of information between cortical layers are the key processes that disambiguate motion direction. We developed a neural model showing how the aperture problem can be solved using different spatial sampling scales between LGN, V1 layer 4, V1 layer 6, and area MT. Our results suggest that multiscale sampling, rather than feedback explicitly, is the key process that gives rise to end-stopped cells in V1 and enables area MT to solve the aperture problem without the need for calculating intersecting constraints or crafting intricate patterns of spatiotemporal receptive fields. Furthermore, the model explains why end-stopped cells no longer emerge in the absence of V1 layer 6 activity (Bolz & Gilbert, 1986), why V1 layer 4 cells are significantly more end-stopped than V1 layer 6 cells (Pack, Livingstone, Duffy, & Born, 2003), and how it is possible to have a solution to the aperture problem in area MT with no solution in V1 in the presence of driving feedback. In summary, while much research in the field focuses on how a laminar architecture can give rise to complicated spatiotemporal receptive fields to solve problems in the motion domain, we show that one can reframe motion integration as an emergent property of multiscale sampling achieved concurrently within lamina and across multiple visual areas.

  9. Coherent network detection of gravitational waves: the redundancy veto

    International Nuclear Information System (INIS)

    Wen Linqing; Schutz, Bernard F

    2005-01-01

    A network of gravitational wave detectors is called redundant if, given the direction to a source, the strain induced by a gravitational wave in one or more of the detectors can be fully expressed in terms of the strain induced in others in the network. Because gravitational waves have only two polarizations, any network of three or more differently oriented interferometers with similar observing bands is redundant. The three-armed LISA space interferometer has three outputs that are redundant at low frequencies. The two aligned LIGO interferometers at Hanford WA are redundant, and the LIGO detector at Livingston LA is nearly redundant with either of the Hanford detectors. Redundant networks have a powerful veto against spurious noise, a linear combination of the detector outputs that contains no gravitational wave signal. For LISA, this 'null' output is known as the Sagnac mode, and its use in discriminating between detector noise and a cosmological gravitational wave background is well understood. But the usefulness of the null veto for ground-based detector networks has been ignored until now. We show that it should make it possible to discriminate in a model-independent way between real gravitational waves and accidentally coincident non-Gaussian noise 'events' in redundant networks of two or more broadband detectors. It has been shown that with three detectors, the null output can even be used to locate the direction to the source, and then two other linear combinations of detector outputs give the optimal 'coherent' reconstruction of the two polarization components of the signal. We discuss briefly the implementation of such a detection strategy in realistic networks, where signals are weak, detector calibration is a significant uncertainty, and the various detectors may have different (but overlapping) observing bands

  10. Optimal networks of future gravitational-wave telescopes

    International Nuclear Information System (INIS)

    Raffai, Péter; Márka, Zsuzsa; Márka, Szabolcs; Gondán, László; Kelecsényi, Nándor; Heng, Ik Siong; Logue, Josh

    2013-01-01

    We aim to find the optimal site locations for a hypothetical network of 1–3 triangular gravitational-wave telescopes. We define the following N-telescope figures of merit (FoMs) and construct three corresponding metrics: (a) capability of reconstructing the signal polarization; (b) accuracy in source localization; and (c) accuracy in reconstructing the parameters of a standard binary source. We also define a combined metric that takes into account the three FoMs with practically equal weight. After constructing a geomap of possible telescope sites, we give the optimal 2-telescope networks for the four FoMs separately in example cases where the location of the first telescope has been predetermined. We found that based on the combined metric, placing the first telescope to Australia provides the most options for optimal site selection when extending the network with a second instrument. We suggest geographical regions where a potential second and third telescope could be placed to get optimal network performance in terms of our FoMs. Additionally, we use a similar approach to find the optimal location and orientation for the proposed LIGO-India detector within a five-detector network with Advanced LIGO (Hanford), Advanced LIGO (Livingston), Advanced Virgo, and KAGRA. We found that the FoMs do not change greatly in sites within India, though the network can suffer a significant loss in reconstructing signal polarizations if the orientation angle of an L-shaped LIGO-India is not set to the optimal value of ∼58.2°( + k × 90°) (measured counterclockwise from East to the bisector of the arms). (paper)

  11. Basic Data Report for Drillhole SNL-2 (C-2948) (Waste Isolation Pilot Plant)

    International Nuclear Information System (INIS)

    Powers, Dennis W.

    2005-01-01

    SNL-2 was drilled in the northwest quarter of Section 12, T22S, R30E, in eastern Eddy County, New Mexico (Figure 2-1). It is located 574 ft from the north line (fnl) and 859 ft from the west line (fwl) of the section (Figure 2-2). This location places the drillhole east of the Livingston Ridge escarpment among oil wells of the Cabin Lake field. SNL-2 will be used to test hydraulic properties and to monitor ground water levels of the Culebra Dolomite Member of the Permian Rustler Formation. SNL-2 was permitted by the New Mexico State Engineer as C-2948. [Official correspondence regarding permitting and regulatory information must reference this permit number.] In the plan describing the integrated groundwater hydrology program (Sandia National Laboratories, 2003), SNL-2 is also codesignated WTS-1 because the location also satisfies needs for long-term monitoring of water quality and movement in the Culebra Dolomite for RCRA permitting; this program is under the management of Washington TRU Solutions LLC (WTS). In the event that additional wells are established on the SNL-2 drillpad to monitor other hydrological units (e.g., the Magenta Dolomite Member of the Permian Rustler Formation), the current drillhole will likely be referred to as SNL-2C because it is completed in the Culebra. Most drillholes at WIPP have been described after completion to provide an account of the geology, hydrology, or other basic data acquired during drilling and immediate completion of the drillhole. In addition, the basic data report provides an account of the drilling procedures and activities that may be helpful to later interpretations of data or for further work in the drillhole, including test activities and eventual plugging and abandoning activities. The basic data report also provides a convenient means of reporting information about administrative activities necessary to drill the hole.

  12. Basic Data Report for Drillhole SNL-2 (C-2948)

    Energy Technology Data Exchange (ETDEWEB)

    Powers, Dennis W. [Washington Regulatory and Environmental Services (United States)

    2005-01-19

    SNL-2 was drilled in the northwest quarter of Section 12, T22S, R30E, in eastern Eddy County, New Mexico (Figure 2-1). It is located 574 ft from the north line (fnl) and 859 ft from the west line (fwl) of the section (Figure 2-2). This location places the drillhole east of the Livingston Ridge escarpment among oil wells of the Cabin Lake field. SNL-2 will be used to test hydraulic properties and to monitor ground water levels of the Culebra Dolomite Member of the Permian Rustler Formation. SNL-2 was permitted by the New Mexico State Engineer as C-2948. [Official correspondence regarding permitting and regulatory information must reference this permit number.] In the plan describing the integrated groundwater hydrology program (Sandia National Laboratories, 2003), SNL-2 is also codesignated WTS-1 because the location also satisfies needs for long-term monitoring of water quality and movement in the Culebra Dolomite for RCRA permitting; this program is under the management of Washington TRU Solutions LLC (WTS). In the event that additional wells are established on the SNL-2 drillpad to monitor other hydrological units (e.g., the Magenta Dolomite Member of the Permian Rustler Formation), the current drillhole will likely be referred to as SNL-2C because it is completed in the Culebra. Most drillholes at WIPP have been described after completion to provide an account of the geology, hydrology, or other basic data acquired during drilling and immediate completion of the drillhole. In addition, the basic data report provides an account of the drilling procedures and activities that may be helpful to later interpretations of data or for further work in the drillhole, including test activities and eventual plugging and abandoning activities. The basic data report also provides a convenient means of reporting information about administrative activities necessary to drill the hole.

  13. Zero air emission and zero drilling waste landfill leachate collection well installation method

    International Nuclear Information System (INIS)

    Miller, M.S.; Hornsby, R.G.

    1992-01-01

    Landfilling of industrial wastes is an extensively used means of disposal throughout the US. Prior to RCRA, many landfills were little more than excavated trenches. During the construction and filling of such trenches, the long-term environmental impact was seldom considered. Water (leachate) management for these early landfills was not part of engineering or operating considerations. Today, waste management facilities succeed or fail on the quality of their leachate management efforts, as judged by groundwater quality around the landfill. The CECOS International Inc. facility near Livingston, Louisiana has three pre-RCRA disposal units (landfills) that were designed, constructed, and closed by a previous owner. These disposal units were constructed without any type of leachate removal system. During 1984-1985, samples from two nearby monitor wells revealed evidence of groundwater contamination in the area, principally in the shallow (30-foot) zone. A one-year, state-approved groundwater assessment revealed the nature and extent of groundwater contamination. Later, the Louisiana Department of Environmental Quality (LDEQ) approved a remedial action plan (RAP) for this area that included: Installation of an engineered slurry wall surrounding the disposal units to isolate the shallow groundwater regime. Placement of an engineered cap over the units to prevent rainwater infiltration. Installation of several recovery wells inside the units to facilitate removal of leachate. While efforts are now underway to provide for removal of impacted groundwater in the vicinity of these old wells, the long-term solution is to reduce or, to the greatest extent possible, eliminate the liquid volume inside the cells. This paper deals with the installation of 16 leachate recovery wells inside the pre-RCRA disposal units

  14. Magnetron sputtering of Fe-oxides on the top of HTS YBCO films

    Energy Technology Data Exchange (ETDEWEB)

    Nurgaliev, T. [Institute of Electronics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Blagoev, B. [Institute of Solid State Physics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Laboratory of High Magnetic Fields and Low Temperatures, 95 Gajowicka Str., 53-421 Wroclaw (Poland); Buchkov, K. [Institute of Solid State Physics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Mateev, E. [Institute of Electronics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Gajda, G. [Laboratory of High Magnetic Fields and Low Temperatures, 95 Gajowicka Str., 53-421 Wroclaw (Poland); Nedkov, I. [Institute of Electronics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Kovacheva, D. [Institute of General and Inorganic Chemistry, Bulgarian Academy of Sciences, Acad. G. Bonchev Street, bl. 10, 1113 Sofia (Bulgaria); Slavov, L. [Institute of Electronics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Laboratory of High Magnetic Fields and Low Temperatures, 95 Gajowicka Str., 53-421 Wroclaw (Poland); Starbova, I.; Starbov, N. [Institute of Solid State Physics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Nankovski, M. [Institute of Electronics, Bulgarian Academy of Sciences, 72 Tsarigradsko Chausse, 1784 Sofia (Bulgaria); Sofia university “St. Kliment Ohridski”, Faculty of Physics, 5 James Bourchier Blvd., 1164 Sofia (Bulgaria)

    2017-05-01

    The possibilities for preparation of bilayers containing magnetic Fe-oxide (Fe-O) and high temperature superconducting (HTS) YBa{sub 2}Cu{sub 3}O{sub 7−x} (YBCO) thin films were investigated. For this purpose, Fe-O films were deposited using reactive magnetron sputtering at comparatively low temperatures T≤250 °C onto dielectric (for example, LaAlO{sub 3} (LAO)) substrates, covered with a HTS YBCO film. The sputtering of the Fe-O layer at such conditions did not lead to a crucial damage of the critical temperature T{sub C} of the YBCO film, but could affect the width of the superconducting transition. A decrease of the critical temperature of the (Fe-O)/YBCO/LAO bilayer kept at ambient conditions was observed, possibly due to the negative effects of the water vapour on the sample characteristics. The double peak structure of the imaginary component of the response signal to the AC harmonic magnetic field, observed in such a (Fe-O)/YBCO/LAO sample, was ascribed from two possible views: as a consequence of morphology determined inter- and intra-granular contributions and/or as transitions from dominant irreversible processes as Bean-Livingston barrier to vortex state chains formation. - Highlights: • Iron-oxide (Fe-O) film sputtered on the top of superconducting HTS YBCO film at not very high temperatures. • No crucially damaged superconducting properties of YBCO film during Fe-O sputtering process. • A negative effect of the ambient conditions on the critical temperature of the obtained samples. • A double peak structure of the response signal to the AC harmonic magnetic field in a (Fe-O)/YBCO/LAO is observed.

  15. In vitro immunobiological activity of an Antarctic streptomyces polysaccharide

    International Nuclear Information System (INIS)

    Toshkova, R.; Yossifova, L.; Gardeva, E.; Zvetkova, E.; Ivanova, V.

    2010-01-01

    Antarctic Streptomyces sp. 1010, were obtained from sea water samples (Livingston Island, Antarctica), during the Third Bulgarian Antarctic Scientific Expedition (1994-1995). The ecophysiological methods for isolation and characterization of these active, cold-adapted, Gram-positive microorganisms (psychrophiles) in morphological, phenotypic, genetic and taxonomic aspects, have been earlier reported. In this study, a new extracellular polysaccharide (heteropolysaccharide) has been isolated and purified from cultured broth of the Antarctic Streptomyces sp. 1010. The monosaccharide content of the Antarctic streptomyces heteropolysaccharide has been examined by TLC and GC/MS. The mitogenic and immuno potential properties of the purified Antarctic Streptomyces polysaccharide (ASMP) have been studied in vitro - in the short-term cultures of human peripheral blood mononuclear cells (hPBMCs - lymphocytes and monocytes) and mouse spleen lymphocytes (mouse splenocytes - mSps). The results obtained show that ASMP has a double lectin-like effect on the proliferative activity of hPBMCs: similar to this of Con A on the lymphoid cells (preliminary T-lymphocytes) and to the effect of LPS on the mononuclear from monocyte-macrophage lineage. Expressed as proliferative index (PI), the mitogenic response of mSps to the in vitro influence of ASMP was also higher than PI in the negative, as well as in the positive controls (mSps, cultured in the presence of PHA, Con A and LPS). The new Antarctic Streptomyces' heteropolysaccharide examined could be useful in the future as an immunomodulative biologically active substance and its extracellular production may contribute to the development of thermobiochemistry, immunomodulative drug therapy and immunopharmaceutical industry. (authors)

  16. Activation of ATPase activity of simian virus 40 large T antigen by the covalent affinity analog of ATP, fluorosulfonylbenzoyl 5'-adenosine.

    Science.gov (United States)

    Bradley, M K

    1990-01-01

    Fluorosulfonylbenzoyl 5'-adenosine (FSBA) bound to one site in simian virus 40 large T antigen (T) and covalently modified greater than 95% of the molecules in a complete reaction. This analog for ATP specifically cross-links to the Mg-phosphate pocket in ATP-binding sites. Cyanogen bromide cleavage and tryptic digestion of [14C]FSBA-labeled protein, paired with T-specific monoclonal antibody analyses, were used to map the site in T to a tryptic peptide just C terminal to the PAb204 epitope. The location of the FSBA linkage was consistent with the predicted tertiary structure of the ATP-binding region in T described previously (M. K. Bradley, T. F. Smith, R. H. Lathrop, D. M. Livingston, and T. A. Webster, Proc. Natl. Acad. Sci. USA 84:4026-4030, 1987). Binding of FSBA to T was cooperative, implying an interaction between two binding sites. This could occur if the protein formed a dimer, and it is known that the ATPase activity is associated with a dimeric T. Most interesting was the activation of the ATPase when up to 50% of T was bound by the analog. The effect was also produced by preincubation with millimolar concentrations of ATP or the nonhydrolyzable analog gamma beta-methylene 5'-adenosine diphosphate at elevated temperatures. When greater than 50% of T was modified by FSBA, the ATPase was inhibited as the analog cross-linked to the second, previously activated, binding site. These data support a dual function for the one ATP-binding site in T as both regulatory and catalytic. Images PMID:1697910

  17. A cadaveric study of the anatomical variation of the origins of the celiac trunk and the superior mesenteric artery: a role in median arcuate ligament syndrome?

    Science.gov (United States)

    Katz-Summercorn, Annalise; Bridger, John

    2013-11-01

    Gray's Anatomy states, "the celiac trunk is the first anterior branch of the abdominal aorta and arises just below the aortic hiatus. The superior mesenteric artery originates from the aorta c1.0 cm below the celiac trunk." (Standring, 2008a, Gray's Anatomy. 40th Ed. London: Churchill Livingstone Elsevier, p. 1073-1074). During dissection classes with medical students we found this not to be the case. We have re-evaluated the anatomy of the origins of the celiac trunk (CT) and superior mesenteric artery (SMA) and the relationship of the CT to the median arcuate ligament (MAL) in 99 cadavers. We have found the external distance between the CT and SMA to range from 0 to 20 mm (mean 3.4 mm, SD 5.17 mm), with the two in direct apposition in 57.6% (n = 99) of cases: a higher figure than previously documented. However, the internal distance between the CT and SMA ranged from 10 to 30 mm (mean 18.9 mm, SD 4.09 mm). There was no distance measurable between the MAL and the CT in 88 cadavers (92.6%, n = 95) and, of these, 32 (33.7%) showed evidence of compression or kinking of the CT. We suspect that the MAL is responsible for the approximation of the CT to the SMA in these cadavers, and that the high incidence of kinking of the CT (33.7% of cases) may have implications with regard to its role in MAL syndrome. Copyright © 2013 Wiley Periodicals, Inc.

  18. Reverse correlating trustworthy faces in young and older adults

    Directory of Open Access Journals (Sweden)

    Catherine eÉthier-Majcher

    2013-09-01

    Full Text Available Little is known about how older persons determine if someone deserves their trust or not based on their facial appearance, a process referred to as facial trustworthiness. In the past few years, Todorov and colleagues have argued that, in young adults, trustworthiness judgments are an extension of emotional judgments, and therefore, that trust judgments are made based on a continuum between anger and happiness (Engell, Todorov & Haxby, 2010; Todorov, 2008. Evidence from the literature on emotion processing suggest that older adults tend to be less efficient than younger adults in the recognition of negative facial expressions (Chaby & Narme, 2009; Ruffman, Henry, Livingstone et al., 2008; Firestone, Turk-Browne & Ryan, 2007; Calder, Keane, Manly et al., 2003. Based on Todorov’s theory and the fact that older adults seem to be less efficient than younger adults in identifying emotional expressions, one could expect that older individuals would have different representations of trustworthy faces and that they would use different cues than younger adults in order to make such judgments. We verified this hypothesis using a variation of Mangini and Biederman's (2004 reverse correlation method in order to test and compare classification images resulting from trustworthiness (in the context of money investment, from happiness, and from anger judgments in two groups of participants: young adults and older healthy adults. Our results show that for elderly participants, both happy and angry representations are correlated with trustworthiness judgments. However, in young adults, trustworthiness judgments are mainly correlated with happiness representations. These results suggest that young and older adults differ in their way of judging trustworthiness.

  19. How has alcohol advertising in traditional and online media in Australia changed? Trends in advertising expenditure 1997-2011.

    Science.gov (United States)

    White, Victoria; Faulkner, Agatha; Coomber, Kerri; Azar, Denise; Room, Robin; Livingston, Michael; Chikritzhs, Tanya; Wakefield, Melanie

    2015-06-19

    The aim of this study was to determine changes in advertising expenditures across eight media channels for the four main alcohol beverage types and alcohol retailers in Australia. Yearly advertising expenditures between January 1997 and December 2011 obtained from a leading media-monitoring company. Media channels assessed were: free-to-air television, newspapers, magazines, radio, outdoors (billboards), cinema, direct mail (from 2005) and online (from 2008). Data were categorised into alcohol retailers (e.g. supermarkets, off-licences) or four alcoholic beverage types (beer, wine, spirits, premixed spirits/cider). Regression analyses examined associations between year and expenditure. Total alcohol advertising expenditure peaked in 2007, then declined to 2011 (P = 0.02). Television advertising expenditure declined between 2000 and 2011 (P advertising expenditure increased between 1997 and 2007. Alcohol retailers' advertising expenditure increased over time (P advertising expenditure declined over time (beer: P advertising expenditure increased (beer: P advertised beer (P advertising alcohol. As our study excluded non-traditional advertising media (e.g. sponsorships, in-store) we cannot determine whether declines in television advertising have been offset by increases in advertising in newer media channels. However, our findings that media channels used for alcohol advertising have changed over time highlights the need for adequate controls on alcohol advertising in all media channels. [White V, Faulkner A, Coomber K, Azar D, Room R, Livingston M, Chikritzhs T, Wakefield M. How has alcohol advertising in traditional and online media in Australia changed? Trends in advertising expenditure 1997-2011. Drug Alcohol Rev 2015]. © 2015 Australasian Professional Society on Alcohol and other Drugs.

  20. CARBONIZER TESTS WITH LAKELAND FEEDSTOCKS

    Energy Technology Data Exchange (ETDEWEB)

    C. Lu; Z. Fan; R. Froehlich; A. Robertson

    2003-09-01

    Research has been conducted under United States Department of Energy Contract (USDOE) DE-AC21-86MC21023 to develop a new type of coal-fired plant for electric power generation. This new type of plant, called a Second Generation Pressurized Fluidized Bed Combustion Plant (2nd Gen PFB), offers the promise of efficiencies greater than 48%, with both emissions and a cost of electricity that are significantly lower than those of conventional pulverized coal-fired (PC) plants with wet flue gas desulfurization/scrubbers. The 2nd Gen PFB plant incorporates the partial gasification of coal in a carbonizer, the combustion of carbonizer char in a pressurized circulating fluidized (PCFB) bed boiler, and the combustion of carbonizer syngas in a topping combustor to achieve gas turbine inlet temperatures of 2700 F and higher. Under the USDOE Clean Coal V Demonstration Plant Program, a nominal 260 MWe plant demonstrating 2nd Gen PFB technology has been proposed for construction at the McIntosh Power Plant of the City of Lakeland, Florida. In the September-December 1997 time period, four test runs were conducted in Foster Wheeler's 12-inch diameter carbonizer pilot plant in Livingston New Jersey to ascertain carbonizer performance characteristics with the Kentucky No. 9 coal and Florida limestone proposed for use in the Lakeland plant. The tests were of a short-term nature exploring carbonizer carbon conversions, sulfur capture efficiencies and syngas alkali levels. The tests were successful; observed carbonizer performance was in agreement with predictions and no operating problems, attributed to the planned feedstocks, were encountered. The results of the four test runs are reported herein.

  1. Child and adolescent exposure to alcohol advertising in Australia's major televised sports.

    Science.gov (United States)

    Carr, Sherilene; O'Brien, Kerry S; Ferris, Jason; Room, Robin; Livingston, Michael; Vandenberg, Brian; Donovan, Robert J; Lynott, Dermot

    2016-07-01

    Exposure to alcohol advertising is associated with greater alcohol consumption in children and adolescents, and alcohol advertising is common in Australian sport. We examine child, adolescent and young adult exposure to alcohol advertising during three televised sports in Australia: Australian Football League (AFL), cricket and the National Rugby League (NRL). Alcohol advertising and audience viewing data were purchased for all AFL, cricket and NRL TV programs in Australia for 2012. We estimated children and adolescents (0-17 years) and young adults (18-29 years) exposure to alcohol advertising during AFL, cricket and NRL programs in the daytime (06:00-20:29 h), and night-time (20:30-23:59 h). There were 3544 alcohol advertisements in AFL (1942), cricket (941) and NRL programs (661), representing 60% of all alcohol advertising in sport TV, and 15% of all alcohol advertisements on Australian TV. These programs had a cumulative audience of 26.9 million children and adolescents, and 32 million young adults. Children and adolescents received 51 million exposures to alcohol advertising, with 47% of this exposure occurring during the daytime. Children and adolescents exposure to alcohol advertising was similar to young adults and peaked after 8.30pm. Child and adolescent and young adult's exposure to alcohol advertising is high when viewing sport TV in Australia in the daytime and night-time. Current alcohol advertising regulations are not protecting children and adolescents from exposure, particularly in prominent televised sports. The regulations should be changed to reduce children and adolescent excessive exposure to alcohol advertising when watching sport. [Carr S, O'Brien KS, Ferris J, Room R, Livingston M, Vandenberg B, Donovan RJ, Lynott D. Child and adolescent exposure to alcohol advertising in Australia's major televised sports. Drug Alcohol Rev 2016;35:406-411]. © 2015 Australasian Professional Society on Alcohol and other Drugs.

  2. A mixture of sparse coding models explaining properties of face neurons related to holistic and parts-based processing.

    Directory of Open Access Journals (Sweden)

    Haruo Hosoya

    2017-07-01

    Full Text Available Experimental studies have revealed evidence of both parts-based and holistic representations of objects and faces in the primate visual system. However, it is still a mystery how such seemingly contradictory types of processing can coexist within a single system. Here, we propose a novel theory called mixture of sparse coding models, inspired by the formation of category-specific subregions in the inferotemporal (IT cortex. We developed a hierarchical network that constructed a mixture of two sparse coding submodels on top of a simple Gabor analysis. The submodels were each trained with face or non-face object images, which resulted in separate representations of facial parts and object parts. Importantly, evoked neural activities were modeled by Bayesian inference, which had a top-down explaining-away effect that enabled recognition of an individual part to depend strongly on the category of the whole input. We show that this explaining-away effect was indeed crucial for the units in the face submodel to exhibit significant selectivity to face images over object images in a similar way to actual face-selective neurons in the macaque IT cortex. Furthermore, the model explained, qualitatively and quantitatively, several tuning properties to facial features found in the middle patch of face processing in IT as documented by Freiwald, Tsao, and Livingstone (2009. These included, in particular, tuning to only a small number of facial features that were often related to geometrically large parts like face outline and hair, preference and anti-preference of extreme facial features (e.g., very large/small inter-eye distance, and reduction of the gain of feature tuning for partial face stimuli compared to whole face stimuli. Thus, we hypothesize that the coding principle of facial features in the middle patch of face processing in the macaque IT cortex may be closely related to mixture of sparse coding models.

  3. Alcohol consumption trends in Australia: Comparing surveys and sales-based measures.

    Science.gov (United States)

    Livingston, Michael; Callinan, Sarah; Raninen, Jonas; Pennay, Amy; Dietze, Paul M

    2018-04-01

    Survey data remain a crucial means for monitoring alcohol consumption, but there has been limited work done to ensure that surveys adequately capture changes in per-capita consumption in Australia. In this study, we explore how trends in consumption from two major Australian surveys compare with an official measure of per-capita consumption between 2001 and 2014 and examine age-specific trends in drinking. Data were from five waves of the cross-sectional National Health Survey (total n = 113 279) and 12 waves of the longitudinal Household Income and Labour Dynamics in Australia Study (average n = 12 347). Overall and age-specific estimates of annual alcohol consumption were derived and compared with official per-capita consumption and previous analyses of the National Drug Strategy Household Survey. In terms of overall consumption, both surveys broadly reflected trends in per-capita consumption, especially the decline that has been observed since 2007/2008. Age-specific trends were broadly similar, with the recent decline in consumption clearly concentrated among teenagers and young adults. The main Australian monitoring surveys remain useful monitoring tools for alcohol consumption in Australia. There is consistent evidence that the recent declines in Australian per-capita consumption have been driven by sharp falls in drinking among young people, a trend that requires further study. [Livingston M, Callinan S, Raninen J, Pennay A, Dietze PM. Alcohol consumption trends in Australia: Comparing surveys and sales-based measures. Drug Alcohol Rev 2017;00:000-000]. © 2017 Australasian Professional Society on Alcohol and other Drugs.

  4. Human adipose stem cell and ASC-derived cardiac progenitor cellular therapy improves outcomes in a murine model of myocardial infarction

    Directory of Open Access Journals (Sweden)

    Davy PMC

    2015-10-01

    Full Text Available Philip MC Davy,1 Kevin D Lye,2,3 Juanita Mathews,1 Jesse B Owens,1 Alice Y Chow,1 Livingston Wong,2 Stefan Moisyadi,1 Richard C Allsopp1 1Institute for Biogenesis Research, 2John A. Burns School of Medicine, University of Hawaii at Mānoa, 3Tissue Genesis, Inc., Honolulu, HI, USA Background: Adipose tissue is an abundant and potent source of adult stem cells for transplant therapy. In this study, we present our findings on the potential application of adipose-derived stem cells (ASCs as well as induced cardiac-like progenitors (iCPs derived from ASCs for the treatment of myocardial infarction. Methods and results: Human bone marrow (BM-derived stem cells, ASCs, and iCPs generated from ASCs using three defined cardiac lineage transcription factors were assessed in an immune-compromised mouse myocardial infarction model. Analysis of iCP prior to transplant confirmed changes in gene and protein expression consistent with a cardiac phenotype. Endpoint analysis was performed 1 month posttransplant. Significantly increased endpoint fractional shortening, as well as reduction in the infarct area at risk, was observed in recipients of iCPs as compared to the other recipient cohorts. Both recipients of iCPs and ASCs presented higher myocardial capillary densities than either recipients of BM-derived stem cells or the control cohort. Furthermore, mice receiving iCPs had a significantly higher cardiac retention of transplanted cells than all other groups. Conclusion: Overall, iCPs generated from ASCs outperform BM-derived stem cells and ASCs in facilitating recovery from induced myocardial infarction in mice. Keywords: adipose stem cells, myocardial infarction, cellular reprogramming, cellular therapy, piggyBac, induced cardiac-like progenitors

  5. Skin hydration, microrelief and greasiness of normal skin in Antarctica.

    Science.gov (United States)

    Tsankov, N; Mateev, D; Darlenski, R

    2018-03-01

    The skin is the primary defence of the human body against external factors from physical, chemical, mechanical and biologic origin. Climatic factors together with low temperature and sun radiation affect the skin. The effect of climatic conditions in Antarctica on healthy skin has not been previously addressed. The aim of this study was to evaluate the changes in the skin hydration, greasiness and microrelief due to the extreme climatic environmental factors during the stay of the members of the Bulgarian Antarctic expedition. Fifty-nine Caucasian healthy subjects, 42 men and 17 women with mean age 50.9 years (27-68), were enrolled. The study was performed in five consecutive years from 2011 to 2016 at the Bulgarian Antarctic base camp at Livingston Island. The study protocol consisted of two parts: study A: duration of 15 days with measurement of skin physiology parameters on a daily basis, and study B: five measurements at baseline and at days 14, 30, 45 and 50 upon arrival in Antarctica. We measured three biophysical parameters related to skin physiology at cheek skin by an impedance measuring device. No statistically significant difference between parameters at the different measurement points. There is a variation in skin hydration reaching its lower point at day 11 and then returning to values similar to baseline. Initially, an increase in skin greasiness was witnessed with a sharp depression at day 11 and final values at day 15 resembling the ones at baseline. An increase, although not statistically significant, in skin roughness was observed in the first 15 days of the study. Study B showed no statistically significant variances between values of the three parameters. Our studies show the pioneer results of the effect of Antarctic climate on human skin physiology. © 2017 European Academy of Dermatology and Venereology.

  6. Seasonal cycle of circulation in the Antarctic Peninsula and the off-shelf transport of shelf waters into southern Drake Passage and Scotia Sea

    Science.gov (United States)

    Jiang, Mingshun; Charette, Matthew A.; Measures, Christopher I.; Zhu, Yiwu; Zhou, Meng

    2013-06-01

    The seasonal cycle of circulation and transport in the Antarctic Peninsula shelf region is investigated using a high-resolution (˜2 km) regional model based on the Regional Oceanic Modeling System (ROMS). The model also includes a naturally occurring tracer with a strong source over the shelf (radium isotope 228Ra, t1/2=5.8 years) to investigate the sediment Fe input and its transport. The model is spun-up for three years using climatological boundary and surface forcing and then run for the 2004-2006 period using realistic forcing. Model results suggest a persistent and coherent circulation system throughout the year consisting of several major components that converge water masses from various sources toward Elephant Island. These currents are largely in geostrophic balance, driven by surface winds, topographic steering, and large-scale forcing. Strong off-shelf transport of the Fe-rich shelf waters takes place over the northeastern shelf/slope of Elephant Island, driven by a combination of topographic steering, extension of shelf currents, and strong horizontal mixing between the ACC and shelf waters. These results are generally consistent with recent and historical observational studies. Both the shelf circulation and off-shelf transport show a significant seasonality, mainly due to the seasonal changes of surface winds and large-scale circulation. Modeled and observed distributions of 228Ra suggest that a majority of Fe-rich upper layer waters exported off-shelf around Elephant Island are carried by the shelfbreak current and the Bransfield Strait Current from the shallow sills between Gerlache Strait and Livingston Island, and northern shelf of the South Shetland Islands, where strong winter mixing supplies much of the sediment derived nutrients (including Fe) input to the surface layer.

  7. New Paleomagnetic and 40Ar/39Ar Geochronological Results for the South Shetland Islands, West Antarctica, and Their Tectonic Implications

    Science.gov (United States)

    Gao, Liang; Zhao, Yue; Yang, Zhenyu; Liu, Jianmin; Liu, Xiaochun; Zhang, Shuan-Hong; Pei, Junling

    2018-01-01

    To reconstruct the paleoposition of the Antarctic Peninsula relative to the South American Plate during the breakup of Gondwana, as well as the opening kinematics of the Drake Passage, we conducted detailed paleomagnetic, rock magnetic, and isotopic chronology studies of Byers Peninsula (Livingston Island) and Fildes Peninsula (King George Island) of the South Shetland Islands. The 40Ar/39Ar ages of the Agate Beach Formation to the Long Hill Formation in Fildes Peninsula range from 56.38 ± 0.2 Ma to 52.42 ± 0.19 Ma. Low natural remanent magnetization/isothermal remanent magnetization ratios, inconsistency with the polarity constrained by the paleomagnetic results and 40Ar/39Ar age constraints, as well as the widespread cation-deficient titanomagnetite and Ti-free magnetite of secondary origin, indicate that the volcanic and sedimentary rocks of Fildes Peninsula were remagnetized at about 55 Ma. Combining our results with previous data from the South Shetland Islands and the Antarctic Peninsula, we calculated the paleopoles for 110 Ma and 55 Ma for the South Shetland Islands and the Antarctic Peninsula. The paleomagnetic reconstruction of the relative paleoposition of the Antarctic Peninsula and South America shows that these plates were connected and experienced a southward movement and clockwise rotation from 110 to 55 Ma. Subsequently, southward translation and clockwise rotation of the Antarctic Peninsula between 55 and 27 Ma separated the Antarctic Peninsula and South America, forming the Drake Passage. Northward translation of South America after 27 Ma increased the N-S divergence and increased the distance between the Antarctic Peninsula and the South American Plate.

  8. WEB-IS2: Next Generation Web Services Using Amira Visualization Package

    Science.gov (United States)

    Yang, X.; Wang, Y.; Bollig, E. F.; Kadlec, B. J.; Garbow, Z. A.; Yuen, D. A.; Erlebacher, G.

    2003-12-01

    Amira (www.amiravis.com) is a powerful 3-D visualization package and has been employed recently by the science and engineering communities to gain insight into their data. We present a new web-based interface to Amira, packaged in a Java applet. We have developed a module called WEB-IS/Amira (WEB-IS2), which provides web-based access to Amira. This tool allows earth scientists to manipulate Amira controls remotely and to analyze, render and view large datasets over the internet, without regard for time or location. This could have important ramifications for GRID computing. The design of our implementation will soon allow multiple users to visually collaborate by manipulating a single dataset through a variety of client devices. These clients will only require a browser capable of displaying Java applets. As the deluge of data continues, innovative solutions that maximize ease of use without sacrificing efficiency or flexibility will continue to gain in importance, particularly in the Earth sciences. Major initiatives, such as Earthscope (http://www.earthscope.org), which will generate at least a terabyte of data daily, stand to profit enormously by a system such as WEB-IS/Amira (WEB-IS2). We discuss our use of SOAP (Livingston, D., Advanced SOAP for Web development, Prentice Hall, 2002), a novel 2-way communication protocol, as a means of providing remote commands, and efficient point-to-point transfer of binary image data. We will present our initial experiences with the use of Naradabrokering (www.naradabrokering.org) as a means to decouple clients and servers. Information is submitted to the system as a published item, while it is retrieved through a subscription mechanisms, via what is known as "topics". These topic headers, their contents, and the list of subscribers are automatically tracked by Naradabrokering. This novel approach promises a high degree of fault tolerance, flexibility with respect to client diversity, and language independence for the

  9. Estrogenic and serotonergic butenolides from the leaves of Piper hispidum Swingle (Piperaceae)

    Science.gov (United States)

    Michel, Joanna L; Chen, Yegao; Zhang, Hongjie; Huang, Yue; Krunic, Alecjev; Orjala, Jimmy; Veliz, Mario; Soni, Kapil K.; Soejarto, Djaja Doel; Caceres, Armando; Perez, Alice; Mahady, Gail B

    2010-01-01

    Ethnopharmacological relevance Our previous work has demonstrated that several plants in the Piperaceae family are commonly used by the Q’eqchi Maya of Livingston, Guatemala to treat amenorrhea, dysmenorrhea, and pain. Extracts of Piper hispidum Swingle (Piperaceae), bound to the estrogen (ER) and serotonin (5-HT7) receptors. Aim of the study To investigate the estrogenic and serotonergic activities of P. hispidum extracts in functionalized assays, identify the active chemical constituents in the leaf extract, and test these compounds as agonists or antagonists of ER and 5-HT7. Materials and methods The effects of the P. hispidum leaf extracts were investigated in estrogen reporter gene and endogenous gene assays in MCF-7 cells to determine if the extracts acted as an estrogen agonist or antagonist. In addition, the active compounds were isolated using ER- and 5-HT7 receptor bioassay-guided fractionation. The structures of the purified compounds were identified using high-resolution LC-MS and NMR spectroscopic methods. The ER- and 5-HT7-agonist effects of the purified chemical constituents were tested in a 2ERE-reporter gene assay in MCF-7 cells and in serotonin binding and functionalized assays. Results Three butenolides including one new compound (1) were isolated from the leaves of P. hispidum, and their structures were determined. Compound 1 bound to the serotonin receptor 5-HT7 with IC50 values of 16.1 and 8.3 μM, respectively, and using GTP shift assays, compound 1 was found to be a partial agonist of the 5-HT7 receptor. The P. hispidum leaf extracts, as well as compounds 2 and 3 enhanced the expression of estrogen responsive reporter and endogenous genes in MCF-7 cells, demonstrating estrogen agonist effects. Conclusions Extracts of P. hispidum act as agonists of the ER and 5-HT7 receptors. Compound 1, a new natural product, identified as 9, 10-methylenedioxy-5,6-Z-fadyenolide, was isolated as the 5-HT7 agonist. Compounds 2 and 3 are reported for the

  10. Preoperative intravenous ibuprofen does not influence postoperative narcotic use in patients undergoing elective hernia repair: a randomized, double-blind, placebo controlled prospective trial

    Directory of Open Access Journals (Sweden)

    Sparber LS

    2017-07-01

    Full Text Available Lauren S Sparber,1 Christine SM Lau,1,2 Tanya S Vialet,1 Ronald S Chamberlain1–4 1Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2Saint George’s University School of Medicine, Grenada, West Indies; 3Department of Surgery, Banner MD Anderson Cancer Center, Gilbert, AZ, USA; 4Department of Surgery, New Jersey Medical School, Rutgers University, Newark, NJ, USA Introduction: Inguinal and umbilical hernia repairs are among the most common surgical procedures performed in the US. Optimal perioperative pain control regimens remain challenging and opioid analgesics are commonly used. Preoperative nonsteroidal anti-inflammatory drug (NSAID administration has been shown to reduce postoperative narcotic requirements. This study sought to evaluate the efficacy of perioperative intravenous (IV ibuprofen on postoperative pain level and narcotic use in patients undergoing open or laparoscopic inguinal and/or umbilical hernia repair.Methods: A single center, randomized, double-blind placebo-controlled trial involving patients ≥18 years undergoing inguinal and/or umbilical hernia repair was performed. Patients were randomized to receive 800 mg of IV ibuprofen or placebo preoperatively. Outcomes assessed included postoperative pain medication required and visual analog scale (VAS pain scores.Results: Forty-eight adult male patients underwent inguinal and/or umbilical hernia repair. Patients receiving IV ibuprofen used more oxycodone/acetaminophen (32% vs 13% and IV hydromorphone (12% vs 8.7%, and fewer combinations of pain medications (44% vs 65.2% in the first two postoperative hours compared to placebo (p=0.556. The IV ibuprofen group had more patients pain free (28% vs 8.7%, p=0.087 and lower VAS scores (3.08±2.14 vs 3.95±1.54, p=0.134 at 2 hours postoperatively, compared to the placebo group, however, this was not statistically significant. Similar pain levels at 1, 3, and 7 days, postoperative and similar use of rescue

  11. Tephra compositions from Late Quaternary volcanoes around the Antarctic Peninsula

    Science.gov (United States)

    Kraus, S.

    2009-12-01

    Crustal extension and rifting processes opened the Bransfield Strait between the South Shetland Islands and the Antarctic Peninsula during the last 4 Ma. Similar processes on the Peninsula's eastern side are responsible for volcanism along Larsen Rift. There are at least 11 volcanic centers with known or suspected Late Pleistocene / Holocene explosive activity (Fig. 1). Fieldwork was carried out on the islands Deception, Penguin, Bridgeman and Paulet, moreover at Melville Peak (King George Is.) and Rezen Peak (Livingston Is.). Of special importance is the second ever reported visit and sampling at Sail Rock, and the work on never before visited outcrops on the northern slopes and at the summit of Cape Purvis volcano (Fig. 1). The new bulk tephra ICP-MS geochemical data provide a reliable framework to distinguish the individual volcanic centers from each other. According to their Mg-number, Melville Peak and Penguin Island represent the most primitive magma source. Nb/Y ratios higher than 0.67 in combination with elevated Th/Yb and Ta/Yb ratios and strongly enriched LREE seem to be diagnostic to distinguish the volcanoes located along the Larsen Rift from those associated with Bransfield Rift. Sr/Y ratios discriminate between the individual Larsen Rift volcanoes, Paulet Island showing considerably higher values than Cape Purvis volcano. Along Bransfield Rift, Bridgeman Island and Melville Peak have notably lower Nb/Y and much higher Th/Nb than Deception Island, Penguin Island and Sail Rock. The latter displays almost double the Th/Yb ratio as compared to Deception Island, and also much higher LREE enrichment but extraordinarily low Ba/Th, discriminating it from Penguin Island. Such extremely low Ba/Th ratios are also typical for Melville Peak, but for none of the other volcanoes. Penguin Island has almost double the Ba/Th and Sr/Y ratios higher than any other investigated volcano. Whereas the volcanoes located in the northern part of Bransfield Strait have Zr

  12. Latitudinal exposure to DDTs, HCB, PCBs, PBDEs and DP in giant petrels (Macronectes spp.) across the Southern Ocean

    Energy Technology Data Exchange (ETDEWEB)

    Roscales, Jose L., E-mail: jlroscales@iqog.csic.es [Department of Instrumental Analysis and Environmental Chemistry, Institute of Organic Chemistry, CSIC (IQOG-CSIC), Juan de la Cierva 3, 28006 Madrid (Spain); González-Solís, Jacob; Zango, Laura [Institut de Recerca de la Biodiversitat (IRBio) and Department of Animal Biology, Universitat de Barcelona, Av Diagonal 643, 08028 Barcelona (Spain); Ryan, Peter G. [Percy FitzPatrick Institute, DST-NRF Centre of Excellence, University of Cape Town, Rondebosch 7701 (South Africa); Jiménez, Begoña [Department of Instrumental Analysis and Environmental Chemistry, Institute of Organic Chemistry, CSIC (IQOG-CSIC), Juan de la Cierva 3, 28006 Madrid (Spain)

    2016-07-15

    Studies on Persistent Organic Pollutants (POPs) in Antarctic wildlife are scarce, and usually limited to a single locality. As a result, wildlife exposure to POPs across the Southern Ocean is poorly understood. In this study, we report the differential exposure of the major southern ocean scavengers, the giant petrels, to POPs across a wide latitudinal gradient. Selected POPs (PCBs, HCB, DDTs, PBDEs) and related compounds, such as Dechlorane Plus (DP), were analyzed in plasma of southern giant petrels (Macronectes giganteus) breeding on Livingston (62°S 61°W, Antarctica), Marion (46°S 37°E, sub-Antarctic), and Gough (40°S 10°W, cool temperate) islands. Northern giant petrels (Macronectes halli) from Marion Island were also studied. Stable isotope ratios of C and N (δ{sup 13}C and δ{sup 15}N) were used as dietary tracers of the marine habitat and trophic level, respectively. Breeding locality was a major factor explaining petrel exposure to POPs compared with species and sex. Significant relationships between δ{sup 13}C values and POP burdens, at both inter- and intra-population levels, support latitudinal variations in feeding grounds as a key factor in explaining petrel pollutant burdens. Overall, pollutant levels in giant petrels decreased significantly with latitude, but the relative abundance (%) of the more volatile POPs increased towards Antarctica. DP was found at negligible levels compared with legacy POPs in Antarctic seabirds. Spatial POP patterns found in giant petrels match those predicted by global distribution models, and reinforce the hypothesis of atmospheric long-range transport as the main source of POPs in Antarctica. Our results confirm that wildlife movements out of the polar region markedly increase their exposure to POPs. Therefore, strategies for Antarctic wildlife conservation should consider spatial heterogeneity in exposure to marine pollution. Of particular relevance is the need to clarify the exposure of Antarctic predators to

  13. α-Methylprednisolone conjugated cyclodextrin polymer-based nanoparticles for rheumatoid arthritis therapy

    Directory of Open Access Journals (Sweden)

    Jungyeon Hwang

    2008-10-01

    Full Text Available Jungyeon Hwang1, Kathleen Rodgers2, James C Oliver3, Thomas Schluep11Insert Therapeutics, Inc., Pasadena, CA, USA; 2Livingston Research Institute, Los Angeles, CA, USA; James C Oliver, Peptagen, Inc., Raleigh, NC USAAbstract: A glycinate derivative of α-methylprednisolone (MP was prepared and conjugated to a linear cyclodextrin polymer (CDP with a loading of 12.4% w/w. The polymer conjugate (CDP-MP self-assembled into nanoparticles with a size of 27 nm. Release kinetics of MP from the polymer conjugate showed a half-life (t1/2 of 50 h in phosphate buffer solution (PBS and 19 h in human plasma. In vitro, the proliferation of human lymphocytes was suppressed to a similar extent but with a delayed effect when CDP-MP was compared with free MP. In vivo, CDP-MP was administered intravenously to mice with collagen-induced arthritis and compared with free MP. CDP-MP was administered weekly for six weeks (0.07, 0.7, and 7 mg/kg/week and MP was administered daily for six weeks (0.01, 0.1, and 1 mg/kg/day. Body weight changes were minimal in all animals. After 28 days, a significant decrease in arthritis score was observed in animals treated weekly with an intermediate or high dose of CDP-MP. Additionally, dorsoplantar swelling was reduced to baseline in animals treated with CDP-MP at the intermediate and high dose level. Histological evaluation showed a reduction in synovitis, pannus formation and disruption of architecture at the highest dose level of CDP-MP. MP administered daily at equivalent cumulative doses showed minimal efficacy in this model. This study demonstrates that conjugation of MP to a cyclodextrin-polymer may improve its efficacy, leading to lower doses and less frequent administration for a safer and more convenient management of rheumatoid arthritis.Keywords: α-methylprednisolone (MP, cyclodextrin polymer (CDP, polymer conjugate (CDP-MP, rheumatoid arthritis (RA, enhanced permeability and retention effect (EPR

  14. De cómo España abrió su ruta a la investigación antártica

    Directory of Open Access Journals (Sweden)

    Castellví Piulachs, Josefina

    2007-10-01

    Full Text Available Antarctica and its surrounding seas have a particular interest for scientists because they treasure up lots of information on the planet’s past and the evolution of its species. Isolation is the main cause of ignorance on Antarctica since only as recently as in the middle of last century began the truly scientific expeditions there. In the eighties a special attention arouse in the Spanish research community towards this continent. This phenomenon added to the political incentive of becoming a member of the Washington Treaty caused the installation of a base and the launching of an oceanographic ship. Since 1987 yearly expeditions are sent there with an average of 140 scientists who carry out research both on board the ship Hesperides and in the two settlements, King Juan Carlos I and Admiral Gabriel de Castilla.La Antártida así como los océanos que la rodean tienen un interés especial para la investigación científica ya que son depositarios de una gran información sobre el pasado del Planeta y la evolución de sus especies. El aislamiento de este continente es la causa de su desconocimiento y solamente en la segunda mitad del siglo XX se puede hablar de expediciones científicas. En los años ochenta en la comunidad científica española se produjo una especial atención por el conocimiento de la Antártida y ayudados por el interés político de que España pudiera ser Miembro Consultivo del Tratado Antártico, se instaló la Base Antártica Española Juan Carlos I en Isla Livingston y se construyó el buque oceanográfico “Hespérides”. Desde 1987 anualmente se organizan expediciones con una media de 140 científicos que hacen sus investigaciones desde el propio buque “Hespérides” y desde los dos asentamientos españoles existentes: Juan Carlos I y Gabriel de Castilla.

  15. A multi-proxy geochemical investigation of late-Quaternary paleoenvironmental change from Burial Lake, Noatak National Preserve, Alaska

    Science.gov (United States)

    Finkenbinder, M. S.; Abbott, M.; Stoner, J. S.; Dorfman, J. M.

    2012-12-01

    Here we present a new multi-proxy geochemical analysis of paleoenvironmental change inferred from sediment cores recovered from Burial Lake (68.434° N, 159.174° W; 430 m ASL) in northwest Alaska. Previous work on cores from 7.9 m water depth sampled at comparatively low resolution revealed basal sediments date to ~ 40,000 cal yr BP and an unconformity during a period of aridity around the Last Glacial Maximum (LGM). We therefore collected multiple overlapping Livingston cores from the lake depocenter (21.5 m water depth) in the summer of 2010 in an effort to develop a temporally continuous, high resolution record spanning prior to the LGM to the present. We focus our interpretations on a 6.51 m core developed through wiggle matching proxy data from core sites A10 and C10. We use traditional laboratory methods and investigate new approaches to assess changes in sedimentation and productivity. We are measuring dry bulk density, organic matter via Loss-on-ignition at 550° C, biogenic silica, magnetic susceptibility, grain size via laser diffractometry, and elemental abundances via scanning x-ray fluorescence (XRF). Future research seeks to test the reliability of two commonly used XRF proxies, for organic matter (incoherence/coherence ratios) and aquatic productivity (Si/Ti ratios). Age control is provided by 12 Accelerator Mass Spectrometry radiocarbon dates of discrete terrestrial macrofossils. Results from these analyses indicate that the depocenter core is continuous and the sediment record spans the last ~ 38,000 cal yr BP and most importantly contains sediments spanning the LGM. Preliminary geochemical results demonstrate substantial cyclicity in organic matter and aquatic productivity beginning in the late-glacial. We seek to analyze the periodicity of these proxies through spectral analysis, although initial observations suggest multi-century to millennial scale variability. In addition, we note the presence of two abrupt, non-linear transitions in organic

  16. Rural-urban migration in Zambia and migrant ties to home villages.

    Science.gov (United States)

    Ogura, M

    1991-06-01

    Rural to urban migration patterns in Zambia and migrant ties to home villages are discussed 1st in terms of a statistical overview of migration and urbanization, and followed by an examination of lengthening stays in towns and ties to the home village based on other studies and the author's field research and random sampling in 6 urban areas of Zambia. The primary population centers are the copperbelt which comprises 45% of the total urban population, and Lusaka which is 24% of the total urban population. 31% of the total population reside in Lusaka, 7 mining towns, Kabwe, and Livingstone. Migration and a high rate of natural population growth are responsible for the urban growth. Recent economic difficulties have reduced the flow of migration to urban areas and lead to the out migration in copper towns. independence also has had an effect on migration, such that female migration increased along with male migration. Female migration reflects female educational advances and the changing practice of housewives accompanying husbands. The informal sector absorbs a great number of the migrant labor force. Income gaps between urban and rural areas also contribute to migration flows. Other magnets in urban areas are better educational opportunities, a water supply, and the lure of city lights. Since independence, migrants have increased their length of stay in towns but continue to maintain links with their home villages. 87.5% of mine workers are estimated as intending to go back to their villages. Before the mid-1970s it is estimated in a Ngombe squatter camp that 65% of employed male household heads had sent money home the prior year, 58% had visited home within the past 5 years, but 25% had never visited in 10 years. 58% intended to return home and 36% intended to stay permanently. The author's research between 1987-89 found 3 types of squatter villages: those retired and not returning to home villages such as Kansusuwa, those workers living in compounds where farm

  17. Atypical teratoid rhabdoid tumors: a population-based clinical outcomes study involving 174 patients from the Surveillance, Epidemiology, and End Results database (1973–2010

    Directory of Open Access Journals (Sweden)

    Lau CS

    2015-09-01

    Full Text Available Christine SM Lau,1,2 Krishnaraj Mahendraraj,1 Ronald S Chamberlain1–31Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2Saint George's University School of Medicine, Grenada, West Indies; 3Department of Surgery, New Jersey Medical School, Rutgers University, Newark, NJ, USA Introduction: Atypical teratoid rhabdoid tumors (ATRTs are rare, highly malignant embryonal tumors of the central nervous system (CNS accounting for 20% of CNS tumors in children under the age of 3. This study examines a large cohort of ATRT patients to determine demographic, clinical, and pathologic factors which impact prognosis and survival. Methods: Demographic and clinical data were abstracted on 174 ATRT patients (171 pediatric patients age <20 and 3 adult patients age ≥20 from the Surveillance, Epidemiology, and End Results database (1973–2010. Standard statistical methodology was used. Results: A total of 174 ATRT cases (mean age of 2.84 years were identified. ATRT had a higher incidence in males (56.3%, Caucasians (59.1%, and children <3 years of age (80.5%, P<0.001. The most common primary sites were the cerebellum (17.8%, ventricles (16.1%, and frontal lobe (12.6%. Mean overall survival was 3.2±0.4 years, while overall and cancer-specific mortality were 63.2% and 56.3%, respectively, P=0.005. Most ATRT cases were treated with surgery alone (58.0%, followed by a combination of surgery and radiation (34.3%, no treatment (6.5%, and radiation alone (1.2%. The use of combination therapy has increased significantly (16.1% since 2005 (P<0.001, while primary surgical resection and radiation therapy rates remain relatively unchanged. The longest survival was observed among ATRT patients receiving combination therapy (5.9±0.7 years, followed by radiation alone (2.8±1.2 years, and surgery alone (1.9±0.4 years, P<0.001. Multivariable analysis identified only distant metastases (OR =4.6 as independently associated with increased mortality

  18. Pressurized fluidized bed combustion second-generation system research and development. Technical progress for Phase 2 and Phase 3, October 1, 1997--September 30, 1998

    Energy Technology Data Exchange (ETDEWEB)

    Robertson, A.; Horazak, D.; Newby, R.; Rehmat, A.; White, J.

    1998-10-01

    When DOE funds were exhausted in March 1995, all Phase 2 activities were placed on hold. In February 1996 a detailed cost estimate was submitted to the DOE for completing the two remaining Phase 2 Multi Annular Swirl Burner (MASB) topping combustor test burns; in August 1996 release was received from METC to proceed with these tests. The first test (Test Campaign No.3) will be conducted to: (1) test the MASB at proposed demonstration plant full to minimum loading operating conditions; (2) identify the lower oxygen limit of the MASB; and (3) demonstrate natural gas to carbonizer fuel gas switching. The Livingston Phase 3 Pilot Plant was last operated under contract DE-AC21-86MC21023 in September 1995 for seven days in an integrated carbonizer-CPFBC configuration. In May, 1996, the pilot plant was transferred to Contract DE-AC22-95PC95143 to allow testing in support of the High Performance Power Systems (HIPPS) Program. The HIPPS Program required modifications to the pilot plant and the following changes were incorporated: (1) installation of a dense phase transport system for loading pulverized coal into the feed system lock hopper directly from a pneumatic transport truck; (2) removal of the char transfer pipe between the char collecting hopper and the CPFBC to allow carbonizer only operation; (3) installation of a lock hopper directly under the char collecting hopper to facilitate char removal from the process, the hopper vent gases exhaust to the carbonizer baghouse filter and the depressured char is transferred via nitrogen to the CPFBC baghouse for dumping into drums; (4) removal of the carbonizer cyclone and top of bed overflow drain line; all material elutriated from the carbonizer bed will thus be removed by the 22-element Westinghouse ceramic candle filter; (5) replacement of the carbonizer continuous bottom bed drain (screw feeder) with a batch-type drain removal system; and (6) installation of a mass spectrometer that draws sample gas via a steam jacketed

  19. Oligodendrogliomas in pediatric and adult patients: an outcome-based study from the Surveillance, Epidemiology, and End Result database

    Directory of Open Access Journals (Sweden)

    Lau CSM

    2017-05-01

    Full Text Available Christine SM Lau,1,2 Krishnaraj Mahendraraj,1 Ronald S Chamberlain1–4 1Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2Saint George’s University School of Medicine, Grenada, West Indies; 3Department of Surgery, New Jersey Medical School, Rutgers University, Newark, NJ, 4Department of Surgery, Banner MD Anderson Cancer Center, Gilbert, AZ, USA Introduction: Oligodendrogliomas (OGs account for <20% of all intracranial tumors and 25% of gliomas. Despite improvements in imaging techniques allowing for earlier diagnosis, OG is rare among the pediatric population. This study examines a large cohort of OG patients in an effort to define the demographic, clinical, and pathologic factors associated with clinical and survival outcomes.Methods: Data on 7,001 OG patients were abstracted from the Surveillance, Epidemiology, and End Result (SEER database (1973–2013. Pediatric patients were defined as ≤19 years old, and adult patients were defined as age ≥20 years.Results: Among 7,001 OG patients, 6.5% were pediatric (mean age 12 ± 6 years, and 93.5% were adult (mean age 46 ± 15 years. Overall, OGs were more common among males, with a male-to-female ratio of 1.28:1. Overall, OGs were more common among Caucasians (76.9% and also among the African American (10.8% pediatric vs. 4.0% adult and Hispanic (12.8% pediatric vs. 11.8% adult. OGs occurred most commonly in the temporal lobe of pediatric patients and the frontal lobes of adults. Surgical resection was the primary treatment modality for both pediatric and adult populations (70.6% and 40.5%, followed by combined surgery and radiation (19.7% and 41.2%. Surgical resection was associated with significantly improved survival in both groups. Pediatric patients had a lower overall mortality (19.8% vs. 48.5% and lower cancer-specific mortality (17.6% vs. 36.8%.Conclusion: OGs most often present in Caucasian males in their fifth decade of life with tumors >4 cm in size

  20. Geomorphology and vegetation mapping the ice-free terrains of the Western Antarctic Peninsula region using very high resolution imagery from an UAV

    Science.gov (United States)

    Vieira, G.; Mora, C.; Pina, P.; Bandeira, L.; Hong, S. G.

    2014-12-01

    March 2014 and will also include some test data from the mountains of serra da Estrela, Portugal. New surveying is planned for the season of 2014-15 with mapping to be conducted in Livingston and King George Islands.

  1. Health Management Applications for International Space Station

    Science.gov (United States)

    Alena, Richard; Duncavage, Dan

    2005-01-01

    Traditional mission and vehicle management involves teams of highly trained specialists monitoring vehicle status and crew activities, responding rapidly to any anomalies encountered during operations. These teams work from the Mission Control Center and have access to engineering support teams with specialized expertise in International Space Station (ISS) subsystems. Integrated System Health Management (ISHM) applications can significantly augment these capabilities by providing enhanced monitoring, prognostic and diagnostic tools for critical decision support and mission management. The Intelligent Systems Division of NASA Ames Research Center is developing many prototype applications using model-based reasoning, data mining and simulation, working with Mission Control through the ISHM Testbed and Prototypes Project. This paper will briefly describe information technology that supports current mission management practice, and will extend this to a vision for future mission control workflow incorporating new ISHM applications. It will describe ISHM applications currently under development at NASA and will define technical approaches for implementing our vision of future human exploration mission management incorporating artificial intelligence and distributed web service architectures using specific examples. Several prototypes are under development, each highlighting a different computational approach. The ISStrider application allows in-depth analysis of Caution and Warning (C&W) events by correlating real-time telemetry with the logical fault trees used to define off-nominal events. The application uses live telemetry data and the Livingstone diagnostic inference engine to display the specific parameters and fault trees that generated the C&W event, allowing a flight controller to identify the root cause of the event from thousands of possibilities by simply navigating animated fault tree models on their workstation. SimStation models the functional power flow

  2. Active intra-basin faulting in the Northern Basin of Lake Malawi from seismic reflection data

    Science.gov (United States)

    Shillington, D. J.; Chindandali, P. R. N.; Scholz, C. A.; Ebinger, C. J.; Onyango, E. A.; Peterson, K.; Gaherty, J. B.; Nyblade, A.; Accardo, N. J.; McCartney, T.; Oliva, S. J.; Kamihanda, G.; Ferdinand, R.; Salima, J.; Mruma, A. H.

    2016-12-01

    Many questions remain about the development and evolution of fault systems in weakly extended rifts, including the relative roles of border faults and intra-basin faults, and segmentation at various scales. The northern Lake Malawi (Nyasa) rift in the East African Rift System is an early stage rift exhibiting pronounced tectonic segmentation, which is defined by 100-km-long border faults. The basins also contain a series of intrabasinal faults and associated synrift sediments. The occurrence of the 2009 Karonga Earthquake Sequence on one of these intrabasinal faults indicates that some of them are active. Here we present new multichannel seismic reflection data from the Northern Basin of the Malawi Rift collected in 2015 as a part of the SEGMeNT (Study of Extension and maGmatism in Malawi aNd Tanzania) project. This rift basin is bound on its east side by the west-dipping Livingstone border fault. Over 650 km of seismic reflection profiles were acquired in the Northern Basin using a 500 to 1540 cu in air gun array and a 1200- to 1500-m seismic streamer. Dip lines image a series of north-south oriented west-dipping intra-basin faults and basement reflections up to 5 s twtt near the border fault. Cumulative offsets on intra-basin faults decrease to the west. The largest intra-basin fault has a vertical displacement of >2 s two-way travel time, indicating that it has accommodated significant total extension. Some of these intra-basin faults offset the lake bottom and the youngest sediments by up to 50 s twtt ( 37 m), demonstrating they are still active. The two largest intra-basin faults exhibit the largest offsets of young sediments and also correspond to the area of highest seismicity based on analysis of seismic data from the 89-station SEGMeNT onshore/offshore network (see Peterson et al, this session). Fault patterns in MCS profiles vary along the basin, suggesting a smaller scale of segmentation of faults within the basin; these variations in fault patterns

  3. Rock Magnetic Properties of Laguna Carmen (Tierra del Fuego, Argentina): Implications for Paleomagnetic Reconstruction

    Science.gov (United States)

    Gogorza, C. G.; Orgeira, M. J.; Ponce, F.; Fernández, M.; Laprida, C.; Coronato, A.

    2013-05-01

    We report preliminary results obtained from a multi-proxy analysis including paleomagnetic and rock-magnetic studies of two sediment cores of Laguna Carmen (53°40'60" S 68°19'0" W, ~83m asl) in the semiarid steppe in northern Tierra del Fuego island, Southernmost Patagonia, Argentina. Two short cores (115 cm) were sampled using a Livingstone piston corer during the 2011 southern fall. Sediments are massive green clays (115 to 70 cm depth) with irregularly spaced thin sandy strata and lens. Massive yellow clay with thin sandy strata continues up to 30 cm depth; from here up to 10 cm yellow massive clays domain. The topmost 10 cm are mixed yellow and green clays with fine sand. Measurements of intensity and directions of Natural Remanent Magnetization (NRM), magnetic susceptibility, isothermal remanent magnetization, saturation isothermal remanent magnetization (SIRM), back field and anhysteretic remanent magnetization at 100 mT (ARM100mT) were performed and several associated parameters calculated (ARM100mT/k and SIRM/ ARM100mT). Also, as a first estimate of relative magnetic grain-size variations, the median destructive field of the NRM (MDFNRM), was determined. Additionally, we present results of magnetic parameters measured with vibrating sample magnetometer (VSM). The stability of the NRM was analyzed by alternating field demagnetization. The magnetic properties have shown variable values, showing changes in both grain size and concentration of magnetic minerals. It was found that the main carrier of remanence is magnetite with the presence of hematite in very low percentages. This is the first paleomagnetic study performed in lakes located in the northern, semiarid fuegian steppe, where humid-dry cycles have been interpreted all along the Holocene from an aeolian paleosoil sequence (Orgeira et el, 2012). Comparison between paleomagnetic records of Laguna Carmen and results obtained in earlier studies carried out at Laguna Potrok Aike (Gogorza et al., 2012

  4. Latitudinal exposure to DDTs, HCB, PCBs, PBDEs and DP in giant petrels (Macronectes spp.) across the Southern Ocean

    International Nuclear Information System (INIS)

    Roscales, Jose L.; González-Solís, Jacob; Zango, Laura; Ryan, Peter G.; Jiménez, Begoña

    2016-01-01

    Studies on Persistent Organic Pollutants (POPs) in Antarctic wildlife are scarce, and usually limited to a single locality. As a result, wildlife exposure to POPs across the Southern Ocean is poorly understood. In this study, we report the differential exposure of the major southern ocean scavengers, the giant petrels, to POPs across a wide latitudinal gradient. Selected POPs (PCBs, HCB, DDTs, PBDEs) and related compounds, such as Dechlorane Plus (DP), were analyzed in plasma of southern giant petrels (Macronectes giganteus) breeding on Livingston (62°S 61°W, Antarctica), Marion (46°S 37°E, sub-Antarctic), and Gough (40°S 10°W, cool temperate) islands. Northern giant petrels (Macronectes halli) from Marion Island were also studied. Stable isotope ratios of C and N (δ 13 C and δ 15 N) were used as dietary tracers of the marine habitat and trophic level, respectively. Breeding locality was a major factor explaining petrel exposure to POPs compared with species and sex. Significant relationships between δ 13 C values and POP burdens, at both inter- and intra-population levels, support latitudinal variations in feeding grounds as a key factor in explaining petrel pollutant burdens. Overall, pollutant levels in giant petrels decreased significantly with latitude, but the relative abundance (%) of the more volatile POPs increased towards Antarctica. DP was found at negligible levels compared with legacy POPs in Antarctic seabirds. Spatial POP patterns found in giant petrels match those predicted by global distribution models, and reinforce the hypothesis of atmospheric long-range transport as the main source of POPs in Antarctica. Our results confirm that wildlife movements out of the polar region markedly increase their exposure to POPs. Therefore, strategies for Antarctic wildlife conservation should consider spatial heterogeneity in exposure to marine pollution. Of particular relevance is the need to clarify the exposure of Antarctic predators to emerging

  5. A review on the status of natural orifice transluminal endoscopic surgery (NOTES cholecystectomy: techniques and challenges

    Directory of Open Access Journals (Sweden)

    Michael C Meadows

    2010-09-01

    Full Text Available Michael C Meadows1,3, Ronald S Chamberlain1,2,31Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2Department of Surgery, University of Medicine and Dentistry of New Jersey, Newark, NJ, USA; 3Saint George’s University, School of Medicine, West Indies, GrenadaIntroduction: The evolution of techniques for the performance of a cholecystectomy over the last 25 years has been swift. The laparoscopic approach is now the gold standard for removal of the gall bladder and is the most frequently performed minimally invasive procedure globally. Currently in its infancy stage, natural orifice transluminal endoscopy surgery, or NOTES, is purported to be the next leap forward in minimally invasive approaches. The safety, feasibility, and effectiveness of this procedure, as well as the significance of potential benefits to patients beyond current surgical approaches are yet undetermined.Methods: A comprehensive literature search was conducted using PubMed, a search engine ­created by the National Library of Medicine. Keywords used in the search included “natural orifice transluminal endoscopic surgery”, “NOTES”, “cholecystectomy”, “transcolonic”, “transvaginal”, and “transgastric”. The accumulated literature was critically analyzed and reviewed.Results: One-hundred and eighty-six cases of NOTES cholecystectomies have been published to date. Of these, 174 have been performed through a transvaginal approach. The remainder of the procedures were performed transgastrically. There are no published reports of ­transcolonic cholecystectomies performed in humans. Four of 186 cases (2.15% were converted to traditional laparoscopy due to intraoperative complications. No significant complications or mortalities have been reported.Conclusion: NOTES cholecystectomy appears to be a feasible procedure. However, technical, safety, and ethical issues remain relatively unresolved. Besides improved cosmesis, whether additional

  6. Late Holocene vegetation dynamics and lake geochemistry at Laguna Miranda, XI Region, Chile Dinámica vegetaciónal y geoquímica lacustre del Holoceno tardío en Laguna Miranda, XI Región, Chile

    Directory of Open Access Journals (Sweden)

    S. G. HABERLE

    2000-12-01

    Full Text Available Palynological and geochemical analysis of late Holocene lake sediments and dendrochronological analysis of Pilgerodendron in a volcanically active region of southern Chile reveal the long-term impact of a series of tephra fall events and tectonic activity on lake sedimentation and local vegetation. An upper 0,75 m core overlaps with a 4,35 m long Livingstone piston core to give a 4,60 m long sediment record, extending back to 4800 yr BP. Geochemical data shows the shift from allogenic dominance to authigenic and biogenic dominance as waterlogged soils developed within the catchment. This is presumed to have occurred under the influence of continued addition of nutrients to the catchment from tephra deposition and the associated high sedimentation rates. The palynological record from this site is dominated by Nothofagus dombeyi-type and Filicales. The most prominent changes in the pollen record, however, are the gradual decline in Podocarpus nubigena pollen throughout the last 4800 yr; the appearance and increase of Gramineae pollen during the past 2100 yr; and the rapid increase in the pollen of Pilgerodendron uviferum within the past 300-400 yr. Pilgerodendron tree-ring analysis and the pollen results over the last 400 years show that the most recent expansion of Pilgerodendron at the northern and eastern margins of this site is a response to either, periodic tectonic induced watertable changes, or is part of a long-term trend in gymnosperm growth around a shallowing lake margin. The decline of shade-intolerant trees such as Weinmannia and Podocarpus within a Nothofagus-rich forest community towards an increased presence of Pilgerodendron and Gramineae (likely Chusquea bamboo, that began over 2100 yr BP, may have been due as much to autogenic processes such as a change in the disturbance regime resulting in the development of waterlogged soils, rather than to an episode of climate change. It is important to recognise the potential effects of

  7. Developing a Science-based River Basin Management Plan for the Kharaa River Basin, Mongolia

    Science.gov (United States)

    Karthe, Daniel

    2013-04-01

    management. In the past, shared and unclear responsibilities, a spatial mismatch between administrative and river basin boundaries, the lack of relevant information, financial resources and implementation capacity resulted in an uncoordinated and partially uncontrolled exploitation of water resources (Livingstone et al. 2009; Horlemann et al. 2012). The recent decision of the Mongolian government to develop river basin management plans and to provide for their implementation through river basin councils and administrations, and the comparatively good data availability resulting from the R&D project, resulted in the decision to jointly develop a science-based river basin management plan for the KRB as a model region for other river basins of the country. References: Hartwig, M.; Theuring, P.; Rode, M. & Borchardt, D. (2012): Suspended sediments in the Kharaa River catchment (Mongolia) and its impact on hyporheic zone functions. Environmental Earth Sciences 65(5):1535-1546. Hofmann, J.; Venohr, M.; Behrendt, H. & Opitz, D. (2010): Integrated Water Resources Management in Central Asia: Nutrient and heavy metal emissions and their relevance for the Kharaa River Basin, Mongolia. Water Science and Technology 62(2):353-363. Horlemann, L. & Dombrowsky, I. (2012): Institutionalising IWRM in developing and transition countries: the case of Mongolia. Environmental Earth Sciences 65(5):1547-1559. Karthe, D.; Borchardt, D. & Hufert, F. (2012a): Implementing IWRM: Experiences from a Central Asian Model Region. In: Pandya, A.B. (Ed.) (2012): India Water Week 2012. Water, Energy and Food Security: Call for Solutions, Part A3, pp. 1-15. Delhi: Ministry of Water Resources, Government of India. Karthe, D.; Sigel, K.; Scharaw, B. et al. (2012b): Towards an integrated concept for monitoring and improvements in water supply, sanitation and hygiene (WASH) in urban Mongolia. Water & Risk 20:1-5. Karthe, D.; Malsy, M.; Kopp, B. & Minderlein, S. (2013): Assessing Water Availibility and its Drivers in

  8. Rewriting the Landform History of One of Africa's Three Largest Basins

    Science.gov (United States)

    Wilkinson, Justin

    2014-01-01

    The Kalahari Basin in southern Africa - one of the largest basins in Africa, along with the Congo and Chad basins - has attracted attention since David Livingstone traveled through the area in the 1840s. It is a semiarid desert with a large freshwater swampland known as the Okavango Swamp (150 km radius). This prominent megafan (a fan with radii >100 km), with its fingers of dark green forests projecting into the dun colors of the dunes of the Kalahari semi-desert, has been well photographed by astronauts over the years. The study area in the northern Kalahari basin is centered on the Okavango megafan of northwest Botswana, whose swampland has become well known as an African wildlife preserve of importance to biology and tourism alike. The Okavango River is unusual because it has deposited not one but two megafans along its course: the Okavango megafan and the Cubango megafan. The Okavango megafan is one of only three well-known megafans in Africa. Megafans on Earth were once thought to be rare, but recent research has documented 68 in Africa alone. Eleven megafans, plus three more candidates, have been documented in the area immediately surrounding the Okavango feature. These 11 megafans occupy the flattest and smoothest terrains adjacent to the neighboring upland and stand out as the darkest areas in the roughness map of the area. Megafan terrains occupy at least 200,000 sq km of the study area. The roughness map shown is based on an algorithm used first on Mars to quantify topographic roughness. Research of Earth's flattest terrains is just beginning with the aid of such maps, and it appears that these terrains are analogous to the flattest regions of Mars. Implications: 1. The variability in depositional style in each subbasin may apply Africa-wide: rift megafan length is dominated by rift width, whereas Owambo subbasin megafans are probably controlled by upland basin size; Zambezi subbasin megafans appear more like foreland basin types, with the position of

  9. Stable isotopes, δ18O and δ2H, in the study of water balance of Lake Massoko, Tanzania: Investigation of the exchange between lake and underground water

    International Nuclear Information System (INIS)

    Bergonzini, L.; Gibert, E.; Winckel, A.

    2002-01-01

    Full text: The stable oxygen and deuterium isotope compositions of a lake depend upon its water balance. Therefore the balance equations of stable isotopes, which imply calculation of the composition of evaporating moisture α E , provide information for assessing the water balance. In most cases, this approach is used to investigate the relationships between lakes and groundwater. Lake Massoko (8 deg. 20'S, 33 deg. 45'E, 870 m.a.s.l.) is a freshwater maar-lake without surface outlet. The lake surface and its runoff area cover 0.38 and 0.55 km 2 respectively. In contrast with the mean annual rainfall in the other parts of south Tanzania (1000-1200 mm y -1 ), the presence of Lake Malawi to the South, and the high ranges to the North (Mounts Poroto, Rungwe and Livingstone) imply local climatic features. Air masses overloaded with humidity bypassing Lake Malawi are submitted, especially in April, to ascending currents, producing rainfalls up to 2450 mm y -1 over Massoko area. Because of the evaporation rate from the lake's surface (around 2100 mm y -1 ) and without taking into account the runoff from the drainage basin, hydrological balance is positive and imply underground lost. One of most difficult points in the establishment of the isotope balances is the calculation of the composition of the evaporated water (δ E ), which requires an estimation of the isotopic composition of the water vapour in the atmosphere over the lake (δ Atm ). Without direct measurements, two ways can be used for the determination of the vapour composition (i) equilibrium with precipitation and reconstitution from them, or (ii) calculation from the balances of a terminal lake of the region. Both approaches are presented and compared, but only the second one allows physical solutions. δ Atm determined from Lake Rukwa hydrological and isotope balances has been used to calculate values for δ E over Lake Massoko. The estimation of δ Atm obtained from Lake Rukwa budgets presents a deuterium

  10. Measurement of N2O and CH4 soil fluxes from garden, agricultural and natural soils using both closed and open chamber systems coupled with high-precision CRDS analyzer

    Science.gov (United States)

    He, Yonggang; Jacobson, Gloria; Alexander, Chris; Fleck, Derek; Hoffnagel, John; Del Campo, Bernardo; Rella, Chris

    2013-04-01

    will present the results of testing done with the analyzer attached to both closed and open chamber systems to quantify fluxes of N2O and CH4 from active soil samples. The soil samples were collected by the University of Iowa from soil test sites used for studying the application of biochar as a soil amendment. Results will compare the two chamber methodologies and results from several soil sample types, garden, agricultural and natural. Preliminary results from laboratory measurements of soil core samples taken from a garden soil sample using the closed-system chamber method show N2O emission to be on the order of 5.67 x 10-2 μg/cm3*hr, which is in good agreement with the open-system chamber method tested on the same soil sample, which yielded fluxes of 6.01 x 10-2 μg/cm3*hr . Additional work presented will verify these initial results and will be compared to literature such as Hutchinsion and Livingston 1993 assessment of the bias of different chamber flux methodologies.

  11. Probiotics improve the efficacy of standard triple therapy in the eradication of Helicobacter pylori: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Lau CSM

    2016-12-01

    Full Text Available Christine S M Lau,1,2 Amanda Ward,2 Ronald S Chamberlain1–4 1Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2Saint George’s University School of Medicine, Grenada, West Indies; 3Department of Surgery, Banner MD Anderson Cancer Center, Gilbert, AZ, USA; 4Department of Surgery, New Jersey Medical School, Rutgers University, Newark, NJ, USA Introduction: Helicobacter pylori colonization is present in half of the world’s population and can lead to numerous gastrointestinal diseases if left untreated, including peptic ulcer disease and gastric cancer. Although concurrent triple therapy remains the recommended treatment regimen for H. pylori eradication, its success rate and efficacy have been declining. Recent studies have shown that the addition of probiotics can significantly increase eradication rates by up to 50%. This meta-analysis examines the impact of probiotic supplementation on the efficacy of standard triple therapy in eradicating H. pylori. Methods: A comprehensive literature search was conducted using PubMed, Cochrane Central Registry of Controlled Trials, and Google Scholar (time of inception to 2016 to identify all published randomized control trials (RCTs assessing the use of probiotics in addition to triple therapy for the treatment of H. pylori. Searches were conducted using the keywords “probiotics”, “triple therapy”, and “Helicobacter pylori”. RCTs comparing the use of probiotics and standard triple therapy with standard triple therapy alone for any duration in patients of any age diagnosed with H. pylori infection were included. H. pylori eradication rates (detected using urea breath test or stool antigen were analyzed as-per-protocol (APP and intention-to-treat (ITT. Results: A total of 30 RCTs involving 4,302 patients APP and 4,515 patients ITT were analyzed. The addition of probiotics significantly increased eradication rates by 12.2% (relative risk [RR] =1.122; 95% confidence

  12. Geology of Glacier National Park and the Flathead Region, Northwestern Montana

    Science.gov (United States)

    Ross, Clyde P.

    1959-01-01

    This report summarizes available data on two adjacent and partly overlapping regions in northwestern Montana. The first of these is Glacier National Park plus small areas east and west of the park. The second is here called, for convenience, the Flathead region; it embraces the mountains from the southern tip of Glacier Park to latitude 48 deg north and between the Great Plains on the east and Flathead Valley on the west. The fieldwork under the direction of the writer was done in 1948, 1949, 1950, and 1951, with some work in 1952 and 1953. The two regions together include parts of the Swan, Flathead, Livingstone, and Lewis Ranges. They are drained largely by branches of the Flathead River. On the east and north, however, they are penetrated by tributaries of the Missouri River and in addition by streams that flow into Canada. Roads and highways reach the borders of the regions; but there are few roads in the regions and only two highways cross them. The principal economic value of the assemblage of mountains described in the present report is as a collecting ground for snow to furnish the water used in the surrounding lowlands and as a scenic and wildlife recreation area. A few metallic deposits and lignitic coal beds are known, but these have not proved to be important and cannot, as far as can now be judged, be expected to become so. No oil except minor seeps has yet been found, and most parts of the two regions covered do not appear geologically favorable to the presence of oil in commercial quantities. The high, Hungry Horse Dam on which construction was in progress during the fieldwork now floods part of the Flathead region and will greatly influence the future of that region. The rocks range in age from Precambrian to Recent. The thickest units belong to the Belt series of Precambrian age, and special attention was paid to them. As a result, it is clear that at least the upper part of the series shows marked lateral changes within short distances. This fact

  13. HIV self-testing among female sex workers in Zambia: A cluster randomized controlled trial.

    Directory of Open Access Journals (Sweden)

    Michael M Chanda

    2017-11-01

    Full Text Available HIV self-testing (HIVST may play a role in addressing gaps in HIV testing coverage and as an entry point for HIV prevention services. We conducted a cluster randomized trial of 2 HIVST distribution mechanisms compared to the standard of care among female sex workers (FSWs in Zambia.Trained peer educators in Kapiri Mposhi, Chirundu, and Livingstone, Zambia, each recruited 6 FSW participants. Peer educator-FSW groups were randomized to 1 of 3 arms: (1 delivery (direct distribution of an oral HIVST from the peer educator, (2 coupon (a coupon for collection of an oral HIVST from a health clinic/pharmacy, or (3 standard-of-care HIV testing. Participants in the 2 HIVST arms received 2 kits: 1 at baseline and 1 at 10 weeks. The primary outcome was any self-reported HIV testing in the past month at the 1- and 4-month visits, as HIVST can replace other types of HIV testing. Secondary outcomes included linkage to care, HIVST use in the HIVST arms, and adverse events. Participants completed questionnaires at 1 and 4 months following peer educator interventions. In all, 965 participants were enrolled between September 16 and October 12, 2016 (delivery, N = 316; coupon, N = 329; standard of care, N = 320; 20% had never tested for HIV. Overall HIV testing at 1 month was 94.9% in the delivery arm, 84.4% in the coupon arm, and 88.5% in the standard-of-care arm (delivery versus standard of care risk ratio [RR] = 1.07, 95% CI 0.99-1.15, P = 0.10; coupon versus standard of care RR = 0.95, 95% CI 0.86-1.05, P = 0.29; delivery versus coupon RR = 1.13, 95% CI 1.04-1.22, P = 0.005. Four-month rates were 84.1% for the delivery arm, 79.8% for the coupon arm, and 75.1% for the standard-of-care arm (delivery versus standard of care RR = 1.11, 95% CI 0.98-1.27, P = 0.11; coupon versus standard of care RR = 1.06, 95% CI 0.92-1.22, P = 0.42; delivery versus coupon RR = 1.05, 95% CI 0.94-1.18, P = 0.40. At 1 month, the majority of HIV tests were self-tests (88.4%. HIV self

  14. A Mentoring Program in Environmental Science for Underrepresented Groups

    Science.gov (United States)

    Stevens, L.; Rizzo, D. M.

    2009-12-01

    We developed a four-year program, combining educational and career support and research activities, to recruit and retain students from underrepresented groups in environmental sciences. Specifically, the program: ○ Assigns each student a faculty or graduate student mentor with whom the student conducts research activities. ○ Includes a weekly group meeting for team building and to review professional development and academic topics, such as time management and research ethics. ○ Requires students to make multiple formal presentations of their research proposals and results. ○ Provides scholarships and stipends for both the academic year and to engage students in summer research. The program seeks to achieve several goals including: ● Enhance academic performance. ● Encourage continued study in environmental science. ● Facilitate students completing their studies at UVM. ● Increase students’ interest in pursuing science careers. ● Create a more welcoming academic environment. To assess progress toward achievement of these goals, we conducted individual structured interviews with participating undergraduate students, graduate students, and faculty members at two points in time. First, interviews were conducted in the fall of 2007 after two years, and again in spring 2009, after four years. An independent research consultant, Dr. Livingston, conducted the interviews. In 2009, over the course of three days, the interviews included three graduate student and two faculty mentors, and six of the seven undergraduate students. Of the six students, three were juniors and three were graduating seniors. Results of the 2009 interviews echoed those of 2007. Both students and their mentors are quite satisfied with the program. The student presentations, weekly meetings, mentoring relationships, and summer research experiences all get high ratings from program participants. Students give high praise to their mentors and the program directors for providing

  15. Chladniite: A New Mineral Honoring the Father of Meteoritics

    Science.gov (United States)

    McCoy, T. J.; Steele, I. M.; Keil, K.; Leonard, B. F.; Endress, M.

    1993-07-01

    cell. A total of 17 lines were observed in the powder pattern. Chladniite is hexagonal, R 3(bar), a = 14.967 angstroms, c = 42.595 angstroms, beta = 120 degrees. Attempts to determine the structure of chladniite are in progress. Chladniite is named for Ernst Florens Friedrich Chladni (1756-1827), who is widely regarded as the "Father of Meteoritics." After his initial training as a lawyer, Chladni turned his attention to science, particularly problems in acoustics. He was not, however, able to obtain a permanent position and embarked upon the life of a nomad, traveling among the great cities of Europe lecturing about acoustics. During these travels, he eventually gained an interest in meteoritics. It was Chladni's pioneering book of 1794 that, for the first time, presented strong evidence for an extraterrestrial origin of meteoritic stones and irons [5]. In addition, Chladni argued that meteorites must have been the building blocks of all planets and argued that a large iron core must exist inside the Earth. During his extensive travels, Chladni also established a meteorite collection that can still be seen at Humboldt University in Berlin. It is appropriate that a mineral be named in his honor as we approach the 200th anniversary of the publication of his monumental work. References: [1] McCoy et al. (1993) Meteoritics, in press. [2] Fuchs et al. (1967) GCA, 21, 1711-1719. [3] Araki and Moore (1981) Am. Mineral., 66, 827-842. [4] Livingstone (1980) Min. Mag., 43, 833-836. [5] Chladni (1794) Riga, J. F. Hartknoch (in German); reprinted (with introduction by G. Hoppe) by Akad. Verlagsgesellschaft Geest & Portig K.-G. (1982) (in German).

  16. HIV self-testing among female sex workers in Zambia: A cluster randomized controlled trial.

    Science.gov (United States)

    Chanda, Michael M; Ortblad, Katrina F; Mwale, Magdalene; Chongo, Steven; Kanchele, Catherine; Kamungoma, Nyambe; Fullem, Andrew; Dunn, Caitlin; Barresi, Leah G; Harling, Guy; Bärnighausen, Till; Oldenburg, Catherine E

    2017-11-01

    HIV self-testing (HIVST) may play a role in addressing gaps in HIV testing coverage and as an entry point for HIV prevention services. We conducted a cluster randomized trial of 2 HIVST distribution mechanisms compared to the standard of care among female sex workers (FSWs) in Zambia. Trained peer educators in Kapiri Mposhi, Chirundu, and Livingstone, Zambia, each recruited 6 FSW participants. Peer educator-FSW groups were randomized to 1 of 3 arms: (1) delivery (direct distribution of an oral HIVST from the peer educator), (2) coupon (a coupon for collection of an oral HIVST from a health clinic/pharmacy), or (3) standard-of-care HIV testing. Participants in the 2 HIVST arms received 2 kits: 1 at baseline and 1 at 10 weeks. The primary outcome was any self-reported HIV testing in the past month at the 1- and 4-month visits, as HIVST can replace other types of HIV testing. Secondary outcomes included linkage to care, HIVST use in the HIVST arms, and adverse events. Participants completed questionnaires at 1 and 4 months following peer educator interventions. In all, 965 participants were enrolled between September 16 and October 12, 2016 (delivery, N = 316; coupon, N = 329; standard of care, N = 320); 20% had never tested for HIV. Overall HIV testing at 1 month was 94.9% in the delivery arm, 84.4% in the coupon arm, and 88.5% in the standard-of-care arm (delivery versus standard of care risk ratio [RR] = 1.07, 95% CI 0.99-1.15, P = 0.10; coupon versus standard of care RR = 0.95, 95% CI 0.86-1.05, P = 0.29; delivery versus coupon RR = 1.13, 95% CI 1.04-1.22, P = 0.005). Four-month rates were 84.1% for the delivery arm, 79.8% for the coupon arm, and 75.1% for the standard-of-care arm (delivery versus standard of care RR = 1.11, 95% CI 0.98-1.27, P = 0.11; coupon versus standard of care RR = 1.06, 95% CI 0.92-1.22, P = 0.42; delivery versus coupon RR = 1.05, 95% CI 0.94-1.18, P = 0.40). At 1 month, the majority of HIV tests were self-tests (88.4%). HIV self-test use

  17. Air-Sea CO2 fluxes in the Atlantic as measured during boreal spring and autumn

    Directory of Open Access Journals (Sweden)

    A. F. Ríos

    2010-05-01

    Oscillation episodes. Contrary the surface waters of the Patagonian Sea behaved as an intense sink of CO2 in March and November. The oceanic waters of the convergence of Falkland and Brazil Currents showed the strongest CO2 absorption with a rate of −5.4 ± 3.6 mol m−2 yr−1 in November. The Southern Oceans sampled in the Drake Passage behave as an average uptake rate of −1.1 ± 0.9 mol m−2 yr−1 while the distal shelf of the Livingston Island acted as a slight source of CO2 to the atmosphere.

  18. Weather types in the South Shetlands (Antarctica) using a circulation type approach

    Science.gov (United States)

    Mora, Carla; João Rocha, Maria; Dutra, Emanuel; Trigo, Isabel; Vieira, Gonçalo; Fragoso, Marcelo; Ramos, Miguel

    2010-05-01

    Weather types in the South Shetlands (Antarctica) were defined using an automated method based on the Lamb Weather Type classification scheme (Jones et al. 1993). This is an objective classification originally developed for the British Isles (Jones et al., 1993) and also applied to southeast (Goodess and Palutikof 1998) and northwest Spain (Lorenzo et al, 2009), Portugal (Trigo and DaCamara 2000) and Greece (Maheras et al. 2004) with good results. Daily atmospheric circulation in the South Shetlands region from 1989 to 2009 was classified using a 16-node grid of sea level pressure data from the ERA Interim. The classification is obtained through the comparison of the magnitudes of the directional and rotational components of the geostrophic flow. Basic circulation types were combined into 10 groups of weather types: four directional types (NW, N, S and SW), three anticyclonic types (A, ASW and ANW), and three cyclonic types (C, CSW and CNW). Westerly flow and cyclonic circulation are the most frequent events throughout the year. The sea level pressure field for each weather type is presented and the synoptic characteristics are described. The analysis is based on ERA-Interim fields, including mean sea level pressure, precipitation, cloud cover, humidity and air temperature. Snow thickess modelled using HTESSEL is also considered. Analysis of variance (anova) and multivariate analysis (principal component analysis) are applied to evaluate the characteristics of each weather type. This circulation-type approach showed good results in the past for the downscaling of precipitation in other regions, and we are interested in evaluating the possibilities that the classification offers for downscaling precipitation, but also for snow and air temperature. For this we will be using observational data at test sites in Livingston and Deception islands. We are also motivated by the possibility of using the circulation-type approach as a predictor in statistical downscaling

  19. The Antarctic permafrost as a testbed for REMS (Rover Environmental Monitoring Station-Mars Science Laboratory)

    Science.gov (United States)

    Esteban, B.; Ramos, M.; Sebastián, E.; Armiens, C.; Gómez-Elvira, J.; Cabos, W.; de Pablo, M. A.

    2009-04-01

    The present climatic characteristics of Mars favor the presence of extense permafrost areas in this lonely planet. Therefore environmental parameters that are included in Martian Rover missions are also used for monitoring thermal soil surface evolution in order to study the permafrost active layer thickness and the energy balance in the soil-atmosphere boundary limit layer. The REMS (Rover Environmental Monitoring Station) is an environmental station designed by the Centro de Astrobiología (CAB- Spain) with the collaboration of national and international partners (CRISA/EADS, UPC and FMI), which is part of the payload of the MSL (Mars Science Laboratory) NASA mission to Mars (http://mars.jpl.nasa.gov/msl/overview/). This mission is expected to be launched in the final months of 2009, and mainly consists of a Rover, with a complete set of scientific instruments; the Rover will carry the biggest, most advanced suite of instruments for scientific studies ever sent to the Martian surface. Five sensors compose the REMS instrument: ground (GT-REMS) and air temperatures, wind speed and direction, pressure, humidity and ultraviolet radiation (UV-REMS). A simplified setup of the REMS was deployed on Antarctica in the surroundings of the Spanish Antarctic Stations on Livingston and Deception Islands (Maritime Antarctica), where the permafrost distribution is well-known. The aim of the experiment was to check REMS's sensors response against hard environmental conditions and calibrates their measures with standard Antarctic devices. The experimental apparatuses included some standard meteorological and thermopiles sensors corresponding to the REMS. All the sensors are mounted in a 1.8 m mast and include a Pt100 air temperature sensor with shield solar protection on the mast top, a Kipp and Zonnen CNR1 net radiometer for measuring infrared (5-50 μm) and short wave solar (305-2800 nm) radiation at 1.5 m high, GT-REMS sensor and its amplification box at 0.7 m high and finally

  20. Ernest Orlando Lawrence (1901-1958), Cyclotron and Medicine

    Energy Technology Data Exchange (ETDEWEB)

    Chu, William T.

    2005-09-01

    On August 8, 2001, Lawrence Berkeley National Laboratory celebrated the centennial of the birth of its founder (and namesake), Ernest Orlando Lawrence. For the occasion, many speeches were given and old speeches were remembered. We recall the words of the late Luis Alvarez, a Nobel Laureate and one of the Lawrence's closest colleagues: ''Lawrence will always be remembered as the inventor of the cyclotron, but more importantly, he should be remembered as the inventor of the modern way of doing science''. J. L. Heilbron and R. W. Seidel, in the introduction of their book, ''Lawrence and His Laboratory'' stated, ''The motives and mechanisms that shaped the growth of the Laboratory helped to force deep changes in the scientific estate and in the wider society. In the entrepreneurship of its founder, Ernest Orlando Lawrence, these motives, mechanisms, and changes came together in a tight focus. He mobilized great and small philanthropists, state and local governments, corporations, and plutocrats, volunteers and virtuosos. The work they supported, from astrophysics and atomic bombs, from radiochemistry to nuclear medicine, shaped the way we observe, control, and manipulate our environment.'' Indeed, all over the civilized world, the ways we do science changed forever after Lawrence built his famed Radiation Laboratory. In this editorial, we epitomize his legacy of changing the way we do medicine, thereby affecting the health and well being of all humanity. This year marks the 75th anniversary of the invention of the cyclotron by Ernest Orlando Lawrence at the University of California at Berkeley. Lawrence conceived the idea of the cyclotron early in 1929 after reading an article by Rolf Wideroe on high-energy accelerators. In the spring of 1930 one of his students, Nels Edlefsen, constructed two crude models of a cyclotron. Later in the fall of the same year, another student, M. Stanley Livingston

  1. Error de medición alrededor de los puntos de corte en el MBI-GS

    Directory of Open Access Journals (Sweden)

    Manuel Fernández Arata

    2014-12-01

    Full Text Available Resumen En la calificación de los resultados del MBI-GS (Maslach Burnout Inventory - General Survey como de sus antecesores, se usan interpretaciones dimensionales, pero también puntos de corte para clasificar a los sujetos y diferenciarlos con respecto a la presencia del síndrome de burnout. Sin embargo, este uso está orientado al tipo de tests referidos a criterios, por lo que la estimación de la confiabilidad debe converger con este tipo de uso. El objetivo del presente estudio fue estimar la confiabilidad alrededor de varios puntos de corte en el MBI-GS (agotamiento emocional, eficacia profesional y cinismo, mediante el coeficiente K2 de Livingston. Los participantes fueron 741 sujetos de varias ocupaciones, provenientes de instituciones públicas y privadas de Lima y de otras ciudades. Previo a la obtención de la confiabilidad criterial, se verificó la unidimensionalidad, el modelo equivalente tau, la distribución y la bimodalidad de los puntajes. Se halló que los puntos de corte más extremos muestran mayor confiabilidad; que la confiabilidad se incrementa en relación al grado de extremidad de los puntajes; que el puntaje de agotamiento emocional obtiene mayor confiabilidad criterial y que cinismo obtiene la menor, pero todos los puntajes generalmente muestran buenas confiabilidades. Se discute el uso de los puntos de corte en relación a su validez y confiabilidad. Abstract In the rating of the MBI-GS results (Maslach Burnout Inventory - General Survey as its predecessors, we used dimensional interpretations, but also cut-off points for classifying and differentiating the subjects with respect to the presence of the burnout syndrome. However, this use is oriented to the type of tests relating to criteria so that the estimate of the reliability must converge with this type of use. The objective of this study was to estimate the reliability around various cutting points in the MBI-GS (emotional exhaustion, professional

  2. Trends in incidence, survival, and management of uveal melanoma: a population-based study of 7,516 patients from the Surveillance, Epidemiology, and End Results database (1973–2012

    Directory of Open Access Journals (Sweden)

    Mahendraraj K

    2016-10-01

    Full Text Available Krishnaraj Mahendraraj,1 Christine SM Lau,1,2 Injoon Lee,2 Ronald S Chamberlain1–3 1Department of Surgery, Saint Barnabas Medical Center, Livingston, NJ, USA; 2St George’s University School of Medicine, Grenada, West Indies; 3Department of Surgery, New Jersey Medical School, Rutgers University, Newark, NJ, USA Introduction: Uveal melanoma (UM is the most common primary intraocular malignancy, despite comprising <5% of all melanomas. To date, relatively few case series of UM have been published. Moreover, the factors influencing survival remain largely unknown. This study sought to analyze the impact of demographics, histology, clinical presentation, and treatments on the clinical outcomes of UM in a large modern nationwide patient cohort.Methods: Demographics and clinical data were abstracted on 277,120 histologically confirmed melanoma patients from the Surveillance, Epidemiology, and End Results database between 1973 and 2012.Results: A total of 7,516 cases of UM represented 3.2% of all recorded cases of melanoma. The mean age-adjusted incidence was 5.1 per million (95% CI 4.2–6.1 and was higher in males (5.9, CI =4.4–7.6 compared to females (4.5, CI =3.3–5.8, P<0.001. UM occurred most commonly in the sixth decade of life (61.4±15 and among Caucasians (94.7%. A total of 52.3% of cases were reported in the Western US (35.7% in California. The initial diagnoses in 65.2% of cases were by histopathology, followed by clinical diagnosis (18.8% and radiographic imaging (16.0%. The percentage of UM cases managed by surgery alone decreased by 69.4% between the 1973–1977 and 2006–2012 time periods, concomitant with a 62% increase in primary radiotherapy, P<0.001. The UM mean overall and cancer-specific 5-year relative survival rates were 79.8%±5.8% and 76%±5.3%, respectively. The mean 5-year cancer-specific survival rate (76% remained stable during the study period between 1973 and 2012. The mean survival for patients treated with

  3. PREFACE: Kelvin and Ireland

    Science.gov (United States)

    Flood, Raymond; McCartney, Mark; Whitaker, Andrew

    2009-07-01

    organisation on the day of the meeting. We also acknowledge financial support from the IOP in London, and in particular thank Susan Lippmann and John Brindley. We also thank Peter Ford, present Chair of the History of Physics Group at the IOP for general encouragement and helping us to obtain this finance. The meeting was also supported by Queen's University Belfast. We would thank Tom Millar, Dean of the Faculty of Engineering and Physical Science for arranging this support. We were supremely fortunate to be allowed to use the magnificent Great Hall, a highly suitable room for the meeting since among the portraits on the walls were many of those referred to in the talks, and even one of the speakers! Catering and audiovisual services were also very helpful. From the School of Mathematics and Physics at Queen's, we would acknowledge the considerable help of Angela Anderson and Margaret Hewitt. We would also thank Kevin Mulhern, who arranged for publicity, Lisa Mitchell who provided the publicity in a splendid way, and also Eugene McCusker and Claire Wilson. Juliet Chantler of Northern Visions prepared an enthralling TV programme around the event and we are very grateful to her also. Joe Millar of the Ulster Scots Agency also publicised the meeting and we thank him as well. David Livingstone gave general support and chaired the morning session, for which we are grateful, and of course we would like to thank all the speakers who were responsible for the meeting being interesting and enjoyable. We would mention Andrew Holmes who gave a very erudite paper at the meeting. Unfortunately, since his material is being published elsewhere, we have not been able to include his contribution here, but he has given helpful advice on the preparation of this volume. Finally we would like to thank Graham Douglas, the Publisher of Journal of Physics: Conference Series for his courtesy and helpfulness in the preparation of this volume.

  4. Overview of Light-Ion Beam Therapy

    International Nuclear Information System (INIS)

    Chu, William T.

    2006-01-01

    In 1930, Ernest Orlando Lawrence at the University of California at Berkeley invented the cyclotron. One of his students, M. Stanley Livingston, constructed a 13-cm diameter model that had all the features of early cyclotrons, accelerating protons to 80 keV using less than 1 kV on a semi-circular accelerating electrode, now called the ''dee''. Soon after, Lawrence constructed the first two-dee 27-Inch (69-cm) Cyclotron, which produced protons and deuterons of 4.8 MeV. In 1939, Lawrence constructed the 60-Inch (150-cm) Cyclotron, which accelerated deuterons to 19 MeV. Just before WWII, Lawrence designed a 184-inch cyclotron, but the war prevented the building of this machine. Immediately after the war ended, the Veksler-McMillan principle of phase stability was put forward, which enabled the transformation of conventional cyclotrons to successful synchrocyclotrons. When completed, the 184-Inch Synchrocyclotron produced 340-MeV protons. Following it, more modern synchrocyclotrons were built around the globe, and the synchrocyclotrons in Berkeley and Uppsala, together with the Harvard cyclotron, would perform pioneering work in treatment of human cancer using accelerated hadrons (protons and light ions). When the 184-Inch Synchrocyclotron was built, Lawrence asked Robert Wilson, one of his former graduate students, to look into the shielding requirements for of the new accelerator. Wilson soon realized that the 184-Inch would produce a copious number of protons and other light ions that had enough energy to penetrate human body, and could be used for treatment of deep-seated diseases. Realizing the advantages of delivering a larger dose in the Bragg peak when placed inside deep-seated tumors, he published in a medical journal a seminal paper on the rationale to use accelerated protons and light ions for treatment of human cancer. The precise dose localization provided by protons and light ions means lower doses to normal tissues adjacent to the treatment volume

  5. Improving the thermal performance of the MGC-20 cyclotron accelerator ion source

    International Nuclear Information System (INIS)

    Azab, A.M.N

    2010-01-01

    The ion source is the heart of the cyclotron accelerator machine. It feeds the electrons to start the plasma generation, and consequently the formation of the ions to be accelerated in the cyclotron's chamber. In addition, it controls the ion beam current and intensity. The performance of the ion source is one of the important factors, which determines the durability, and the production efficiency of the cyclotron. The ion source should have a long stable working life in order to provide particles for isotope production.The regular isotope production program in Egypt's cyclotron facility has been interrupted several times by the sudden break down of the traditional tantalum filament cathode of the ion source. This has been the cause of equipment downtime, for filament replacement. A study for the improvement of the ion source lifetime of the MGC-20 cyclotron accelerator has been carried out by selecting three suitable materials for the ion source filament and compare between them. The cathode material plays a very important role for the production of intense ion beams; hence investigation on other low work-function materials is needed to further enhance the source performance. Two materials were selected for the filament, namely tungsten and molybdenum, in addition to the original tantalum filament. The selected materials for the filament have a high melting point and give low wearing rate during the plasma production, since the filament lifetime of the Livingston source, which is the type used in Egypt's Cyclotron, is usually limited due to the high plasma densities near the filament. In the present work, the effect of the normal operation parameters of the MGC-20 cyclotron on the filament's lifetime is studied for solving the lifetime problem of the MGC-20 cyclotron's ion source.The new types of the filaments were machined from wires, 2.5 mm in diameter, to take the same shape and dimensions as the original tantalum (Ta) filament. The three types of filaments

  6. Overview of Light-Ion Beam Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Chu, William T.

    2006-03-16

    In 1930, Ernest Orlando Lawrence at the University of California at Berkeley invented the cyclotron. One of his students, M. Stanley Livingston, constructed a 13-cm diameter model that had all the features of early cyclotrons, accelerating protons to 80 keV using less than 1 kV on a semi-circular accelerating electrode, now called the ''dee''. Soon after, Lawrence constructed the first two-dee 27-Inch (69-cm) Cyclotron, which produced protons and deuterons of 4.8 MeV. In 1939, Lawrence constructed the 60-Inch (150-cm) Cyclotron, which accelerated deuterons to 19 MeV. Just before WWII, Lawrence designed a 184-inch cyclotron, but the war prevented the building of this machine. Immediately after the war ended, the Veksler-McMillan principle of phase stability was put forward, which enabled the transformation of conventional cyclotrons to successful synchrocyclotrons. When completed, the 184-Inch Synchrocyclotron produced 340-MeV protons. Following it, more modern synchrocyclotrons were built around the globe, and the synchrocyclotrons in Berkeley and Uppsala, together with the Harvard cyclotron, would perform pioneering work in treatment of human cancer using accelerated hadrons (protons and light ions). When the 184-Inch Synchrocyclotron was built, Lawrence asked Robert Wilson, one of his former graduate students, to look into the shielding requirements for of the new accelerator. Wilson soon realized that the 184-Inch would produce a copious number of protons and other light ions that had enough energy to penetrate human body, and could be used for treatment of deep-seated diseases. Realizing the advantages of delivering a larger dose in the Bragg peak when placed inside deep-seated tumors, he published in a medical journal a seminal paper on the rationale to use accelerated protons and light ions for treatment of human cancer. The precise dose localization provided by protons and light ions means lower doses to normal tissues adjacent to the

  7. Chapter 29: historical aspects of the major neurological vitamin deficiency disorders: overview and fat-soluble vitamin A.

    Science.gov (United States)

    Lanska, Douglas J

    2010-01-01

    The vitamine doctrine: Although diseases resulting from vitamin deficiencies have been known for millennia, such disorders were generally attributed to toxic or infectious causes until the "vitamin doctrine" was developed in the early 20th century. In the late-19th century, a physiologically complete diet was believed to require only sufficient proteins, carbohydrates, fats, inorganic salts, and water. From 1880-1912, Lunin, Pekelharing, and Hopkins found that animals fed purified mixtures of known food components failed to grow or even lost weight and died, unless the diet was supplemented with small amounts of milk, suggesting that "accessory food factors" are required in trace amounts for normal growth. By this time, Funk suggested that deficiencies of trace dietary factors, which he labeled "vitamines" on the mistaken notion that they were "vital amines," were responsible for such diseases as beriberi, scurvy, rickets, and pellagra. Vitamin A deficiency eye disease: Night blindness was recognized by the ancient Egyptians and Greeks, and many authorities from Galen onward advocated liver as a curative. Outbreaks of night blindness were linked to nutritional causes in the 18th and 19th centuries by von Bergen, Schwarz, and others. Corneal ulceration was reported in 1817 by Magendie among vitamin A-deficient dogs fed for several weeks on a diet limited to sugar and water, although he erroneously attributed this to a deficiency of dietary nitrogen (i.e. protein). Subsequently, corneal epithelial defects, often in association with night blindness, were recognized in malnourished individuals subsisting on diets now recognizable as deficient in vitamin A by Budd, Livingstone, von Hubbenet, Bitot, Mori, Ishihari, and others. During World War I, Bloch conducted a controlled clinical trial of different diets among malnourished Danish children with night blindness and keratomalacia and concluded that whole milk, butter, and cod-liver oil contain a fat-soluble substance

  8. The 2009 Lindau Nobel Laureate Meeting: Roger Y. Tsien, Chemistry 2008.

    Science.gov (United States)

    Tsien, Roger Y

    2010-01-13

    American biochemist Roger Tsien shared the 2008 Nobel Prize in Chemistry with Martin Chalfie and Osamu Shimomura for their discovery and development of the Green Fluorescent Protein (GFP). Tsien, who was born in New York in 1952 and grew up in Livingston New Jersey, began to experiment in the basement of the family home at a young age. From growing silica gardens of colorful crystallized metal salts to attempting to synthesize aspirin, these early experiments fueled what would become Tsien's lifelong interest in chemistry and colors. Tsien's first official laboratory experience was an NSF-supported summer research program in which he used infrared spectroscopy to examine how metals bind to thiocyanate, for which he was awarded a $10,000 scholarship in the Westinghouse Science Talent Search. Following graduation from Harvard in 1972, Tsien attended Cambridge University in England under a Marshall Scholarship. There he learned organic chemistry --a subject he'd hated as an undergraduate-- and looked for a way to synthesize dyes for imaging neuronal activity, generating BAPTA based optical calcium indicator dyes. Following the completion of his postdoctoral training at Cambridge in 1982, Tsien accepted a faculty position at the University of California, Berkeley. There he and colleagues developed and improved numerous small molecule indicators, including indicators fura-2 and indo-1. In 1989, Tsien moved his laboratory to the University of California at San Diego, where he and his colleagues developed the enhanced mutant of GFP as a way to devise a cyclic AMP (cAMP) sensor for use in live cells. They initially engineered molecules to take advantage of the conformational change that occurs when cAMP binds to protein kinase A (PKA). By labeling one part of PKA with fluoroscein and another with a rhodamine, they hoped to detect Fluorescence Resonance Energy Transfer (FRET), which would occur when the two molecules were in close proximity. The initial experiments

  9. Neutron-Star Merger Detected By Many Eyes and Ears

    Science.gov (United States)

    Kohler, Susanna

    2017-10-01

    PredictedTheoretical models describing the merger of two compact objects predict a chirping gravitational-wave signal as the objects spiral closer and closer. Unlike in a black-hole merger, however, the end of the chirp from merging neutron stars should coincide with a phenomenon known as a short gamma-ray burst: a powerful storm of energetic gamma rays produced as the objects finally collide.According to the models, these gravitational waves and gamma rays will be followed by a kilonova a transient source visible in infrared, optical, and ultraviolet which arises from radioactive decay of heavy elements formed in the collision. This source should gradually decay over a timescale of weeks.Lastly, the merger could create a powerful jet of high-energy particles, which could be visible to us in X-ray and radio wavelengths as it is emitted and interacts with its surrounding environment. We could also detect neutrinos from this outflow.What We Saw (and Didnt See)The localization of the gravitational-wave, gamma-ray, and optical signals of the neutron-star merger detected on 17 August, 2017. [Abbott et al. 2017]So what did we see on 17 August, 2017 and thereafter? Heres what was found by the army of collaborations searching in gravitational waves, electromagnetic signals across the spectrum, and neutrinos:Gravitational WavesThe gravitational-wave signature of a binary neutron-star merger was observed with all three gravitational-wave detectors currently operating as a part of the LIGO-Virgo collaboration. GW170817s signal was in the sensitivity band of these detectors for 100 seconds, arriving first at the Virgo detector in Italy, next at LIGO-Livingston in Louisiana 22 milliseconds later, and finally at LIGO-Hanford in Washington 3 milliseconds after that. These detections localized the source to a region of 31 square degrees at a relatively nearby distance of 130 million light-years, and they identified the binary components to be neutron stars.Gamma-Ray BurstThe Fermi Gamma

  10. Preface

    Directory of Open Access Journals (Sweden)

    Baldev Arora

    2009-06-01

    measurements
    at least once per week to enable baselines to be established and must be
    away from power sources and transmission lines. This restricts the location of magnetic
    observatories used for deep Earth investigations. However, presented here are
    papers describing ways to overcome harsh conditions and obtain magnetic data in
    remote locations. The need for long term ground based geomagnetic observatories
    for reference models is well established and discussed. Also discussed, is the study
    of magnetic field variations for determining transient phenomena. The measuring
    stations can exist unmanned as highlighted during the session by the Japanese group (not included in this volume and Chambodut et al.
    Five papers (Cafarella et al., Chambodut et al., De Lauretis et al., Maksymchuk
    et al., and Torta et al. describe magnetic observations in Antarctica. Most of this
    continent is covered by ice so it is almost impossible to sample the continental surface
    directly: magnetic exploration allows us to overcome much of this problem, providing
    important information on the geological and tectonic settings of this continent.
    Antarctica is also an interesting magnetic region because it is in darkness for
    half of the year, so production of the ionospheric plasma that creates the daily Solar
    quiet variation is reduced for this period in this region (Chambodut et al.. In addition,
    it contains the southern polar cap current system – a window to the solar wind
    and the magnetospheric-ionospheric energy transfer processes (De Lauretis et al..
    Torta et al. and Chambodut et al. describe the exceptional means necessary for a
    magnetic observatory in Antarctica attempting to attain INTERMAGNET status. Torta et
    al. use Livingston Island (LIV, in the South Shetland Islands archipelago (in operation
    for ten years, and Chambodut et al. describe Concordia Base (in operation for
    just over 3

  11. AAS 228: Day 3 morning

    Science.gov (United States)

    Kohler, Susanna

    2016-06-01

    theoretical discussion and showed that enough ionizing photons for cosmic reionization could be obtained if we consider binary stars. The idea is that material transfer within binary systems could extend the lifetimes of massive stars, thereby allowing them to produce enough ionizing photons before they die. Veronica Allen closed the session by sharing with us her work on characterizing the chemistry in the massive star-forming region G35.20-0.74N. An asymmetric distribution of nitrogen-bearing species was found, which could be due to disk fragmentation on unresolved scales and the formation of multiple sources with different ages. Plenary Session Kavli Foundation Lecture: Observation of Gravitational Waves (by Susanna Kohler)Gabriela Gonzlez, spokesperson for the LIGO Scientific collaboration.Following this mornings exciting press conference, Gabriela Gonzlez, spokesperson for the LIGO Scientific collaboration, gave the Kavli Foundation Plenary Lectureship. Though the Kavli lecture usually opens the AAS meeting, it was moved this week to accommodate the schedule for LIGOs big announcement today!Gonzlez opened the plenary by digging a little further into the physics of LIGO detections. She described how the detectors work, pointing out that theyre designed to detect a strain of 1 part in 1021. This is roughly the same as measuring if the Earth-Sun distance changed by the size of a single atom!Our ability to localize gravitational-wave detections currently relies on the timing of the observations: noting the difference in time between when the signal passes the LIGO Livingston and LIGO Hanford detectors (on the scale of 10 ms) can give us a broad sense of where in the sky the signal came from. Our ability to localize will significantly improve when future detectors like Virgo (Europe), LIGO-India, and KAGRA (Japan) come online within the next decade.Gonzalez: the addition of Virgo will significantly improve our ability to localize the sources. #aas228 pic.twitter.com/kCvG8l

  12. News and Announcements

    Science.gov (United States)

    1999-07-01

    the inside of meteorites. Zare and colleague Andrew Alexander are contributors to the Journal's Viewpoints series, sponsored by the Camille and Henry Dreyfus Foundation: "Anatomy of Elementary Chemical Reactions", JCE, 1998, 75, 1105. The Welch Award in Chemistry has been given by the Welch Foundation since 1972 to honor lifetime achievements in the field. Zare will be honored and presented with a $300,000 prize and gold medallion during the Foundation's annual award banquet held in Houston in October. NEACT Conference: Chemistry of Materials and Material Science The 61st Summer Conference of NEACT, the New England Association of Chemistry Teachers, will be held from Monday, August 9, through Thursday, August 12, at Massachusetts Institute of Technology in Cambridge, MA. The four-day conference will feature an exploration of the chemistry of materials and material science and effective methods of presenting these in the classroom and laboratory. The keynote address is "Teaching Solid State Chemistry at MIT" by Ron Latanision of MIT's Department of Material Science. Other presentations include "Driving Force", James Livingston; "The Colorful Nanoworld", Moungi Bawendi; "Molecular Wire-Based Amplification in Chemical Sensors", Timothy Swager; "Putting Solids in the Foundation", Arthur Ellis, George Lisensky, and Karen Nordell; "Miracle Materials", Valerie Wilcox; "Teaching About Polymers to Chemistry Students", Richard Stein; and "Using Software in Teaching About Polymers to Chemistry Students", William Vining. There will be a selection of workshops on the conference theme as well. The conference is open to all. The program chairperson is Peter J. Nassiff, Science Department Chairperson at Burlington High School. For further information contact Nassiff at 80 Gregory Road, Framingham, MA 01701; email: pnassiff@massed.net. Call for Symposia, Papers, & Workshops: 16th BCCE The Web site for the 16th Biennial Conference on Chemical Education, July 30-August 3, 2000, at the